WorldWideScience

Sample records for dysprosium 173

  1. Synthesis and characterization of tetraphenylporphyrinate of dysprosium route dysprosium acetylacetonate

    International Nuclear Information System (INIS)

    Martinez M, V.

    1992-01-01

    Dysprosium bis (tetraphenylporphyrinate) and bis (dysprosium) Tris (tetraphenylporphyrinate) were synthesized from dysprosium tetraphenylporphyrinate prepared in situ, and characterized by IR, UV-vis, TGA, DTA, EPR and magnetic susceptibility measurements. The double decker compound was obtained by direct oxidation of the HDy(TPP) 2 intermediate. The existence of the radical anion, (TPP) - , in the double decker product was conformed by EPR spectrometry. Dysprosium monoporphyrinate was isolated and characterized by the same techniques. (Author)

  2. On polymorphism of dysprosium trichloride

    Energy Technology Data Exchange (ETDEWEB)

    Zakiryanova, Irina D.; Khokhlov, Vladimir A.; Salyulev, Alexander B.; Korzun, Iraida V. [RAS Ural Branch, Ekaterinburg (Russian Federation). Institute of High-Temperature Electrochemistry

    2015-07-01

    For the first time, the structure of crystalline DyCl{sub 3} over a wide temperature range from room temperature to melting point was studied by Raman spectroscopy. The phonon modes (cm{sup -1}) of dysprosium trichloride (monoclinic crystal lattice of AlCl{sub 3} type, Z = 4, CN = 6) at room temperature are 257 (A{sub 1g}), 201 (E{sub g}), 112 (E{sub g}), 88 (A{sub 1g}), and 63 (E{sub g}). The monoclinic structure of the crystalline DyCl{sub 3} C{sub 2h}{sup 3} symmetry was found to remain constant over the studied temperature range. No polymorphic transformation in the solid state was detected. Gravimetry, calorimetry, and mass spectrometry have been used in addition to support the conclusions made on the basis of Raman spectroscopic data.

  3. On polymorphism of dysprosium trichloride

    International Nuclear Information System (INIS)

    Zakiryanova, Irina D.; Khokhlov, Vladimir A.; Salyulev, Alexander B.; Korzun, Iraida V.

    2015-01-01

    For the first time, the structure of crystalline DyCl 3 over a wide temperature range from room temperature to melting point was studied by Raman spectroscopy. The phonon modes (cm -1 ) of dysprosium trichloride (monoclinic crystal lattice of AlCl 3 type, Z = 4, CN = 6) at room temperature are 257 (A 1g ), 201 (E g ), 112 (E g ), 88 (A 1g ), and 63 (E g ). The monoclinic structure of the crystalline DyCl 3 C 2h 3 symmetry was found to remain constant over the studied temperature range. No polymorphic transformation in the solid state was detected. Gravimetry, calorimetry, and mass spectrometry have been used in addition to support the conclusions made on the basis of Raman spectroscopic data.

  4. Can a dysprosium shortage threaten green energy technologies?

    International Nuclear Information System (INIS)

    Hoenderdaal, Sander; Tercero Espinoza, Luis; Marscheider-Weidemann, Frank; Graus, Wina

    2013-01-01

    Dysprosium, one of the various rare earth elements, is currently for more than 99% mined in China. As China is reducing its exports, new mining projects outside of China are needed to sustain supply and meet future demands. Dysprosium is mainly used in permanent magnets to retain the magnet's strength at elevated temperatures. Therefore, the use of dysprosium doped permanent magnets is preferred in electric vehicles and direct-drive wind turbines. Based on four scenarios it could be shown that dysprosium demand will probably outstrip supply in the short term (up to 2020). Although new mines are being developed, it takes several years for them to become productive. For the long term it is expected that enough dysprosium oxide is available in the earth crust (which is economically feasible to mine with current dysprosium prices) to fulfil the projected demand of dysprosium up to 2050. Recycling of dysprosium can further secure dysprosium supply in the long term by reducing primary dysprosium use by 35% in 2050. Electric vehicles are likely to play a dominant role in future increases in dysprosium demand. Even with the limited market share in 2011, electric vehicles already contribute to 20% of dysprosium use. -- Highlights: ► Dysprosium may hamper the implementation of electric cars and wind mills. ► In the short term (up to 2020) a deficit of dysprosium supply can be expected. ► In the long term (up to 2050) sufficient dysprosium is available. ► Electric vehicles are expected to dominate future dysprosium demand. ► China's dominance in dysprosium supply is likely to decrease by 2020.

  5. Resonance ionization spectroscopy in dysprosium

    Energy Technology Data Exchange (ETDEWEB)

    Studer, D., E-mail: dstuder@uni-mainz.de; Dyrauf, P.; Naubereit, P.; Heinke, R.; Wendt, K. [Johannes Gutenberg-Universität Mainz, Institut für Physik (Germany)

    2017-11-15

    We report on resonance ionization spectroscopy (RIS) of high-lying energy levels in dysprosium. We developed efficient excitation schemes and re-determined the first ionization potential (IP) via analysis of Rydberg convergences. For this purpose both two- and three-step excitation ladders were investigated. An overall ionization efficiency of 25(4) % could be demonstrated in the RISIKO mass separator of Mainz University, using a three-step resonance ionization scheme. Moreover, an extensive analysis of the even-parity 6sns- and 6snd-Rydberg-series convergences, measured via two-step excitation was performed. To account for strong perturbations in the observed s-series, the approach of multichannel quantum defect theory (MQDT) was applied. Considering all individual series limits we extracted an IP-value of 47901.76(5) cm{sup −1}, which agrees with the current literature value of 47901.7(6) cm{sup −1}, but is one order of magnitude more precise.

  6. Nature of the magnetic susceptibility of dysprosium. Paramagnetic susceptibility of dysprosium - yttrium alloys

    International Nuclear Information System (INIS)

    Demidov, V.G.; Levitin, R.Z.; Chistyakov, O.D.

    1976-01-01

    The paramagnetic susceptibility of single crystals of dysprosium-yttirum alloys is measured in the basal plane and along the hexagonal axis. It is shown that the susceptibility of the alloys obeys the Curie-Weiss law, the effective magnetic moments allong the different directions being the same and the paramagnetic Curie temperatures being different. The difference between the paramagnetic Curie temperatures in the basal plane and along the hexagonal axis is independent of the dysprosium concentration in the alloy. As a comparison with the theoretical models of magnetic anisotropy shows, this is an indication that the magnetic anisotropy of dysprosium - yttrium alloys is of a single-ion nature

  7. Semiconductor composition containing iron, dysprosium, and terbium

    Science.gov (United States)

    Pooser, Raphael C.; Lawrie, Benjamin J.; Baddorf, Arthur P.; Malasi, Abhinav; Taz, Humaira; Farah, Annettee E.; Kalyanaraman, Ramakrishnan; Duscher, Gerd Josef Mansfred; Patel, Maulik K.

    2017-09-26

    An amorphous semiconductor composition includes 1 to 70 atomic percent iron, 15 to 65 atomic percent dysprosium, 15 to 35 atomic percent terbium, balance X, wherein X is at least one of an oxidizing element and a reducing element. The composition has an essentially amorphous microstructure, an optical transmittance of at least 50% in at least the visible spectrum and semiconductor electrical properties.

  8. Dysprosium complexes with the tetraphenylporphyrin macrocyclic ligand

    International Nuclear Information System (INIS)

    Martinez M, V.; Padilla, J.; Ramirez, F.M.

    1992-04-01

    In this report, the results obtained on the synthesis, characterization and study of the chemical behavior of dysprosium complex with the acetylacetone chelating agent (Hacac) and the tetraphenylporphyrin macrocyclic ligand (H 2 TFP) are given. Based on the literature but according to our necessities and interest, the appropriate methodology settled down from the synthesis of prime matters until the obtaining and characterization of the products. The acetyl acetonate complex was obtained of mono hydrated dysprosium [Dy(acac) 3 . H 2 0] and trihydrated [Dy(acac) 3 .3 H 2 0], the mono tetra phenyl porphyrinate [Dy(TFP)(acac). 2 ac] the double sandwich of the dysprosium porphyrinate [Dy(TFP) 2 ] and the triple sandwich of the dysprosium porphyrinate [Dy(TFP) 3 . 2 TCB] (TCB = trichlorobenzene). Its were characterized by their melting points, solubility, IR, UV, TGA and DTA both first and besides the techniques already mentioned for NMR'H, RPE and Magnetic susceptibility the three last complexes. From the spectroscopic point of view, IR and RPE its suggested the existence of a complex of inverse mixed valence [Dy(TFP) 2- (TFP) 1- ] for the Dy(TFP) 2 as a result of the existence of the free radical (TFP' 1- and that it was not in none of the other porphyrin compounds. In the NMR'H spectra of the compounds were not observed signals in the region from 0 to 10 ppm that which shows that the dysprosium complexes in special those of the porphyrin type are highly paramagnetic and its could be used as displacement reagents, creators of images and contrast agents of great utility in these days in studies of NMR, technique today by today used in medical diagnoses. (Author)

  9. Heat capacity measurements on dysprosium titanate

    International Nuclear Information System (INIS)

    Kandan, R.; Prabhakara Reddy, B.; Panneerselvam, G.; Nagarajan, K.

    2014-01-01

    Dysprosium titanate is considered as a candidate material for use in the control rods of future nuclear reactors. The Dy 2 TiO 5 compound was prepared by solid-state synthesis and characterized by XRD technique. The high temperature enthalpy increments of dysprosium titanates have been measured for the first time by employing the method of inverse drop calorimetry in the temperature range 748-1645 K by using high temperature drop calorimeter. The calorimeter, the method of measurement and the procedure adopted for enthalpy increment measurements and analysis of the measured data to compute thermodynamic functions have been described elsewhere. The measured enthalpy increments were fitted to polynomial in temperature by using the least squares method. The fit equation in the temperature range from 298 to 1800 K is given

  10. High temperature oxidation kinetics of dysprosium particles

    Energy Technology Data Exchange (ETDEWEB)

    Jaques, Brian J.; Butt, Darryl P., E-mail: DarrylButt@BoiseState.edu

    2015-09-25

    Highlights: • The oxidation behavior of dysprosium particles was studied from 500 to 1000 °C. • Activation energy in initial region found as 8–25 kJ/mol, depending on atmosphere. • Activation energy in intermediate region found as 80–95 kJ/mol. • The oxide grows at the metal–oxide interface. • Generally, the formed oxide behaved as a p-type semiconductor. - Abstract: Rare earth elements have been recognized as critical materials for the advancement of many strategic and green technologies. Recently, the United States Department of Energy has invested many millions of dollars to enhance, protect, and forecast their production and management. The work presented here attempts to clarify the limited and contradictory literature on the oxidation behavior of the rare earth metal, dysprosium. Dysprosium particles were isothermally oxidized from 500 to 1000 °C in N{sub 2}–(2%, 20%, and 50%) O{sub 2} and Ar–20% O{sub 2} using simultaneous thermal analysis techniques. Two distinct oxidation regions were identified at each isothermal temperature in each oxidizing atmosphere. Initially, the oxidation kinetics are very fast until the reaction enters a slower, intermediate region of oxidation. The two regions are defined and the kinetics of each are assessed to show an apparent activation energy of 8–25 kJ/mol in the initial region and 80–95 kJ/mol in the intermediate oxidation reaction region. The effects of varying the oxygen partial pressure on the reaction rate constant are used to show that dysprosium oxide (Dy{sub 2}O{sub 3}) generally acts as a p-type semiconductor in both regions of oxidation (with an exception above 750 °C in the intermediate region)

  11. Can a dysprosium shortage threaten green energy technologies?

    NARCIS (Netherlands)

    Hoenderdaal, S.; Tercero Espinoza, L.; Marschneider-Weidemann, F.; Crijns - Graus, Wina|info:eu-repo/dai/nl/308005015

    2013-01-01

    Dysprosium, one of the various rare earth elements, is currently for more than 99% mined in China. As China is reducing its exports, new mining projects outside of China are needed to sustain supply and meet future demands. Dysprosium is mainly used in permanent magnets to retain the magnet's

  12. Ethanolamine derivatives of dysprosium and holmium

    International Nuclear Information System (INIS)

    Gharia, K.S.; Singh, M.; Mathur, S.; Sankhla, B.S.

    1981-01-01

    The preparation and properties of dysprosium and holmium derivatives of mono-, di- and tri-ethanolamine derivatives are described. Compounds of general formulae: Ln(OPrsup(i)) 2 (mea), Ln(OPrsup(i))(mea) 2 , Ln(mea) 3 , Ln(OPrsup(i))(dea), Ln 2 (dea) 3 , Ln(dea)(deaH) and Ln(tea) (where Ln = Dy or Ho and mea, dea and tea are the anions of respective ethanolamine) were obtained and characterized by elemental analysis and IR spectra. (author)

  13. Synthesis and characterization of tetraphenylporphyrinate of dysprosium route dysprosium acetylacetonate.; Sintesis y caracterizacion de un porfirinato de disprosio via acetilacetonato de disprosio.

    Energy Technology Data Exchange (ETDEWEB)

    Martinez M, V

    1993-12-31

    Dysprosium bis (tetraphenylporphyrinate) and bis (dysprosium) Tris (tetraphenylporphyrinate) were synthesized from dysprosium tetraphenylporphyrinate prepared in situ, and characterized by IR, UV-vis, TGA, DTA, EPR and magnetic susceptibility measurements. The double decker compound was obtained by direct oxidation of the HDy(TPP){sub 2} intermediate. The existence of the radical anion, (TPP){sup -} , in the double decker product was conformed by EPR spectrometry. Dysprosium monoporphyrinate was isolated and characterized by the same techniques. (Author).

  14. Method for producing dysprosium-iron-boron alloy powder

    International Nuclear Information System (INIS)

    Camp, F.E.; Wooden, S.A.

    1989-01-01

    A method for producing a dysprosium-iron alloy adapted for use in the manufacture of rare-earth element containing, iron-boron permanent magnets, the method including providing a particle mixture comprising dysprosium oxide, iron and calcium, compacting the particle mixture to produce a consolidated article, heating the article for a time at temperature to form a metallic compound comprising dysprosium and iron and to form calcium oxide, producing a particle mass of -35 mesh from the compact, washing the particle mass with water at a temperature no greater than 10 0 C to react to the calcium and to the calcium oxide therewith to form a calcium hydroxide, while preventing oxidation of the particle mass, and removing the calcium hydroxide from the particle mass

  15. Synthesis and thermal decomposition study of dysprosium trifluoroacetate

    DEFF Research Database (Denmark)

    Opata, Y. A.; Grivel, J.-C.

    2018-01-01

    A study of the thermal decomposition process of dysprosium trifluoroacetate hydrate under flowing argon is presented. Thermogravimetry, differential thermal analysis, evolved gas analysis and ex-situ x-ray diffraction techniques have been employed in the investigation. Three main stages were...

  16. Magnon contribution to electrical resistance of gadolinium-dysprosium alloy single crystals

    International Nuclear Information System (INIS)

    Nikitin, S.A.; Slobodchikov, S.S.; Solomkin, I.K.

    1978-01-01

    The magnon, phonon and interelectron collision contributions to the electric resistance of single crystals of gadolinium-dysprosium alloys were quantified. A relationship was found to exist between the electric resistance and the variation of the topology of the Fermi surface on melting of gadolinium with dysprosium. It was found that gadolinium-dysprosium alloys, which have no helicoidal magnetic structure in magnetically ordered state, feature a spin-spin helicoidal-type correlations in the paramagnetic field

  17. Compounds of divalent thulium, neodymium, and dysprosium

    International Nuclear Information System (INIS)

    Bochkarev, M.N.; Fedushkin, I.L.; Trifonov, A.A.; Fagin, A.A.; Kirillov, E.N.

    1998-01-01

    Full text: Judging on the Ln(II)/Ln(III) potentials Tm, Nd, and Dy are the first candidates after Sm, Eu, and Yb for the preparation of Ln(II) compounds. The first molecular Tm(II) derivatives, TmI 2 (DME) 3 (I), has been obtained recently by the reduction of TmI 3 with thulium metal in DME (1,2-dimethoxyethane). The tetrahydrofuran (THF) analogue, TmI 2 (THF) 5 , was synthesized similarly. In the case of TmBI 3 and TmCl 3 the same reaction does not occur. The compound I is inert toward naphthalene, anthracene, phenylacetylene, CpH, (Me 3 Si) 2 NH, 2,4,6-t-Bu 3 C 6 H 2 OH, Cp 2 V, Cp 2 Fe, or Cp 3 Er. The reactions of I with PhOH, Ph 3 COH, 3,6-t-Bu 2 C 6 H 2 (OH) 2 -1,2 (Cat), and calixarene (Cal) produce, Ph 3 COTmI 2 (DME) 2 , (Cat)TmI(DME) 2 , and (Cal)TmI, correspondingly. The attempts to use I for preparation of the other Tm(II) complexes failed. In all cases (reactions with C 10 H 8 Li, CpK, [1,3-(Me 3 Si) 2 C 5 H 3 ]MgCl, and [Cp'-SiMe 2 -Ind']K 2 ) the Tm(III) derivatives (respectively, (C 10 H 8 Tm) 2 C 10 H 8 , Cp 3 Tm, [1,3-(Me 3 Si) 2 C 5 H 3 ] 2 TmCl, and Cp'-SiMe 2 -Ind')TmI) were obtained. The new stable Tm(II) complex, PhOTmI(DME) 2 (II), has been synthesized by the reduction of I with potassium metal in DME. The product was isolated as the green crystals with μ eff 4.6 BM. Unlike TmI 3 , NdI 3 and DyI 3 can not be reduced by metallic neodymium, dysprosium or sodium in DME or THF. Re-investigation of the product formed in the reaction of NdCl 3 with a lack of Li and naphthalene which was claimed before as NdCl 2 (THF) 2 has shown that this is a mixture of Nd(III) naphthalene complexes of the type [(NdCl 2 (THF) 2 ]nC 10 H 8 (n = 4- 7) (III). Nevertheless the product may be used instead of NdCl 2 for the preparation of RNdCl 2 type complexes. The reactions of III with t-BuNCH=CHNBu-t (DAD), PhCH=CHCH=CHPh (DBD), and PhCH=CHPh afford (DAD)NdCl 2 (THF) 2 , (DBD)[NdCl 2 (THF) 2 ] 2 , and (PhCHCHPh)[NdCl 2 ] 2 (THF) 3 , respectively. The iodides of Nd

  18. Properties of Polydisperse Tin-doped Dysprosium and Indium Oxides

    Directory of Open Access Journals (Sweden)

    Malinovskaya Tatyana

    2017-01-01

    Full Text Available The results of investigations of the complex permittivity, diffuse-reflectance, and characteristics of crystal lattices of tin-doped indium and dysprosium oxides are presented. Using the methods of spectroscopy and X-ray diffraction analysis, it is shown that doping of indium oxide with tin results in a significant increase of the components of the indium oxide complex permittivity and an appearance of the plasma resonance in its diffuse-reflectance spectra. This indicates the appearance of charge carriers with the concentration of more than 1021 cm−3 in the materials. On the other hand, doping of the dysprosium oxide with the same amount of tin has no effect on its optical and electromagnetic properties.

  19. Charge transfer cross sections for dysprosium and cerium

    Energy Technology Data Exchange (ETDEWEB)

    Adachi, Hajime; Tamura, Koji; Okazaki, Tetsuji; Shibata, Takemasa [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1998-06-01

    Symmetric resonant charge transfer cross sections between singly ionized ions and the parent atoms were measured for dysprosium and cerium in the impact energy of 200-2000eV. The cross sections were determined from the ratio between the number of ions produced by charge transfer and those in primary ion beam. The primary ion beam was produced by a laser ion source in which their atoms were ionized by laser resonant photo-ionization. The slow ions produced by charge transfer and fast primary ions were detected with Faraday cups. The obtained cross sections were (1.82{+-}0.14) x 10{sup -14} cm{sup 2} for dysprosium and (0.88{+-}0.12) x 10{sup -14} cm{sup 2} for cerium in the above energy range. The difference of these values can mostly be explained by considering the electron configurations of these atoms and ions. (author)

  20. Charge transfer cross sections for dysprosium and cerium

    International Nuclear Information System (INIS)

    Adachi, Hajime; Tamura, Koji; Okazaki, Tetsuji; Shibata, Takemasa

    1998-06-01

    Symmetric resonant charge transfer cross sections between singly ionized ions and the parent atoms were measured for dysprosium and cerium in the impact energy of 200-2000eV. The cross sections were determined from the ratio between the number of ions produced by charge transfer and those in primary ion beam. The primary ion beam was produced by a laser ion source in which their atoms were ionized by laser resonant photo-ionization. The slow ions produced by charge transfer and fast primary ions were detected with Faraday cups. The obtained cross sections were (1.82±0.14) x 10 -14 cm 2 for dysprosium and (0.88±0.12) x 10 -14 cm 2 for cerium in the above energy range. The difference of these values can mostly be explained by considering the electron configurations of these atoms and ions. (author)

  1. Neutron capture measurements and resonance parameters of dysprosium

    Energy Technology Data Exchange (ETDEWEB)

    Shin, S.G.; Kye, Y.U.; Namkung, W.; Cho, M.H. [Pohang University of Science and Technology, Division of Advanced Nuclear Engineering, Pohang, Gyeongbuk (Korea, Republic of); Kang, Y.R.; Lee, M.W. [Dongnam Inst. of Radiological and Medical Sciences, Research Center, Busan (Korea, Republic of); Kim, G.N. [Kyungpook National University, Department of Physics, Daegu (Korea, Republic of); Ro, T.I. [Dong-A University, Department of Physics, Busan (Korea, Republic of); Danon, Y.; Williams, D. [Rensselaer Polytechnic Institute, Department of Mechanical, Aerospace, and Nuclear Engineering, Troy, NY (United States); Leinweber, G.; Block, R.C.; Barry, D.P.; Rapp, M.J. [Naval Nuclear Laboratory, Knolls Atomic Power Laboratory, Schenectady, NY (United States)

    2017-10-15

    Neutron capture yields of dysprosium isotopes ({sup 161}Dy, {sup 162}Dy, {sup 163}Dy, and {sup 164}Dy) were measured using the time-of-flight method with a 16 segment sodium iodide multiplicity detector. The measurements were made at the 25m flight station at the Gaerttner LINAC Center at Rensselaer Polytechnic Institute. Resonance parameters were obtained using the multilevel R-matrix Bayesian code SAMMY. The neutron capture data for four enriched dysprosium isotopes and one natural dysprosium sample were sequentially fitted. New resonances not listed in ENDF/B-VII.1 were observed. There were 29 and 17 new resonances from {sup 161}Dy and {sup 163}Dy isotopes, respectively. Six resonances from {sup 161}Dy isotope, two resonances from {sup 163}Dy, and four resonances from {sup 164}Dy were not observed. The capture resonance integrals of each isotope were calculated with the resulting resonance parameters and those of ENDF/B-VII.1 in the energy region from 0.5 eV to 20 MeV and were compared to the capture resonance integrals with the resonance parameters from ENDF/B-VII.1. A resonance integral value of the natural dysprosium calculated with present resonance parameters was 1405 ± 3.5 barn. The value is ∝ 0.3% higher than that obtained with the ENDF/B-VII.1 parameters. The distributions of the present and ENDF/B-VII.1 neutron widths were compared to a Porter-Thomas distribution. Neutron strength functions for {sup 161}Dy and {sup 163}Dy were calculated with the present resonance parameters and both values were in between the values of ''Atlas of Neutron Resonances'' and ENDF/B-VII.1. The present radiation width distributions of {sup 161}Dy and {sup 163}Dy were fitted with the χ{sup 2} distribution by varying the degrees of freedom. (orig.)

  2. The development of dysprosium-165 hydroxide macroaggregates for radiation synovectomy

    International Nuclear Information System (INIS)

    McLaren, A.B.; Hetherington, E.L.R.; Maddalena, D.J.; Snowden, G.M.

    1988-06-01

    The development of a dysprosium-165 product, Dy-HMA, which is suitable for the radiation synovectomy of arthritic joints is described. Dysprosium-165 is a short-lived (t 1/2 = 139 min) beta-emitter produced by the neutron irradiation of natural dysprosium. Dy-HMA is a suspension of macroaggregated hydroxide particles in saline with the majority of particles in the 3-5 μm range. Studies in rabbits have demonstrated minimal leakage following the intra-articular injection of a knee joint. At 24 hours, the accumulation in the liver is about 0.003% of the injected dose and there is considerably less in other organs and tissue. The use of Dy-HMA has considerable advantages over the presently used yttrium-90 products. The undesired leakage to and subsequent irradiation of other organs is considerably reduced. The period of hospitalisation is reduced from four days to one and the production of 165 Dy in Australia will overcome the difficulties of supply 90 Y from overseas. 21 refs., 1 fig., 18 tabs

  3. Dosimetric properties of dysprosium doped lithium borate glass irradiated by 6 MV photons

    International Nuclear Information System (INIS)

    Ab Rasid, A.; Wagiran, H.; Hashim, S.; Ibrahim, Z.; Ali, H.

    2015-01-01

    Undoped and dysprosium doped lithium borate glass system with empirical formula (70–x) B 2 O 3 –30 Li 2 O–(x) Dy 2 O 3 (x=0.1, 0.3, 0.5, 0.7, 1.0 mol%) were prepared using the melt-quenching technique. The dosimetric measurements were performed by irradiating the samples to 6 MV photon beam using linear accelerator (LINAC) over a dose range of 0.5–5.0 Gy. The glass series of dysprosium doped lithium borate glass produced the best thermoluminescence (TL) glow curve with the highest intensity peak from sample with 1.0 mol% Dy 2 O 3 concentration. Minimum detectable dose was detected at 2.24 mGy, good linearity of regression coefficient, high reproducibility and high sensitivity compared to the undoped glass are from 1.0 mol% dysprosium doped lithium borate glass. The results indicated that the series of dysprosium doped lithium glasses have a great potential to be considered as a thermoluminescence dosimetry (TLD). - Highlights: • TL response of undoped and dysprosium doped lithium borate glass subjected to 6 MV photons irradiation at low dose range. • TL linear response of dysprosium doped lithium borate glass. • The sensitivity of dysprosium doped lithium borate glass is approximately 93 times higher than undoped glass

  4. Elevated temperature study of Nd-Fe-B--based magnets with cobalt and dysprosium additions

    International Nuclear Information System (INIS)

    Gauder, D.R.; Froning, M.H.; White, R.J.; Ray, A.E.

    1988-01-01

    This paper discusses the elevated temperature performance of Nd-Fe-B magnets containing 0--15 wt. % cobalt substitutions for iron and 0--10 wt. % dysprosium substitutions for neodymium. Test samples were prepared using conventional powder metallurgy techniques. Elevated temperature hysteresis loop and open-circuit measurements were performed on the samples to investigate irreversible losses and long term aging losses at 150 0 C. Magnets with high amounts of both cobalt and dysprosium exhibited lower losses of coercivity and magnetization. Dysprosium had more influence on the elevated temperature performance of the material than did cobalt

  5. Study on the electrochemical of the metal deposition from ionic liquids for lithium, titanium and dysprosium

    International Nuclear Information System (INIS)

    Berger, Claudia A.

    2017-01-01

    The thesis was aimed to the characterization of electrochemically deposited film of lithium, titanium and dysprosium on Au(111) from different ionic liquids, finally dysprosium on neodymium-iron-boron magnate for industrial applications. The investigation of the deposits were performed using cyclic voltametry, in-situ scanning tunneling microscopy, electrochemical quartz microbalance, XPS and Auger electron spectroscopy. The sample preparation is described in detail. The deposition rate showed a significant temperature dependence.

  6. A terminal fluoride ligand generates axial magnetic anisotropy in dysprosium complexes

    Energy Technology Data Exchange (ETDEWEB)

    Norel, Lucie [Department of Chemistry, University of California, Berkeley, CA (United States); Univ Rennes, CNRS, ISCR (Institut des Sciences Chimiques de Rennes) - UMR 6226, Rennes (France); Darago, Lucy E.; Chakarawet, Khetpakorn; Gonzalez, Miguel I.; Olshansky, Jacob H.; Long, Jeffrey R. [Department of Chemistry, University of California, Berkeley, CA (United States); Le Guennic, Boris; Rigaut, Stephane [Univ Rennes, CNRS, ISCR (Institut des Sciences Chimiques de Rennes) - UMR 6226, Rennes (France)

    2018-02-12

    The first dysprosium complexes with a terminal fluoride ligand are obtained as air-stable compounds. The strong, highly electrostatic dysprosium-fluoride bond generates a large axial crystal-field splitting of the J=15/2 ground state, as evidenced by high-resolution luminescence spectroscopy and correlated with the single-molecule magnet behavior through experimental magnetic susceptibility data and ab initio calculations. (copyright 2018 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)

  7. Terbium and dysprosium complexes luminescence at low temperatures

    Energy Technology Data Exchange (ETDEWEB)

    Meshkova, S B; Kravchenko, T B; Kononenko, L.I.; Poluehktov, N S [AN Ukrainskoj SSR, Odessa. Fiziko-Khimicheskij Inst.

    1979-01-01

    The variation is studied of the luminescence intensity of terbium and dysprosium complexes used in the analysis as solutions are cooled down to the liquid nitrogen temperature. Three groups of methods have been studied: observation of fluorescence of aqueous solutions, precipitate and extract suspensions in organic solvents. The brightest luminescence and greatest increase in luminescence intensity are observed at freezing of complex solvents with 1,2-dioxybenzene-3,5-disulfonic acid (DBSA) and iminodiacetic acid (IDA) and DBSA+EDTA, as well as in the case of benzene extracting of complexes with phenanthroline and salicylic acid. Otherwise the intensity increases 2-14-fold and for the complex of terbium with acetoacetic ester 36-fold.

  8. Dysprosium (holmium) determination in the presence of erbium and dysprosium (holmium, erbium) determination in the presence of cerium

    International Nuclear Information System (INIS)

    Tolubara, A.I.; Kochubej, A.I.; Usatenko, Yu.I.

    1978-01-01

    Effect of salicylic acid upon complex formation in the systems REE - boronsulfoalizarinate, REE - oxine and REE - boronsulfoalizarinate - oxine is investigated. Comparison of optical characteristics of the above systems in the absence and in the presence of salicylic acid is carried out. It is established that in all the cases the effect of salicylic acid depends both on the nature of REE and the ratio of all the components of the system. Under certain conditions the given dependence is observed only for erbium complexes. Extraction-photometric methods of dysprosium and holmium determination in the presence of equal erbium amounts, as well as holmium and erbium determination in the presence of cerium equal amounts is developed

  9. Dysprosium (holmium) determination in the presence of erbium and dysprosium (holmium, erbium) determination in the presence of cerium

    Energy Technology Data Exchange (ETDEWEB)

    Tolubara, A I; Kochubei, A I; Usatenko, Yu I

    1978-01-01

    Effect of salicylic acid upon complex formation in the systems REE - boronsulfoalizarinate, REE - oxine and REE - boronsulfoalizarinate - oxine is investigated. Comparison of optical characteristics of the above systems in the absence and in the presence of salicylic acid is carried out. It is established that in all the cases the effect of salicylic acid depends both on the nature of REE and the ratio of all the components of the system. Under certain conditions the given dependence is observed only for erbium complexes. Extraction-photometric methods of dysprosium and holmium determination in the presence of equal erbium amounts, as well as holmium and erbium determination in the presence of cerium equal amounts is developed.

  10. Isotopic shifts and configuration mixing in the dysprosium II spectrum

    International Nuclear Information System (INIS)

    Aufmuth, P.

    1977-01-01

    Using a photoelectric Fabry-Perot spectrometer with digital data acquisition, the isotopic shifts of all stable dysprosium isotopes (Z = 66, A = 156, 158, 160, 161, 162, 163, 164) have been measured in transitions from the groundstate configuration 4f 10 6s to the excited configurations 4f 9 5d6s, 4f 9 5d 2 , and 4f 10 6p of the spark spectrum. Mass and volume effects have been seperated; the results are compared with arc spectrum measurements. From the volume effect of a pure s-p transition the change of the mean electric quadratic nuclear radius delta 2 > has been calculated. In order to test fine structure calculations of the Dy II spectrum, the isotopic shifts of 29 lines of the isotopes 162 Dy and 164 Dy have been measured. Based on the sharing rule, the reported configuration mixing could be confirmed in principle; for one energy level (E = 22908 K) the asignement has been proved to be false, in the case of three other levels (E = 22467, 22672, and 28885 K) the asignement is doubtfull. For the ground state levels 4f 10 6s 6 I the influence of relativistic effects could be proved; these effects can be interpreted in the framework of a parametric representation of the isotopic shift. The order of magnitude of the crossed second order effects has been estimated. (orig.) [de

  11. Low Field Magnetic and Thermal Hysteresis in Antiferromagnetic Dysprosium

    Directory of Open Access Journals (Sweden)

    Iuliia Liubimova

    2017-06-01

    Full Text Available Magnetic and thermal hysteresis (difference in magnetic properties on cooling and heating have been studied in polycrystalline Dy (dysprosium between 80 and 250 K using measurements of the reversible Villari effect and alternating current (AC susceptibility. We argue that measurement of the reversible Villari effect in the antiferromagnetic phase is a more sensitive method to detect magnetic hysteresis than the registration of conventional B(H loops. We found that the Villari point, recently reported in the antiferromagnetic phase of Dy at 166 K, controls the essential features of magnetic hysteresis and AC susceptibility on heating from the ferromagnetic state: (i thermal hysteresis in AC susceptibility and in the reversible Villari effect disappears abruptly at the temperature of the Villari point; (ii the imaginary part of AC susceptibility is strongly frequency dependent, but only up to the temperature of the Villari point; (iii the imaginary part of the susceptibility drops sharply also at the Villari point. We attribute these effects observed at the Villari point to the disappearance of the residual ferromagnetic phase. The strong influence of the Villari point on several magnetic properties allows this temperature to be ranked almost as important as the Curie and Néel temperatures in Dy and likely also for other rare earth elements and their alloys.

  12. Kinetics of the nitridation of dysprosium during mechanochemical processing

    Energy Technology Data Exchange (ETDEWEB)

    Alanko, Gordon A.; Osterberg, Daniel D.; Jaques, Brian J. [Department of Materials Science and Engineering, College of Engineering, Boise State University, 1910 University Drive, Boise, ID 83725 (United States); Hurley, Michael F. [Department of Materials Science and Engineering, College of Engineering, Boise State University, 1910 University Drive, Boise, ID 83725 (United States); Center for Advanced Energy Studies, 995 University Boulevard, Idaho Falls, ID 83401 (United States); Butt, Darryl P., E-mail: darrylbutt@boisestate.edu [Department of Materials Science and Engineering, College of Engineering, Boise State University, 1910 University Drive, Boise, ID 83725 (United States); Center for Advanced Energy Studies, 995 University Boulevard, Idaho Falls, ID 83401 (United States)

    2015-01-25

    Highlights: • DyN was mechanochemically synthesized by milling pure metal under nitrogen. • Temperature and pressure were monitored to investigate reaction progress. • The effects of metal adhered to media on the impact energetics was measured. • The reactive milling kinetics are described in terms of reactive surface formation. - Abstract: Dysprosium nitride was synthesized by the reactive milling of the rare earth metal under 400 kPa nitrogen gas in a planetary ball mill. The nitrogen consumption rate was calculated from in situ temperature and pressure measurements to find the reaction extent as a function of milling time at milling speeds from 350 to 650 rpm. The results are analyzed in terms of a fundamental milling dynamics model in which the input milling energy is the primary driving force for reaction and the rate limiting step of the nitridation kinetics is the formation of chemically active surfaces. The model differs from traditional gas–solid reactions which are often limited by diffusion of a species through a surface layer or by dissociation of the gas molecule. These results give fresh insight into reactive gas–solid milling kinetics.

  13. Systems of pyridine, piperidine, piperazine, morpholine hydrochlorides-terbium (dysprosium) chloride-water

    International Nuclear Information System (INIS)

    Gajfutdinova, R.K.; Sharafutdinova, A.A.; Murinov, Yu.I.

    1988-01-01

    The isothermal cross section method at 25 and 50 deg C is applied to study pyridine hydrochloride-terbium chloride-water (1) piperidine hydrochloride-dysprosium chloride-water (2), piperazine dihydrochloride-dysprosium chloride-water (3) and morpholine hydrochloride-terbium chloride (4) systems. Solubility isotherma prove the formation of incongruently soluble compound of the TbCl 3 x6C 5 H 5 NxHCl composition systems (1). The individuality of the new solid phase is proved by the chemical and DTA methods. Systems (2-4) are of a simple eutonic type

  14. Exploration of dysprosium: the most critical element for Japan

    Science.gov (United States)

    Watanabe, Y.

    2012-04-01

    Dysprosium (Dy), one of the heavy rare earth elements, is used mainly as an additive for NdFeB permanent magnets which are installed in various modern industrial products such as voice coil motors in computers, factory automation machinery, hybrid and electric vehicles, home electronics, and wind turbine, to improve heat resistance of the magnets. Dy has been produced about 2,000t per year from the ores from ion adsorption type deposits in southern China. However, the produced amount of Dy was significantly reduced in 2011 in China due to reservation of heavy rare earth resources and protection of natural environment, resulting in soaring of Dy price in the world. In order to respond the increasing demand of Dy, unconventional supply sources are inevitably developed, in addition to heavy rare earth enriched ion adsorption type deposits outside China. Heavy rare earth elements including Dy are dominantly hosted in xenotime, fergusonite, zircon, eudialyte, keiviite, kainosite, iimoriite, etc. Concentration of xenotime is found in placer deposits in Malaysia and India, hydrothermal deposits associated with unconformity-type uranium mineralization (Athabasca basin in Canada, Western Australia), iron-oxide fluorite mineralization (South Africa) and Sn-bearing alkaline granite (Brazil). Zircon and fergusontie concentration is found as igneous and hydrothermal products in peralkaline syenite, alkaline granite and pegmatite (e.g., Nechalacho in Canada). Eudialyte concentration is found in some peralkaline syenite bodies in Greenland, Canada, Sweden and Russia. Among these sources, large Dy resources are estimated in the deposits hosted in peralkaline rocks (Nechalacho: 79,000t, Kvanefjeld: 49,000t, Norra Karr: 15,700t, etc.) compared to the present demand of Dy. Thus, Dy will be supplied from the deposits associated with peralkaline and alkaline deposits in future instead of ion adsorption type deposits in southern China.

  15. Dosimetric properties of dysprosium doped lithium borate glass irradiated by 6 MV photons

    Science.gov (United States)

    Ab Rasid, A.; Wagiran, H.; Hashim, S.; Ibrahim, Z.; Ali, H.

    2015-07-01

    Undoped and dysprosium doped lithium borate glass system with empirical formula (70-x) B2O3-30 Li2O-(x) Dy2O3 (x=0.1, 0.3, 0.5, 0.7, 1.0 mol%) were prepared using the melt-quenching technique. The dosimetric measurements were performed by irradiating the samples to 6 MV photon beam using linear accelerator (LINAC) over a dose range of 0.5-5.0 Gy. The glass series of dysprosium doped lithium borate glass produced the best thermoluminescence (TL) glow curve with the highest intensity peak from sample with 1.0 mol% Dy2O3 concentration. Minimum detectable dose was detected at 2.24 mGy, good linearity of regression coefficient, high reproducibility and high sensitivity compared to the undoped glass are from 1.0 mol% dysprosium doped lithium borate glass. The results indicated that the series of dysprosium doped lithium glasses have a great potential to be considered as a thermoluminescence dosimetry (TLD).

  16. In situ characterization of the nitridation of dysprosium during mechanochemical processing

    Energy Technology Data Exchange (ETDEWEB)

    Jaques, Brian J.; Osterberg, Daniel D.; Alanko, Gordon A.; Tamrakar, Sumit; Smith, Cole R.; Hurley, Michael F.; Butt, Darryl P., E-mail: DarrylButt@BoiseState.edu

    2015-01-15

    Highlights: • A nitridation reaction in a high energy planetary ball mill was monitored in situ. • Dysprosium mononitride was synthesized from Dy at low temperatures in short times. • Ideal gas law and in situ temperature and pressure used to assess reaction extent. • It is proposed that reaction rate is proportional to the creation of new surface. - Abstract: Processing of advanced nitride ceramics traditionally requires long durations at high temperatures and, in some cases, in hazardous atmospheres. In this study, dysprosium mononitride (DyN) was rapidly formed from elemental dysprosium in a closed system at ambient temperatures. An experimental procedure was developed to quantify the progress of the nitridation reaction during mechanochemical processing in a high energy planetary ball mill (HEBM) as a function of milling time and intensity using in situ temperature and pressure measurements, SEM, XRD, and particle size analysis. No intermediate phases were formed. It was found that the creation of fresh dysprosium surfaces dictates the rate of the nitridation reaction, which is a function of milling intensity and the number of milling media. These results show clearly that high purity nitrides can be synthesized with short processing times at low temperatures in a closed system requiring a relatively small processing footprint.

  17. A model for additive transport in metal halide lamps containing mercury and dysprosium tri-iodide

    NARCIS (Netherlands)

    Beks, M.L.; Haverlag, M.; Mullen, van der J.J.A.M.

    2008-01-01

    The distribution of additives in a metal halide lamp is examined through numerical modelling. A model for a lamp containing sodium iodide additives has been modified to study a discharge containing dysprosium tri-iodide salts. To study the complex chemistry the method of Gibbs minimization is used

  18. Neutronography of an intermediate phase in dysprosium near the Neel point

    Energy Technology Data Exchange (ETDEWEB)

    Bessergenev, V G; Gogava, V V; Kovalevskaya, Yu A; Mandzhavidze, A G; Fedorov, V M; Shilo, S I

    1985-11-25

    Neutronographical study of dysprosium magnetic structure near the point of magnetic disordering depending on thermal prehistory of the sample is carried out. Intermediate vortex phase transformed then into the helical one is shown to occur from the paramagnetic phase under cooling.

  19. Synthesis and X-ray structure of the dysprosium(III) complex derived ...

    African Journals Online (AJOL)

    Synthesis and X-ray structure of the dysprosium(III) complex derived from the ligand 5-chloro-1 ... Bulletin of the Chemical Society of Ethiopia ... synthesized and its crystal structure determined by single X-ray diffraction at room temperature.

  20. Dysprosium-containing layered double hydroxides nanoparticles intercalated with biologically active species as an approach for theranostic systems

    KAUST Repository

    Arratia-Quijada, Jenny

    2015-10-23

    A layered double hydroxide structure including dysprosium cations was prepared by co-precipitation. The nanoparticles showed a linear relationship with the reciprocal relaxation spin-lattice (T1) time of water protons which is reflected as contrast in aqueous suspensions analyzed by magnetic resonance imaging. The interlayer space of dysprosium containing LDH was successfully intercalated with folate, ibuprofen and gallate ions, which are key molecules for recognition of some cancer cells and treatment of diseases. The paramagnetic property of the dysprosium-containing LDH detected in this work beside the ability to transport drugs open up the opportunity to design theranostic materials in a single crystal phase with nanometric dimensions.

  1. Dysprosium-containing layered double hydroxides nanoparticles intercalated with biologically active species as an approach for theranostic systems

    KAUST Repository

    Arratia-Quijada, Jenny; Sá nchez Jimé nez, Cecilia; Gurinov, Andrei; Pé rez Centeno, Armando; Ceja Andrade, Israel; Carbajal Arí zaga, Gregorio Guadalupe

    2015-01-01

    A layered double hydroxide structure including dysprosium cations was prepared by co-precipitation. The nanoparticles showed a linear relationship with the reciprocal relaxation spin-lattice (T1) time of water protons which is reflected as contrast in aqueous suspensions analyzed by magnetic resonance imaging. The interlayer space of dysprosium containing LDH was successfully intercalated with folate, ibuprofen and gallate ions, which are key molecules for recognition of some cancer cells and treatment of diseases. The paramagnetic property of the dysprosium-containing LDH detected in this work beside the ability to transport drugs open up the opportunity to design theranostic materials in a single crystal phase with nanometric dimensions.

  2. Dysprosium complexes with the tetraphenylporphyrin macrocyclic ligand; Complejos de disprosio con el ligante macrociclico tetrafenilporfirina

    Energy Technology Data Exchange (ETDEWEB)

    Martinez M, V.; Padilla, J.; Ramirez, F.M

    1992-04-15

    In this report, the results obtained on the synthesis, characterization and study of the chemical behavior of dysprosium complex with the acetylacetone chelating agent (Hacac) and the tetraphenylporphyrin macrocyclic ligand (H{sub 2}TFP) are given. Based on the literature but according to our necessities and interest, the appropriate methodology settled down from the synthesis of prime matters until the obtaining and characterization of the products. The acetyl acetonate complex was obtained of mono hydrated dysprosium [Dy(acac){sub 3}. H{sub 2}0] and trihydrated [Dy(acac){sub 3} .3 H{sub 2}0], the mono tetra phenyl porphyrinate [Dy(TFP)(acac). 2 ac] the double sandwich of the dysprosium porphyrinate [Dy(TFP){sub 2}] and the triple sandwich of the dysprosium porphyrinate [Dy(TFP){sub 3}. 2 TCB] (TCB = trichlorobenzene). Its were characterized by their melting points, solubility, IR, UV, TGA and DTA both first and besides the techniques already mentioned for NMR'H, RPE and Magnetic susceptibility the three last complexes. From the spectroscopic point of view, IR and RPE its suggested the existence of a complex of inverse mixed valence [Dy(TFP){sup 2-} (TFP) {sup 1-}] for the Dy(TFP){sub 2} as a result of the existence of the free radical (TFP' {sup 1-} and that it was not in none of the other porphyrin compounds. In the NMR'H spectra of the compounds were not observed signals in the region from 0 to 10 ppm that which shows that the dysprosium complexes in special those of the porphyrin type are highly paramagnetic and its could be used as displacement reagents, creators of images and contrast agents of great utility in these days in studies of NMR, technique today by today used in medical diagnoses. (Author)

  3. Dysprosium complexes with the tetraphenylporphyrin macrocyclic ligand; Complejos de disprosio con el ligante macrociclico tetrafenilporfirina

    Energy Technology Data Exchange (ETDEWEB)

    Martinez M, V; Padilla, J; Ramirez, F M

    1992-04-15

    In this report, the results obtained on the synthesis, characterization and study of the chemical behavior of dysprosium complex with the acetylacetone chelating agent (Hacac) and the tetraphenylporphyrin macrocyclic ligand (H{sub 2}TFP) are given. Based on the literature but according to our necessities and interest, the appropriate methodology settled down from the synthesis of prime matters until the obtaining and characterization of the products. The acetyl acetonate complex was obtained of mono hydrated dysprosium [Dy(acac){sub 3}. H{sub 2}0] and trihydrated [Dy(acac){sub 3} .3 H{sub 2}0], the mono tetra phenyl porphyrinate [Dy(TFP)(acac). 2 ac] the double sandwich of the dysprosium porphyrinate [Dy(TFP){sub 2}] and the triple sandwich of the dysprosium porphyrinate [Dy(TFP){sub 3}. 2 TCB] (TCB = trichlorobenzene). Its were characterized by their melting points, solubility, IR, UV, TGA and DTA both first and besides the techniques already mentioned for NMR'H, RPE and Magnetic susceptibility the three last complexes. From the spectroscopic point of view, IR and RPE its suggested the existence of a complex of inverse mixed valence [Dy(TFP){sup 2-} (TFP) {sup 1-}] for the Dy(TFP){sub 2} as a result of the existence of the free radical (TFP' {sup 1-} and that it was not in none of the other porphyrin compounds. In the NMR'H spectra of the compounds were not observed signals in the region from 0 to 10 ppm that which shows that the dysprosium complexes in special those of the porphyrin type are highly paramagnetic and its could be used as displacement reagents, creators of images and contrast agents of great utility in these days in studies of NMR, technique today by today used in medical diagnoses. (Author)

  4. Dysprosium, the balance problem, and wind power technology

    International Nuclear Information System (INIS)

    Elshkaki, Ayman; Graedel, T.E.

    2014-01-01

    Highlights: • We investigate the impacts of the increasing market share of wind power on the demand and supply of REE. • The analysis is carried out using a dynamic material flow and stock model and three scenarios for Dy supply. • The supply of Dy from all deposits will likely lead to an oversupply of the total REEs, Nd, La, Ce and Y. • The supply of Dy from critical REE or Dy rich deposits will likely lead to an oversupply of Ce and Y only. • Large quantities of thorium will be co-produced as a result of Dy demand that needs to be managed carefully. - Abstract: Wind power technology is one of the cleanest electricity generation technologies that are expected to have a substantial share in the future electricity mix. Nonetheless, the expected increase in the market share of wind technology has led to an increasing concern of the availability, production capacity and geographical concentration of the metals required for the technology, especially the rear earth elements (REE) neodymium (Nd) and the far less abundant dysprosium (Dy), and the impacts associated with their production. Moreover, Nd and Dy are coproduced with other rare earth metals mainly from iron, titanium, zirconium, and thorium deposits. Consequently, an increase in the demand for Nd and Dy in wind power technology and in their traditional applications may lead to an increase in the production of the host metals and other companion REE, with possible implications on their supply and demand. In this regard, we have used a dynamic material flow and stock model to study the impacts of the increasing demand for Nd and Dy on the supply and demand of the host metals and other companion REE. In one scenario, when the supply of Dy is covered by all current and expected producing deposits, the increase in the demand for Dy leads to an oversupply of 255 Gg of total REE and an oversupply of the coproduced REE Nd, La, Ce and Y. In the second and third scenarios, however, when the supply of Dy is

  5. Dysprosium-containing layered double hydroxides nanoparticles intercalated with biologically active species as an approach for theranostic systems

    Energy Technology Data Exchange (ETDEWEB)

    Arratia-Quijada, Jenny [Departamento de Ciencias de la Salud, Centro Universitario Tonalá, Universidad de Guadalajara, Av. Nuevo Periférico No. 555, C.P. 48525, Tonalá, Jalisco (Mexico); Sánchez Jiménez, Cecilia [Departamento de Química, Universidad de Guadalajara, Boulevard Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico); Gurinov, Andrey [Research Resources Center for Magnetic Resonance, St. Petersburg State University, Universitetskiy pr. 26, 198504 St. Petersburg (Russian Federation); NMR Core Lab, King Abdullah University of Science and Technology, Thuwal 23955-6900 (Saudi Arabia); Pérez Centeno, Armando; Ceja Andrade, Israel [Departamento de Física, Universidad de Guadalajara, Boulevard Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico); Carbajal Arízaga, Gregorio Guadalupe, E-mail: gregoriocarbajal@yahoo.com.mx [Departamento de Química, Universidad de Guadalajara, Boulevard Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico)

    2016-01-15

    Graphical abstract: - Highlights: • LDH structure including dysprosium was prepared by co-precipitation. • LDH was capable to produce contrast in the T1 mode of MRI. • LDH were intercalated with folate, ibuprofen and gallate ions. - Abstract: A layered double hydroxide structure including dysprosium cations was prepared by co-precipitation. The nanoparticles showed a linear relationship with the reciprocal relaxation spin-lattice (T1) time of water protons which is reflected as contrast in aqueous suspensions analyzed by magnetic resonance imaging. The interlayer space of dysprosium containing LDH was successfully intercalated with folate, ibuprofen and gallate ions, which are key molecules for recognition of some cancer cells and treatment of diseases. The paramagnetic property of the dysprosium-containing LDH detected in this work beside the ability to transport drugs open up the opportunity to design theranostic materials in a single crystal phase with nanometric dimensions.

  6. Dysprosium-containing layered double hydroxides nanoparticles intercalated with biologically active species as an approach for theranostic systems

    International Nuclear Information System (INIS)

    Arratia-Quijada, Jenny; Sánchez Jiménez, Cecilia; Gurinov, Andrey; Pérez Centeno, Armando; Ceja Andrade, Israel; Carbajal Arízaga, Gregorio Guadalupe

    2016-01-01

    Graphical abstract: - Highlights: • LDH structure including dysprosium was prepared by co-precipitation. • LDH was capable to produce contrast in the T1 mode of MRI. • LDH were intercalated with folate, ibuprofen and gallate ions. - Abstract: A layered double hydroxide structure including dysprosium cations was prepared by co-precipitation. The nanoparticles showed a linear relationship with the reciprocal relaxation spin-lattice (T1) time of water protons which is reflected as contrast in aqueous suspensions analyzed by magnetic resonance imaging. The interlayer space of dysprosium containing LDH was successfully intercalated with folate, ibuprofen and gallate ions, which are key molecules for recognition of some cancer cells and treatment of diseases. The paramagnetic property of the dysprosium-containing LDH detected in this work beside the ability to transport drugs open up the opportunity to design theranostic materials in a single crystal phase with nanometric dimensions.

  7. 12 CFR 308.173 - Prevailing party.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Prevailing party. 308.173 Section 308.173 Banks....173 Prevailing party. (a) General rule. An eligible applicant who, following an adversary adjudication has gained victory on the merits in the proceeding is a “prevailing party”. An eligible applicant may...

  8. 49 CFR 173.323 - Ethylene oxide.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Ethylene oxide. 173.323 Section 173.323... SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.323 Ethylene oxide. (a) For packaging ethylene oxide in non-bulk packagings, silver mercury or any of its alloys or copper may not be used in any...

  9. 21 CFR 173.230 - Ethylene dichloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Ethylene dichloride. 173.230 Section 173.230 Food... Solvents, Lubricants, Release Agents and Related Substances § 173.230 Ethylene dichloride. A tolerance of 30 parts per million is established for ethylene dichloride in spice oleoresins when present therein...

  10. 49 CFR 173.443 - Contamination control.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Contamination control. 173.443 Section 173.443... SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.443 Contamination control. (a) The level of non-fixed (removable) radioactive contamination on the external surfaces of each package offered for...

  11. 21 CFR 173.290 - Trichloroethylene.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Trichloroethylene. 173.290 Section 173.290 Food and..., Lubricants, Release Agents and Related Substances § 173.290 Trichloroethylene. Tolerances are established for residues of trichloroethylene resulting from its use as a solvent in the manufacture of foods as follows...

  12. 21 CFR 173.160 - Candida guilliermondii.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Candida guilliermondii. 173.160 Section 173.160... CONSUMPTION Enzyme Preparations and Microorganisms § 173.160 Candida guilliermondii. The food additive Candida... the following conditions: (a) The food additive is the enzyme system of the viable organism Candida...

  13. 21 CFR 173.255 - Methylene chloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Methylene chloride. 173.255 Section 173.255 Food... Solvents, Lubricants, Release Agents and Related Substances § 173.255 Methylene chloride. Methylene chloride may be present in food under the following conditions: (a) In spice oleoresins as a residue from...

  14. 21 CFR 173.375 - Cetylpyridinium chloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Cetylpyridinium chloride. 173.375 Section 173.375... CONSUMPTION Specific Usage Additives § 173.375 Cetylpyridinium chloride. Cetylpyridinium chloride (CAS Reg. No....1666 of this chapter, at a concentration of 1.5 times that of cetylpyridinium chloride. (c) The...

  15. 49 CFR 173.322 - Ethyl chloride.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Ethyl chloride. 173.322 Section 173.322 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY... SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.322 Ethyl chloride. Ethyl chloride must be...

  16. 21 CFR 173.210 - Acetone.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Acetone. 173.210 Section 173.210 Food and Drugs..., Lubricants, Release Agents and Related Substances § 173.210 Acetone. A tolerance of 30 parts per million is established for acetone in spice oleoresins when present therein as a residue from the extraction of spice. ...

  17. 19 CFR 173.0 - Scope.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Scope. 173.0 Section 173.0 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) ADMINISTRATIVE REVIEW IN GENERAL § 173.0 Scope. This part deals with the general authority of review, the...

  18. 22 CFR 17.3 - Fault.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Fault. 17.3 Section 17.3 Foreign Relations...) § 17.3 Fault. A recipient of an overpayment is without fault if he or she performed no act of... agency may have been at fault in initiating an overpayment will not necessarily relieve the individual...

  19. 33 CFR 173.17 - Reciprocity.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Reciprocity. 173.17 Section 173.17 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) BOATING SAFETY VESSEL NUMBERING AND CASUALTY AND ACCIDENT REPORTING Numbering § 173.17 Reciprocity. (a) Section...

  20. Dysprosium-Catalyzed Growth of Single-Walled Carbon Nanotube Arrays on Substrates

    Directory of Open Access Journals (Sweden)

    Qian Yong

    2009-01-01

    Full Text Available Abstract In this letter, we report that dysprosium is an effective catalyst for single-walled carbon nanotubes (SWNTs growth via a chemical vapor deposition (CVD process for the first time. Horizontally superlong well-oriented SWNT arrays on SiO2/Si wafer can be fabricated by EtOH-CVD under suitable conditions. The structure and properties are characterized by scanning electron microscopy, transition electron microscopy, Raman spectroscopy and atomic force microscopy. The results show that the SWNTs from dysprosium have better structural uniformity and better conductivity with fewer defects. This rare earth metal provides not only an alternative catalyst for SWNTs growth, but also a possible method to generate high percentage of superlong semiconducting SWNT arrays for various applications of nanoelectronic device.

  1. Sandwich-type tetrakis(phthalocyaninato) dysprosium-cadmium quadruple-decker SMM.

    Science.gov (United States)

    Wang, Hailong; Qian, Kang; Wang, Kang; Bian, Yongzhong; Jiang, Jianzhuang; Gao, Song

    2011-09-14

    Homoleptic tetrakis[2,3,9,10,16,17,23,24-octa(butyloxy)phthalocyaninato] dysprosium-cadmium quadruple-decker complex 1 was isolated in relatively good yield of 43% from a simple one-pot reaction. This compound represents the first sandwich-type tetrakis(phthalocyaninato) rare earth-cadmium quadruple-decker SMM that has been structurally characterized. This journal is © The Royal Society of Chemistry 2011

  2. {Delta}I = 2 energy staggering in normal deformed dysprosium nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Riley, M.A.; Brown, T.B.; Archer, D.E. [Florida State Univ., Tallahassee, FL (United States)] [and others

    1996-12-31

    Very high spin states (I{ge}50{Dirac_h}) have been observed in {sup 155,156,157}Dy. The long regular band sequences, free from sharp backbending effects, observed in these dysprosium nuclei offer the possibility of investigating the occurence of any {Delta}I = 2 staggering in normal deformed nuclei. Employing the same analysis techniques as used in superdeformed nuclei, certain bands do indeed demonstrate an apparent staggering and this is discussed.

  3. Analysis of the x-ray spectrum emitted by laser-produced plasma of dysprosium

    International Nuclear Information System (INIS)

    Marcus, Gilad; Louzon, Einat; Henis, Zohar; Maman, Shlomo; Mandelbaum, Pinchas

    2007-01-01

    A detailed analysis of the x-ray spectrum (5-10.2 A ring ) emitted by laser-produced plasma of dysprosium (Dy) is given using ab initio calculations with the HULLAC relativistic code and isoelectronic trends. Resonance 3d-4p, 3d-nf (n=4 to 7), 3p-4s, and 3p-4d transitions of Ni I-like Dy XXXIX and neighboring ion satellite transitions (from Dy XXXIV to Dy XL) are identified

  4. Phosphor Dysprosium-Doped Layered Double Hydroxides Exchanged with Different Organic Functional Groups

    Directory of Open Access Journals (Sweden)

    David Ricardo Martínez Vargas

    2013-01-01

    Full Text Available The layers of a Zn/Al layered double hydroxide (LDH were doped with Dy3+ cations. Among some compositions, the Zn2+ : Al3+ : Dy3+ molar ratio equal to 30 : 9 : 1 presented a single crystalline phase. Organic anions with carboxylic, amino, sulfate, or phosphate functional groups were intercalated as single layers between LDH layers as confirmed by X-ray diffraction and infrared spectroscopy. Photoluminescence spectra of the nitrate intercalated LDH showed a wide emission band with strong intensity in the yellow region (around 574 nm, originated due to symmetry distortion of the octahedral coordination in dysprosium centers. Moreover, a broad red band emission was also detected apparently due to the presence of zinc oxide. The distorted symmetry of the dysprosium coordination environment, also confirmed by X-ray photoelectron spectroscopy analysis, was modified after the intercalation with phenyl phosphonate (PP, aspartate (Asp, adipate (Adip, and serinate (Ser anions; the emission as measured from PL spectra of these LDH was more intense in the blue region (ca. 486 nm, thus indicating an increase in symmetry of dysprosium octahedrons. The red emission band from zinc oxide kept the same intensity after intercalation of dodecyl sulfate (DDS. An additional emission of unknown origin at λ = 767 nm was present in all LDHs.

  5. Synovectomy of the rheumatoid knee using intra-articular injection of dysprosium-165-ferric hydroxide macroaggregates

    International Nuclear Information System (INIS)

    Sledge, C.B.; Zuckerman, J.D.; Shortkroff, S.; Zalutsky, M.R.; Venkatesan, P.; Snyder, M.A.; Barrett, W.P.

    1987-01-01

    One hundred and eleven patients who had seropositive rheumatoid arthritis and persistent synovitis of the knee were treated with intra-articular injection of 270 millicuries of dysprosium-165 bound to ferric hydroxide macroaggregates. A two-year follow-up was available for fifty-nine of the treated knees. Thirty-nine had a good result; nine, a fair result; and eleven, a poor result. Of the twenty-five knees that had Stage-I radiographic changes, nineteen had a good result. Of the thirty-four knees that had Stage-II radiographic changes, twenty showed a good result. Systemic spread of the radioactivity from the injected joint was minimum. The mean whole-body dose was calculated to be 0.3 rad and that to the liver twenty-four hours after injection, 3.2 rads. The results indicated that dysprosium-165-ferric hydroxide macroaggregate is an effective agent for performing radiation synovectomy, particularly in knees that have Stage-I radiographic changes. Because of the minimum rate of systemic spread of the dysprosium-165, it offers a definite advantage over agents that previously have been used

  6. Development and mastering of production of dysprosium hafnate as absorbing material for control rods of promising thermal neutron reactors

    International Nuclear Information System (INIS)

    Zakharov, A.V.; Risovany, V.D.; Muraleva, E.M.; Sokolov, V.F.

    2011-01-01

    The main advantages of dysprosium hafnate as an absorbing material for LWR control rods are the following: -) unlimited radiation resistance; - two absorbing components, Dy and Hf, increasing physical efficiency of the material compared to Dy 2 O 3 -TiO 2 and alloy 80% Ag - 15% In - 5% Cd; -) variability of physical efficiency by changing a composition, but maintaining other performance characteristics of the material; -) high process-ability due to the absence of phase transients and single-phase structure (solid solution); -) production of high density pellets. Lab-scale mastering of dysprosium hafnate pellets production showed a possibility of material synthesis using a solid-phase method, as well as of dysprosium hafnate pellets production by cold pressing and subsequent sintering. Within a whole range of examined compositions (23 mol% - 75 mol% Dy 2 O 3 ), a single-phase material with a highly radiation resistant fluorite-like structure was produced. Experiments on cold pressing and sintering of pellets confirmed a possibility of producing high quality dysprosium hafnate pellets from synthesized powder. A pilot batch of dysprosium hafnate pellets with standard sizes was produced. The standard sizes corresponded to the absorbing elements of the WWER-1000 control rods and met the main requirements to the absorbing element columns. The pilot batch size was approximately 6 kg. Acceptance testing of the pilot batch of dysprosium hafnate pellets was conducted, fulfillment of the requirements of technical conditions was checked and preirradiation properties of the pellets were examined. High quality of the produced pellets was confirmed, thus, demonstrating a real possibility of producing large batches of the dysprosium hafnate pellets. The next step is the production of test absorbing elements and cluster assemblies for the WWER-1000 control rods with their further installation for pilot operation at one of the Russian nuclear power plants

  7. Systematic study on surface and magnetostructural changes in Mn-substituted dysprosium ferrite by hydrothermal method

    Energy Technology Data Exchange (ETDEWEB)

    Rekha, G. [Department of Physics, College of Engineering Guindy, Anna University, Sardar Patel Road, Chennai 600025 (India); Tholkappiyan, R. [Department of Physics, College of Engineering Guindy, Anna University, Sardar Patel Road, Chennai 600025 (India); Department of Physics, College of Science, UAE University, Al-Ain 15551 (United Arab Emirates); Vishista, K., E-mail: raovishista@gmail.com [Department of Physics, College of Engineering Guindy, Anna University, Sardar Patel Road, Chennai 600025 (India); Hamed, Fathalla [Department of Physics, College of Science, UAE University, Al-Ain 15551 (United Arab Emirates)

    2016-11-01

    Highlights: • Garnet type Dy{sub 3}Fe{sub 5-x}Mn{sub x}O{sub 12} (x = 0–0.06) nanoparticles of 88.4–86.8 nm were synthesized by hydrothermal method. • The Dy, Mn, Fe and O elements in the ferrites were confirmed from XPS. • The multiple oxidation states of Fe and Mn ions, bonding energy and cationic distributions of the samples were examined by XPS. • The magnetic property shows ferromagnetic behavior from VSM technique. • The results from these studies are correlated with respect to Mn dopant. - Abstract: Dysprosium iron garnets are of scientific importance because of the wide range of magnetic properties that can be obtained in substituting dysprosium by a rare earth metal. In the present work, the effect of Mn substitution on magnetostructural changes in dysprosium ferrite nanoparticles is studied. Highly crystalline pure and Mn doped dysprosium ferrite nanoparticles were synthesized by hydrothermal method. The samples were calcined at 1100 °C for 2 h in air atmosphere which is followed by characterization using XRD, FT-IR analysis, SEM, XPS and VSM. The average crystallite size of synthesized samples were calculated by X-ray diffraction falls in the range of 88.4–86.8 nm and was found to be in cubic garnet structure. For further investigation of the structure and corresponding changes in the tetrahedral and octahedral stretching vibrational bonds, FT-IR was used. The synthesized samples consist of multiple oxidation (Fe{sup 3+} and Fe{sup 2+}) states for Fe ions and (Mn{sup 3+} and Mn{sup 2+}) Mn ions analyzed in three ways of Fe 2p and Mn 2p spectra from the XPS analysis. With respect to Mn dopant in Dy{sub 3}Fe{sub 5}O{sub 12}, the cationic distributions of elements were discussed from high resolution XPS spectra by peak position and shift, area, width. To find out the porous/void surface morphology of the sample, scanning electron microscopy was used. From XPS analysis, the presence of elements (Dy, Mn, Fe and O) and their composition in the

  8. Synthesis, structural characterization and in vitro testing of dysprosium containing silica particles as potential MRI contrast enhancing agents

    Energy Technology Data Exchange (ETDEWEB)

    Chiriac, L.B.; Trandafir, D.L. [Faculty of Physics & National Magnetic Resonance Center, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Interdisciplinary Research Institute on Bio-Nano-Sciences & Faculty of Physics, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Turcu, R.V.F. [Faculty of Physics & National Magnetic Resonance Center, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Todea, M. [Interdisciplinary Research Institute on Bio-Nano-Sciences & Faculty of Physics, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Simon, S., E-mail: simons@phys.ubbcluj.ro [Faculty of Physics & National Magnetic Resonance Center, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Interdisciplinary Research Institute on Bio-Nano-Sciences & Faculty of Physics, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania)

    2016-11-01

    Highlights: • Dysprosium containing silica microparticles obtained by freeze and spray drying. • Higher structural units interconnection achieved in freeze vs. spray dried samples. • Dy occurance on the outermost layer of the microparticles evidenced by XPS. • Enhanced MRI contrast observed for freeze dried samples with 5% mol Dy{sub 2}O{sub 3}. - Abstract: The work is focused on synthesis and structural characterization of novel dysprosium-doped silica particles which could be considered as MRI contrast agents. Sol-gel derived silica rich particles obtained via freeze-drying and spray-drying processing methods were structurally characterized by XRD, {sup 29}Si MAS-NMR and XPS methods. The occurrence of dysprosium on the outermost layer of dysprosium containing silica particles was investigated by XPS analysis. The MRI contrast agent characteristics have been tested using RARE-T{sub 1} and RARE-T{sub 2} protocols. The contrast of MRI images delivered by the investigated samples was correlated with their local structure. Dysprosium disposal on microparticles with surface structure characterised by decreased connectivity of the silicate network units favours dark T{sub 2}-weighted MRI contrast properties.

  9. Synthesis, structural characterization and in vitro testing of dysprosium containing silica particles as potential MRI contrast enhancing agents

    International Nuclear Information System (INIS)

    Chiriac, L.B.; Trandafir, D.L.; Turcu, R.V.F.; Todea, M.; Simon, S.

    2016-01-01

    Highlights: • Dysprosium containing silica microparticles obtained by freeze and spray drying. • Higher structural units interconnection achieved in freeze vs. spray dried samples. • Dy occurance on the outermost layer of the microparticles evidenced by XPS. • Enhanced MRI contrast observed for freeze dried samples with 5% mol Dy_2O_3. - Abstract: The work is focused on synthesis and structural characterization of novel dysprosium-doped silica particles which could be considered as MRI contrast agents. Sol-gel derived silica rich particles obtained via freeze-drying and spray-drying processing methods were structurally characterized by XRD, "2"9Si MAS-NMR and XPS methods. The occurrence of dysprosium on the outermost layer of dysprosium containing silica particles was investigated by XPS analysis. The MRI contrast agent characteristics have been tested using RARE-T_1 and RARE-T_2 protocols. The contrast of MRI images delivered by the investigated samples was correlated with their local structure. Dysprosium disposal on microparticles with surface structure characterised by decreased connectivity of the silicate network units favours dark T_2-weighted MRI contrast properties.

  10. Synthesis, characterization and sup 23 Na NMR shift studies of a novel dysprosium(III) crown ether texaphyrin

    Energy Technology Data Exchange (ETDEWEB)

    Sessler, J.L.; Mody, T.D. (Texas Univ., Austin, TX (United States). Dept. of Chemistry); Ramasamy, R.; Sherry, A.D. (Texas Univ., Dallas, TX (United States))

    1992-05-01

    The synthesis and characterization of a novel dysprosium(III) crown-ether texaphyrin (Dy(BCTxp)){sup 2+} is reported. This complex was designed to serve as a ditopic chelate for both dysprosium(III) and sodium cations. {sup 23}Sodium NMR spectroscopic studies indicates that titration of Na{sup +} with increasing concentrations of (Dy(BCTxp)){sup 2+} results in a shift toward higher frequency and gives a net hyperfine shift of 0.86 ppm. Sodium complexation is taking place into the crown subunit in (Dy(BCTxp)){sup 2+} and the degree of complexation is not reduced substantially by the positive charge on the dysprosium(III) portion of this binucleating system.

  11. 21 CFR 211.173 - Laboratory animals.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Laboratory animals. 211.173 Section 211.173 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS... Laboratory animals. Animals used in testing components, in-process materials, or drug products for compliance...

  12. 46 CFR 173.010 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... VESSEL USE Lifting § 173.010 Definitions. As used in this part— (a) Hook load means the weight of the object lifted by the crane. (b) Crane radius means the distance illustrated in Figure 173.010. EC01MR91...

  13. 21 CFR 173.240 - Isopropyl alcohol.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Isopropyl alcohol. 173.240 Section 173.240 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Solvents...

  14. 40 CFR 173.9 - Judicial review.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Judicial review. 173.9 Section 173.9 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES GOVERNING... Judicial review. The State may appeal an order rescinding, in whole or in part, its primary enforcement...

  15. 21 CFR 173.355 - Dichlorodifluoromethane.

    Science.gov (United States)

    2010-04-01

    ... with good manufacturing practice, as a direct-contact freezing agent for foods. (c) To assure safe use... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Dichlorodifluoromethane. 173.355 Section 173.355 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD...

  16. 7 CFR 1150.173 - Confidential treatment.

    Science.gov (United States)

    2010-01-01

    ... reports of the number of persons subject to this subpart or statistical data collected therefrom, which... 7 Agriculture 9 2010-01-01 2009-01-01 true Confidential treatment. 1150.173 Section 1150.173 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing...

  17. 49 CFR 173.174 - Refrigerating machines.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Refrigerating machines. 173.174 Section 173.174 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY... Refrigerating machines. A refrigerating machine assembled for shipment and containing 7 kg (15 pounds) or less...

  18. 49 CFR 173.159 - Batteries, wet.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Batteries, wet. 173.159 Section 173.159... Batteries, wet. (a) Electric storage batteries, containing electrolyte acid or alkaline corrosive battery fluid (wet batteries), may not be packed with other materials except as provided in paragraphs (g) and...

  19. 49 CFR 173.163 - Hydrogen fluoride.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Hydrogen fluoride. 173.163 Section 173.163... Hydrogen fluoride. (a) Hydrogen fluoride (hydrofluoric acid, anhydrous) must be packaged as follows: (1) In... filling ratio of 0.84. (b) A cylinder removed from hydrogen fluoride service must be condemned in...

  20. 21 CFR 173.400 - Dimethyldialkylammonium chloride.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Dimethyldialkylammonium chloride. 173.400 Section... HUMAN CONSUMPTION Specific Usage Additives § 173.400 Dimethyldialkylammonium chloride. Dimethyldialkylammonium chloride may be safely used in food in accordance with the following prescribed conditions: (a...

  1. 21 CFR 173.55 - Polyvinylpyrrolidone.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Polyvinylpyrrolidone. 173.55 Section 173.55 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR... a residual level not to exceed 40 parts per million. Wine As a clarifying agent, at a residual level...

  2. Dysprosium disilicide nanostructures on silicon(001) studied by scanning tunneling microscopy and transmission electron microscopy

    International Nuclear Information System (INIS)

    Ye Gangfeng; Nogami, Jun; Crimp, Martin A.

    2006-01-01

    The microstructure of self-assembled dysprosium silicide nanostructures on silicon(001) has been studied by scanning tunneling microscopy and transmission electron microscopy. The studies focused on nanostructures that involve multiple atomic layers of the silicide. Cross-sectional high resolution transmission electron microscopy images and fast Fourier transform analysis showed that both hexagonal and orthorhombic/tetragonal silicide phases were present. Both the magnitude and the anisotropy of lattice mismatch between the silicide and the substrate play roles in the morphology and epitaxial growth of the nanostructures formed

  3. Major conformations of the ligand skeleton of a tetranuclear dysprosium (3) tartrate complex

    International Nuclear Information System (INIS)

    Chevela, V.V.; Semenov, V.Eh.; Bezryadin, S.G.; Savitskaya, T.V.; Kolesar, I.R.; Matveev, S.N.; Shamov, G.A.

    1999-01-01

    By the molecular mechanics method (MIND program, stoichiometry was studied and basic conformations of ligand frame of dysprosium (3) tetranuclear complex bis-(d-tartrato) bis-(l-tartrato)tetradysprosiate (3) - anion Dy 4 (d-L) 2 (l-L) 2 4- (1) (d-H 4 L = d-tartaric acid, l-H 4 L = l - tartaric acid) were revealed. It is shown that theoretically calculated mP τ constants for so-called compact conformations of 1, where tartratoligands are in gosh conformation, agree with experimentally obtained constant of paramagnetic birefringence (mP e ) of complex 1 [ru

  4. Incinerator carryover tests with dysprosium as a stand-in for plutonium

    International Nuclear Information System (INIS)

    Hooker, R.L.

    1981-11-01

    A full-scale (5 kg/h) incinerator is being tested with nonradioactive feed materials which simulate SRP-generator combustible transuranic wastes. The incinerator is two-stage and is designed to provide relatively quiescent conditions in the primary chamber where the ash is formed. This feature should minimize entrainment of Pu-bearing particles into the off-gas system. A series of runs have been completed in which incinerator feed was spiked with dysprosium to simulate Pu. Carryover of Dy into the off-gas system was found to be low (about 1/4%). 4 figures, 3 tables

  5. Incorporation of dysprosium ions into PbTiO3 ferroelectric ceramic system

    Directory of Open Access Journals (Sweden)

    A. Peláiz-Barranco

    2015-03-01

    Full Text Available A structural analysis concerning the incorporation of dysprosium into A- and/or B-sites of the lead titanate is shown. The two "boundary" refinements are presented, i.e., Dy2+ substitutes for Pb2+ (Dy3+ substitutes for Ti4+ and Dy3+ substitutes for Pb2+ (Dy3+ substitutes for Ti4+. The results offer quantitative information about the incorporation into both crystallographic sites. The increase of Dy3+ fraction into B-site provides the increase of the Ti4+ atomic displacement along the [001] direction and the tetragonal distortion.

  6. Dosimetric properties of dysprosium doped calcium magnesium borate glass subjected to Co-60 gamma ray

    Energy Technology Data Exchange (ETDEWEB)

    Omar, R. S., E-mail: ratnasuffhiyanni@gmail.com; Wagiran, H., E-mail: husin@utm.my; Saeed, M. A. [Department of Physics, Faculty of Science, Universiti Teknologi Malaysia, 81310 Johor Bahru (Malaysia)

    2016-01-22

    Thermoluminescence (TL) dosimetric properties of dysprosium doped calcium magnesium borate (CMB:Dy) glass are presented. This study is deemed to understand the application of calcium as the modifier in magnesium borate glass with the presence of dysprosium as the activator to be performed as TL dosimeter (TLD). The study provides fundamental knowledge of a glass system that may lead to perform new TL glass dosimetry application in future research. Calcium magnesium borate glass systems of (70-y) B{sub 2}O{sub 3} − 20 CaO – 10 MgO-(y) Dy{sub 2}O{sub 3} with 0.05  mol % ≤ y ≤ 0.7  mol % of dyprosium were prepared by melt-quenching technique. The amorphous structure and TL properties of the prepared samples were determined using powder X-ray diffraction (XRD) and TL reader; model Harshaw 4500 respectively. The samples were irradiated to Co-60 gamma source at a dose of 50 Gy. Dosimetric properties such as annealing procedure, time temperature profile (TTP) setting, optimization of Dy{sub 2}O{sub 3} concentration of 0.5 mol % were determined for thermoluminescence dosimeter (TLD) reader used.

  7. Treatment of rheumatoid synovitis of the knee with intraarticular injection of dysprosium 165-ferric hydroxide macroaggregates

    International Nuclear Information System (INIS)

    Sledge, C.B.; Zuckerman, J.D.; Zalutsky, M.R.

    1986-01-01

    One hundred eight knees of 93 patients with seropositive rheumatoid arthritis and persistent synovitis of the knee were treated with an intraarticular injection of 270 mCi of dysprosium 165 bound to ferric hydroxide macroaggregate. Leakage of radioactivity from the injected joint was minimal. Mean leakage to the venous blood 3 hours after injection was 0.11% of the injected dose; this corresponds to a mean whole body dose of 0.2 rads. Mean leakage to the liver 24 hours after injection was 0.64% of the injected dose; this corresponds to a mean liver dose of 3.2 rads. In 7 additional patients examined, there was negligible or near negligible activity found in the draining inguinal lymph nodes. One-year followup was possible for 74 knees (63 patients). Sixty-one percent of the knees had good results, 23% had fair results, and 16% had poor results. There was a direct correlation between the radiographic stage and response to treatment. In knees with stage I radiographic changes, 72% showed good results; 93% showed improvement. In knees with stage II changes, 59% showed good results; 81% showed improvement. These preliminary results indicate that dysprosium 165-ferric hydroxide macroaggregate is an effective agent for radiation synovectomy. The low leakage rates observed offer a definite advantage over agents previously used

  8. Dual responsive dysprosium-doped hydroxyapatite particles and toxicity reduction after functionalization with folic and glucuronic acids

    Energy Technology Data Exchange (ETDEWEB)

    Sánchez Lafarga, Ana Karen; Pacheco Moisés, Fermín P. [Departamento de Química, Universidad de Guadalajara, Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico); Gurinov, Andrey [Research Resources Center for Magnetic Resonance, Saint Petersburg State University, Universitetskij pr. 26, 198504 St. Petersburg (Russian Federation); Ortiz, Genaro Gabriel [Laboratorio Desarrollo-Envejecimiento, Enfermedades Neurodegenerativas, Centro de Investigación Biomédica de Occidente (CIBO), Instituto Mexicano de Seguro Social (IMSS), Guadalajara, Jalisco (Mexico); Carbajal Arízaga, Gregorio Guadalupe, E-mail: gregoriocarbajal@yahoo.com.mx [Departamento de Química, Universidad de Guadalajara, Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico)

    2015-03-01

    The development of probes for biomedical applications demands materials with low toxicity levels besides fluorescence or magnetic properties to be detected by confocal microscopes or MRI resonators. Several drug delivery systems or other biomedical materials prepared with hydroxyapatite have been proposed, however, toxicity effects might arise when the size of particles is nanometric. In this study, hydroxyapatite functionalized with glucuronic or folic acids presented lower oxidative stress, measured from lipoperoxides and nitric oxide indicators in rats than pure hydroxyapatite. In separated experiments, hydroxyapatite was doped with dysprosium cations by coprecipitation producing a single crystal phase with fluorescent properties easily visualized by confocal microscopy when excited at 488 nm. These particles also presented the ability to modify the proton relaxation time in T1 maps collected by magnetic resonance imaging. These modified hydroxyapatite nanoparticles could be candidates to design bimodal probes with low toxicity. - Highlights: • Hydroxyapatite functionalized with glucuronic acid reduced oxidative stress in rats. • Functionalization with folic acid reduced oxidative stress in rats. • Dysprosium doping does not affect the crystalline structure of hydroxyapatite. • Dysprosium doped particles are visible in fluorescent microscope. • Dysprosium doped particles act as MRI contrast agents.

  9. Kinetic stability of the dysprosium(3) complex with tetraazaporphine in acetic acid-water and acetic acid-methanol mixtures

    International Nuclear Information System (INIS)

    Khelevina, O.G.; Vojnov, A.A.

    1999-01-01

    Water-soluble dysprosium tetraazaporphine with acetylacetonate-ion as extraligand is synthesized for the first time. Its kinetic stability in acetic acid solutions is investigated. It is shown that the complex is dissociated with formation of free tetraazaporphine. Kinetic parameters of dissociation reaction are determined [ru

  10. Dual responsive dysprosium-doped hydroxyapatite particles and toxicity reduction after functionalization with folic and glucuronic acids

    International Nuclear Information System (INIS)

    Sánchez Lafarga, Ana Karen; Pacheco Moisés, Fermín P.; Gurinov, Andrey; Ortiz, Genaro Gabriel; Carbajal Arízaga, Gregorio Guadalupe

    2015-01-01

    The development of probes for biomedical applications demands materials with low toxicity levels besides fluorescence or magnetic properties to be detected by confocal microscopes or MRI resonators. Several drug delivery systems or other biomedical materials prepared with hydroxyapatite have been proposed, however, toxicity effects might arise when the size of particles is nanometric. In this study, hydroxyapatite functionalized with glucuronic or folic acids presented lower oxidative stress, measured from lipoperoxides and nitric oxide indicators in rats than pure hydroxyapatite. In separated experiments, hydroxyapatite was doped with dysprosium cations by coprecipitation producing a single crystal phase with fluorescent properties easily visualized by confocal microscopy when excited at 488 nm. These particles also presented the ability to modify the proton relaxation time in T1 maps collected by magnetic resonance imaging. These modified hydroxyapatite nanoparticles could be candidates to design bimodal probes with low toxicity. - Highlights: • Hydroxyapatite functionalized with glucuronic acid reduced oxidative stress in rats. • Functionalization with folic acid reduced oxidative stress in rats. • Dysprosium doping does not affect the crystalline structure of hydroxyapatite. • Dysprosium doped particles are visible in fluorescent microscope. • Dysprosium doped particles act as MRI contrast agents

  11. 49 CFR 173.173 - Paint, paint-related material, adhesives, ink and resins.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Paint, paint-related material, adhesives, ink and... Than Class 1 and Class 7 § 173.173 Paint, paint-related material, adhesives, ink and resins. (a) When..., paint-related material, adhesives, ink and resins must be packaged as follows: (1) As prescribed in...

  12. Watt-level dysprosium fiber laser at 315 μm with 73% slope efficiency

    Science.gov (United States)

    Woodward, R. I.; Majewski, M. R.; Bharathan, G.; Hudson, D. D.; Fuerbach, A.; Jackson, S. D.

    2018-04-01

    Rare-earth-doped fiber lasers are emerging as promising high-power mid-infrared sources for the 2.6-3.0 {\\mu}m and 3.3-3.8 {\\mu}m regions based on erbium and holmium ions. The intermediate wavelength range, however, remains vastly underserved, despite prospects for important manufacturing and defense applications. Here, we demonstrate the potential of dysprosium-doped fiber to solve this problem, with a simple in-band pumped grating-stabilized linear cavity generating up to 1.06 W at 3.15 {\\mu}m. A slope efficiency of 73% with respect to launched power (77% relative to absorbed power) is achieved: the highest value for any mid-infrared fiber laser to date, to the best of our knowledge. Opportunities for further power and efficiency scaling are also discussed.

  13. Proton NMR relaxivity of blood samples in the presence of some gadolinium and dysprosium compounds

    International Nuclear Information System (INIS)

    Coroiu, I.; Darabont, Al.; Bogdan, M.

    1999-01-01

    The use of some new compounds in MRI tissue and blood characterisation based on nuclear spin relaxation time measurements cannot be sustained until the molecular sources of these variations are understood. Tissues and blood are complex molecular systems with complex NMR properties. A better comprehension of the molecular basis of relaxation offers the possibility to predict the changes expected for a given pathology. The purpose of this contribution is to evidence the different relaxation characteristics of some gadolinium and dysprosium compounds in the presence and absence of the blood and to give a possible explanation about the molecular processes that cause occurrence of changes. Some gadolinium and dysprosium compounds such as: Gd-CIT (gadolinium citrate), Dy-DTPA (DTPA-diethylenetriamine pentaacetic acid), iron oxide - gadolinium oxide (or dysprosium oxide)- dextran complexes were prepared. The longitudinal T 1 -1 and transverse T 2 -1 'relaxation rates' measurements have been carried out as a function of molar concentrations. All measurements have been made at room temperature (about 25 deg.C) and the proton Larmor frequency ν o = 90 MHz. The pulsed NMR spectrometer utilised was a commercial Bruker SXP4/100 spectrometer. Transverse relaxation rate measurements have been made using the Carr-Purcell method, while longitudinal relaxation rate measurements using the inversion recovery pulse sequence, 180 angle-τ-90 angle. The accuracy was about 2-3% for the longitudinal relaxation rates and about 5-7% for the transverse relaxation rates. R 1 and R 2 relaxivities, in mM -1 s -1 were determined from the least square determination of the slopes of plots 1/T 1,2 versus compound molar concentration, using at least five independent measurements at several concentrations between 0 and 2 mM. Increased R 2 relaxivity observed for dysprosium compounds in the blood presence can be explained by PRE effect. The largest gain in R 2 relaxivity seems to imply a noncovalent

  14. Investigation on rare earth magnets recycling by organophosphoric extractant encapsulated polymeric beads for separation of dysprosium

    International Nuclear Information System (INIS)

    Yadav, Kartikey K.; Singh, D.K.; Kain, V.

    2017-01-01

    Rare earth elements (REEs) are a basic requirement of the electronics and new industries including green technology. In the present work an organophosphoric extractant encapsulating polyethersulfone (PES) beads has been developed and employed for dysprosium (Dy) separation from aqueous stream. Polyethersulfonic beads encapsulating PC88A were prepared by phase inversion method. During the synthesis of the beads, preparatory parameters were also optimized to obtain best suited beads which were subsequently characterized for their encapsulation capacity and micro structural investigation. The results obtained in the present investigation suggested that PES/PVAJPC88A composite beads could be used for separation of rare earths from aqueous medium obtained from the solubilisation of magnetic scrap materials

  15. Design and validation of a photon insensitive multidetector neutron spectrometer based on Dysprosium activation foils

    International Nuclear Information System (INIS)

    Gómez-Ros, J.M.; Bedogni, R.; Palermo, I.; Esposito, A.; Delgado, A.; Angelone, M.; Pillon, M.

    2011-01-01

    This communication describes a photon insensitive passive neutron spectrometer consisting of Dysprosium (Dy) activation foils located along three perpendicular axes within a single moderating polyethylene sphere. The Monte Carlo code MCNPX 2.6 was used to optimize the spatial arrangement of the detectors and to derive the spectrometer response matrix. Nearly isotropic response in terms of neutron fluence for energies up to 20 MeV was obtained by combining the readings of the detectors located at the same radius value. The spectrometer was calibrated using a previously characterized 14 MeV neutron beam produced in the ENEA Frascati Neutron Generator (FNG). The overall uncertainty of the spectrometer response matrix at 14 MeV, assessed on the basis of this experiment, was ±3%.

  16. Influence of modifiers on the separation of dysprosium from neodymium using organophosphorus acid derivates

    Energy Technology Data Exchange (ETDEWEB)

    Elwert, Tobias; Schwarz, Sabrina; Goldmann, Daniel [TU Clausthal, Clausthal-Zellerfeld (Germany). Lehrstuhl fuer Rohstoffaufbereitung und Recycling

    2016-01-15

    The aim of this study was to investigate the applicability of three organophosphorus acid derivates (D2EHPA, EHEHPA and Cyanex 572) for the separation of terbium and dysprosium from praseodymium and neodymium from NdFeB magnets in chloride solution. A special focus was put on the effect of phase modifiers. The investigations revealed that all extractants show in general a similar extraction behavior but the extraction is shifted to higher pH values in the order D2EHPA < EHEHPA < Cyanex 572. Therefore, and due to higher realizable loadings, EHEHPA and Cyanex 572 are more suitable for the investigated separation problem than D2EHPA. Whereas EHEHPA requires 1-decanol as phase modifier, Cyanex 572 can be employed without modifier addition.

  17. Automated spectrofluorimetric determinations of terbium and dysprosium in rare earth mixtures

    Energy Technology Data Exchange (ETDEWEB)

    Lyle, S.J.; Za' tar, N. (Kent Univ., Canterbury (UK))

    1983-12-01

    Several methods involving the use of water-soluble binary and ternary complexes have been proposed for the spectrofluorimetric determination based on terbium(III) emission at 545 nm. These are terbium(III) with (A) ethylenediamine-N,N'-bis(o-hydroxyphenylacetic acid), (B) o-hydroxyphenyliminodiacetic acid, (C) EDTA + 5-sulphosalicylic acid, (D) EDTA + 1,2-dihydroxybenzene-3,5-disulphonic acid disodium salt (Tiron), and (E) iminodiacetic acid (IDA) + Tiron. Two of the reagent mixtures (D and E) can also be used for the fluorimetric determination of dysprosium(III) at 582 nm. A comparison has been made of these methods in order to select the most satisfactory procedure with respect to selectivity, sensitivity and suitability for adaption to automatic operation. Results are given and discussed.

  18. Spectrographic determination of dysprosium in doped crystals of calcium sulfate used for dosimetric material

    International Nuclear Information System (INIS)

    Grigoletto, T.; Lordello, A.R.

    1984-01-01

    A spectrographic method is described for the quantitative determination of dysprosium in doped crystals of calcium sulphate. The consequences of the changes in some parameters of the excitation conditions, such as arc current, electrode type and total or partial burning of sample, in the analytical results are discussed. Matrix effects are investigated. Variations in the intensity of the spectral lines are verified by recording the spectrum in distinct photographic plates. The role of internal standard in analytical reproducibility and in counterbalance of the variations in the arc current and in the weight of sample is studied. Accuracy is estimated by comparative analysis of two calcium sulphate samples by X-Ray Fluorescence, Neutron Activation and Inductive Coupled Plasma Emission Spectroscopy. (M.A.C.) [pt

  19. Use of dispersive liquid-liquid microextraction for simultaneous preconcentration of samarium, europium, gadolinium and dysprosium

    International Nuclear Information System (INIS)

    Mallah, M.H.; Atomic Energy Organization of Iran, Tehran; Shemirani, F.; Ghannadi Maragheh, M.

    2008-01-01

    A new preconcentration method of dispersive liquid-liquid microextraction (DLLME) was developed for simultaneous preconcentration of samarium, europium, gadolinium and dysprosium. DLLME technique was successfully used as a sample preparation method. In this preconcentration method, an appropriate mixture of extraction solvent, disperser solvent was injected rapidly into an aqueous solution containing Sm, Eu, Gd and Dy after complex formation using chelating reagent of the 1-(2-pyridylazo)-2-naphthol (PAN). After phase separation, 0.5 mL of the settled phase containing enriched analytes was determined by inductively coupled plasma optical emission spectrometry (ICP-OES). The main factors affected the preconcentration of Sm, Eu, Gd and Dy were extraction and dispersive solvent type and their volume, extraction time, volume of chelating agent (PAN), centrifuge speed and drying temperature of the samples. Under the best operating condition simultaneous preconcentration factors of 80, 100, 103 and 78 were obtained for Sm, Eu, Gd and Dy, respectively. (author)

  20. A model for additive transport in metal halide lamps containing mercury and dysprosium tri-iodide

    International Nuclear Information System (INIS)

    Beks, M L; Haverlag, M; Mullen, J J A M van der

    2008-01-01

    The distribution of additives in a metal halide lamp is examined through numerical modelling. A model for a lamp containing sodium iodide additives has been modified to study a discharge containing dysprosium tri-iodide salts. To study the complex chemistry the method of Gibbs minimization is used to decide which species have to be taken into account and to fill lookup tables with the chemical composition at different combinations of elemental abundance, lamp pressure and temperature. The results from the model with dysprosium additives were compared with earlier results from the lamp containing sodium additives and a simulation of a pure mercury lamp. It was found that radial segregation creates the conditions required for axial segregation. Radial segregation occurs due to the unequal diffusion of atoms and molecules. Under the right conditions convection currents in the lamp can cause axial demixing. These conditions depend on the ratio of axial convection and radial diffusion as expressed by the Peclet number. At a Peclet number of unity axial segregation is most pronounced. At low Peclet numbers radial segregation is at its worst, while axial segregation is not present. At large Peclet numbers the discharge becomes homogeneously mixed. The degree of axial segregation at a Peclet number of unity depends on the temperature at which the additive under consideration fully dissociates. If the molecules dissociate very close to the walls no molecules are transported by the convective currents in the lamp, and hence axial segregation is limited. If they dissociate further away from the walls in the area where the downward convective currents are strongest, more axial segregation is observed

  1. Electrochemical behaviour of dysprosium in the eutectic LiCl-KCl at W and Al electrodes

    International Nuclear Information System (INIS)

    Castrillejo, Y.; Bermejo, M.R.; Barrado, A.I.; Pardo, R.; Barrado, E.; Martinez, A.M.

    2005-01-01

    The electrochemical behaviour of DyCl 3 was studied in the eutectic LiCl-KCl at different temperatures. The cathodic reaction can be written:Dy(III)+3e-bar Dy(0)which can be divided in two very close cathodic steps:Dy(III)+1e-bar Dy(II)andDy(II)+2e-bar Dy(0)Transient electrochemical techniques, such as cyclic voltammetry, chronopotentiometry, and chronoamperometry were used in order to study the reaction mechanism and the transport parameters of electroactive species at a tungsten electrode. The results showed that in the eutectic LiCl-KCl, electrocrystallization of dysprosium seems to be the controlling electrochemical step. Chronoamperometric studies indicated instantaneous nucleation of dysprosium with three dimensional growth of the nuclei whatever the applied overpotential.Mass transport towards the electrode is a simple diffusion process, and the diffusion coefficient of the electroactive species, i.e. Dy(III), has been calculated. The validity of the Arrhenius law was also verified by plotting the variation of the logarithm of the diffusion coefficient versus 1/T.In addition, the electrode reactions of the LiCl-KCl-DyCl 3 solutions at an Al wire were also investigated by cyclic voltammetry and open circuit chronopotentiometry. The redox potential of the Dy(III)/Dy couple at the Al electrode was observed at more positive potentials values than those at the inert electrode. This potential shift was thermodynamically analyzed by a lowering of activity of Dy in the metal phase due to the formation of intermetallic compounds

  2. Dysprosium lithium borate glass mircrospheres for radiation synovectomy: The in vitro and in vivo performance evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Zhao Di; Yu Jing [Institute of Bioengineering and Information Technology Materials, Center for Advanced Materials and Nano-Biomedicine, Tongji University, Shanghai, 200092 (China); Huang Wenhai, E-mail: whhuang@tongji.edu.cn [Institute of Bioengineering and Information Technology Materials, Center for Advanced Materials and Nano-Biomedicine, Tongji University, Shanghai, 200092 (China); Zhou Nai; Wang Deping [Institute of Bioengineering and Information Technology Materials, Center for Advanced Materials and Nano-Biomedicine, Tongji University, Shanghai, 200092 (China); Yin Wei [Institute of Isotope Research, Sinitic Academy of Atomic Energy, Beijing 102413 (China); Chen Yaqing [The Sixth People' s Hospital, Shanghai 200233 (China)

    2010-08-30

    The radioactive dysprosium lithium borate glass (DyLB) microspheres with different glass compositions were prepared for radiation synovectomy. The biodegradability and biocompatibility of these DyLB microspheres were evaluated in vitro and in vivo. The DyLB microspheres studied in this work were partially biodegradable in a simulated body fluid (SBF), with the final weight loss of the microspheres in the range of 24.6% and 55.0% (wt.%) after 8 days of immersion. The ICP results revealed that the dissolution of lithium significantly decreased from 100% to 53.7% with increasing content of Dy{sub 2}O{sub 3} in the microspheres from 18% to 22% (wt.%, from S-1 to S-3). However, for all of the three samples, nearly all of the dysprosium (> 99.997%, wt.%) remained in the microspheres, in the form of insoluble phosphates and carbonates, which was proved by the SEM and EDX analyses. The degradation of DyLB microspheres in SBF gradually decreased with immersion time and eventually reached equilibrium after 7 days of immersion. Compared to the other two samples, the S-3 sample with the lowest Dy{sup 3+} dissolution (about 0.002%) was considered more secure for clinical application. Furthermore, the S-3 DyLB microspheres exhibited good biocompatibility, since neither tissue damage nor inflammation was observed, after they were implanted in the liver of rat for two weeks. After neutron activation, the radionuclide purity of radioactive S-3 DyLB microspheres was 99.999%, which were suitable for radiation synovectomy.

  3. Photoluminescence study on amino functionalized dysprosium oxide-zinc oxide composite bifunctional nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Joseph, Aswathy; Praveen, G.L; Abha, K.; Lekha, G.M [Department of Chemistry, University of Kerala, Kariavattom, Kerala 695581 (India); George, Sony, E-mail: emailtosony@gmail.com [Department of Chemistry, University of Kerala, Kariavattom, Kerala 695581 (India)

    2012-08-15

    An organic dispersion of 9-15 nm size stable dysprosium oxide incorporated zinc oxide nanocomposites exhibiting luminescence in the visible region has been synthesised by a wet chemical precipitation technique at room temperature. Tetraethoxysilane TEOS [(C{sub 2}H{sub 5}O){sub 4}Si], (3-aminopropyl) trimethoxysilane (APTS) and a 1:1 mixture of TEOS-APTS have been used as capping agents to control the particle size as well as to achieve uniform dispersion of composite nanoparticles in methanol medium. X-ray diffractometer (XRD) analysis reveals the formation phase of amino-functionalised colloidal dysprosium oxide incorporated ZnO composite nanoparticles to be of zincite structure. The Transmission Electron Microscopy (TEM) images show that the particles are spheroids in shape, having average crystalline sizes ranging from 9 to 15 nm. The photoluminescence (PL) observed in these composites has been attributed to the presence of near band edge excitonic emission and existence of defect centres. The time correlated single photon counting studies of the composite nanoparticles exhibited three decay pathways. The enhanced PL emission intensity of solid state fluorescence spectra of samples is attributed to the absence of vibrational relaxation process. - Highlights: Black-Right-Pointing-Pointer Nano-composites are synthesised using a one step wet chemical precipitation method. Black-Right-Pointing-Pointer A significant fluorescence life time of 8.25 ns is obtained for the nano-composite. Black-Right-Pointing-Pointer Nano-composite particles exhibited pale yellow fluorescence rather than blue. Black-Right-Pointing-Pointer Vibrational cascade free enhanced fluorescence is obtained for the dry sample.

  4. Simultaneous determination of dysprosium, holmium and erbium in high purity rare earth oxides by second order derivative spectrophotometry

    International Nuclear Information System (INIS)

    Anbu, M.; Prasada Rao, T.; Iyer, C. S. P.; Damodaran, A. D.

    1996-01-01

    High purity individual rare earth oxides are increasingly used as major components in lasers (Y 2 O 3 ), phosphors (YVO 3 , Eu 2 O 3 ), magnetic bubble memory films (Gd 2 O 3 ) and refractive-index lenses and fibre optics (La 2 O 3 ). The determination of individual lanthanides in high purity rare earth oxides is a more important and difficult task. This paper reports the utilization of higher order derivative spectrophotometry for the simultaneous determination of dysprosium, holmium and erbium in high purity rare earth oxides. The developed procedure is simple, reliable and allows the determination of 0.001 to 0.2% of dysprosium, holmium and erbium in several rare earth. (author). 9 refs, 2 figs, 2 tabs

  5. Mixed (phthalocyaninato)(Schiff-base) di-dysprosium sandwich complexes. Effect of magnetic coupling on the SMM behavior.

    Science.gov (United States)

    Wang, Hailong; Liu, Chenxi; Liu, Tao; Zeng, Suyuan; Cao, Wei; Ma, Qi; Duan, Chunying; Dou, Jianmin; Jiang, Jianzhuang

    2013-11-21

    Reaction between Schiff-base ligand and half-sandwich complex M(Pc)(acac) led to the isolation of new sandwich-type mixed (phthalocyaninato)(Schiff-base) di-lanthanide compounds M2(Pc)2(L)H2O (M = Dy, Gd) (1, 2) [H2Pc = metal free phthalocyanine, Hacac = acetylacetone, H2L = N,N'-bis(3-methyloxysalicylidene)benzene-1,2-diamine] with the triple-decker molecular structure clearly revealed by single crystal X-ray diffraction analysis. For the comparative studies, sandwich triple-decker analogues with pure Schiff-base ligand M2(L)3H2O (M = Dy, Gd) (3, 4) were also prepared. Dynamic magnetic measurement result reveals the single-molecule magnet (SMM) nature of the di-dysprosium derivative 1, while the static magnetic investigation over both pure and the diamagnetic diluted samples of this compound discloses the interionic ferromagnetic coupling between the two dysprosium ions, which in turn effectively suppresses the QTM and enhances the energy barrier of this SMM. Nevertheless, comparative studies over the static magnetic properties of the di-dysprosium triple-decker complexes 1 and 3 indicate the stronger magnetic coupling between the two lanthanide ions in mixed (phthalocyaninato)(Schiff-base) species than in the pure Schiff-base triple-decker analogue, suggesting the special coordination sphere around the dysprosium ions in the former compound over the latter one on the more intense inter-ionic ferromagnetic coupling. As a very small step towards understanding the structure-property relationship, the present result will be surely helpful for the design and synthesis of the multinuclear lanthanide-based SMMs with good properties.

  6. 40 CFR 141.173 - Filtration.

    Science.gov (United States)

    2010-07-01

    ... PRIMARY DRINKING WATER REGULATIONS Enhanced Filtration and Disinfection-Systems Serving 10,000 or More People § 141.173 Filtration. A public water system subject to the requirements of this subpart that does... treatment, direct filtration, slow sand filtration, or diatomaceous earth filtration. A public water system...

  7. 21 CFR 173.368 - Ozone.

    Science.gov (United States)

    2010-04-01

    ... CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Specific Usage Additives § 173.368 Ozone. Ozone (CAS Reg. No. 10028-15-6) may be safely used in the treatment, storage, and processing of foods, including meat and poultry (unless such use is precluded by standards of identity in 9...

  8. 49 CFR 173.403 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... emitters and low toxicity alpha emitters or 0.04 Bq/cm2 for all other alpha emitters. Contamination exists... containers.” Graphite means, for the purposes of § 173.453, graphite with a boron equivalent content less... A2/g. Low toxicity alpha emitters means natural uranium; depleted uranium; natural thorium; uranium...

  9. Evaluating United States and world consumption of neodymium, dysprosium, terbium, and praseodymium in final products

    Science.gov (United States)

    Hart, Matthew

    This paper develops scenarios of future rare-earth-magnet metal (neodymium, dysprosium, terbium, and praseodymium) consumption in the permanent magnets used in wind turbines and hybrid electric vehicles. The scenarios start with naive base-case scenarios for growth in wind-turbine and hybrid-electric-vehicle sales over the period 2011 to 2020, using historical data for each good. These naive scenarios assume that future growth follows time trends in historical data and does not depend on any exogenous variable. Specifically, growth of each technological market follows historical time trends, and the amount of rare earths used per unit of technology remains fixed. The chosen reference year is 2010. Implied consumptions of the rare earth magnet metals are calculated from these scenarios. Assumptions are made for the material composition of permanent magnets, the market share of permanent-magnet wind turbines and vehicles, and magnet weight per unit of technology. Different scenarios estimate how changes in factors like the material composition of magnets, growth of the economy, and the price of a substitute could affect future consumption. Each scenario presents a different method for reducing rare earth consumption and could be interpreted as potential policy choices. In 2010, the consumption (metric tons, rare-earth-oxide equivalent) of each rare-earth-magnet metal was as follows. Total neodymium consumption in the world for both technologies was 995 tons; dysprosium consumption was 133 tons; terbium consumption was 50 tons; praseodymium consumption was zero tons. The base scenario for wind turbines shows there could be strong, exponential growth in the global wind turbine market. New U.S. sales of hybrid vehicles would decline (in line with the current economic recession) while non-U.S. sales increase through 2020. There would be an overall increase in the total amount of magnetic rare earths consumed in the world. Total consumption of each rare earth in the short

  10. 49 CFR 173.6 - Materials of trade exceptions.

    Science.gov (United States)

    2010-10-01

    ...-reactive (see § 173.124), poisonous by inhalation (see § 173.133), or a hazardous waste. (b) Packaging. (1..., boxes or compartments. (4) For gasoline, a packaging must be made of metal or plastic and conform to the...

  11. 49 CFR 173.465 - Type A packaging tests.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Type A packaging tests. 173.465 Section 173.465 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY... SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.465 Type A packaging tests. (a) The packaging...

  12. 49 CFR 173.3 - Packaging and exceptions.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Packaging and exceptions. 173.3 Section 173.3... SHIPMENTS AND PACKAGINGS General § 173.3 Packaging and exceptions. (a) The packaging of hazardous materials.... standard packaging must be open to inspection by a representative of the Department. (b) The regulations...

  13. 46 CFR 173.062 - Drainage of weather deck.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Drainage of weather deck. 173.062 Section 173.062 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO VESSEL USE School Ships § 173.062 Drainage of weather deck. The weather deck of each sailing...

  14. 29 CFR 1915.173 - Drums and containers.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 7 2010-07-01 2010-07-01 false Drums and containers. 1915.173 Section 1915.173 Labor... Vessels, Drums and Containers, Other Than Ship's Equipment § 1915.173 Drums and containers. (a) Shipping drums and containers shall not be pressurized to remove their contents. (b) A temporarily assembled...

  15. 25 CFR 173.2 - Project engineer's authority.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Project engineer's authority. 173.2 Section 173.2 Indians... LANDS WITHDRAWN OR ACQUIRED IN CONNECTION WITH INDIAN IRRIGATION PROJECTS § 173.2 Project engineer's authority. The project engineer is the official charged with the responsibility for the enforcement of this...

  16. 49 CFR 173.183 - Nitrocellulose base film.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Nitrocellulose base film. 173.183 Section 173.183... Nitrocellulose base film. Films, nitrocellulose base, must be packaged in packagings conforming to the... tape or paper; authorized only for not over 600 m (1969 feet) of film. [Amdt. 173-224, 55 FR 52643 Dec...

  17. 34 CFR 668.173 - Refund reserve standards.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 3 2010-07-01 2010-07-01 false Refund reserve standards. 668.173 Section 668.173 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF POSTSECONDARY EDUCATION, DEPARTMENT OF EDUCATION STUDENT ASSISTANCE GENERAL PROVISIONS Financial Responsibility § 668.173...

  18. 13 CFR 120.173 - Lead-based paint.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Lead-based paint. 120.173 Section 120.173 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION BUSINESS LOANS Policies Applying to All Business Loans Requirements Imposed Under Other Laws and Orders § 120.173 Lead-based paint. If...

  19. 49 CFR 173.185 - Lithium cells and batteries.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Lithium cells and batteries. 173.185 Section 173... Class 7 § 173.185 Lithium cells and batteries. (a) Cells and batteries. A lithium cell or battery, including a lithium polymer cell or battery and a lithium-ion cell or battery, must conform to all of the...

  20. 21 CFR 173.275 - Hydrogenated sperm oil.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Hydrogenated sperm oil. 173.275 Section 173.275... CONSUMPTION Solvents, Lubricants, Release Agents and Related Substances § 173.275 Hydrogenated sperm oil. The food additive hydrogenated sperm oil may be safely used in accordance with the following prescribed...

  1. 49 CFR 173.31 - Use of tank cars.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Use of tank cars. 173.31 Section 173.31... SHIPMENTS AND PACKAGINGS Preparation of Hazardous Materials for Transportation § 173.31 Use of tank cars. (a) General. (1) No person may offer a hazardous material for transportation in a tank car unless the tank car...

  2. 19 CFR 173.1 - Authority to review for error.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Authority to review for error. 173.1 Section 173.1 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) ADMINISTRATIVE REVIEW IN GENERAL § 173.1 Authority to review for error. Port directors...

  3. 46 CFR 173.051 - Public nautical school ships.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Public nautical school ships. 173.051 Section 173.051 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO VESSEL USE School Ships § 173.051 Public nautical school ships. Each public nautical school...

  4. Spectrographic determination of dysprosium dopant in calcium sulphate used as dosimetric material

    International Nuclear Information System (INIS)

    Grigoletto, T.

    1982-01-01

    A spectrographic method is described for the quantitative determination of dysprosium in doped crystals of calcium sulphate. The consequences of the changes in some parameters of the excitation conditions, such as arc current, electrode type and total or partial burning of sample, in the analytical results are discussed. Matrix effects are investigated by comparison among analytical curves obtained from three different methods of standard preparations. Variations in the intensity of the spectral lines are verificated by recording the spectrum in distinct photographic plates (SA-1). The role of internal standard in analytical reproducibility and in counterbalance of the variations in the arc current and in the weight of sample are studied. The great similarity in excitation behavior of many of the rare earths is used to provide a high degree of internal standardization. Precision studies show a standard deviation of about + - 2,4 percent by use of lanthanum as an internal standard. Accuracy is estimate by comparative analysis of two calcium sulphate samples by X-Rays Fluorescence, Neutron Activation and Inductive Coupled Plasma (ICP) Emission Spectroscopy. (Author) [pt

  5. Combustion of gadolinium and dysprosium chelates as a cellular integrity marker in MR imaging

    International Nuclear Information System (INIS)

    Ericsson, A.; Bach-Gansmo, T.; Niklasson, F.; Hemmingsson, A.

    1995-01-01

    A combination of gadolinium (Gd) and dysprosium (Dy) chelates was investigated as a potential marker of cell-membrane integrity by means of a double-contrast effect in MR imaging. Blood samples with varying hematocrit (Hct) levels containing intact or lysed cells were used as model systems. With intact cells, the agents were assumed to be distributed solely extracellularly and the highest Hct studied (69%) was assumed to mimic the ratio of extracellular to intracellular water in tissue. The combined effect on image intensity of Gd (in a concentration corresponding to 0.2 mmol/kg b.w. in humans) and Dy (0.6 mmol/kg b.w.) applied simultaneously was a marked difference in signal intensity between samples with intact and lysed cells in both the T1- and T2-weighted spin-echo images with a corresponding increase in the contrast-to-noise ratio. This was the result of a T1 reduction caused by Gd with a negligible Dy susceptibility effect in areas with lysed cells. On the other hand, the Dy susceptibility effect (i.e. reduced apparent T2) dominated in areas with intact cells. Thus, the combination of Gd and Dy may serve as a marker of cell-membrane integrity in MR examinations. (orig.)

  6. Isolation of {sup 163}Ho from dysprosium target material by HPLC for neutrino mass measurements

    Energy Technology Data Exchange (ETDEWEB)

    Mocko, Veronika; Taylor, Wayne A.; Nortier, Francois M.; Engle, Jonathan W.; Pollington, Anthony D.; Kunde, Gerd J.; Rabin, Michael W.; Birnbaum, Eva R. [Los Alamos National Laboratory, Los Alamos, NM (United States). Chemistry Div.; Barnhart, Todd E.; Nickles, Robert J. [Univ. Wisconsinn, Madison, WI (United States). Dept. of Medical Physics

    2015-07-01

    The rare earth isotope {sup 163}Ho is of interest for neutrino mass measurements. This report describes the isolation of {sup 163}Ho from a proton-irradiated dysprosium target and its purification. A Dy metal target was irradiated with 16 MeV protons for 10 h. After target dissolution, {sup 163}Ho was separated from the bulk Dy via cation-exchange high performance liquid chromatography using 70 mmol dm{sup -3} α-hydroxyisobutyric acid as the mobile phase. Subsequent purification of the collected Ho fraction was performed to remove the α-hydroxyisobutyrate chelating agent and to concentrate the Ho in a low ionic strength aqueous matrix. The final solution was characterized by MC-ICP-MS to determine the {sup 163}Ho/{sup 165}Ho ratio, {sup 163}Ho and the residual Dy content. The HPLC purification process resulted in a decontamination factor 1.4 x 10{sup 5} for Dy. The isolated Ho fraction contained 24.8 ± 1.3 ng of {sup 163}Ho corresponding to holmium recovery of 72 ± 3%.

  7. Nuclear statistics of dysprosium resonance parameters in the energy range 10 - 1000 eV

    International Nuclear Information System (INIS)

    Shin, S. G.; Kye, Y. U.; Cho, M. H.; Kim, G. N.; Namkung, W.; Lee, M. W.; Kang, Y. R.; Roe, T. I.

    2016-01-01

    A resonance parameter analysis is often performed in the Resolved Resonance Region (RRR) in order to estimate the average level spacing, distribution of the reduced widths and so on. Neutron Capture experiments on dysprosium isotopes were performed at the electron linear accelerator (LINAC) facility of the Rensselear Polytechnic Institute (RPI) in the neutron energy region from 10 eV to 1 keV. The following nuclear statistics of the resonance parameters will be discussed in this paper. The D 0 for 161 Dy and 163 Dy were judged to be constant up to 120.6 and 163.9 eV, respectively. It was assumed that the D 0 of 162 Dy and 164 Dy is constant up to 1000 eV because they have few resonances. The results were compared with the values from Reference 11 as shown in Figure 1. Statistical distributions of reduced neutron were investigated for the three isotopes in the region from 0 to 1000 eV; 161 Dy, 162 Dy, and 163 Dy, but not for 164 Dy because of a few number of resonances. The reduced neutron widths Γ n 0 were divided by the unweighted average reduced neutron width < Γ n 0 > for each isotope. A cumulative distribution of these unitless ratios is compared with the integral of the Porter-Thomas distribution (χ 2 distribution with one degree of freedom). The results agree reasonably with the Porter Thomas distributions.

  8. Self-organized dysprosium-directed alginate hydrogels and its chemical features

    Energy Technology Data Exchange (ETDEWEB)

    Ma, Qianmin [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Gao, Jinwei [Institute for Advanced Materials, Academy of Advanced Optoelectronics, South China Normal University, Guangzhou 510006 (China); Peng, Huojun [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Wang, Qianming, E-mail: qmwang@scnu.edu.cn [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Guangzhou Key Laboratory of Materials for Energy Conversion and Storage, Guangzhou 510006 (China)

    2016-09-15

    Rational use of self-organized materials may contribute in developing new structures and devices in practical technology. Synthetic metallo-supramolecular gels are generally designed with transitional metal-directed process. However, the assembly of both lanthanide and sodium alginate in macromolecular systems would find a new way of utilizing its physical properties. The stimuli-responsive molecule (alginate) could firmly form stable hydrogels upon the encapsulation of dysprosium ions. In addition, the immobilization of YVO{sub 4}: Eu{sup 3+} nanoparticle in the soft matrix has been achieved and it has never been explored in the fabrication of phosphor-incorporated luminescent alginate gels. The key feature of the present soft matter is that its red emission could be switched off in the presence of sodium ascorbate and the results may have a tremendous impact on the extension of photophysical application based on soft nanoscale devices. - Highlights: • Dy{sup 3+} can be used for the gelation of the dissolved alginate. • Lanthanide hydrogels could exhibit red emissions under excitations. • Luminescence could be switched “off” in the presence of sodium ascorbate.

  9. Optical properties of zinc borotellurite glass doped with trivalent dysprosium ion

    Science.gov (United States)

    Ami Hazlin, M. N.; Halimah, M. K.; Muhammad, F. D.; Faznny, M. F.

    2017-04-01

    The zinc borotellurite doped with dysprosium oxide glass samples with chemical formula {[(TeO2) 0 . 7(B2O3) 0 . 3 ] 0 . 7(ZnO) 0 . 3 } 1 - x(Dy2O3)x (where x=0.01, 0.02, 0.03, 0.04 and 0.05 M fraction) were prepared by using conventional melt quenching technique. The structural and optical properties of the proposed glass systems were characterized by using X-ray diffraction (XRD) spectroscopy, Fourier Transform Infrared (FTIR) spectroscopy, and UV-VIS spectroscopy. The amorphous nature of the glass systems is confirmed by using XRD technique. The infrared spectra of the glass systems indicate three obvious absorption bands which are assigned to BO3 and TeO4 vibrational groups. Based on the absorption spectra obtained, the direct and indirect optical band gaps, as well as the Urbach energy were calculated. It is observed that both the direct and indirect optical band gaps increase with the concentration of Dy3+ ions. On the other hand, the Urbach energy is observed to decrease as the concentration of Dy3+ ions increases.

  10. The liquid membrane for extraction of Yttrium and Dysprosium from Acid Nitric

    International Nuclear Information System (INIS)

    Johny, W.S.; Raldi-Artono-Koestoer; Kris-Tri-Basuki; Sudibyo

    1996-01-01

    The determination of surfactant in liquid membrane has been done. The surfactant is span-80 (sorbitol-monooleate), the liquid membrane phase was the organic phase (O), the internal liquid phase (W) with ratio O/W = 1, and surfactant. The organic phase using D 2 EHPA in the kerosene and the internal liquid phase using aqua des or acid nitric. The determination of surfactant with variation of span-80 (0,25 - 2%) in the liquid membrane volume. The speed of stirrer was 3500 rpm in 20 minute. The ratio of liquid membrane phase form and external phase (aqua des or acid nitric) was 1, the speed of stirrer was 350 rpm in 10 minute (permeation process). The liquid phase and the liquid membrane phase was separated and then determinated the volume of liquid membrane, the result of percentage of span-80 was 0,25 % volume. The extraction of yttrium and dysprosium in 2 M HNO 3 was Kd y = 2.945 and Kd D y = 0.019

  11. Custom Coordination Environments for Lanthanoids: Tripodal Ligands Achieve Near-Perfect Octahedral Coordination for Two Dysprosium-Based Molecular Nanomagnets.

    Science.gov (United States)

    Lim, Kwang Soo; Baldoví, José J; Jiang, ShangDa; Koo, Bong Ho; Kang, Dong Won; Lee, Woo Ram; Koh, Eui Kwan; Gaita-Ariño, Alejandro; Coronado, Eugenio; Slota, Michael; Bogani, Lapo; Hong, Chang Seop

    2017-05-01

    Controlling the coordination sphere of lanthanoid complexes is a challenging critical step toward controlling their relaxation properties. Here we present the synthesis of hexacoordinated dysprosium single-molecule magnets, where tripodal ligands achieve a near-perfect octahedral coordination. We perform a complete experimental and theoretical investigation of their magnetic properties, including a full single-crystal magnetic anisotropy analysis. The combination of electrostatic and crystal-field computational tools (SIMPRE and CONDON codes) allows us to explain the static behavior of these systems in detail.

  12. Experimental and theoretical approach on the optical properties of zinc borotellurite glass doped with dysprosium oxide

    Science.gov (United States)

    Halimah, M. K.; Ami Hazlin, M. N.; Muhammad, F. D.

    2018-04-01

    A series of glass samples with chemical formula {[(TeO2)0.7(B2O3)0.3]0.7(ZnO)0.3}1 - x(Dy2O3)x where x = 0.01, 0.02, 0.03, 0.04 and 0.05 M fraction were synthesized through conventional melt-quenching method. The most common way to fabricate a glass material is by fusion of two or more component oxides followed by their quenching. This technique is known as melt-quenching technique. Kaur et al. (2016) [1] highlighted that the melt-quenching method able to enhance the mechanical properties like hardness and flexural strength of the material. The nature of the glass systems is proven to be amorphous based on the XRD pattern. The FTIR spectra of the glass systems confirm the existence of five bands which are assigned for the BO4, BO3, TeO4 and TeO3 vibrational groups. The density of the glass systems is increased with the addition of Dy2O3 while the molar volume is found to be inversely proportional to the density of the proposed glass. The optical properties of the glasses are determined through the absorption spectra obtained from the UV-VIS spectrophotometer. From the absorption spectra, the indirect and direct optical band gaps and the Urbach energy are found to be inversely proportional to each other. As the molar fraction of the Dy2O3 increased, the optical band gaps are observed to increase as opposed to the Urbach energy. For this glass system, the values of refractive index, electronic polarizability, oxide ion polarizability and the optical basicity are found to decrease as the addition of the dysprosium oxide is increased. From the emission spectra, two intense blue and yellow emission bands are observed, which correspond to the 4F9/2 → 6H15/2 and 4F9/2 → 6H13/2 transitions of Dy3 + ions respectively. The CIE chromaticity coordinates of the zinc borotellurite glass systems are found to be located in the white light region. Generation of white light The generation of the white light can be achieved by using two emission bands which comprise of the yellow

  13. Textured dysprosium and gadolinium poles for high-field, short-period hybrid undulators

    International Nuclear Information System (INIS)

    Murokh, Alex; Solovyov, Vyacheslav; Agustsson, Ron; O'Shea, Finn H.; Chubar, Oleg; Chen, Yung; Grandsaert, Thomas

    2014-01-01

    We discuss the feasibility of enhancement of the gap field in a short-period hybrid undulator by using pole inserts with the saturation inductance B s , over that of iron, 2 T. Dysprosium metal, with the saturation inductance of 3.4 T below 90 K, and Gadolinium with B s =2.7 T, appear as good candidates as the optimized pole material. However, due to the high magnetic anisotropy of Dy, such a high level of magnetization can only be realized when the external field lies in the basal plane. This implies that the pole has to be single-crystalline or highly textured. Considering that growing large, >10mm, Dy single crystals is difficult, we propose secondary recrystallization as a method to induce the required texture in thin Dy and Gd foils. The textured foils can be stacked to produce pole inserts of the desired geometry and orientation. Results of small-scale processing and magnetic measurements of thin (20–60 μ) foils provide evidence that the required texture quality can be achieved by a relatively simple sequence of heat-treatments and cold rolling. The advantage of textured Dy and Gd poles is demonstrated in a several period test undulator. -- Highlights: • Textured rare-earth materials for use as undulator pole materials. • We measure the development of texture in Dy and Gd. • We compare the rare-earth materials with high saturation steel in undulators. • Thin sheets of Dy and Gd materials perform similar to single crystals

  14. Electrocatalytic approach for the efficiency increase of electrolytic hydrogen production: Proof-of-concept using platinum-dysprosium alloys

    International Nuclear Information System (INIS)

    Santos, D.M.F.; Šljukić, B.; Sequeira, C.A.C.; Macciò, D.; Saccone, A.; Figueiredo, J.L.

    2013-01-01

    Development of electrocatalytic materials for the hydrogen evolution reaction (HER) is attempted with the aim of reducing the water electrolysis overpotential and increasing its efficiency. Using linear scan voltammetry measurements of the hydrogen discharge enables evaluation of the electrocatalytic activity for the HER of platinum–dysprosium (Pt–Dy) intermetallic alloy electrodes of different compositions. Understanding of materials electrocatalytic performance is based on determination of several crucial kinetic parameters, including the Tafel coefficients, b, charge transfer coefficients, α, exchange current densities, j 0 , and activation energies, E a . Influence of temperature on HER is investigated by performing studies at temperatures ranging from 25 °C to 85 °C. The effect of the Dy amount in the efficiency of the HER on the Pt–Dy alloys is analysed. Results demonstrate that Dy can substantially increase the electrocatalytic activity of the Pt alloys, in comparison to the single Pt electrode. Efforts are made to correlate the microstructure of the alloys with their performance towards the HER. - Highlights: ► Development of electrocatalysts to increase efficiency of electrolytic hydrogen production. ► Synthesis and evaluation of composition and morphology of platinum–dysprosium (Pt–Dy) alloys. ► Hydrogen evolution reaction on Pt–Dy alloys electrodes studied using linear scan voltammetry in alkaline medium. ► Pt–Dy alloy with equiatomic composition enhances kinetics of hydrogen discharge compared to single Pt

  15. The application of x-ray spectrometry to isotopic-source activation analysis of dysprosium and holmium

    International Nuclear Information System (INIS)

    Pillay, A.E.; Mboweni, R.C.M.

    1990-01-01

    A novel aspect of activation analysis is described for the determination of dysprosium and holmium at low concentrations. The method involves the measurement of K x-rays from radionuclides produced by thermal neutron activation using a 1 mg 252 Cf source. The basis for elemental selection depends largely on the demand for analysis and on the existence of favourable nuclear properties for the production of a practicable x-ray yield. A full appraisal of the analytical potential of the method is presented with particular emphasis on its application to geological matrices. The sensitivity was optimised by employing a detector that was particularly effective at photon energies below 150 keV. Analytical conditions are demonstrated for the elements of interest over a wide range of concentrations in small powdered samples. The investigation formed the basis of a feasibility study to establish if the application could be developed for the routine off-line determination of dysprosium and holmium using an isotopic-neutron source. (author)

  16. Reduction of titanocene dichloride with dysprosium: access to a stable titanocene(ii) equivalent for phosphite-free Takeda carbonyl olefination.

    Science.gov (United States)

    Bousrez, G; Déchamps, I; Vasse, J-L; Jaroschik, F

    2015-05-28

    The reduction of titanocene dichloride with dysprosium yields a new titanocene(ii) equivalent without the need for further stabilising ligands. This reagent can be employed in combination with dithioacetals for the olefination of different carbonyl groups and allows for a simplified all-in-one procedure.

  17. Acute dysprosium toxicity to Daphnia pulex and Hyalella azteca and development of the biotic ligand approach

    Energy Technology Data Exchange (ETDEWEB)

    Vukov, Oliver, E-mail: vuko3930@mylaurier.ca [Biology Department, Wilfrid Laurier University, Waterloo, Ontario N2L 3C5 (Canada); Smith, D. Scott [Chemistry Department, Wilfrid Laurier University, Waterloo, Ontario N2L 3C5 (Canada); McGeer, James C. [Biology Department, Wilfrid Laurier University, Waterloo, Ontario N2L 3C5 (Canada)

    2016-01-15

    The toxicological understanding of rare earth elements (REEs) in the aquatic environment is very limited but of increasing concern. The objective of this research is to compare the toxicological effect of the REE dysprosium to the freshwater invertebrates Daphnia pulex and Hyalella azteca and in the more sensitive organism, understand the toxicity modifying influence of Ca, Na, Mg, pH and dissolved organic matter (DOM). Standard methods (Environment Canada) were followed for testing and culture in media of intermediate hardness (60 mg CaCO{sub 3} mg/L) at pH 7.8 with Ca at 0.5, Na 0.5, Mg 0.125 (mM) and 23 °C. Acute toxicity tests were done with <24 h old neonates for 48 h in the case of D. pulex and with 2–9 days old offspring for 96 h tests with Hyalella. The potential protective effect of cationic competition was tested with Ca (0.5–2.0 mM), Na (0.5–2.0 mM) and Mg (0.125–0.5 mM). The effect of pH (6.5–8.0) and Suwannee River DOM complexation (at dissolved organic carbon (DOC) concentrations of 9 and 13 mg C/L) were evaluated. Dissolved Dy concentrations were lower than total (unfiltered) indicating precipitation, particularly at higher concentrations. Acute toxicity of Dy to H. azteca and D. pulex revealed Hyalella to be 1.4 times more sensitive than Daphnia. Additions of Ca and Na but not Mg provided significant protection against Dy toxicity to Hyalella. Similarly, low pH was associated with reduction in toxicity. Exposures which were pH buffered with and without MOPS were significantly different and indicated that MOPS enhanced Dy toxicity. DOM also mitigated Dy toxicity. Biotic ligand based parameters (Log K values) were calculated based on free ion relationships as determined by geochemical equilibrium modeling software (WHAM ver. 7.02). The log K value for Dy{sup 3+} toxicity to Hyalella was 7.75 while the protective influence of Ca and Na were 3.95 and 4.10, respectively. This study contributes data towards the development of site specific

  18. Synthesis and characterization of phosphors based on calcium and magnesium silicates doped with europium and dysprosium

    International Nuclear Information System (INIS)

    Misso, Agatha Matos

    2016-01-01

    Ca and Mg silicates based phosphors were prepared by sol-gel method combined with the molten salts process. The gel of silica was obtained from Na 2 SiO 3 solution by using europium, dysprosium, calcium and magnesium chloride solutions. Therefore, those chlorides were homogeneously dispersed into the gel. The obtained gel was dried and heat treated to 900° C for 1h to allow the fusion of the present salts. Then it was water washed until negative test for Cl - , and dried. The reduction of the europium to Eu 2+ was performed under atmosphere of 5% of H 2 and 95% of Ar to 900° C for 3h, to reach CaMgSi 2 O 6 :Eu 2+ and CaMgSi 2 O 6 :Eu 2+ :Dy 3+ phosphors. Diopside was identified as main crystalline phase and quartz, as secondary phase from XRD (X-ray diffraction) patterns. SEM (scanning electron microscopy) micrographs, of the samples showed needles, spheres, leaves and rods of particles and agglomerates. Thermal analysis (TGA-DTGA) curves revealed that the crystallization temperature of CaMgSi 2 O 6 :Eu 2+ lies around 765° C. Photoluminescence spectroscopy of the phosphors was studied based on interconfigurational 4f N → 4f N-1 5d transition of Eu 2+ ion. The spectra of excitation showed 4f N → 4f N-1 5d transition of Eu 2+ ion broad band, related to the ligand to metal charge transfer transition (LMCT) O 2- (2p) → Eu 3+ in the 250 nm region, when the emission is monitored at 583,5 nm. It also presents the 4f ↔ 4f transitions of Eu 3+ ion bands, showing the 7 F 0 → 5 L 6 transition at 393 nm. From emission spectra with excitation monitored at 393 nm, it can be observed fine peaks between 570 and 750 nm which are characteristics of 5 D 0 → 7 F J (J = 0 - 5) transition of Eu 3+ ion, indicating that the Eu 3+ ion occupies a site with center of inversion. Finally, the obtained results indicate that the developed method is suitable to synthesize CaMgSi 2 O 6 :Eu 2+ and CaMgSi 2 O 6 :Eu 2+ :Dy 3+ phosphors, as it has been proposed. (author)

  19. Luminescence properties of dysprosium doped calcium magnesium silicate phosphor by solid state reaction method

    Energy Technology Data Exchange (ETDEWEB)

    Sahu, Ishwar Prasad, E-mail: ishwarprasad1986@gmail.com [School of Studies in Physics & Astrophysics, Pt. Ravishankar Shukla University, Raipur, C.G. 492010 (India); Chandrakar, Priya; Baghel, R.N.; Bisen, D.P.; Brahme, Nameeta [School of Studies in Physics & Astrophysics, Pt. Ravishankar Shukla University, Raipur, C.G. 492010 (India); Tamrakar, Raunak Kumar [Department of Applied Physics, Bhilai Institute of Technology, Durg, C.G. 491001 (India)

    2015-11-15

    Dysprosium doped calcium magnesium silicate (CaMgSi{sub 2}O{sub 6}:Dy{sup 3+}) white light emitting phosphor was synthesized by solid state reaction process. The crystal structure of sintered phosphor was monoclinic structure with space group C2/c. Chemical composition of the sintered CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor was confirmed by EDX. The prepared CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor was excited from 352 nm and their corresponding emission spectra were recorded at blue (470 nm), yellow (570 nm) and red (675 nm) line due to the {sup 4}F{sub 9/2} → {sup 6}H{sub 15/2}, {sup 4}F{sub 9/2} → {sup 6}H{sub 13/2}, {sup 4}F{sub 9/2} → {sup 6}H{sub 11/2} transitions of Dy{sup 3+} ions. The combination of these three emissions constituted as white light confirmed by the Commission Internationale de L'Eclairage (CIE) chromatic coordinate diagram. The possible mechanism of the white light emitting long lasting CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor was also investigated. Investigation on afterglow property show that phosphor held fast and slow decay process. The peak of mechanoluminescence (ML) intensity increases linearly with increasing impact velocity of the moving piston. Thus the present investigation indicates that the local piezoelectricity-induced electron bombardment model is responsible to produce ML in prepared CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor. - Highlights: • The crystal structure of CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor is consistent with standard monoclinic structure. • CIE coordinates of CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor is suitable as white light emitting phosphor. • The local piezoelectricity-induced electron bombardment model is responsible to produce ML in CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor.

  20. An ICP AES method for determination of dysprosium and terbium in high purity yttrium oxide

    International Nuclear Information System (INIS)

    Rupawate, V.H.; Hareendran, K.N.; Roy, S.B.

    2011-01-01

    High purity yttrium finds interesting application in astronavigation, luminescence, nuclear energy and metallurgical industries. Most of these applications require yttrium oxide of highest purity. Consequently there is a need for production of high purity yttrium oxide. Separation and purification of yttrium from other rare earths is a challenging task due to their close chemical properties. Liquid-liquid extraction and ion exchange have been widely used in the production of yttrium oxide of highest purity. Determination of impurities, especially other rare earths, in ppm level is required for process development and chemical characterization of the high purity Y 2 O 3 . Many methods have been described in literature. However since the advent of ICP AES much work in this area has been carried out by this technique. This paper describes the work done for determination of dysprosium (Dy) and terbium (Tb) in yttrium oxide using a high resolution sequential ICP AES. Emission spectra of rare earth elements are very complex and due to this complexity it is important to select spectral interference free analyte lines for determination of rare earths in rare earth matrix. For the determination of Dy and Tb in Y 2 O 3 , sensitive lines of Dy and Tb are selected from the instrument wavelength table and spectral interference free emission lines for the determination is selected by scanning around the selected wavelengths using 5 g/L Y solution and 5 mg/L standard solutions of Dy and Tb prepared in 4% nitric acid. It is found 353.170 nm line of Dy and 350.917 nm line Tb is suitable for quantitative determination. The signal to background ratio increases with increase in matrix concentration, i.e. from 1 to 5 mg/L. The optimum forward power is determined and it is found to be 1100W for Dy and 1000W for Tb. The instrument is calibrated using matrix matched standards containing 5g/L of Y matrix. Samples are dissolved in nitric acid and Y concentration is maintained at 5g/L. Two

  1. Acute dysprosium toxicity to Daphnia pulex and Hyalella azteca and development of the biotic ligand approach

    International Nuclear Information System (INIS)

    Vukov, Oliver; Smith, D. Scott; McGeer, James C.

    2016-01-01

    The toxicological understanding of rare earth elements (REEs) in the aquatic environment is very limited but of increasing concern. The objective of this research is to compare the toxicological effect of the REE dysprosium to the freshwater invertebrates Daphnia pulex and Hyalella azteca and in the more sensitive organism, understand the toxicity modifying influence of Ca, Na, Mg, pH and dissolved organic matter (DOM). Standard methods (Environment Canada) were followed for testing and culture in media of intermediate hardness (60 mg CaCO 3 mg/L) at pH 7.8 with Ca at 0.5, Na 0.5, Mg 0.125 (mM) and 23 °C. Acute toxicity tests were done with <24 h old neonates for 48 h in the case of D. pulex and with 2–9 days old offspring for 96 h tests with Hyalella. The potential protective effect of cationic competition was tested with Ca (0.5–2.0 mM), Na (0.5–2.0 mM) and Mg (0.125–0.5 mM). The effect of pH (6.5–8.0) and Suwannee River DOM complexation (at dissolved organic carbon (DOC) concentrations of 9 and 13 mg C/L) were evaluated. Dissolved Dy concentrations were lower than total (unfiltered) indicating precipitation, particularly at higher concentrations. Acute toxicity of Dy to H. azteca and D. pulex revealed Hyalella to be 1.4 times more sensitive than Daphnia. Additions of Ca and Na but not Mg provided significant protection against Dy toxicity to Hyalella. Similarly, low pH was associated with reduction in toxicity. Exposures which were pH buffered with and without MOPS were significantly different and indicated that MOPS enhanced Dy toxicity. DOM also mitigated Dy toxicity. Biotic ligand based parameters (Log K values) were calculated based on free ion relationships as determined by geochemical equilibrium modeling software (WHAM ver. 7.02). The log K value for Dy 3+ toxicity to Hyalella was 7.75 while the protective influence of Ca and Na were 3.95 and 4.10, respectively. This study contributes data towards the development of site specific water quality

  2. 49 CFR 173.2 - Hazardous materials classes and index to hazard class definitions.

    Science.gov (United States)

    2010-10-01

    ....50 1 1.6 Extremely insensitive detonating substances 173.50 2 2.1 Flammable gas 173.115 2 2.2 Non-flammable compressed gas 173.115 2 2.3 Poisonous gas 173.115 3 Flammable and combustible liquid 173.120 4 4.1 Flammable solid 173.124 4 4.2 Spontaneously combustible material 173.124 4 4.3 Dangerous when wet...

  3. 7 CFR 993.173 - Reports of accounting.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Reports of accounting. 993.173 Section 993.173... accounting. (a) Independent handler's reports of accounting. Within 10 days (exclusive of Saturdays, Sundays... association, makes an accounting or settlement with a producer or dehydrator for prunes delivered to him, he...

  4. 49 CFR 173.23 - Previously authorized packaging.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Previously authorized packaging. 173.23 Section... REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Preparation of Hazardous Materials for Transportation § 173.23 Previously authorized packaging. (a) When the regulations specify a packaging with a specification marking...

  5. 49 CFR 173.206 - Packaging requirements for chlorosilanes.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Packaging requirements for chlorosilanes. 173.206...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Non-bulk Packaging for Hazardous Materials Other Than Class 1 and Class 7 § 173.206 Packaging requirements for chlorosilanes. (a) When § 172.101 of this...

  6. 21 CFR 173.250 - Methyl alcohol residues.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Methyl alcohol residues. 173.250 Section 173.250 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD.... Methyl alcohol may be present in the following foods under the conditions specified: (a) In spice...

  7. 1 CFR 17.3 - Criteria for emergency publication.

    Science.gov (United States)

    2010-01-01

    ... 1 General Provisions 1 2010-01-01 2010-01-01 false Criteria for emergency publication. 17.3..., AND PROCESSING OF DOCUMENTS FILING FOR PUBLIC INSPECTION AND PUBLICATION SCHEDULES Emergency Schedule § 17.3 Criteria for emergency publication. The emergency schedule is designed to provide the fastest...

  8. 27 CFR 25.173 - Brewer in default.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Brewer in default. 25.173... OF THE TREASURY LIQUORS BEER Tax on Beer Prepayment of Tax § 25.173 Brewer in default. (a) When a... the brewer is otherwise in default in payment of tax under § 25.164, beer may not be removed for...

  9. 9 CFR 381.173 - Mechanically Separated (Kind of Poultry).

    Science.gov (United States)

    2010-01-01

    ... Poultry). 381.173 Section 381.173 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Definitions and...

  10. 40 CFR 265.173 - Management of containers.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Management of containers. 265.173... DISPOSAL FACILITIES Use and Management of Containers § 265.173 Management of containers. (a) A container... waste. (b) A container holding hazardous waste must not be opened, handled, or stored in a manner which...

  11. 40 CFR 264.173 - Management of containers.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Management of containers. 264.173... Use and Management of Containers § 264.173 Management of containers. (a) A container holding hazardous... container holding hazardous waste must not be opened, handled, or stored in a manner which may rupture the...

  12. 14 CFR 25.173 - Static longitudinal stability.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Static longitudinal stability. 25.173... AIRCRAFT AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY AIRPLANES Flight Stability § 25.173 Static... forces (including friction) must be as follows: (a) A pull must be required to obtain and maintain speeds...

  13. 14 CFR 23.173 - Static longitudinal stability.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Static longitudinal stability. 23.173... Stability § 23.173 Static longitudinal stability. Under the conditions specified in § 23.175 and with the airplane trimmed as indicated, the characteristics of the elevator control forces and the friction within...

  14. 49 CFR 173.316 - Cryogenic liquids in cylinders.

    Science.gov (United States)

    2010-10-01

    ... filling density for hydrogen, cryogenic liquid is defined as the percent ratio of the weight of lading in... 49 Transportation 2 2010-10-01 2010-10-01 false Cryogenic liquids in cylinders. 173.316 Section... REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.316 Cryogenic liquids in...

  15. 49 CFR 173.194 - Gas identification sets.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Gas identification sets. 173.194 Section 173.194... Gas identification sets. Gas identification sets containing poisonous material must be packaged in... silical gel, gas identification sets may be shipped as follows: (1) If the poisonous material does not...

  16. 21 CFR 133.173 - Pasteurized process cheese food.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized process cheese food. 133.173 Section 133.173 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific...

  17. 49 CFR 173.219 - Life-saving appliances.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Life-saving appliances. 173.219 Section 173.219... Life-saving appliances. (a) A life-saving appliance, self-inflating or non-self-inflating, containing small quantities of hazardous materials that are required as part of the life-saving appliance must...

  18. Dual responsive dysprosium-doped hydroxyapatite particles and toxicity reduction after functionalization with folic and glucuronic acids.

    Science.gov (United States)

    Sánchez Lafarga, Ana Karen; Pacheco Moisés, Fermín P; Gurinov, Andrey; Ortiz, Genaro Gabriel; Carbajal Arízaga, Gregorio Guadalupe

    2015-03-01

    The development of probes for biomedical applications demands materials with low toxicity levels besides fluorescence or magnetic properties to be detected by confocal microscopes or MRI resonators. Several drug delivery systems or other biomedical materials prepared with hydroxyapatite have been proposed, however, toxicity effects might arise when the size of particles is nanometric. In this study, hydroxyapatite functionalized with glucuronic or folic acids presented lower oxidative stress, measured from lipoperoxides and nitric oxide indicators in rats than pure hydroxyapatite. In separated experiments, hydroxyapatite was doped with dysprosium cations by coprecipitation producing a single crystal phase with fluorescent properties easily visualized by confocal microscopy when excited at 488nm. These particles also presented the ability to modify the proton relaxation time in T1 maps collected by magnetic resonance imaging. These modified hydroxyapatite nanoparticles could be candidates to design bimodal probes with low toxicity. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Magnetic anisotropy of dysprosium(III) in a low-symmetry environment: a theoretical and experimental investigation.

    Science.gov (United States)

    Bernot, Kevin; Luzon, Javier; Bogani, Lapo; Etienne, Mael; Sangregorio, Claudio; Shanmugam, Muralidharan; Caneschi, Andrea; Sessoli, Roberta; Gatteschi, Dante

    2009-04-22

    A mixed theoretical and experimental approach was used to determine the local magnetic anisotropy of the dysprosium(III) ion in a low-symmetry environment. The susceptibility tensor of the monomeric species having the formula [Dy(hfac)(3)(NIT-C(6)H(4)-OEt)(2)], which contains nitronyl nitroxide (NIT-R) radicals, was determined at various temperatures through angle-resolved magnetometry. These results are in agreement with ab initio calculations performed using the complete active space self-consistent field (CASSCF) method, validating the predictive power of this theoretical approach for complex systems containing rare-earth ions, even in low-symmetry environments. Susceptibility measurements performed with the applied field along the easy axis eventually permitted a detailed analysis of the temperature and field dependence of the magnetization, providing evidence that the Dy ion transmits an antiferromagnetic interaction between radicals but that the Dy-radical interaction is ferromagnetic.

  20. Watt-level dysprosium fiber laser at 3.15  μm with 73% slope efficiency.

    Science.gov (United States)

    Woodward, R I; Majewski, M R; Bharathan, G; Hudson, D D; Fuerbach, A; Jackson, S D

    2018-04-01

    Rare-earth-doped fiber lasers are emerging as promising high-power mid-infrared sources for the 2.6-3.0 μm and 3.3-3.8 μm regions based on erbium and holmium ions. The intermediate wavelength range, however, remains vastly underserved, despite prospects for important manufacturing and defense applications. Here, we demonstrate the potential of dysprosium-doped fiber to solve this problem, with a simple in-band pumped grating-stabilized linear cavity generating up to 1.06 W at 3.15 μm. A slope efficiency of 73% with respect to launched power (77% relative to absorbed power) is achieved-the highest value for any mid-infrared fiber laser to date, to the best of our knowledge. Opportunities for further power and efficiency scaling are also discussed.

  1. On-line complexation/cloud point preconcentration for the sensitive determination of dysprosium in urine by flow injection inductively coupled plasma-optical emission spectrometry

    International Nuclear Information System (INIS)

    Ortega, Claudia; Cerutti, Soledad; Silva, Maria F.; Olsina, Roberto A.; Martinez, Luis D.

    2003-01-01

    An on-line dysprosium preconcentration and determination system based on the hyphenation of cloud point extraction (CPE) to flow injection analysis (FIA) associated with ICP-OES was studied. For the preconcentration of dysprosium, a Dy(III)-2-(5-bromo-2-pyridylazo)-5-diethylaminophenol complex was formed on-line at pH 9.22 in the presence of nonionic micelles of PONPE-7.5. The micellar system containing the complex was thermostated at 30 C in order to promote phase separation, and the surfactant-rich phase was retained in a microcolumn packed with cotton at pH 9.2. The surfactant-rich phase was eluted with 4 mol L -1 nitric acid at a flow rate of 1.5 mL min -1 , directly in the nebulizer of the plasma. An enhancement factor of 50 was obtained for the preconcentration of 50 mL of sample solution. The detection limit value for the preconcentration of 50 mL of aqueous solution of Dy was 0.03 μg L -1 . The precision for 10 replicate determinations at the 2.0 μg L -1 Dy level was 2.2% relative standard deviation (RSD), calculated from the peak heights obtained. The calibration graph using the preconcentration system for dysprosium was linear with a correlation coefficient of 0.9994 at levels near the detection limits up to at least 100 μg L -1 . The method was successfully applied to the determination of dysprosium in urine. (orig.)

  2. 46 CFR 173.058 - Double bottom requirements.

    Science.gov (United States)

    2010-10-01

    ... PERTAINING TO VESSEL USE School Ships § 173.058 Double bottom requirements. Each new sailing school vessel... service must comply with the double bottom requirements in §§ 171.105 through 171.109, inclusive, of this...

  3. 46 CFR 173.007 - Location of the hook load.

    Science.gov (United States)

    2010-10-01

    ... PERTAINING TO VESSEL USE Lifting § 173.007 Location of the hook load. When doing the calculations required in this subpart, the hook load must be considered to be located at the head of the crane. ...

  4. 49 CFR 173.218 - Fish meal or fish scrap.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Fish meal or fish scrap. 173.218 Section 173.218... Fish meal or fish scrap. (a) Except as provided in Column (7) of the HMT in § 172.101 of this subchapter, fish meal or fish scrap, containing at least 6%, but not more than 12% water, is authorized for...

  5. 32 CFR 173.3 - Profit reduction clause.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Profit reduction clause. 173.3 Section 173.3... violating 18 U.S.C. 201-224 (bribery, graft, and conflicts of interest), 18 U.S.C. 371 (conspiracy), 18 U.S.... 1341 (fraud), 18 U.S.C. 1343 (fraud by wire) for any act in connection with or related to the obtaining...

  6. Graphite furnace atomic absorption spectrometry with a tantalum boat for the determination of yttrium, samarium, and dysprosium in a mish metal

    International Nuclear Information System (INIS)

    Daidoji, Hidehiro; Tamura, Shohei

    1982-01-01

    The determination of yttrium, samarium, and dysprodium by means of graphite-furnace atomic absorption spectrometry (AAS) was studied by a tantalum boat inserted into a graphite tube atomizer. These elements could not be determined by the use of a commercial graphite tube, In the atomization from a tantalum boat, better analytical sensitivities and negligible memory effects for these rare earths are obtained. The analytical sensitivities of yttrium, samarium, and dysprodium with the tantalum boat were 0.60 ng, 0.86 ng, and 0.17 ng respectively. This method was applied for the determination of yttrium, samarium, and dysprosium in a mish metal. The measurements were performed with slightly acidified solutions (0.01 mol dm 3 HCI or HNO 3 ). The sensitivities and the precisions for these elements decreased with increasing acid concentration. An enhancement in the sensitivities of yttrium and dysprosium upon the addition of a large excess of lanthanum, neodymium, and praseodymium salts were observed. The yttrium, samarium, and dysprosium in a mish metal were determined with both analytical curves of standard solutions containing an excess of lanthanum, cerium, and neodymium ions and of the standard addition. The precisions for this work were in the 3 - 9.3% range. (author)

  7. Workplace testing of the new single sphere neutron spectrometer based on Dysprosium activation foils (Dy-SSS)

    International Nuclear Information System (INIS)

    Bedogni, R.; Gómez-Ros, J.M.; Esposito, A.; Gentile, A.; Chiti, M.; Palacios-Pérez, L.; Angelone, M.; Tana, L.

    2012-01-01

    A photon insensitive passive neutron spectrometer consisting of a single moderating polyethylene sphere with Dysprosium activation foils arranged along three perpendicular axes was designed by CIEMAT and INFN. The device is called Dy-SSS (Dy foil-based Single Sphere Spectrometer). It shows nearly isotropic response in terms of neutron fluence up to 20 MeV. The first prototype, previously calibrated with 14 MeV neutrons, has been recently tested in workplaces having different energy and directional distributions. These are a 2.5 MeV nearly mono-chromatic and mono-directional beam available at the ENEA Frascati Neutron Generator (FNG) and the photo-neutron field produced in a 15 MV Varian CLINAC DHX medical accelerator, located in the Ospedale S. Chiara (Pisa). Both neutron spectra are known through measurements with a Bonner Sphere Spectrometer. In both cases the experimental response of the Dy-SSS agrees with the reference data. Moreover, it is demonstrated that the spectrometric capability of the new device are independent from the directional distribution of the neutron field. This opens the way to a new generation of moderation-based neutron instruments, presenting all advantages of the Bonner sphere spectrometer without the disadvantage of the repeated exposures. This concept is being developed within the NESCOFI@BTF project of INFN (Commissione Scientifica Nazionale 5).

  8. Workplace testing of the new single sphere neutron spectrometer based on Dysprosium activation foils (Dy-SSS)

    Science.gov (United States)

    Bedogni, R.; Gómez-Ros, J. M.; Esposito, A.; Gentile, A.; Chiti, M.; Palacios-Pérez, L.; Angelone, M.; Tana, L.

    2012-08-01

    A photon insensitive passive neutron spectrometer consisting of a single moderating polyethylene sphere with Dysprosium activation foils arranged along three perpendicular axes was designed by CIEMAT and INFN. The device is called Dy-SSS (Dy foil-based Single Sphere Spectrometer). It shows nearly isotropic response in terms of neutron fluence up to 20 MeV. The first prototype, previously calibrated with 14 MeV neutrons, has been recently tested in workplaces having different energy and directional distributions. These are a 2.5 MeV nearly mono-chromatic and mono-directional beam available at the ENEA Frascati Neutron Generator (FNG) and the photo-neutron field produced in a 15 MV Varian CLINAC DHX medical accelerator, located in the Ospedale S. Chiara (Pisa). Both neutron spectra are known through measurements with a Bonner Sphere Spectrometer. In both cases the experimental response of the Dy-SSS agrees with the reference data. Moreover, it is demonstrated that the spectrometric capability of the new device are independent from the directional distribution of the neutron field. This opens the way to a new generation of moderation-based neutron instruments, presenting all advantages of the Bonner sphere spectrometer without the disadvantage of the repeated exposures. This concept is being developed within the NESCOFI@BTF project of INFN (Commissione Scientifica Nazionale 5).

  9. Workplace testing of the new single sphere neutron spectrometer based on Dysprosium activation foils (Dy-SSS)

    Energy Technology Data Exchange (ETDEWEB)

    Bedogni, R., E-mail: roberto.bedogni@lnf.infn.it [INFN-LNF (Frascati National Laboratories), Via E. Fermi n. 40-00044 Frascati (Italy); Gomez-Ros, J.M. [INFN-LNF (Frascati National Laboratories), Via E. Fermi n. 40-00044 Frascati (Italy); CIEMAT, Av. Complutense 40, 28040 Madrid (Spain); Esposito, A.; Gentile, A.; Chiti, M.; Palacios-Perez, L. [INFN-LNF (Frascati National Laboratories), Via E. Fermi n. 40-00044 Frascati (Italy); Angelone, M. [ENEA C.R. Frascati, C.P. 65, 00044 Frascati (Italy); Tana, L. [A.O. Universitaria Pisana-Ospedale S. Chiara, Via Bonanno Pisano, Pisa (Italy)

    2012-08-21

    A photon insensitive passive neutron spectrometer consisting of a single moderating polyethylene sphere with Dysprosium activation foils arranged along three perpendicular axes was designed by CIEMAT and INFN. The device is called Dy-SSS (Dy foil-based Single Sphere Spectrometer). It shows nearly isotropic response in terms of neutron fluence up to 20 MeV. The first prototype, previously calibrated with 14 MeV neutrons, has been recently tested in workplaces having different energy and directional distributions. These are a 2.5 MeV nearly mono-chromatic and mono-directional beam available at the ENEA Frascati Neutron Generator (FNG) and the photo-neutron field produced in a 15 MV Varian CLINAC DHX medical accelerator, located in the Ospedale S. Chiara (Pisa). Both neutron spectra are known through measurements with a Bonner Sphere Spectrometer. In both cases the experimental response of the Dy-SSS agrees with the reference data. Moreover, it is demonstrated that the spectrometric capability of the new device are independent from the directional distribution of the neutron field. This opens the way to a new generation of moderation-based neutron instruments, presenting all advantages of the Bonner sphere spectrometer without the disadvantage of the repeated exposures. This concept is being developed within the NESCOFI@BTF project of INFN (Commissione Scientifica Nazionale 5).

  10. 49 CFR 173.340 - Tear gas devices.

    Science.gov (United States)

    2010-10-01

    ... SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.340 Tear gas devices. (a) Packagings for...) Tear gas devices may not be assembled with, or packed in the same packaging with, mechanically- or manually-operated firing, igniting, bursting, or other functioning elements unless of a type and design...

  11. 40 CFR 98.173 - Calculating GHG emissions.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING Iron and Steel Production § 98.173 Calculating GHG emissions... for the process as specified in paragraphs (b)(1)(i) through (b)(1)(vii) of this section. The... the gaseous fuel (kg/kg-mole). MVC = Molar volume conversion factor (849.5 scf per kg-mole at standard...

  12. 33 CFR 173.27 - Numbers: Display; size; color.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Numbers: Display; size; color...: Display; size; color. (a) Each number required by § 173.15 must: (1) Be painted on or permanently attached...; (3) Contrast with the color of the background and be distinctly visible and legible; (4) Have spaces...

  13. 21 CFR 173.21 - Perfluorinated ion exchange membranes.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Perfluorinated ion exchange membranes. 173.21... ion exchange membranes. Substances identified in paragraph (a) of this section may be safely used as ion exchange membranes intended for use in the treatment of bulk quantities of liquid food under the...

  14. 49 CFR 173.60 - General packaging requirements for explosives.

    Science.gov (United States)

    2010-10-01

    ... explosives contained in the package, so that neither interaction between the explosives and the packaging... 49 Transportation 2 2010-10-01 2010-10-01 false General packaging requirements for explosives. 173...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Definitions, Classification and Packaging for Class 1...

  15. 21 CFR 173.395 - Trifluoromethane sulfonic acid.

    Science.gov (United States)

    2010-04-01

    ...) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Specific Usage Additives § 173.395 Trifluoromethane sulfonic acid. Trifluoromethane sulfonic acid... acid) may safely be used in the production of cocoa butter substitute from palm oil (1-palmitoyl-2...

  16. 14 CFR 135.173 - Airborne thunderstorm detection equipment requirements.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Airborne thunderstorm detection equipment... Aircraft and Equipment § 135.173 Airborne thunderstorm detection equipment requirements. (a) No person may... the aircraft is equipped with either approved thunderstorm detection equipment or approved airborne...

  17. 49 CFR 173.306 - Limited quantities of compressed gases.

    Science.gov (United States)

    2010-10-01

    ... container must be weighed and leak tested. The leak detection equipment must be sufficiently sensitive to... Section 173.306 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS... softening provided that it does not leak. (vi) As an alternative to the hot water bath test in paragraph (a...

  18. 49 CFR 173.312 - Requirements for shipment of MEGCs.

    Science.gov (United States)

    2010-10-01

    ...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Gases; Preparation and Packaging § 173.312 Requirements... MEGC's structural or service equipment may be affected. (4) No person may fill or offer for... requalification due date. (5) Prior to filling and offering a MEGC for transportation, the MEGC's structural and...

  19. 49 CFR 173.7 - Government operations and materials.

    Science.gov (United States)

    2010-10-01

    ...) Determining the airworthiness and directing maintenance of the aircraft; and (3) Dispatching the aircraft... REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS General § 173.7 Government operations and materials. (a) Hazardous... regulations in this subchapter or in packagings of equal or greater strength and efficiency as certified by...

  20. Oxide perovskites with tetravalent dysprosium and compounds of the type Ba/sub 3/RE/sub 4/O/sub 9/ (RE = Rare Earth Element)

    Energy Technology Data Exchange (ETDEWEB)

    Brauer, G; Kristen, H [Freiburg Univ. (Germany, F.R.)

    1980-03-01

    In analogy to our investigations concerning tetravalent Nd in oxide perovskites, we also tried to stabilize dysprosium(IV) by incorporation in host-lattices with the perovskite structure. As host-lattices we used BaCeO/sub 3/, BaTbO/sub 3/, and SrTbO/sub 3/. Only in Ba(Ce, Dy)O/sub 3/ we could trace Dy(IV) with certainty. Among the prepared mixed oxides, also the phase Ba/sub 3/Dy/sub 4/O/sub 9/ occured. The lattice parameters of several phases of this latter type were redetermined.

  1. Effect of solvents on relation of intensities of bands of luminescence spectra of terbium and dysprosium ions in solutions of their complexes with acetoacetic ester

    International Nuclear Information System (INIS)

    Kononenko, L.I.; Bel'tyukova, S.V.; Meshkova, S.B.; Kravchenko, T.B.; Poluehktov, N.S.

    1978-01-01

    An investigation is made of the effect of different solvents on the ratio of the intensity of luminescence spectrum bands of terbium and dysprosium ions, corresponding and not corresponding to ''supersensitive'' transitions in complex compounds with acetoacetic ether. A dependence is established between these values and the dielectric constant of the solvent, and also parallels in their changes, which indicate the similar manifestation of the effect of solvents in both elements. A correlation is observed between ratios of the intensity of luminescence spectrum bands and values of forces of neodymium complex absorption band oscillators in different solvents

  2. Optical amplifier operating at 1.3 microns useful for telecommunications and based on dysprosium-doped metal chloride host materials

    Energy Technology Data Exchange (ETDEWEB)

    Page, R.H.; Schaffers, K.I.; Payne, S.A.; Krupke, W.F.; Beach, R.J.

    1997-12-02

    Dysprosium-doped metal chloride materials offer laser properties advantageous for use as optical amplifiers in the 1.3 {micro}m telecommunications fiber optic network. The upper laser level is characterized by a millisecond lifetime, the host material possesses a moderately low refractive index, and the gain peak occurs near 1.31 {micro}m. Related halide materials, including bromides and iodides, are also useful. The Dy{sup 3+}-doped metal chlorides can be pumped with laser diodes and yield 1.3 {micro}m signal gain levels significantly beyond those currently available. 9 figs.

  3. Optical amplifier operating at 1.3 microns useful for telecommunications and based on dysprosium-doped metal chloride host materials

    Energy Technology Data Exchange (ETDEWEB)

    Page, Ralph H. (San Ramon, CA); Schaffers, Kathleen I. (Pleasanton, CA); Payne, Stephen A. (Castro Valley, CA); Krupke, William F. (Pleasanton, CA); Beach, Raymond J. (Livermore, CA)

    1997-01-01

    Dysprosium-doped metal chloride materials offer laser properties advantageous for use as optical amplifiers in the 1.3 .mu.m telecommunications fiber optic network. The upper laser level is characterized by a millisecond lifetime, the host material possesses a moderately low refractive index, and the gain peak occurs near 1.31 .mu.m. Related halide materials, including bromides and iodides, are also useful. The Dy.sup.3+ -doped metal chlorides can be pumped with laser diodes and yield 1.3 .mu.m signal gain levels significantly beyond those currently available.

  4. Determination of Diclofenac on a Dysprosium Nanowire- Modified Carbon Paste Electrode Accomplished in a Flow Injection System by Advanced Filtering

    Directory of Open Access Journals (Sweden)

    Ali Akbar Moosavi-Movahedi

    2009-09-01

    Full Text Available A new detection technique called Fast Fourier Transform Square-Wave Voltammetry (FFT SWV is based on measurements of electrode admittance as a function of potential. The response of the detector (microelectrode, which is generated by a redox processes, is fast, which makes the method suitable for most applications involving flowing electrolytes. The carbon paste electrode was modified by nanostructures to improve sensitivity. Synthesized dysprosium nanowires provide a more effective nanotube-like surface [1-4] so they are good candidates for use as a modifier for electrochemical reactions. The redox properties of diclofenac were used for its determination in human serum and urine samples. The support electrolyte that provided a more defined and intense peak current for diclofenac determination was a 0.05 mol L−1 acetate buffer pH = 4.0. The drug presented an irreversible oxidation peak at 850 mV vs. Ag/AgCl on a modified nanowire carbon paste electrode which produced high current and reduced the oxidation potential by about 100 mV. Furthermore, the signal-to-noise ratio was significantly increased by application of a discrete Fast Fourier Transform (FFT method, background subtraction and two-dimensional integration of the electrode response over a selected potential range and time window. To obtain the much sensivity the effective parameters such as frequency, amplitude and pH was optimized. As a result, CDL of 2.0 × 10−9 M and an LOQ of 5.0 × 10−9 M were found for the determination for diclofenac. A good recovery was obtained for assay spiked urine samples and a good quantification of diclofenac was achieved in a commercial formulation.

  5. On the annealing behaviour of dysprosium ion implanted nickel: a combined study using Rutherford backscattering, transmission electron microscopy, and total current spectroscopy

    International Nuclear Information System (INIS)

    Chadderton, L.T.; Johnson, E.

    1977-01-01

    Despite continuing improvements in applications of the analytical method of Rutherford backscattering (RBS) to solid state physics it is recognized that more complete information can be obtained if other techniques - for example transmission electron microscopy (TEM) - are employed simultaneously. Experiments are described in which a combined RBS and TEM study of the annealing of nickel, rendered amorphous by implantation of 20 keV dysprosium ions is supplemented with a completely new technique - total current spectroscopy (TCS). In TCS low energy electrons (0-15 eV) are used to probe the damaged nickel. Observations have been made during annealing of both the reappearance of the bulk band structure of the metal and of a 'surface peak' which is highly sensitive to the recovery process. Changes in the height of the surface peak reveal three sharp annealing stages, the first two being preceded by reverse annealing which correlates well with RBS and TEM results. The first annealing stage - following the amorphous to crystalline transition - may be associated with electronic effects in the vicinity of the Curie point. Changes in the position of the surface peak allow one to trace the diffusion of dysprosium to the surface. Quantum mechanical resonances at the damage/crystal interface have also been followed throughout annealing. The initially amorphous layer (approximately 2.2nm) increases in thickness slightly during recovery. (Auth.)

  6. 49 CFR 173.189 - Batteries containing sodium or cells containing sodium.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Batteries containing sodium or cells containing sodium. 173.189 Section 173.189 Transportation Other Regulations Relating to Transportation PIPELINE AND... Than Class 1 and Class 7 § 173.189 Batteries containing sodium or cells containing sodium. (a...

  7. 36 CFR 1192.173 - Automated guideway transit vehicles and systems.

    Science.gov (United States)

    2010-07-01

    .... Vertical alignment may be accomplished by vehicle air suspension or other suitable means of meeting the... vehicles and systems. 1192.173 Section 1192.173 Parks, Forests, and Public Property ARCHITECTURAL AND... TRANSPORTATION VEHICLES Other Vehicles and Systems § 1192.173 Automated guideway transit vehicles and systems. (a...

  8. 49 CFR 173.182 - Barium azide-50 percent or more water wet.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Barium azide-50 percent or more water wet. 173.182 Section 173.182 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS... Class 1 and Class 7 § 173.182 Barium azide—50 percent or more water wet. Barium azide—50 percent or more...

  9. 19 CFR 191.173 - Imported duty-paid derivatives (no manufacture).

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Imported duty-paid derivatives (no manufacture). 191.173 Section 191.173 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND... § 191.173 Imported duty-paid derivatives (no manufacture). When the basis for drawback under 19 U.S.C...

  10. Four new dysprosium and neodymium octamolybdate hydrates: assembly of RE2(Mo8O27) sheets and topotactic transformations.

    Science.gov (United States)

    Kuang, Xiaojun; Evans, Ivana R

    2010-07-05

    Four new Dy and Nd hydrated octamolybdate materials have been prepared: [Dy(2)(H(2)O)(12)](Mo(8)O(27)) x 8 H(2)O, [Dy(2)(H(2)O)(6)](Mo(8)O(27)), [Nd(2)(H(2)O)(12)](Mo(8)O(27)) x 6 H(2)O, and [Nd(2)(H(2)O)(6)]Mo(8)O(27) x 3 H(2)O. They adopt one known and three new structure types, which we have determined ab initio from powder X-ray diffraction data. The four compounds contain the same basic structural building block, in the form of RE(2)Mo(8)O(27) (RE = Dy, Nd) chains, which are arranged differently for the two rare earths in the fully hydrated precursor materials. [Dy(2)(H(2)O)(12)](Mo(8)O(27)) x 8 H(2)O comprises isolated Dy(2)Mo(8)O(27) chains assembled in a zigzag manner along the a axis with interspersed crystallized water molecules, which differs from the parallel arrangements of isolated Nd(2)Mo(8)O(27) chains in [Nd(2)(H(2)O)(12)](Mo(8)O(27)) x 6 H(2)O. Partial dehydration of the two precursors leads to new phases [Dy(2)(H(2)O)(6)](Mo(8)O(27)) and [Nd(2)(H(2)O)(6)]Mo(8)O(27) x 3 H(2)O, respectively, prior to complete dehydration, which leads to initially amorphous and eventually crystalline rare-earth molybdenum mixed metal oxides. Both initial transformations occur topotactically. Partial dehydration of the Dy phase condenses the assembly of the Dy(2)Mo(8)O(27) chains principally along the a axis, leading to a 3-dimensional (3D) framework, with each Dy bridging two (Mo(8)O(27))(6-) sheets in the product. The partial dehydration of the Nd precursor condenses the assembly of Nd(2)Mo(8)O(27) chains along the [110] axis, leading to a 3D framework where each Nd bridges three (Mo(8)O(27))(6-) units. Both new dysprosium octamolybdates adopt noncentrosymmetric polar structures in space group P2(1) and are second harmonic generation (SHG) active.

  11. Microstructure and thermal properties of dysprosium and thulium co-doped barium titanate ceramics for high performance multilayer ceramic capacitors

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jinseong; Kim, Dowan; Noh, Taimin [School of Materials Science and Engineering, Pusan National University, Busan 609-735 (Korea, Republic of); Ahn, Byungmin [Department of Chemical Engineering and Materials Science, University of Southern California, Los Angeles, CA 90089-0241 (United States); Lee, Heesoo, E-mail: heesoo@pusan.ac.kr [School of Materials Science and Engineering, Pusan National University, Busan 609-735 (Korea, Republic of)

    2011-09-15

    Highlights: > Dy/Tm co-doping method in BaTiO{sub 3} was suggested to improve electrical properties and temperature stability simultaneously. > We examined these properties in terms of microstructural analysis and substitution rate. > Increase of Dy{sub 2}O{sub 3} addition enhanced dielectric constant. > Increase of Tm{sub 2}O{sub 3} addition enhanced temperature stability. > Improved electrical properties and temperature stability through Dy/Tm co-doping were deduced from formation of electrons and core-shell structure. - Abstract: The co-doping characteristics on microstructure and thermal properties of barium titanate (BaTiO{sub 3}) were investigated to elucidate formation of core-shell structure by dysprosium (Dy) and thulium (Tm) addition in the BaTiO{sub 3}-Dy{sub 2}O{sub 3}-Tm{sub 2}O{sub 3} system. The dielectrics co-doped with 0.7 mol% Dy{sub 2}O{sub 3} and 0.3 mol% Tm{sub 2}O{sub 3} had the dielectric constant up to 2200 as a function of temperature, which was 30% higher than that of specimen containing only Tm{sub 2}O{sub 3} at the room temperature. It could be explained by the fact that the increase of Dy{sub 2}O{sub 3} addition contributed to the improvement of dielectric constant. On the other hand, the rapid diffusion rate of Dy{sup 3+} ions in BaTiO{sub 3} showed an adverse effect on temperature stability caused by destruction of core-shell. As the compensation for shell expansion in BaTiO{sub 3}, the reinforcement of the core-shell structure through the addition of Tm{sub 2}O{sub 3} was confirmed by TEM-EDS analysis and attributed the temperature coefficient of capacitance (TCC) in a reliability condition (-55 deg. C to 125 deg. C, {Delta}C = {+-}15% or less). The enhanced electrical properties and temperature stability could be deduced from the generation of electrons and the formation core-shell structure in co-doped BaTiO{sub 3} system respectively.

  12. Single-molecule magnet behavior in an octanuclear dysprosium(iii) aggregate inherited from helical triangular Dy3 SMM-building blocks.

    Science.gov (United States)

    Zhang, Li; Zhang, Peng; Zhao, Lang; Wu, Jianfeng; Guo, Mei; Tang, Jinkui

    2016-06-28

    An unprecedented octanuclear dysprosium(iii) cluster with the formula [Dy8L6(μ3-OH)4(μ2-CH3O)2(CH3OH)6(H2O)2]·6H2O·10CH3OH·2CH3CN () based on a nonlinearly tritopic aroylhydrazone ligand H3L has been isolated, realizing the successful linking of pairwise interesting triangular Dy3 SMMs. It is noteworthy that two enantiomers (Λ and Δ configurations) individually behaving as a coordination-induced chirality presented in the Dy3 helicate are connected in the meso Dy8 cluster. Remarkably, alternating-current magnetic susceptibility measurements revealed that the Dy8 cluster shows typical SMM behavior inherited from its Dy3 helical precursor. It is one of the rare polynuclear Lnn SMMs (n > 7) under zero dc field.

  13. Study for the determination of samarium, europium,terbium, dysprosium and yttrium in gadolinium oxide matrix by means of atomic absorption spectrophotometry using a graphite furnace

    International Nuclear Information System (INIS)

    Caires, A.C.F.

    1985-01-01

    A study for determination of samarium, europium, terbium, dysprosium and yttrium in a gadolinium oxide matrix by atomic absorption spectrophotometry using a graphite furnace is presented. The best charrring and atomization conditions were estabilished for each element, the most convenient ressonance lines being selected as well. The study was carried out for the mentioned lanthanides both when pure and when in binary mixtures with gadolinium, besides those where all for them were together with gadolinium. The determination limits for pure lanthanides were found to be between 1.3 and 9.6 ng assuming a 20% relative standard deviation as acceptable. The detection limits were in the range 0.51 and 7.5 ng, assuming as positive any answer higher than twofold the standard deviation. (author) [pt

  14. Synthesis and X-ray diffraction studies of dysprosium-calcium ferrites Dy1-xCaxFeO3-y (0≤x≤2/3)

    International Nuclear Information System (INIS)

    Li, J.; Song, D.; Su, Z.; Wang, T.M.

    1997-01-01

    Samples of dysprosium-calcium ferrites Dy 1-x Ca x FeO 3-y with x ranging from 0 to 2/3 were novelly prepared in air by solid state reaction and characterized by X-ray powder diffraction. These samples are single-phased orthorhombic perovskite-type compounds belonging to the space group D 2h 16 -Pbnm. The lattice constants of the Dy 1-x Ca x FeO 3-y samples have been refined by Cohen's least-squares method. The initial substitution of Ca for Dy leads to a decrease of the lattice constants. Further substitution of Ca for Dy has hardly any influence on the lattice dimensions. (orig.)

  15. Lithium perbromate monohydrate at 296 and 173 K

    International Nuclear Information System (INIS)

    Blackburn, A.C.; Gerkin, R.E.

    1995-01-01

    Lithium tetraoxobromate(1-) monohydrate, LiBrO 4 .H 2 O, whose perchlorate analog has not yet been described, is found to be isomorphic with NaBrO 4 .H 2 O and NaClO 4 .H 2 O. Each of the two inequivalent Li ions is coordinated by six O atoms, thus forming distorted octahedra, each of which has three inequivalent Li-O distances. At room temperature, the average Li(1)-O and Li(2)-O distances are 2.150 and 2.164 A, respectively. The perbromate ion displays very nearly regular tetrahedral geometry, although it is not subject to symmetry constraints. At 296 K the average observed Br-O distance is 1.610 (4) A and the average O-Br-O angle is 109.5 (6) , while at 173 K the corresponding values are 1.613 (4) A and 109.5 (7) . The perbromate ion shows rigid-body behavior but the lithium coordination polyhedra do not. At 296 K, the average rigid-body corrected Br-O distance in the perbromate ion is 1.624 (3) A, in excellent agreement with the corresponding value reported for NaBrO 4 .H 2 O. Refinement of the two inequivalent H atoms allowed detailed analysis of the hydrogen bonding, which is more extensive than in NaBrO 4 .H 2 O or in NaClO 4 .H 2 O. The average observed B values for the H atoms [2.9 (3) A 2 at 296 K and 2.8 (3) A 2 at 173 K] are sufficiently small to suggest that dynamic disordering of the H atoms (determined by magnetic resonance methods for NaClO 4 .H 2 O) is not significant in the title salt. (orig.)

  16. 49 CFR 173.474 - Quality control for construction of packaging.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Quality control for construction of packaging. 173...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.474 Quality control for construction of packaging. Prior to the first use of any packaging for the shipment of Class 7...

  17. 49 CFR 173.466 - Additional tests for Type A packagings designed for liquids and gases.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Additional tests for Type A packagings designed...) Materials § 173.466 Additional tests for Type A packagings designed for liquids and gases. (a) In addition to the tests prescribed in § 173.465, Type A packagings designed for liquids and gases must be...

  18. 49 CFR 173.161 - Chemical kits and first aid kits.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Chemical kits and first aid kits. 173.161 Section... Class 7 § 173.161 Chemical kits and first aid kits. (a) Chemical kits and First aid kits must conform to... 10 kg. (b) Chemical kits and First aid kits are excepted from the specification packaging...

  19. 30 CFR 206.173 - How do I calculate the alternative methodology for dual accounting?

    Science.gov (United States)

    2010-07-01

    ... measured at facility measurement points whose quality exceeds 1,000 Btu/cf are subject to dual accounting... for dual accounting? 206.173 Section 206.173 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT... the alternative methodology for dual accounting? (a) Electing a dual accounting method. (1) If you are...

  20. 49 CFR 173.172 - Aircraft hydraulic power unit fuel tank.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Aircraft hydraulic power unit fuel tank. 173.172... Class 1 and Class 7 § 173.172 Aircraft hydraulic power unit fuel tank. Aircraft hydraulic power unit fuel tanks containing a mixture of anhydrous hydrazine and monomethyl hydrazine (M86 fuel) and designed...

  1. 49 CFR 173.159a - Exceptions for non-spillable batteries.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Exceptions for non-spillable batteries. 173.159a... Class 1 and Class 7 § 173.159a Exceptions for non-spillable batteries. (a) Exceptions for hazardous...-spillable batteries offered for transportation or transported in accordance with this section are subject to...

  2. 21 CFR 173.140 - Esterase-lipase derived from Mucor miehei.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Esterase-lipase derived from Mucor miehei. 173.140... HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.140 Esterase-lipase derived from Mucor miehei. Esterase-lipase enzyme, consisting of enzyme derived from Mucor miehei var. Cooney et Emerson by...

  3. 19 CFR 173.5 - Review of entry covering household or personal effects.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Review of entry covering household or personal effects. 173.5 Section 173.5 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND... authority to grant. Where the port director has no authority to grant the waiver, the application shall be...

  4. 21 CFR 173.145 - Alpha-Galactosidase derived from Mortierella vinaceae var. raffinoseutilizer.

    Science.gov (United States)

    2010-04-01

    ... vinaceae var. raffinoseutilizer. 173.145 Section 173.145 Food and Drugs FOOD AND DRUG ADMINISTRATION... Alpha-Galactosidase derived from Mortierella vinaceae var. raffinoseutilizer. The food additive alpha-galactosidase and parent mycelial microorganism Mortierella vinaceae var. raffinoseutilizer may be safely used...

  5. 33 CFR 173.85 - Fees levied by the Coast Guard.

    Science.gov (United States)

    2010-07-01

    .... 173.85 Section 173.85 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) BOATING SAFETY VESSEL NUMBERING AND CASUALTY AND ACCIDENT REPORTING Issue of Certificate of.... (b) Fees are payable by check or money-order made payable to the “U.S. Coast Guard”; by major credit...

  6. 21 CFR 173.280 - Solvent extraction process for citric acid.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Solvent extraction process for citric acid. 173.280... HUMAN CONSUMPTION Solvents, Lubricants, Release Agents and Related Substances § 173.280 Solvent extraction process for citric acid. A solvent extraction process for recovery of citric acid from...

  7. 21 CFR 173.70 - Chloromethylated aminated styrene-divinylbenzene resin.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Chloromethylated aminated styrene-divinylbenzene resin. 173.70 Section 173.70 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Polymer...

  8. 49 CFR 173.426 - Excepted packages for articles containing natural uranium or thorium.

    Science.gov (United States)

    2010-10-01

    ... outer surface of the uranium or thorium is enclosed in an inactive sheath made of metal or other durable... uranium or thorium. 173.426 Section 173.426 Transportation Other Regulations Relating to Transportation....426 Excepted packages for articles containing natural uranium or thorium. A manufactured article in...

  9. Influence of intramolecular f-f interactions on nuclear spin driven quantum tunneling of magnetizations in quadruple-decker phthalocyanine complexes containing two terbium or dysprosium magnetic centers.

    Science.gov (United States)

    Fukuda, Takamitsu; Matsumura, Kazuya; Ishikawa, Naoto

    2013-10-10

    Nuclear spin driven quantum tunneling of magnetization (QTM) phenomena, which arise from admixture of more than two orthogonal electronic spin wave functions through the couplings with those of the nuclear spins, are one of the important magnetic relaxation processes in lanthanide single molecule magnets (SMMs) in the low temperature range. Although recent experimental studies have indicated that the presence of the intramolecular f-f interactions affects their magnetic relaxation processes, little attention has been given to their mechanisms and, to the best of our knowledge, no rational theoretical models have been proposed for the interpretations of how the nuclear spin driven QTMs are influenced by the f-f interactions. Since quadruple-decker phthalocyanine complexes with two terbium or dysprosium ions as the magnetic centers show moderate f-f interactions, these are appropriate to investigate the influence of the f-f interactions on the dynamic magnetic relaxation processes. In the present paper, a theoretical model including ligand field (LF) potentials, hyperfine, nuclear quadrupole, magnetic dipolar, and the Zeeman interactions has been constructed to understand the roles of the nuclear spins for the QTM processes, and the resultant Zeeman plots are obtained. The ac susceptibility measurements of the magnetically diluted quadruple-decker monoterbium and diterbium phthalocyanine complexes, [Tb-Y] and [Tb-Tb], have indicated that the presence of the f-f interactions suppresses the QTMs in the absence of the external magnetic field (H(dc)) being consistent with previous reports. On the contrary, the faster magnetic relaxation processes are observed for [Tb-Tb] than [Tb-Y] at H(dc) = 1000 Oe, clearly demonstrating that the QTMs are rather enhanced in the presence of the external magnetic field. Based on the calculated Zeeman diagrams, these observations can be attributed to the enhanced nuclear spin driven QTMs for [Tb-Tb]. At the H(dc) higher than 2000 Oe, the

  10. Multi-quasi-particle states in 173Hf

    International Nuclear Information System (INIS)

    Fabricius, B.; Dracoulis, G.D.; Kibedi, T.; Stuchbery, A.E.; Baxter, A.M.

    1991-01-01

    Rotational bands built on 1, 3 and 5 quasi-particle (qp) states in 173 Hf have been populated to medium and high spins through the 160 Gd( 18 O, 5n) reaction. The 1qp bands, previously identified as the 1/2 - [521], 5/2 - [512] and 7/2 + [633] (mixed i 13/2 ) Nilsson configurations, have been extended past the first back-bend and show different alignment properties, possibly originating from deformation differences. The multi-particle states were identified from excitation energies, the properties of their associated band structures and decay patterns. The 3qp states are the previously known K π =19/2 + and 23/2 - isomeric states originating from the 7/2 + [633] quasi-neutron coupled to the 6 + and 8 - , 2-quasi-proton excitations and a K π =(13/2 + ) state possibly containing the three lowest quasi-neutrons. A 5qp state with K π =(29/2 - ) was identified as the same three lowest lying quasi-neutrons coupled to the 8 - , 2-quasi-proton excitation. The low excitation energies of these two related 3- and 5-quasi-particle states implies a reduced neutron pairing gap, which can be attributed to the effect of blocking. (orig.)

  11. Multi-quasi-particles states in 173Hf

    International Nuclear Information System (INIS)

    Fabricius, B.; Dracoulis, G.D.; Kibedi, T.; Stuchbery, A.E.; Baxter, A.M.

    1990-10-01

    Rotational bands built on 1, 3 and 5 quasi-particle (qp) states in 173 Hf have been populated to medium and high spins through the 160 Gd ( 18 O,5n) reaction. The 1qp bands, previously identified as the 1/2 - [521], 5/2 - [512] and 7/2 + [633] (mixed i 1 3 /2 ) Nilsson configurations, have been extended past the first back-bend and show different alignment properties, possibly originating from deformation differences. The multi-particle states were identified from excitation energies, the properties of their associated band structures and decay patterns. The 3 qp states are the previously known K π 19/2 + and 23/2 - isomeric states originating from the 7/2 + [633] quasi-neutron coupled to the 6 + and 8 - , 2-quasi-proton excitations and a K π = (13/2 + ) state possibly containing the three lowest quasi-neutrons. A 5 qp state with K π = (29/2 - ) was identified as the same three lowest lying quasi-neutrons coupled to the 8 - , 2-quasi-proton excitation. The low excitation energies of these two related 3- and 5-quasi-particle states implies a reduced neutron pairing gap, which can be attributed to the effect of blocking. 28 refs., 2 tabs., 9 figs

  12. Dual-mode T_1 and T_2 magnetic resonance imaging contrast agent based on ultrasmall mixed gadolinium-dysprosium oxide nanoparticles: synthesis, characterization, and in vivo application

    International Nuclear Information System (INIS)

    Tegafaw, Tirusew; Xu, Wenlong; Ahmad, Md Wasi; Lee, Gang Ho; Baeck, Jong Su; Chang, Yongmin; Bae, Ji Eun; Chae, Kwon Seok; Kim, Tae Jeong

    2015-01-01

    A new type of dual-mode T_1 and T_2 magnetic resonance imaging (MRI) contrast agent based on mixed lanthanide oxide nanoparticles was synthesized. Gd"3"+ ("8S_7_/_2) plays an important role in T_1 MRI contrast agents because of its large electron spin magnetic moment resulting from its seven unpaired 4f-electrons, and Dy"3"+ ("6H_1_5_/_2) has the potential to be used in T_2 MRI contrast agents because of its very large total electron magnetic moment: among lanthanide oxide nanoparticles, Dy_2O_3 nanoparticles have the largest magnetic moments at room temperature. Using these properties of Gd"3"+ and Dy"3"+ and their oxide nanoparticles, ultrasmall mixed gadolinium-dysprosium oxide (GDO) nanoparticles were synthesized and their potential to act as a dual-mode T_1 and T_2 MRI contrast agent was investigated in vitro and in vivo. The D-glucuronic acid coated GDO nanoparticles (d_a_v_g = 1.0 nm) showed large r_1 and r_2 values (r_2/r_1 ≈ 6.6) and as a result clear dose-dependent contrast enhancements in R_1 and R_2 map images. Finally, the dual-mode imaging capability of the nanoparticles was confirmed by obtaining in vivo T_1 and T_2 MR images. (paper)

  13. Extraction of Dysprosium Ions with DTPA Functionalized Superparamagnetic Nanoparticles Probed by Energy Dispersive X-ray Fluorescence and TEM/High-Angle Annular Dark Field Imaging.

    Science.gov (United States)

    Melo, Fernando Menegatti de; Almeida, Sabrina da Nobrega; Uezu, Noemi Saori; Ramirez, Carlos Alberto Ospina; Santos, Antonio Domingues Dos; Toma, Henrique Eisi

    2018-06-01

    The extraction of dysprosium (Dy3+) ions from aqueous solution was carried out successfully, using magnetite (Fe3O4) nanoparticles functionalized with diethylenetriaminepentaacetic acid (MagNP@DTPA). The process was monitored by energy dispersive X-ray fluorescence spectroscopy, as a function of concentration, proceeding according to a Langmuir isotherm with an equilibrium constant of 2.57 × 10-3 g(MagNP) L-1 and a saturation limit of 63.2 mgDy/gMagNP. The presence of paramagnetic Dy3+ ions attached to the superparamagnetic nanoparticles led to an overall decrease of magnetization. By imaging the nanoparticles surface using scanning transmission electron microscopy equipped with high resolution elemental analysis, it was possible to probe the binding of the Dy3+ ions to DTPA, and to show their distribution in a region of negative magnetic field gradients. This finding is coherent with the observed decrease of magnetization, associated with the antiferromagnetic coupling between the lanthanide ions and the Fe3O4 core.

  14. 49 CFR 17.3 - What programs and activities of the Department are subject to these regulations?

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false What programs and activities of the Department are subject to these regulations? 17.3 Section 17.3 Transportation Office of the Secretary of Transportation INTERGOVERNMENTAL REVIEW OF DEPARTMENT OF TRANSPORTATION PROGRAMS AND ACTIVITIES § 17.3 What programs and activities...

  15. 49 CFR 173.418 - Authorized packages-pyrophoric Class 7 (radioactive) materials.

    Science.gov (United States)

    2010-10-01

    ... must not be fissile unless excepted by § 173.453; (b) Contained in sealed and corrosion resistant receptacles with positive closures (friction or slip-fit covers or stoppers are not authorized); (c) Free of...

  16. Global use structures of the magnetic materials neodymium and dysprosium. A scenario-based analysis of the effect of the diffusion of electromobility on the demand for rare earths; Globale Verwendungsstrukturen der Magnetwerkstoffe Neodym und Dysprosium. Eine szenariobasierte Analyse der Auswirkung der Diffusion der Elektromobilitaet auf den Bedarf an Seltenen Erden

    Energy Technology Data Exchange (ETDEWEB)

    Gloeser-Chahoud, Simon; Kuehn, Andre; Tercero Espinoza, Luis

    2016-06-15

    Neodymium-iron-boron magnets (NdFeB) have experienced a significant demand as the most powerful permanent magnet in recent years, especially for the manufacture of compact electric servomotors with high efficiency and high power density, especially for mobile applications in hybrid traction motors and electric vehicles or for electric bikes. However, NdFeB magnets are also increasingly being used in general mechanical engineering (conveying and pumping systems, tools, air conditioning systems, lift motors, etc.), in the small electric motors of conventional passenger cars or in the generators of large wind power plants with permanent magnetic direct drive. Nevertheless, there is still high uncertainty in the use structures of NdFeB magnets and the contained rare earth elements neodymium and dysprosium. An effective instrument for increasing the market transparency and the understanding of complex anthropogenic material cycles is the dynamic material flow modeling. In the present work paper, this instrument is used for an in-depth analysis of the use structures of NdFeB magnets and the contained rare earths on a global scale. The dynamic modeling of product usage cycles reveals today's usage structures and quantifies future magnetic quantities in obsolete product flows. It could be shown that the magnets in today's scrap volume are mainly contained in obsolete electronics applications such as hard disks (HDD), CD and DVD drives, which makes the recycling hardly seem to be economical due to the small magnets and the high material spread, but in the foreseeable future with larger magnetic quantities from synchronous servomotors and generators can be expected, which significantly increases the recycling potential. In a further step, the effect of the diffusion of alternative drives in the automotive market on the dysprosium requirement is analyzed using a system dynamics model and possible adaptation mechanisms in the form of different substitution effects in

  17. Synthesis and characterization of a family of structurally characterized dysprosium alkoxides for improved fatigue-resistance characteristics of PDyZT thin films.

    Science.gov (United States)

    Boyle, Timothy J; Bunge, Scott D; Clem, Paul G; Richardson, Jacob; Dawley, Jeffrey T; Ottley, Leigh Anna M; Rodriguez, Mark A; Tuttle, Bruce A; Avilucea, Gabriel R; Tissot, Ralph G

    2005-03-07

    Using either an ammoniacal route, the reaction between DyCl3, Na0, and HOR in liquid ammonia, or preferentially reacting Dy(N(SiMe3)2)3 with HOR in a solvent, we isolated a family of dysprosium alkoxides as [Dy(mu-ONep)2(ONep)]4 (1), (ONep)2Dy[(mu3-ONep)(mu-ONep)Dy(ONep)(THF)]2(mu-ONep) (2), (ONep)2Dy[(mu3-ONep)(mu-ONep)Dy(ONep)(py)]2(mu-ONep) (3), [Dy3(mu3-OBut)2(mu-OBut3(OBut)4(HOBut)2] (4), [Dy3(mu3-OBut)2(mu-OBut)3(OBut)4(THF)2] (5), [Dy3(mu3-OBut)2(mu-OBut)3(OBut)4(py)2] (6), (DMP)Dy(mu-DMP)4[Dy(DMP)2(NH3)]2 (7), [Dy(eta6-DMP)(DMP)2]2 (8), Dy(DMP)3(THF)3 (9), Dy(DMP)3(py)3 (10), Dy(DIP)3(NH3)2 (11), [Dy(eta6-DIP)(DIP)2]2 (12), Dy(DIP)3(THF)2 (13), Dy(DIP)3(py)3 (14), Dy(DBP)3(NH3) (15), Dy(DBP)3 (16), Dy(DBP)3(THF) (17), Dy(DBP)3(py)2 (18), [Dy(mu-TPS)(TPS2]2 (19), Dy(TPS)3(THF)3 (20), and Dy(TPS)3(py)3 (21), where ONep = OCH2CMe3, OBut) = OCMe3, DMP = OC6H3(Me)(2)-2,6, DIP = OC6H3(CHMe2)(2)-2,6, DBP = OC6H3(CMe3)(2)-2,6, TPS = OSi(C6H5)3, tol = toluene, THF = tetrahydrofuran, and py = pyridine. We were not able to obtain X-ray quality crystals of compounds 2, 8, and 9. The structures observed and data collected for the Dy compounds are consistent with those reported for its other congeners. A number of these precursors were used as Dy dopants in Pb(Zr0.3Ti0.7)O3 (PZT 30/70) thin films, with compound 12 yielding the highest-quality films. The resulting Pb0.94Dy0.04(Zr0.3Ti0.7)O3 [PDyZT (4/30/70)] had similar properties to PZT (30/70), but showed substantial resistance to polarization reversal fatigue.

  18. The role of dysprosium on the structural and magnetic properties of (Nd_1_−_xDy_x)_2Fe_1_4B nanoparticles

    International Nuclear Information System (INIS)

    Rahimi, Hamed; Ghasemi, Ali; Mozaffarinia, Reza; Tavoosi, Majid

    2017-01-01

    In current work, Nd2Fe14B nanoparticles was synthesized by sol-gel method. Dysprosium powders were added into Nd2Fe14B nanoparticles by mechanical alloying process in order to enhancement of coercivity. The phase analysis, structure, and magnetic properties of annealed (Nd_1_−_xDy_x)_2Fe_1_4B nanoparticles with different Dy-content (x=0.1, 0.2, 0.3, 0.4, 0.5, 0.6) were investigated by employing X-ray diffraction, X-ray photoelectron spectroscopy, energy dispersive spectroscopy, field emission scanning electron microscope, transmission electron microscope and vibrating sample magnetometer techniques. The results showed that with an increase in Dy amounts, the coercivity of particles increased from 2.9 kOe to 13.4 kOe and then decreased to 5.6 kOe. By adding an optimum amount of Dy (x=0.4), the coercivity was significantly increased from 2.9 kOe to 13.4 kOe. The average particle size of annealed (Nd_1_−_xDy_x)_2Fe_1_4B nanoparticles was below 10 nm. Magnetization reversal studies indicate that the coercivity of milled and annealed (Nd_1_−_xDy_x)_2Fe_1_4B nanoparticles is controlled by the nucleation of reversed magnetic domains. The experimental results in the angular dependence of coercivity for (Nd_1_−_xDy_x)_2Fe_1_4B permanent magnets showed that the normalized coercivity of the permanent magnets H_c(θ)/H_c(0) increases from 1 to about 1.2–1.5 with increasing θ from 0 to about π/3, for x=0.4–0.6. - Highlights: • Dy was added to Nd_2Fe_1_4B nanoparticles to improve the coercivity. • A maximum squareness ratio of 0.99 was obtained. • The average particle size decreased with an increase in Dy-content.

  19. Global use structures of the magnetic materials neodymium and dysprosium. A scenario-based analysis of the effect of the diffusion of electromobility on the demand for rare earths

    International Nuclear Information System (INIS)

    Gloeser-Chahoud, Simon; Kuehn, Andre; Tercero Espinoza, Luis

    2016-01-01

    Neodymium-iron-boron magnets (NdFeB) have experienced a significant demand as the most powerful permanent magnet in recent years, especially for the manufacture of compact electric servomotors with high efficiency and high power density, especially for mobile applications in hybrid traction motors and electric vehicles or for electric bikes. However, NdFeB magnets are also increasingly being used in general mechanical engineering (conveying and pumping systems, tools, air conditioning systems, lift motors, etc.), in the small electric motors of conventional passenger cars or in the generators of large wind power plants with permanent magnetic direct drive. Nevertheless, there is still high uncertainty in the use structures of NdFeB magnets and the contained rare earth elements neodymium and dysprosium. An effective instrument for increasing the market transparency and the understanding of complex anthropogenic material cycles is the dynamic material flow modeling. In the present work paper, this instrument is used for an in-depth analysis of the use structures of NdFeB magnets and the contained rare earths on a global scale. The dynamic modeling of product usage cycles reveals today's usage structures and quantifies future magnetic quantities in obsolete product flows. It could be shown that the magnets in today's scrap volume are mainly contained in obsolete electronics applications such as hard disks (HDD), CD and DVD drives, which makes the recycling hardly seem to be economical due to the small magnets and the high material spread, but in the foreseeable future with larger magnetic quantities from synchronous servomotors and generators can be expected, which significantly increases the recycling potential. In a further step, the effect of the diffusion of alternative drives in the automotive market on the dysprosium requirement is analyzed using a system dynamics model and possible adaptation mechanisms in the form of different substitution effects in the

  20. 49 CFR 173.428 - Empty Class 7 (radioactive) materials packaging.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Empty Class 7 (radioactive) materials packaging... SHIPPERS-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.428 Empty Class 7 (radioactive) materials packaging. A packaging which previously contained Class 7 (radioactive...

  1. 49 CFR 173.220 - Internal combustion engines, self-propelled vehicles, mechanical equipment containing internal...

    Science.gov (United States)

    2010-10-01

    ... and vehicles with certain electronic equipment when transported by aircraft or vessel. When an... vehicles, mechanical equipment containing internal combustion engines, and battery powered vehicles or... Than Class 1 and Class 7 § 173.220 Internal combustion engines, self-propelled vehicles, mechanical...

  2. 49 CFR 173.134 - Class 6, Division 6.2-Definitions and exceptions.

    Science.gov (United States)

    2010-10-01

    ... transportation and also capable of cutting or penetrating skin or a packaging material. Sharps includes needles... § 173.199, as appropriate. (9) Dried blood spots or specimens for fecal occult blood detection placed on... cutting or penetrating skin or packaging material, the primary container must be capable of retaining the...

  3. 46 CFR 173.020 - Intact stability standards: Counterballasted and non-counterballasted vessels.

    Science.gov (United States)

    2010-10-01

    ...) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO VESSEL USE Lifting § 173.020 Intact stability standards... vessel that is not equipped to counter-ballast while lifting must be shown by design calculations to... and crane radius. (b) Each vessel must have a righting arm curve with the following characteristics...

  4. 46 CFR 173.025 - Additional intact stability standards: Counterballasted vessels.

    Science.gov (United States)

    2010-10-01

    ...) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO VESSEL USE Lifting § 173.025 Additional intact stability standards: Counterballasted vessels. (a) Each vessel equipped to counterballast while lifting must be shown... loading and operation and at each combination of hook load and crane radius. (b) When doing the...

  5. 49 CFR 173.150 - Exceptions for Class 3 (flammable and combustible liquids).

    Science.gov (United States)

    2010-10-01

    ... HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION HAZARDOUS MATERIALS REGULATIONS... § 173.156. (d) Alcoholic beverages. An alcoholic beverage (wine and distilled spirits as defined in 27...-on baggage; or (3) Is a Packing Group III alcoholic beverage in a packaging of 250 L (66 gallons) or...

  6. 49 CFR 173.221 - Polymeric beads, expandable and Plastic molding compound.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Polymeric beads, expandable and Plastic molding... Than Class 1 and Class 7 § 173.221 Polymeric beads, expandable and Plastic molding compound. (a) Non-bulk shipments of Polymeric beads (or granules), expandable, evolving flammable vapor and Plastic...

  7. 49 CFR 173.195 - Hydrogen cyanide, anhydrous, stabilized (hydrocyanic acid, aqueous solution).

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Hydrogen cyanide, anhydrous, stabilized... Hazardous Materials Other Than Class 1 and Class 7 § 173.195 Hydrogen cyanide, anhydrous, stabilized (hydrocyanic acid, aqueous solution). (a) Hydrogen cyanide, anhydrous, stabilized, must be packed in...

  8. Development of the common law in view of Sections 39(2) and 173 ...

    African Journals Online (AJOL)

    The common (or non-statutory) law has also retained its position, subject however to the superior courts' inherent power, or rather their obligation in terms of section 173 of the Constitution, to develop the common law taking into account the interests of justice. The courts have for a long time had the task of developing the ...

  9. 49 CFR 173.476 - Approval of special form Class 7 (radioactive) materials.

    Science.gov (United States)

    2010-10-01

    ... (radioactive) materials must maintain on file for at least one year after the latest shipment, and provide to... evidence based on calculative methods to show that the material is able to pass the tests; or other... shipping papers as “Radioactive Material, Special Form, n.o.s.” [Amdt. 173-244, 60 FR 50307, Sept. 28, 1995...

  10. Tank 241-B-108, cores 172 and 173 analytical results for the final report

    Energy Technology Data Exchange (ETDEWEB)

    Nuzum, J.L., Fluoro Daniel Hanford

    1997-03-04

    The Data Summary Table (Table 3) included in this report compiles analytical results in compliance with all applicable DQOS. Liquid subsamples that were prepared for analysis by an acid adjustment of the direct subsample are indicated by a `D` in the A column in Table 3. Solid subsamples that were prepared for analysis by performing a fusion digest are indicated by an `F` in the A column in Table 3. Solid subsamples that were prepared for analysis by performing a water digest are indicated by a I.wl. or an `I` in the A column of Table 3. Due to poor precision and accuracy in original analysis of both Lower Half Segment 2 of Core 173 and the core composite of Core 173, fusion and water digests were performed for a second time. Precision and accuracy improved with the repreparation of Core 173 Composite. Analyses with the repreparation of Lower Half Segment 2 of Core 173 did not show improvement and suggest sample heterogeneity. Results from both preparations are included in Table 3.

  11. 49 CFR 173.9 - Transport vehicles or freight containers containing lading which has been fumigated.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Transport vehicles or freight containers... MATERIALS REGULATIONS SHIPPERS-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS General § 173.9 Transport... hazardous material. (b) No person may offer for transportation or transport a rail car, freight container...

  12. 49 CFR 173.164 - Mercury (metallic and articles containing mercury).

    Science.gov (United States)

    2010-10-01

    ... ounces) of mercury per package; (iv) Tubes which are completely jacketed in sealed leakproof metal cases... 49 Transportation 2 2010-10-01 2010-10-01 false Mercury (metallic and articles containing mercury... Than Class 1 and Class 7 § 173.164 Mercury (metallic and articles containing mercury). (a) For...

  13. 49 CFR 173.33 - Hazardous materials in cargo tank motor vehicles.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Hazardous materials in cargo tank motor vehicles... Transportation § 173.33 Hazardous materials in cargo tank motor vehicles. (a) General requirements. (1) No person may offer or accept a hazardous material for transportation in a cargo tank motor vehicle except as...

  14. Are there non-statistical effects in /sup 173/Yb(n,gamma)/sup 174/Yb?

    International Nuclear Information System (INIS)

    Pospisil, S.; Becvar, F.; Chrien, R.E.; Kopecky, J.

    1987-01-01

    The resonance-averaged capture of neutrons in 173 Yb has been studied at energy of 2 keV. With a statistical significance of 99.5% an enhancement of E1-transition to the neutron 2QP levels in 174 Yb is observed. 8 refs

  15. Classroom Materials for Teaching "The Particle Nature of Matter." Practical Paper No. 173.

    Science.gov (United States)

    Pella, Milton O.; And Others

    This document presents the lesson plans and tests used in the research study reported in Technical Report 173 (ED 070 658), together with descriptions of models and films developed for the teaching program. Thirty-one lessons are included, covering the topics of matter and energy; making interferences; particles; a model for matter; particles and…

  16. 25 CFR 1000.173 - How does a newly selected Tribe/Consortium initiate the negotiation phase?

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 2 2010-04-01 2010-04-01 false How does a newly selected Tribe/Consortium initiate the negotiation phase? 1000.173 Section 1000.173 Indians OFFICE OF THE ASSISTANT SECRETARY, INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ANNUAL FUNDING AGREEMENTS UNDER THE TRIBAL SELF-GOVERNMENT ACT AMENDMENTS TO THE INDIAN SELF-DETERMINATION AND EDUCATIO...

  17. 21 CFR 173.320 - Chemicals for controlling microorganisms in cane-sugar and beet-sugar mills.

    Science.gov (United States)

    2010-04-01

    ...-sugar and beet-sugar mills. 173.320 Section 173.320 Food and Drugs FOOD AND DRUG ADMINISTRATION... controlling microorganisms in cane-sugar and beet-sugar mills. Agents for controlling microorganisms in cane-sugar and beet-sugar mills may be safely used in accordance with the following conditions: (a) They are...

  18. 21 CFR 173.315 - Chemicals used in washing or to assist in the peeling of fruits and vegetables.

    Science.gov (United States)

    2010-04-01

    ... peeling of fruits and vegetables. 173.315 Section 173.315 Food and Drugs FOOD AND DRUG ADMINISTRATION... used in washing or to assist in the peeling of fruits and vegetables. Chemicals may be safely used to wash or to assist in the peeling of fruits and vegetables in accordance with the following conditions...

  19. Tumor vessel normalization by the PI3K inhibitor HS-173 enhances drug delivery.

    Science.gov (United States)

    Kim, Soo Jung; Jung, Kyung Hee; Son, Mi Kwon; Park, Jung Hee; Yan, Hong Hua; Fang, Zhenghuan; Kang, Yeo Wool; Han, Boreum; Lim, Joo Han; Hong, Soon-Sun

    2017-09-10

    Tumor vessels are leaky and immature, which causes poor oxygen and nutrient supply to tumor vessels and results in cancer cell metastasis to distant organs. This instability of tumor blood vessels also makes it difficult for anticancer drugs to penetrate and reach tumors. Numerous tumor vessel normalization approaches have been investigated for improving drug delivery into tumors. In this study, we investigated whether phosphoinositide 3-kinase (PI3K) inhibitors are able to improve vascular structure and function over the prolonged period necessary to achieve effective vessel normalization. The PI3K inhibitors, HS-173 and BEZ235 potently suppressed tumor growth and hypoxia, and increased tumor apoptosis in animal models. PI3K inhibitors also induced a regular, flat monolayer of endothelial cells (ECs) in vessels, improving stability of vessel structure, and normalized tumor vessels by increasing vascular maturity, pericyte coverage, basement membrane thickness, and tight-junctions. These effects resulted in a decrease in tumor vessel tortuosity and vessel thinning, and improved vessel function and blood flow. The tumor vessel stabilization effect of the PI3K inhibitor HS-173 also decreased the number of metastatic lung nodules in vivo metastasis model. Furthermore, HS-173 improved the delivery of doxorubicin into the tumor region, enhancing its anticancer effects. Mechanistic studies suggested that PI3K inhibitor HS-173-induced vessel normalization reflected changes in endothelial Notch signaling. Taken together, our findings indicate that vessel normalization by PI3K inhibitors restrained tumor growth and metastasis while improving chemotherapy by enhancing drug delivery into the tumor, suggesting that HS-173 may have a therapeutic value as an enhancer or an anticancer drug. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Extension of the energy range of the experimental activation cross-sections data of longer-lived products of proton induced nuclear reactions on dysprosium up to 65MeV.

    Science.gov (United States)

    Tárkányi, F; Ditrói, F; Takács, S; Hermanne, A; Ignatyuk, A V

    2015-04-01

    Activation cross-sections data of longer-lived products of proton induced nuclear reactions on dysprosium were extended up to 65MeV by using stacked foil irradiation and gamma spectrometry experimental methods. Experimental cross-sections data for the formation of the radionuclides (159)Dy, (157)Dy, (155)Dy, (161)Tb, (160)Tb, (156)Tb, (155)Tb, (154m2)Tb, (154m1)Tb, (154g)Tb, (153)Tb, (152)Tb and (151)Tb are reported in the 36-65MeV energy range, and compared with an old dataset from 1964. The experimental data were also compared with the results of cross section calculations of the ALICE and EMPIRE nuclear model codes and of the TALYS nuclear reaction model code as listed in the latest on-line libraries TENDL 2013. Copyright © 2015. Published by Elsevier Ltd.

  1. Dysprosium doping induced shape and magnetic anisotropy of Fe{sub 3−x}Dy{sub x}O{sub 4} (x=0.01–0.1) nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Jain, Richa [School of Sciences, Indira Gandhi National Open University, Maidan Garhi, New Delhi 110068 (India); Department of Physics, ARSD college, University of Delhi, New Delhi 110021 (India); Luthra, Vandna [Department of Physics, Gargi College, Siri Fort Road, New Delhi 110049 (India); Gokhale, Shubha, E-mail: sgokhale@ignou.ac.in [School of Sciences, Indira Gandhi National Open University, Maidan Garhi, New Delhi 110068 (India)

    2016-09-15

    The effect of dysprosium doping on evolution of structural and magnetic properties of magnetite (Fe{sub 3}O{sub 4}) nanoparticles is reported. A standard route of co-precipitation was used for the synthesis of undoped and doped magnetite nanoparticles Fe{sub 3−x}Dy{sub x}O{sub 4} (x=0.0–0.1). Transmission electron microscopy (TEM) shows formation of round shaped particles with diameter in the range of 8–14 nm for undoped sample. On doping beyond x=0.01, the formation of rod like structures is initiated along with the round shaped particles. The number of rods is found to increase with increasing doping concentration. Magnetic characterization using Vibrating Sample Magnetometer (VSM) revealed doping dependent magnetic properties which can be correlated with the crystallite size as determined from X-ray diffraction (XRD). Enhancement in the saturation magnetization in the initial stages of doping can be explained on the basis of incorporation of Dy{sup 3+} ions in the inverse spinel structure at the octahedral site in place of Fe{sup 3+} ions. Subsequent decrease in saturation magnetization observed beyond x=0.03 could be attributed to precipitation of excess Dy in form of dysprosium ferrite phase. - Highlights: • Report on formation of nanorods in magnetite prompted by Dy doping. • Observation of anisotropic magnetic behaviour emanating from the shape anisotropy. • Evidence of Dy{sup 3+} ions occupying octahedral site in place of Fe{sup 3+} ions. • Nanorods envisaged to be useful as catalysts and in biomedical applications.

  2. Dysprosium selective potentiometric membrane sensor

    Energy Technology Data Exchange (ETDEWEB)

    Zamani, Hassan Ali, E-mail: haszamani@yahoo.com [Department of Applied Chemistry, Mashhad Branch, Islamic Azad University, Mashhad (Iran, Islamic Republic of); Faridbod, Farnoush; Ganjali, Mohammad Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)

    2013-03-01

    A novel Dy(III) ion-selective PVC membrane sensor was made using a new synthesized organic compound, 3,4-diamino-N Prime -((pyridin-2-yl)methylene)benzohydrazide (L) as an excellent sensing element. The electrode showed a Nernstian slope of 19.8 {+-} 0.6 mV per decade in a wide concentration range of 1.0 Multiplication-Sign 10{sup -6}-1.0 Multiplication-Sign 10{sup -2} mol L{sup -1}, a detection limit of 5.5 Multiplication-Sign 10{sup -7} mol L{sup -1}, a short conditioning time, a fast response time (< 10 s), and high selectivity towards Dy(III) ion in contrast to other cations. The proposed sensor was successfully used as an indicator electrode in the potentiometric titration of Dy(III) ions with EDTA. The membrane sensor was also applied to the F{sup -} ion indirect determination of some mouth washing solutions and to the Dy{sup 3+} determination in binary mixtures. Highlights: Black-Right-Pointing-Pointer The novelty of this work is based on the high affinity of the ionophore toward the Dy{sup 3+} ions. Black-Right-Pointing-Pointer This technique is very simple, fast and inexpensive and it is not necessary to use sophisticated equipment. Black-Right-Pointing-Pointer The newly developed sensor is superior to the formerly reported Dy{sup 3+} sensors in terms of selectivity.

  3. 173 | Page

    African Journals Online (AJOL)

    Fr. Ikenga

    Again, individuals and non-governmental organization (NGO's) suffer great restraint in .... by individuals or non-governmental organizations (NGOs) with observer status before the African. Commission on Human and ..... Innovations and Prospect of the African Court on Human and Peoples' Rights. In furtherance of effective ...

  4. OBIECTUL INFRACŢIUNII PREVĂZUTE LA ART.173 CP RM

    Directory of Open Access Journals (Sweden)

    Mihaela BOTNARENCO

    2015-11-01

    Full Text Available În cadrul prezentului articol analizei este supus obiectul infracţiunii de hărţuire sexuală. Inter alia, autorul formulează definiţia conceptelor de inviolabilitate sexuală şi de libertate sexuală şi stabileşte situaţiile particulare în care aceste valori sociale şi relaţiile sociale aferente sunt proteguite prin incriminarea faptei infracţionale prevăzute la art.173 CP RM. Concomitent este studiat obiectul juridic secundar al infracţiunii de hărţuire sexuală în corelaţie cu acţiunea principală, dar şi cu acţiunea secundară din conţinutul laturii obiective a componenţei de infracţiune analizate.OBJECT OF CRIME PROVIDED BY ART.173 CRIMINAL CODE OF MOLDOVA The purpose of this article is to analyze the object of the sexual harassment. Inter alia, the author defines the notions of sexual inviolability and sexual freedom as well as identifies the specific situations when these social values and related social relationships are protected by the criminal law. Moreover, the author makes a thorough analysis of the secondary legal object of this crime in connection with main and secondary acts included in the objective side of sexual harassment.

  5. Three-quasiparticle isomer in 173Ta and the excitation energy dependence of K -forbidden transition rates

    OpenAIRE

    Wood, RT; Walker, PM; Lane, G J; Carroll, R. J.; Cullen, David; Dracoulis, G D; Hota, S. S.; Kibédi, T.; Palalani, N; Podolyak, Zs.; Reed, MW; Schiffl, K; Wright, A.M

    2017-01-01

    Using the 168Er(10B,5n) reaction at a beam energy of 68 MeV, new data have been obtained for the population and decay of a T1/2=148ns, Kπ=21/2− three-quasiparticle isomer at 1717 keV in 173Ta. Revised decay energies and intensities have been determined, together with newly observed members of a rotational band associated with the isomer. By comparison with other isomers in the A≈180 deformed region, the 173Ta isomer properties help to specify the key degrees of freedom that determine K-forbid...

  6. The human story of Crew 173- capturing a Mars analog mission

    Science.gov (United States)

    Shaw, Niamh; Musilova, Michaela; Pons Lorente, Arnau; Sisaid, Idriss; Naor, Roy; Blake, Richard

    2017-04-01

    An international crew of six scientists, engineers, artists and entrepreneurs with different space specialisations were selected by the Mars Society to take part in a Martian simulation in January 2017. An ambitious outreach and media strategy was developed, aimed at communicating the benefits of missions to Mars to the public and to capture the public's interest by telling the human story of the crew's mission. Entitled Crew 173 Team PRIMA, they entered the Mars Desert Research Station in the Utah Desert and conducted research in 3D printing, hydroponics, geology and astronomy. Both the scientific and community experience of this mission was documented through still image, video, audio, diary and daily journalling by the resident artist of the mission, Niamh Shaw. The full experience of the crew was documented (before, during and after the expedition), to capture each individual experience of the crew and the human experience of isolation of future human space missions.

  7. Revisão radiológica de 173 casos consecutivos de paracoccidioidomicose Radiological review of 173 consecutive cases of paracoccidioidomycosis

    Directory of Open Access Journals (Sweden)

    Henrique Simão Trad

    2006-06-01

    Full Text Available OBJETIVO: Revisar e determinar a incidência dos achados radiológicos mais importantes da paracoccidioidomicose, e verificar as possíveis variantes de suas apresentações. MATERIAIS E MÉTODOS: Foram revistos 173 casos consecutivos de paracoccidioidomicose, atendidos no período de 1970 a 1980. Os estudos radiológicos direcionados a cada caso foram reanalisados por no mínimo dois radiologistas experientes. RESULTADOS: Foram encontrados 94 casos de acometimento pulmonar isolado e 38 de acometimento pulmonar associado a lesões ganglionares, viscerais, ósseas e à tuberculose. Sem envolvimento pulmonar foram encontrados 41 casos, com lesões intestinais, viscerais, ósseas ou combinadas. Os principais achados radiológicos da forma pulmonar foram opacidade intersticial reticular e nodular bilateral, seguida por consolidação, também bilateral. As formas visceral e intestinal apresentaram lesões predominantes no fígado, jejuno e íleo. Na forma ganglionar houve predominância do comprometimento difuso abdominal e periférico, e no ósseo, áreas de lise principalmente em ossos longos e clavícula. CONCLUSÃO: A paracoccidioidomicose é doença granulomatosa comum no Brasil, acometendo principalmente o pulmão, tendo como porta de entrada a inalação dos esporos do fungo. Outras formas desta doença, menos freqüentes ou raras, devem ser permanentemente lembradas no diagnóstico diferencial.OBJECTIVE: To determine the incidence of most significant radiological findings of paracoccidioidomycosis and to verify its possible variants. MATERIALS AND METHODS: One hundred and seventy-three cases of paracoccidioidomycosis presented between 1970 and 1980 were reviewed, including their radiological workup reanalysis by at least two experienced radiologists. RESULTS: Ninety-four cases were pulmonary only and 38 were pulmonary associated with ganglial, visceral and osseous lesions or in association with tuberculosis. There was no pulmonary

  8. Study on gamma rays from the 173Ybsub (n,γ) 174Yb reaction with resonance neutrons

    International Nuclear Information System (INIS)

    Aldea, L.; Bechvarzh, F.; Gonzatko, Ya.; Pospishil, S; Telezhnikov, S.A.

    1976-01-01

    Relative intensities of primary transitions from individual 173 Yb + n resonances were measured. For 9 resonances with Jsub (π) = 2 - and for 8 transitions an experimental correlation coefficient Rsub(exp) = 0.40 between GITAsub(n lambda) 0 deg and Isub(*g lambda f) / Esub(*g) 5 deg was found to have a significance level 99.8 %

  9. HS-173, a Novel PI3K Inhibitor, Attenuates the Activation of Hepatic Stellate Cells in Liver Fibrosis

    Science.gov (United States)

    Son, Mi Kwon; Ryu, Ye-Lim; Jung, Kyung Hee; Lee, Hyunseung; Lee, Hee Seung; Yan, Hong Hua; Park, Heon Joo; Ryu, Ji-Kan; Suh, Jun–Kyu; Hong, Sungwoo; Hong, Soon-Sun

    2013-01-01

    Hepatic stellate cells (HSCs) are the primary source of matrix components in liver disease such as fibrosis. Phosphatidylinositol 3-kinase (PI3K) signaling in HSCs has been shown to induce fibrogenesis. In this study, we evaluated the anti-fibrotic activity of a novel imidazopyridine analogue (HS-173) in human HSCs as well as mouse liver fibrosis. HS-173 strongly suppressed the growth and proliferation of HSCs and induced the arrest at the G2/M phase and apoptosis in HSCs. Furthermore, it reduced the expression of extracellular matrix components such as collagen type I, which was confirmed by an in vivo study. We also observed that HS-173 blocked the PI3K/Akt signaling pathway in vitro and in vivo. Taken together, HS-173 suppressed fibrotic responses such as cell proliferation and collagen synthesis by blocking PI3K/Akt signaling. Therefore, we suggest that this compound may be an effective therapeutic agent for ameliorating liver fibrosis through the inhibition of PI3K signaling. PMID:24326778

  10. 49 CFR 173.427 - Transport requirements for low specific activity (LSA) Class 7 (radioactive) materials and...

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Transport requirements for low specific activity... SHIPMENTS AND PACKAGINGS Class 7 (Radioactive) Materials § 173.427 Transport requirements for low specific... must be transported in accordance with the following conditions: (1) The external dose rate may not...

  11. 49 CFR Appendix B to Part 173 - Procedure for Testing Chemical Compatibility and Rate of Permeation in Plastic Packaging and...

    Science.gov (United States)

    2010-10-01

    ... Rate of Permeation in Plastic Packaging and Receptacles B Appendix B to Part 173 Transportation Other... Plastic Packaging and Receptacles 1. The purpose of this procedure is to determine the chemical compatibility and permeability of liquid hazardous materials packaged in plastic packaging and receptacles...

  12. Fermented Milk Containing Bifidobacterium lactis DN-173 010 in Childhood Constipation: A Randomized, Double-Blind, Controlled Trial

    NARCIS (Netherlands)

    Tabbers, Merit M.; Chmielewska, Ania; Roseboom, Maaike G.; Crastes, Nolwenn; Perrin, Catherine; Reitsma, Johannes B.; Norbruis, Obbe; Szajewska, Hania; Benninga, Marc A.

    2011-01-01

    BACKGROUND: Constipation is a frustrating symptom affecting 3% of children worldwide. A fermented dairy product containing Bifidobacterium lactis strain DN-173 010 was effective in increasing stool frequency in constipated women. Our aim was to assess the effects of this product in constipated

  13. 49 CFR 173.477 - Approval of packagings containing greater than 0.1 kg of non-fissile or fissile-excepted uranium...

    Science.gov (United States)

    2010-10-01

    ... kg of non-fissile or fissile-excepted uranium hexafluoride. 173.477 Section 173.477 Transportation... non-fissile or fissile-excepted uranium hexafluoride. (a) Each offeror of a package containing more than 0.1 kg of uranium hexafluoride must maintain on file for at least one year after the latest...

  14. Laparoscopic Heller-Dor for primary esophageal achalasia: outcomes in 173 patients.

    Science.gov (United States)

    Rosati, Riccardo; Fumagalli Romario, Uberto; Ceolin, Martina; Massaron, Simonetta; Peracchia, Alberto

    2013-01-01

    Laparoscopic Heller myotomy combined with anterior (Dor) fundoplication is the most widely-used surgical procedure for treating esophageal achalasia in Europe From November 1992 through May 2010 we performed laparoscopic Heller-Dor on 173 patients Conversion to laparotomy was required in three cases (1.7%) at the beginning of the experience (for mucosal) perforation which was the most frequent intraoperative complication, managed laparoscopically with the increasing experience. Five (2.9%) cases had minor postoperative complications. Clinical results were satisfactory in 99.4% of cases. One patient (0.6%) had severe persistent dysphagia. Mean esophageal diameter decreased from 50 mm ± 12 (range 20- 90) to 25 mm ± 7 (range 15-80). Lower esophageal sphincter pressure decreased from 32 mmHg (median, range 10- 93) pre-operatively to 11 mmHg (median, range 5-21) at one year follow up and residual pressure from 12 mmHg (median, range 3-30) to 4 mmHg (median, range 1-8). Impedance and pH monitoring showed normal levels in 39/47 (83%) patients who agreed to testing. The good outcomes of this experience, in part due to careful adherence to technical aspects of the operation, confirm that the laparoscopic Heller-Dor is the gold standard surgical treatment for esophageal achalasia.

  15. Study of CPO resonances on the intercombination line in 173Yb

    Science.gov (United States)

    Kumar, Pushpander; Singh, Alok K.; Bharti, Vineet; Natarajan, Vasant; Pandey, Kanhaiya

    2018-02-01

    We study coherent population oscillations in an odd isotope of the two-electron atom Yb. The experiments are done using magnetic sublevels of the {F}g=5/2\\to {F}e=3/2 hyperfine transition in 173Yb of the {}1{{{S}}}0\\to {}3{{{P}}}1 intercombination line. The experiments are done both with and without an applied magnetic field. In the absence of an applied field, the complicated sublevel structure along with the saturated fluorescence effect causes the linewidth to be larger than the 190 kHz natural linewidth of the transition. In the presence of a field (of magnitude 330 mG), a well-defined quantization axis is present which results in the formation of two M-type systems. The total fluorescence is then limited by spin coherence among the ground sublevels. In addition, the pump beam gets detuned from resonance which results in a reduced scattering rate from the {}3{{{P}}}1 state. Both of these effects result in a reduction of the linewidth to a subnatural value of about 100 kHz.

  16. The role of dysprosium on the structural and magnetic properties of (Nd{sub 1−x}Dy{sub x}){sub 2}Fe{sub 14}B nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Rahimi, Hamed; Ghasemi, Ali, E-mail: ali13912001@yahoo.com; Mozaffarinia, Reza; Tavoosi, Majid

    2017-02-15

    In current work, Nd2Fe14B nanoparticles was synthesized by sol-gel method. Dysprosium powders were added into Nd2Fe14B nanoparticles by mechanical alloying process in order to enhancement of coercivity. The phase analysis, structure, and magnetic properties of annealed (Nd{sub 1−x}Dy{sub x}){sub 2}Fe{sub 14}B nanoparticles with different Dy-content (x=0.1, 0.2, 0.3, 0.4, 0.5, 0.6) were investigated by employing X-ray diffraction, X-ray photoelectron spectroscopy, energy dispersive spectroscopy, field emission scanning electron microscope, transmission electron microscope and vibrating sample magnetometer techniques. The results showed that with an increase in Dy amounts, the coercivity of particles increased from 2.9 kOe to 13.4 kOe and then decreased to 5.6 kOe. By adding an optimum amount of Dy (x=0.4), the coercivity was significantly increased from 2.9 kOe to 13.4 kOe. The average particle size of annealed (Nd{sub 1−x}Dy{sub x}){sub 2}Fe{sub 14}B nanoparticles was below 10 nm. Magnetization reversal studies indicate that the coercivity of milled and annealed (Nd{sub 1−x}Dy{sub x}){sub 2}Fe{sub 14}B nanoparticles is controlled by the nucleation of reversed magnetic domains. The experimental results in the angular dependence of coercivity for (Nd{sub 1−x}Dy{sub x}){sub 2}Fe{sub 14}B permanent magnets showed that the normalized coercivity of the permanent magnets H{sub c}(θ)/H{sub c}(0) increases from 1 to about 1.2–1.5 with increasing θ from 0 to about π/3, for x=0.4–0.6. - Highlights: • Dy was added to Nd{sub 2}Fe{sub 14}B nanoparticles to improve the coercivity. • A maximum squareness ratio of 0.99 was obtained. • The average particle size decreased with an increase in Dy-content.

  17. A new topical hemostatic agent TT-173 reduces blood loss in a sheep model of total knee arthroplasty.

    Science.gov (United States)

    Centeno, Alberto; Rojas, Santiago; Arias, Belén; Miquel, Ignasi; Sánchez, Pilar; Ureta, Claudia; Rincón, Esther; López, Ramón; Murat, Jesús

    2017-12-01

    Total knee arthroplasty is associated with blood loss during the intervention and may require allogenic blood transfusion. Treatments such as tranexamic acid and fibrin sealants improved the bleeding control in several clinical trials, but the hemorrhage associated with the intervention is still significant. Thus far, very few studies have evaluated hemostatic treatments in animal models of total knee arthroplasty. This work describes a sheep model of bleeding associated with total knee arthroplasty and investigates a new class of hemostatic treatment based on recombinant tissue factor. Sheep were treated with the anticoagulant heparin, and the joint was accessed by a paramedial incision. Ligaments and menisci were eliminated and femoral condyles and tibia plateau were sectioned exposing the trabecular bone. An intra-articular drain was used to recover and quantify the blood loss during the 90-min period after treatment. The efficacy of one milligram and three milligrams of TT-173 was evaluated and compared with tranexamic acid. The occurrence of analytical alterations and systemic absorption was also investigated. Treatment with TT-173 reduced the blood loss in comparison with control or tranexamic acid. No significant differences were observed between the two doses evaluated. Moreover, a dose of six milligrams of TT-173 did not induce any clinical or analytical alteration, and significant systemic absorption was not observed. Data obtained strongly suggest that TT-173 could be useful in reducing the blood loss associated with total knee arthroplasty and without safety concerns derived from the systemic absorption of the product. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. 49 CFR 173.301 - General requirements for shipment of compressed gases and other hazardous materials in cylinders...

    Science.gov (United States)

    2010-10-01

    ... less; (vi) A fire extinguisher; or (vii) A “B” style cylinder with a capacity of 40 ft 3 (1.13 m3) or an “MC” style cylinder with a capacity of 10 ft 3 (0.28m3) containing acetylene. (2) For cylinders... citations affecting § 173.301, see the List of CFR Sections Affected, which appears in the Finding Aids...

  19. The kinase domain residue serine 173 of Schizosaccharomyces pombe Chk1 kinase is critical for the response to DNA replication stress

    Directory of Open Access Journals (Sweden)

    Naomi Coulton

    2017-12-01

    Full Text Available While mammalian Chk1 kinase regulates replication origins, safeguards fork integrity and promotes fork progression, yeast Chk1 acts only in G1 and G2. We report here that the mutation of serine 173 (S173A in the kinase domain of fission yeast Chk1 abolishes the G1-M and S-M checkpoints with little impact on the G2-M arrest. This separation-of-function mutation strongly reduces the Rad3-dependent phosphorylation of Chk1 at serine 345 during logarithmic growth, but not when cells experience exogenous DNA damage. Loss of S173 lowers the restrictive temperature of a catalytic DNA polymerase epsilon mutant (cdc20.M10 and is epistatic with a mutation in DNA polymerase delta (cdc6.23 when DNA is alkylated by methyl-methanesulfate (MMS. The chk1-S173A allele is uniquely sensitive to high MMS concentrations where it displays a partial checkpoint defect. A complete checkpoint defect occurs only when DNA replication forks break in cells without the intra-S phase checkpoint kinase Cds1. Chk1-S173A is also unable to block mitosis when the G1 transcription factor Cdc10 (cdc10.V50 is impaired. We conclude that serine 173, which is equivalent to lysine 166 in the activation loop of human Chk1, is only critical in DNA polymerase mutants or when forks collapse in the absence of Cds1.

  20. The decay of hot dysprosium nuclei

    International Nuclear Information System (INIS)

    Atac, A.; Rekstad, J.; Guttormsen, M.; Messelt, S.; Ramsoey, T.; Thorsteinsen, T.F.; Loevhoeiden, G.; Roedland, T.

    1987-03-01

    The γ-decay following the 162,163 Dy( 3 He,αxn) reactions with E 3 He =45 MeV has been studied. Non-statistical γ-radiation with energies of E γ ≅1 MeV and ≅2 MeV is found for various residual nuclei. The properties of these γ-ray bumps depend on the number of emitted neutrons and reveal an odd-even mass dependence. New techniques to extract average neutron energies as a function of excitation energy and of the number of emitted neutrons are employed. The deduced neutron energies are consistent with Fermi-gas model predictions

  1. Ontwikkeling van die gemenereg in die lig van artikel 39(2 en 173 van die Grondwet

    Directory of Open Access Journals (Sweden)

    LTC Harms

    2004-10-01

    Full Text Available DEVELOPMENT OF THE COMMON LAW IN VIEW OF SECTIONS 39(2 AND 173 OF THE CONSTITUTIONThe point of departure in the Constitution is that the existing legal order should largely be kept intact, despite the fact that this is disliked by some. The common (or non-statutory law has also retained its position, subject however to the superior courts' inherent power, or rather their obligation in terms of section 173 of the Constitution, to develop the common law taking into account the interests of justice. The courts have for a long time had the task of developing the common law with reference to especially the boni mores, moral standards and the common notion of what is right and fair. The Bill of Rights now is a source and summation of such notion.At times there had been an exaggerated call for petere fontes. The Courts however still have the competence to adapt the law to serve commercial and other needs, even without reference to the Bill of Rights. The underlying principles of the common law are largely, though not in all respects, consistent with the Bill of Rights. There is an essential distinction between the development of a rule of the common law in accordance with constitutional norms, and the invalidation of a rule which is inconsistent with the Constitution. Courts tend not to make this distinction and this leads to inconsistencies. Some believe that the common law is perfect and unaffected by the Bill of Rights. Others consider the Bill of Rights to have granted the judiciary a hunting license on the common law, making the positive law a matter of judicial discretion and allowing the courts to infringe upon the domain of the legislature and to ignore precedents. The common law consists of a myriad rules developed over many centuries involving great minds. It represents a fine web, the disturbance of which at one point may have severe unexpected consequences elsewhere. The new era makes extraordinary demands on judicial officers. The

  2. 3' fragment of miR173-programmed RISC-cleaved RNA is protected from degradation in a complex with RISC and SGS3.

    Science.gov (United States)

    Yoshikawa, Manabu; Iki, Taichiro; Tsutsui, Yasuhiro; Miyashita, Kyoko; Poethig, R Scott; Habu, Yoshiki; Ishikawa, Masayuki

    2013-03-05

    trans-acting small interfering RNAs (tasiRNAs) are plant-specific endogenous siRNAs produced via a unique pathway whose first step is the microRNA (miRNA)-programmed RNA-induced silencing complex (RISC)-mediated cleavage of tasiRNA gene (TAS) transcripts. One of the products is subsequently transformed into tasiRNAs by a pathway that requires several factors including SUPPRESSOR OF GENE SILENCING3 (SGS3) and RNA-DEPENDENT RNA POLYMERASE6. Here, using in vitro assembled ARGONAUTE (AGO)1-RISCs, we show that SGS3 is recruited onto RISCs only when they bind target RNA. Following cleavage by miRNA173 (miR173)-programmed RISC, SGS3 was found in complexes containing cleaved TAS2 RNA and RISC. The 3' cleavage fragment (the source of tasiRNAs) was protected from degradation in this complex. Depletion of SGS3 did not affect TAS2 RNA cleavage by miR173-programmed RISC, but did affect the stability of the 3' cleavage fragment. When the 3' nucleotide of 22-nt miR173 was deleted or the corresponding nucleotide in TAS2 RNA was mutated, the complex was not observed and the 3' cleavage fragment was degraded. Importantly, these changes in miR173 or TAS2 RNA are known to lead to a loss of tasiRNA production in vivo. These results suggest that (i) SGS3 associates with AGO1-RISC via the double-stranded RNA formed by the 3'-terminal nucleotides of 22-nt miR173 and corresponding target RNA, which probably protrudes from the AGO1-RISC molecular surface, (ii) SGS3 protects the 3' cleavage fragment of TAS2 RNA from degradation, and (iii) the observed SGS3-dependent stabilization of the 3' fragment of TAS2 RNA is key to tasiRNA production.

  3. The D173G mutation in ADAMTS-13 causes a severe form of congenital thrombotic thrombocytopenic purpura

    KAUST Repository

    Lancellotti, S.

    2015-08-13

    Congenital thrombotic thrombocytopenic purpura (TTP) is a rare form of thrombotic microangiopathy, inherited with autosomal recessive mode as a dysfunction or severe deficiency of ADAMTS-13 (A Disintegrin And Metalloprotease with ThromboSpondin 1 repeats Nr. 13), caused by mutations in the ADAMTS-13 gene. About 100 mutations of the ADAMTS-13 gene were identified so far, although only a few characterised by in vitro expression studies. A new Asp to Gly homozygous mutation at position 173 of ADAMTS-13 sequence was identified in a family of Romanian origin, with some members affected by clinical signs of TTP. In two male sons, this mutation caused a severe (< 3 %) deficiency of ADAMTS-13 activity and antigen level, associated with periodic thrombocytopenia, haemolytic anaemia and mild mental confusion. Both parents, who are cousins, showed the same mutation in heterozygous form. Expression studies of the mutant ADAMTS-13, performed in HEK293 cells, showed a severe decrease of the enzyme’s activity and secretion, although the protease was detected inside the cells. Molecular dynamics found that in the D173G mutant the interface area between the metalloprotease domain and the disintegrin-like domain significantly decreases during the simulations, while the proline-rich 20 residues linker region (LR, 285–304) between them undergoes extensive conformational changes. Inter-domain contacts are also significantly less conserved in the mutant compared to the wild-type. Both a decrease of the inter-domain contacts along with a substantial conformational rearrangement of LR interfere with the proper maturation and folding of the mutant ADAMTS-13, thus impairing its secretion.

  4. [Acute ethanol intoxication among children and adolescents. A retrospective analysis of 173 patients admitted to a university children hospital].

    Science.gov (United States)

    Schöberl, S; Nickel, P; Schmutzer, G; Siekmeyer, W; Kiess, W

    2008-01-01

    In the last time the alcohol consumption among children and adolescents is a big theme in all kind of media. The ethanol consumption among children and adolescents has risen during the last years, but also new hazardous drinking patterns like "binge-drinking" are increasing. These drinking episodes are responsible for many hospital presentations of children and adolescents with acute ethanol intoxication. This study is a retrospective analysis of 173 patients admitted to the university children hospital of Leipzig due to acute ethanol intoxication during the period 1998-2004. Investigated parameters were: socio-demographic factors, clinical presentation and management as well as quantity and type of alcohol. During the years 1998-2004 the rate of alcohol intoxicated patients in this study increased, from 1998-2003 at about 171.4%. Totally 173 patients with an average age of 14.5 years were admitted to the university children hospital. There were significantly more boys than girls. The mean blood alcohol concentration of these patients was 1.77%. Some of the patients had severe symptoms. 62 were unconscious, 2 were in coma and at least 3 patients had to be ventilated. A difference between socioeconomic groups could be observed by comparing the different school types. 44.8% of the patients went to the middle school. Furthermore 17 patients of this study had mental disorders or psychosocial problems and were therefore in psychological or psychiatric treatment. In this study a significant influence of social classes or psychosocial problems on alcohol consumption such as binge-drinking leading to acute ethanol intoxication could not be found. Alarming is the increasing number of ethanol intoxicated patients, the young age, the high measured blood ethanol concentrations and the severe symptoms of these patients. This is the reason why early and intensive prevention strategies are required.

  5. The D173G mutation in ADAMTS-13 causes a severe form of congenital thrombotic thrombocytopenic purpura

    KAUST Repository

    Lancellotti, S.; Peyvandi, F.; Pagliari, M.; Cairo, A.; Abdel-Azeim, Safwat; Chermak, Edrisse; Lazzareschi, I.; Mastrangelo, S.; Cavallo, Luigi; Oliva, R.; De Cristofaro, R.

    2015-01-01

    Congenital thrombotic thrombocytopenic purpura (TTP) is a rare form of thrombotic microangiopathy, inherited with autosomal recessive mode as a dysfunction or severe deficiency of ADAMTS-13 (A Disintegrin And Metalloprotease with ThromboSpondin 1 repeats Nr. 13), caused by mutations in the ADAMTS-13 gene. About 100 mutations of the ADAMTS-13 gene were identified so far, although only a few characterised by in vitro expression studies. A new Asp to Gly homozygous mutation at position 173 of ADAMTS-13 sequence was identified in a family of Romanian origin, with some members affected by clinical signs of TTP. In two male sons, this mutation caused a severe (< 3 %) deficiency of ADAMTS-13 activity and antigen level, associated with periodic thrombocytopenia, haemolytic anaemia and mild mental confusion. Both parents, who are cousins, showed the same mutation in heterozygous form. Expression studies of the mutant ADAMTS-13, performed in HEK293 cells, showed a severe decrease of the enzyme’s activity and secretion, although the protease was detected inside the cells. Molecular dynamics found that in the D173G mutant the interface area between the metalloprotease domain and the disintegrin-like domain significantly decreases during the simulations, while the proline-rich 20 residues linker region (LR, 285–304) between them undergoes extensive conformational changes. Inter-domain contacts are also significantly less conserved in the mutant compared to the wild-type. Both a decrease of the inter-domain contacts along with a substantial conformational rearrangement of LR interfere with the proper maturation and folding of the mutant ADAMTS-13, thus impairing its secretion.

  6. 41 CFR 302-9.173 - How many replacement POV's may my agency authorize me to transport to my post of duty at...

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 4 2010-07-01 2010-07-01 false How many replacement POV's may my agency authorize me to transport to my post of duty at Government expense? 302-9.173... How many replacement POV's may my agency authorize me to transport to my post of duty at Government...

  7. Abnormal glomerular filtration rate in children, adolescents and young adults starts below 75 mL/min/1.73 m(2).

    Science.gov (United States)

    Pottel, Hans; Hoste, Liesbeth; Delanaye, Pierre

    2015-05-01

    The chronic kidney disease (CKD) classification system for children is similar to that for adults, with both mainly based on estimated glomerular filtration rate (eGFR) combined with fixed cut-off values. The main cut-off eGFR value used to define CKD is 60 mL/min/1.73 m(2), a value that is also applied for children older than 2 years of age, adolescents and young adults. Based on a literature search, we evaluated inclusion criteria for eGFR in clinical trials or research studies on CKD for children. We also collected information on direct measurements of GFR (mGFR) in children and adolescents, with the aim to estimate the normal reference range for GFR. Using serum creatinine (Scr) normal reference values and Scr-based eGFR-equations, we also evaluated the correspondence between Scr normal reference values and (e)GFR normal reference values. Based on our literature search, the inclusion of children in published CKD studies has been based on cut-off values for eGFR of >60 mL/min/1.73 m(2). The lower reference limits for mGFR far exceed this adult threshold. Using eGFR values calculated using Scr-based formulas, we found that abnormal Scr levels in children already correspond to eGFR values that are below a cut-off of 75 mL/min/1.73 m(2). Abnormal GFR in children, adolescents and young adults starts below 75 mL/min/1.73 m(2), and as abnormality is a sign of disease, we recommend referring children, adolescents and young adults with an (e)GFR of <75 mL/min/1.73 m(2) for further clinical assessment.

  8. Nutritional determinants of worldwide diabetes: an econometric study of food markets and diabetes prevalence in 173 countries.

    Science.gov (United States)

    Basu, Sanjay; Stuckler, David; McKee, Martin; Galea, Gauden

    2013-01-01

    Ageing and urbanization leading to sedentary lifestyles have been the major explanations proposed for a dramatic rise in diabetes worldwide and have been the variables used to predict future diabetes rates. However, a transition to Western diets has been suggested as an alternative driver. We sought to determine what socio-economic and dietary factors are the most significant population-level contributors to diabetes prevalence rates internationally. Multivariate regression models were used to study how market sizes of major food products (sugars, cereals, vegetable oils, meats, total joules) corresponded to diabetes prevalence, incorporating lagged and cumulative effects. The underlying social determinants of food market sizes and diabetes prevalence rates were also studied, including ageing, income, urbanization, overweight prevalence and imports of foodstuffs. Data were obtained from 173 countries. Population-based survey recipients were the basis for diabetes prevalence and food market data. We found that increased income tends to increase overall food market size among low- and middle-income countries, but the level of food importation significantly shifts the content of markets such that a greater proportion of available joules is composed of sugar and related sweeteners. Sugar exposure statistically explained why urbanization and income have been correlated with diabetes rates. Current diabetes projection methods may estimate future diabetes rates poorly if they fail to incorporate the impact of nutritional factors. Imported sugars deserve further investigation as a potential population-level driver of global diabetes.

  9. 3′ fragment of miR173-programmed RISC-cleaved RNA is protected from degradation in a complex with RISC and SGS3

    Science.gov (United States)

    Yoshikawa, Manabu; Iki, Taichiro; Tsutsui, Yasuhiro; Miyashita, Kyoko; Poethig, R. Scott; Habu, Yoshiki; Ishikawa, Masayuki

    2013-01-01

    trans-acting small interfering RNAs (tasiRNAs) are plant-specific endogenous siRNAs produced via a unique pathway whose first step is the microRNA (miRNA)-programmed RNA-induced silencing complex (RISC)–mediated cleavage of tasiRNA gene (TAS) transcripts. One of the products is subsequently transformed into tasiRNAs by a pathway that requires several factors including SUPPRESSOR OF GENE SILENCING3 (SGS3) and RNA-DEPENDENT RNA POLYMERASE6. Here, using in vitro assembled ARGONAUTE (AGO)1–RISCs, we show that SGS3 is recruited onto RISCs only when they bind target RNA. Following cleavage by miRNA173 (miR173)-programmed RISC, SGS3 was found in complexes containing cleaved TAS2 RNA and RISC. The 3′ cleavage fragment (the source of tasiRNAs) was protected from degradation in this complex. Depletion of SGS3 did not affect TAS2 RNA cleavage by miR173-programmed RISC, but did affect the stability of the 3′ cleavage fragment. When the 3′ nucleotide of 22-nt miR173 was deleted or the corresponding nucleotide in TAS2 RNA was mutated, the complex was not observed and the 3′ cleavage fragment was degraded. Importantly, these changes in miR173 or TAS2 RNA are known to lead to a loss of tasiRNA production in vivo. These results suggest that (i) SGS3 associates with AGO1–RISC via the double-stranded RNA formed by the 3′-terminal nucleotides of 22-nt miR173 and corresponding target RNA, which probably protrudes from the AGO1–RISC molecular surface, (ii) SGS3 protects the 3′ cleavage fragment of TAS2 RNA from degradation, and (iii) the observed SGS3-dependent stabilization of the 3′ fragment of TAS2 RNA is key to tasiRNA production. PMID:23417299

  10. Evaluation of the performance of national health systems in 2004-2011: An analysis of 173 countries.

    Science.gov (United States)

    Sun, Daxin; Ahn, Haksoon; Lievens, Tomas; Zeng, Wu

    2017-01-01

    In an effort to improve health service delivery and achieve better health outcomes, the World Health Organization (WHO) has called for improved efficiency of health care systems to better use the available funding. This study aims to examine the efficiency of national health systems using longitudinal country-level data. Data on health spending per capita, infant mortality rate (IMR), under 5 mortality rate (U5MR), and life expectancy (LE) were collected from or imputed for 173 countries from 2004 through 2011. Data envelopment analyses were used to evaluate the efficiency and regression models were constructed to examine the determinants of efficiency. The average efficiency of the national health system, when examined yearly, was 78.9%, indicating a potential saving of 21.1% of health spending per capita to achieve the same level of health status for children and the entire population, if all countries performed as well as their peers. Additionally, the efficiency of the national health system varied widely among countries. On average, Africa had the lowest efficiency of 67%, while West Pacific countries had the highest efficiency of 86%. National economic status, HIV/AIDS prevalence, health financing mechanisms and governance were found to be statistically associated with the efficiency of national health systems. Taking health financing as an example, a 1% point increase of social security expenses as a percentage of total health expenditure correlated to a 1.9% increase in national health system efficiency. The study underscores the need to enhance efficiency of national health systems to meet population health needs, and highlights the importance of health financing and governance in improving the efficiency of health systems, to ultimately improve health outcomes.

  11. 173 - 177 Falodun J

    African Journals Online (AJOL)

    DR. AMIN

    palm oil mill effluent and NPK 15:15:15 fertilizer on the growth and yield of soyabean genotype ... growing maize and reported a significant effect on yield. Organic fertilizers supply the ... (1984) and significant differences among treatment.

  12. Pages 166- 173.pmd

    African Journals Online (AJOL)

    Administrator

    The logistic regression model to predict neonatal mortality had a good fit (AUC: 0.8507, misclassification rate: 13.6%) ... intensive care units, principal component analysis, logistic regression, ... between cost of neonatal care and length of stay.

  13. Phase equilibria in the Zr-Si-B ternary system (Zr-Si-ZrB{sub 2} region) at 1 173 K

    Energy Technology Data Exchange (ETDEWEB)

    Han, Feng; Luo, Hao [Guangxi Univ., Nanning (China). College of Materials Science and Engineering; Guangxi Univ., Nanning (China). Guangxi Key Lab. of Processing for Non-ferrous Metal and Featured Materials; Zhan, Yongzhong [Guangxi Univ., Nanning (China). College of Materials Science and Engineering; Guangxi Univ., Nanning (China). Guangxi Key Lab. of Processing for Non-ferrous Metal and Featured Materials; Guangxi Univ., Nanning (China). Center of Ecological Collaborative Innovation for Aluminum Industry

    2017-10-15

    The isothermal section of the Zr-Si-B ternary system (Zr-Si-ZrB{sub 2} region) at 1 173 K has been experimentally determined. All equilibrated alloys were characterized via X-ray powder diffraction and scanning electron microscopy equipped with energy-dispersive X-ray analysis. A ternary phase Zr{sub 5}(Si{sub 0.86}B{sub 0.14}){sub 3} was found at 1 173 K. The experimental results show that the isothermal section consists of 11 single-phase regions, 26 two-phase regions and 13 three-phase regions. The existence of eight compounds, i.e. ZrSi{sub 2}, ZrSi, Zr{sub 5}Si{sub 4}, Zr{sub 3}Si{sub 2}, Zr{sub 2}Si, ZrB, ZrB{sub 2} and Zr{sub 5}(Si{sub 0.86}B{sub 0.14}){sub 3} in this system has been confirmed in the Zr-Si-ZrB{sub 2} region at 1 173 K.

  14. Comparative performance of the CKD Epidemiology Collaboration (CKD-EPI) and the Modification of Diet in Renal Disease (MDRD) Study equations for estimating GFR levels above 60 mL/min/1.73 m2.

    Science.gov (United States)

    Stevens, Lesley A; Schmid, Christopher H; Greene, Tom; Zhang, Yaping Lucy; Beck, Gerald J; Froissart, Marc; Hamm, Lee L; Lewis, Julia B; Mauer, Michael; Navis, Gerjan J; Steffes, Michael W; Eggers, Paul W; Coresh, Josef; Levey, Andrew S

    2010-09-01

    The Modification of Diet in Renal Disease (MDRD) Study equation underestimates measured glomerular filtration rate (GFR) at levels>60 mL/min/1.73 m2, with variable accuracy among subgroups; consequently, estimated GFR (eGFR)>or=60 mL/min/1.73 m2 is not reported by clinical laboratories. Here, performance of a more accurate GFR-estimating equation, the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) equation, is reported by level of GFR and clinical characteristics. Test of diagnostic accuracy. Pooled data set of 3,896 people from 16 studies with measured GFR (not used for the development of either equation). Subgroups were defined by eGFR, age, sex, race, diabetes, prior solid-organ transplant, and body mass index. eGFR from the CKD-EPI and MDRD Study equations and standardized serum creatinine. Measured GFR using urinary or plasma clearance of exogenous filtration markers. Mean measured GFR was 68+/-36 (SD) mL/min/1.73 m2. For eGFR73 m2, both equations have similar bias (median difference compared with measured GFR). For eGFR of 30-59 mL/min/1.73 m2, bias was decreased from 4.9 to 2.1 mL/min/1.73 m2 (57% improvement). For eGFR of 60-89 mL/min/1.73 m2, bias was decreased from 11.9 to 4.2 mL/min/1.73 m2 (61% improvement). For eGFR of 90-119 mL/min/1.73 m2, bias was decreased from 10.0 to 1.9 mL/min/1.73 m2 (75% improvement). Similar or improved performance was noted for most subgroups with eGFR73 m2, other than body mass indexor=90 mL/min/1.73 m2. Limited number of elderly people and racial and ethnic minorities with measured GFR. The CKD-EPI equation is more accurate than the MDRD Study equation overall and across most subgroups. In contrast to the MDRD Study equation, eGFR>or=60 mL/min/1.73 m2 can be reported using the CKD-EPI equation. Copyright (c) 2010 National Kidney Foundation, Inc. All rights reserved.

  15. Effect of the consumption of a fermented dairy product containing Bifidobacterium lactis DN-173 010 on constipation in childhood: a multicentre randomised controlled trial (NTRTC: 1571).

    Science.gov (United States)

    Tabbers, Merit M; Chmielewska, Ania; Roseboom, Maaike G; Boudet, Claire; Perrin, Catherine; Szajewska, Hania; Benninga, Marc A

    2009-03-18

    Constipation is a frustrating symptom affecting 3% of children worldwide. Randomised controlled trials show that both polyethylene glycol and lactulose are effective in increasing defecation frequency in children with constipation. However, in 30-50%, these children reported abdominal pain, bloating, flatulence, diarrhoea, nausea and bad taste of the medication. Two recent studies have shown that the fermented dairy product containing Bifidobacterium lactis strain DN-173 010 is effective in increasing stool frequency in constipation-predominant irritable bowel syndrome patients with a defecation frequency fermented dairy product is effective in the treatment of constipated children with a defecation frequency fermented dairy product containing Bifidobacterium lactis DN-173 010 or a control product, twice a day, for 3 weeks. During the study all children are instructed to try to defecate on the toilet for 5-10 minutes after each meal (3 times a day) and daily complete a standardized bowel diary. Primary endpoint is stool frequency. Secondary endpoints are stool consistency, faecal incontinence frequency, pain during defecation, digestive symptoms (abdominal pain, flatulence), adverse effects (nausea, diarrhoea, bad taste) and intake of rescue medication (Bisacodyl). Rate of success and rate of responders are also evaluated, with success defined as > or = 3 bowel movements per week and or = 3 on the last week of product consumption. To demonstrate that the success percentage in the intervention group will be 35% and the success percentage in the control group (acidified milk without ferments, toilet training, bowel diary) will be 15%, with alpha 0.05 and power 80%, a total sample size of 160 patients was calculated. This study is aimed to show that the fermented dairy product containing Bifidobacterium lactis strain DN-173 010 is effective in increasing stool frequency after 3 weeks of product consumption in children with functional constipation and a defecation

  16. Effect of the consumption of a fermented dairy product containing Bifidobacterium lactis DN-173 010 on constipation in childhood: a multicentre randomised controlled trial (NTRTC: 1571

    Directory of Open Access Journals (Sweden)

    Perrin Catherine

    2009-03-01

    Full Text Available Abstract Background Constipation is a frustrating symptom affecting 3% of children worldwide. Randomised controlled trials show that both polyethylene glycol and lactulose are effective in increasing defecation frequency in children with constipation. However, in 30–50%, these children reported abdominal pain, bloating, flatulence, diarrhoea, nausea and bad taste of the medication. Two recent studies have shown that the fermented dairy product containing Bifidobacterium lactis strain DN-173 010 is effective in increasing stool frequency in constipation-predominant irritable bowel syndrome patients with a defecation frequency Methods/design It is a two nation (The Netherlands and Poland double-blind, placebo-controlled randomised multicentre trial in which 160 constipated children (age 3–16 years with a defecation frequency Bifidobacterium lactis DN-173 010 or a control product, twice a day, for 3 weeks. During the study all children are instructed to try to defecate on the toilet for 5–10 minutes after each meal (3 times a day and daily complete a standardized bowel diary. Primary endpoint is stool frequency. Secondary endpoints are stool consistency, faecal incontinence frequency, pain during defecation, digestive symptoms (abdominal pain, flatulence, adverse effects (nausea, diarrhoea, bad taste and intake of rescue medication (Bisacodyl. Rate of success and rate of responders are also evaluated, with success defined as ≥ 3 bowel movements per week and ≤1 faecal incontinence episode over the last 2 weeks of product consumption and responder defined as a subject reporting a stool frequency ≥ 3 on the last week of product consumption. To demonstrate that the success percentage in the intervention group will be 35% and the success percentage in the control group (acidified milk without ferments, toilet training, bowel diary will be 15%, with alpha 0.05 and power 80%, a total sample size of 160 patients was calculated. Conclusion This

  17. Fibroblast Growth Factor-23 and Vitamin D Metabolism in Subjects with eGFR ≥60 ml/min/1.73 m².

    Science.gov (United States)

    Nakatani, Shinya; Nakatani, Ayumi; Tsugawa, Naoko; Yamada, Shinsuke; Mori, Katsuhito; Imanishi, Yasuo; Ishimura, Eiji; Okano, Toshio; Inaba, Masaaki

    2015-01-01

    Fibroblast growth factor (FGF)-23 and parathyroid hormone (PTH) are both potent phosphaturic hormones. Since they exert opposite effects on vitamin D metabolism, the measurement of 3 vitamin D metabolites; 25-hydroxyvitamin D (25-OH-D), 1,25-dihydroxyvitamin D (1,25(OH)2D), and 24,25-dihydroxyvitamin D (24,25(OH)2D), allows the distinction of the effects of FGF-23 from those of PTH. The aim of this study was to elucidate which factor, FGF-23 or PTH, plays a more important role in the regulation of vitamin D metabolites in subjects with estimated glomerular filtration (eGFR) ≥60 ml/min/1.73 m(2). Subjects with eGFR ≥60 ml/min/1.73 m(2) (n = 20) were enrolled and their serum levels of FGF-23, intact PTH, and vitamin D metabolites were determined. Serum FGF-23 correlated inversely with 1,25(OH)2D (r = -0.717, p = 0.0004) and the 1,25(OH)2D/25-OH-D ratio (r = -0.518, p = 0.019), compared with a significant positive correlation between serum intact PTH and the 1,25(OH)2D/25-OH-D ratio (r = 0.562, p = 0.010). Multiple regression analyses revealed serum FGF-23 as a significant factor that was associated with serum 1,25(OH)2D (β = -0.593, p = 0.018), 1,25(OH)2D/25-OH-D ratio (β = -0.521, p = 0.025), and the 24,25(OH)2D/1,25(OH)2D ratio (β = 0.632, p = 0.008), and intact PTH as a significant factor associated with the 1,25(OH)2D/25-OH-D ratio (β = 0.445, p = 0.028). This study demonstrated that, even in subjects with eGFR ≥60 ml/min/1.73 m(2), FGF-23 might play an important role in the regulation of vitamin D metabolism. In addition to the established role of PTH, the association between FGF-23 and indices of vitamin D metabolism suggested the potential role of FGF-23 on phosphate metabolism in such patients. © 2015 S. Karger AG, Basel.

  18. Triangular flow of negative pions emitted in PbAu collisions at $\\sqrt{S_{NN}} = 17.3$ GeV

    CERN Document Server

    Adamová, D.

    Differential triangular flow, $v_3(p_T)$, of negative pions is measured at $\\sqrt{s_{NN}}$= 17.3~GeV around midrapidity by the CERES/NA45 experiment at CERN in central PbAu collisions in the range 0-30\\% with a mean centrality of 5.5\\%. This is the first measurement of the triangular flow at SPS energies. The $p_T$ range extends from about 0.05~GeV/c to more than 2~GeV/c. The triangular flow magnitude, corrected for the HBT effects, is smaller by a factor of about 2 than the one measured by the PHENIX experiment at RHIC and the ALICE experiment at the LHC. Within the analyzed range of central collisions no significant centrality dependence is observed. The data are found to be well described by a viscous hydro calculation combined with an UrQMD cascade model for the late stages.

  19. Study of heat conductivity, electric conductivity and thermo-emf of BiSrCaCu2Ox and Bi1.82Sr1.73Ca1.73Ca1.25Cu2.2Ox systems

    International Nuclear Information System (INIS)

    Zhukova, T.B.; Parfen'eva, L.S.; Popov, V.V.; Melekh, B.T.; Smirnov, I.A.; Khalmedov, Kh.M.

    1991-01-01

    Phase compositions are determined and temperature dependences are measured of x-heat conductivity, ρ-electric resistance and α-thermo-emf of polycrystal, monophase, highly textured HTSC samples of BiSrCaCu 2 O x and Bi 1.82 Sr 1.73 Ca 1.25 Cu 2.2 O x produced through method of direct induction melting in the air in a cold container. Sample 'aging' after storage in the air and vacuum, leading to decrease in the number of foring phases and increase in the basic phase content as well as to change of x, ρ and α coefficients is identified

  20. Synthesis and characterization of phosphors based on calcium and magnesium silicates doped with europium and dysprosium; Síntese e caracterização de fósforos a base de silicatos de cálcio e magnésio dopados com európio e disprósio

    Energy Technology Data Exchange (ETDEWEB)

    Misso, Agatha Matos

    2016-07-01

    Ca and Mg silicates based phosphors were prepared by sol-gel method combined with the molten salts process. The gel of silica was obtained from Na{sub 2}SiO{sub 3} solution by using europium, dysprosium, calcium and magnesium chloride solutions. Therefore, those chlorides were homogeneously dispersed into the gel. The obtained gel was dried and heat treated to 900° C for 1h to allow the fusion of the present salts. Then it was water washed until negative test for Cl{sup -}, and dried. The reduction of the europium to Eu{sup 2+} was performed under atmosphere of 5% of H{sub 2} and 95% of Ar to 900° C for 3h, to reach CaMgSi{sub 2}O{sub 6}:Eu{sup 2+} and CaMgSi{sub 2}O{sub 6}:Eu{sup 2+}:Dy{sup 3+} phosphors. Diopside was identified as main crystalline phase and quartz, as secondary phase from XRD (X-ray diffraction) patterns. SEM (scanning electron microscopy) micrographs, of the samples showed needles, spheres, leaves and rods of particles and agglomerates. Thermal analysis (TGA-DTGA) curves revealed that the crystallization temperature of CaMgSi{sub 2}O{sub 6}:Eu{sup 2+} lies around 765° C. Photoluminescence spectroscopy of the phosphors was studied based on interconfigurational 4f{sup N} → 4f{sup N-1} 5d transition of Eu{sup 2+} ion. The spectra of excitation showed 4f{sup N} → 4f{sup N-1} 5d transition of Eu{sup 2+} ion broad band, related to the ligand to metal charge transfer transition (LMCT) O{sup 2-} (2p) → Eu{sup 3+} in the 250 nm region, when the emission is monitored at 583,5 nm. It also presents the 4f ↔ 4f transitions of Eu{sup 3+} ion bands, showing the {sup 7}F{sub 0} → {sup 5}L{sub 6} transition at 393 nm. From emission spectra with excitation monitored at 393 nm, it can be observed fine peaks between 570 and 750 nm which are characteristics of {sup 5}D{sub 0} → {sup 7}F{sub J} (J = 0 - 5) transition of Eu{sup 3+} ion, indicating that the Eu{sup 3+} ion occupies a site with center of inversion. Finally, the obtained results indicate

  1. Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

    Directory of Open Access Journals (Sweden)

    Yao Han

    Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant

  2. Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

    Science.gov (United States)

    Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong

    2015-01-01

    MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.

  3. Photodissociation spectroscopy of the dysprosium monochloride molecular ion

    Energy Technology Data Exchange (ETDEWEB)

    Dunning, Alexander, E-mail: alexander.dunning@gmail.com; Schowalter, Steven J.; Puri, Prateek; Hudson, Eric R. [Department of Physics and Astronomy, University of California, Los Angeles, California 90095 (United States); Petrov, Alexander; Kotochigova, Svetlana [Department of Physics, Temple University, Philadelphia, Pennsylvania 19122 (United States)

    2015-09-28

    We have performed a combined experimental and theoretical study of the photodissociation cross section of the molecular ion DyCl{sup +}. The photodissociation cross section for the photon energy range 35 500 cm{sup −1} to 47 500 cm{sup −1} is measured using an integrated ion trap and time-of-flight mass spectrometer; we observe a broad, asymmetric profile that is peaked near 43 000 cm{sup −1}. The theoretical cross section is determined from electronic potentials and transition dipole moments calculated using the relativistic configuration-interaction valence-bond and coupled-cluster methods. The electronic structure of DyCl{sup +} is extremely complex due to the presence of multiple open electronic shells, including the 4f{sup 10} configuration. The molecule has nine attractive potentials with ionically bonded electrons and 99 repulsive potentials dissociating to a ground state Dy{sup +} ion and Cl atom. We explain the lack of symmetry in the cross section as due to multiple contributions from one-electron-dominated transitions between the vibrational ground state and several resolved repulsive excited states.

  4. Influence of dysprosium addition on the structural, morphological ...

    Indian Academy of Sciences (India)

    Microwave absorption properties of hexaferrite (70 wt%)–acrylic resin. (30 wt%) composites ... the RE ions were substituted for Sr (Ba) or Fe, taking into accounts the .... general the RE substitutions weaken the super exchange interactions ...

  5. Single molecule magnet behaviour in robust dysprosium-biradical complexes.

    Science.gov (United States)

    Bernot, Kevin; Pointillart, Fabrice; Rosa, Patrick; Etienne, Mael; Sessoli, Roberta; Gatteschi, Dante

    2010-09-21

    A Dy-biradical complex was synthesized and characterized down to very low temperature. ac magnetic measurements reveal single molecule magnet behaviour visible without any application of dc field. The transition to the quantum tunneling regime is evidenced. Photophysical and EPR measurements provide evidence of the excellent stability of these complexes in solution.

  6. Scissors Mode of Dipolar Quantum Droplets of Dysprosium Atoms

    Science.gov (United States)

    Ferrier-Barbut, Igor; Wenzel, Matthias; Böttcher, Fabian; Langen, Tim; Isoard, Mathieu; Stringari, Sandro; Pfau, Tilman

    2018-04-01

    We report on the observation of the scissors mode of a single dipolar quantum droplet. The existence of this mode is due to the breaking of the rotational symmetry by the dipole-dipole interaction, which is fixed along an external homogeneous magnetic field. By modulating the orientation of this magnetic field, we introduce a new spectroscopic technique for studying dipolar quantum droplets. This provides a precise probe for interactions in the system, allowing us to extract a background scattering length for 164Dy of 69 (4 )a0 . Our results establish an analogy between quantum droplets and atomic nuclei, where the existence of the scissors mode is also only due to internal interactions. They further open the possibility to explore physics beyond the available theoretical models for strongly dipolar quantum gases.

  7. Calorimetric investigation of an yttrium-dysprosium spin glass

    International Nuclear Information System (INIS)

    Wenger, L.E.

    1978-01-01

    In an effort to compare the spin glass characteristics of yttrium--rare earth alloys with those of the noble-metal spin glasses, the susceptibility and heat capacity of Y/sub 0.98/Dy/sub 0.02/ have been measured in the temperature range 2.5--40 K. The low-field ac susceptibility measurement shows the characteristic cusp-like peak at 7.64 K. The magnetic specific heat of the same sample shows a peak at 7.0 K and may be qualitatively described as a semi-cusp. The magnetic entropy change from absolute zero to 7 K is approximately 0.52 of cR ln(2J+1). These results are qualitatively different than previous calorimetric results on the archetypal spin glasses, AuFe and CuMn, where rounded maxima are observed at temperatures above the spin glass transition temperatures

  8. Emission spectra of yttrium vanadate doped with bismuth and dysprosium

    International Nuclear Information System (INIS)

    Pawar, B.V.; Patil, R.N.

    1975-01-01

    The fluorescence spectra of YVO 4 :Bi and YVO 4 :Bi:Dy phosphors under X-rays and ultra-violet radiation have been studied. The observations on the phosphors with constant Bi 3+ and varying Dy 3+ concentration can be attributed to radiationless transfer of energy from Bi 3+ to Dy 3+ coupled with non-radiative losses due to self-quenching at higher level of Dy 3+ concentration. While the observations on the phosphors with constant Dy 3+ and varying Bi 3+ concentration indicate that there is radiationless transfer from Bi 3+ to Dy 3+ under X-ray or UV irradiation. (author)

  9. Dysprosium-free melt-spun permanent magnets

    International Nuclear Information System (INIS)

    Brown, D N; Wu, Z; He, F; Miller, D J; Herchenroeder, J W

    2014-01-01

    Melt-spun NdFeB powders can be formed into a number of different types of permanent magnet for a variety of applications in electronics, automotive and clean technology industries. The melt-spinning process produces flake powder with a fine uniform array of nanoscale Nd 2 Fe 14 B grains. These powders can be net-shape formed into isotropic polymer-bonded magnets or hot formed into fully dense magnets. This paper discusses the influence of heavy rare earth elements and microstructure on the magnetic performance, thermal stability and material cost of NdFeB magnets. Evidence indicates that melt-spun nanocrystalline NdFeB magnets are less dependent on heavy rare earth elements for high-temperature performance than the alternative coarser-grained sintered NdFeB magnets. In particular, hot-pressed melt-spun magnets are an attractive low-cost solution for applications that require thermal stability up to 175–200 °C. (paper)

  10. Dysprosium-free melt-spun permanent magnets.

    Science.gov (United States)

    Brown, D N; Wu, Z; He, F; Miller, D J; Herchenroeder, J W

    2014-02-12

    Melt-spun NdFeB powders can be formed into a number of different types of permanent magnet for a variety of applications in electronics, automotive and clean technology industries. The melt-spinning process produces flake powder with a fine uniform array of nanoscale Nd2Fe14B grains. These powders can be net-shape formed into isotropic polymer-bonded magnets or hot formed into fully dense magnets. This paper discusses the influence of heavy rare earth elements and microstructure on the magnetic performance, thermal stability and material cost of NdFeB magnets. Evidence indicates that melt-spun nanocrystalline NdFeB magnets are less dependent on heavy rare earth elements for high-temperature performance than the alternative coarser-grained sintered NdFeB magnets. In particular, hot-pressed melt-spun magnets are an attractive low-cost solution for applications that require thermal stability up to 175-200 °C.

  11. Crystal and molecular structure of dysprosium (3) n-aminobenzoate

    International Nuclear Information System (INIS)

    Khiyalov, M.S.; Amiraslanov, I.R.; Mamedov, Kh.S.; Movsumov, Eh.M.

    1981-01-01

    The X ray diffraction investigation of the Dy(NH 2 C 6 H 4 COO) 3 x3H 2 O complex is carried out. Triclinic crystals have lattice parameters α=11.095(15), b=9.099(17), c=12.780 (15)A, α=108.051(12), β=89.072(10); γ=104.954(12) 0 , space group P anti 1, Z=2. The structure consists of dimer molecules. The third water molecule in the formula is an outer spherical one. The average lengths of Dy-O and Dy-OH 2 are 2.39 and 2.40 A respectively, the average value of Dy-O in bridge carboxylates (2.26A) is remarkably shorter. Hydrogen bonds between amine ligand ends, carboxylic groups oxygen and water molecules bind complex molecules into the three-dimensional frame [ru

  12. Microscopic study of neutron-rich dysprosium isotopes

    International Nuclear Information System (INIS)

    Vargas, Carlos E.; Velazquez, Victor; Lerma, Sergio

    2013-01-01

    Microscopic studies in heavy nuclei are very scarce due to large valence spaces involved. This computational problem can be avoided by means of the use of symmetry-based models. Ground-state, γ and β bands, and their B(E2) transition strengths in 160-168 Dy isotopes, are studied in the framework of the pseudo-SU(3) model which includes the preserving symmetry Q . Q term and the symmetry-breaking Nilsson and pairing terms, systematically parametrized. Additionally, three rotor-like terms are considered, whose free parameters, fixed for all members of the chain, are used to fine tune the moment of inertia of rotational bands and the band head of γ and β bands. The model succesfully describes in a systematic way rotational features in these nuclei and allows to extrapolate toward the midshell nucleus 170 Dy. The results presented show that it is possible to study a full chain of isotopes or isotones in the region with the present model. (orig.)

  13. Microscopic study of neutron-rich dysprosium isotopes

    Energy Technology Data Exchange (ETDEWEB)

    Vargas, Carlos E. [Universidad Veracruzana, Facultad de Fisica e Inteligencia Artificial, Xalapa (Mexico); Universidad Nacional Autonoma de Mexico, Facultad de Ciencias, Apartado Postal 70-542, Mexico D.F. (Mexico); Velazquez, Victor [Universidad Nacional Autonoma de Mexico, Facultad de Ciencias, Apartado Postal 70-542, Mexico D.F. (Mexico); Lerma, Sergio [Universidad Veracruzana, Facultad de Fisica e Inteligencia Artificial, Xalapa (Mexico)

    2013-01-15

    Microscopic studies in heavy nuclei are very scarce due to large valence spaces involved. This computational problem can be avoided by means of the use of symmetry-based models. Ground-state, {gamma} and {beta} bands, and their B(E2) transition strengths in {sup 160-168}Dy isotopes, are studied in the framework of the pseudo-SU(3) model which includes the preserving symmetry Q . Q term and the symmetry-breaking Nilsson and pairing terms, systematically parametrized. Additionally, three rotor-like terms are considered, whose free parameters, fixed for all members of the chain, are used to fine tune the moment of inertia of rotational bands and the band head of {gamma} and {beta} bands. The model succesfully describes in a systematic way rotational features in these nuclei and allows to extrapolate toward the midshell nucleus {sup 170}Dy. The results presented show that it is possible to study a full chain of isotopes or isotones in the region with the present model. (orig.)

  14. Structural and magnetic study of dysprosium substituted cobalt ferrite nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Hemaunt, E-mail: hvatsal@gmail.com [Department of Physics, Govind Ballabh Pant University of Agr. & Technology, Pantnagar, Uttarakhand 263145 (India); Srivastava, R.C. [Department of Physics, Govind Ballabh Pant University of Agr. & Technology, Pantnagar, Uttarakhand 263145 (India); Pal Singh, Jitendra [Advanced Analysis Centre, Korea Institute of Science and Technology, Seoul 02792 (Korea, Republic of); Negi, P. [Department of Physics, Govind Ballabh Pant University of Agr. & Technology, Pantnagar, Uttarakhand 263145 (India); Agrawal, H.M. [Advanced Analysis Centre, Korea Institute of Science and Technology, Seoul 02792 (Korea, Republic of); Das, D. [UGC-DAE CSR Kolkata Centre, Kolkata 700098 (India); Hwa Chae, Keun [Advanced Analysis Centre, Korea Institute of Science and Technology, Seoul 02792 (Korea, Republic of)

    2016-03-01

    The present work investigates the magnetic behavior of Dy{sup 3+} substituted cobalt ferrite nanoparticles. X-ray diffraction studies reveal presence of cubic spinel phases in these nanoparticles. Raman spectra of these nanoparticles show change in intensity of Raman bands, which reflects cation redistribution in cubic spinel lattice. Saturation magnetization and coercivity decrease with increase of Dy{sup 3+}concentration in these nanoparticles. Room temperature Mössbauer measurements show the cation redistribution in these nanoparticles and corroborates the results obtained from Raman Spectroscopic measurements. Decrease in magnetization of Dy{sup 3+} substituted cobalt ferrite is attributed to the reduction in the magnetic interaction and cation redistribution. - Highlights: • Slight decrease in crystallite size after Dy{sup 3+} doping. • Saturation magnetization and coercivity decrease after Dy{sup 3+} doping. • Mössbauer measurements show the cation redistribution in the samples.

  15. Dysprosium Acetylacetonato Single-Molecule Magnet Encapsulated in Carbon Nanotubes

    Directory of Open Access Journals (Sweden)

    Ryo Nakanishi

    2016-12-01

    Full Text Available Dy single-molecule magnets (SMMs, which have several potential uses in a variety of applications, such as quantum computing, were encapsulated in multi-walled carbon nanotubes (MWCNTs by using a capillary method. Encapsulation was confirmed by using transmission electron microscopy (TEM. In alternating current magnetic measurements, the magnetic susceptibilities of the Dy acetylacetonato complexes showed clear frequency dependence even inside the MWCNTs, meaning that this hybrid can be used as magnetic materials in devices.

  16. Energy dependence of particle ratio fluctuations in central Pb+Pb collisions from $\\sqrt{s_{_{NN}}} =$~6.3 to 17.3 GeV

    CERN Document Server

    Alt, C; Baatar, B; Barna, D; Bartke, J; Betev, L; Bialkowska, H; Blume, C; Boimska, B; Botje, M; Bracinik, J; Bramm, R; Bunccic, P; Cerny, V; Christakoglou, P; Chvala, O; Cramer, J G; Csató, P; Dinkelaker, P; Eckardt, V; Flierl, D; Fodor, Z; Foka, P; Friese, V; Gál, J; Gazdzicki, M; Genchev, V; Georgopoulos, G; Gladysz, E; Grebieszkow, K; Hegyi, S; Höhne, C; Kadija, K; Karev, A; Kliemant, M; Kniege, S; Kolesnikov, V I; Kornas, E; Korus, R; Kowalski, M; Kraus, I; Kreps, M; Kresan, D; Van Leeuwen, M; Lévai, P; Litov, L; Lungwitz, B; Makariev, M; Malakhov, A I; Mateev, M; Melkumov, G L; Mischke, A; Mitrovski, M; Molnár, J; Mrówczynski, St; Nicolic, V; Pálla, G; Panagiotou, A D; Panayotov, D; Petridis, A; Pikna, M; Prindle, D; Pühlhofer, F; Renfordt, R; Roland, C; Roland, G; Rybczynski, M; Rybicki, A; Sandoval, A; Schmitz, N; Schuster, T; Seyboth, P; Siklér, F; Sitár, B; Skrzypczak, E; Stefanek, G; Stock, R; Ströbele, H; Susa, T; Szentpétery, I; Sziklai, J; Szymanski, P; Trubnikov, V; Varga, D; Vassiliou, M; Veres, G I; Vesztergombi, G; Vranic, D; Wetzler, A; Wlodarczyk, Z; Yoo, I K

    2009-01-01

    We present recent measurements of the energy dependence of event-by-event fluctuations in the K/pi and (p + \\bar{p})/pi multiplicity ratios in heavy ion collisions at the CERN SPS. The particle ratio fluctuations were obtained for central Pb+Pb collisions at five collision energies, \\sqrt{s_{_{NN}}}, between 6.3 and 17.3 GeV. After accounting for the effects of finite-number statistics and detector resolution, we extract the strength of non-statistical fluctuations at each energy. For the K/pi ratio, larger fluctuations than expected for independent particle production are found at all collision energies. The fluctuations in the (p + \\bar{p})/pi ratio are smaller than expectations from independent particle production, indicating correlated pion and proton production from resonance decays. For both ratios, the deviation from purely statistical fluctuations shows an increase towards lower collision energies. The results are compared to transport model calculations, which fail to describe the energy dependence o...

  17. A Search for Technosignatures from 14 Planetary Systems in the Kepler Field with the Green Bank Telescope at 1.15–1.73 GHz

    Science.gov (United States)

    Margot, Jean-Luc; Greenberg, Adam H.; Pinchuk, Pavlo; Shinde, Akshay; Alladi, Yashaswi; Prasad MN, Srinivas; Bowman, M. Oliver; Fisher, Callum; Gyalay, Szilard; McKibbin, Willow; Miles, Brittany; Nguyen, Donald; Power, Conor; Ramani, Namrata; Raviprasad, Rashmi; Santana, Jesse; Lynch, Ryan S.

    2018-05-01

    Analysis of Kepler mission data suggests that the Milky Way includes billions of Earth-sized planets in the habitable zone of their host stars. Current technology enables the detection of technosignatures emitted from a large fraction of the Galaxy. We describe a search for technosignatures that is sensitive to Arecibo-class transmitters located within ∼420 ly of Earth and transmitters that are 1000 times more effective than Arecibo within ∼13000 ly of Earth. Our observations focused on 14 planetary systems in the Kepler field and used the L-band receiver (1.15–1.73 GHz) of the 100 m diameter Green Bank Telescope. Each source was observed for a total integration time of 5 minutes. We obtained power spectra at a frequency resolution of 3 Hz and examined narrowband signals with Doppler drift rates between ±9 Hz s‑1. We flagged any detection with a signal-to-noise ratio in excess of 10 as a candidate signal and identified approximately 850,000 candidates. Most (99%) of these candidate signals were automatically classified as human-generated radio-frequency interference (RFI). A large fraction (>99%) of the remaining candidate signals were also flagged as anthropogenic RFI because they have frequencies that overlap those used by global navigation satellite systems, satellite downlinks, or other interferers detected in heavily polluted regions of the spectrum. All 19 remaining candidate signals were scrutinized and none were attributable to an extraterrestrial source.

  18. BITUMINOUS MIX RESPONSE TO PLASTIC DEFORMATIONS: COMPARISON OF THE SPANISH NLT-173 AND UNE-EN 12697-22 WHEEL-TRACKING TESTS

    Directory of Open Access Journals (Sweden)

    GEMA GARCÍA-TRAVÉ

    2012-01-01

    Full Text Available La formación de roderas es uno de los mayores deterioros que se producen en los firmes flexibles, lo que ocasiona la pérdida de regularidad superficial que repercute de forma negativa en la calidad del servicio prestado a los usuarios. Existen distintos ensayos de laboratorio que permiten evaluar las deformaciones plásticas producidas en las capas del pavimento, entre ellos podemos destacar los ensayos de simulación. El objetivo de esta investigación es analizar el comportamiento de una mezcla bituminosa en caliente frente a deformaciones plásticas, mediante dos métodos de ensayo diferentes; ensayo en pista de laboratorio de acuerdo a la normativa española NLT-173 y el ensayo de rodadura UNE-EN 12697-22 (ensayo obligatorio tras la entrada en vigor del Marcado CE de mezclas bituminosas en 2008. La finalidad última de este artículo es formular una propuesta de modificación de la normativa española (PG-3 sobre los límites exigibles en éste último ensayo.

  19. New candidates for active asteroids: Main-belt (145) Adeona, (704) Interamnia, (779) Nina, (1474) Beira, and near-Earth (162,173) Ryugu

    Science.gov (United States)

    Busarev, Vladimir V.; Makalkin, Andrei B.; Vilas, Faith; Barabanov, Sergey I.; Scherbina, Marina P.

    2018-04-01

    For the first time, spectral signs of subtle coma activity were observed for four main-belt primitive asteroids (145) Adeona, (704) Interamnia, (779) Nina, and (1474) Beira around their perihelion distances in September 2012, which were interpreted as manifestations of the sublimation of H2O ice in/under the surface matter (Busarev et al., 2015a, 2015b). We confirm the phenomenon for Nina when it approached perihelion in September 2016. At the same time, based on results of spectral observations of near-Earth asteroid (162,173) Ryugu (Vilas, 2008) being a target of Japan's Hayabusa 2 space mission, we suspected a periodic similar transient activity on the Cg-type asteroid. However, unlike the main-belt primitive asteroids demonstrating sublimation of ices close to their perihelion distances, the effect on Ryugu was apparently registered near aphelion. To explain the difference, we calculated the subsolar temperature depending on heliocentric distance of the asteroids, considered qualitative models of internal structure of main-belt and near-Earth primitive asteroids including ice and performed some analytical estimations. Presumed temporal sublimation/degassing activity of Ryugu is a sign of a residual frozen core in its interior. This could be an indication of a relatively recent transition of the asteroid from the main asteroid belt to the near-Earth area.

  20. Triangular flow of negative pions emitted in PbAu collisions at √{sNN} = 17.3 GeV

    Science.gov (United States)

    Adamová, D.; Agakichiev, G.; Andronic, A.; Antończyk, D.; Appelshäuser, H.; Belaga, V.; Bielčíková, J.; Braun-Munzinger, P.; Busch, O.; Cherlin, A.; Damjanović, S.; Dietel, T.; Dietrich, L.; Drees, A.; Dubitzky, W.; Esumi, S. I.; Filimonov, K.; Fomenko, K.; Fraenkel, Z.; Garabatos, C.; Glässel, P.; Hering, G.; Holeczek, J.; Kalisky, M.; Karpenko, Iu.; Krobath, G.; Kushpil, V.; Maas, A.; Marín, A.; Milošević, J.; Miśkowiec, D.; Panebrattsev, Y.; Petchenova, O.; Petráček, V.; Radomski, S.; Rak, J.; Ravinovich, I.; Rehak, P.; Sako, H.; Schmitz, W.; Schuchmann, S.; Sedykh, S.; Shimansky, S.; Stachel, J.; Šumbera, M.; Tilsner, H.; Tserruya, I.; Tsiledakis, G.; Wessels, J. P.; Wienold, T.; Wurm, J. P.; Yurevich, S.; Yurevich, V.

    2017-01-01

    Differential triangular flow, v3 (pT), of negative pions is measured at √{sNN} = 17.3 GeV around midrapidity by the CERES/NA45 experiment at CERN in central PbAu collisions in the range 0-30% with a mean centrality of 5.5%. This is the first measurement as a function of transverse momentum of the triangular flow at SPS energies. The pT range extends from about 0.05 GeV/c to more than 2 GeV/c. The triangular flow magnitude, corrected for the HBT effects, is smaller by a factor of about 2 than the one measured by the PHENIX experiment at RHIC and the ALICE experiment at the LHC. Within the analyzed range of central collisions no significant centrality dependence is observed. The data are found to be well described by a viscous hydrodynamic calculation combined with an UrQMD cascade model for the late stages.

  1. Production of lipopeptides by Bacillus amyloliquefaciens XZ-173 in solid state fermentation using soybean flour and rice straw as the substrate.

    Science.gov (United States)

    Zhu, Zhen; Zhang, Guoyi; Luo, Yi; Ran, Wei; Shen, Qirong

    2012-05-01

    This work was aimed to produce lipopeptides by Bacillus amyloliquefaciens XZ-173 in solid state fermentation using agro-industrial byproducts. A central composite design was used to get the highest lipopeptides production. Results revealed that the optimal conditions for maximum lipopeptides production were 1.79% starch and 1.91% yeast extract by employing 5.58 g soybean flour and 3.67 g rice straw as the solid substrate with initial pH 7.5, moisture content 55% and a 10% inoculum level at 30°C for 2 days. Under these conditions, the experimental yield of lipopeptides reached 50.01 mg/gds, which was very close to the predicted value (49.91 mg/gds). At high concentration, the lipopeptides extracted from fermented substrates showed strong antibiotic activity against Rhizoctonia solani and Ralstonia solanacearum and certain emulsification but good emulsion stability. This is the first report on lipopeptides production that uses rice straw as a major substrate. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Finding of 13(2) , 17(3) -cyclopheophorbide a enol as a degradation product of chlorophyll in shrunk zooxanthellae of the coral Montipora digitata.

    Science.gov (United States)

    Suzuki, Toshiyuki; Casareto, Beatriz Estela; Shioi, Yuzo; Ishikawa, Yoshio; Suzuki, Yoshimi

    2015-02-01

    We examined the morphology and pigment composition of zooxanthellae in corals subjected to normal temperature (27°C) and thermal stress (32°C). We observed several normal and abnormal morphological types of zooxanthellar cells. Normal cells were intact and their chloroplasts were unbroken (healthy); abnormal cells were shrunken and had partially degraded or broken chloroplasts, or they were bleached and without chloroplasts. At 27°C, most healthy zooxanthellar cells were retained in the coral tissue, whereas shrunken zooxanthellae were expelled. Under thermal stress, the abundance of healthy zooxanthellae declined and the proportion of shrunken/abnormal cells increased in coral tissues. The rate of algal cell expulsion was reduced under thermal stress. Within the shrunken cells, we detected the presence of a chl-like pigment that is not ordinarily found in healthy zooxanthellae. Analysis of the absorption spectrum, absorption maxima, and retention time (by HPLC) indicated that this pigment was 13(2) , 17(3) -cyclopheophorbide a enol (cPPB-aE), which is frequently found in marine and lacustrine sediments, and in protozoans that graze on phytoplankton. The production of cPPB-aE in shrunken zooxanthellae suggests that the chls have been degraded to cPPB-aE, a compound that is not fluorescent. The lack of a fluorescence function precludes the formation of reactive oxygen species. We therefore consider the formation of cPPB-aE in shrunken zooxanthellae to be a mechanism for avoiding oxidative stress. © 2014 The Authors. Journal of Phycology published by Wiley Periodicals, Inc. on behalf of Phycological Society of America.

  3. Macrophage Migration Inhibitory Factor Promoter Polymorphisms (−794 CATT5–8 and −173 G>C: Relationship with mRNA Expression and Soluble MIF Levels in Young Obese Subjects

    Directory of Open Access Journals (Sweden)

    Inés Matia-García

    2015-01-01

    Full Text Available We analyzed the relationship of −794 CATT5–8 and −173 G>C MIF polymorphisms with mRNA and soluble MIF in young obese subjects. A total of 250 young subjects, 150 normal-weight and 100 obese subjects, were recruited in the study. Genotyping of −794 CATT5–8 and −173 G>C MIF polymorphisms was performed by PCR and PCR-RFLP, respectively. MIF mRNA expression was determined by real-time PCR and serum MIF levels were measured using an ELISA kit. For both MIF promoter polymorphisms, no significant differences in the genotype and allele frequencies between groups were observed. MIF mRNA expression was slightly higher in obese subjects than in normal-weight subjects (1.38-fold, while soluble MIF levels did not show differences between groups. In addition, we found an increase in MIF mRNA expression in carriers of the 6,6 and C/C genotypes and the 6G haplotype of the −794 CATT5–8 and −173 G>C MIF polymorphisms, although it was not significant. In conclusion, this study found no relationship between obesity and MIF gene promoter polymorphisms with MIF mRNA expression in young obese subjects.

  4. Tuberculosis in Scottish military veterans: evidence from a retrospective cohort study of 57 000 veterans and 173 000 matched non-veterans.

    Science.gov (United States)

    Bergman, Beverly P; Mackay, D F; Pell, J P

    2017-02-01

    Tuberculosis was a major cause of morbidity and manpower loss in the Armed Forces during World War II. Military control programmes commenced in the 1950s but were initially limited in scope by the many recruits who were already tuberculin positive on enlistment. The aim of our study was to examine whether veterans have an increased risk of tuberculosis compared with non-veterans. Retrospective cohort study of 57 000 veterans born 1945-1985, and 173 000 people with no record of military service, resident in Scotland, matched for age, sex and area of residence, using Cox proportional hazard analysis to compare the risk of tuberculosis overall, by birth cohort, length of service and year of diagnosis and to examine comorbidities. Over mean 29 years follow-up, 69 (0.12%) veterans were recorded as having tuberculosis, compared with 267 (0.15%) non-veterans (unadjusted HR 0.90, 95% CIs 0.69 to 1.19, p=0.463). Only the 1945-1949 veterans' birth cohort was at higher risk, unadjusted HR 1.54, 95% CIs 0.98 to 2.45, p=0.061, although the difference in risk did not achieve significance. Veterans born from 1950 were at significantly reduced risk of tuberculosis compared with non-veterans after adjusting for deprivation, HR 0.67, 95% CI 0.47 to 0.95, p=0.026. The most common comorbidities were smoking-related and alcohol-related disease. The risk of comorbid hepatitis B or C was very low, in both veterans and non-veterans. No length of service was associated with an increased risk of tuberculosis in comparison with non-veterans. Scottish veterans born before 1950 are at moderately increased risk of tuberculosis compared with age, sex and geographically matched civilians with no record of service, although the difference is not statistically significant. Scottish veterans born from 1950 show a reduction in risk compared with civilians. Tuberculosis should be considered in the differential diagnosis of respiratory disease in the older veteran. Published by the BMJ Publishing

  5. Effect of a fermented milk containing Bifidobacterium animalis DN-173 010 on the health-related quality of life and symptoms in irritable bowel syndrome in adults in primary care: a multicentre, randomized, double-blind, controlled trial.

    Science.gov (United States)

    Guyonnet, D; Chassany, O; Ducrotte, P; Picard, C; Mouret, M; Mercier, C-H; Matuchansky, C

    2007-08-01

    Health-related quality of life (HRQoL) has been rarely evaluated as a primary endpoint in the assessment of the effect of probiotics on the irritable bowel syndrome (IBS). To study the effects of fermented milk containing Bifidobacterium animalis DN-173 010 and yoghurt strains on the IBS in a multicentre, double-blind, controlled trial. A total of 274 primary care adults with constipation-predominant IBS (Rome II) were randomized to consume for 6 weeks either the test fermented milk or a heat-treated yoghurt (control). HRQoL and digestive symptoms were assessed after 3 and 6 weeks on an intention-to-treat population of 267 subjects. The HRQoL discomfort score, the primary endpoint, improved (P food on discomfort HRQoL score and bloating in constipation-predominant IBS, and on stool frequency in subjects with <3 stools/week.

  6. MIF functional polymorphisms (-794 CATT5-8 and -173 G>C) are associated with MIF serum levels, severity and progression in male multiple sclerosis from western Mexican population.

    Science.gov (United States)

    Castañeda-Moreno, V A; De la Cruz-Mosso, U; Torres-Carrillo, N; Macías-Islas, M A; Padilla-De la Torre, O; Mireles-Ramírez, M A; González-Pérez, O; Ruiz-Sandoval, J L; Huerta, M; Trujillo, X; Ortuño-Sahagún, D; Jf, Muñoz-Valle

    2018-07-15

    Macrophage migration inhibitory factor (MIF) is a cytokine associated with tissue damage in multiple autoimmune diseases such as systemic lupus erythematosus, rheumatoid arthritis and psoriatic arthritis. The role of MIF in multiple sclerosis (MS) and the contribution of its polymorphisms are unknown in our population. Therefore, we decided to investigate the genetic association of -794 CATT 5-8 (rs5844572) and -173 G>C (rs755622) MIF polymorphisms with MS, clinical variables and MIF serum levels in the population of western Mexico. 230 MS patients diagnosed according to McDonald criteria and 248 control subjects (CS) were recruited for this study, both polymorphisms were genotyped by PCR and PCR-RFLP and MIF serum levels were measured by ELISA kit. Severity and progression of MS were evaluated by EDSS and MSSS scores, respectively. Genotypes carrying the 5 repeats alleles of -794 CATT 5-8 MIF polymorphism present higher MIF serum levels in comparison with no carriers, and the presence of 5,7 heterozygous genotype contribute to the increase of disease severity and damage progression in MS patients. Notably when we stratified by sex, an effect of risk alleles (7 repeats and -173*C) of both MIF polymorphisms on EDSS and MSSS scores on males was found (p < 0.01). This study suggests that polymorphic alleles of MIF polymorphisms could act as sex-specific disease modifiers that increase the severity and progression of MS in male Mexican-Mestizo western population. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Energy dependence of kaon-to-proton ratio fluctuations in central Pb+Pb collisions from $\\sqrt{s_{NN}}$ = 6.3 to 17.3 GeV

    CERN Document Server

    Anticic, T.; Barna, D.; Bartke, J.; Beck, H.; Betev, L.; Bialkowska, H.; Blume, C.; Bogusz, M.; Boimska, B.; Book, J.; Botje, M.; Buncic, P.; Cetner, T.; Christakoglou, P.; Chung, P.; Chvala, O.; Cramer, J.G.; Eckardt, V.; Fodor, Z.; Foka, P.; Friese, V.; Gazdzicki, M.; Grebieszkow, K.; Hohne, C.; Kadija, K.; Karev, A.; Kolesnikov, V.I.; Kollegger, T.; Kowalski, M.; Kresan, D.; Laszlo, A.; Lacey, R.; van Leeuwen, M.; Mackowiak, M.; Makariev, M.; Malakhov, A.I.; Mateev, M.; Melkumov, G.L.; Mitrovski, M.; Mrowczynski, St.; Nicolic, V.; Palla, G.; Panagiotou, A.D.; Peryt, W.; Pluta, J.; Prindle, D.; Puhlhofer, F.; Renfordt, R.; Roland, C.; Roland, G.; Rybczynski, M.; Rybicki, A.; Sandoval, A.; Schmitz, N.; Schuster, T.; Seyboth, P.; Sikler, F.; Skrzypczak, E.; Slodkowski, M.; Stefanek, G.; Stock, R.; Strobele, H.; Susa, T.; Szuba, M.; Utvic, M.; Varga, D.; Vassiliou, M.; Veres, G.I.; Vesztergombi, G.; Vranic, D.; Wlodarczyk, Z.; Wojtaszek-Szwarc, A.

    2011-01-01

    Kaons and protons carry large parts of two conserved quantities, strangeness and baryon number. It is argued that their correlation and thus also fluctuations are sensitive to conditions prevailing at the anticipated parton-hadron phase boundary. Fluctuations of the $(\\mathrm{K}^+ + \\mathrm{K}^-)/(\\mathrm{p}+\\bar{\\mathrm{p}})$ and $\\mathrm{K}^+/\\mathrm{p}$ ratios have been measured for the first time by NA49 in central Pb+Pb collisions at 5 SPS energies between $\\sqrt{s_{NN}}$= 6.3~GeV and 17.3~GeV. Both ratios exhibit a change of sign in $\\sigma_{\\mathrm{dyn}}$, a measure of non-statistical fluctuations, around $\\sqrt{s_{NN}}$ = 8~GeV. Below this energy, $\\sigma_{\\mathrm{dyn}}$ is positive, indicating higher fluctuation compared to a mixed event background sample, while for higher energies, $\\sigma_{\\mathrm{dyn}}$ is negative, indicating correlated emission of kaons and protons. The results are compared to UrQMD calculations which which give a good description at the higher SPS energies, but fail to reproduc...

  8. Synthesis and silica coating of calcia-doped ceria/plate-like titanate (K0.8Li0.27Ti1.73O4) nanocomposite by seeded polymerization technique

    International Nuclear Information System (INIS)

    El-Toni, Ahmed Mohamed; Yin, Shu; Sato, Tsugio

    2007-01-01

    Calcia-doped ceria is of potential interest as an ultraviolet (UV) radiation blocking material in personal care products because of the excellent UV light absorption property and low catalytic ability for the oxidation of organic materials superior to undoped ceria. In order to reduce the oxidation catalytic activity further, calcia-doped ceria was coated with amorphous silica by means of seeded polymerization technique. Generally, nanoparticles of inorganic materials do not provide a good coverage for human skin because of the agglomeration of the particles. The plate-like particles are required to enhance the coverage ability of inorganic materials. This can be accomplished by synthesis of calcia-doped ceria/plate-like potassium lithium titanate (K 0.8 Li 0.27 Ti 1.73 O 4 ) nanocomposite with subsequent silica coating to control catalytic activity of calcia-doped ceria. Calcia-doped ceria/plate-like potassium lithium titanate nanocomposite was prepared by soft chemical method followed by silica coating via seeded polymerization technique. Silica coated calcia-doped ceria/plate-like potassium lithium titanate nanocomposite was characterized by X-ray diffraction, SEM, TEM, XPS and FT-IR

  9. Successive composition of two laser channels upon excitation of He-Ar-Xe (2.03 μm) and Ar-Xe (1.73 μm) mixtures by uranium fission fragments

    International Nuclear Information System (INIS)

    Pikulev, A A; Tsvetkov, V M; Sosnin, P V; Sinyanskii, A A

    2009-01-01

    The operation efficiency of the scheme with successive composition of two laser channels upon excitation of the active medium by uranium-235 fission fragments is studied experimentally and numerically. For the He:Ar:Xe = 380:380:1 mixture (at a pressure of 1 atm and the lasing wavelength λ = 2.03 μm) the maximum lasing power of a double channel (1 kW) is almost twice that of a single channel (540 W). Calculations show that in the case of ideal composition (without losses on mirrors) the lasing power of the double channel can be increased to 1.2 kW. For the Ar:Xe = 380:1 mixture (the pressure is 0.5 atm, λ = 1.73 μm) the maximum lasing power of the double channel (620 W) is slightly above that of the single channel (520 W), which is caused by the losses on aluminum mirrors employed for channel doubling and by a negative effect of optical inhomogeneities. In the case of ideal composition, the lasing power can be increased to 830 W. (lasers)

  10. Evaluation of the 175Lu(n,2n)174Lu, 175Lu(n,2n/sup 174m/Lu, and 175Lu(n,3n)173Lu cross sections from threshold to 20 MeV

    International Nuclear Information System (INIS)

    Philis, C.; Young, P.G.; Arthur, E.D.

    1978-04-01

    An evaluation of the 175 Lu(n,2n) 174 Lu, 175 Lu(n,2n)/sup 174m/Lu, and 175 Lu(n,3n) 173 Lu reactions from threshold to 20 MeV is presented. Available experimental data were renormalized to a consistent set of standards and were used along with results from statistical-preequilibrium model calculations to produce recommended curves for each of these reactions

  11. Areva at March 31, 2014: Downturn in revenue as anticipated, to euro 1.781 bn (-17.3% like for like), Backlog of euro 40.2 bn

    International Nuclear Information System (INIS)

    Duperray, Julien; Berezowskyj, Katherine; Grange, Aurelie; Rosso, Jerome; Thebault, Alexandre; Scorbiac, Marie de; Repaire, Philippine du

    2014-01-01

    Following the marked growth of the nuclear operations in 2013, thanks in particular to the strength of recurring activities and the contribution of exceptional items such as significant uranium sales volumes and non-recurring foreign contracts, revenue in the first quarter of the year fell sharply, as Areva had anticipated. A strong seasonal effect will materialize in 2014, with greater activity to be expected in the second half of the year. As indicated when releasing 2013 annual results, the current economic environment is still unfavorable, with market prices deteriorating in the front end of the cycle and lackluster demand from customers for installed base services. AREVA's operations generated consolidated revenue of 1.781 billion euros in the first quarter of 2014, a decrease of 18.1% (-17.3 % like for like) compared with the same period in 2013. The Front End Business Group (BG) reported strong growth of +59.0% (+59.8% like for like). Revenue was down in the Mining, Reactors and Services, Back End and Renewable Energies BGs, at -63.0% (-62.3% like for like), -14.1% (-12.5% like for like), -41.7% (-41.6% like for like) and -38.2% (-34.6% like for like) respectively. Foreign exchange had a negative impact of 18 million euros over the period, while the change in consolidation scope had a negative impact of 3 million euros. The group's backlog reached 40.2 billion euros at March 31, 2014, a decrease of 2.9% compared with December 31, 2013 and of 8.8% year on year

  12. RT-173: Helix, 2017 Helix Technical Report

    Science.gov (United States)

    2018-01-16

    and to coordinate across the problem domain and solution domain. Categories include: communication; listening and comprehension ; working in a...proficiency set as a useful and comprehensive model. The forces identified in Figure 1 – experiences, mentoring, education and training – are linked

  13. 10 CFR 205.173 - Public hearings.

    Science.gov (United States)

    2010-01-01

    ... proposed rule or regulation is likely to have a substantial impact on the Nation's economy or large numbers... hearing, together with the written comments submitted and other relevant information developed during the...

  14. 49 CFR 173.54 - Forbidden explosives.

    Science.gov (United States)

    2010-10-01

    ... dimension of which exceeds 23 mm (0.906 inch), or a toy torpedo containing a mixture of potassium chlorate... subpart. (b) An explosive mixture or device containing a chlorate and also containing: (1) An ammonium...

  15. 21 CFR 173.65 - Divinylbenzene copolymer.

    Science.gov (United States)

    2010-04-01

    ... weight-percent ethyl-vinyl-benzene, and no more than 4 weight-percent nonpolymerizable impurities. (b) In... Archives and Records Administration (NARA). For information on the availability of this material at NARA...

  16. 35_173 - 179_BIO 015 Akhilendra

    African Journals Online (AJOL)

    userpc

    population live in small and medium ci ... based development projects should focus ... nges of sustainability viz; lack of basic amenities and facilities, heal ... rds sustainable living environment of Damaturu town in Yobe Sta ... rojects should focus on major areas of water, electricity, housi .... Ministry of Lands and Housing.

  17. 21 CFR 173.300 - Chlorine dioxide.

    Science.gov (United States)

    2010-04-01

    ... sodium chlorite by electrolysis. (2) The generator effluent contains at least 90 percent (by weight) of... Health Association, 800 I St. NW., Washington, DC 20001-3750. You may inspect a copy at the Center for...

  18. 14 CFR 17.3 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... issuance of a Contracting Officer final decision. Contract disputes for purposes of ADR only may also... communication or the use of ADR. The Default Adjudicative Process is conducted by a DRO or Special Master... Office of Dispute Resolution for Acquisition. For a post-award protest, the awardee of the contract that...

  19. BDML Metadata: 173 [SSBD[Archive

    Lifescience Database Archive (English)

    Full Text Available NC-SA 0.180 af0395dc-f2a1-4e46-9a3b-28e282ab0526 0.105 x 0.105 x 0.5 (micrometer), 40 (second) http://ssbd.qbic.riken.jp/data.../source/Ce_KK_P002/RNAi_R10E4.4_061107_02.zip http://ssbd.qbic.riken.jp/data.../bdml/Ce_KK_P002/RNAi_R10E4.4_061107_02.bdml0.18.xml http://ssbd.qbic.riken.jp/data/pdpml/Ce_KK_...P002.pdpml0.06.xml http://ssbd.qbic.riken.jp/search/af0395dc-f2a1-4e46-9a3b-28e282ab0526/ http://ssbd.qbic.riken.jp/omero/webclient/?show=dataset-88 ...

  20. 21 CFR 173.340 - Defoaming agents.

    Science.gov (United States)

    2010-04-01

    ... cooking purposes, whereby no more than 10 parts per million is present in the cooked food. Formaldehyde As... alcohol Magnesium stearate As defined in § 172.863 of this chapter. Mineral oil: Conforming with § 172.878... chapter. Soybean oil fatty acids, hydroxylated Tallow, hydrogenated, oxidized or sulfated Tallow alcohol...

  1. 21 CFR 173.370 - Peroxyacids.

    Science.gov (United States)

    2010-04-01

    ... good manufacturing practice (unless precluded by the U.S. Department of Agriculture's standards of... the Division of Petition Review, Center for Food Safety and Applied Nutrition, Food and Drug... National Archives and Records Administration (NARA). For information on the availability of this material...

  2. Publications | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Building Capacity for Sustainable Responses to Climate Change in Cities of Portuguese-speaking Small Island Developing States (Cabo Verde and São Tomé e Príncipe) - Final Technical Report (restricted access). Small Island Developing States (SIDS) are highly vulnerable to climate change. In some locations coastal ...

  3. 50 CFR 17.3 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... part; Authentic native articles of handicrafts and clothing means items made by an Indian, Aleut, or... species, or a fire or other natural catastrophic event in areas prone to such events). Conservation plan... captive populations of the affected species: (a) Provision of health care, management of populations by...

  4. 49 CFR 173.158 - Nitric acid.

    Science.gov (United States)

    2010-10-01

    ... as identified by American Iron and Steel Institute type number, and, in addition, the letters “HT” following the steel designation on containers subject to stress relieving or heat treatment during... °F)), (B) Stabilized Type 347 in the as-welded condition, (C) Stabilized Type 347 stress-relieved...

  5. Search Results | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    As currently foreseen, neither the two-state nor the one-state solution offers much hope of resolving the Israeli-Palestinian conflict. Project ... The first phase of the project was funded after qualifying in a competition for projects featuring an ecosystem approach to human health in West Africa (100772). Project.

  6. 40 CFR 763.173 - Exemptions.

    Science.gov (United States)

    2010-07-01

    ... inadequate to allow the Agency to make a reasoned judgment on any of the information required in paragraph (d... the appropriate ban. This letter will be considered a final Agency action for purposes of judicial... notice will be considered a final Agency action for purposes of judicial review. (j) The length of an...

  7. 32 CFR 17.3 - Commission personnel.

    Science.gov (United States)

    2010-07-01

    ... with 32 CFR part 9, the Appointing Authority shall appoint at least three but no more than seven members and one or two alternate members. The Appointing Authority may remove members and alternate... Appointing Authority may replace the member, direct that an alternate member serve in the place of the...

  8. 47 CFR 87.173 - Frequencies.

    Science.gov (United States)

    2010-10-01

    ....000-117.975 MHz Q DGP Differential GPS. 108.050 MHz Q RLT 108.100-111.950 MHz Q RLL ILS Localizer. 108....600-121.925 MHz O, L, Q MA, FAC, MOU, RLT, GCO, RCO, RPC 25 kHz channel spacing. 121.950 MHz K FAS 121.... 122.700 MHz G, L MA, FAU, MOU Unicom at airports with no control tower; Aeronautical utility stations...

  9. 49 CFR 173.308 - Lighters.

    Science.gov (United States)

    2010-10-01

    ... word “sample” must appear on the shipping paper as part of the proper shipping name or in association... lighter design conforms to paragraph (a) of this section and passes or does not pass the required leakage... at least three years thereafter, a copy of each lighter's test report must be maintained by the...

  10. 33 CFR 173.3 - Definitions.

    Science.gov (United States)

    2010-07-01

    ...: (a) [Reserved] (b) Issuing authority means a State that has a numbering system approved by the Coast Guard or the Coast Guard where a number system has not been approved. Issuing authorities are listed in..., firm, partnership, corporation, company, association, joint-stock association, or governmental entity...

  11. 173 Résumé Abstract

    African Journals Online (AJOL)

    AKA BOKO

    1Laboratoire de Physique Appliquée de l'Université de Fianarantsoa - Madagascar. 2 Département de Sciences Exactes ... 3 Laboratoire de Mathématiques Et Physique des Systèmes-Groupes de Mécanique. Énergétique à .... Par définition, la vitesse de séchage est la variation par rapport au temps de l'humidité absolue ...

  12. 7 CFR 989.173 - Reports.

    Science.gov (United States)

    2010-01-01

    ... certified by an organic certification organization currently registered with the California Department of Food and Agriculture or such certifying organization accredited under the National Organic Program... shall provide copies of the organic certificate(s) applicable to the quantity of raisins reported as...

  13. 7 CFR 1.173 - Judges.

    Science.gov (United States)

    2010-01-01

    ... proceeding, (2) is related within the third degree by blood or marriage to any party to the proceeding, or (3... present. Any memorandum or other communication addressed to the Judicial Officer or a Judge, during the... prior to any hearing to be conducted by telephone or audio-visual telecommunication; (8) Require that...

  14. 49 CFR 173.29 - Empty packagings.

    Science.gov (United States)

    2010-10-01

    ... hazardous material shall be offered for transportation and transported in the same manner as when it.... (c) A non-bulk packaging containing only the residue of a hazardous material covered by Table 2 of... in Column 10a of the § 172.101 table for transportation by vessel, an empty drum or cylinder may be...

  15. 49 CFR 173.63 - Packaging exceptions.

    Science.gov (United States)

    2010-10-01

    ... transport personnel to remote work sites, such as offshore drilling units. (b) Cartridges, small arms, and... than 1 g explosive (excluding ignition and delay charges) that are electric blasting caps with leg wires 4 feet long or longer, delay connectors in plastic sheaths, or blasting caps with empty plastic...

  16. Publications | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Physico-chemical characteristics and fatty acid profile of desert date kernel oil in ... Learning for an uncertain future : vulnerabilities of agricultural production to ... trends in temperature, rainfall, sunshine, humidity and tidal water level in the ...

  17. 43 CFR 17.3 - Discrimination prohibited.

    Science.gov (United States)

    2010-10-01

    ... participate in the program as an employee but only to the extent set forth in paragraph (c) of this section... impairing accomplishment of the objectives of the program as respect individuals of a particular race, color..., financial aid, or other benefits provided under a program receiving Federal financial assistance shall be...

  18. 21 CFR 173.50 - Polyvinylpolypyrrolidone.

    Science.gov (United States)

    2010-04-01

    ... percent acetic acid, and 50 percent alcohol, no more than 50 parts per million of extractables is obtained with each solvent. (c) It is used or intended for use as a clarifying agent in beverages and vinegar...

  19. WESF (173)Cs gamma ray sources

    Science.gov (United States)

    Kenna, B. T.

    1984-10-01

    The Waste Encapsulation and Storage Facility (WESP) at Hanford, Washington has been separating cesium from stored liquid defense waste since 1945. This is done to alleviate the heat generated by the decay of radioactive Cs137. The cesium is converted to CsCl, doubly encapsulated in 316l stainless steel, and placed in storage. The potential utility of these Cs137 capsules as gamma radiation sources was demonstrated. Registration of the capsule with the NRC as a sealed gamma source would facilitate the licensing of non-DOE irradiation facilities using this source. To grant this registration, the NRC requires characteristics of the capsule. It must also be demonstrated that the capsule will maintain its integrity under both normal circumstances and specified abnormal conditions. The required information is provided through collation of results of studies and tests done previously by other laboratories.

  20. 21 CFR 17.3 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL CIVIL MONEY PENALTIES... giving rise to civil money penalty actions brought under 21 U.S.C. 333(g)(1): (1) Significant departure... has the same definition for civil money penalty actions that may be brought under that act. (e) Any...

  1. 21 CFR 173.165 - Candida lipolytica.

    Science.gov (United States)

    2010-04-01

    ... may be safely used as the organism for fermentation production of citric acid in accordance with the... intended for use as a pure culture in the fermentation process for the production of citric acid from... such as oil, grease, detergent residues, etc. Examine all glassware including stoppers and stopcocks...

  2. Adsorption of dysprosium on the graphite (0001) surface: Nucleation and growth at 300 K

    International Nuclear Information System (INIS)

    Kwolek, Emma J.; Lii-Rosales, Ann; Lei, Huaping; Wang, Cai-Zhuang; Tringides, Michael C.; Evans, James W.; Wallingford, Mark; Zhou, Yinghui; Thiel, Patricia A.

    2016-01-01

    We have studied nucleation and growth of Dy islands on the basal plane of graphite at 300 K using scanning tunneling microscopy, density functional theory (DFT) in a form that includes van der Waals interactions, and analytic theory. The interaction of atomic Dy with graphite is strong, while the diffusion barrier is small. Experiment shows that at 300 K, the density of nucleated islands is close to the value predicted for homogeneous nucleation, using critical nucleus size of 1 and the DFT-derived diffusion barrier. Homogeneous nucleation is also supported by the monomodal shape of the island size distributions. Comparison with the published island density of Dy on graphene shows that the value is about two orders of magnitude smaller on graphite, which can be attributed to more effective charge screening in graphite. The base of each island is 3 atomic layers high and atomically ordered, forming a coincidence lattice with the graphite. Islands resist coalescence, probably due to multiple rotational orientations associated with the coincidence lattice. Upper levels grow as discernible single-atom layers. Analysis of the level populations reveals significant downward interlayer transport, which facilitates growth of the base. This island shape is metastable, since more compact three-dimensional islands form at elevated growth temperature.

  3. Dysprosium separation from aqueous phase by non-dispersive solvent extraction employing hollow fibre membrane module

    International Nuclear Information System (INIS)

    Yadav, Kartikey K.; Singh, D.K.; Kain, V.

    2017-01-01

    Rare earth elements (REEs) consist of fourteen lanthanides and three elements which are Sc, Y and La resulting in total 17 REEs. In the last decade, these rare earths elements which have unique physical and chemical properties have been highly in demand for their application in almost all walks of life. Various methods such as ion exchange, precipitation and solvent extraction have been used to recover these elements from aqueous solutions. These traditional methods have some inherent disadvantages like handling of hazardous organic chemicals, ineffectiveness to recover a very low concentration of contaminated source etc. In this regard, an important method i.e. liquid membrane offers separation scheme; which combines the characteristics, of solvent extraction and solid membrane separation, to overcome the disadvantages of conventional techniques. Various experiments were carried out to evaluate the effect of feed acidity, metal ion concentration, carrier concentration, feed composition, flow rates and phase ratio on the transport of rare earths metal ions across the membrane

  4. Manufacturing of Dysprosium-Iron Alloys by Electrolysis in Fluoride-Based Electrolytes: Oxide Solubility Determinations

    Science.gov (United States)

    Martinez, Ana Maria; Støre, Anne; Osen, Karen Sende

    2018-04-01

    Electrolytic production of light rare earth elements and alloys takes place in a fluoride-based electrolyte using rare earth oxides as raw material. The optimization of this method, mainly in terms of the energy efficiency and environmental impact control, is rather challenging. Anode effects, evolution of fluorine-containing compounds, and side cathode reactions could largely be minimized by a good control of the amount of rare earth oxide species dissolved in the fluoride-based electrolyte and their dissolution rate. The oxide content of the fluoride melts REF3-LiF (RE = Nd, Dy) at different compositions and temperatures were experimentally determined by carbothermal analysis of melt samples. The highest solubility values of oxide species, added as Dy2O3 and Dy2(CO3)3, were obtained to be of ca. 3 wt pct (expressed as Dy2O3) in the case of the equimolar DyF3-LiF melt at 1323 K (1050 °C). The oxide saturation values increased with the amount of REF3 present in the molten bath and the working temperature.

  5. A naproxen complex of dysprosium intercalates into calf thymus DNA base pairs

    International Nuclear Information System (INIS)

    Yang, Mengsi; Jin, Jianhua; Xu, Guiqing; Cui, Fengling; Luo, Hongxia

    2014-01-01

    Highlights: • Binding mode to ctDNA was studied by various methods. • Intercalation is the most possible binding mode. • Dynamic and static quenching occurred simultaneously. • Hydrophobic force played a major role. • Binding characteristic of rare earth complexes to DNA are dependent on the element. - Abstract: The binding mode and mechanism of dysprosium–naproxen complex (Dy–NAP) with calf thymus deoxyribonucleic acid (ctDNA) were studied using UV–vis and fluorescence spectra in physiological buffer (pH 7.4). The results showed that more than one type of quenching process occurred and the binding mode between Dy–NAP with ctDNA might be intercalation. In addition, ionic strength, iodide quenching and fluorescence polarization experiments corroborated the intercalation binding mode between Dy–NAP and ctDNA. The calculated thermodynamic parameters ΔG, ΔH and ΔS at different temperature demonstrated that hydrophobic interaction force played a major role in the binding process

  6. White light emission and color tunability of dysprosium doped barium silicate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Mishra, Lokesh; Sharma, Anchal; Vishwakarma, Amit K.; Jha, Kaushal [Department of Applied Physics, Delhi Technological University, Delhi 110042 (India); Jayasimhadri, M., E-mail: jayaphysics@yahoo.com [Department of Applied Physics, Delhi Technological University, Delhi 110042 (India); Ratnam, B.V.; Jang, Kiwan [Department of Physics, Changwon National University, Changwon 641-77 (Korea, Republic of); Rao, A.S.; Sinha, R.K. [Department of Applied Physics, Delhi Technological University, Delhi 110042 (India)

    2016-01-15

    The present work elucidates the synthesis of Dy{sup 3+} doped barium silicate glasses, along with the subsequent studies performed to evaluate its viability in solid state lighting applications. The synthesized photonic glasses were investigated via X-Ray Diffraction, Scanning Electron Microscopy and Fourier Transform Infrared Spectroscopy. The photoluminescence properties were examined under ultraviolet (UV)/near UV (NUV) excitation. Photoluminescence spectrum exhibited characteristic emission bands at λ{sub em}=483 nm (blue) and λ{sub em}=576 nm (yellow) which are ascribed to the {sup 4}F{sub 9/2}→{sup 6}H{sub 15/2} and {sup 4}F{sub 9/2}→{sup 6}H{sub 13/2} transitions of Dy{sup 3+} ion, respectively. The chromaticity coordinates under excitation of λ{sub ex}=348 nm are (0.31, 0.34), which lies in the white region of CIE 1931 chromaticity diagram and are in excellent proximity with the standard equal energy white illuminant (0.333, 0.333). The calculated correlated color temperature and the yellow to blue (Y/B) ratio are found to be 6602 K and 1.12, respectively for the optimized sample. The synthesized photonic glass also offered the possibility of tuning the color as exemplified through the variation in CIE coordinates, correlated color temperature and the Y/B ratio. The results confirm the possibility of color tunability from the proposed glass and may be useful for various photonic device applications. - Highlights: • Successfully synthesized Dy{sup 3+} doped barium silicate glasses. • Structural properties thoroughly discussed by using XRD and FT-IR. • Photoluminescence and colorimetry properties have been investigated. • Y/B ratio and the reason for color tunability have been successfully explained. • CIE coordinates of Dy{sup 3+}:BBS glass confirm its suitability for w-LEDs.

  7. New ultrasonic attenuation maxima for single crystal dysprosium in a magnetic field

    International Nuclear Information System (INIS)

    Treder, R.A.; Maekawa, S.; Levy, M.

    1976-01-01

    The temperatures and corresponding applied basal plane magnetic fields are reported for longitudinal ultrasonic attenuation maxima in a cylindrical Dy sample. Besides maxima at Tsub(N) and Tsub(C), two new maxima are observed and possible explanations for their existence are given. (Auth.)

  8. Adsorption of dysprosium on the graphite (0001) surface: Nucleation and growth at 300 K

    Energy Technology Data Exchange (ETDEWEB)

    Kwolek, Emma J.; Lii-Rosales, Ann [The Ames Laboratory, Ames, Iowa 50011 (United States); Department of Chemistry, Iowa State University, Ames, Iowa 50011 (United States); Lei, Huaping; Wang, Cai-Zhuang; Tringides, Michael C.; Evans, James W. [The Ames Laboratory, Ames, Iowa 50011 (United States); Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States); Wallingford, Mark; Zhou, Yinghui [The Ames Laboratory, Ames, Iowa 50011 (United States); Thiel, Patricia A., E-mail: pthiel@iastate.edu [The Ames Laboratory, Ames, Iowa 50011 (United States); Department of Chemistry, Iowa State University, Ames, Iowa 50011 (United States); Department of Materials Science and Engineering, Iowa State University, Ames, Iowa 50011 (United States)

    2016-12-07

    We have studied nucleation and growth of Dy islands on the basal plane of graphite at 300 K using scanning tunneling microscopy, density functional theory (DFT) in a form that includes van der Waals interactions, and analytic theory. The interaction of atomic Dy with graphite is strong, while the diffusion barrier is small. Experiment shows that at 300 K, the density of nucleated islands is close to the value predicted for homogeneous nucleation, using critical nucleus size of 1 and the DFT-derived diffusion barrier. Homogeneous nucleation is also supported by the monomodal shape of the island size distributions. Comparison with the published island density of Dy on graphene shows that the value is about two orders of magnitude smaller on graphite, which can be attributed to more effective charge screening in graphite. The base of each island is 3 atomic layers high and atomically ordered, forming a coincidence lattice with the graphite. Islands resist coalescence, probably due to multiple rotational orientations associated with the coincidence lattice. Upper levels grow as discernible single-atom layers. Analysis of the level populations reveals significant downward interlayer transport, which facilitates growth of the base. This island shape is metastable, since more compact three-dimensional islands form at elevated growth temperature.

  9. An operationally simple method for separating the rare-earth elements neodymium and dysprosium

    Energy Technology Data Exchange (ETDEWEB)

    Bogart, Justin A.; Lippincott, Connor A.; Carroll, Patrick J.; Schelter, Eric J. [Department of Chemistry, University of Pennsylvania, Philadelphia, PA (United States)

    2015-07-06

    Rare-earth metals are critical components of electronic materials and permanent magnets. Recycling of consumer materials is a promising new source of rare earths. To incentivize recycling there is a clear need for simple methods for targeted separations of mixtures of rare-earth metal salts. Metal complexes of a tripodal nitroxide ligand [{(2-"tBuNO)C_6H_4CH_2}{sub 3}N]{sup 3-} (TriNOx{sup 3-}), feature a size-sensitive aperture formed of its three η{sup 2}-(N,O) ligand arms. Exposure of metal cations in the aperture induces a self-associative equilibrium comprising [M(TriNOx)thf]/[M(TriNOx)]{sub 2} (M=rare-earth metal). Differences in the equilibrium constants (K{sub eq}) for early and late metals enables simple Nd/Dy separations through leaching with a separation ratio S{sub Nd/Dy}=359. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  10. An Operationally Simple Method for Separating the Rare-Earth Elements Neodymium and Dysprosium.

    Science.gov (United States)

    Bogart, Justin A; Lippincott, Connor A; Carroll, Patrick J; Schelter, Eric J

    2015-07-06

    Rare-earth metals are critical components of electronic materials and permanent magnets. Recycling of consumer materials is a promising new source of rare earths. To incentivize recycling there is a clear need for simple methods for targeted separations of mixtures of rare-earth metal salts. Metal complexes of a tripodal nitroxide ligand [{(2-(t) BuNO)C6 H4 CH2 }3 N](3-) (TriNOx(3-) ), feature a size-sensitive aperture formed of its three η(2) -(N,O) ligand arms. Exposure of metal cations in the aperture induces a self-associative equilibrium comprising [M(TriNOx)thf]/ [M(TriNOx)]2 (M=rare-earth metal). Differences in the equilibrium constants (Keq ) for early and late metals enables simple Nd/Dy separations through leaching with a separation ratio SNd/Dy =359. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Cerium: an unlikely replacement of dysprosium in high performance Nd-Fe-B permanent magnets.

    Science.gov (United States)

    Pathak, Arjun K; Khan, Mahmud; Gschneidner, Karl A; McCallum, Ralph W; Zhou, Lin; Sun, Kewei; Dennis, Kevin W; Zhou, Chen; Pinkerton, Frederick E; Kramer, Matthew J; Pecharsky, Vitalij K

    2015-04-24

    Replacement of Dy and substitution of Nd in NdFeB-based permanent magnets by Ce, the most abundant and lowest cost rare earth element, is important because Dy and Nd are costly and critical rare earth elements. The Ce, Co co-doped alloys have excellent high-temperature magnetic properties with an intrinsic coercivity being the highest known for T ≥ 453 K. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. A Linear Tetranuclear Dysprosium(III) Compound Showing Single-Molecule Magnet Behavior

    Energy Technology Data Exchange (ETDEWEB)

    Ke, Hongshan; Xu, Gong Feng; Guo, Yun-Nan; Gamez, Patrick; Beavers, Christine M; Teat, Simon J; Tang, Jinkui

    2010-04-20

    Although magnetic measurements reveal a single-relaxation time for a linear tetranuclear Dy(III) compound, the wide distribution of the relaxation time observed clearly suggests the presence of two slightly different anisotropic centres, therefore opening new avenues for investigating the relaxation dynamics of lanthanide aggregates.

  13. Experimental study of induced staggered magnetic fields in dysprosium gallium garnet (DGG)

    International Nuclear Information System (INIS)

    Steiner, M.; Corliss, L.M.; Hastings, J.M.; Blume, M.; Giordano, N.; Wolf, W.P.

    1979-01-01

    Neutron diffraction techniques have been used to study induced staggered magnetic field effects in DGG. The application of a uniform magnetic field at temperatures much greater than the Neel temperature induces a significant amount of antiferromagnetic order. The temperature and field dependences of this effect are in good agreement with recent theoretical predicions

  14. Influence of dysprosium and terbium additions on aluminium structure and properties

    International Nuclear Information System (INIS)

    Fridlyander, I.N.; Sokolovskaya, E.M.; Zimina, E.N.; Tkachenko, E.A.; Artemova, M.S.

    1992-01-01

    The influence of 0.3%Dy and 0.3%Tb additions were investigated on grain size in aluminium ingots and on recrystallization and mechanical properties in 1.5 mm thick sheets. Grain refinement in ingots was revealed along with an increase of sheet recrystallization temperature and grain growth retardation in the process of secondary recrystallization. Ultimate strength was found to rise at some decrease of specific elongation

  15. Improvement of high-frequency characteristics of Z-type hexaferrite by dysprosium doping

    International Nuclear Information System (INIS)

    Mu Chunhong; Liu Yingli; Song Yuanqiang; Wang Liguo; Zhang Huaiwu

    2011-01-01

    Z-type hexaferrite has great potential applications as anti-EMI material for magnetic devices in the GHz region. In this work, Dy-doped Z-type hexaferrites with nominal stoichiometry of Ba 3 Co 2 Dy x Fe 24-x O 41 (x 0.0, 0.05, 0.5, 1.0) were prepared by an improved solid-state reaction method. The effects of rare earth oxide (Dy 2 O 3 ) addition on the phase composition, microstructure and electromagnetic properties of the ceramics were investigated. Structure and micromorphology characterizations indicate that certain content of Dy doping will cause the emergence of the second phase Dy 3 Fe 5 O 12 at the grain boundaries of the majority phase Z-type hexaferrite, due to which the straightforward result is the grain refinement during the successive sintering process. Permeability spectra measurements show that the initial permeability reaches its maximum of 17 at 300 MHz with x = 0.5, while the cutoff frequency keeps above 800 MHz. The apparent specific anisotropy field H K of Dy-doped Z-type hexaferrites decreases with x increasing. The relationships among phase composition, grain size, permeability spectra, and anisotropy are theoretically investigated, and according to the analysis, Dy doping effects on its magnetic properties can be well explained and understood.

  16. Synthesis, photoluminescence and intramolecular energy transfer model of a dysprosium complex

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Aiqin; Zhang Jiuli; Pan Qiliang; Wang Shuhua [College of Materials Science and Engineering, Taiyuan University of Technology, No. 79 West Yingze Street, Taiyuan, Shanxi 030024 (China); Key Laboratory of Interface Science and Engineering in Advanced Materials of Taiyuan University of Technology, Ministry of Education, Taiyuan, Shanxi 030024 (China); Jia Husheng, E-mail: Jia_Husheng@126.com [College of Materials Science and Engineering, Taiyuan University of Technology, No. 79 West Yingze Street, Taiyuan, Shanxi 030024 (China) and Key Laboratory of Interface Science and Engineering in Advanced Materials of Taiyuan University of Technology, Ministry of Education, Taiyuan, Shanxi 030024 (China); Xu Bingshe [College of Materials Science and Engineering, Taiyuan University of Technology, No. 79 West Yingze Street, Taiyuan, Shanxi 030024 (China); Key Laboratory of Interface Science and Engineering in Advanced Materials of Taiyuan University of Technology, Ministry of Education, Taiyuan, Shanxi 030024 (China)

    2012-04-15

    The energy of the highest occupied molecular orbital and the lowest unoccupied molecular orbital as well as their energy gaps, and the singlet and triplet state energy levels of 4-benzoylbenzoic acid (HL=4-BBA) and triphenylphosphine oxide (TPPO) were calculated with the Gaussian03 program package. The singlet state and triplet state energy levels were also estimated from the UV-vis absorption spectra and phosphorescence spectra. The results suggest that the calculated values approximately coincided with the experimental values. A Dy(III) complex was synthesized with 4-BBA as primary ligand and TPPO as neutral ligand. The structure of the complex was characterized by elemental analysis, {sup 1}H NMR spectrometry, and FTIR spectrometry. TG-DTG analysis indicates that the complex kept stable up to 305 Degree-Sign C. The photoluminescence properties were studied by fluorescence spectrometry. The results show that Dy(III) ion sensitized by 4-BBA and TPPO emitted characteristic peaks at 572 nm ({sup 4}F{sub 9/2}-{sup 6}H{sub 13/2}) and 480 nm ({sup 4}F{sub 9/2}-{sup 6}H{sub 15/2}), and its Commission Internationale de L'Eclairge coordinates were calculated as x=0.33 and y=0.38, being located in the white range. Intermolecular energy transfer process was discussed and energy transfer model was also proposed. - Highlights: Black-Right-Pointing-Pointer Quantum calculation provides theoretical method of ligand choice for rare earth. Black-Right-Pointing-Pointer The complex Dy(L){sub 3}(TPPO){sub 2} emitted white light. Black-Right-Pointing-Pointer The CIE coordinates were calculated as x=0.33 and y=0.38. Black-Right-Pointing-Pointer Energy transfer in Dy(L){sub 3}(TPPO){sub 2} followed Dexter electron exchange theory.

  17. Crystal-field magnetic anisotropy of dilute dysprosium or erbium in yttrium single crystals

    DEFF Research Database (Denmark)

    Høg, J.; Touborg, P.

    1974-01-01

    Magnetization measurements have been performed between 1.3 and 300 K in fields up to 50 × 105 A/m in the a, b, and c directions of hcp crystals of pure Y and Y doped with 0.14-at.% Dy or 0.14-at.% Er, using the Faraday method and a vibrating-sample method. The characteristic behavior of both...

  18. Extraction and stripping of neodymium (III) and dysprosium (III) by TRUEX solvent

    International Nuclear Information System (INIS)

    Rout, Alok; Venkatesan, K.A.; Antony, M.P.; Srinivasan, T.G.; Vasudeva Rao, P.R.

    2009-01-01

    McCabe-Thiele diagram for the extraction and stripping of Nd (III) and Dy (III) by TRUEX solvent has been constructed to determine the number of stages required for complete extraction and stripping. (author)

  19. Antiferroquadrupolar ordering and anisotropic magnetic phase diagram of dysprosium palladium bronze, DyPd3S4

    International Nuclear Information System (INIS)

    Matsuoka, Eiichi; Tayama, Takashi; Sakakibara, Toshiro; Hiroi, Zenji; Takeda, Naoya; Ishikawa, Masayasu; Shirakawa, Naoki

    2007-01-01

    From the measurements of magnetization and specific heat, we constructed B-T phase diagrams of single-crystalline DyPd 3 S 4 which is known to exhibit antiferroquadrupolar (AFQ) and antiferromagnetic (AFM) ordering at low temperatures. The phase diagrams are found to be highly anisotropic and re-entrant, which are typical of rare-earth compounds exhibiting multipolar ordering. The crystalline electric field (CEF) scheme of Dy 3+ in DyPd 3S4 was deduced from the specific heat and magnetization measurements of the Y-diluted compounds Dy 1-x Y x Pd 3 S 4 (0.1≤x≤0.9) and discussed in detail. The CEF ground state was determined to be the orbitally-degenerated quartet Γ 67 (1) , and the overall splitting width was estimated to be about 104 K. No correlation was found between the anisotropy of T Q and that of the Zeeman splitting width of the ground quartet Γ 67 (1) . (author)

  20. Effect of Ligand Field Tuning on the SMM Behavior for Three Related Alkoxide-Bridged Dysprosium Dimers.

    Science.gov (United States)

    Peng, Yan; Mereacre, Valeriu; Baniodeh, Amer; Lan, Yanhua; Schlageter, Martin; Kostakis, George E; Powell, Annie K

    2016-01-04

    The synthesis and characterization of three Dy2 compounds, [Dy2(HL1)2(NO3)4] (1), [Dy2(L2)2(NO3)4] (2), and [Dy2(HL3)2(NO3)4] (3), formed using related tripodal ligands with a central tertiary amine bearing picolyl and alkoxy arms, 2-[(2-hydroxy-ethyl)-pyridin-2-ylmethylamino]-ethanol (H2L1), 2-(bis-pyridin-2-ylmethylamino)-ethanol (HL2), and 2-(bis-pyridin-2-ylmethylamino)-propane-1,3-diol (H2L3), are reported. The compounds are rare examples of alkoxide-bridged {Dy2} complexes and display capped square antiprism coordination geometry around each Dy(III) ion. Changes in the ligand field environment around the Dy(III) ions brought about through variations in the ligand donors can be gauged from the magnetic properties, with compounds 1 and 2 showing antiparallel coupling between the Dy(III) ions and 3 showing parallel coupling. Furthermore, slow relaxation of the magnetization typical of SMM behavior could be observed for compounds 2 and 3, suggesting that small variations in the ligand field can have a significant influence on the slow relaxation processes responsible for SMM behavior of Dy(III)-based systems.

  1. Effects of magnetic annealing on structure and multiferroic properties of pure and dysprosium substituted BiFeO 3

    KAUST Repository

    Zhang, Shuxia; Yao, Yingbang; Chen, Yao; Wang, Dongliang; Zhang, Xianping; Awaji, Satoshi; Watanabe, Kazuo; Ma, Yanwei

    2012-01-01

    In this work, the effects of magnetic annealing on crystal structure and multiferroic properties of BiFeO 3 and Bi 0.85Dy 0.15FeO 3 have been investigated. It is found that the X-ray diffraction patterns of pure BiFeO 3 samples are obviously broadened after magnetic annealing, whereas those of Bi 0.85Dy 0.15FeO 3 samples are almost unchanged. Magnetic field annealing did not affect the magnetic properties of these two kinds of samples much. However, ferroelectric properties of the two materials exhibited different behaviors after magnetic field annealing. For pure BiFeO 3 samples, the remnant polarizations (P r) are suppressed; in contrast, for Bi 0.85Dy 0.15FeO 3 samples, P r is greatly enhanced. Possible mechanisms for the effects of magnetic field annealing have been discussed. © 2012 Elsevier B.V. All rights reserved.

  2. A rational approach to the modulation of the dynamics of the magnetisation in a dysprosium-nitronyl-nitroxide radical complex.

    Science.gov (United States)

    Poneti, Giordano; Bernot, Kevin; Bogani, Lapo; Caneschi, Andrea; Sessoli, Roberta; Wernsdorfer, Wolfgang; Gatteschi, Dante

    2007-05-14

    A control of the dynamics of the magnetisation is chemically achieved in a ring-like Dy-radical based molecule, allowing the estimation of the quantum tunneling frequency with a (4)He-cooled susceptometer.

  3. Manufacturing of Dysprosium-Iron Alloys by Electrolysis in Fluoride-Based Electrolytes. Electrolysis in a Laboratory-Scale Cell

    Science.gov (United States)

    Martinez, Ana Maria; Osen, Karen Sende; Støre, Anne; Gudbrandsen, Henrik; Kjos, Ole Sigmund; Solheim, Asbjørn; Wang, Zhaohui; Oury, Alexandre; Namy, Patrick

    2018-04-01

    Electrolytic production of light rare earth elements and rare earth alloys with transition elements takes place in a fluoride-based electrolyte using rare earth oxides as raw material. The optimization of this method, mainly in terms of the energy efficiency and environmental impact control, is rather challenging. Anode effects, evolution of fluorine-containing compounds and side cathode reactions could largely be minimized by good control of the amount of rare earth oxide species dissolved in the fluoride-based electrolyte and their dissolution rate. The Dy2O3 feed rate needed for stable cell operation was studied by following up the anode voltage and gas analysis. On-line analysis of the cell off-gases by FTIR showed that the electrochemical reaction for the formation of Dy-Fe alloy gives mainly CO gas and that CF4 is starting to evolve gradually at anode voltages of ca. 3.25 V. The limiting current density for the discharge of the oxide ions at the graphite anode was in the range of 0.1 to 0.18 A cm-2 at dissolved Dy2O3 contents of ca. 1 wt pct. Modeling of the laboratory cell reactor was also carried out by implementing two models, i.e., an electrical model simulating the current density distribution at the electrodes and a laminal bubbly flow model that explains the electrolyte velocity induced by gas bubble production at the anode.

  4. Sol-gel synthesis and crystallization kinetics of dysprosium-titanate Dy2Ti2O7 for photonic applications

    Czech Academy of Sciences Publication Activity Database

    Mrázek, Jan; Potel, M.; Buršík, Jiří; Mráček, A.; Kallistová, Anna; Jonášová, Šárka; Boháček, Jan; Kašík, Ivan

    2015-01-01

    Roč. 168, November (2015), s. 159-167 ISSN 0254-0584 Institutional support: RVO:67985882 ; RVO:68081723 ; RVO:67985831 Keywords : Ceramics * Inorganic compounds * Optical materials Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering; JG - Metallurgy (UFM-A); CB - Analytical Chemistry, Separation (GLU-S) Impact factor: 2.101, year: 2015

  5. Critical Rare Earths, National Security, and U.S.-China Interactions: A Portfolio Approach to Dysprosium Policy Design

    Science.gov (United States)

    2015-01-01

    from Donald and Susan Rice , both funds which enabled me to focus on the dissertation. I thank Dean Susan Marquis for her dedication to the growth of...quota of 89,2000 tonnes (Table 2.2). The sprawling black market not only prevents Beijing’s efforts to bring the production under its levers to...yttrium are often used for pigmentation for consumer products such as paint and sunglasses. REE-based lasers are used for cosmetic , epidermal, and

  6. White- and blue-light-emitting dysprosium(III) and terbium(III)-doped gadolinium titanate phosphors.

    Science.gov (United States)

    Antić, Ž; Kuzman, S; Đorđević, V; Dramićanin, M D; Thundat, T

    2017-06-01

    Here we report the synthesis and structural, morphological, and photoluminescence analysis of white- and blue-light-emitting Dy 3 + - and Tm 3 + -doped Gd 2 Ti 2 O 7 nanophosphors. Single-phase cubic Gd 2 Ti 2 O 7 nanopowders consist of compact, dense aggregates of nanoparticles with an average size of ~25 nm for Dy 3 + -doped and ~50 nm for Tm 3 + -doped samples. The photoluminescence results indicated that ultraviolet (UV) light excitation of the Dy 3 + -doped sample resulted in direct generation of white light, while a dominant yellow emission was obtained under blue-light excitation. Intense blue light was obtained for Tm 3 + -doped Gd 2 Ti 2 O 7 under UV excitation suggesting that this material could be used as a blue phosphor. Copyright © 2016 John Wiley & Sons, Ltd.

  7. Isothermal sections of phase equilibria diagrams for systems (terbium, dysprosium, holmium)-molybdenum-boron at 1273 K

    International Nuclear Information System (INIS)

    Kuz'ma, Yu.B.; Zakharchuk, N.P.; Maksimova, L.T.

    1988-01-01

    The methods of X-ray analysis are used to study the R-Mo-B (R-Tb, Dy, Ho) systems and isothermal sections of phase equilibria diagrams at 1273 K are plotted. A formation of RMoB 4 (structure of the YCrB 4 type) is confirmed and borides R 3 MoB 7 (structure of the Er 3 CrB 7 type) and ∼ RMo 4 B 8 (of the unknown structure) are obtained for the first time. Borides DyMoB 3 and HoMoB 3 are of the ErMoB 3 structure. Lattice periods of new compounds are indicated. Diffractogrammes of borides Dy 3 MoB 7 and DyMoB 3 are calculated. A peculiarity of components interaction in the systems rare-earth metal-molybdenum-boron is considered

  8. Effects of magnetic annealing on structure and multiferroic properties of pure and dysprosium substituted BiFeO 3

    KAUST Repository

    Zhang, Shuxia

    2012-07-01

    In this work, the effects of magnetic annealing on crystal structure and multiferroic properties of BiFeO 3 and Bi 0.85Dy 0.15FeO 3 have been investigated. It is found that the X-ray diffraction patterns of pure BiFeO 3 samples are obviously broadened after magnetic annealing, whereas those of Bi 0.85Dy 0.15FeO 3 samples are almost unchanged. Magnetic field annealing did not affect the magnetic properties of these two kinds of samples much. However, ferroelectric properties of the two materials exhibited different behaviors after magnetic field annealing. For pure BiFeO 3 samples, the remnant polarizations (P r) are suppressed; in contrast, for Bi 0.85Dy 0.15FeO 3 samples, P r is greatly enhanced. Possible mechanisms for the effects of magnetic field annealing have been discussed. © 2012 Elsevier B.V. All rights reserved.

  9. Generation of White Light from Dysprosium-Doped Strontium Aluminate Phosphor by a Solid-State Reaction Method

    Science.gov (United States)

    Sahu, Ishwar Prasad; Bisen, D. P.; Brahme, N.; Tamrakar, Raunak Kumar

    2016-04-01

    A single-host lattice, white light-emitting SrAl2O4:Dy3+ phosphor was synthesized by a solid-state reaction method. The crystal structure of prepared SrAl2O4:Dy3+ phosphor was in a monoclinic phase with space group P21. The chemical composition of the sintered SrAl2O4:Dy3+ phosphor was confirmed by the energy dispersive x-ray spectroscopy technique. Under ultra-violet excitation, the characteristic emissions of Dy3+ are peaking at 475 nm, 573 nm and 660 nm, originating from the transitions of 4F9/2 → 6H15/2, 4F9/2 →&!nbsp; 6H13/2 and 4F9/2 → 6H11/2 in the 4f9 configuration of Dy3+ ions. Commission International de I'Eclairage color coordinates of SrAl2O4:Dy3+ are suitable for white light-emitting phosphor. In order to investigate the suitability of the samples as white color light sources for industrial uses, correlated color temperature (CCT) and color rendering index (CRI) values were calculated. Values of CCT and CRI were found well within the defined acceptable range. Mechanoluminescence (ML) intensity of SrAl2O4:Dy3+ phosphor increased linearly with increasing impact velocity of the moving piston. Thus, the present investigation indicates piezo-electricity was responsible for producing ML in sintered SrAl2O4:Dy3+ phosphor. Decay rates of the exponential decaying period of the ML curves do not change significantly with impact velocity. The photoluminescence and ML results suggest that the synthesized SrAl2O4:Dy3+ phosphor was useful for the white light-emitting diodes and stress sensor respectively.

  10. Complexes of lanthanum(III), cerium(III), samarium(III) and dysprosium(III) with substituted piperidines

    Energy Technology Data Exchange (ETDEWEB)

    Manhas, B S; Trikha, A K; Singh, H; Chander, M

    1983-11-01

    Complexes of the general formulae M/sub 2/Cl/sub 6/(L)/sub 3/.C/sub 2/H/sub 5/OH and M/sub 2/(NO/sub 3/)/sub 6/(L)/sub 2/.CH/sub 3/OH have been synthesised by the reactions of chlorides and nitrates of La(III), Ce(III), Sm(III) and Dy(III) with 2-methylpiperidine, 3-methylpiperidine and 4-methylpiperidine. These complexes have been characterised on the basis of their elemental analysis, and IR and electronic reflectance spectra. IR spectral data indicate the presence of coordinated ethanol and methanol molecules and bidentate nitrate groups. Coordination numbers of the metal ions vary from 5 to 8. 19 refs.

  11. Study of the optical and magnetostatic properties of thin platelets of dysprosium and holmium ortho-ferrites

    International Nuclear Information System (INIS)

    Challeton, Didier

    1970-07-01

    Device applications of cylindrical magnetic domains - sometimes referred to as 'bubbles' - was first demonstrated by A.H. Bobeck in the rare earth ortho-ferrites. General magnetic and optical properties of the rare earth ortho-ferrites are considered. The theoretical study of the cylindrical magnetic domains and their stability conditions are presented in this paper. The single crystals were grown by the PbO flux method. The thin platelets (≅ 50 microns thick) preparation is specified and the magneto-optical measurements are presented. Absorption, birefringence and Faraday rotation were measured in HoFeO 3 and DyFeO 3 . The utilisation conditions of these materials are characterized by the measurements of the smallest stable domain diameter. (author) [fr

  12. An alkali-metal ion extracted layered compound as a template for a metastable phase synthesis in a low-temperature solid-state reaction: preparation of brookite from K0.8Ti1.73Li0.27O4.

    Science.gov (United States)

    Ozawa, Tadashi C; Sasaki, Takayoshi

    2010-03-15

    We have designed a new approach to synthesize brookite, i.e., to extract alkali-metal ions from K(0.8)Ti(1.73)Li(0.27)O(4) (KTLO) and to apply simultaneous heat treatment to the remaining lepidocrocite-type layers of TiO(6) octahedra. For the alkali-metal ion extraction and the simultaneous heat treatment, KTLO was heated at 400 degrees C with polytetrafluoroethylene (PTFE) in flowing Ar. PTFE has been found to be an effective agent to extract strongly electropositive alkali-metal ions from KTLO because of the strong electronegativity of F as its component. The product of this reaction consists of a mixture of brookite, K(2)CO(3), LiF, and PTFE derivatives, indicating the complete extraction of K(+) and Li(+) from KTLO and formation of brookite from the lepidocrocite-type layer of TiO(6) octahedra as a template. This brookite has a partial replacement of O(2-) with F(-) and/or slight oxygen deficiency; thus, its color is light-bluish gray. Fully oxidized brookite formation and complete decomposition of PTFE derivatives have been achieved by further heating in flowing air, and coproduced alkali-metal salts have been removed by washing in water. Powder X-ray diffraction, Raman spectroscopy, and chemical analysis results have confirmed that the final brookite product treated at 600 degrees C is single phase, and it is white. The method to extract alkali-metal ions from a crystalline material using PTFE is drastically different from the common methods such as soft-chemical and electrochemical reactions. It is likely that this new synthetic approach is applicable to other layered systems to prepare a diverse family of compounds, including novel metastable ones.

  13. 49 CFR 173.59 - Description of terms for explosives.

    Science.gov (United States)

    2010-10-01

    ...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Definitions, Classification and Packaging for Class 1... insensitive detonating substances and which demonstrate a negligible probability of accidental initiation or... processes. Charges, propelling. Articles consisting of propellant charge in any physical form, with or...

  14. 24 CFR 17.3 - Administrative claim; who may file.

    Science.gov (United States)

    2010-04-01

    ... representative. (c) A claim based on death may be presented by the executor or administrator of the decedent's... evidence of his authority to present a claim on behalf of the claimant as agent, executor, administrator...

  15. 21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Catalase derived from Micrococcus lysodeikticus... Micrococcus lysodeikticus. Bacterial catalase derived from Micrococcus lysodeikticus by a pure culture... cheese, in accordance with the following conditions. (a) The organism Micrococcus lysodeikticus from...

  16. 49 CFR 173.21 - Forbidden materials and packages.

    Science.gov (United States)

    2010-10-01

    ... stabilized or inhibited in a manner to preclude such evolution. The SADT may be determined by any of the test... generate a dangerous evolution of heat, unless packaged in a manner which precludes such an occurrence. (d... container, or overpack with another material, the mixing of which is likely to cause a dangerous evolution...

  17. What we do | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    IDRC supports research in developing countries to create real and lasting change. ... Community Based Governance of Wetlands in the Sand River Catchment Area (South Africa) ... Sri Lanka, Central Asia, Far East Asia, South Asia. PROJECT ...

  18. 21 CFR 173.350 - Combustion product gas.

    Science.gov (United States)

    2010-04-01

    .... Caution. The various parts of the absorption train must be connected by gas-tight tubing and joints... gas source is connected in series to the flow-rate device, the flow meter, and the absorption.... Maintain the coolant bath at 0 °C throughout. Remove the absorption vessel from the bath, disconnect, and...

  19. 49 CFR 173.181 - Pyrophoric materials (liquids).

    Science.gov (United States)

    2010-10-01

    ... inner receptacles of glass or metal, not over 1 L (0.3 gallon) capacity each, having positive screwcap... be closed by positive means, not by friction. (c) Steel drums (1A2) or fiber drums (1G) not exceeding... each, closed by positive means, not friction. (1) Inner packagings must have no opening exceeding 25 mm...

  20. 49 CFR 173.319 - Cryogenic liquids in tank cars.

    Science.gov (United States)

    2010-10-01

    ... Federal Railroad Administration may be made by e-mail to [email protected] or telephone call to (202....113A60W. (e) Special requirements for class DOT 113 tank cars—(1) A class DOT-113 tank car need not be... integrity test. When required by paragraph (e)(1) of this section, either of the following thermal integrity...

  1. 33 CFR 173.57 - Contents of report.

    Science.gov (United States)

    2010-07-01

    ... contributed to causing the casualty. (w) The make, model, type (open, cabin, house, or other), beam width at... outdrive, sail, or other), fuel (gas, diesel, or other), construction (wood, steel, aluminum, plastic...

  2. 21 CFR 173.325 - Acidified sodium chlorite solutions.

    Science.gov (United States)

    2010-04-01

    ... processing of red meat, red meat parts, and organs as a component of a spray or in the processing of red meat... rinse prior to consumption. (2) The additive is used as a single application in processing facilities as... (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR...

  3. 173 original article glycated haemoglobin levels in patients

    African Journals Online (AJOL)

    boaz

    therapy, two patients had pre-diabetes with HbA1c values of 6.0% and 5.8% while the HbA1c values of the remaining patients were less than .... determined by the blood glucose levels in the .... treatment of MDR-TB on glycaemic homeostasis.

  4. 21 CFR 173.5 - Acrylate-acrylamide resins.

    Science.gov (United States)

    2010-04-01

    ... produced by the polymerization of acrylamide with partial hydrolysis, or by copolymerization of acrylamide... polyacrylate-acrylamide resin is produced by the polymerization and subsequent hydrolysis of acrylonitrile in a... or cane sugar juice and liquor or corn starch hydrolyzate in an amount not to exceed 5 parts per...

  5. 49 CFR 173.199 - Category B infectious substances.

    Science.gov (United States)

    2010-10-01

    ... this section; (ii) Anticoagulants used to stabilize blood or plasma; or (iii) Small quantities of Class... copy or electronic image of these instructions must be retained by the manufacturer and subsequent...

  6. 49 CFR 173.197 - Regulated medical waste.

    Science.gov (United States)

    2010-10-01

    ... requirements of § 178.801(j) and record retention requirements of § 178.801(l) of this subchapter. Inner... constructed of metal or fiberglass and have a capacity of at least 3.5 cubic meters (123.6 cubic feet) and not... welded or seamless construction and a rigid, weatherproof top to prevent the intrusion of water (e.g...

  7. 21 CFR 173.25 - Ion-exchange resins.

    Science.gov (United States)

    2010-04-01

    ..., distilled water and 10 percent ethanol, when, following washing and pretreatment of the resin in accordance... paragraph (a)(18) of this section is used to treat aqueous sugar solutions subject to the condition that the temperature of the sugar solution passing through the resin bed is maintained at 82 °C (179.6 °F) or less and...

  8. 21 CFR 173.310 - Boiler water additives.

    Science.gov (United States)

    2010-04-01

    ...-sodium acrylate resin Contains not more than 0.05 percent by weight of acrylamide monomer. Acrylic acid/2...-hydroxyethylidene-1,1-diphosphonic acid (CAS Reg. No. 2809-21-4) and its sodium and potassium salts Lignosulfonic.... Potassium carbonate Potassium tripolyphosphate Sodium acetate Sodium alginate Sodium aluminate Sodium...

  9. 21 CFR 173.20 - Ion-exchange membranes.

    Science.gov (United States)

    2010-04-01

    ... and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION... centimeters of the following solvents: Distilled water, 5 percent acetic acid, and 50 percent alcohol...

  10. 21 CFR 173.40 - Molecular sieve resins.

    Science.gov (United States)

    2010-04-01

    ... and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION... gram of dry resin (expressed in terms of water regain), and a particle size of 10 to 300 microns. (b...

  11. 173 Christian Missionaries and Civilization in Southern Nigeria ...

    African Journals Online (AJOL)

    NGOZI

    and Christianity into the interiors of West Africa during their civilizing mission in 1841” (p. 87). ... record that civilization in Nigeria started around the mission houses. .... the advent of the missionaries slavery was rampant among the people of ...

  12. 40 CFR 180.173 - Ethion; tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ..., meat 0.2 10/1/08 Hog, meat byproducts 0.2 10/1/08 Horse, fat 0.2 10/1/08 Horse, meat 0.2 10/1/08 Horse...: Commodity Parts per million Expiration/Revocation Date Cattle, fat 0.2 10/1/08 Cattle, meat 0.2 10/1/08 Cattle, meat byproducts 0.2 10/1/08 Citrus, dried pulp 25.0 10/1/08 Fruit, citrus, group 10 5.0 10/1/08...

  13. Dicty_cDB: AFI173 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available cDNA clone:pph30f12, 3' end,single read. 599 e-167 1 CN206669 |CN206669.1 Tor7097 Gametophyte rehydration... sequence. 74 3e-09 1 CN206834 |CN206834.1 Tor7258 Gametophyte rehydration Librar

  14. 32 CFR 173.2 - Competitive Information Certification.

    Science.gov (United States)

    2010-07-01

    ... Procurement Task Force. (2) The requirement to provide the Certificate may be further limited to certain... Business Ethics and Integrity complying with the Interim rule in lieu of Competitive Information...

  15. What we do | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Learning Initiatives for Network Economies in Asia (LIRNEasia) : Building Capacity in ICT Policy. It is now generally accepted that affordable, effective telecommunication services play an integral role in development. Central Asia, Far East Asia, South Asia, Cambodia, Sri Lanka, Indonesia, Laos, Pakistan, Philippines.

  16. 49 CFR 173.62 - Specific packaging requirements for explosives.

    Science.gov (United States)

    2010-10-01

    ...:“Packaging approved by the competent authority of the United States of America (USA)”. PARTICULAR PACKING.... A jet perforating gun, charged, oil well may be transported under the following conditions: a... from every other kind, and from any gun, tool or other supplies, unless approved in accordance with...

  17. 34 CFR 403.173 - What expenses are allowable?

    Science.gov (United States)

    2010-07-01

    ... ADULT EDUCATION, DEPARTMENT OF EDUCATION STATE VOCATIONAL AND APPLIED TECHNOLOGY EDUCATION PROGRAM What... coordination between vocational education programs, business, and industry, including advisory council meetings...

  18. 49 CFR 173.4a - Excepted quantities.

    Science.gov (United States)

    2010-10-01

    ... onto a solid unyielding surface from a height of 1.8 m (5.9 feet): (i) Where the sample is in the shape... sample is in the shape of a drum, it must be dropped in each of the following orientations: (A) One drop...

  19. 1935 15' Quad #173 Aerial Photo Mosaic Index - NM

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — Aerial Photo Reference Mosaics contain aerial photographs that are retrievable on a frame by frame basis. The inventory contains imagery from various sources that...

  20. 49 CFR 173.196 - Category A infectious substances.

    Science.gov (United States)

    2010-10-01

    ... temperatures and pressures of transport by aircraft to which they could be subjected if refrigeration were lost... pressure producing a pressure differential of not less than 95 kPa (0.95 bar, 14 psi). (7) The primary... well as the temperatures and pressures of transport by aircraft to which they could be subjected if...

  1. All projects related to | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Topic: HEALTH POLICY, DISEASES, LABOUR SHORTAGE, Economic and social development, RESEARCH CAPACITY, RESEARCH FELLOWSHIPS, INSTITUTION BUILDING. Region: Mozambique, Brazil, South Africa. Program: ... Region: Indonesia, Malaysia, Philippines, Viet Nam. Program: Employment and Growth.

  2. 21 CFR 173.150 - Milk-clotting enzymes, microbial.

    Science.gov (United States)

    2010-04-01

    ...; family, Bacillaceae; genus, Bacillus; species, cereus (Frankland and Frankland). (3) Mucor pusillus Lindt...; genus, Mucor; species, pusillus; variety, Lindt. (4) Mucor miehei Cooney et Emerson classified as follows: Class, Phycomycetes; subclass, Zygomycetes; order, Mucorales; family, Mucoraceae; genus, Mucor...

  3. Dicty_cDB: VSF173 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available TT ATTTCAGGAAAAGCACTTGCATTTTCA sequence update 2001. 3.22 Translated Amino Acid sequence ---*tskkwdmilkql*vf...vasyflapvpkyim* k*r*ffk*krni*rywvifnrsiyxiwicnsxdfspfryyfrkstcif Frame B: ---*tskkwdmilkql*vflahlqlvyylif*hv

  4. 19 CFR 10.173 - Evidence of country of origin.

    Science.gov (United States)

    2010-04-01

    ... entry—(1) Merchandise not wholly the growth, product, or manufacture of a beneficiary developing country... growth, product, or manufacture of a single beneficiary developing country, the exporter of the... shown. Failure to submit the declaration in a timely fashion will result in a denial of duty-free...

  5. 24 CFR 248.173 - Resident homeownership program.

    Science.gov (United States)

    2010-04-01

    ..., consistent with paragraph (f) of this section; (x) How the marketing of currently vacant units and units... 50 percent of such proceeds shall be returned to the Commissioner for use under §§ 248.157 and 248... homeowner under the homeownership program approved under this section shall be paid to the HOME Investment...

  6. People’s Republic of China Scientific Abstracts, Number 173.

    Science.gov (United States)

    1977-08-03

    method, and the PCA reaction suppressing action of disodium chromoglycate and the sapo - ninum of Shao-nien-hung (Ardisia alyxiacfolia Tsiang.) The...element is its sapo - ninum, which is highly toxic, but the toxicity of its acetylated and hydrolytic product is much less. AUTHOR: CH’EN Ti-hua [7II5

  7. 49 CFR 173.50 - Class 1-Definitions.

    Science.gov (United States)

    2010-10-01

    .... (a) Explosive. For the purposes of this subchapter, an explosive means any substance or article... minor explosion hazard. The explosive effects are largely confined to the package and no projection of fragments of appreciable size or range is to be expected. An external fire must not cause virtually...

  8. Road Materials and Pavement Design, Volume 17(3)

    CSIR Research Space (South Africa)

    De Beer, Morris

    2016-03-01

    Full Text Available Environment, Pretoria, South Africa Jo Sias Daniel - University of New Hampshire, USA Zhongyin Guo - Tongji University, Shanghai, P.R. of China Kwang W. Kim - Kangwon National University, Republic of Korea Niki Kringos - KTH Royal Institute of Technology...

  9. South of Sahara | Page 173 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Language French. Read more about Le partenariat mondial sur les données ouvertes pour le développement. Language French. Read more about Renforcement des capacités de recherche en agriculture visant le développement en Afrique subsaharienne. Language French. Read more about Soutien organisationnel de ...

  10. 49 CFR 173.417 - Authorized fissile materials packages.

    Science.gov (United States)

    2010-10-01

    ... for export and import shipments. (2) A residual “heel” of enriched solid uranium hexafluoride may be... made in accordance with Table 2, as follows: Table 2—Allowable Content of Uranium Hexafluoride (UF6... Liters Cubic feet Maximum Uranium 235-enrichment (weight)percent Maximum “Heel” weight per cylinder UF6...

  11. Publications | Page 173 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    E-Commerce in the Asian Context : Selected Case Studies. Le commerce électronique en Asie retient beaucoup l'attention en raison de la prolifération des connexions Internet et des technologies connexes dans la région. Face à cette tendance, le Centre de recherches pour le développement international (.

  12. 46 CFR 108.173 - Class I, Division 2 locations.

    Science.gov (United States)

    2010-10-01

    ... of the mud circulating system from the final degassing discharge to the mud suction connection at the mud pit. (b) A location in the weather that is— (1) Within the boundaries of the drilling derrick up...

  13. 49 CFR 173.318 - Cryogenic liquids in cargo tanks.

    Science.gov (United States)

    2010-10-01

    ... without an intervening shut-off valve, or a check valve permitting flow from the pipe or hose into the... valve, pipe or fitting, external to the jacket that retains lading during transportation may not be... system of one or more pressure relief valves; and (B) A secondary system of one of more frangible discs...

  14. An application of neutron radiography to archaeology

    International Nuclear Information System (INIS)

    Tugrul, B.

    1990-01-01

    Neutron radiography is more useful for certain materials than are the other radiographic techniques. Some neutrons are attenuated by light materials such as water, hydrocarbons and boron, but penetrate through heavy materials such as steel, lead and uranium. The object must be irradiated by neutrons for neutron radiography. The neutron irradiation can take place in a reactor or with a neutron source. The transfer technique relies on the build-up of radioactivity in a foil due to neutron absorption. In this way an activation image is formed in the foil. For this technique, dysprosium ( 164 Dy) and indium ( 115 In) foils can be used. After this irradiation, foils are transferred to a film in the dark-room, the latent image being formed in the film by decay radiation from the foil. The neutron radiography technique has been applied to a sword together with its sheath (inventory number 83/173) (Tugrul and Erdal 1987); a piece of cloth was visible on the handle of the sword. Sword and sheath had become corroded together. The artefact is from the Ikiztepe excavation near the city of Samsun in north Anatolia and belongs to the Early Bronze Age. First, X-ray radiography showed that the sword had been destroyed in large part and was not suitable for conservation and restoration procedures. Second, neutron radiography was carried out. Dysprosium-164 was used for the transfer method as a foil screen and irradiated in the reactor at 100 kW for half an hour. The dysprosium foil remained against the radiographic (Structurix, D-7) film for approximately three half-lives after the irradiation. The neutron radiograph shows the cloth layer continuing towards the bottom of the sheath. Through the cloth, water would have been introduced to the inside of the sheath and this was the main cause of corrosion to the artefact and so of the sword's destruction. (author)

  15. Hexanuclear, heterometallic, Ni₃Ln₃ complexes possessing O-capped homo- and heterometallic structural subunits: SMM behavior of the dysprosium analogue.

    Science.gov (United States)

    Goura, Joydeb; Guillaume, Rogez; Rivière, Eric; Chandrasekhar, Vadapalli

    2014-08-04

    The reaction of hetero donor chelating mannich base ligand 6,6'-{(2-(dimethylamino)ethylazanediyl)bis(methylene)}bis(2-methoxy-4-methylphenol) with Ni(ClO4)2·6H2O and lanthanide(III) salts [Dy(III) (1); Tb(III) (2); Gd (III) (3); Ho(III) (4); and Er(III) (5)] in the presence of triethylamine and pivalic acid afforded a series of heterometallic hexanuclear Ni(II)-Ln(III) coordination compounds, [Ni3Ln3(μ3-O)(μ3-OH)3(L)3(μ-OOCCMe3)3]·(ClO4)·wCH3CN·xCH2Cl2·yCH3OH·zH2O [for 1, w = 8, x = 3, y = 0, z = 5.5; for 2, w = 0, x = 5, y = 0, z = 6.5; for 3, w = 15, x = 18, y = 3, z = 7.5; for 4, w = 15, x = 20, y = 6, z = 9.5; and for 5, w = 0, x = 3, y = 2, z = 3]. The molecular structure of these complexes reveals the presence of a monocationic hexanuclear derivative containing one perchlorate counteranion. The asymmetric unit of each of the hexanuclear derivatives comprises the dinuclear motif [NiLn(L)(μ3-O)(μ3-OH)(μ-Piv)]. The cation contains three interlinked O-capped clusters: one Ln(III)3O and three Ni(II)Ln(III)2O. Each of the lanthanide centers is eight- coordinated (distorted trigonal-dodecahedron), while the nickel centers are hexacoordinate (distorted octahedral). The study of the magnetic properties of all compounds are reported and suggests single molecule magnet behavior for the Dy(III) derivative (1).

  16. Enhancement of lanthanide evaporation by complexation: Dysprosium tri-iodide mixed with indium iodide and thulium tri-iodide mixed with thallium iodide

    Energy Technology Data Exchange (ETDEWEB)

    Curry, J. J.; Henins, A.; Hardis, J. E. [National Institute of Standards and Technology, 100 Bureau Drive, Gaithersburg, Maryland 20899 (United States); Estupiñán, E. G. [OSRAM SYLVANIA Inc., 71 Cherry Hill Drive, Beverly, Massachusetts 01915 (United States); Lapatovich, W. P. [Walter Lapatovich Consulting, 51 Pye Brook Lane, Boxford, Massachusetts 01921 (United States); Shastri, S. D. [Advanced Photon Source, Argonne National Laboratory, 9700 South Cass Avenue, Argonne, Illinois 60439 (United States)

    2013-09-28

    The vapors in equilibrium with condensates of DyI{sub 3}, DyI{sub 3}/InI, TmI{sub 3}, and TmI{sub 3}/TlI were observed over the temperature range from 900 K to 1400 K using x-ray induced fluorescence. The total densities of each element (Dy, Tm, In, Tl, and I) in the vapor, summed over all atomic and molecular species, were determined. Dramatic enhancements in the total vapor densities of Dy and Tm were observed in the vapors over DyI{sub 3}/InI and TmI{sub 3}/TlI as compared to the vapors over pure DyI{sub 3} and pure TmI{sub 3}, respectively. An enhancement factor exceeding 10 was observed for Dy at T≈ 1020 K, decreasing to 0 at T≈ 1250 K. An enhancement factor exceeding 20 was observed for Tm at T≈ 1040 K, decreasing to 0 at T≈ 1300 K. Such enhancements are expected from the formation of the vapor-phase hetero-complexes DyInI{sub 4} and TmTlI{sub 4}. Numerical simulations of the thermo-chemical equilibrium suggest the importance of additional complexes in liquid phases. A description of the measurement technique is given. Improvements in the absolute calibration lead to an approximately 40% correction to previously reported preliminary results [J. J. Curry et al., Chem. Phys. Lett. 507, 52 (2011); Appl. Phys. Lett. 100, 083505 (2012)].

  17. Complexation behaviour of DADCA and DAPDA with dysprosium-166/holmium-166 parent daughter system and its potential for use in radioimmunotherapy

    International Nuclear Information System (INIS)

    Orsini, S.; University of Technology, Broadway, NSW; Di Bartolo, N.; Smith, S.; Baker, T.

    1998-01-01

    Full text: A novel approach for the delivery of therapeutic doses from 166 Ho to cancerous tissue is via the decay of its parent, 166 Dy. When designing radioimmunoconjugte, a crucial question is to determine whether the ligand used in the radiolabeling process is capable of holding the 166 Ho on decay of the parent, 166 Dy. In this study, two pendant arm macrocycles 1, 10-Diaza-4, 7, 13, 16-tetraoxacyclooctadecane-N, N'-diacetic acid, (DACDA) and 1, 10-Diaza-4, 7, 13-trioxacyclopentadecane-N, N'-diacetic acid, (DAPDA) that were reported to forms reasonably stable complexes with Dy and Ho, were synthesised. The synthesis of the two pendant arm macrocycles was first attempted using methods outlined by Chang and Rowland. The yields obtained through this method were low (10 % for both ligands) and it was considered important to investigate alternative approaches to the synthesis. The new method involved an alkylation reaction in the presence of acetonitrile and sodium bicarbonate. The method took considerably less time and the yields increased to 88 %. The ligands were characterised using 1 H NMR, 13 C NMR and mass spectrometry. The chemical and radiolytic stabilities of 166 Dy and 166 Ho complexes of the two ligands were investigated at pH = 5 and the ligands potential for use in the in vivo generator system evaluated

  18. CCDC 1402057: Experimental Crystal Structure Determination : pentakis(tetra-n-butylammonium) tetrakis(mu-oxalato)-dodecachloro-tetranitrosyl-ethanol-tetra-ruthenium-dysprosium sesquihydrate

    KAUST Repository

    Kuhn, Paul-Steffen; Cremer, Laura; Gavriluta, Anatolie; Jovanović, Katarina K.; Filipović, Lana; Hummer, Alfred A.; Bü chel, Gabriel E.; Dojčinović, Biljana P.; Meier, Samuel M.; Rompel, Annette; Radulović, Siniša; Tommasino, Jean Bernard; Luneau, Dominique; Arion, Vladimir B.

    2015-01-01

    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  19. 3D dysprosium density in the metal-halide lamp measured by emission and laser absorption spectroscopy in a centrifuge at 1-10g

    NARCIS (Netherlands)

    Flikweert, A.J.; Nimalasuriya, T.; Thubé, G.M.; Kroesen, G.M.W.; Stoffels, W.W.

    2007-01-01

    The metal-halide lamp is a High Intensity Discharge (HID) lamp with a high efficiency. The salt additive (DyI3) acts as prime radiator. The present lamp suffers from non-uniform light output, caused by diffusion and convection processes. To gain a better understanding of the lamp, the convection is

  20. Effect of dysprosium substitution on electrical properties of SrBi{sub 4}Ti{sub 4}O{sub 15}

    Energy Technology Data Exchange (ETDEWEB)

    Mamatha, B., E-mail: boinanemamatha@gmail.com; Sarah, P.

    2014-10-15

    SrBi{sub 4−x}Dy{sub x}Ti{sub 4}O{sub 15} (with x = 0.02, 0.04, 0.06 and 0.08) powders have been synthesized using the stoichiometric amounts of nitrates and oxides of the constituent materials through sol–gel method. The compound so formed is characterized using X-ray diffraction. The density and lattice parameters are calculated. The impedance and electrical conductivity properties are investigated. The imaginary part of impedance as a function of frequency shows Debye like relaxation. Impedance data presented in the Nyquist plot which is used to identify an equivalent circuit and the fundamental circuit parameters are determined at different temperatures. The results of bulk a.c. conductivity as a function of frequency at different temperatures are presented. The dielectric behavior was investigated. Permittivity was calculated based on the relaxation frequency using an alternative approach based on the variation of the imaginary impedance component as a function of reciprocal angular frequency. The frequency dependence of real and imaginary permittivities was also investigated. - Highlights: • SrBi{sub 4−x}Dy{sub x}Ti{sub 4}O{sub 15} (x = 0.02, 0.04, 0.06 and 0.08) powders are produced by sol–gel method. Phase formation is confirmed by XRD analysis. • Frequency dependent imaginary part of impedance shows distribution of relaxation in system. • Broadness of Z″ peak shows distribution of relaxation frequency. • Increase in peak width at ½ maxima of Z″ with increase of temperature shows increase of relaxation frequency distribution. • Cole–Cole plots are resolved into two different circles, ascribed to different mechanisms of polarization and relaxation phenomena.

  1. Transition metal redox switches for reversible "on/off" and "slow/fast" single-molecule magnet behaviour in dysprosium and erbium bis-diamidoferrocene complexes.

    Science.gov (United States)

    Dickie, Courtney M; Laughlin, Alexander L; Wofford, Joshua D; Bhuvanesh, Nattamai S; Nippe, Michael

    2017-12-01

    Single-molecule magnets (SMMs) are considered viable candidates for next-generation data storage and quantum computing. Systems featuring switchability of their magnetization dynamics are particularly interesting with respect to accessing more complex logic gates and device architectures. Here we show that transition metal based redox events can be exploited to enable reversible switchability of slow magnetic relaxation of magnetically anisotropic lanthanide ions. Specifically, we report anionic homoleptic bis-diamidoferrocene complexes of Dy 3+ (oblate) and Er 3+ (prolate) which can be reversibly oxidized by one electron to yield their respective charge neutral redox partners (Dy: [1] - , 1 ; Er: [2] - , 2 ). Importantly, compounds 1 and 2 are thermally stable which allowed for detailed studies of their magnetization dynamics. We show that the Dy 3+ [1] - / 1 system can function as an "on"/"off" or a "slow"/"fast" redox switchable SMM system in the absence or presence of applied dc fields, respectively. The Er 3+ based [2] - / 2 system features "on"/"off" switchability of SMM properties in the presence of applied fields. Results from electrochemical investigations, UV-vis-NIR spectroscopy, and 57 Fe Mössbauer spectroscopy indicate the presence of significant electronic communication between the mixed-valent Fe ions in 1 and 2 in both solution and solid state. This comparative evaluation of redox-switchable magnetization dynamics in low coordinate lanthanide complexes may be used as a potential blueprint toward the development of future switchable magnetic materials.

  2. Comparison of MR imaging after administration of dysprosium-based magnetic-susceptibility contrast media with diffusion-weighted MR imaging in evaluation of regional cerebral ischemia

    International Nuclear Information System (INIS)

    Moseley, M.E.; Kucharczyk, J.; Kurhanewicz, J.; Mintorovitch, J.; Cohen, Y.; Rocklage, S.; Quay, S.C.; Norman, D.

    1989-01-01

    This paper reports on a study to establish whether a nonionic T2-shortening contrast agent, Dy-DTPA-bis(methylamide) (Dy-DTPA-BMA), would facilitate early detection of stroke-induced cerebral perfusion deficits. The sensitivity of susceptibility-enhanced MR imaging was compared with that of diffusion-weighted MR imaging in the same cats subjected to unilateral occlusion of the middle cerebral artery (MCA). A 2-T unit, equipped with self-shielded gradient coils (± 20 G/cm, 15-cm bore size), was used in conjunction with an 8.5-cm inner diameter low-pass bird cage proton imaging coil. Diffusion-weighted images displayed increased signal intensity in the ischemic MCA territory less than 1 hour after occlusion, whereas T2-weighted MR images without contrast enhancement usually failed to depict injury for 2--3 hours after toke. With contrast administration (0.5 mmoles/kg of Dy-DTPA-BMA), however, T2-weighted images revealed perfusion deficits (hyperintensity) within 1 hour after MCA occlusion, and these corresponded to the anatomic regions of ischemic injury shown on diffusion-weighted MR images

  3. Magnetic anisotropy and neutron scattering studies of some rare earth metals

    International Nuclear Information System (INIS)

    Day, R.

    1978-08-01

    The thesis is concerned with magnetic anisotropy of dysprosium and alloys of gadolinium: yttrium, and also neutron scattering studies of dysprosium. The experiments are discussed under the topic headings: magnetic anisotropy, rare earths, torque measurements, elastic neutron scattering, inelastic neutron scattering, dysprosium measurements, and results for the gadolinium: yttrium alloys. (U.K.)

  4. 49 CFR 173.247 - Bulk packaging for certain elevated temperature materials.

    Science.gov (United States)

    2010-10-01

    ... reference to the axes of the transport vehicle. Each accelerative or decelerative load may be considered... packagings used for transportation of molten metals and molten glass by rail when movement is restricted to...

  5. 49 CFR 173.5b - Portable and mobile refrigeration systems.

    Science.gov (United States)

    2010-10-01

    ... the end of disconnected lines must be tightly closed. (4) The aggregate total volumetric capacity of... permanent and clearly visible manner. The evaporating line must have a pressure gauge with corresponding temperature markings mounted so as to be easily readable when standing on the ground. The gauge must be...

  6. 21 CFR 173.120 - Carbohydrase and cellulase derived from Aspergillus niger.

    Science.gov (United States)

    2010-04-01

    ... cellulase derived from Aspergillus niger. Carbohydrase and cellulase enzyme preparation derived from Aspergillus niger may be safely used in food in accordance with the following prescribed conditions: (a) Aspergillus niger is classified as follows: Class, Deuteromycetes; order, Moniliales; family, Moniliaceae...

  7. 49 CFR 173.32 - Requirements for the use of portable tanks.

    Science.gov (United States)

    2010-10-01

    ... that is significantly reflective, such as a light-reflecting color if painted, or a bright reflective... thickness that the overall thermal conductance is not more than 0.080 Btu per hour per square foot per... square foot per degree Fahrenheit differential in temperature per hour. The conductance must be...

  8. 49 CFR 173.27 - General requirements for transportation by aircraft.

    Science.gov (United States)

    2010-10-01

    ... liquids. (d) Closures. Stoppers, corks or other such friction-type closures must be held securely, tightly..., 4, or 8, or Division 5.1, 5.2 or 6.1 that are packaged and offered for transport in glass... of the § 172.101 table Maximum authorized net capacity of each inner packaging Glass, earthenware or...

  9. 49 CFR 173.471 - Requirements for U.S. Nuclear Regulatory Commission approved packages.

    Science.gov (United States)

    2010-10-01

    ... format may be submitted by facsimile (fax) to (202) 366-3753 or (202) 366-3650, or by electronic mail (e-mail) to “[email protected]” Upon registration, the offeror will be furnished with a copy of the... format may be submitted by facsimile (fax) to (202) 366-3753 or (202) 366-3650, or by electronic mail (e...

  10. 49 CFR 173.473 - Requirements for foreign-made packages.

    Science.gov (United States)

    2010-10-01

    ...-3650, or by electronic mail (e-mail) to “[email protected]” If the offeror is requesting the... Transport of Radioactive Material, No. TS-R-1, ” (IBR, see § 171.7 of this subchapter) shall also comply...) 366-3753 or (202) 366-3650, or by electronic mail to “[email protected]” Each request is considered in...

  11. 49 CFR 173.472 - Requirements for exporting DOT Specification Type B and fissile packages.

    Science.gov (United States)

    2010-10-01

    ... or (202) 366-3650, or by electronic mail (e-mail) to “[email protected]” Each request is considered in... the package identification marking indicated in the U.S. Competent Authority Certificate. (e) Before... into or through which the package will be transported, unless the offeror has documentary evidence that...

  12. 49 CFR 173.420 - Uranium hexafluoride (fissile, fissile excepted and non-fissile).

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Uranium hexafluoride (fissile, fissile excepted....420 Uranium hexafluoride (fissile, fissile excepted and non-fissile). (a) In addition to any other... non-fissile uranium hexafluoride must be offered for transportation as follows: (1) Before initial...

  13. 49 CFR 173.56 - New explosives-definition and procedures for classification and approval.

    Science.gov (United States)

    2010-10-01

    ... agency the ranges of composition of ingredients and compounds, showing the intended manufacturing... was produced to an explosives testing range if— (1) It is not a primary (a 1.1A initiating) explosive...) Ammunition with inert projectile or blank ammunition; and (4) Ammunition not exceeding 50 caliber for rifle...

  14. 49 CFR 173.24 - General requirements for packagings and packages.

    Science.gov (United States)

    2010-10-01

    ... identifiable (without the use of instruments) release of hazardous materials to the environment; (2) The effectiveness of the package will not be substantially reduced; for example, impact resistance, strength... significant chemical or galvanic reaction between the materials and contents of the package. (3) Plastic...

  15. Spin-orbit coupling in ultracold Fermi gases of 173Yb atoms

    Science.gov (United States)

    Song, Bo; He, Chengdong; Hajiyev, Elnur; Ren, Zejian; Seo, Bojeong; Cai, Geyue; Amanov, Dovran; Zhang, Shanchao; Jo, Gyu-Boong

    2017-04-01

    Synthetic spin-orbit coupling (SOC) in cold atoms opens an intriguing new way to probe nontrivial topological orders beyond natural conditions. Here, we report the realization of the SOC physics both in a bulk system and in an optical lattice. First, we demonstrate two hallmarks induced from SOC in a bulk system, spin dephasing in the Rabi oscillation and asymmetric atomic distribution in the momentum space respectively. Then we describe the observation of non-trivial spin textures and the determination of the topological phase transition in a spin-dependent optical lattice dressed by the periodic Raman field. Furthermore, we discuss the quench dynamics between topological and trivial states by suddenly changing the band topology. Our work paves a new way to study non-equilibrium topological states in a controlled manner. Funded by Croucher Foundation and Research Grants Council (RGC) of Hong Kong (Project ECS26300014, GRF16300215, GRF16311516, and Croucher Innovation Grants).

  16. 49 CFR 173.412 - Additional design requirements for Type A packages.

    Science.gov (United States)

    2010-10-01

    ... exclusive use, the cargo compartment, instead of the individual packages, may be sealed. (b) The smallest... device that is independent of any other part of the package. (e) For each component of the containment... event of leakage; or (ii) Have a containment system composed of primary inner and secondary outer...

  17. 49 CFR 173.302a - Additional requirements for shipment of nonliquefied (permanent) compressed gases in...

    Science.gov (United States)

    2010-10-01

    ... analysis and heat treatment specified in spec. 3AA 67,000 73,000 III. Steels of analysis and heat treatment... following formula: S = 1.7EE / KV−0.4P Where: S = wall stress, pounds per square inch; EE = elastic...

  18. Potassium bis(carbonato-O,O')(ethylenediamine-N,N')cobaltate(III) monohydrate at 173 K.

    Science.gov (United States)

    Belai, N; Dickman, M H; Pope, M T

    2001-07-01

    The title salt, K[Co(C2H8N2)(CO3)2].H2O, consists of a distorted octahedral cobalt complex anion and a seven-coordinate potassium cation. Both metal atoms have crystallographic twofold symmetry, one C2 axis passing through the Co atom and C--C bond, and another along a short K--O (water) bond of 2.600 A (corrected for libration). The carbonate is bidentate to both cobalt and potassium and the water forms a hydrogen bond to a carbonate O atom.

  19. 173 Étude des performances épuratoires de la technique du ...

    African Journals Online (AJOL)

    Afrique Sciences

    à la station d'épuration de la ville d'Errachidia - Maroc. Chaouki HAMID1*, Lahcen ELWATIK1, Youssef RAMCHOUN2, Rachid FATH-ALLAH3,. Abdelrhafour AYYACH3, Zhor FATHALLAH4, Azzeddine EL MIDAOUI3 et El Mahdi HBAIZ5. 1Equipe des substances naturelles, synthèse et dynamique moléculaire, Faculté des ...

  20. Neutron scattering from 12C between 15.6 and 17.3 MeV

    International Nuclear Information System (INIS)

    Chen, Z.M.; Baird, K.; Howell, C.R.; Roberts, M.L.; Tornow, W.; Walter, R.L.

    1993-01-01

    The differential cross section σ(θ) for neutron elastic scattering from 12 C and for inelastic scattering from the 4.44 MeV state was measured at 15.57, 16.75 and 17.29 MeV. The σ(θ) data, together with published analysing power A y (θ) data, were analysed in the framework of the spherical optical model and in the coupled-channels formalism. It was concluded that the present 12 C(n,n) 12 C data and published data at higher energies appear to be well suited for determining properties of valence single-particle excitations in 11 C via an iterative-moment approach or a dispersive optical-model analysis. (author)

  1. 49 CFR 173.315 - Compressed gases in cargo tanks and portable tanks.

    Science.gov (United States)

    2010-10-01

    ..., MC-330, MC-331 225; See Notes 4 and 8. Chlorodifluoroethane (R-142b) (1-Chloro 1,1-difluoroethane.... Difluoroethane (R-152a); (See Note 9) 79 See Note 7 DOT-51, MC-330, MC-331 150. Dimethyl ether (see Note 16) 59.... Chlorine None. Dichlorodifluoromethane Do. Difluoroethane Do. Difluoromonochloroethane Do. Dimethyl ether...

  2. 49 CFR 173.313 - UN Portable Tank Table for Liquefied Compressed Gases.

    Science.gov (United States)

    2010-10-01

    ... Refrigerant gas R 21 7.0 Allowed Normal 1.23 7.0 7.0 7.0 1030 1,1-Difluoroethane or Refrigerant gas R 152a 16....1 Allowed Normal 1.07 20.8 18.6 16.6 2517 1-Chloro-1,1-difluoroethane or Refrigerant gas R 142b 8.9 Allowed Normal 0.99 7.8 7.0 7.0 2602 Dichlorodifluoromethane and difluoroethane azeotropic mixture with...

  3. Advanced Organic Solid States Materials. Volume 173. Materials Research Society Symposium Proceedings

    Science.gov (United States)

    1990-08-08

    from the Comision Interministerial de Ciencia y Tecnologia . The authors thank to the Laboratoire de Physique des Materiaux and to Dr. G. Legal and Dr...related to a high decrease of electron density of the corresponding 3d - orbitals. Table 5 57Fe-Mof6bauer data Compound T 1K] &EQ 1mm/si IS [mm/sla) 1b...for both Kc and Cel, a cross-over temperature T, (expressed in % of Tc ) separates a 3D regime, close to Tc, from a lower-dimensional regime, above

  4. 21 CFR 161.173 - Canned wet pack shrimp in transparent or nontransparent containers.

    Science.gov (United States)

    2010-04-01

    ... HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION FISH AND SHELLFISH Requirements for...; prepared in one of the styles specified in paragraph (a)(3) of this section, in sufficient water or other...) Acceptable quality level (AQL). The maximum percent of defective sample units permitted in a lot that will be...

  5. 49 CFR 38.173 - Automated guideway transit vehicles and systems.

    Science.gov (United States)

    2010-10-01

    ... accomplished by vehicle air suspension or other suitable means of meeting the requirement. (c) In stations... 49 Transportation 1 2010-10-01 2010-10-01 false Automated guideway transit vehicles and systems... DISABILITIES ACT (ADA) ACCESSIBILITY SPECIFICATIONS FOR TRANSPORTATION VEHICLES Other Vehicles and Systems § 38...

  6. SU-E-T-173: Clinical Comparison of Treatment Plans and Fallback Plans for Machine Downtime

    Energy Technology Data Exchange (ETDEWEB)

    Cruz, W [University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Cancer Therapy and Research Center, San Antonio, TX (United States); Papanikolaou, P [University of Texas Health Science Center at San Antonio, San Antonio, TX (United States); Mavroidis, P [University of North Carolina, Chapel Hill, NC (United States); Stathakis, S [Cancer Therapy and Research Center, San Antonio, TX (United States)

    2015-06-15

    Purpose: The purpose of this study was to determine the clinical effectiveness and dosimetric quality of fallback planning in relation to machine downtime. Methods: Plans for a Varian Novalis TX were mimicked, and fallback plans using an Elekta VersaHD machine were generated using a dual arc template. Plans for thirty (n=30) patients of various treatment sites optimized and calculated using RayStation treatment planning system. For each plan, a fall back plan was created and compared to the original plan. A dosimetric evaluation was conducted using the homogeneity index, conformity index, as well as DVH analysis to determine the quality of the fallback plan on a different treatment machine. Fallback plans were optimized for 60 iterations using the imported dose constraints from the original plan DVH to give fallback plans enough opportunity to achieve the dose objectives. Results: The average conformity index and homogeneity index for the NovalisTX plans were 0.76 and 10.3, respectively, while fallback plan values were 0.73 and 11.4. (Homogeneity =1 and conformity=0 for ideal plan) The values to various organs at risk were lower in the fallback plans as compared to the imported plans across most organs at risk. Isodose difference comparisons between plans were also compared and the average dose difference across all plans was 0.12%. Conclusion: The clinical impact of fallback planning is an important aspect to effective treatment of patients. With the complexity of LINACS increasing every year, an option to continue treating during machine downtime remains an essential tool in streamlined treatment execution. Fallback planning allows the clinic to continue to run efficiently should a treatment machine become offline due to maintenance or repair without degrading the quality of the plan all while reducing strain on members of the radiation oncology team.

  7. 49 CFR 173.28 - Reuse, reconditioning and remanufacture of packagings.

    Science.gov (United States)

    2010-10-01

    ... and limitations: (1) A non-bulk packaging which, upon inspection, shows evidence of a reduction in... than fiberboard), plastic film, or textile are not authorized for reuse; (4) Metal and plastic drums... metal packagings) or minimum (for plastic packagings) thickness of the packaging material, as required...

  8. 49 CFR 173.58 - Assignment of class and division for new explosives.

    Science.gov (United States)

    2010-10-01

    ... Thermal Sensitivity Test at 75 °C (167 °F); (iv) The Small Scale Burning Test; (v) The EIDS Cap Test; (vi... Sensitivity Test, Princess Incendiary Spark Test, DDT Test, and External Fire Test, each as described in the... occurs: (1) Detonation occurs in the Cap Sensitivity Test (Test Method 5(a)); (2) Detonation occurs in...

  9. Sud du Sahara | Page 173 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... Promoting Women's Economic Empowerment (GrOW). Langue English. Read more about Integrated Intervention for Diabetes Risk After Gestational Diabetes in South Africa. Langue English. Read more about Essais cliniques d'un vaccin expérimental contre le virus Ebola : une intervention canadienne dans la recherche.

  10. 49 CFR 173.436 - Exempt material activity concentrations and exempt consignment activity limits for radionuclides.

    Science.gov (United States)

    2010-10-01

    ... Rh-99 Rhodium (45) 1.0×101 2.7×10−10 1.0×106 2.7×10−5 Rh-101 1.0×102 2.7×10−9 1.0×107 2.7×10−4 Rh-102 1.0×101 2.7×10−10 1.0×106 2.7×10−5 Rh-102m 1.0×102 2.7×10−9 1.0×106 2.7×10−5 Rh-103m 1.0×104 2.7×10−7 1.0×108 2.7×10−3 Rh-105 1.0×102 2.7×10−9 1.0×107 2.7×10−4 Rn-222 (b) Radon (86) 1.0×101 2.7×10−10...

  11. 49 CFR 173.435 - Table of A1 and A2 values for radionuclides.

    Science.gov (United States)

    2010-10-01

    ...×10−8 Rh-99 Rhodium (45) 2.0 5.4×101 2.0 5.4×101 3.0×103 8.2×104 Rh-101 4.0 1.1×102 3.0 8.1×101 4.1×101 1.1×103 Rh-102 5.0×10−1 1.4×101 5.0×10−1 1.4×101 4.5×101 1.2×103 Rh-102m 2.0 5.4×101 2.0 5.4×101 2.3×102 6.2×103 Rh-103m 4.0×101 1.1×103 4.0×101 1.1×103 1.2×106 3.3×107 Rh-105 1.0×101 2.7×102 8.0×10...

  12. 46 CFR 170.173 - Criterion for vessels of unusual proportion and form.

    Science.gov (United States)

    2010-10-01

    ... point to at least 20 degrees; and (iii) At least 15 foot-degrees of energy to the smallest of the... flooding point to at least 15 degrees; and (iii) At least 10 foot-degrees of energy to the smallest of the... free until the trimming moment is zero. (e) For the purpose of demonstrating acceptable stability on...

  13. 49 CFR 173.132 - Class 6, Division 6.1-Definitions.

    Science.gov (United States)

    2010-10-01

    ... Toxicity. A liquid or solid with an LD50 for acute oral toxicity of not more than 300 mg/kg. (ii) Dermal Toxicity. A material with an LD50 for acute dermal toxicity of not more than 1000 mg/kg. (iii) Inhalation Toxicity. (A) A dust or mist with an LC50 for acute toxicity on inhalation of not more than 4 mg/L; or (B...

  14. 49 CFR 173.302 - Filling of cylinders with nonliquefied (permanent) compressed gases.

    Science.gov (United States)

    2010-10-01

    ... containing oxygen continuously fed to tanks containing live fish may be offered for transportation and... breathing apparatus (SCUBA), self-contained breathing apparatus (SCBA) or oxygen service. The cylinder...

  15. 49 CFR 173.441 - Radiation level limitations and exclusive use provisions.

    Science.gov (United States)

    2010-10-01

    ...; or in the case of a flat-bed style vehicle, at any point on the vertical planes projected from the...-bed style vehicle, at any point 2 m (6.6 feet) from the vertical planes projected by the outer edges... included with the shipping paper information. The instructions must be sufficient so that, when followed...

  16. 49 CFR 173.166 - Air bag inflators, air bag modules and seat-belt pretensioners.

    Science.gov (United States)

    2010-10-01

    ... generant and, in some cases, a pressure vessel (cylinder)) is a gas generator used to inflate an air bag in... domestic transportation by highway, rail freight, cargo vessel or cargo aircraft, a serviceable air bag...

  17. 29 CFR 4.173 - Meeting requirements for vacation fringe benefits.

    Science.gov (United States)

    2010-07-01

    ... vacation benefits, it would place the incumbent contractor at a distinct competitive disadvantage as well... service. Rather, as illustrated below, the reason(s) for an employee's absence from work is the primary... the full amount of the employee's vacation benefit. (2) The requirements for furnishing data relative...

  18. 49 CFR 1.73 - Delegation to the Administrator of the Federal Motor Carrier Safety Administration.

    Science.gov (United States)

    2010-10-01

    ... to remove, to the maximum extent practicable, a worst case discharge, the review and approval of... movie production sites; (9) Section 4134 relating to the grant program for persons to train operators of...; section (b)(1) relating to a review of Canadian and Mexican compliance with Federal motor vehicles safety...

  19. 49 CFR 173.225 - Packaging requirements and other provisions for organic peroxides.

    Science.gov (United States)

    2010-10-01

    ... calculated using the following formula: ER20DE04.003 Where: U = K/L = heat transfer coefficient of the... packaging conforms to the requirements of this subchapter: (1) Rail cars. Class DOT 103, 104, 105, 109, 111, 112, 114, 115, or 120 fusion-weld tank car tanks are authorized. DOT 103W, 111A60F1 and 111A60W1 tank...

  20. 21 CFR 173.357 - Materials used as fixing agents in the immobilization of enzyme preparations.

    Science.gov (United States)

    2010-04-01

    ... glucose isomerase enzyme preparations for use in the manufacture of high fructose corn syrup, in... manufacture of high fructose corn syrup, in accordance with § 184.1372 of this chapter. Cellulose triacetate... enzyme preparations for use in the manufacture of high fructose corn syrup, in accordance with § 184.1372...

  1. 76 FR 34273 - National Endowment for the Arts; National Council on the Arts 173rd Meeting

    Science.gov (United States)

    2011-06-13

    ... Commander, 70 Intelligence Surveillance and Reconnaissance Wing, Fort Meade, MD on Blue Star Museums; by... discussion, it becomes necessary for the Council to discuss non-public commercial or financial information of...

  2. 49 CFR 173.5a - Oilfield service vehicles and mechanical displacement meter provers.

    Science.gov (United States)

    2010-10-01

    ... sufficiently long to assure detection of leaks, but in no case less than 5 minutes. (4) In addition to the... PIPELINE AND HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION HAZARDOUS MATERIALS...

  3. 49 CFR Appendix H to Part 173 - Method of Testing for Sustained Combustibility

    Science.gov (United States)

    2010-10-01

    ... standard manner sustains combustion. 2. Principle of the method A metal block with a concave depression... consisting of a block of aluminum alloy or other corrosion-resistant metal of high thermal conductivity is... is 2.2 mm (see Figure 32.5.2.1); (b) Thermometer, mercury in glass, for horizontal operation, with a...

  4. 49 CFR 173.12 - Exceptions for shipment of waste materials.

    Science.gov (United States)

    2010-10-01

    ... blocked and braced in such a manner that they are separated from incompatible materials by a minimum... pallet with shrink-wrap or stretch-wrap except that labels representative of each Hazard Class or...

  5. 49 CFR 173.52 - Classification codes and compatibility groups of explosives.

    Science.gov (United States)

    2010-10-01

    ... containing both an explosive substance and flammable liquid or gel J 1.1J1.2J 1.3J Article containing both an... classification codes for substances and articles described in the first column of table 1. Table 2 shows the... possible classification codes for explosives. Table 1—Classification Codes Description of substances or...

  6. 49 CFR 173.8 - Exceptions for non-specification packagings used in intrastate transportation.

    Science.gov (United States)

    2010-10-01

    ... used to transport a flammable cryogenic liquid, hazardous substance, hazardous waste, or a marine... be used by an intrastate motor carrier for transportation of a flammable liquid petroleum product in... flammable liquid petroleum product in accordance with the provisions of paragraph (d) of this section. (d...

  7. 49 CFR 173.230 - Fuel cell cartridges containing hazardous material.

    Science.gov (United States)

    2010-10-01

    ... integral vent feature) is deemed to pass the fire test if: (A) The internal pressure vents to zero gauge... required to power the equipment, plus two spares; (5) Large robust articles containing fuel cells may be...

  8. 49 CFR 173.121 - Class 3-Assignment of packing group.

    Science.gov (United States)

    2010-10-01

    ... packing group shall be determined by applying the following criteria: Packing group Flash point (closed-cup) Initial boiling point I ≤35°C (95 °F) II 35 °C (95 °F) III ≥23 °C, ≤60 °C (≥73 °F, ≤140 °F) >35...-GENERAL REQUIREMENTS FOR SHIPMENTS AND PACKAGINGS Definitions Classification, Packing Group Assignments...

  9. Seasonal variation in plasma and corpus luteum oestradiol.17[3and ...

    African Journals Online (AJOL)

    Flemming 1993) and, in males, with circulating sex steroid concentrations ..... biology of the Cape mole-rat, Georychus capensis (Rodentia. Bathycrgidac), j, Zool" ... brain. and behavior: an emerging discipline in herpetology. In: Biology of the ...

  10. 20 CFR 655.173 - Setting meal charges; petition for higher meal charges.

    Science.gov (United States)

    2010-04-01

    ... the 12 month percentage change for the Consumer Price Index for all Urban Consumers for Food between... may begin charging the higher rate upon receipt of a favorable decision from the CO unless the CO sets a later effective date in the decision. (c) Appeal rights. In the event the employer's petition for...

  11. Sexospécificités | Page 173 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    From increasing access to nutritious food to boosting women's opportunities to lead safe and healthy lives, the most popular content featured on our ... Grâce au Global Entrepreneurship Monitor (GEM), des chercheurs canadiens et étrangers acquièrent et mettent en commun des connaissances sur les motivations des ...

  12. 49 CFR 173.314 - Compressed gases in tank cars and multi-unit tank cars.

    Science.gov (United States)

    2010-10-01

    ... or secondary Division 2.1 (flammable gas) hazard. For single unit tank cars, interior pipes of... lading exceeding 1.52 mm (0.060 inch) diameter must be equipped with excess flow valves. For single unit... inches) glass fiber placed over 5.08 cm (2 inches) of ceramic fiber. Tank cars must have excess flow...

  13. Résultats de recherche | Page 173 | CRDI - Centre de recherches ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Cette recherche s'inscrit dans le contexte d'une superposition de deux faits ... de technologies de l'information et de la communication (TIC), ou télécentre, dans ... Le Centro de Tecnologia e Sociedade (CTS - centre pour la technologie et la ...

  14. Preparation, characterization, and luminescence properties of dysprosium perchlorate with MABA-Si and phen or dipy complexes as well as SiO{sub 2}@Dy(MABA-Si)L core-shell structure nanometermeter luminescent composites

    Energy Technology Data Exchange (ETDEWEB)

    Li, Wen-Xian, E-mail: nmglwx@163.com [College of Chemistry and Chemical Engineering, Inner Mongolia University, Hohhot 010021 (China); Zheng, Yu-Shan [Inner Mongolia Autonomous Region Product Quality Inspection Institute, Hohhot 010010 (China); Cao, Xiao-fang; Bai, Juan; Fu, Zhi-Fang; Bao, Jin-Rong; Li, Yi-Lian [College of Chemistry and Chemical Engineering, Inner Mongolia University, Hohhot 010021 (China)

    2016-10-15

    Two novel ternary rare earth complexes Dy(MABA-Si)·L{sub 2}(ClO{sub 4}){sub 3}·2H{sub 2}O (L= Phen or Dipy) were prepared using HOOCC{sub 6}H{sub 4}N(CONH(CH{sub 2}){sub 3}Si-(OCH{sub 2}CH{sub 3}){sub 3}){sub 2} which was abbreviated or denoted as MABA-Si. MABA-Si was the first ligand, L was the second ligand. The corresponding two SiO{sub 2}@Dy(MABA-Si)L nanometermeter luminescent composites were synthesized as well, and the silica spheres is the core, and the ternary rare earth complex Dy(MABA-Si)·L{sub 2}(ClO{sub 4}){sub 3}·2H{sub 2}O was the shell layer, who was abbreviated or denoted as Dy((MABA-Si)L). The ternary complexes have been characterized by element analysis, molar conductivity, IR spectra and {sup 1}HNMR spectra. The results showed that the chemical formula of the complex was Dy(MABA-Si)·L{sub 2}(ClO{sub 4}){sub 3}·2H{sub 2}O. The fluorescent spectra illustrated that the complexes displayed its characteristic luminescence in solid state, and the luminescence was superior than Dy{sup 3+}. The core-shell structure of SiO{sub 2}@Dy(MABA-Si)L nanometermeter luminescent composite was characterized by SEM, TEM and IR spectra. Based on the SEM photographs, the core-shell structure particles showed its regular microstructure including smooth surface, and good dispersity. The ternary complex coated on the mono-dispersed SiO{sub 2} spheres by self-assembly. The fluorescent spectra illustrated that the core-shell structure of SiO{sub 2}@Dy(MABA-Si)L nanometermeter luminescent composites exhibited stronger fluorescent than the ternary complexes. The fluorescence lifetime of the complexes and core-shell structure composites was measured as well.

  15. Dysprosium-doped PbGa2S4 laser generating at 4.3 μm directly pumped by 1.7 μm laser diode.

    Science.gov (United States)

    Jelínková, Helena; Doroshenko, Maxim E; Jelínek, Michal; Sulc, Jan; Osiko, Vyacheslav V; Badikov, Valerii V; Badikov, Dmitrii V

    2013-08-15

    In this Letter, we demonstrate the pulsed and CW operation of the Dy:PbGa(2)S(4) laser directly pumped by the 1.7 μm laser diode. In the pulsed regime (pulse duration 5 ms; repetition rate 20 Hz), the maximum mean output power of 9.5 mW was obtained with the slope efficiency of 9.3% with respect to the absorbed pump power. The generated wavelength was 4.32 μm, and the laser beam cross section was approximately Gaussian on both axes. Stable CW laser generation was also successfully obtained with the maximum output power of 67 mW and the slope efficiency of 8%. Depopulation of the lower laser level by 1.7 μm pump radiation absorption followed by 1.3 μm upconversion fluorescence was demonstrated. These results show the possibility of construction of the compact diode-pumped solid-state pulsed or CW laser generating at 4.3 μm in the power level of tens mW operating at room temperature.

  16. Stability constants and thermodynamic parameters of trivalent gadolinium, yttrium, terbium, dysprosium and holmium complexes with 2-(p-sulphophenylazo) 1,8-dihydroxynaphthalene 3,6 disulphonic acid (trisodium salt)[SPADNS

    International Nuclear Information System (INIS)

    Dubey, S.N.; Nagpal, S.; Kalra, H.L.; Puri, D.M.

    1980-01-01

    The stepwise stability constants of Gd(III), Y(III), Tb(III), Dy(III) and Ho(III) complexes with SPADNS have been determined potentiometrically in aqueous solution using Bjerrum-Calvin technique as modified by Irving and Rossotti at different temperatures (20deg and 40deg) and 0.1 M ionic strength (NaClO 4 ). The trend in the stability of these metal complexes has been found to be: Ho(III) > Dy(III) > Tb(III) > Y(III) > Gd(III). The overall changes in ΔGdeg, ΔHdeg and ΔSdeg accompanying the complex formation have also been determined. (author)

  17. Stability constants and thermodynamic parameters of trivalent gadolinium, yttrium, terbium, dysprosium and holmium complexes with 2-(p-sulphophenylazo) 1,8-dihydroxynaphthalene 3,6 disulphonic acid (trisodium salt)(SPADNS)

    Energy Technology Data Exchange (ETDEWEB)

    Dubey, S.N.; Nagpal, S.; Kalra, H.L.; Puri, D.M. (Kurukshetra Univ. (India). Dept. of Chemistry)

    1980-10-01

    The stepwise stability constants of Gd(III), Y(III), Tb(III), Dy(III) and Ho(III) complexes with SPADNS have been determined potentiometrically in aqueous solution using Bjerrum-Calvin technique as modified by Irving and Rossotti at different temperatures (20deg and 40deg) and 0.1 M ionic strength (NaClO/sub 4/). The trend in the stability of these metal complexes has been found to be: Ho(III) > Dy(III) > Tb(III) > Y(III) > Gd(III). The overall changes in ..delta..Gdeg, ..delta..Hdeg and ..delta..Sdeg accompanying the complex formation have also been determined.

  18. Poly[(6-carboxypicolinato-κ3O2,N,O6(μ3-pyridine-2,6-dicarboxylato-κ5O2,N,O6:O2′:O6′dysprosium(III

    Directory of Open Access Journals (Sweden)

    Xu Li

    2009-11-01

    Full Text Available In the title complex, [Dy(C7H3NO4(C7H4NO4]n, one of the ligands is fully deprotonated while the second has lost only one H atom. Each DyIII ion is coordinated by six O atoms and two N atoms from two pyridine-2,6-dicarboxylate and two 6-carboxypicolinate ligands, displaying a bicapped trigonal-prismatic geometry. The average Dy—O bond distance is 2.40 Å, some 0.1Å longer than the corresponding Ho—O distance in the isotypic holmium complex. Adjacent DyIII ions are linked by the pyridine-2,6-dicarboxylate ligands, forming a layer in (100. These layers are further connected by π–π stacking interactions between neighboring pyridyl rings [centroid–centroid distance = 3.827 (3 Å] and C—H...O hydrogen-bonding interactions, assembling a three-dimensional supramolecular network. Within each layer, there are other π–π stacking interactions between neighboring pyridyl rings [centroid–centroid distance = 3.501 (2 Å] and O—H...O and C—H...O hydrogen-bonding interactions, which further stabilize the structure.

  19. 49 CFR 40.173 - Who is responsible for paying for the test of a split specimen?

    Science.gov (United States)

    2010-10-01

    ... is responsible for paying for the test of a split specimen? (a) As the employer, you are responsible... 49 Transportation 1 2010-10-01 2010-10-01 false Who is responsible for paying for the test of a.... (b) As the employer, you must not condition your compliance with these requirements on the employee's...

  20. Gas-chromatographic separation of hydrogen isotopes mixtures on capillary molecular sieve 5 A column at 173 K

    International Nuclear Information System (INIS)

    Bidica, N.; Preda, A.; Stanciu, V.

    2002-01-01

    Analysis of a gas mixture of hydrogen species, is not too easy because the differences in their physical-chemical properties are very small; the most different are their masses, and consequently most common analytical method appear to be the mass-spectrometry. However, the impossibility to distinguish between two ions (atomic or molecular) with the same mass renders this method as unapplicable. Another problem is the decay of tritium with production of 3 He. These disadvantages of mass-spectrometry have made that other analytical methods, like gas chromatography, to be considered and developed. Thus, there are many papers about various chromatographic columns especially prepared for hydrogen species separation but the preparation and treatment of these columns are very difficult to reproduce. Besides these, there are two other main disadvantages: column operating temperature is very low and long retention times for hydrogen species (more than half an hour) are required. However, the gas-chromatography method still remains an appropriate one. The method described in this paper was based on using a capillary molecular sieve 5A column which has been operated for this kind of separation. The retention times were relatively short, about 8-9 minutes. The carrier gas was Ne and the detector - TCD. In the paper chromatograms for various carrier flow rates and various hydrogen isotope mixtures are presented. The results demonstrated a quite good efficiency for H 2 , HD, D 2 and a not very good one for orthoH 2 -paraH 2 . (authors)

  1. 49 CFR 173.304a - Additional requirements for shipment of liquefied compressed gases in specification cylinders.

    Science.gov (United States)

    2010-10-01

    ...-3E1800. Chlorodifluroethane or 1-Chloro-1, 1-difluoroethane (R-142b) 100 DOT-3A150; DOT-3AA150; DOT-3B150...; DOT-3AL225. Dichlorodifluoromethane and difluoroethane mixture (constant boiling mixture) (R-500) (see...; DOT-4BW240; DOT-4E240; DOT-39. 1,1-Difluoroethane (R-152a) (see note 8) 79 DOT-3A150; DOT-3AA150; DOT...

  2. Gausbert de Poicibot, “Be·s cuget venjar Amors” (BdT 173.2

    Directory of Open Access Journals (Sweden)

    Francesca Andolfato

    2010-09-01

    Full Text Available This paper offers a commentary and a new critical edition of Gausbert de Poicibot’s poem “Be·s cuget venjar Amors”, which apparently belongs to the genre of the ‘mala chanso’, that was particularly popular during the period that the Limousin poet was active. To abandon love enables the poet to recuperate reason and ‘sen’ and to justify, almost in didactic terms, his separation from the lady, thus clearly showing that he had so far sung the praises of a lady who was not worthy of receiving them. The song is also compared to other typical examples of the subgenre to which it belongs, such as “Si be·m partetz, mala dompna, de vos” by Gui d’Uissel (BdT 194.19, considered to be paradigmatic of the ‘mala chanso’ and probably familiar to Gausbert de Poicibot, though it will be pointed out that this poetic mode has roots in the work of troubadours of previous generations, such as Bernart de Ventadorn and Raimbaut d’Aurenga, whom Gausbert seems to use as models.

  3. SU-F-J-173: Online Replanning for Dose Painting Based On Changing ADC Map of Pancreas Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Ates, O; Ahunbay, E; Erickson, B; Li, X [Medical College of Wisconsin, Milwaukee, WI (United States)

    2016-06-15

    Purpose: The introduction of MR-guided radiation therapy (RT), e.g., MR-Linac, would allow dose painting to adapt spatial RT response revealed from MRI data during the RT delivery. The purpose of this study is to investigate the use of an online replanning method to adapt dose painting from the MRI Apparent Diffusion Coefficient (ADC) map acquired during the delivery of RT for pancreatic cancers. Methods: Original dose painting plans were created based on multi-parametric simulation MRI including T1, T2 and ADC, using a treatment planning system (MONACO, Elekta) equipped with an online replanning algorithm (WSO, warm start optimization). Multiple GTVs, identified based on various ADC levels were prescribed to different doses ranging from 50–70 Gy with simultaneous integrated boost in 28 fractions. The MRI acquired after RT were used to mimic weekly MRI, on which the changing GTVs, pancreatic head and other organs-at-risk (OAR) (duodenum, stomach, small bowel) were delineated. The adaptive plan was generated by applying WSO algorithm starting from the deformed original plan based on the weekly MRI using a deformable image registration (DIR) software (ADMIRE, Elekta). The online replanning method takes <10 min. including DIR, target delineation, WSO execution and final dose calculation. Standard IGRT repositioning and full-blown reoptimization plans were also generated to compare with the adaptive plans. Results: The online replanning method significantly improved the multiple target coverages and OAR sparing for pancreatic cancers. For example, for a case with two GTVs with prescriptions of 60 and 70 Gy in pancreatic head, V100-GTV70 (the volume covered by 100% of prescription dose for GTV with 70 Gy)/V100-GTV60/V100-CTV50/V45-duodenum were (95.1/22.2/69.5/85.7), (95.0/97.0/98.6/34.3), and (95.0/98.1/100.0/38.7) for the IGRT, adaptive and reoptimization plans, respectively. Conclusion: The introduced online adaptive replanning method can effectively account for interfractional changes including tumor spatial response during MR-guided RT delivery, allowing precise delivery of dose painting. This study was partially supported by Elekta Inc.

  4. 49 CFR 173.133 - Assignment of packing group and hazard zones for Division 6.1 materials.

    Science.gov (United States)

    2010-10-01

    ...: Packing group Oral toxicity LD50 (mg/kg) Dermal toxicity LD50 (mg/kg) Inhalation toxicity by dusts and mists LC50 (mg/L) I ≤5.0 ≤50 ≤0.2 II >5.0 and ≤50 >50 and ≤200 >0.2 and ≤2.0 III >50 and ≤300 >200 and... table: Packing Group Vapor concentration and toxicity I (Hazard Zone A) V ≥ 500 LC50 and LC50 ≤ 200 mL...

  5. 40 CFR 63.173 - Standards: Agitators in gas/vapor service and in light liquid service.

    Science.gov (United States)

    2010-07-01

    ... all times greater than the agitator stuffing box pressure; or (ii) Equipped with a barrier fluid... closed-loop system that purges the barrier fluid into a process stream. (2) The barrier fluid is not in...

  6. 40 CFR 429.173 - Effluent limitations representing the degree of effluent reduction attainable by the application...

    Science.gov (United States)

    2010-07-01

    ... degree of effluent reduction attainable by the application of the best available technology economically... (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS TIMBER PRODUCTS PROCESSING POINT SOURCE CATEGORY Wood Furniture... best available technology economically achievable (BAT). Except as provided in 40 CFR 125.30 through...

  7. SU-F-T-173: One-Scan Protocol: Verifying the Delivery of Spot-Scanning Proton Beam

    Energy Technology Data Exchange (ETDEWEB)

    Chan, M; Li, J [Memorial Sloan-Kettering Cancer Center, Basking Ridge, NJ (United States); Chen, C; Mah, D [Procure Treatment Center, Somerset, NJ (United States); Tang, X [Memorial Sloan Kettering Cancer Center, West Harrison, NY (United States); Li, X [Memorial Sloan Kettering Cancer Center, Rockville Centre, NY (United States); Tang, G [Memorial Sloan Kettering Cancer Center, New York, NY (United States)

    2016-06-15

    Purpose: Radiochromic film for spot-scanning QA provides high spatial resolution and efficiency gains from one-shot irradiation for multiple depths. However, calibration can be a tedious procedure which may limit widespread use. Moreover, since there may be an energy dependence, which manifests as a depth dependence, this may require additional measurements for each patient. We present a one-scan protocol to simplify the procedure. Methods: We performed the calibration using an EBT3 film at depths of 18, 20, 24cm of Plastic Water exposed by a 6-level step-wedge plan on a Proteus Plus proton system (IBA, Belgium). The calibration doses ranged 65–250 cGy(RBE) for proton energies of 170–200MeV. A clinical prostate+nodes plan was used for validation. The planar doses at selected depths were measured with EBT3 films and analyzed using one-scan protocol (one-scan digitization of QA film and at least one film exposed to known dose). The Gamma passing rates, dose-difference maps, and profiles of 2D planar doses measured with EBT3 film, IBA MatriXX PT, versus TPS calculations were analyzed and compared. Results: The EBT3 film measurement results matched well with the TPS calculation data with an average passing rate of ∼95% for 2%/2mm and slightly lower passing rates were obtained from an ion chamber array detector. We were able to demonstrate that the use of a proton step-wedge provided clinically acceptable results and minimized variations between film-scanner orientation, inter-scan, and scanning conditions. Furthermore, it could be derived from no more than two films exposed to known doses (one could be zero) for rescaling the master calibration curve at each depth. Conclusion: The use of a proton step-wedge for calibration of EBT3 film increases efficiency. The sensitivity of the calibration to depth variations has been explored. One-scan protocol results appear to be comparable to that of the ion chamber array detector. One author has a research grant from Ashland Inc., the manufacturer of the GafChromic film.

  8. 49 CFR 173.115 - Class 2, Divisions 2.1, 2.2, and 2.3-Definitions.

    Science.gov (United States)

    2010-10-01

    ... substances of Class 8, PG I are forbidden from transportation in an aerosol container. (7) Flammable... 2.1, 2.2, and 2.3—Definitions. (a) Division 2.1 (Flammable gas). For the purpose of this subchapter, a flammable gas (Division 2.1) means any material which is a gas at 20 °C (68 °F) or less and 101.3...

  9. Study on Magnetic Responsibility of Rare Earth Ferrite/Polyacrylamide Magnetic Microsphere

    Institute of Scientific and Technical Information of China (English)

    Zhang Ming; Wang Zhifeng; Zhang Hong; Dai Shaojun; Qiu Guanming; Okamoto Hiroshi

    2005-01-01

    In inverse microemulsion, rare earth ferrite/polyacrylamide magnetic microsphere were prepared and their magnetic responsibility were studied by magnetic balance. Results indicate that the magnetic responsibility of microsphere relates to magnetic moment of rare earth ion, and it can be improved by the addition of dysprosium ion of high magnetic moment. Dysprosium content has an effect on magnetic responsibility of dysprosium ferrite/polyacrylamide magnetic microsphere. The microsphere displays strong magnetic responsibility when the molar ratio of Dy3+/iron is 0.20.

  10. A DPOC como uma doença de envelhecimento acelerado** Chest Translating Basic Research Into Clinical Practice 2009; 135:173-180

    Directory of Open Access Journals (Sweden)

    Kazuhiro Ito

    2009-07-01

    Full Text Available Resumo: A DPOC constitui um problema de saúde global de importância crescente, com enorme impacto nos custos directos e indirectos em recursos de saúde. Apesar do seu impacto, pouco se sabe ainda sobre os mecanismos celulares, moleculares e genéticos desta doença, e as te-rapêuticas farmacológicas actualmente disponíveis não influenciam a progressão da doença ou a mortalidade. A limitação do débito aéreo avaliada pela redução do volume expiratório máximo no 1.º segundo (FEV1 progride muito lentamente ao longo de várias décadas, condicionando o aparecimento de sintomas em adultos acima dos 40 anos ou já na terceira idade. Desta forma, a prevalência da DPOC é dependente da idade, sugerindo uma relação íntima entre a pato-génese da DPOC e a do envelhecimento.A senescência ou processo de envelhecimento definese como o declínio progressivo da homeostasia que ocorre após estar completa a fase reprodutiva da vida e conduz a um risco aumentado de doença e de morte. Segundo Kirkwood1, o envelhecimento resulta da interacção entre a lesão e a reparação, como resultado da energia produzida pelo indivíduo para manter a integridade orgânica e proteger o ADN da agressão oxidativa. A falência orgânica ou celular na manutenção ou reparação resulta de uma acção integrada entre genes, ambiente e defeitos intrínsecos do organismo. Subjacente ao processo de envelhecimento, existe uma acumulação progressiva de danos a nível molecular.As alterações a nível celular causam reacções inflamatórias, e estas, por sua vez, exacerbam as lesões celulares existentes. Desta forma, os factores inflamatórios e anti-inflamatórios modulam a evolução do envelhe-cimento. As alterações inflamatórias e estruturais associadas ao envelhecimento resultam da falência em eliminar os radicais de oxigénio (ROS, da falência em reparar o ADN lesado e do encurtamento do teló-mero. Os telómeros protegem as extremidades dos cromossomas, mas, quando se encontram expostos a elevados níveis de stress oxidativo, vão-se encurtando progressivamente à medida que as células se dividem. Com o envelhecimento, a perda e encurtamento dos telómeros condicionam o declínio da capacidade para as células se dividirem – senescência replicativa.O stress oxidativo causa lesão do ADN, o que acelera o processo de envelhecimento e aumenta o risco de cancro (exemplo, a senescência da glândula mamária e o risco elevado de cancro da mama.Os gases ambientais, como o fumo do cigarro ou outros poluentes, podem acelerar o envelhecimento do pulmão ou agravar os eventos relacionados com o en-velhecimento pulmonar através de uma resolução defeituosa da inflamação. A redução das moléculas anti-envelhecimento como as histona desacetilases e as sirtuínas, pode igualmente induzir a progressão acelerada para a DPOC.Ainda não é claro como é que o processo de envelhe-cimento está envolvido no declínio da função pulmonar e na inflamação da DPOC. Contudo, o pulmão do idoso e o pulmão do doente com DPOC apresen-tam muitas semelhanças. A lesão provocada pelo fumo do cigarro e outros pneumopoluentes conduz a um declínio mais acelerado da função pulmonar, com falência dos mecanismos de reparação e de manuten-ção. A presença de inflamação nos dois processos (en-velhecimento e DPOC traduz-se em acumulação de neutrófilos, na activação da NF-kB e na elevação dos níveis plasmáticos de interleucinas IL-6, IL-8 e TNF-α. Também os telómeros das células alveolares tipo II, das células endoteliais e das células mononu-cleares em doentes com enfisema são significativamente mais curtos do que em indivíduos não fumadores da mesma idade.Neste artigo, os autores descrevem ainda estudos recentes sobre os mecanismos de transdução de sinal, como as vias da acetilação das proteínas envolvidas no processo de envelhecimento, identificando assim novas moléculas anti-envelhecimento que poderão constituir abordagens inovadoras na terapêutica da DPOC. Os antioxidantes actualmente disponíveis, como a N-acetilcisteína, não são suficientemente potentes para reduzir o stress oxidativo nos pulmões. Existem vários fármacos em desenvolvimento, como os novos análogos da glutationa e da superoxido dismutase (exemplo, o sulforafano e novas moléculas antienvelhecimento com maior controlo sobre a resis-tência ao stress oxidativo, a reparação do ADN e a inflamação, como os activadores das sirtuínas (exem-plo, o resveratrol, o activador específico da SIRT1 ou o activador da SIRT6.

  11. The effect of irradiation by 173Cs and 60Co on the optical and spectral response properties of lead iodide thin films

    International Nuclear Information System (INIS)

    Jamil, S. S. B.; Ltaif, A. K.; Fadhel, H. M.

    2012-12-01

    This films of solution grown PbI 2 and of pure material of PbI 2 have been deposited onto glass substrate at 100o C by vacuum thermal evaporation technique. Some physical properties of samples without and with gamma radiation are studied. The irradiation process to the samples were made by applied sample to 1 73 'Cs source with activity 0.635 μci and 6 0C o source with activity 0.62 μci without and with different times of irradiation (3,4,5,6, weeks) to obtain the suitable dose. The x-ray diffraction analysis confirmed that PbI 2 films are polycrystalline, having bollixing structure. Transmission spectra, absorption coefficient and band gap energy are studies were also carried out in the wavelength region of 420-900 nm. The band gap of Pb1 2 at room temperature was found to be 2.37-2.78 eV with direct transition nature using the plots were calculated which were machinating with earlier reported value. The spectral photocurrent of PbI 2 layers deposited in different time were also studied, it is found the maximum photocurrent response always is between the wavelength 490-500 nm. (Author)

  12. Broad and Visionary. Commentary on Allen Kent (1977) Information Science. (Journal of Education for Librarianship, 17(3), 131-139)

    Science.gov (United States)

    Bates, Marcia J.

    2015-01-01

    Allen Kent was a pioneer in many aspects of library and information science (LIS), and yet, as this author reads Kent's 1977 article, there is not much in it that has become ancient, irrelevant history. The questions he discusses are still alive in the discipline in 2014, whether it is called LIS (library and information science), information…

  13. CRED Subsurface Temperature Recorder (STR); NWHI, LIS; Long: -173.88422, Lat: 25.94284 (WGS84); Sensor Depth: 20.42m; Data Range: 20060927-20081004.

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  14. CRED Subsurface Temperature Recorder (STR); NWHI, LIS; Long: -173.96097, Lat: 26.06337 (WGS84); Sensor Depth: 0.61m; Data Range: 20060925-20081005.

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  15. CRED Subsurface Temperature Recorder (STR); NWHI, LIS; Long: -173.91583, Lat: 25.96762 (WGS84); Sensor Depth: 10.36m; Data Range: 20081004-20090910.

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  16. CRED Subsurface Temperature Recorder (STR); NWHI, LIS; Long: -173.96100, Lat: 26.06368 (WGS84); Sensor Depth: 0.50m; Data Range: 20030726-20041008.

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  17. CRED Subsurface Temperature Recorder (STR); NWHI, LIS; Long: -173.96100, Lat: 26.06368 (WGS84); Sensor Depth: 0.50m; Data Range: 20020930-20030725.

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  18. Corrosion and Nanomechanical Behaviors of 16.3Cr-0.22N-0.43C-1.73Mo Martensitic Stainless Steel

    International Nuclear Information System (INIS)

    Ghosh, Rahul; Krishna, S. Chenna; Venugopal, A.; Narayanan, P. Ramesh; Jha, Abhay K.; Ramkumar, P.; Venkitakrishnan, P. V.

    2016-01-01

    The effect of nitrogen on the electrochemical corrosion and nanomechanical behaviors of martensitic stainless steel was examined using potentiodynamic polarization and nanoindentation test methods. The results indicate that partial replacement of carbon with nitrogen effectively improved the passivation and pitting corrosion resistance of conventional high-carbon and high- chromium martensitic steels. Post-test observation of the samples after a potentiodynamic test revealed a severe pitting attacks in conventional martensitic steel compared with nitrogen- containing martensitic stainless steel. This was shown to be due to (i) microstructural refinement results in retaining a high-chromium content in the matrix, and (ii) the presence of reversed austenite formed during the tempering process. Since nitrogen addition also resulted in the formation of a Cr_2N phase as a process of secondary hardening, the hardness of the nitrogen- containing steel is slightly higher than the conventional martensitic stainless steel under tempered conditions, even though the carbon content is lowered. The added nitrogen also improved the wear resistance of the steel as the critical load (Lc2) is less, along with a lower scratch friction coefficient (SFC) when compared to conventional martensitic stainless steel such as AISI 440C.

  19. Triangular flow of negative pions emitted in PbAu collisions at root s(NN)=17.3 GeV

    Czech Academy of Sciences Publication Activity Database

    Adamová, Dagmar; Agakichiev, G.; Andronic, A.; Antonczyk, D.; Appelshäuser, H.; Belaga, V.; Bielčíková, Jana; Kushpil, Vasilij; Petráček, V.; Šumbera, Michal

    2017-01-01

    Roč. 957, JAN (2017), s. 99-108 ISSN 0375-9474 Institutional support: RVO:61389005 Keywords : Tringular flow * SPS * heavy ion Subject RIV: BG - Nuclear, Atomic and Molecular Physics, Colliders OBOR OECD: Nuclear physics Impact factor: 1.916, year: 2016

  20. Pregnant adolescent self-care in the prevention of risk factors of Hypertensive Disorders in Pregnancy (HDP - doi:10.5020/18061230.2007.p173

    Directory of Open Access Journals (Sweden)

    Zélia Maria de Sousa Araújo Santos

    2012-01-01

    Full Text Available Adolescent pregnancy is considered a problem for public health, due to the high mortality related to hypertensive disorders in pregnancy – HDP. This was a descriptive study with the aim of analyzing the pregnant adolescent self-care in the prevention of HDP risk factors. It was carried out in the Nucleus of Integrated Medical Attention – NAMI, in Fortaleza – Ceará, with twenty women from the Dendê Community, taken care of in the prenatal ambulatory of that institution, during the months of September and October, 2005. The data were collected by means of interview. The pregnant adolescents informed precarious socio-economic conditions, low schooling and other risk factors for HDP, beyond the age: black color, familiar history, arterial hypertension (AH, diabetes mellitus, renal illness and emotional conflicts. The knowledge on the prevention of risk factors was restricted to five (25% pregnant adolescents; however it was reduced to fragmented information, and the preventive behaviors related to feeding habit, smoke and alcoholism cessation, and physical exercise. Therefore, it was evidenced among the adolescents the unsatisfactory exercise of self-care activities, aiming at preventing HDP risk factors; that beyond the age, they presented other predisposing factors to this disorders; that they were susceptible to preventive behaviors and/or control, as in the case of chronic-degenerative illnesses – AH and diabetes mellitus. Probably, this behavior was associated to the elementary and fragmented knowledge, and the absence or the deficiency of family participation in health promotion actions, mainly in those inherent to the prenatal follow-up.