WorldWideScience

Sample records for dysprosium 157

  1. {Delta}I = 2 energy staggering in normal deformed dysprosium nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Riley, M.A.; Brown, T.B.; Archer, D.E. [Florida State Univ., Tallahassee, FL (United States)] [and others

    1996-12-31

    Very high spin states (I{ge}50{Dirac_h}) have been observed in {sup 155,156,157}Dy. The long regular band sequences, free from sharp backbending effects, observed in these dysprosium nuclei offer the possibility of investigating the occurence of any {Delta}I = 2 staggering in normal deformed nuclei. Employing the same analysis techniques as used in superdeformed nuclei, certain bands do indeed demonstrate an apparent staggering and this is discussed.

  2. Dysprosium magneto-optical traps

    CERN Document Server

    Youn, Seo Ho; Ray, Ushnish; Lev, Benjamin L

    2010-01-01

    Magneto-optical traps (MOTs) of highly magnetic lanthanides open the door to explorations of novel phases of strongly correlated matter such as lattice supersolids and quantum liquid crystals. We recently reported the first MOTs of the five high abundance isotopes of the most magnetic atom, dysprosium. Described here are details of the experimental technique employed for repumper-free Dy MOTs containing up to half a billion atoms. Extensive characterization of the MOTs' properties---population, temperature, loading, metastable decay dynamics, trap dynamics---is provided.

  3. On polymorphism of dysprosium trichloride

    Energy Technology Data Exchange (ETDEWEB)

    Zakiryanova, Irina D.; Khokhlov, Vladimir A.; Salyulev, Alexander B.; Korzun, Iraida V. [RAS Ural Branch, Ekaterinburg (Russian Federation). Institute of High-Temperature Electrochemistry

    2015-07-01

    For the first time, the structure of crystalline DyCl{sub 3} over a wide temperature range from room temperature to melting point was studied by Raman spectroscopy. The phonon modes (cm{sup -1}) of dysprosium trichloride (monoclinic crystal lattice of AlCl{sub 3} type, Z = 4, CN = 6) at room temperature are 257 (A{sub 1g}), 201 (E{sub g}), 112 (E{sub g}), 88 (A{sub 1g}), and 63 (E{sub g}). The monoclinic structure of the crystalline DyCl{sub 3} C{sub 2h}{sup 3} symmetry was found to remain constant over the studied temperature range. No polymorphic transformation in the solid state was detected. Gravimetry, calorimetry, and mass spectrometry have been used in addition to support the conclusions made on the basis of Raman spectroscopic data.

  4. Resonance ionization spectroscopy in dysprosium

    Energy Technology Data Exchange (ETDEWEB)

    Studer, D., E-mail: dstuder@uni-mainz.de; Dyrauf, P.; Naubereit, P.; Heinke, R.; Wendt, K. [Johannes Gutenberg-Universität Mainz, Institut für Physik (Germany)

    2017-11-15

    We report on resonance ionization spectroscopy (RIS) of high-lying energy levels in dysprosium. We developed efficient excitation schemes and re-determined the first ionization potential (IP) via analysis of Rydberg convergences. For this purpose both two- and three-step excitation ladders were investigated. An overall ionization efficiency of 25(4) % could be demonstrated in the RISIKO mass separator of Mainz University, using a three-step resonance ionization scheme. Moreover, an extensive analysis of the even-parity 6sns- and 6snd-Rydberg-series convergences, measured via two-step excitation was performed. To account for strong perturbations in the observed s-series, the approach of multichannel quantum defect theory (MQDT) was applied. Considering all individual series limits we extracted an IP-value of 47901.76(5) cm{sup −1}, which agrees with the current literature value of 47901.7(6) cm{sup −1}, but is one order of magnitude more precise.

  5. The dysprosium-tin phase diagram

    Energy Technology Data Exchange (ETDEWEB)

    Eremenko, V.N.; Bulanova, M.V.; Martsenjuk, P.S. (I.N. Frantsevich Inst. for Problems of Materials Science, Kiev (Ukraine))

    1992-12-07

    The dysprosium-tin phase diagram was established by means of differential thermal, X-ray and microscopic analyses of 22 alloys. Seven intermetallic compounds were found to exist in the system. Dy[sub 5]Sn[sub 3] melts congruently at 1870 degC, and undergoes a polymorphous transformation at 1823 [+-] 6 degC. The intermetallics Dy[sub 5]Sn[sub 4], Dy[sub 11]Sn[sub 10], DySn, Dy[sub 4]Sn[sub 5], DySn[sub 2], DySn[sub 3] are formed peritectically at 1712 [+-]11, 1605 [+-]12, 1208 [+-]3, 1166 [+-]7, 1138 [+-]3 and 747 [+-]6 degC respectively. DySn[sub 3] exists in a narrow temperature range, in two polymorphous modifications. The transformation [beta]-DySn[sub 3] [yields] [alpha]-DySn[sub 3] occurs at 608 [+-] 12 degC, and at 499 [+-]2 degC [alpha]-DySn[sub 3] decomposes to DySn[sub 2] and the tin-rich melt. The dysprosium-rich eutectic crystallizes at 1204 [+-]10 degC and contains 13 at.% tin. The solid-state solubility of tin in dysprosium is about 3 at.%, and that of dysprosium in tin is negligible.

  6. Towards a new measurement of parity violation in dysprosium

    CERN Document Server

    Leefer, N; Antypas, D; Budker, D

    2014-01-01

    The dysprosium parity violation experiment concluded nearly 17 years ago with an upper limit on weak interaction induced mixing of nearly degenerate, opposite parity states in atomic dysprosium. While that experiment was limited in sensitivity by statistics, a new apparatus constructed in the interim for radio-frequency spectroscopy is expected to provide significant improvements to the statistical sensitivity. Preliminary work from the new PV experiment in dysprosium is presented with a discussion of the current statistical sensitivity and outlook.

  7. Dysprosium Modification of Cobalt Ferrite Ionic Magnetic Fluids

    Institute of Scientific and Technical Information of China (English)

    JIANG Rong-li; LIU Yong-chao; GENG Quan-rong; ZHAO Wen-tao

    2005-01-01

    Dysprosium composite cobalt ferrite ionic magnetic fluids were prepared by precipitation in the presence of Tri-sodium citrate. Influence of dysprosium modification on magnetic property is studied. The result shows that magnetic response toward exterior magnetic field can be improved by adding Dy3+. Studies also show that the increase of reaction temperature may improve the modification effect of dysprosium. By adding dysprosium ions, the average diameter of the magnetic nanoparticles will be decreased evidently. It is clear that the particles appear as balls, Cobalt ferrite with sizes of 12-15 nm, rare earth composite cobalt ferrite with sizes of 6-8 nm.

  8. Can a dysprosium shortage threaten green energy technologies?

    NARCIS (Netherlands)

    Hoenderdaal, S.; Tercero Espinoza, L.; Marschneider-Weidemann, F.; Crijns - Graus, Wina

    2013-01-01

    Dysprosium, one of the various rare earth elements, is currently for more than 99% mined in China. As China is reducing its exports, new mining projects outside of China are needed to sustain supply and meet future demands. Dysprosium is mainly used in permanent magnets to retain the magnet's streng

  9. Phenalenyl-based mononuclear dysprosium complexes

    Directory of Open Access Journals (Sweden)

    Yanhua Lan

    2016-07-01

    Full Text Available The phenalenyl-based dysprosium complexes [Dy(PLN2(HPLNCl(EtOH] (1, [Dy(PLN3(HPLN]·[Dy(PLN3(EtOH]·2EtOH (2 and [Dy(PLN3(H2O2]·H2O (3, HPLN being 9-hydroxy-1H-phenalen-1-one, have been synthesized. All compounds were fully characterized by means of single crystal X-ray analysis, paramagnetic 1H NMR, MALDI-TOF mass spectrometry, UV–vis spectrophotometry and magnetic measurements. Both static (dc and dynamic (ac magnetic properties of these complexes have been investigated, showing slow relaxation of magnetization, indicative of single molecule magnet (SMM behavior. Attempts to synthesize sublimable phenalenyl-based dysprosium complexes have been made by implementing a synthetic strategy under anhydrous conditions. The sublimed species were characterized and their thermal stability was confirmed. This opens up the possibility to deposit phenalenyl-based lanthanides complexes by sublimation onto surfaces, an important prerequisite for ongoing studies in molecular spintronics.

  10. Anisotropy in the Interaction of Ultracold Dysprosium

    CERN Document Server

    Kotochigova, Svetlana

    2011-01-01

    The nature of the interaction between ultracold atoms with a large orbital and spin angular momentum has attracted considerable attention. It was suggested that such interactions can lead to the realization of exotic states of highly correlated matter. Here, we report on a theoretical study of the competing anisotropic dispersion, magnetic dipole-dipole, and electric quadrupole-quadrupole forces between two dysprosium atoms. Each dysprosium atom has an orbital angular momentum L=6 and magnetic moment $\\mu=10\\mu_B$. We show that the dispersion coefficients of the ground state adiabatic potentials lie between 1865 a.u. and 1890 a.u., creating a non-negligible anisotropy with a spread of 25 a.u. and that the electric quadrupole-quadrupole interaction is weak compared to the other interactions. We also find that for interatomic separations $R< 50\\,a_0$ both the anisotropic dispersion and magnetic dipole-dipole potential are larger than the atomic Zeeman splittings for external magnetic fields of order 10 G to ...

  11. First search for double $\\beta$ decay of dysprosium

    CERN Document Server

    Belli, P; Cappella, F; Cerulli, R; Danevich, F A; d'Angelo, S; Di Vacri, M L; Incicchitti, A; Laubenstein, M; Nagorny, S S; Nisi, S; Tolmachev, A V; Tretyak, V I; Yavetskiy, R P

    2011-01-01

    A search for double $\\beta$ decay of dysprosium was realized for the first time with the help of an ultra low-background HP Ge $\\gamma$ detector. After 2512 h of data taking with a 322 g sample of dysprosium oxide limits on double beta processes in $^{156}$Dy and $^{158}$Dy have been established on the level of $T_{1/2}\\geq 10^{14}-10^{16}$ yr. Possible resonant double electron captures in $^{156}$Dy and $^{158}$Dy were restricted on a similar level. As a by-product of the experiment we have measured the radioactive contamination of the Dy$_2$O$_3$ sample and set limits on the $\\alpha$ decay of dysprosium isotopes to the excited levels of daughter nuclei as $T_{1/2}\\geq 10^{15} - 10^{17}$ yr.

  12. Neutron resonance parameters of dysprosium isotopes using neutron capture yields

    Energy Technology Data Exchange (ETDEWEB)

    Shin, S. G.; Kye, Y. U.; Cho, M. H. [POSTECH, Pohang (Korea, Republic of); Namkung, W. [Pohang Accelerator Laboratory, Pohang (Korea, Republic of); Kim, G. N. [Kyungpook National University, Daegu (Korea, Republic of); Lee, M. W.; Kang, Y. R. [Dongnam Inst. Of Radiological and Medical Science, Busan (Korea, Republic of)

    2015-10-15

    Dysprosium is used in the field of nuclear reactor system because it has a very large thermal neutron absorption cross-section. The dysprosium alloyed with special stainless steels is attractive for control in nuclear reactor because of the ability to absorb neutrons readily without swelling or contracting over time and its high melting point. Dysprosium is also one of fission products from the thermal fission of {sup 234}U, {sup 233}U, and {sup 239}Pu. The fission products are accumulated in the reactor core by the burn-up of the nuclear fuel and the poison effect is increased. Therefore, it is required to understand how Dysprosium as both a poison and an absorbing material in the control rod has an effect on the neutron population in a nuclear reactor system over all energy regions. Neutron Capture experiments on Dy isotopes were performed at the electron linear accelerator (LINAC) facility of the Rensselear Polytechnic Institute (RPI) in the neutron energy region from 10 eV to 1 keV. Resonance parameters were extracted by fitting the neutron capture data using the SAMMY multilevel R-matrix Bayesian code.

  13. Properties of Polydisperse Tin-doped Dysprosium and Indium Oxides

    Directory of Open Access Journals (Sweden)

    Malinovskaya Tatyana

    2017-01-01

    Full Text Available The results of investigations of the complex permittivity, diffuse-reflectance, and characteristics of crystal lattices of tin-doped indium and dysprosium oxides are presented. Using the methods of spectroscopy and X-ray diffraction analysis, it is shown that doping of indium oxide with tin results in a significant increase of the components of the indium oxide complex permittivity and an appearance of the plasma resonance in its diffuse-reflectance spectra. This indicates the appearance of charge carriers with the concentration of more than 1021 cm−3 in the materials. On the other hand, doping of the dysprosium oxide with the same amount of tin has no effect on its optical and electromagnetic properties.

  14. Dysprosium titanate as an absorber material for control rods

    Science.gov (United States)

    Risovany, V. D.; Varlashova, E. E.; Suslov, D. N.

    2000-09-01

    Disprosium titanate is an attractive control rod material for the thermal neutron reactors. Its main advantages are: insignificant swelling, no out-gassing under neutron irradiation, rather high neutron efficiency, a high melting point (˜1870°C), non-interaction with the cladding at temperatures above 1000°C, simple fabrication and easily reprocessed non-radioactive waste. It can be used in control rods as pellets and powder. The disprosium titanate control rods have worked off in the MIR reactor for 17 years, in VVER-1000 - for 4 years without any operating problems. After post-irradiation examinations this type of control rod having high lifetime was recommended for the VVER and RBMK. The paper presents the examination results of absorber element dummies containing dysprosium titanate, irradiated in the SM reactor to the neutron fluence of 3.4×10 22 cm -2 ( E>0.1 MeV) and, also, the data on structure, thermal-physical properties of dysprosium titanate, efficiency of dysprosium titanate control rods.

  15. Dysprosium electrodeposition from a hexaalkylguanidinium-based ionic liquid

    Science.gov (United States)

    Berger, Claudia A.; Arkhipova, Maria; Maas, Gerhard; Jacob, Timo

    2016-07-01

    The rare-earth element dysprosium (Dy) is an important additive that increases the magnetocrystalline anisotropy of neodymium magnets and additionally prevents from demagnetizing at high temperatures. Therefore, it is one of the most important elements for high-tech industries and is mainly used in permanent magnetic applications, for example in electric vehicles, industrial motors and direct-drive wind turbines. In an effort to develop a more efficient electrochemical technique for depositing Dy on Nd-magnets in contrast to commonly used costly physical vapor deposition, we investigated the electrochemical behavior of dysprosium(iii) trifluoromethanesulfonate in a custom-made guanidinium-based room-temperature ionic liquid (RTIL). We first examined the electrodeposition of Dy on an Au(111) model electrode. The investigation was carried out by means of cyclic voltammetry (CV) and X-ray photoelectron spectroscopy (XPS). The initial stages of metal deposition were followed by in situ scanning tunneling microscopy (STM). CV measurements revealed a large cathodic reduction peak, which corresponds to the growth of monoatomic high islands, based on STM images taken during the initial stages of deposition. XPS identified these deposited islands as dysprosium. A similar reduction peak was also observed on an Nd-Fe-B substrate, and positively identified as deposited Dy using XPS. Finally, we varied the concentration of the Dy precursor, electrolyte flow and temperature during Dy deposition and demonstrated that each of these parameters could be used to increase the thickness of the Dy deposit, suggesting that these parameters could be tuned simultaneously in a temperature-controlled flow cell to enhance the thickness of the Dy layer.The rare-earth element dysprosium (Dy) is an important additive that increases the magnetocrystalline anisotropy of neodymium magnets and additionally prevents from demagnetizing at high temperatures. Therefore, it is one of the most important

  16. Dysprosium detector for neutron dosimetry in external beam radiotherapy

    Science.gov (United States)

    Ostinelli, A.; Berlusconi, C.; Conti, V.; Duchini, M.; Gelosa, S.; Guallini, F.; Vallazza, E.; Prest, M.

    2014-09-01

    Radiotherapy treatments with high-energy (>8 MeV) photon beams are a standard procedure in clinical practice, given the skin and near-target volumes sparing effect, the accurate penetration and the uniform spatial dose distribution. On the other hand, despite these advantages, neutrons may be produced via the photo-nuclear (γ,n) reactions of the high-energy photons with the high-Z materials in the accelerator head, in the treatment room and in the patient, resulting in an unwanted dose contribution which is of concern, given its potential to induce secondary cancers, and which has to be monitored. This work presents the design and the test of a portable Dysprosium dosimeter to be used during clinical treatments to estimate the "in vivo" dose to the patient. The dosimeter has been characterized and validated with tissue-equivalent phantom studies with a Varian Clinical iX 18 MV photon beam, before using it with a group of patients treated at the S. Anna Hospital in Como. The working principle of the dosimeter together with the readout chain and the results in terms of delivered dose are presented.

  17. Dysprosium detector for neutron dosimetry in external beam radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Ostinelli, A.; Berlusconi, C.; Conti, V.; Duchini, M.; Gelosa, S. [Medical Physics - Sant' Anna Hospital, Como (Italy); Guallini, F. [EL.SE s.r.l. (Italy); Vallazza, E. [INFN, Trieste (Italy); Prest, M. [University of Insubria, Como (Italy)

    2014-09-21

    Radiotherapy treatments with high-energy (>8MeV) photon beams are a standard procedure in clinical practice, given the skin and near-target volumes sparing effect, the accurate penetration and the uniform spatial dose distribution. On the other hand, despite these advantages, neutrons may be produced via the photo-nuclear (γ,n) reactions of the high-energy photons with the high-Z materials in the accelerator head, in the treatment room and in the patient, resulting in an unwanted dose contribution which is of concern, given its potential to induce secondary cancers, and which has to be monitored. This work presents the design and the test of a portable Dysprosium dosimeter to be used during clinical treatments to estimate the “in vivo” dose to the patient. The dosimeter has been characterized and validated with tissue-equivalent phantom studies with a Varian Clinical iX 18 MV photon beam, before using it with a group of patients treated at the S. Anna Hospital in Como. The working principle of the dosimeter together with the readout chain and the results in terms of delivered dose are presented.

  18. Low Field Magnetic and Thermal Hysteresis in Antiferromagnetic Dysprosium

    Directory of Open Access Journals (Sweden)

    Iuliia Liubimova

    2017-06-01

    Full Text Available Magnetic and thermal hysteresis (difference in magnetic properties on cooling and heating have been studied in polycrystalline Dy (dysprosium between 80 and 250 K using measurements of the reversible Villari effect and alternating current (AC susceptibility. We argue that measurement of the reversible Villari effect in the antiferromagnetic phase is a more sensitive method to detect magnetic hysteresis than the registration of conventional B(H loops. We found that the Villari point, recently reported in the antiferromagnetic phase of Dy at 166 K, controls the essential features of magnetic hysteresis and AC susceptibility on heating from the ferromagnetic state: (i thermal hysteresis in AC susceptibility and in the reversible Villari effect disappears abruptly at the temperature of the Villari point; (ii the imaginary part of AC susceptibility is strongly frequency dependent, but only up to the temperature of the Villari point; (iii the imaginary part of the susceptibility drops sharply also at the Villari point. We attribute these effects observed at the Villari point to the disappearance of the residual ferromagnetic phase. The strong influence of the Villari point on several magnetic properties allows this temperature to be ranked almost as important as the Curie and Néel temperatures in Dy and likely also for other rare earth elements and their alloys.

  19. A Low-Symmetry Dysprosium Metallocene Single-Molecule Magnet with a High Anisotropy Barrier.

    Science.gov (United States)

    Pugh, Thomas; Chilton, Nicholas F; Layfield, Richard A

    2016-09-05

    The single-molecule magnet (SMM) properties of the isocarbonyl-ligated dysprosium metallocene [Cp*2 Dy{μ-(OC)2 FeCp}]2 (1Dy ), which contains a rhombus-shaped Dy2 Fe2 core, are described. Combining a strong axial [Cp*](-) ligand field with a weak equatorial field consisting of the isocarbonyl ligands leads to an anisotropy barrier of 662 cm(-1) in zero applied field. The dominant thermal relaxation pathways in 1Dy involves at least the fourth-excited Kramers doublet, thus demonstrating that prominent SMM behavior can be observed for dysprosium in low-symmetry environments.

  20. Malonate complexes of dysprosium: synthesis, characterization and application for LI-MOCVD of dysprosium containing thin films.

    Science.gov (United States)

    Milanov, Andrian P; Seidel, Rüdiger W; Barreca, Davide; Gasparotto, Alberto; Winter, Manuela; Feydt, Jürgen; Irsen, Stephan; Becker, Hans-Werner; Devi, Anjana

    2011-01-07

    A series of malonate complexes of dysprosium were synthesized as potential metalorganic precursors for Dy containing oxide thin films using chemical vapor deposition (CVD) related techniques. The steric bulkiness of the dialkylmalonato ligand employed was systematically varied and its influence on the resulting structural and physico-chemical properties that is relevant for MOCVD was studied. Single crystal X-ray diffraction analysis revealed that the five homoleptic tris-malonato Dy complexes (1-5) are dimers with distorted square-face bicapped trigonal-prismatic geometry and a coordination number of eight. In an attempt to decrease the nuclearity and increase the solubility of the complexes in various solvents, the focus was to react these dimeric complexes with Lewis bases such as 2,2'-biypridyl and pyridine (6-9). This resulted in monomeric tris-malonato mono Lewis base adduct complexes with improved thermal properties. Finally considering the ease of synthesis, the monomeric nature and promising thermal characteristics, the silymalonate adduct complex [Dy(dsml)(3)bipy] (8) was selected as single source precursor for growing DySi(x)O(y) thin films by liquid injection metalorganic chemical vapor deposition (LI-MOCVD) process. The as-deposited films were analyzed for their morphology and composition by scanning electron microscopy (SEM), energy dispersive X-ray (EDX) analysis, Rutherford backscattering (RBS) analysis and X-ray photoelectron spectroscopy.

  1. Exploration of dysprosium: the most critical element for Japan

    Science.gov (United States)

    Watanabe, Y.

    2012-04-01

    Dysprosium (Dy), one of the heavy rare earth elements, is used mainly as an additive for NdFeB permanent magnets which are installed in various modern industrial products such as voice coil motors in computers, factory automation machinery, hybrid and electric vehicles, home electronics, and wind turbine, to improve heat resistance of the magnets. Dy has been produced about 2,000t per year from the ores from ion adsorption type deposits in southern China. However, the produced amount of Dy was significantly reduced in 2011 in China due to reservation of heavy rare earth resources and protection of natural environment, resulting in soaring of Dy price in the world. In order to respond the increasing demand of Dy, unconventional supply sources are inevitably developed, in addition to heavy rare earth enriched ion adsorption type deposits outside China. Heavy rare earth elements including Dy are dominantly hosted in xenotime, fergusonite, zircon, eudialyte, keiviite, kainosite, iimoriite, etc. Concentration of xenotime is found in placer deposits in Malaysia and India, hydrothermal deposits associated with unconformity-type uranium mineralization (Athabasca basin in Canada, Western Australia), iron-oxide fluorite mineralization (South Africa) and Sn-bearing alkaline granite (Brazil). Zircon and fergusontie concentration is found as igneous and hydrothermal products in peralkaline syenite, alkaline granite and pegmatite (e.g., Nechalacho in Canada). Eudialyte concentration is found in some peralkaline syenite bodies in Greenland, Canada, Sweden and Russia. Among these sources, large Dy resources are estimated in the deposits hosted in peralkaline rocks (Nechalacho: 79,000t, Kvanefjeld: 49,000t, Norra Karr: 15,700t, etc.) compared to the present demand of Dy. Thus, Dy will be supplied from the deposits associated with peralkaline and alkaline deposits in future instead of ion adsorption type deposits in southern China.

  2. Long afterglow of trivalent dysprosium doped strontium aluminate

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Yuan Ming, E-mail: dongshanisland@126.com [School of Mathematics and Physics, Changzhou University, Jiangsu 213164 (China); Ma, Qing-lan [School of Mathematics and Physics, Changzhou University, Jiangsu 213164 (China); School of Electronics and Information, Nantong University, Jiangsu 226019 (China)

    2015-04-15

    Trivalent dysprosium doped strontium aluminate (SrA1{sub 2}O{sub 4}:Dy{sup 3+}) was synthesized via the sol–gel combustion method to realize green afterglow in the absence of Eu{sup 2+} luminescent centers. The morphology, crystal structure, photoluminescence and long afterglow of the SrAl{sub 2}O{sub 4}:Dy{sup 3+} were characterized with scanning electron microscopy, X-ray diffraction, energy-dispersive X-ray spectroscopy and photoluminescence spectroscopy, respectively. The bluish-green photoluminescence of SrAl{sub 2}O{sub 4}:Dy{sup 3+} consists of a broad emission band centered at about 520 nm and two characteristic emissions of Dy{sup 3+} ions centered at 480 and 575 nm, respectively. The green afterglow of SrAl{sub 2}O{sub 4}:Dy{sup 3+} is a broad emission band centered at around 520 nm, and the lifetime extracted from afterglow decay is found to be 53 s. The mechanism on the green afterglow from SrAl{sub 2}O{sub 4}:Dy{sup 3+} is discussed in terms of the possible defect levels in the host. - Highlights: • Broad band long-lasting afterglow is observed in SrAl{sub 2}O{sub 4}:Dy{sup 3+} phosphors. • Characteristic emissions of Dy{sup 3+} ions are superimposed on the broad PL of phosphors. • Dy{sup 3+} ions can also act as luminescent centers in addition to electron traps. • A mechanism on long afterglow of SrAl{sub 2}O{sub 4}:Dy{sup 3+} is proposed without Eu{sup 2+} activator.

  3. Low temperature spin reorientation in dysprosium iron garnet

    Energy Technology Data Exchange (ETDEWEB)

    Lahoubi, M; Younsi, W; Soltani, M L [Department of Physics, Badji-Mokhtar University, BP-12 Annaba, 23000 (Algeria); Voiron, J; Schmitt, D, E-mail: mlahoubi@gmail.co [Louis Neel Laboratory, CNRS-UJF, BP-166, 38042 Grenoble Cedex 9 (France)

    2009-03-01

    The spin reorientation (SR) phase transition in dysprosium iron garnet (Dy{sub 3}Fe{sub 5}O{sub 12} or DyIG) have been studied by specific heat C{sub p}(T) and high field magnetisation measurements M{sub T}(H) and M{sub H}(T) on single crystals at low temperature. A first order SR is observed with a sharp jump at T{sub SR} = 14.5+-0.5 K in the C{sub p}(T) curve which corresponds to a spontaneous change from the high temperature (HT) easy direction (111) to an (uuw) angular low temperature (LT) phases. Above T{sub SR}, the magnetic structure is described by the irreducible representation (IR) A{sub 2g} of the rhombohedral space group R 3 c. Below T{sub SR}, the magnetic structure changes in the monoclinic the space group C2/c with the IR A{sub g}. When the field H is kept aligned along the hard symmetry directions (100) and (110), we obtain respectively the variation of the angular positions theta(T) and theta'(T) from the total spontaneous magnetisation down to 1.5 K (theta = 39.23 deg. and theta' = 30.14 deg.) and the results are in good agreement with the previous observations in low fields. When the sample is allowed to rotate freely on itself, the critical field H{sub c}(T) between the HT(111) and the LT(uuw) angular phases permits us to precise the transition line up to 15 T and 40 K between the so called canted field induced (FI) and the associated collinear magnetic phases. The experimental magnetic phase diagram (MPD) is precisely determined in the (H{sub c}-T) plane and the domains of the existence and the stability of the two magnetic phases are specified.

  4. Anisotropic magnetic properties of dysprosium iron garnet (DyIG)

    Energy Technology Data Exchange (ETDEWEB)

    Lahoubi, M; Younsi, W; Soltani, M-L [Department of Physics, Badji-Mokhtar University, BP 12 - 23000 Annaba (Algeria); Ouladdiaf, B, E-mail: mlahoubi@gmail.co [Institut Laue Langevin, BP 156 - 38042 Grenoble Cedex 9 (France)

    2010-01-01

    The magnetic properties of dysprosium iron garnet (DyIG) have been studied by performing high resolution powder neutron diffraction experiments and high dc fields magnetizations on single crystals. Among all the reflections (hkl) indexed in the nuclear cubic space group (CSG) Ia 3-bar d with h+k+l=2n and k=[000], the superstructure lines (hkl)* forbidden by the symmetry (222)* and (622)* are not observed in the patterns at all temperatures. The pattern at 130 K is well interpreted within the magnetic modes F belonging to the irreducible representation (IR) T{sub 1g} of the CSG and identified to the room temperature ferrimagnetic Neel model. The high magnetic field behavior of the spontaneous collinear magnetic structure (MS) along the easy axis (EA) <111> is isotropic. Below 130 K, the patterns exhibit additional magnetic superstructure lines. They are associated to the appearance of the spontaneous non collinear MS which is described in the subgroup of the CSG, R 3-bar c within the IR A{sub 2g}. A strong magnetization anisotropy (MA) is observed at 1.5 K in the low symmetry phases were the spin reorientation transition (SR) occur at T{sub RS}=14.5 K. The onset of MA is detected below two characteristic temperatures, Ta{sub 1}=125 K and Ta{sub 2}=75 K respectively to the hard axis (HA) <100> and <110>. Symmetry arguments are used in the framework of the theory of representation analysis (RA) applied to the subgroup of R 3-bar c, C2/c within the IR A{sub g}. It seems that this MA results essentially from the difference between the spontaneous non collinear MS and the field induced (FI) configurations. All results are discussed with previous neutrons studies.

  5. Dysprosium-containing layered double hydroxides nanoparticles intercalated with biologically active species as an approach for theranostic systems

    KAUST Repository

    Arratia-Quijada, Jenny

    2015-10-23

    A layered double hydroxide structure including dysprosium cations was prepared by co-precipitation. The nanoparticles showed a linear relationship with the reciprocal relaxation spin-lattice (T1) time of water protons which is reflected as contrast in aqueous suspensions analyzed by magnetic resonance imaging. The interlayer space of dysprosium containing LDH was successfully intercalated with folate, ibuprofen and gallate ions, which are key molecules for recognition of some cancer cells and treatment of diseases. The paramagnetic property of the dysprosium-containing LDH detected in this work beside the ability to transport drugs open up the opportunity to design theranostic materials in a single crystal phase with nanometric dimensions.

  6. Effects of Dysprosium Oxide Doping on Microstructure and Properties of Barium Titanate Ceramic

    Institute of Scientific and Technical Information of China (English)

    Pu Yongping; Ren Huijun; Chen Wei; Chen Shoutian

    2005-01-01

    Different amounts of dysprosium oxide were incorporated into barium titanate powders synthesized by hydrothermal method. Relations of substitution behaviors and lattice parameters with solid-solubility were studied. Furthermore, the influences of dysprosium oxide doping fraction on grain size and dielectric properties of barium titanate ceramic, including dielectric constant and breakdown electric field strength, were investigated via scanning electron microscope, X-ray diffraction and electric property tester. The results show that dysprosium oxide can restrain abnormal grain growth during sintering and that fine-grained and high density of barium titanate ceramic can result in excellent dielectric properties. As mass fraction of dysprosium oxide is 0.6%, the lattice parameters of grain increase to the maximum because of the lowest vacancy concentration. The electric property parameters are cited as following: dielectric constant (25 ℃) reaches 4100, the change in relative dielectric constant with temperature is -10% to 10% within the range of -15~100 ℃, breakdown electric field strength (alternating current) achieves 3.2 kV·mm-1, which can be used in manufacturing high voltage ceramic capacitors.

  7. Sandwich-type tetrakis(phthalocyaninato) dysprosium-cadmium quadruple-decker SMM.

    Science.gov (United States)

    Wang, Hailong; Qian, Kang; Wang, Kang; Bian, Yongzhong; Jiang, Jianzhuang; Gao, Song

    2011-09-14

    Homoleptic tetrakis[2,3,9,10,16,17,23,24-octa(butyloxy)phthalocyaninato] dysprosium-cadmium quadruple-decker complex 1 was isolated in relatively good yield of 43% from a simple one-pot reaction. This compound represents the first sandwich-type tetrakis(phthalocyaninato) rare earth-cadmium quadruple-decker SMM that has been structurally characterized.

  8. In situ characterization of the nitridation of dysprosium during mechanochemical processing

    Energy Technology Data Exchange (ETDEWEB)

    Jaques, Brian J.; Osterberg, Daniel D.; Alanko, Gordon A.; Tamrakar, Sumit; Smith, Cole R.; Hurley, Michael F.; Butt, Darryl P., E-mail: DarrylButt@BoiseState.edu

    2015-01-15

    Highlights: • A nitridation reaction in a high energy planetary ball mill was monitored in situ. • Dysprosium mononitride was synthesized from Dy at low temperatures in short times. • Ideal gas law and in situ temperature and pressure used to assess reaction extent. • It is proposed that reaction rate is proportional to the creation of new surface. - Abstract: Processing of advanced nitride ceramics traditionally requires long durations at high temperatures and, in some cases, in hazardous atmospheres. In this study, dysprosium mononitride (DyN) was rapidly formed from elemental dysprosium in a closed system at ambient temperatures. An experimental procedure was developed to quantify the progress of the nitridation reaction during mechanochemical processing in a high energy planetary ball mill (HEBM) as a function of milling time and intensity using in situ temperature and pressure measurements, SEM, XRD, and particle size analysis. No intermediate phases were formed. It was found that the creation of fresh dysprosium surfaces dictates the rate of the nitridation reaction, which is a function of milling intensity and the number of milling media. These results show clearly that high purity nitrides can be synthesized with short processing times at low temperatures in a closed system requiring a relatively small processing footprint.

  9. Dysprosium complexes with the tetraphenylporphyrin macrocyclic ligand; Complejos de disprosio con el ligante macrociclico tetrafenilporfirina

    Energy Technology Data Exchange (ETDEWEB)

    Martinez M, V.; Padilla, J.; Ramirez, F.M

    1992-04-15

    In this report, the results obtained on the synthesis, characterization and study of the chemical behavior of dysprosium complex with the acetylacetone chelating agent (Hacac) and the tetraphenylporphyrin macrocyclic ligand (H{sub 2}TFP) are given. Based on the literature but according to our necessities and interest, the appropriate methodology settled down from the synthesis of prime matters until the obtaining and characterization of the products. The acetyl acetonate complex was obtained of mono hydrated dysprosium [Dy(acac){sub 3}. H{sub 2}0] and trihydrated [Dy(acac){sub 3} .3 H{sub 2}0], the mono tetra phenyl porphyrinate [Dy(TFP)(acac). 2 ac] the double sandwich of the dysprosium porphyrinate [Dy(TFP){sub 2}] and the triple sandwich of the dysprosium porphyrinate [Dy(TFP){sub 3}. 2 TCB] (TCB = trichlorobenzene). Its were characterized by their melting points, solubility, IR, UV, TGA and DTA both first and besides the techniques already mentioned for NMR'H, RPE and Magnetic susceptibility the three last complexes. From the spectroscopic point of view, IR and RPE its suggested the existence of a complex of inverse mixed valence [Dy(TFP){sup 2-} (TFP) {sup 1-}] for the Dy(TFP){sub 2} as a result of the existence of the free radical (TFP' {sup 1-} and that it was not in none of the other porphyrin compounds. In the NMR'H spectra of the compounds were not observed signals in the region from 0 to 10 ppm that which shows that the dysprosium complexes in special those of the porphyrin type are highly paramagnetic and its could be used as displacement reagents, creators of images and contrast agents of great utility in these days in studies of NMR, technique today by today used in medical diagnoses. (Author)

  10. Synthesis, structural characterization and in vitro testing of dysprosium containing silica particles as potential MRI contrast enhancing agents

    Science.gov (United States)

    Chiriac, L. B.; Trandafir, D. L.; Turcu, R. V. F.; Todea, M.; Simon, S.

    2016-11-01

    The work is focused on synthesis and structural characterization of novel dysprosium-doped silica particles which could be considered as MRI contrast agents. Sol-gel derived silica rich particles obtained via freeze-drying and spray-drying processing methods were structurally characterized by XRD, 29Si MAS-NMR and XPS methods. The occurrence of dysprosium on the outermost layer of dysprosium containing silica particles was investigated by XPS analysis. The MRI contrast agent characteristics have been tested using RARE-T1 and RARE-T2 protocols. The contrast of MRI images delivered by the investigated samples was correlated with their local structure. Dysprosium disposal on microparticles with surface structure characterised by decreased connectivity of the silicate network units favours dark T2-weighted MRI contrast properties.

  11. Dysprosium-containing layered double hydroxides nanoparticles intercalated with biologically active species as an approach for theranostic systems

    Energy Technology Data Exchange (ETDEWEB)

    Arratia-Quijada, Jenny [Departamento de Ciencias de la Salud, Centro Universitario Tonalá, Universidad de Guadalajara, Av. Nuevo Periférico No. 555, C.P. 48525, Tonalá, Jalisco (Mexico); Sánchez Jiménez, Cecilia [Departamento de Química, Universidad de Guadalajara, Boulevard Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico); Gurinov, Andrey [Research Resources Center for Magnetic Resonance, St. Petersburg State University, Universitetskiy pr. 26, 198504 St. Petersburg (Russian Federation); NMR Core Lab, King Abdullah University of Science and Technology, Thuwal 23955-6900 (Saudi Arabia); Pérez Centeno, Armando; Ceja Andrade, Israel [Departamento de Física, Universidad de Guadalajara, Boulevard Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico); Carbajal Arízaga, Gregorio Guadalupe, E-mail: gregoriocarbajal@yahoo.com.mx [Departamento de Química, Universidad de Guadalajara, Boulevard Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico)

    2016-01-15

    Graphical abstract: - Highlights: • LDH structure including dysprosium was prepared by co-precipitation. • LDH was capable to produce contrast in the T1 mode of MRI. • LDH were intercalated with folate, ibuprofen and gallate ions. - Abstract: A layered double hydroxide structure including dysprosium cations was prepared by co-precipitation. The nanoparticles showed a linear relationship with the reciprocal relaxation spin-lattice (T1) time of water protons which is reflected as contrast in aqueous suspensions analyzed by magnetic resonance imaging. The interlayer space of dysprosium containing LDH was successfully intercalated with folate, ibuprofen and gallate ions, which are key molecules for recognition of some cancer cells and treatment of diseases. The paramagnetic property of the dysprosium-containing LDH detected in this work beside the ability to transport drugs open up the opportunity to design theranostic materials in a single crystal phase with nanometric dimensions.

  12. Slow magnetic relaxation in a hydrogen-bonded 2D array of mononuclear dysprosium(III) oxamates.

    Science.gov (United States)

    Fortea-Pérez, Francisco R; Vallejo, Julia; Julve, Miguel; Lloret, Francesc; De Munno, Giovanni; Armentano, Donatella; Pardo, Emilio

    2013-05-01

    The reaction of N-(2,6-dimethylphenyl)oxamic acid with dysprosium(III) ions in a controlled basic media afforded the first example of a mononuclear lanthanide oxamate complex exhibiting a field-induced slow magnetic relaxation behavior typical of single-ion magnets (SIMs). The hydrogen-bond-mediated self-assembly of this new bifunctional dysprosium(III) SIM in the solid state provides a unique example of 2D hydrogen-bonded polymer with a herringbone net topology.

  13. Extension of the energy range of the experimental activation cross-sections data of longer-lived products of proton induced nuclear reactions on dysprosium up to 65 MeV

    CERN Document Server

    Tárkányi, F; Takács, S; Hermanne, A; Ignatyuk, A V

    2016-01-01

    Activation cross-sections data of longer-lived products of proton induced nuclear reactions on dysprosium were extended up to 65 MeV by using stacked foil irradiation and gamma spectrometry experimental methods. Experimental cross-sections data for the formation of the radionuclides $^{159}$Dy, $^{157}$Dy, $^{155}$Dy, $^{161}$Tb, $^{160}$Tb, $^{156}$Tb, $^{155}$Tb, $^{154m2}$Tb, $^{154m1}$Tb, $^{154g}$Tb, $^{153}$Tb, $^{152}$Tb and $^{151}$Tb are reported in the 36-65 MeV energy range, and compared with an old dataset from 1964. The experimental data were also compared with the results of cross section calculations of the ALICE and EMPIRE nuclear model codes and of the TALYS nuclear reaction model code as listed in the latest on-line libraries TENDL 2013.

  14. Extension of the energy range of the experimental activation cross-sections data of longer-lived products of proton induced nuclear reactions on dysprosium up to 65MeV.

    Science.gov (United States)

    Tárkányi, F; Ditrói, F; Takács, S; Hermanne, A; Ignatyuk, A V

    2015-04-01

    Activation cross-sections data of longer-lived products of proton induced nuclear reactions on dysprosium were extended up to 65MeV by using stacked foil irradiation and gamma spectrometry experimental methods. Experimental cross-sections data for the formation of the radionuclides (159)Dy, (157)Dy, (155)Dy, (161)Tb, (160)Tb, (156)Tb, (155)Tb, (154m2)Tb, (154m1)Tb, (154g)Tb, (153)Tb, (152)Tb and (151)Tb are reported in the 36-65MeV energy range, and compared with an old dataset from 1964. The experimental data were also compared with the results of cross section calculations of the ALICE and EMPIRE nuclear model codes and of the TALYS nuclear reaction model code as listed in the latest on-line libraries TENDL 2013. Copyright © 2015. Published by Elsevier Ltd.

  15. Dysprosium-Catalyzed Growth of Single-Walled Carbon Nanotube Arrays on Substrates

    Directory of Open Access Journals (Sweden)

    Qian Yong

    2009-01-01

    Full Text Available Abstract In this letter, we report that dysprosium is an effective catalyst for single-walled carbon nanotubes (SWNTs growth via a chemical vapor deposition (CVD process for the first time. Horizontally superlong well-oriented SWNT arrays on SiO2/Si wafer can be fabricated by EtOH-CVD under suitable conditions. The structure and properties are characterized by scanning electron microscopy, transition electron microscopy, Raman spectroscopy and atomic force microscopy. The results show that the SWNTs from dysprosium have better structural uniformity and better conductivity with fewer defects. This rare earth metal provides not only an alternative catalyst for SWNTs growth, but also a possible method to generate high percentage of superlong semiconducting SWNT arrays for various applications of nanoelectronic device.

  16. Direct Search for keV Sterile Neutrino Dark Matter with a Stable Dysprosium Target

    CERN Document Server

    Lasserre, T; Cribier, M; Merle, A; Mertens, S; Vivier, M

    2016-01-01

    We investigate a new method to search for keV-scale sterile neutrinos that could account for Dark Matter. Neutrinos trapped in our galaxy could be captured on stable $^{163}$Dy if their mass is greater than 2.83~keV. Two experimental realizations are studied, an integral counting of $^{163}$Ho atoms in dysprosium-rich ores and a real-time measurement of the emerging electron spectrum in a dysprosium-based detector. The capture rates are compared to the solar neutrino and radioactive backgrounds. An integral counting experiment using several kilograms of $^{163}$Dy could reach a sensitivity for the sterile-to-active mixing angle $\\sin^2\\theta_{e4}$ of $10^{-5}$ significantly exceeding current laboratory limits. Mixing angles as low as $\\sin^2\\theta_{e4} \\sim 10^{-7}$ / $\\rm m_{^{163}\\rm Dy}\\rm{(ton)}$ could possibly be explored with a real-time experiment.

  17. Preparation of Dysprosium Ferrite/Polyacrylamide Magnetic Composite Microsphere and Its Characterization

    Institute of Scientific and Technical Information of China (English)

    Hidehiro Kumazawa; Wang Zhifeng; Zhou Lanxiang; Zhang Hong; Li Yourong; Zhang Ming

    2005-01-01

    Using the technique of microemulsion polymerization with nano-reactor, dysprosium ferrite/polyacrylamide magnetic composite microsphere was prepared by one-step method in a single inverse microemulsion. The structure, average particle size, morphology of composite microsphere were characterized by FTIR, XRD, TEM and TGA. The magnetic responsibility of composite microsphere was also investigated. The results indicate that the magnetic composite microsphere possess high magnetic responsibility and suspension stability.

  18. Poly[[[μ3-N′-(carboxymethylethylenediamine-N,N,N′-triacetato]dysprosium(III] trihydrate

    Directory of Open Access Journals (Sweden)

    Xiaomei Zhuang

    2010-11-01

    Full Text Available In the title coordination polymer, {[Dy(C10H13N2O8]·3H2O}n, the dysprosium(III ion is coordinated by two N atoms and six O atoms from three different (carboxymethylethylenediaminetriacetate ligands in a distorted square-antiprismatic geometry. The ligands connect the metal atoms, forming layers parallel to the ab plane. O—H...O hydrogen bonds further assemble adjacent layers into a three-dimensional supramolecular network.

  19. Making two dysprosium atoms rotate - Einstein-de Haas effect revisited

    OpenAIRE

    Górecki, Wojciech; Rzążewski, Kazimierz

    2016-01-01

    We present a numerical study of the behaviour of two magnetic dipolar atoms trapped in a harmonic potential and exhibiting the standard Einstein-de Haas effect while subject to a time dependent homogeneous magnetic field. Using a simplified description of the short range interaction and the full expression for the dipole-dipole forces we show, that under experimentally realisable conditions two dysprosium atoms may be pumped to a high ($l>20$) value of the relative orbital angular momentum.

  20. Phosphor Dysprosium-Doped Layered Double Hydroxides Exchanged with Different Organic Functional Groups

    Directory of Open Access Journals (Sweden)

    David Ricardo Martínez Vargas

    2013-01-01

    Full Text Available The layers of a Zn/Al layered double hydroxide (LDH were doped with Dy3+ cations. Among some compositions, the Zn2+ : Al3+ : Dy3+ molar ratio equal to 30 : 9 : 1 presented a single crystalline phase. Organic anions with carboxylic, amino, sulfate, or phosphate functional groups were intercalated as single layers between LDH layers as confirmed by X-ray diffraction and infrared spectroscopy. Photoluminescence spectra of the nitrate intercalated LDH showed a wide emission band with strong intensity in the yellow region (around 574 nm, originated due to symmetry distortion of the octahedral coordination in dysprosium centers. Moreover, a broad red band emission was also detected apparently due to the presence of zinc oxide. The distorted symmetry of the dysprosium coordination environment, also confirmed by X-ray photoelectron spectroscopy analysis, was modified after the intercalation with phenyl phosphonate (PP, aspartate (Asp, adipate (Adip, and serinate (Ser anions; the emission as measured from PL spectra of these LDH was more intense in the blue region (ca. 486 nm, thus indicating an increase in symmetry of dysprosium octahedrons. The red emission band from zinc oxide kept the same intensity after intercalation of dodecyl sulfate (DDS. An additional emission of unknown origin at λ = 767 nm was present in all LDHs.

  1. Systematic study on surface and magnetostructural changes in Mn-substituted dysprosium ferrite by hydrothermal method

    Energy Technology Data Exchange (ETDEWEB)

    Rekha, G. [Department of Physics, College of Engineering Guindy, Anna University, Sardar Patel Road, Chennai 600025 (India); Tholkappiyan, R. [Department of Physics, College of Engineering Guindy, Anna University, Sardar Patel Road, Chennai 600025 (India); Department of Physics, College of Science, UAE University, Al-Ain 15551 (United Arab Emirates); Vishista, K., E-mail: raovishista@gmail.com [Department of Physics, College of Engineering Guindy, Anna University, Sardar Patel Road, Chennai 600025 (India); Hamed, Fathalla [Department of Physics, College of Science, UAE University, Al-Ain 15551 (United Arab Emirates)

    2016-11-01

    Highlights: • Garnet type Dy{sub 3}Fe{sub 5-x}Mn{sub x}O{sub 12} (x = 0–0.06) nanoparticles of 88.4–86.8 nm were synthesized by hydrothermal method. • The Dy, Mn, Fe and O elements in the ferrites were confirmed from XPS. • The multiple oxidation states of Fe and Mn ions, bonding energy and cationic distributions of the samples were examined by XPS. • The magnetic property shows ferromagnetic behavior from VSM technique. • The results from these studies are correlated with respect to Mn dopant. - Abstract: Dysprosium iron garnets are of scientific importance because of the wide range of magnetic properties that can be obtained in substituting dysprosium by a rare earth metal. In the present work, the effect of Mn substitution on magnetostructural changes in dysprosium ferrite nanoparticles is studied. Highly crystalline pure and Mn doped dysprosium ferrite nanoparticles were synthesized by hydrothermal method. The samples were calcined at 1100 °C for 2 h in air atmosphere which is followed by characterization using XRD, FT-IR analysis, SEM, XPS and VSM. The average crystallite size of synthesized samples were calculated by X-ray diffraction falls in the range of 88.4–86.8 nm and was found to be in cubic garnet structure. For further investigation of the structure and corresponding changes in the tetrahedral and octahedral stretching vibrational bonds, FT-IR was used. The synthesized samples consist of multiple oxidation (Fe{sup 3+} and Fe{sup 2+}) states for Fe ions and (Mn{sup 3+} and Mn{sup 2+}) Mn ions analyzed in three ways of Fe 2p and Mn 2p spectra from the XPS analysis. With respect to Mn dopant in Dy{sub 3}Fe{sub 5}O{sub 12}, the cationic distributions of elements were discussed from high resolution XPS spectra by peak position and shift, area, width. To find out the porous/void surface morphology of the sample, scanning electron microscopy was used. From XPS analysis, the presence of elements (Dy, Mn, Fe and O) and their composition in the

  2. Synthesis, structural characterization and in vitro testing of dysprosium containing silica particles as potential MRI contrast enhancing agents

    Energy Technology Data Exchange (ETDEWEB)

    Chiriac, L.B.; Trandafir, D.L. [Faculty of Physics & National Magnetic Resonance Center, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Interdisciplinary Research Institute on Bio-Nano-Sciences & Faculty of Physics, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Turcu, R.V.F. [Faculty of Physics & National Magnetic Resonance Center, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Todea, M. [Interdisciplinary Research Institute on Bio-Nano-Sciences & Faculty of Physics, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Simon, S., E-mail: simons@phys.ubbcluj.ro [Faculty of Physics & National Magnetic Resonance Center, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Interdisciplinary Research Institute on Bio-Nano-Sciences & Faculty of Physics, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania)

    2016-11-01

    Highlights: • Dysprosium containing silica microparticles obtained by freeze and spray drying. • Higher structural units interconnection achieved in freeze vs. spray dried samples. • Dy occurance on the outermost layer of the microparticles evidenced by XPS. • Enhanced MRI contrast observed for freeze dried samples with 5% mol Dy{sub 2}O{sub 3}. - Abstract: The work is focused on synthesis and structural characterization of novel dysprosium-doped silica particles which could be considered as MRI contrast agents. Sol-gel derived silica rich particles obtained via freeze-drying and spray-drying processing methods were structurally characterized by XRD, {sup 29}Si MAS-NMR and XPS methods. The occurrence of dysprosium on the outermost layer of dysprosium containing silica particles was investigated by XPS analysis. The MRI contrast agent characteristics have been tested using RARE-T{sub 1} and RARE-T{sub 2} protocols. The contrast of MRI images delivered by the investigated samples was correlated with their local structure. Dysprosium disposal on microparticles with surface structure characterised by decreased connectivity of the silicate network units favours dark T{sub 2}-weighted MRI contrast properties.

  3. Influence of exchange splitting on optical properties in gadolinium and dysprosium single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Knyazev, Yu.V.; Bolotin, G.A. (AN SSSR, Sverdlovsk. Inst. Fiziki Metallov)

    1984-12-01

    The temperature dependences of optical conductivity in gadolinium and dysprosium single crystals at the light wave vector polarization along a hexagonal axis and in the basis plane are considered. A substantial anisotropy of interzonal absorption has been found. The sample transition into magnetically ordered state is shown to be accompanied by the emergence of resonance absorption peaks in the near infrared spectral region. The manifestation of these peculiarities is associated with quantum electron transitions between the s-, d-f- interaction-split energy bands near the Fermi level. Main peculiarities of the experimental spectrum of gadolinium optical conductivity found their reflection in theoretically calculated dispersion dependence.

  4. Therapeutic application of dysprosium-165-FHMA in the treatment of rheumatoid knee effusions

    Energy Technology Data Exchange (ETDEWEB)

    English, R.J.; Zalutsky, M.; Venkatesan, P.; Sledge, C.B.

    1986-03-01

    Radiation synovectomy utilizing a variety of radionuclides has proven to be an effective technique in the treatment of rheumatoid arthritis. The recent introduction of the short-lived radionuclide, Dysprosium-165 (/sup 165/Dy), as a replacement for the longer-lived radiocolloids has reduced nontarget dosimetry caused by leakage of the agent from the articular cavity. A review of the methods and status of radiation synovectomy, and the application of /sup 165/Dy-ferric hydroxide macroaggregates (FHMA) as an alternative therapeutic agent is described.

  5. Properties of dysprosium-doped gallium lanthanum sulfide fiber amplifiers operating at 1.3 microm.

    Science.gov (United States)

    Samson, B N; Schweizer, T; Hewak, D W; Laming, R I

    1997-05-15

    In light of recent progress in the fabrication of gallium lanthanum sulfide (GaLaS) fibers, we have modeled the performance of dysprosium-doped GaLaS fiber amplifiers operating at 1.3 microm . Based on experimental data, we find that the incorporation of a codopant (terbium) in the fiber core significantly shortens the optimum amplifier length from >30 m to approximately 3 m . Such a device may be practical, given the fiber losses currently achieved in GaLaS fibers.

  6. 40 CFR 157.34 - Certification.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Certification. 157.34 Section 157.34... REQUIREMENTS FOR PESTICIDES AND DEVICES Child-Resistant Packaging § 157.34 Certification. (a) General. (1) The... that the package meets the standards of § 157.32. (2) Certification must be submitted with...

  7. Effect of dysprosium on the kinetics and structural transformations during the decomposition of the supersaturated solid solution in magnesium-samarium alloys

    Science.gov (United States)

    Rokhlin, L. L.; Luk'yanova, E. A.; Tabachkova, N. Yu.; Dobatkina, T. V.; Tarytina, I. E.; Korol'kova, I. G.

    2017-03-01

    The effect of dysprosium added in the amounts such that it does not form an individual phase in equilibrium with solid magnesium on the decomposition of the supersaturated magnesium solid solution in Mg-Sm alloys is studied. The presence of dysprosium in Mg-Sm alloys is found to retard the decomposition of the supersaturated magnesium solid solution and to increase the hardening effect upon aging. When these alloys are aged, dysprosium is partly retained in the magnesium solid solution and partly enters into the compositions of the phases that form during the decomposition of the solid solution and are characteristic of Mg-Sm alloys.

  8. Cyclic single-molecule magnets: from the odd-numbered heptanuclear to a dimer of heptanuclear dysprosium clusters.

    Science.gov (United States)

    Tian, Haiquan; Bao, Song-Song; Zheng, Li-Min

    2016-02-01

    A heptanuclear and a dimer of heptanuclear dysprosium clusters (Dy7 and Dy14) have been successfully synthesized by ingenious coalescence of the single and double pyrazinyl hydrazone as well as phosphonate ligands. The complexes feature the largest odd-numbered cyclic lanthanide clusters reported thus far. Both exhibit single molecule magnet behaviors at low temperature.

  9. A comparison of the effects of symmetry and magnetoanisotropy on paramagnetic relaxation in related dysprosium single ion magnets.

    Science.gov (United States)

    Williams, Ursula J; Mahoney, Brian D; DeGregorio, Patrick T; Carroll, Patrick J; Nakamaru-Ogiso, Eiko; Kikkawa, James M; Schelter, Eric J

    2012-06-07

    Dysprosium complexes of the tmtaa(2-) ligand were synthesized and characterized by X-band EPR and magnetism studies. Both complexes demonstrate magnetoanisotropy and slow paramagnetic relaxation. Comparison of these compounds with the seminal phthalocyanine complex [Dy(Pc)(2)](-) shows the azaannulide complexes are more susceptible to relaxation through non-thermal pathways.

  10. Dual responsive dysprosium-doped hydroxyapatite particles and toxicity reduction after functionalization with folic and glucuronic acids

    Energy Technology Data Exchange (ETDEWEB)

    Sánchez Lafarga, Ana Karen; Pacheco Moisés, Fermín P. [Departamento de Química, Universidad de Guadalajara, Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico); Gurinov, Andrey [Research Resources Center for Magnetic Resonance, Saint Petersburg State University, Universitetskij pr. 26, 198504 St. Petersburg (Russian Federation); Ortiz, Genaro Gabriel [Laboratorio Desarrollo-Envejecimiento, Enfermedades Neurodegenerativas, Centro de Investigación Biomédica de Occidente (CIBO), Instituto Mexicano de Seguro Social (IMSS), Guadalajara, Jalisco (Mexico); Carbajal Arízaga, Gregorio Guadalupe, E-mail: gregoriocarbajal@yahoo.com.mx [Departamento de Química, Universidad de Guadalajara, Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico)

    2015-03-01

    The development of probes for biomedical applications demands materials with low toxicity levels besides fluorescence or magnetic properties to be detected by confocal microscopes or MRI resonators. Several drug delivery systems or other biomedical materials prepared with hydroxyapatite have been proposed, however, toxicity effects might arise when the size of particles is nanometric. In this study, hydroxyapatite functionalized with glucuronic or folic acids presented lower oxidative stress, measured from lipoperoxides and nitric oxide indicators in rats than pure hydroxyapatite. In separated experiments, hydroxyapatite was doped with dysprosium cations by coprecipitation producing a single crystal phase with fluorescent properties easily visualized by confocal microscopy when excited at 488 nm. These particles also presented the ability to modify the proton relaxation time in T1 maps collected by magnetic resonance imaging. These modified hydroxyapatite nanoparticles could be candidates to design bimodal probes with low toxicity. - Highlights: • Hydroxyapatite functionalized with glucuronic acid reduced oxidative stress in rats. • Functionalization with folic acid reduced oxidative stress in rats. • Dysprosium doping does not affect the crystalline structure of hydroxyapatite. • Dysprosium doped particles are visible in fluorescent microscope. • Dysprosium doped particles act as MRI contrast agents.

  11. Tuning Slow Magnetic Relaxation in a Two-Dimensional Dysprosium Layer Compound through Guest Molecules.

    Science.gov (United States)

    Chen, Qi; Li, Jian; Meng, Yin-Shan; Sun, Hao-Ling; Zhang, Yi-Quan; Sun, Jun-Liang; Gao, Song

    2016-08-15

    A novel two-dimensional dysprosium(III) complex, [Dy(L)(CH3COO)]·0.5DMF·H2O·2CH3OH (1), has been successfully synthesized from a new pyridine-N-oxide (PNO)-containing ligand, namely, N'-(2-hydroxy-3-methoxybenzylidene)pyridine-N-oxidecarbohydrazide (H2L). Single-crystal X-ray diffraction studies reveal that complex 1 is composed of a dinuclear dysprosium subunit, which is further extended by the PNO part of the ligand to form a two-dimensional layer. Magnetic studies indicate that complex 1 shows well-defined temperature- and frequency-dependent signals under a zero direct-current (dc) field, typical of slow magnetic relaxation with an effective energy barrier Ueff of 33.6 K under a zero dc field. Interestingly, powder X-ray diffraction and thermogravimetric analysis reveal that compound 1 undergoes a reversible phase transition that is induced by the desorption and absorption of methanol and water molecules. Moreover, the desolvated sample [Dy(L)(CH3COO)]·0.5DMF (1a) also exhibits slow magnetic relaxation but with a higher anisotropic barrier of 42.0 K, indicating the tuning effect of solvent molecules on slow magnetic relaxation.

  12. Dosimetric properties of dysprosium doped calcium magnesium borate glass subjected to Co-60 gamma ray

    Energy Technology Data Exchange (ETDEWEB)

    Omar, R. S., E-mail: ratnasuffhiyanni@gmail.com; Wagiran, H., E-mail: husin@utm.my; Saeed, M. A. [Department of Physics, Faculty of Science, Universiti Teknologi Malaysia, 81310 Johor Bahru (Malaysia)

    2016-01-22

    Thermoluminescence (TL) dosimetric properties of dysprosium doped calcium magnesium borate (CMB:Dy) glass are presented. This study is deemed to understand the application of calcium as the modifier in magnesium borate glass with the presence of dysprosium as the activator to be performed as TL dosimeter (TLD). The study provides fundamental knowledge of a glass system that may lead to perform new TL glass dosimetry application in future research. Calcium magnesium borate glass systems of (70-y) B{sub 2}O{sub 3} − 20 CaO – 10 MgO-(y) Dy{sub 2}O{sub 3} with 0.05  mol % ≤ y ≤ 0.7  mol % of dyprosium were prepared by melt-quenching technique. The amorphous structure and TL properties of the prepared samples were determined using powder X-ray diffraction (XRD) and TL reader; model Harshaw 4500 respectively. The samples were irradiated to Co-60 gamma source at a dose of 50 Gy. Dosimetric properties such as annealing procedure, time temperature profile (TTP) setting, optimization of Dy{sub 2}O{sub 3} concentration of 0.5 mol % were determined for thermoluminescence dosimeter (TLD) reader used.

  13. Luminescent properties of dysprosium(Ⅲ) ions in LaAlO3 nanocrystallites

    Institute of Scientific and Technical Information of China (English)

    K. Lema(n)ski; P.J. Dere(n)

    2011-01-01

    The absorption and emission spectra as well as decay time profile of Dy3+ ions in LaAlO3 nanocrystals were analyzed.The crystal structure of LaAlO3 was confirmed from XRD measurement.The emission peaks from blue to red came from main emitting level of dysprosium 4F9/2 to the ground and other excited levels of Dy3+ ions.Cross relaxation process led to non-radiative quenching of luminescence,so that the lifetime of the 4F9/2 energy level ions decreased with increasing amount of doped Dy3+ ions.The cross relaxation transfer rates were experimentally determined as a function of Dy3+ concentration.

  14. Magnetic ordering temperatures in rare earth metal dysprosium under ultrahigh pressures

    Science.gov (United States)

    Samudrala, Gopi K.; Tsoi, Georgiy M.; Weir, Samuel T.; Vohra, Yogesh K.

    2014-04-01

    Magnetic ordering temperatures in heavy rare earth metal dysprosium (Dy) have been studied using an ultrasensitive electrical transport measurement technique in a designer diamond anvil cell to a pressure of 69 GPa and a temperature of 10 K. Previous studies using magnetic susceptibility measurements at high pressures were able to track magnetic ordering temperature only till 7 GPa in the hexagonal close packed (hcp) phase of Dy. Our studies indicate that the magnetic ordering temperature shows an abrupt drop of 80 K at the hcp-Sm phase transition followed by a gradual decrease that continues till 17 GPa. This is followed by a rapid increase in the magnetic ordering temperatures in the double hcp phase and finally leveling off in the distorted face centered cubic phase of Dy. Our studies reaffirm that 4f-shell remains localized in Dy and there is no loss of magnetic moment or 4f-shell delocalization for pressures up to 69 GPa.

  15. 33 CFR 157.126 - Pumps.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Pumps. 157.126 Section 157.126... Washing (COW) System on Tank Vessels Design, Equipment, and Installation § 157.126 Pumps. (a) Crude oil must be supplied to the COW machines by COW system pumps or cargo pumps. (b) The pumps under...

  16. 33 CFR 157.154 - Assistant personnel.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Assistant personnel. 157.154 Section 157.154 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... Crude Oil Washing (COW) System on Tank Vessels Personnel § 157.154 Assistant personnel. The owner...

  17. 40 CFR 157.27 - Unit packaging.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Unit packaging. 157.27 Section 157.27 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PACKAGING REQUIREMENTS FOR PESTICIDES AND DEVICES Child-Resistant Packaging § 157.27 Unit packaging. Pesticide...

  18. 33 CFR 157.166 - Hydrocarbon emissions.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Hydrocarbon emissions. 157.166... Crude Oil Washing (COW) System on Tank Vessels Cow Operations § 157.166 Hydrocarbon emissions. If the... ballasted in that port the hydrocarbon vapors in each tank are contained by a means under § 157.132....

  19. 36 CFR 1192.157 - Lighting.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Lighting. 1192.157 Section 1192.157 Parks, Forests, and Public Property ARCHITECTURAL AND TRANSPORTATION BARRIERS COMPLIANCE BOARD... Buses and Systems § 1192.157 Lighting. (a) Any stepwell or doorway immediately adjacent to the driver...

  20. 33 CFR 157.49 - Instruction manual.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Instruction manual. 157.49... Vessel Operation § 157.49 Instruction manual. The master of a tank vessel shall ensure that the instruction manual under § 157.23 is available and used when the cargo or ballast systems are operated....

  1. 40 CFR 157.32 - Standards.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Standards. 157.32 Section 157.32... REQUIREMENTS FOR PESTICIDES AND DEVICES Child-Resistant Packaging § 157.32 Standards. (a) Effectiveness standard. The child-resistant packaging, when tested by the protocol specified in 16 CFR 1700.20,...

  2. Electrochemical behaviour of dysprosium in the eutectic LiCl-KCl at W and Al electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Castrillejo, Y. [Dpto de Quimica Analitica, Facultad de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain)]. E-mail: ycastril@qa.uva.es; Bermejo, M.R. [Dpto de Quimica Analitica, Facultad de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Barrado, A.I. [Dpto de Quimica Analitica, Facultad de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Pardo, R. [Dpto de Quimica Analitica, Facultad de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Barrado, E. [Dpto de Quimica Analitica, Facultad de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Martinez, A.M. [Department of Materials Technology, Sem Saelands vei 6, 7491 Trondheim (Norway)

    2005-03-15

    The electrochemical behaviour of DyCl{sub 3} was studied in the eutectic LiCl-KCl at different temperatures. The cathodic reaction can be written:Dy(III)+3e-bar Dy(0)which can be divided in two very close cathodic steps:Dy(III)+1e-bar Dy(II)andDy(II)+2e-bar Dy(0)Transient electrochemical techniques, such as cyclic voltammetry, chronopotentiometry, and chronoamperometry were used in order to study the reaction mechanism and the transport parameters of electroactive species at a tungsten electrode. The results showed that in the eutectic LiCl-KCl, electrocrystallization of dysprosium seems to be the controlling electrochemical step. Chronoamperometric studies indicated instantaneous nucleation of dysprosium with three dimensional growth of the nuclei whatever the applied overpotential.Mass transport towards the electrode is a simple diffusion process, and the diffusion coefficient of the electroactive species, i.e. Dy(III), has been calculated. The validity of the Arrhenius law was also verified by plotting the variation of the logarithm of the diffusion coefficient versus 1/T.In addition, the electrode reactions of the LiCl-KCl-DyCl{sub 3} solutions at an Al wire were also investigated by cyclic voltammetry and open circuit chronopotentiometry. The redox potential of the Dy(III)/Dy couple at the Al electrode was observed at more positive potentials values than those at the inert electrode. This potential shift was thermodynamically analyzed by a lowering of activity of Dy in the metal phase due to the formation of intermetallic compounds.

  3. Structural, optical, thermal, mechanical and dielectric studies of Sulfamic acid single crystals: An influence of dysprosium (Dy3+) doping

    Science.gov (United States)

    Singh, Budhendra; Shkir, Mohd.; AlFaify, S.; Kaushal, Ajay; Nasani, Narendar; Bdikin, Igor; Shoukry, H.; Yahia, I. S.; Algarni, H.

    2016-09-01

    Sulfamic acid is a potential material that exhibits excellent optical properties. A good quality, pure and dysprosium (Dy3+) doped (2.5 and 5 mol %) Sulfamic acid (SA) single crystals were grown successfully by slow cooling method. Structural study revealed a slight change in its lattice parameters and volume, suggesting the successful incorporation of Dy3+ in crystal system. The existence of dysprosium in the system was also confirmed. Presence of various vibrational modes was confirmed. Optical transparency was found to have a significant effect with variation in the doping concentration. Furthermore, a marked enhancement in its mechanical parameters with doping was also identified by nanoindentation technique. Etching study was also performed on the grown crystals to study the etch-pit formation and growth mechanism. Effect of doping on the thermal stability was analysed. All the results were compared and discussed in detail to get insight of the effect of doping concentration on Sulfamic acid crystal.

  4. Optical trapping of ultracold dysprosium atoms: transition probabilities, dynamic dipole polarizabilities and van der Waals $C_6$ coefficients

    CERN Document Server

    Li, Hui; Dulieu, Olivier; Nascimbene, Sylvain; Lepers, Maxence

    2016-01-01

    The efficiency of optical trapping of ultracold atoms depend on the atomic dynamic dipole polarizability governing the atom-field interaction. In this article, we have calculated the real and imaginary parts of the dynamic dipole polarizability of dysprosium in the ground and first excited level. Due to the high electronic angular momentum of those two states, the polarizabilities possess scalar, vector and tensor contributions that we have computed, on a wide range of trapping wavelengths, using the sum-over-state formula. Using the same formalism, we have also calculated the $C_6$ coefficients characterizing the van der Waals interaction between two dysprosium atoms in the two lowest levels. We have computed the energies of excited states and the transition probabilities appearing in the sums, using a combination of \\textit{ab initio} and least-square-fitting techniques provided by the Cowan codes and extended in our group. Regarding the real part of the polarizability, for field frequencies far from atomic...

  5. Mixed (phthalocyaninato)(Schiff-base) di-dysprosium sandwich complexes. Effect of magnetic coupling on the SMM behavior.

    Science.gov (United States)

    Wang, Hailong; Liu, Chenxi; Liu, Tao; Zeng, Suyuan; Cao, Wei; Ma, Qi; Duan, Chunying; Dou, Jianmin; Jiang, Jianzhuang

    2013-11-21

    Reaction between Schiff-base ligand and half-sandwich complex M(Pc)(acac) led to the isolation of new sandwich-type mixed (phthalocyaninato)(Schiff-base) di-lanthanide compounds M2(Pc)2(L)H2O (M = Dy, Gd) (1, 2) [H2Pc = metal free phthalocyanine, Hacac = acetylacetone, H2L = N,N'-bis(3-methyloxysalicylidene)benzene-1,2-diamine] with the triple-decker molecular structure clearly revealed by single crystal X-ray diffraction analysis. For the comparative studies, sandwich triple-decker analogues with pure Schiff-base ligand M2(L)3H2O (M = Dy, Gd) (3, 4) were also prepared. Dynamic magnetic measurement result reveals the single-molecule magnet (SMM) nature of the di-dysprosium derivative 1, while the static magnetic investigation over both pure and the diamagnetic diluted samples of this compound discloses the interionic ferromagnetic coupling between the two dysprosium ions, which in turn effectively suppresses the QTM and enhances the energy barrier of this SMM. Nevertheless, comparative studies over the static magnetic properties of the di-dysprosium triple-decker complexes 1 and 3 indicate the stronger magnetic coupling between the two lanthanide ions in mixed (phthalocyaninato)(Schiff-base) species than in the pure Schiff-base triple-decker analogue, suggesting the special coordination sphere around the dysprosium ions in the former compound over the latter one on the more intense inter-ionic ferromagnetic coupling. As a very small step towards understanding the structure-property relationship, the present result will be surely helpful for the design and synthesis of the multinuclear lanthanide-based SMMs with good properties.

  6. Dicty_cDB: VFL157 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFL157 (Link to dictyBase) - - - Contig-U16169-1 - (Link to Original site) VFL1...57F 530 - - - - - - Show VFL157 Library VF (Link to library) Clone ID VFL157 (Link to dicty...iol.tsukuba.ac.jp/CSM/VF/VFL1-C/VFL157Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VFL157 (VFL157Q) /CSM/VF/VFL1-C/VFL157Q.Seq.d/ CACTGTTGGCCTACTGG...roducing significant alignments: (bits) Value VFL157 (VFL157Q) /CSM/VF/VFL1-C/VFL1

  7. Dicty_cDB: SLB157 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLB157 (Link to dictyBase) - - - - SLB157Z (Link to Original site) - - SLB...157Z 700 - - - - Show SLB157 Library SL (Link to library) Clone ID SLB157 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLB1-C/SLB...157Q.Seq.d/ Representative seq. ID SLB157Z (Link to Original site) R...epresentative DNA sequence >SLB157 (SLB157Q) /CSM/SL/SLB1-C/SLB157Q.Seq.d/ XXXXXXXXXXCGTGATCTTACTGATTACATGAT

  8. Evaluating United States and world consumption of neodymium, dysprosium, terbium, and praseodymium in final products

    Science.gov (United States)

    Hart, Matthew

    This paper develops scenarios of future rare-earth-magnet metal (neodymium, dysprosium, terbium, and praseodymium) consumption in the permanent magnets used in wind turbines and hybrid electric vehicles. The scenarios start with naive base-case scenarios for growth in wind-turbine and hybrid-electric-vehicle sales over the period 2011 to 2020, using historical data for each good. These naive scenarios assume that future growth follows time trends in historical data and does not depend on any exogenous variable. Specifically, growth of each technological market follows historical time trends, and the amount of rare earths used per unit of technology remains fixed. The chosen reference year is 2010. Implied consumptions of the rare earth magnet metals are calculated from these scenarios. Assumptions are made for the material composition of permanent magnets, the market share of permanent-magnet wind turbines and vehicles, and magnet weight per unit of technology. Different scenarios estimate how changes in factors like the material composition of magnets, growth of the economy, and the price of a substitute could affect future consumption. Each scenario presents a different method for reducing rare earth consumption and could be interpreted as potential policy choices. In 2010, the consumption (metric tons, rare-earth-oxide equivalent) of each rare-earth-magnet metal was as follows. Total neodymium consumption in the world for both technologies was 995 tons; dysprosium consumption was 133 tons; terbium consumption was 50 tons; praseodymium consumption was zero tons. The base scenario for wind turbines shows there could be strong, exponential growth in the global wind turbine market. New U.S. sales of hybrid vehicles would decline (in line with the current economic recession) while non-U.S. sales increase through 2020. There would be an overall increase in the total amount of magnetic rare earths consumed in the world. Total consumption of each rare earth in the short

  9. Luminescence features of dysprosium and phosphorus oxide co-doped lithium magnesium borate glass

    Science.gov (United States)

    Hashim, S.; Mhareb, M. H. A.; Ghoshal, S. K.; Alajerami, Y. S. M.; Saripan, M. I.; Bradley, D. A.

    2017-08-01

    Lithium magnesium borate (LMB) glass system co-doped with the oxides of dysprosium (Dy2O3) and phosphorus (P2O5) were synthesized using melt-quenching method. Prepared samples were characterized using various techniques to determine the effects of co-dopants concentration variation on their thermoluminescence (TL) and photoluminescence (PL) properties. TL glow curves of LMB:0.5Dy sample revealed a single prominent peak at Tm=190 °C, where TL intensity was enhanced by a factor of 2.5 with the increase of P2O5 concentration up to 1 mol%. This enhancement was accompanied by a shift in Tm towards higher temperature. Good linearity in the range of 1-100 Gy with linear correlation coefficient of 0.998 was achieved. PL spectra displayed two significant peaks centred at 481 nm and 573 nm. These attractive luminescence features of the proposed glass system may be useful for the development of radiation dosimetry.

  10. Single-molecule magnet behavior for an antiferromagnetically superexchange-coupled dinuclear dysprosium(III) complex.

    Science.gov (United States)

    Long, Jérôme; Habib, Fatemah; Lin, Po-Heng; Korobkov, Ilia; Enright, Gary; Ungur, Liviu; Wernsdorfer, Wolfgang; Chibotaru, Liviu F; Murugesu, Muralee

    2011-04-13

    A family of five dinuclear lanthanide complexes has been synthesized with general formula [Ln(III)(2)(valdien)(2)(NO(3))(2)] where (H(2)valdien = N1,N3-bis(3-methoxysalicylidene)diethylenetriamine) and Ln(III) = Eu(III)1, Gd(III)2, Tb(III)3, Dy(III)4, and Ho(III)5. The magnetic investigations reveal that 4 exhibits single-molecule magnet (SMM) behavior with an anisotropic barrier U(eff) = 76 K. The step-like features in the hysteresis loops observed for 4 reveal an antiferromagnetic exchange coupling between the two dysprosium ions. Ab initio calculations confirm the weak antiferromagnetic interaction with an exchange constant J(Dy-Dy) = -0.21 cm(-1). The observed steps in the hysteresis loops correspond to a weakly coupled system similar to exchange-biased SMMs. The Dy(2) complex is an ideal candidate for the elucidation of slow relaxation of the magnetization mechanism seen in lanthanide systems.

  11. A comparative study of donor formation in dysprosium, holmium, and erbium implanted silicon

    Energy Technology Data Exchange (ETDEWEB)

    Emtsev, V.V.; Emtsev, V.V. Jr.; Poloskin, D.S.; Shek, E.I.; Sobolev, N.A. [Division of Solid State Electronics, Ioffe Physicotechnical Institute, Russian Academy of Sciences, 194021 St. Petersburg (Russian Federation)

    1998-12-01

    Formation of donor centers in Czochralski grown silicon doped with dysprosium, holmium, and erbium is discussed. Donor states of three kinds are introduced in the implanted layers after annealing at T=700C. Shallow donor states with ionization energies between 20 and 40 meV are attributed to oxygen -related thermal donors. Other donor centers in the energy range of E{sub C}-(60...70) meV and E{sub C}-(100...120) meV appear to be dependent on dopants. After a 900C anneal strong changes in the donor formation are observed only in silicon doped with erbium. Instead of donors at E{sub C}-(118{+-}5) meV, new donor centres at E{sub C}-(145{+-}5) meV are formed. Reportedly, the latter ones are involved in the excitation process of the Er{sup 3+} ions with a characteristic luminescence line at {approx}1.54 {mu}m. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

  12. Thermoluminescence properties of lithium magnesium borate glasses system doped with dysprosium oxide.

    Science.gov (United States)

    Mhareb, M H A; Hashim, S; Ghoshal, S K; Alajerami, Y S M; Saleh, M A; Razak, N A B; Azizan, S A B

    2015-12-01

    We report the impact of dysprosium (Dy(3+)) dopant and magnesium oxide (MgO) modifier on the thermoluminescent properties of lithium borate (LB) glass via two procedures. The thermoluminescence (TL) glow curves reveal a single prominent peak at 190 °C for 0.5 mol% of Dy(3+). An increase in MgO contents by 10 mol% enhances the TL intensity by a factor of 1.5 times without causing any shift in the maximum temperature. This enhancement is attributed to the occurrence of extra electron traps created via magnesium and the energy transfer to trivalent Dy(3+) ions. Good linearity in the range of 0.01-4 Gy with a linear correlation coefficient of 0.998, fading as low as 21% over a period of 3 months, excellent reproducibility without oven annealing and tissue equivalent effective atomic numbers ~8.71 are achieved. The trap parameters, including geometric factor (μg), activation energy (E) and frequency factor (s) associated with LMB:Dy are also determined. These favorable TL characteristics of prepared glasses may contribute towards the development of Li2O-MgO-B2O3 radiation dosimeters.

  13. Optical properties of zinc borotellurite glass doped with trivalent dysprosium ion

    Science.gov (United States)

    Ami Hazlin, M. N.; Halimah, M. K.; Muhammad, F. D.; Faznny, M. F.

    2017-04-01

    The zinc borotellurite doped with dysprosium oxide glass samples with chemical formula {[(TeO2) 0 . 7(B2O3) 0 . 3 ] 0 . 7(ZnO) 0 . 3 } 1 - x(Dy2O3)x (where x=0.01, 0.02, 0.03, 0.04 and 0.05 M fraction) were prepared by using conventional melt quenching technique. The structural and optical properties of the proposed glass systems were characterized by using X-ray diffraction (XRD) spectroscopy, Fourier Transform Infrared (FTIR) spectroscopy, and UV-VIS spectroscopy. The amorphous nature of the glass systems is confirmed by using XRD technique. The infrared spectra of the glass systems indicate three obvious absorption bands which are assigned to BO3 and TeO4 vibrational groups. Based on the absorption spectra obtained, the direct and indirect optical band gaps, as well as the Urbach energy were calculated. It is observed that both the direct and indirect optical band gaps increase with the concentration of Dy3+ ions. On the other hand, the Urbach energy is observed to decrease as the concentration of Dy3+ ions increases.

  14. Isolation of {sup 163}Ho from dysprosium target material by HPLC for neutrino mass measurements

    Energy Technology Data Exchange (ETDEWEB)

    Mocko, Veronika; Taylor, Wayne A.; Nortier, Francois M.; Engle, Jonathan W.; Pollington, Anthony D.; Kunde, Gerd J.; Rabin, Michael W.; Birnbaum, Eva R. [Los Alamos National Laboratory, Los Alamos, NM (United States). Chemistry Div.; Barnhart, Todd E.; Nickles, Robert J. [Univ. Wisconsinn, Madison, WI (United States). Dept. of Medical Physics

    2015-07-01

    The rare earth isotope {sup 163}Ho is of interest for neutrino mass measurements. This report describes the isolation of {sup 163}Ho from a proton-irradiated dysprosium target and its purification. A Dy metal target was irradiated with 16 MeV protons for 10 h. After target dissolution, {sup 163}Ho was separated from the bulk Dy via cation-exchange high performance liquid chromatography using 70 mmol dm{sup -3} α-hydroxyisobutyric acid as the mobile phase. Subsequent purification of the collected Ho fraction was performed to remove the α-hydroxyisobutyrate chelating agent and to concentrate the Ho in a low ionic strength aqueous matrix. The final solution was characterized by MC-ICP-MS to determine the {sup 163}Ho/{sup 165}Ho ratio, {sup 163}Ho and the residual Dy content. The HPLC purification process resulted in a decontamination factor 1.4 x 10{sup 5} for Dy. The isolated Ho fraction contained 24.8 ± 1.3 ng of {sup 163}Ho corresponding to holmium recovery of 72 ± 3%.

  15. Dicty_cDB: CHF157 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF157 (Link to dictyBase) - - - Contig-U15817-1 CHF157P (Link to Original site) CHF1...57F 676 CHF157Z 644 CHF157P 1300 - - Show CHF157 Library CH (Link to library) Clone ID CHF1...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHF1-C/CHF157Q.Seq.d/ Representative seq. ID CHF1...57P (Link to Original site) Representative DNA sequence >CHF157 (CHF157Q) /CSM/CH/CHF1-C/CHF1...s producing significant alignments: (bits) Value CHF157 (CHF157Q) /CSM/CH/CHF1-C/CHF157Q.Seq.d/ 2272 0.0 VHC

  16. 18 CFR 157.37 - Project design.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Project design. 157.37... Seasons for Alaska Natural Gas Transportation Projects § 157.37 Project design. In reviewing any... proposed project has been designed to accommodate the needs of shippers who have made conforming...

  17. Prevalence of Escherichia coli O157

    NARCIS (Netherlands)

    Abdissa, Rosa; Haile, Woynshet; Fite, Akafete Teklu; Beyi, Ashenafi Feyisa; Agga, Getahun E.; Edao, Bedaso Mammo; Tadesse, Fanos; Korsa, Mesula Geloye; Beyene, Takele; Beyene, Tariku Jibat; Zutter, De Lieven; Cox, Eric; Goddeeris, Bruno Maria

    2017-01-01

    Background: There is paucity of information regarding the epidemiology of Escherichia coli O157: H7 in developing countries. In this study, we investigated the occurrence of E. coli O157: H7 associated with beef cattle at processing plants and at retail shops in Ethiopia. Methods: Various samples

  18. Dicty_cDB: VHL157 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHL157 (Link to dictyBase) - - - - VHL157P (Link to Original site) VHL157F 569 VHL1...57Z 721 VHL157P 1270 - - Show VHL157 Library VH (Link to library) Clone ID VHL157 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHL1...-C/VHL157Q.Seq.d/ Representative seq. ID VHL157P (Link to... Original site) Representative DNA sequence >VHL157 (VHL157Q) /CSM/VH/VHL1-C/VHL157Q.Seq.d/ AACTCTCGAGTGCAAA

  19. Dicty_cDB: CHR157 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR157 (Link to dictyBase) - - - Contig-U16259-1 - (Link to Original site) CHR...157F 616 - - - - - - Show CHR157 Library CH (Link to library) Clone ID CHR157 (Link to dicty...iol.tsukuba.ac.jp/CSM/CH/CHR1-C/CHR157Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >CHR157 (CHR157Q) /CSM/CH/CHR1-C/CHR157Q.Seq.d/ ATTTTTATTAAAATTAA...NA Score E Sequences producing significant alignments: (bits) Value N AC116305 |AC116305.2 Dictyostelium discoideum chr

  20. Acute dysprosium toxicity to Daphnia pulex and Hyalella azteca and development of the biotic ligand approach.

    Science.gov (United States)

    Vukov, Oliver; Smith, D Scott; McGeer, James C

    2016-01-01

    The toxicological understanding of rare earth elements (REEs) in the aquatic environment is very limited but of increasing concern. The objective of this research is to compare the toxicological effect of the REE dysprosium to the freshwater invertebrates Daphnia pulex and Hyalella azteca and in the more sensitive organism, understand the toxicity modifying influence of Ca, Na, Mg, pH and dissolved organic matter (DOM). Standard methods (Environment Canada) were followed for testing and culture in media of intermediate hardness (60mg CaCO3 mg/L) at pH 7.8 with Ca at 0.5, Na 0.5, Mg 0.125 (mM) and 23°C. Acute toxicity tests were done with azteca and D. pulex revealed Hyalella to be 1.4 times more sensitive than Daphnia. Additions of Ca and Na but not Mg provided significant protection against Dy toxicity to Hyalella. Similarly, low pH was associated with reduction in toxicity. Exposures which were pH buffered with and without MOPS were significantly different and indicated that MOPS enhanced Dy toxicity. DOM also mitigated Dy toxicity. Biotic ligand based parameters (LogK values) were calculated based on free ion relationships as determined by geochemical equilibrium modeling software (WHAM ver. 7.02). The logK value for Dy(3+) toxicity to Hyalella was 7.75 while the protective influence of Ca and Na were 3.95 and 4.10, respectively. This study contributes data towards the development of site specific water quality guidelines and criteria for Dy and possibly REEs in general and offers insight into the complex bio-geochemical nature of this element.

  1. Optical trapping of ultracold dysprosium atoms: transition probabilities, dynamic dipole polarizabilities and van der Waals C 6 coefficients

    Science.gov (United States)

    Li, H.; Wyart, J.-F.; Dulieu, O.; Nascimbène, S.; Lepers, M.

    2017-01-01

    The efficiency of the optical trapping of ultracold atoms depends on the atomic dynamic dipole polarizability governing the atom-field interaction. In this article, we have calculated the real and imaginary parts of the dynamic dipole polarizability of dysprosium in the ground and first excited levels. Due to the high electronic angular momentum of those two states, the polarizabilities possess scalar, vector and tensor contributions that we have computed, on a wide range of trapping wavelengths, using the sum-over-state formula. Using the same formalism, we have also calculated the C 6 coefficients characterizing the van der Waals interaction between two dysprosium atoms in the two lowest levels. We have computed the energies of excited states and the transition probabilities appearing in the sums, using a combination of ab initio and least-square-fitting techniques provided by the Cowan codes and extended in our group. Regarding the real part of the polarizability, for field frequencies far from atomic resonances, the vector and tensor contributions are two-orders-of-magnitude smaller than the scalar contribution, whereas for the imaginary part, the vector and tensor contributions represent a noticeable fraction of the scalar contribution. Finally, our anisotropic C 6 coefficients are much smaller than those published in the literature.

  2. 42 CFR 422.157 - Accreditation organizations.

    Science.gov (United States)

    2010-10-01

    ....157 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES... accreditation no longer provides assurance that the Medicare requirements are met or exceeded. (3) Onsite..., auditing meetings concerning the accreditation process, evaluating survey results or the...

  3. 33 CFR 157.35 - Ballast added to cargo tanks.

    Science.gov (United States)

    2010-07-01

    ... segregated ballast tanks or dedicated clean ballast tanks under § 157.09, § 157.10, § 157.10a(a)(1), § 157...; (b) More ballast water than can be carried in segregated ballast tanks or dedicated clean ballast... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Ballast added to cargo tanks....

  4. Acute dysprosium toxicity to Daphnia pulex and Hyalella azteca and development of the biotic ligand approach

    Energy Technology Data Exchange (ETDEWEB)

    Vukov, Oliver, E-mail: vuko3930@mylaurier.ca [Biology Department, Wilfrid Laurier University, Waterloo, Ontario N2L 3C5 (Canada); Smith, D. Scott [Chemistry Department, Wilfrid Laurier University, Waterloo, Ontario N2L 3C5 (Canada); McGeer, James C. [Biology Department, Wilfrid Laurier University, Waterloo, Ontario N2L 3C5 (Canada)

    2016-01-15

    The toxicological understanding of rare earth elements (REEs) in the aquatic environment is very limited but of increasing concern. The objective of this research is to compare the toxicological effect of the REE dysprosium to the freshwater invertebrates Daphnia pulex and Hyalella azteca and in the more sensitive organism, understand the toxicity modifying influence of Ca, Na, Mg, pH and dissolved organic matter (DOM). Standard methods (Environment Canada) were followed for testing and culture in media of intermediate hardness (60 mg CaCO{sub 3} mg/L) at pH 7.8 with Ca at 0.5, Na 0.5, Mg 0.125 (mM) and 23 °C. Acute toxicity tests were done with <24 h old neonates for 48 h in the case of D. pulex and with 2–9 days old offspring for 96 h tests with Hyalella. The potential protective effect of cationic competition was tested with Ca (0.5–2.0 mM), Na (0.5–2.0 mM) and Mg (0.125–0.5 mM). The effect of pH (6.5–8.0) and Suwannee River DOM complexation (at dissolved organic carbon (DOC) concentrations of 9 and 13 mg C/L) were evaluated. Dissolved Dy concentrations were lower than total (unfiltered) indicating precipitation, particularly at higher concentrations. Acute toxicity of Dy to H. azteca and D. pulex revealed Hyalella to be 1.4 times more sensitive than Daphnia. Additions of Ca and Na but not Mg provided significant protection against Dy toxicity to Hyalella. Similarly, low pH was associated with reduction in toxicity. Exposures which were pH buffered with and without MOPS were significantly different and indicated that MOPS enhanced Dy toxicity. DOM also mitigated Dy toxicity. Biotic ligand based parameters (Log K values) were calculated based on free ion relationships as determined by geochemical equilibrium modeling software (WHAM ver. 7.02). The log K value for Dy{sup 3+} toxicity to Hyalella was 7.75 while the protective influence of Ca and Na were 3.95 and 4.10, respectively. This study contributes data towards the development of site specific

  5. White light emission of dysprosium doped lanthanum calcium phosphate oxide and oxyfluoride glasses

    Science.gov (United States)

    Luewarasirikul, N.; Kim, H. J.; Meejitpaisan, P.; Kaewkhao, J.

    2017-04-01

    Lanthanum calcium phosphate oxide and oxyfluoride glasses doped with dysprosium oxide were prepared by melt-quenching technique with chemical composition 20La2O3:10CaO:69P2O5:1Dy2O3 and 20La2O3:10CaF2:69P2O5:1Dy2O3. The physical, optical and luminescence properties of the glass samples were studied to evaluate their potential to using as luminescence materials for solid-state lighting applications. The density, molar volume and refractive index of the glass samples were carried out. The optical and luminescence properties were studied by investigating absorption, excitation, and emission spectra of the glass samples. The absorption spectra were investigated in the UV-Vis-NIR region from 300 to 2000 nm. The excitation spectra observed under 574 nm emission wavelength showed the highest peak centered at 349 nm (6H15/2 → 6P7/2). The emission spectra, excited with 349 nm excitation wavelength showed two major peaks corresponding to 482 nm blue emission (4F9/2 → 6H15/2) and 574 nm yellow emission (4F9/2 → 6H13/2). The experimental lifetime were found to be 0.539 and 0.540 for oxide and oxyfluoride glass sample, respectively. The x,y color coordinates under 349 nm excitation wavelength were (0.38, 0.43) for both glass samples, that be plotted in white region of CIE 1931 chromaticity diagram. The CCT values obtained from the glass samples are 4204 K for oxide glass and 4228 K for oxyfluoride glass corresponding to the commercial cool white light (3100-4500 K). Judd-Ofelt theory had also been employed to obtain the J-O parameters (Ω2, Ω4 and Ω6), oscillator strength, radiative transition possibility, stimulated emission cross section and branching ratio. The Ω2 > Ω4 > Ω6 trend of J-O parameters of both glass samples may indicate the good quality of a glass host for using as optical device application. Temperature dependence of emission spectra was studied from 300 K to 10 K and found that the intensity of the emission peak was found to be increased with

  6. Limits on violations of Lorentz symmetry and the Einstein equivalence principle using radio-frequency spectroscopy of atomic dysprosium.

    Science.gov (United States)

    Hohensee, M A; Leefer, N; Budker, D; Harabati, C; Dzuba, V A; Flambaum, V V

    2013-08-02

    We report a joint test of local Lorentz invariance and the Einstein equivalence principle for electrons, using long-term measurements of the transition frequency between two nearly degenerate states of atomic dysprosium. We present many-body calculations which demonstrate that the energy splitting of these states is particularly sensitive to violations of both special and general relativity. We limit Lorentz violation for electrons at the level of 10(-17), matching or improving the best laboratory and astrophysical limits by up to a factor of 10, and improve bounds on gravitational redshift anomalies for electrons by 2 orders of magnitude, to 10(-8). With some enhancements, our experiment may be sensitive to Lorentz violation at the level of 9 × 10(-20).

  7. Nonlinear optical properties of lutetium and dysprosium bisphthalocyanines at 1550 nm with femto- and nanosecond pulse excitation

    Science.gov (United States)

    Plekhanov, A. I.; Basova, T. V.; Parkhomenko, R. G.; Gürek, A. G.

    2017-02-01

    In this work, the nonlinear optical properties of unsubstituted lutetium (LuPc2) and dysprosium (DyPc2) bisphthalocyanines as well as octasubstituted Lu(PcR8)2 derivative with R=-S(C6H13) were studied at a wavelength of 1550 nm with 10 ns and 300 fs pulses. Based on Z-scan measurements the nonlinear absorption and refraction coefficient as well as the nature of nonlinear optical properties were analyzed for these materials. Open aperture Z-scan indicates strong two-photon absorption in all three bisphthalocyanines in nano- and femtosecond regimes. With good nonlinear optical coefficients, bisphthalocyanines of rare earth elements are expected to be promising materials for the creation of optical limiters.

  8. Spectroscopic data of the 1.8-, 2.9-, and 4.3- mu m transitions in dysprosium-doped gallium lanthanum sulfide glass

    Science.gov (United States)

    Schweizer, T.; Hewak, D. W.; Samson, B. N.; Payne, D. N.

    1996-10-01

    Infrared emission at 1.8, 2.9, and 4.3 mu m is measured in dysprosium-doped gallium lanthanum sulfide (Ga:La:S) glass excited at 815 nm. Emission cross sections were calculated by Judd-Ofelt analysis, the Fuchtbauer-Ladenburg equation, and the theory of McCumber. The sigma tau value for the 4.3- mu m transition is \\similar 4000 times larger in the Ga:La:S glass than in a dysprosium-doped LiYF4 crystal, which has lased on this transition. The large sigma tau value and the recently reported ability of Ga:La:S glass to be fabricated into fiber form show the potential for an efficient, low-threshold mid-infrared fiber laser. The fluorescence peak at 4.3 mu m coincides with the fundamental absorption of atmospheric carbon dioxide, making the glass a potential laser source for gas-sensing applications.

  9. Spectroscopic data of the 1.8-, 2.9-, and 4.3-microm transitions in dysprosium-doped gallium lanthanum sulfide glass.

    Science.gov (United States)

    Schweizer, T; Hewak, D W; Samson, B N; Payne, D N

    1996-10-01

    Infrared emission at 1.8, 2.9, and 4.3 microm is measured in dysprosium-doped gallium lanthanum sulfide (Ga:La:S) glass excited at 815 nm. Emission cross sections were calculated by Judd-Ofelt analysis, the Füchtbauer- Ladenburg equation, and the theory of McCumber. The sigmatau value for the 4.3-microm transition is ~4000 times larger in the Ga:La:S glass than in a dysprosium-doped LiYF(4) crystal, which has lased on this transition. The large sigmatau value and the recently reported ability of Ga:La:S glass to be fabricated into fiber form show the potential for an efficient, low-threshold mid-infrared fiber laser. The f luorescence peak at 4.3 microm coincides with the fundamental absorption of atmospheric carbon dioxide, making the glass a potential laser source for gas-sensing applications.

  10. On-line complexation/cloud point preconcentration for the sensitive determination of dysprosium in urine by flow injection inductively coupled plasma-optical emission spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Ortega, Claudia; Cerutti, Soledad; Silva, Maria F. [Departamento de Quimica Analitica, Facultad de Quimica, Bioquimica y Farmacia, Universidad Nacional de San Luis, Chacabuco y Pedernera, 5700, San Luis (Argentina); Olsina, Roberto A.; Martinez, Luis D. [Departamento de Quimica Analitica, Facultad de Quimica, Bioquimica y Farmacia, Universidad Nacional de San Luis, Chacabuco y Pedernera, 5700, San Luis (Argentina); Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Avda. Rivadavia 1917, CP C1033AAJJ, Buenos Aires (Argentina)

    2003-01-01

    An on-line dysprosium preconcentration and determination system based on the hyphenation of cloud point extraction (CPE) to flow injection analysis (FIA) associated with ICP-OES was studied. For the preconcentration of dysprosium, a Dy(III)-2-(5-bromo-2-pyridylazo)-5-diethylaminophenol complex was formed on-line at pH 9.22 in the presence of nonionic micelles of PONPE-7.5. The micellar system containing the complex was thermostated at 30 C in order to promote phase separation, and the surfactant-rich phase was retained in a microcolumn packed with cotton at pH 9.2. The surfactant-rich phase was eluted with 4 mol L{sup -1} nitric acid at a flow rate of 1.5 mL min{sup -1}, directly in the nebulizer of the plasma. An enhancement factor of 50 was obtained for the preconcentration of 50 mL of sample solution. The detection limit value for the preconcentration of 50 mL of aqueous solution of Dy was 0.03 {mu}g L{sup -1}. The precision for 10 replicate determinations at the 2.0 {mu}g L{sup -1}Dy level was 2.2% relative standard deviation (RSD), calculated from the peak heights obtained. The calibration graph using the preconcentration system for dysprosium was linear with a correlation coefficient of 0.9994 at levels near the detection limits up to at least 100 {mu}g L {sup -1}. The method was successfully applied to the determination of dysprosium in urine. (orig.)

  11. Escherichia coli O157:H7.

    Science.gov (United States)

    Mead, P S; Griffin, P M

    1998-10-10

    Escherichia coli O157 was first identified as a human pathogen in 1982. One of several Shiga toxin-producing serotypes known to cause human illness, the organism probably evolved through horizontal acquisition of genes for Shiga toxins and other virulence factors. E. coli O157 is found regularly in the faeces of healthy cattle, and is transmitted to humans through contaminated food, water, and direct contact with infected people or animals. Human infection is associated with a wide range of clinical illness, including asymptomatic shedding, non-bloody diarrhoea, haemorrhagic colitis, haemolytic uraemic syndrome, and death. Since laboratory practices vary, physicians need to know whether laboratories in their area routinely test for E. coli O157 in stool specimens. Treatment with antimicrobial agents remains controversial: some studies suggest that treatment may precipitate haemolytic uraemic syndrome, and other studies suggest no effect or even a protective effect. Physicians can help to prevent E. coli O157 infections by counselling patients about the hazards of consuming undercooked ground meat or unpasteurised milk products and juices, and about the importance of handwashing to prevent the spread of diarrhoeal illness, and by informing public-health authorities when they see unusual numbers of cases of bloody diarrhoea or haemolytic uraemic syndrome.

  12. 18 CFR 157.216 - Abandonment.

    Science.gov (United States)

    2010-04-01

    ... OF ENERGY REGULATIONS UNDER NATURAL GAS ACT APPLICATIONS FOR CERTIFICATES OF PUBLIC CONVENIENCE AND... in § 157.203(b), provided the certificate holder obtains the written consent of each customer served... abandon: (1) Any receipt or delivery point if all of the existing customers of the pipeline served...

  13. 18 CFR 157.207 - General reporting requirements.

    Science.gov (United States)

    2010-04-01

    ... CONVENIENCE AND NECESSITY AND FOR ORDERS PERMITTING AND APPROVING ABANDONMENT UNDER SECTION 7 OF THE NATURAL... specified in § 157.217(b); (g) For each change in customer name authorized under § 157.218, the...

  14. Presence of Escherichia coli O157 and O157:H7 in raw milk and Van herby cheese

    Directory of Open Access Journals (Sweden)

    Sancak Yakup Can

    2015-12-01

    Full Text Available The Shiga toxin-producing Escherichia coli (STEC strains are currently considered important emerging pathogens threatening public health. Among Shiga toxin-producing Escherichia coli, E. coli O157:H7 strains have emerged as important human pathogens. This study was conducted to determine the presence of Escherichia coli O157 and O157:H7 in raw milk samples and Van herby cheese samples. For this purpose, 100 samples of raw milk were collected and 100 samples of herby cheese sold for consumption in Van province in Turkey were obtained from grocers and markets in order to detect the presence of Escherichia coli O157 and O157:H7. The method of E. coli O157 and O157:H7 isolation proposed by the Food and Drug Administration (FDA was used. E. coli O157 in raw milk and herby cheese samples was found in 11% and 6% of samples respectively, and E. coli O157:H7 was found in 2% of herby cheese samples. No E. coli O157:H7 was detected in raw milk samples. This study showed that raw milk was contaminated with E. coli O157 and herby cheese was contaminated with both E. coli O157 and E. coli O157:H7; therefore, herby cheese poses a serious risk to public health.

  15. 15 CFR 930.157 - Mediation and informal negotiations.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Mediation and informal negotiations. 930.157 Section 930.157 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade... Activities Having Interstate Coastal Effects § 930.157 Mediation and informal negotiations. The...

  16. 49 CFR 37.157-37.159 - [Reserved

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false 37.157-37.159 Section 37.157-37.159 Transportation Office of the Secretary of Transportation TRANSPORTATION SERVICES FOR INDIVIDUALS WITH DISABILITIES (ADA) Paratransit as a Complement to Fixed Route Service §§ 37.157-37.159...

  17. 33 CFR 157.47 - Information for master.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Information for master. 157.47 Section 157.47 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... Vessel Operation § 157.47 Information for master. A master or person in charge of a new vessel...

  18. 21 CFR 131.157 - Light whipping cream.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Light whipping cream. 131.157 Section 131.157 Food... HUMAN CONSUMPTION MILK AND CREAM Requirements for Specific Standardized Milk and Cream § 131.157 Light whipping cream. (a) Description. Light whipping cream is cream which contains not less than 30 percent...

  19. 46 CFR 45.157 - Scuppers and gravity drains.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 2 2010-10-01 2010-10-01 false Scuppers and gravity drains. 45.157 Section 45.157 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) LOAD LINES GREAT LAKES LOAD LINES Conditions of Assignment § 45.157 Scuppers and gravity drains. Scuppers and gravity deck drains from...

  20. TRUPACT-II 157 Examination Report

    Energy Technology Data Exchange (ETDEWEB)

    Barry H. O& #39; Brien; Jeffrey M. Lacy; Kip E. Archibald

    2003-12-01

    This report presents the results of examination and recovery activities performed on the TRUPACT-II 157 shipping container. The container was part of a contact-handled transuranic waste shipment being transported on a truck to the Waste Isolation Pilot Plant in New Mexico when an accident occurred. Although the transport vehicle sustained only minor damage, airborne transuranic contamination was detected in air samples extracted from inside TRUPACT-II 157 at the Waste Isolation Pilot Plant. Consequently, the shipping container was rejected, resealed, and returned to the Idaho National Engineering and Environmental Laboratory where the payload was disassembled, examined, and recovered for subsequent reshipment to the Waste Isolation Pilot Plant. This report documents the results of those activities.

  1. Synthesis and Crystal Structure of Tri-(2-mercaptopyridine N-oxide)bis(dimethyl sulfoxide) Dysprosium(Ⅲ)

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    A range of rare earth metal complexes of 2-mercaptopyridine N-oxide (Hmpo) have been synthesized, and studied by elemental analysis and IR spectroscopic technique. Crystal structure of Dy(mpo)3(DMSO)2 (DMSO = dimethyl sulfoxide) has been determined. The complex crystallizes in the triclinic system, space group Pī with lattice parameters: a = 9.602(3), b = 9.803(3), c = 15.498(5)A, α= 89.51(1), β= 85.73(1), γ= 62.99(1)°, Dc = 1.787 g/cm3, C19H24N3O5S5Dy, Mr = 697.21, Z = 2, F(000) = 690, μ = 3.321mm-1, the final R = 0.0237 and wR = 0.0587 for 4116 reflections with I>σ2(I). The coordination number of dysprosium Ⅲ is eight, and its coordination geometry is a somewhat distorted square antiprism with O(3), O(4), O(5), S(3) and O(1), O(2), S(1), S(2) at the tetragonal bases (dihedral angle between their mean planes is 2.9(1)0). Around the Dy atom, three five-membered ring planes (Dy, O, N, C, S) make the dihedral angles of 74.42, 11.31 and 83.72, respectively.

  2. Photo-, cathodo- and thermoluminescent properties of dysprosium-doped HfO2 films deposited by ultrasonic spray pyrolysis.

    Science.gov (United States)

    Manríquez, R Reynoso; Góngora, J A I Díaz; Guzmán-Mendoza, J; Montalvo, T Rivera; Olguín, J C Guzmán; Ramírez, P V Cerón; García-Hipólito, M; Falcony, C

    2014-09-01

    In this work, the photoluminescent (PL), cathodoluminescent (CL) and thermoluminescent (TL) properties of hafnium oxide films doped with trivalent dysprosium ions are reported. The films were deposited on glass substrates at temperatures ranging from 300 to 600°C, using chlorides as precursor reagents. The surface morphology of films showed a veins shaped microstructure at low deposition temperatures, while at higher temperatures the formation of spherical particles was observed on the surface. X-ray diffraction showed the presence of HfO2 monoclinic phase in the films deposited at temperatures greater than 400°C. The PL and CL spectra of the doped films showed the highest emission band centered at 575nm corresponding to the transitions (4)F9/2→(6)H13/2, which is a characteristic transition of Dy(3+) ion. The greatest emission intensities were observed in samples doped with 1 atomic percent (at%) of DyCl3 in the precursor solution. Regarding the TL behavior, the glow curve of HfO2:Dy(+3) films exhibited spectrum with one broad band centered at about 150°C. The highest intensity TL response was observed on the films deposited at 500°C. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Workplace testing of the new single sphere neutron spectrometer based on Dysprosium activation foils (Dy-SSS)

    Science.gov (United States)

    Bedogni, R.; Gómez-Ros, J. M.; Esposito, A.; Gentile, A.; Chiti, M.; Palacios-Pérez, L.; Angelone, M.; Tana, L.

    2012-08-01

    A photon insensitive passive neutron spectrometer consisting of a single moderating polyethylene sphere with Dysprosium activation foils arranged along three perpendicular axes was designed by CIEMAT and INFN. The device is called Dy-SSS (Dy foil-based Single Sphere Spectrometer). It shows nearly isotropic response in terms of neutron fluence up to 20 MeV. The first prototype, previously calibrated with 14 MeV neutrons, has been recently tested in workplaces having different energy and directional distributions. These are a 2.5 MeV nearly mono-chromatic and mono-directional beam available at the ENEA Frascati Neutron Generator (FNG) and the photo-neutron field produced in a 15 MV Varian CLINAC DHX medical accelerator, located in the Ospedale S. Chiara (Pisa). Both neutron spectra are known through measurements with a Bonner Sphere Spectrometer. In both cases the experimental response of the Dy-SSS agrees with the reference data. Moreover, it is demonstrated that the spectrometric capability of the new device are independent from the directional distribution of the neutron field. This opens the way to a new generation of moderation-based neutron instruments, presenting all advantages of the Bonner sphere spectrometer without the disadvantage of the repeated exposures. This concept is being developed within the NESCOFI@BTF project of INFN (Commissione Scientifica Nazionale 5).

  4. Ferroelectric properties of dysprosium-doped Bi4Ti3O12 thin films crystallized in various atmospheres

    Institute of Scientific and Technical Information of China (English)

    CHENG Chuan-pin; TANG Ming-hua; YE Zhi; ZHOU Yic-hun; ZHENG Xue-jun; ZHONG Xiang-li; HU Zeng-shun

    2006-01-01

    Dysprosium-doped Bi4Ti3O12 (Bi3.4Dy0.6Ti3O12,BDT) ferroelectric thin films were deposited on Pt(111)/Ti/SiO2/Si(111) substrates by chemical solution deposition (CSD) and crystallized in nitrogen,air and oxygen atmospheres,respectively. X-ray diffraction (XRD) and scanning electron microscopy (SEM) were used to identify the crystal structure,the surface and cross-section morphology of the deposited ferroelectric films. The results show that the crystallization atmosphere has significant effect on determining the crystallization and ferroelectric properties of the BDT films. The film crystallized in nitrogen at a relatively low temperature of 650 ℃,exhibits excellent crystallinity and ferroelectricity with a remanent polarization of 2Pr = 24.9 μC/cm2 and a coercive field of 144.5 kV/cm. While the films annealed in air and oxygen at 650 ℃ do not show good crystallinity and ferroelectricity until they are annealed at 700 ℃. The structure evolution and ferroelectric properties of BDT thin films annealed under different temperatures (600-750 ℃) were also investigated. The crystallinity of the BDT films is improved and the average grain size increases when the annealing temperature increases from 600 ℃ to 750 ℃ at an interval of 50 ℃. However,the polarization of the films is not monotonous function of the annealing temperature.

  5. Reference: 157 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 157 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u15659096i Chen Gu et al. 2005 Fe...Y1 metalloprotease is required for chloroplast development and, hence, a defectiv...e EGY1 gene has pleiotropic effects both on chloroplast development and on ethylene-dependent gravitropism o...uired for chloroplast development. 3 364-75 15659096 2005 Feb The Plant journal Bi Yu Rong|Chen Gu|Li Ning

  6. Shape Co-Existence in the Transitional Nuclide 157Yb

    Institute of Scientific and Technical Information of China (English)

    徐川; 华辉; 李湘庆; 张双全; 许甫荣; 石跃; 竺礼华; 吴晓光; 李广生; 贺创业

    2012-01-01

    High-spin states in 157Yb have been populated in the 144Sm(160, 3n)157yb fusion- evaporation reaction at a beam energy of 85 MeV, and two rotational bands have been established for the first time. Within the framework of the triaxial particle-rotor model, the energy spectra and single-particle configurations of 157Yb are investigated. The calculated energy spectra agree well with the experimental data. The newly observed vf7/2 band, and the previously known vi13/2 band in 157Yb, are also discussed by means of Total-Routhian-Surface methods. The structural characters observed in 157Yb provide evidence for the shape coexistence of three distinct shapes: prolate, triaxial and oblate. At higher spins, both the vf7/2 band and the vi13/2 band in 157Yb undergo a shape evolution with sizable alignments occurring.

  7. Sensitive search for the temporal variation of the fine structure constant using radio-frequency E1 transitions in atomic dysprosium

    CERN Document Server

    Nguyen, A T; Lamoreaux, S K; Torgerson, J R

    2003-01-01

    It has been proposed that the radio-frequency electric-dipole (E1) transition between two nearly degenerate opposite-parity states in atomic dysprosium should be highly sensitive to possible temporal variation of the fine structure constant ($\\alpha$) [V. A. Dzuba, V. V. Flambaum, and J. K. Webb, Phys. Rev. A {\\bf 59}, 230 (1999)]. We discuss here an experimental realization of the proposed search, which involves monitoring the E1 transition frequency over a period of time using direct frequency counting techniques. We estimate that a statistical sensitivity of $|\\adota| \\sim 10^{-18}$/yr may be achieved and discuss possible systematic effects in such a measurement.

  8. 33 CFR 157.300 - Qualifications for exemptions under this part.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Qualifications for exemptions under this part. 157.300 Section 157.300 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF... VESSELS CARRYING OIL IN BULK Exemption From § 157.10a or § 157.10c § 157.300 Qualifications...

  9. Photoresist outgassing at 157 nm exposure

    Science.gov (United States)

    Hien, Stefan; Angood, Steve; Ashworth, Dominic; Basset, Steve; Bloomstein, Theodore M.; Dean, Kim R.; Kunz, Roderick R.; Miller, Daniel A.; Patel, Shashikant; Rich, Georgia K.

    2001-08-01

    Contamination of optical elements during photoresist exposure is a serious issue in optical lithography. The outgassing of photoresist has been identified as a problem at 248nm and 193nm in production because the organic films that can be formed on an exposure lens can cause transmission loss and sever image distortion. At these exposure energies, the excitation of the photo acid generator, formation of acid, and cleavage of the protecting group are highly selective processes. At 157nm, the exposure energy is much higher (7.9 eV compared to 6.4 eV at 193nm) and it is known from laser ablation experiments that direct laser cleavage of sigma bonds occurs. The fragments formed during this irradiation can be considered as effective laser deposition precursors even in the mid ppb level. In this study, methods to quantify photoresist outgassing at 157 nm are discussed. Three criteria have been set up at International SEMATECH to protect lens contamination and to determine the severity of photoresist outgassing. First, we measured film thickness loss as a function of exposure dose for a variety of materials. In a second test we studied the molecular composition of the outgassing fragments with an exposure chamber coupled to a gas chromatograph and a mass spectrometer detector. Our third method was a deposition test of outgassing vapors on a CaF2 proof plate followed by analysis using VUV and X-ray photoelectron spectroscopies (XPS). With this technique we found deposits for many different resists. Our main focus is on F- and Si- containing resists. Both material classes form deposits especially if these atoms are bound to the polymer side chains. Whereas the F-containing films can be cleaned off under 157nm irradiation, cleaning of Si-containing films mainly produces SiO2. Our cleaning studies of plasma deposited F-containing organic films on SiO2 did not indicate damage of this surface by the possible formation of HF. Despite that we strongly recommend engineering

  10. Dysprosium doping induced shape and magnetic anisotropy of Fe3-xDyxO4 (x=0.01-0.1) nanoparticles

    Science.gov (United States)

    Jain, Richa; Luthra, Vandna; Gokhale, Shubha

    2016-09-01

    The effect of dysprosium doping on evolution of structural and magnetic properties of magnetite (Fe3O4) nanoparticles is reported. A standard route of co-precipitation was used for the synthesis of undoped and doped magnetite nanoparticles Fe3-xDyxO4 (x=0.0-0.1). Transmission electron microscopy (TEM) shows formation of round shaped particles with diameter in the range of 8-14 nm for undoped sample. On doping beyond x=0.01, the formation of rod like structures is initiated along with the round shaped particles. The number of rods is found to increase with increasing doping concentration. Magnetic characterization using Vibrating Sample Magnetometer (VSM) revealed doping dependent magnetic properties which can be correlated with the crystallite size as determined from X-ray diffraction (XRD). Enhancement in the saturation magnetization in the initial stages of doping can be explained on the basis of incorporation of Dy3+ ions in the inverse spinel structure at the octahedral site in place of Fe3+ ions. Subsequent decrease in saturation magnetization observed beyond x=0.03 could be attributed to precipitation of excess Dy in form of dysprosium ferrite phase.

  11. 19 CFR 122.157 - Documents required for clearance.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Documents required for clearance. 122.157 Section 122.157 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT... clearance. As a condition precedent to clearance, the aircraft commander shall present to Customs: (a)...

  12. 33 CFR 157.455 - Minimum under-keel clearance.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Minimum under-keel clearance. 157... § 157.455 Minimum under-keel clearance. (a) The owner or operator of a tankship, that is not fitted with... written under-keel clearance guidance that includes— (1) Factors to consider when calculating the...

  13. 33 CFR 157.15 - Slop tanks in tank vessels.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Slop tanks in tank vessels. 157... (CONTINUED) POLLUTION RULES FOR THE PROTECTION OF THE MARINE ENVIRONMENT RELATING TO TANK VESSELS CARRYING OIL IN BULK Design, Equipment, and Installation § 157.15 Slop tanks in tank vessels. (a) Number....

  14. 33 CFR 157.204 - Letter of acceptance.

    Science.gov (United States)

    2010-07-01

    ...) POLLUTION RULES FOR THE PROTECTION OF THE MARINE ENVIRONMENT RELATING TO TANK VESSELS CARRYING OIL IN BULK Dedicated Clean Ballast Tanks on Tank Vessels General § 157.204 Letter of acceptance. The Coast Guard... submitted under § 157.202 show that the dedicated clean ballast tank system meets this subpart....

  15. 18 CFR 157.214 - Increase in storage capacity.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Increase in storage... Act for Certain Transactions and Abandonment § 157.214 Increase in storage capacity. (a) Prior notice. Subject to the notice requirements of § 157.205, the certificate holder is authorized to increase the...

  16. Escherichia coli O157 infections and unpasteurised milk

    NARCIS (Netherlands)

    Allerberger, F; Wagner, M; Schweiger, P; Rammer, H P; Resch, A; Dierich, M P; Friedrich, A W; Karch, H

    2001-01-01

    We report on two children with Escherichia coli O157 infection, one of whom developed haemolytic uraemic syndrome (HUS). Both had drunk raw cows or goats milk in the week before their illness. Molecular subtyping identified a sorbitol fermenting Escherichia coli O157:H isolate from a dairy cow. This

  17. Escherichia coli O157 infections and unpasteurised milk

    NARCIS (Netherlands)

    Allerberger, F; Wagner, M; Schweiger, P; Rammer, H P; Resch, A; Dierich, M P; Friedrich, A W; Karch, H

    2001-01-01

    We report on two children with Escherichia coli O157 infection, one of whom developed haemolytic uraemic syndrome (HUS). Both had drunk raw cows or goats milk in the week before their illness. Molecular subtyping identified a sorbitol fermenting Escherichia coli O157:H isolate from a dairy cow. This

  18. 47 CFR 73.157 - Antenna testing during daytime.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false Antenna testing during daytime. 73.157 Section... BROADCAST SERVICES AM Broadcast Stations § 73.157 Antenna testing during daytime. (a) The licensee of a station using a directional antenna during daytime or nighttime hours may, without further authority...

  19. 33 CFR 157.13 - Designated observation area.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Designated observation area. 157... OIL IN BULK Design, Equipment, and Installation § 157.13 Designated observation area. Each new vessel must have a designated observation area on the weather deck or above that is: (a) Located where the...

  20. 33 CFR 157.440 - Autopilot alarm or indicator.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Autopilot alarm or indicator. 157... § 157.440 Autopilot alarm or indicator. (a) A tankship owner or operator shall ensure that each installed autopilot unit without automatic manual override has an audible and visual alarm, which...

  1. 33 CFR 157.39 - Machinery space bilges.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Machinery space bilges. 157.39... Vessel Operation § 157.39 Machinery space bilges. (a) A tank vessel may discharge an oily mixture from a machinery space bilge that is combined with an oil cargo residue if the vessel discharges in compliance...

  2. [Survival of VTEC O157 and non-O157 in water troughs and bovine feces].

    Science.gov (United States)

    Polifroni, Rosana; Etcheverría, Analía I; Arroyo, Guillermo H; Padola, Nora L

    2014-01-01

    Verotoxin-producing Escherichia coli (VTEC) is the etiologic agent of hemolytic-uremic syndrome (HUS), which typically affects children ranging in age from six months to five years old. Transmission is produced by consumption of contaminated food, by direct contact with animals or the environment and from person to person. In previous studies we determined that the environment of a dairy farm is a non-animal reservoir; thus, we proposed to study the survival of 4 VTEC isolates (O20:H19; O91:H21; O157:H7 and O178:H19) in sterile water troughs and bovine feces by viable bacteria count and detection of virulence genes by PCR. It was demonstrated that the survival of different VTEC isolates (O157 and non-O157) varied in terms of their own characteristics as well as of the environmental conditions where they were found. The main differences between isolates were their survival time and the maximal counts reached. The competitive and adaptive characteristics of some isolates increase the infection risk for people that are visiting or working on a farm, as well as the risk for reinfection of the animals and food contamination. Copyright © 2014 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  3. Perforating corneal injury in rat and pentadecapeptide BPC 157.

    Science.gov (United States)

    Masnec, Sanja; Kokot, Antonio; Zlatar, Mirna; Kalauz, Miro; Kunjko, Kristian; Radic, Bozo; Klicek, Robert; Drmic, Domagoj; Lazic, Ratimir; Brcic, Luka; Radic, Radivoje; Ivekovic, Renata; Seiwerth, Sven; Sikiric, Predrag

    2015-07-01

    Based on its healing effects in various tissues, we hypothesized that the stable gastric pentadecapeptide BPC 157 heals corneal ulcerations in rats and effects corneal transparency. We made a penetrant linear 2-mm incision in the paralimbal region of the left cornea at the 5 o'clock position with a 20-gauge MVR incision knife at 45° under an operating microscope. Medication was BPC 157 (2 pg/mL, 2 ng/mL, and 2 μg/mL distilled water, two eye drops/left rat eye) immediately after injury induction and then every 8 h up to 120 h; controls received an equal volume of distilled water. In contrast to the poor healing response in controls, BPC 157 significantly accelerated the healing process in 2 μg and 2 ng BPC 157-treated eyes, starting 24 h after the injury, and the fluorescein and Seidel tests became negative. The epithelial defects were completely healed at 72 h (2 μg BPC 157-treated group) and at 96 h (2 ng BPC 157-treated group) after injury. Aqueous cells were absent at 96 h and 120 h after injury in the 2 μg and 2 ng BPC 157-treated groups, respectively. In conclusion, BPC 157 effects the rapid regaining of corneal transparency. Whereas controls developed new vessels that grew from the limbus to the penetrated area, BPC 157-treated rats generally had no new vessels, and those that did form in the limbus did not make contact with the penetrated area. Thus, BPC 157 eye drops successfully close perforating corneal incisions in rats.

  4. Topological data analysis of Escherichia coli O157:H7 and non-O157 survival in soils

    Science.gov (United States)

    Shiga toxin-producing E. coli O157:H7 and non-O157 have been implicated in many foodborne illnesses caused by the consumption of contaminated fresh produce. However, data on their persistence in major fresh produce-growing soils are limited due to the complexity in datasets generated from different ...

  5. Topological data analysis of Escherichia coli O157:H7 and non-O157 survival in soils.

    Science.gov (United States)

    Ibekwe, Abasiofiok M; Ma, Jincai; Crowley, David E; Yang, Ching-Hong; Johnson, Alexis M; Petrossian, Tanya C; Lum, Pek Y

    2014-01-01

    Shiga toxin-producing E. coli O157:H7 and non-O157 have been implicated in many foodborne illnesses caused by the consumption of contaminated fresh produce. However, data on their persistence in soils are limited due to the complexity in datasets generated from different environmental variables and bacterial taxa. There is a continuing need to distinguish the various environmental variables and different bacterial groups to understand the relationships among these factors and the pathogen survival. Using an approach called Topological Data Analysis (TDA); we reconstructed the relationship structure of E. coli O157 and non-O157 survival in 32 soils (16 organic and 16 conventionally managed soils) from California (CA) and Arizona (AZ) with a multi-resolution output. In our study, we took a community approach based on total soil microbiome to study community level survival and examining the network of the community as a whole and the relationship between its topology and biological processes. TDA produces a geometric representation of complex data sets. Network analysis showed that Shiga toxin negative strain E. coli O157:H7 4554 survived significantly longer in comparison to E. coli O157:H7 EDL 933, while the survival time of E. coli O157:NM was comparable to that of E. coli O157:H7 EDL 933 in all of the tested soils. Two non-O157 strains, E. coli O26:H11 and E. coli O103:H2 survived much longer than E. coli O91:H21 and the three strains of E. coli O157. We show that there are complex interactions between E. coli strain survival, microbial community structures, and soil parameters.

  6. 33 CFR 157.122 - Piping, valves, and fittings.

    Science.gov (United States)

    2010-07-01

    ...) Each overpressure relief valve must discharge into the suction side of a pump that meets § 157.126(b... system for oil washing and water washing, that piping system must be designed to drain the crude oil...

  7. Child Support Enforcement Annual Data Report Form 157 - YR 2006

    Data.gov (United States)

    U.S. Department of Health & Human Services — State officials use the OCSE-157 to report annual statistical and financial information on their Child Support Enforcement (CSE) program to the Department of Health...

  8. Child Support Enforcement Annual Data Report Form 157 - YR 2003

    Data.gov (United States)

    U.S. Department of Health & Human Services — State officials use the OCSE-157 to report annual statistical and financial information on their Child Support Enforcement (CSE) program to the Department of Health...

  9. Child Support Enforcement Annual Data Report Form 157 - YR 2005

    Data.gov (United States)

    U.S. Department of Health & Human Services — State officials use the OCSE-157 to report annual statistical and financial information on their Child Support Enforcement (CSE) program to the Department of Health...

  10. Child Support Enforcement Annual Data Report Form 157 - YR 2007

    Data.gov (United States)

    U.S. Department of Health & Human Services — State officials use the OCSE-157 to report annual statistical and financial information on their Child Support Enforcement (CSE) program to the Department of Health...

  11. Child Support Enforcement Annual Data Report Form 157 - YR 2004

    Data.gov (United States)

    U.S. Department of Health & Human Services — State officials use the OCSE-157 to report annual statistical and financial information on their Child Support Enforcement (CSE) program to the Department of Health...

  12. Child Support Enforcement Annual Data Report Form 157 - YR 2008

    Data.gov (United States)

    U.S. Department of Health & Human Services — State officials use the OCSE-157 to report annual statistical and financial information on their Child Support Enforcement (CSE) program to the Department of Health...

  13. Child Support Enforcement Annual Data Report Form 157 - YR 2004

    Data.gov (United States)

    U.S. Department of Health & Human Services — State officials will use the OCSE-157 to report statistical and some financial information on their Child Support Enforcement (CSE) program to the Department of...

  14. Single-molecule magnet behavior in an octanuclear dysprosium(iii) aggregate inherited from helical triangular Dy3 SMM-building blocks.

    Science.gov (United States)

    Zhang, Li; Zhang, Peng; Zhao, Lang; Wu, Jianfeng; Guo, Mei; Tang, Jinkui

    2016-06-28

    An unprecedented octanuclear dysprosium(iii) cluster with the formula [Dy8L6(μ3-OH)4(μ2-CH3O)2(CH3OH)6(H2O)2]·6H2O·10CH3OH·2CH3CN () based on a nonlinearly tritopic aroylhydrazone ligand H3L has been isolated, realizing the successful linking of pairwise interesting triangular Dy3 SMMs. It is noteworthy that two enantiomers (Λ and Δ configurations) individually behaving as a coordination-induced chirality presented in the Dy3 helicate are connected in the meso Dy8 cluster. Remarkably, alternating-current magnetic susceptibility measurements revealed that the Dy8 cluster shows typical SMM behavior inherited from its Dy3 helical precursor. It is one of the rare polynuclear Lnn SMMs (n > 7) under zero dc field.

  15. Another challenge to paramagnetic relaxation theory: a study of paramagnetic proton NMR relaxation in closely related series of pyridine-derivatised dysprosium complexes.

    Science.gov (United States)

    Rogers, Nicola J; Finney, Katie-Louise N A; Senanayake, P Kanthi; Parker, David

    2016-02-14

    Measurements of the relaxation rate behaviour of two series of dysprosium complexes have been performed in solution, over the field range 1.0 to 16.5 Tesla. The field dependence has been modelled using Bloch-Redfield-Wangsness theory, allowing estimates of the electronic relaxation time, T1e, and the size of the magnetic susceptibility, μeff, to be made. Changes in relaxation rate of the order of 50% at higher fields were measured, following variation of the para-substituent in the single pyridine donor. The magnetic susceptibilities deviated unexpectedly from the free-ion values for certain derivatives in each series examined, in a manner that was independent of the electron-releasing/withdrawing ability of the pyridine substituent, suggesting that the polarisability of just one pyridine donor in octadenate ligands can play a significant role in defining the magnetic susceptibility anisotropy.

  16. Discovery of {sup 157}W and {sup 161}Os

    Energy Technology Data Exchange (ETDEWEB)

    Bianco, L., E-mail: lbianco@uoguelph.c [Department of Physics, University of Liverpool, Liverpool, L69 7ZE (United Kingdom); Page, R.D.; Darby, I.G.; Joss, D.T. [Department of Physics, University of Liverpool, Liverpool, L69 7ZE (United Kingdom); Simpson, J. [STFC, Daresbury Laboratory, Daresbury, Warrington, WA4 4AD (United Kingdom); Al-Khalili, J.S.; Cannon, A.J. [Department of Physics, University of Surrey, Guildford, GU2 7XH (United Kingdom); Cederwall, B. [Royal Institute of Technology, Alba Nova Center, S-106 91 Stockholm (Sweden); Eeckhaudt, S. [Department of Physics, University of Jyvaeskylae, PO Box 35, FIN-40014, Jyvaeskylae (Finland); Ertuerk, S. [Nigde Universitesi, Fen-Edebiyat Falkueltesi, Fizik Boeluemue, Nigde (Turkey); Gall, B. [IPHC, CNRS-IN2P3, ULP Strasbourg, 23 rue de Loess, 67037 Strasbourg cedex 2 (France); Hornillos, M.B. Gomez [STFC, Daresbury Laboratory, Daresbury, Warrington, WA4 4AD (United Kingdom); Grahn, T. [Department of Physics, University of Liverpool, Liverpool, L69 7ZE (United Kingdom); Greenlees, P.T. [Department of Physics, University of Jyvaeskylae, PO Box 35, FIN-40014, Jyvaeskylae (Finland); Hadinia, B. [Royal Institute of Technology, Alba Nova Center, S-106 91 Stockholm (Sweden); Heyde, K. [Vakgroep Subatomaire en Stralingsfysika, Universiteit Gent, B-9000 Gent (Belgium); Jakobsson, U.; Jones, P.M.; Julin, R.; Juutinen, S. [Department of Physics, University of Jyvaeskylae, PO Box 35, FIN-40014, Jyvaeskylae (Finland)

    2010-06-07

    The nuclides {sup 157}W and {sup 161}Os have been discovered in reactions of {sup 58}Ni ion beams with a {sup 106}Cd target. The {sup 161}Os {alpha}-decay energy and half-life were 6890{+-}12 keV and 640{+-}60 {mu}s. The daughter {sup 157}W nuclei {beta}-decayed with a half-life of 275{+-}40 ms, populating both low-lying {alpha}-decaying states in {sup 157}Ta, which is consistent with a 7/2{sup -} ground state in {sup 157}W. Fine structure observed in the {alpha} decay of {sup 161}Os places the lowest excited state in {sup 157}W with I{sup {pi}=}9/2{sup -} at 318{+-}30 keV. The branching ratio of 5.5{sub -2.2}{sup +3.1}% indicates that {sup 161}Os also has a 7/2{sup -} ground state. Shell-model calculations analysing the effects of monopole shifts and a tensor force on the relative energies of 2f{sub 7/2} and 1h{sub 9/2} neutron states in N=83 isotones are presented.

  17. Ultrahigh Spin Structures in 157,158,159Er

    Institute of Scientific and Technical Information of China (English)

    MA Hai-Liang; DONG Bao-Guo; YAN Yu-Liang

    2008-01-01

    Rotational structures at ultrahigh spin in 157'158'159Er have been investigated with the configuration-dependent cranked Nilsson-Strutinsky approach. Configurations of observed bands are assigned and the corresponding deformations are given theoretically. The calculations suggest that one of ultrahigh spin bands in 158Er is triaxial highly deformed and the other is normal-deformed, while both ultrahigh spin bands in 157Er are suggested to be triaxial highly deformed. The possible ultrahigh spin bands in l59Er are predicted to be triaxial highly deformed and have shape coexistence in the same configuration. The configurations with two neutron holes in the Nosc=4 orbitals and two neutron holes in the h11/2 orbitals in 159Er are favoured for ultrahigh spin states but unfavoured for band termination, which is similar to ultrahigh spin bands in 157,158Er.

  18. ESCHERICHIA COLI O157 IN WITHE VEAL CALVES CARCASSES

    Directory of Open Access Journals (Sweden)

    V. D’Orio

    2013-02-01

    Full Text Available During 2006 one hundred and three white veal calves slaughtered at an abattoir in Isernia (Italy were examined for E. coli O157 intestinal carriage and carcass contamination, using Immuno-Magnetic Separation (IMS and multiplex PCR. Faecal material before slaughtering and carcass samples, using sponge-bag, were collected. E. coli O157 isolates were found in 10 (9,71% faecal and 9 (8,7% carcass samples. PCR analysis showed that all the strains from faecal and from carcass samples carried eaeA, hlyA and stx2 genes, while five strains stx1 gene. The results confirm that the slaughter practices can largely influence the rate of E. coli O157 carcasses contamination and suggest that white veal calves meat could be an important risk for human health.

  19. Tuning the composition and magnetostructure of dysprosium iron garnets by Co-substitution: An XRD, FT-IR, XPS and VSM study

    Energy Technology Data Exchange (ETDEWEB)

    Tholkappiyan, R.; Vishista, K., E-mail: raovishista@gmail.com

    2015-10-01

    Graphical abstract: - Highlights: • Garnet type Dy{sub 3}Fe{sub 5−x}Co{sub x}O{sub 12} (x = 0–0.06) nanoparticles were synthesized by glycine assisted combustion method. • To investigate and confirm the phases in the synthesized ferrite nanoparticles by FT-IR and XRD analysis. • To investigate the compositional and oxidation state of the samples by X-ray photoelectron spectroscopy. • The detailed core level spectra of Dy 4d, Fe 2p, Co 2p and O 1s were analyzed using XPS. • The magnetic property was studied by VSM technique. - Abstract: We report the Co-substituting on the synthesis and properties of garnet type dysprosium ferrite nanoparticles by basic composition Dy{sub 3}Fe{sub 5−x}Co{sub x}O{sub 12} (x = 0–0.06) synthesized through glycine assisted combustion method. A possible formation mechanism of synthesized Dy{sub 3}Fe{sub 5−x}Co{sub x}O{sub 12} samples by controlling the synthesis process has been proposed. XRD, FT-IR, XPS and VSM studies were used to investigate the compositional and magnetostructural properties of the prepared nanoparticles. XRD results confirm that all the samples are single-phase cubic garnet structure with mean crystallite size of 97–105 nm obtained from Scherrer method and 95–102 nm from W–H method. FT-IR analysis shows the presence of three expected bands in the frequency limit of 450–600 cm{sup −1} attributed to metal–O stretching vibration in tetrahedral site of garnet structure. A typical survey spectrum from XPS results confirmed the presence of Dy, Fe, Co and O elements in the samples. This study also to characterize the different oxidation states of the samples by fitting the parameters of high resolution Dy 4d, Fe 2p, Co 2p and O 1s XPS spectra. The XPS data of Dy 4d spectrum show that Dy{sup 3+} ion occupy in dodecahedral (D) site. The XPS analysis of Fe 2p and Co 2p data suggests that (Fe{sup 3+} and Fe{sup 2+}), (Co{sup 3+} and Co{sup 2+}) are distributed in tetrahedral and octahedral sites

  20. Prevalence, genetic characterization and virulence genes of sorbitol-fermenting Escherichia coli O157:H- and E. coli O157:H7 isolated from retail beef.

    Science.gov (United States)

    Sallam, Khalid Ibrahim; Mohammed, Mahmoud Ahmed; Ahdy, Asmaa Mohammed; Tamura, Tomohiro

    2013-08-01

    Sorbitol-fermenting (SF) Escherichia coli O157:H- strains have emerged as important pathogens and have been associated with a higher incidence of progression to hemolytic-uremic syndrome (HUS) than non-sorbitol fermenting (NSF) E. coli O157:H7. The present study was carried out to determine the prevalence of SF E. coli O157:H- and NSF E. coli O157:H7 strains in retail beef products in Mansoura, Egypt. The contamination rates with rfbEO157-positive E. coli O157 strains were 26.7% (8/30), 10% (3/30) and 3.7% (1/27) in ground beef, beef burger, and fresh beef samples, respectively with an overall mean of 13.8% (12/87) among all meat products tested. SF E. coli O157:H- were the most dominant among the isolated O157 strains. Of the fifteen O157 strains isolated, 11 (73.3%) were SF E. coli O157:H-, while the remaining 4 (26.7%) were NSF E. coli O157:H7. The 11 SF O157H- strains were genetically positive for sfpA gene. Restriction fragment length polymorphism (RFLP) analysis for fliC gene demonstrated a similar pattern for both SF and NSF O157 isolates. PCR assays verified the existence of stx1 gene in 7 (46.7%) and stx2 gene in 13 (86.7%) of the 15 O157 strains isolated. Unexpectedly, two of the 15 O157 strains isolated were negative for Shiga toxin genes. The eae gene was identified in all of the 15 O157 strains except in one NSF O157:H7 strain. EHEC-hlyA gene was detected in 14 (93.3%) of the 15 O157 isolates, nonetheless only 11 strains showed enterohemolytic phenotype on blood agar. A combination of the four virulence genes, stx1, stx2, eae and EHEC-hlyA were detected in 7 (46.7%) strains, while six (40%) strains were positive for stx2, eae and hlyA genes. This is the first record for isolation of E. coli O157: H- in Egypt as well as in the African continent.

  1. Phenotype abnormality: 157 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 157 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u663i decreased effic...iency in organ named root hair cell during process named growth ... root hair cell ... decreased efficiency ... growth ...

  2. 33 CFR 157.11 - Pumping, piping and discharge arrangements.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Pumping, piping and discharge... CARRYING OIL IN BULK Design, Equipment, and Installation § 157.11 Pumping, piping and discharge arrangements. (a) Each tank vessel must have a fixed piping system for transferring oily mixtures from...

  3. 18 CFR 157.34 - Notice of open season.

    Science.gov (United States)

    2010-04-01

    ... agreements as provided in § 157.33(b) and the prospective applicant does not redesign the project to... in the State of Alaska. (ii) The job titles and descriptions, and chain of command for all officers... gas in the State of Alaska. (ii) The job titles and descriptions, and chain of command for...

  4. 33 CFR 157.23 - Cargo and ballast system information.

    Science.gov (United States)

    2010-07-01

    ... CARRYING OIL IN BULK Design, Equipment, and Installation § 157.23 Cargo and ballast system information. (a... automatic and manual operation of the cargo and ballast system in the vessel. (b) The format and information... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Cargo and ballast system...

  5. 33 CFR 157.222 - Pump and piping arrangements.

    Science.gov (United States)

    2010-07-01

    ... OIL IN BULK Dedicated Clean Ballast Tanks on Tank Vessels Design and Equipment § 157.222 Pump and piping arrangements. (a) Dedicated clean ballast tanks must be connected to the least practicable: (1... each dedicated clean ballast tank must be arranged so that oily water does not enter any...

  6. 33 CFR 157.220 - Dedicated clean ballast tanks: Standards.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Dedicated clean ballast tanks... CARRYING OIL IN BULK Dedicated Clean Ballast Tanks on Tank Vessels Design and Equipment § 157.220 Dedicated clean ballast tanks: Standards. (a) Cargo tanks that are designated as dedicated clean ballast...

  7. 33 CFR 157.218 - Dedicated clean ballast tanks: Alterations.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Dedicated clean ballast tanks... CARRYING OIL IN BULK Dedicated Clean Ballast Tanks on Tank Vessels General § 157.218 Dedicated clean ballast tanks: Alterations. The dedicated clean ballast tanks or equipment on a tank vessel that has...

  8. 33 CFR 157.132 - Cargo tanks: Hydrocarbon vapor emissions.

    Science.gov (United States)

    2010-07-01

    ...(a)(2) or § 157.10c(b)(2) without sufficient segregated ballast tanks or dedicated clean ballast... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Cargo tanks: Hydrocarbon vapor... SECURITY (CONTINUED) POLLUTION RULES FOR THE PROTECTION OF THE MARINE ENVIRONMENT RELATING TO TANK...

  9. 33 CFR 157.216 - Required documents: Foreign tank vessels.

    Science.gov (United States)

    2010-07-01

    ... CARRYING OIL IN BULK Dedicated Clean Ballast Tanks on Tank Vessels General § 157.216 Required documents... the United States unless the vessel has on board— (1) The Dedicated Clean Ballast Tank Operations... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Required documents: Foreign...

  10. 18 CFR 157.36 - Open seasons for expansions.

    Science.gov (United States)

    2010-04-01

    ... shippers seeking to transport natural gas from areas other than Prudhoe Bay and Point Thomson. ... COMMISSION, DEPARTMENT OF ENERGY REGULATIONS UNDER NATURAL GAS ACT APPLICATIONS FOR CERTIFICATES OF PUBLIC... GAS ACT Open Seasons for Alaska Natural Gas Transportation Projects § 157.36 Open seasons...

  11. 40 CFR 93.157 - Frequency of conformity determinations.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Frequency of conformity determinations... PROGRAMS (CONTINUED) DETERMINING CONFORMITY OF FEDERAL ACTIONS TO STATE OR FEDERAL IMPLEMENTATION PLANS Determining Conformity of General Federal Actions to State or Federal Implementation Plans § 93.157...

  12. 40 CFR 98.157 - Records that must be retained.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING HCFC-22 Production and HFC-23 Destruction § 98.157 Records... shall retain the following records: (1) The data used to estimate HFC-23 emissions. (2) Records documenting the initial and periodic calibration of the gas chromatographs, weigh scales, volumetric...

  13. 34 CFR 300.157 - Performance goals and indicators.

    Science.gov (United States)

    2010-07-01

    ... CHILDREN WITH DISABILITIES State Eligibility Additional Eligibility Requirements § 300.157 Performance... yearly progress, including the State's objectives for progress by children with disabilities, under..., with any other goals and academic standards for children established by the State; (b) Have in effect...

  14. 33 CFR 157.17 - Oil residue (sludge) tank.

    Science.gov (United States)

    2010-07-01

    ... tons or more must have a tank that receives and holds oil residue resulting from purification of fuel... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Oil residue (sludge) tank. 157.17...) POLLUTION RULES FOR THE PROTECTION OF THE MARINE ENVIRONMENT RELATING TO TANK VESSELS CARRYING OIL IN BULK...

  15. Prevalence and antibiogram of Escherichia coli O157 isolated from ...

    African Journals Online (AJOL)

    J., 2017, 21 (2), 109-120. Ethiop. Vet. J., 2017, 21 ... 1College of Veterinary Medicine and Agriculture, Addis Ababa University, Ethiopia. 2School of ... examined to identify E. coli O157 by ISO 17604:2005 method and by using. Dry spot E. coli ...

  16. 33 CFR 157.12f - Workshop functional test requirements.

    Science.gov (United States)

    2010-07-01

    ... CARRYING OIL IN BULK Design, Equipment, and Installation § 157.12f Workshop functional test requirements... the specific design of equipment. A completed workshop certificate including the delivery test...; (2) A check of the correct function of the signal processor and the recording equipment...

  17. 33 CFR 157.500 - Purpose and applicability.

    Science.gov (United States)

    2010-07-01

    ... OIL IN BULK Interim Measures for Certain Tank Vessels Without Double Hulls Carrying Animal Fat or... fat or vegetable oil. (b) This subpart applies to each tank vessel specified in § 157.01 of this part that— (1) Is 5,000 gross tons or more; (2) Carries animal fat or vegetable oil in bulk as cargo...

  18. 18 CFR 157.218 - Changes in customer name.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Changes in customer... CONVENIENCE AND NECESSITY AND FOR ORDERS PERMITTING AND APPROVING ABANDONMENT UNDER SECTION 7 OF THE NATURAL... Act for Certain Transactions and Abandonment § 157.218 Changes in customer name. (a)...

  19. Stable gastric pentadecapeptide BPC 157 heals rat colovesical fistula.

    Science.gov (United States)

    Grgic, Tihomir; Grgic, Dora; Drmic, Domagoj; Sever, Anita Zenko; Petrovic, Igor; Sucic, Mario; Kokot, Antonio; Klicek, Robert; Sever, Marko; Seiwerth, Sven; Sikiric, Predrag

    2016-06-05

    To establish the effects of BPC 157 on the healing of rat colovesical fistulas, Wistar Albino male rats were randomly assigned to different groups. BPC 157, a stable gastric pentadecapeptide, has been used in clinical applications-specifically, in ulcerative colitis-and was successful in treating both external and internal fistulas. BPC 157 was provided daily, perorally, in drinking water (10µg/kg, 12ml/rat/day) until sacrifice or, alternatively, 10µg/kg or 10ng/kg intraperitoneally, with the first application at 30min after surgery and the last at 24h before sacrifice. Controls simultaneously received an equivolume of saline (5.0ml/kg ip) or water only (12ml/rat/day). Assessment (i.e., colon and vesical defects, fistula leaking, fecaluria and defecation through the fistula, adhesions and intestinal obstruction as healing processes) took place on days 7, 14 and 28. Control colovesical fistulas regularly exhibited poor healing, with both of the defects persisting; continuous fistula leakage; fecaluria and defecation through the fistula; advanced adhesion formation; and intestinal obstruction. By contrast, BPC 157 given perorally or intraperitoneally and in µg- and ng-regimens rapidly improved the whole presentation, with both colon and vesical defects simultaneously ameliorated and eventually healed. The maximal instilled volume was continuously raised until it reached the values of healthy rats, there were no signs of fecaluria and no defecation through the fistula, there was counteraction of advanced adhesion formation or there was an intestinal obstruction. In conclusion, BPC 157 effects appear to be suited to inducing full healing of colocutaneous fistulas in rats.

  20. A dysprosium-based metal-organic framework: Synthesis, characterization, crystal structure and interaction with calf thymus-DNA and bovine serum albumin

    Indian Academy of Sciences (India)

    Biplab Mondal; Buddhadeb Sen; Ennio Zangrando; Pabitra Chattopadhyay

    2014-07-01

    A dysprosium-based metallo-organic framework (MOF) containing calcium ions formulated as {Dy(pyda)3Ca1.5(H2O)6} · 5.5H2O (1) (H2pyda = pyridine-2,6-dicarboxylic acid) was solvothermally synthesized in ethanolic medium and characterized by physico-chemical and spectroscopic tools. A detailed structural analysis of the solid state structure of 1 by single crystal X-ray diffraction study showed a tricapped trigonal prism geometry for lanthanide in the [Dy(pyda)3]3− fragment. The mode of interaction of 1 with calf thymus- DNA and with protein bovine serum albumin (BSA) was investigated by using absorption and emission spectroscopic tools. The apparent association constant of complex 1 with CT-DNA was deduced from an absorption spectral study (b = 4.08 × 104 M-1). Spectral and viscosity measurements indicated a groove-binding mode of 1 with CT-DNA, and from spectroscopic study the formation of a metal complex-BSA adduct was assumed to be the result of the interaction of 1 with BSA.

  1. Dual-mode T1 and T2 magnetic resonance imaging contrast agent based on ultrasmall mixed gadolinium-dysprosium oxide nanoparticles: synthesis, characterization, and in vivo application

    Science.gov (United States)

    Tegafaw, Tirusew; Xu, Wenlong; Wasi Ahmad, Md; Baeck, Jong Su; Chang, Yongmin; Bae, Ji Eun; Chae, Kwon Seok; Kim, Tae Jeong; Lee, Gang Ho

    2015-09-01

    A new type of dual-mode T1 and T2 magnetic resonance imaging (MRI) contrast agent based on mixed lanthanide oxide nanoparticles was synthesized. Gd3+ (8S7/2) plays an important role in T1 MRI contrast agents because of its large electron spin magnetic moment resulting from its seven unpaired 4f-electrons, and Dy3+ (6H15/2) has the potential to be used in T2 MRI contrast agents because of its very large total electron magnetic moment: among lanthanide oxide nanoparticles, Dy2O3 nanoparticles have the largest magnetic moments at room temperature. Using these properties of Gd3+ and Dy3+ and their oxide nanoparticles, ultrasmall mixed gadolinium-dysprosium oxide (GDO) nanoparticles were synthesized and their potential to act as a dual-mode T1 and T2 MRI contrast agent was investigated in vitro and in vivo. The D-glucuronic acid coated GDO nanoparticles (davg = 1.0 nm) showed large r1 and r2 values (r2/r1 ≈ 6.6) and as a result clear dose-dependent contrast enhancements in R1 and R2 map images. Finally, the dual-mode imaging capability of the nanoparticles was confirmed by obtaining in vivo T1 and T2 MR images.

  2. Experimental and molecular dynamics studies of dysprosium(III) salt solutions for a better representation of the microscopic features used within the binding mean spherical approximation theory.

    Science.gov (United States)

    Ruas, Alexandre; Guilbaud, Philippe; Den Auwer, Christophe; Moulin, Christophe; Simonin, Jean-Pierre; Turq, Pierre; Moisy, Philippe

    2006-10-19

    This work is aimed at a predictive description of the thermodynamic properties of actinide(III) salt solutions at high concentration and 25 degrees C. A new solution of the binding mean spherical approximation (BIMSA) theory, based on the Wertheim formalism, for taking into account 1:1 and also 1:2 complex formation, is used to reproduce, from a simple procedure, experimental osmotic coefficient variation with concentration for three binary salt solutions of the same lanthanide(III) cation: dysprosium(III) perchlorate, nitrate, and chloride. The relevance of the fitted parameters is discussed, and their values are compared with available literature values. UV-vis/near-IR, time-resolved laser-induced fluorescence spectroscopy experiments, and molecular dynamics (MD) calculations were conducted for dilute to concentrated solutions (ca. 3 mol.kg-1) for a study of the microscopic behavior of DyCl3 binary solutions. Coupling MD calculations and extended X-ray absorption fine structure led to the determination of reliable distances. The MD results were used for a discussion of the parameters used in the BIMSA.

  3. Experimental and molecular dynamics studies of dysprosium(III) salt solutions for a better representation of the microscopic features used within the binding mean spherical approximation theory

    Energy Technology Data Exchange (ETDEWEB)

    Ruas, Alexandre; Guilbaud, Philippe; Den Auwer, Christophe; Moulin, Christophe; Simonin, Jean-Pierre; Turq, Pierre; Moisy, Philippe [DEN/DRCP/SCPS, CEA-Valrho Marcoule, BP 17171, 30207 Bagnols-sur-Ceze Cedex, DEN/DPC/SECR/LSRM, CEA-Saclay, Bat 391, BP 91191 Gif sur Yvette, Cedex (France); Laboratoire LI2C (UMR 7612), Universite Pierre et Marie Curie-Paris 6, Boite No. 51, 4 Place Jussieu, 75252 Paris Cedex 05 (France)

    2006-07-01

    This work is aimed at a predictive description of the thermodynamic properties of actinide (III) salt solutions at high concentration and 25 deg. C. A new solution of the binding mean spherical approximation (BIMSA) theory, based on the Wertheim formalism, for taking into account 1: 1 and also 1: 2 complex formation, is used to reproduce, from a simple procedure, experimental osmotic coefficient variation with concentration for three binary salt solutions of the same lanthanide (III) cation: dysprosium (III) perchlorate, nitrate, and chloride. The relevance of the fitted parameters is discussed, and their values are compared with available literature values. UV-vis/near-IR, time-resolved laser-induced fluorescence spectroscopy experiments, and molecular dynamics (MD) calculations were conducted for dilute to concentrated solutions (ca. 3 mol, kg{sup -1}) for a study of the microscopic behavior of DyCl{sub 3} binary solutions. Coupling MD calculations and extended X-ray absorption fine structure led to the determination of reliable distances. The MD results were used for a discussion of the parameters used in the BIMSA. (authors)

  4. Elucidation of Dual Magnetic Relaxation Processes in Dinuclear Dysprosium(III) Phthalocyaninato Triple-Decker Single-Molecule Magnets Depending on the Octacoordination Geometry.

    Science.gov (United States)

    Katoh, Keiichi; Aizawa, Yu; Morita, Takaumi; Breedlove, Brian K; Yamashita, Masahiro

    2017-08-07

    When applying single-molecule magnets (SMMs) to spintronic devices, control of the quantum tunneling of the magnetization (QTM) as well as a spin-lattice interactions are important. Attempts have been made to use not only coordination geometry but also magnetic interactions between SMMs as an exchange bias. In this manuscript, dinuclear dysprosium(III) (Dy(III) ) SMMs with the same octacoordination geometry undergo dual magnetic relaxation processes at low temperature. In the dinuclear Dy(III) phthalocyaninato (Pc(2-) ) triple-decker type complex [(Pc)Dy(ooPc)Dy(Pc)] (1) (ooPc(2-) =2,3,9,10,16,17,23,24-octakis(octyloxy)phthalocyaninato) with a square-antiprismatic (SAP) geometry, the ground state is divided by the Zeeman effect, and level intersection occurs when a magnetic field is applied. Due to the ground state properties of 1, since the Zeeman diagram where the levels intersect in an Hdc of 2500 Oe, two kinds of QTM and direct processes occur. However, dinuclear Dy(III) -Pc systems with C4 geometry, which have a twist angle (ϕ) of less than 45° do not undergo dual magnetic relaxation processes. From magnetic field and temperature dependences, the dual magnetic relaxation processes were clarified. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Annealing behaviour and crystal structure of RF-sputtered Bi-substituted dysprosium iron-garnet films having excess co-sputtered Bi-oxide content

    Energy Technology Data Exchange (ETDEWEB)

    Vasiliev, M; Nur-E-Alam, M; Alameh, K [Electron Science Research Institute, Edith Cowan University, 270 Joondalup Drive, Joondalup, WA, 6027 (Australia); Premchander, P; Lee, Y T [Department of Information and Communications, Gwangju Institute of Science and Technology (GIST), Gwangju, 500-712 (Korea, Republic of); Kotov, V A [Institute of Radio Engineering and Electronics, Russian Academy of Sciences, 11 Mohovaya St, Moscow, 125009 (Russian Federation); Lee, Y P, E-mail: m.vasiliev@ecu.edu.au [Quantum Photonic Science Research Center, Department of Physics, Hanyang University, 133-791 (Korea, Republic of)

    2011-02-23

    We investigate the magneto-optic properties, crystal structure and annealing behaviour of nano-composite media with record-high magneto-optic quality exceeding the levels reported so far in sputtered iron-garnet films. Bi-substituted dysprosium-gallium iron-garnet films having excess bismuth oxide content are deposited using RF co-sputtering, and a range of garnet materials are crystallized using conventional oven-annealing processes. We report, for the first time ever, the results of optimization of thermal processing regimes for various high-performance magneto-optic iron-garnet compositions synthesized and describe the evolution of the optical and magneto-optical properties of garnet-Bi-oxide composite-material films occurring during the annealing processes. The crystallization temperature boundaries of the system (BiDy){sub 3}(FeGa){sub 5}O{sub 12} : Bi{sub 2}O{sub 3} are presented. We also report the results of x-ray diffraction and energy-dispersive x-ray spectroscopy studies of this recently developed class of high-performance magneto-optic composites. Our hypothesis of iron oxides being the cause of excess optical absorption in sputtered Bi-iron-garnet films is confirmed experimentally.

  6. 33 CFR Appendix C to Part 157 - Procedure for Determining Distribution of Segregated Ballast Tanks To Provide Protection Against...

    Science.gov (United States)

    2010-07-01

    ..., Ramming, or Collision C Appendix C to Part 157 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF... VESSELS CARRYING OIL IN BULK Pt. 157, App. C Appendix C to Part 157—Procedure for Determining...

  7. Colonization of the meat extracellular matrix proteins by O157 and non-O157 enterohemorrhagic Escherichia coli.

    Science.gov (United States)

    Chagnot, Caroline; Caccia, Nelly; Loukiadis, Estelle; Ganet, Sarah; Durand, Alexandra; Bertin, Yolande; Talon, Régine; Astruc, Thierry; Desvaux, Mickaël

    2014-10-01

    Enterohemorrhagic Escherichia coli (EHEC) are anthropozoonotic agents that range third among food-borne pathogens respective to their incidence and dangerousness in the European Union. EHEC are Shiga-toxin producing E. coli (STEC) responsible for foodborne poisoning mainly incriminated to the consumption of contaminated beef meat. Among the hundreds of STEC serotypes identified, EHEC mainly belong to O157:H7 but non-O157 can represent 20 to 70% of EHEC infections per year. Seven of those serogroups are especially of high-risk for human health, i.e. O26, O45, O103, O111, O121, O145 and O104. While meat can be contaminated all along the food processing chain, EHEC contamination essentially occurs at the dehiding stage of slaughtering. Investigating bacterial colonization to the skeletal-muscle extracellular matrix (ECM) proteins, it appeared that environmental factors influenced specific and non-specific bacterial adhesion of O157 and non-O157 EHEC as well as biofilm formation. Importantly, mechanical treatment (i.e. shaking, centrifugation, pipetting and vortexing) inhibited and biased the results of bacterial adhesion assay. Besides stressing the importance of the protocol to investigate bacterial adhesion to ECM proteins, this study demonstrated that the colonization abilities to ECM proteins vary among EHEC serogroups and should ultimately be taken into consideration to evaluate the risk of contamination for different types of food matrices.

  8. Toward Development of an Oral, Plant-Based Vaccine Against Escherichia coli O157:H7

    Science.gov (United States)

    2004-01-01

    species, including birds, sheep , deer, dogs, and humans, as well as survive and multiply in certain environmental niches (Wallace et al., 1997; Kudva...Gansheroff et al., 1999). Furthermore, colostrum from sows immunized intramuscularly with intimin from EHEC O157:H7 contains anti-intiminO157...protect a host from EHEC O157:H7-mediated disease. EHEC O157:H7 can colonize calves and adult cattle, sheep , and a variety of other domestic and wild

  9. 18 CFR 157.212 - Synthetic and liquefied natural gas facilities.

    Science.gov (United States)

    2010-04-01

    ... of the Natural Gas Act for Certain Transactions and Abandonment § 157.212 Synthetic and liquefied... liquefied natural gas and that are not “related jurisdictional natural gas facilities” as defined in § 153.2... natural gas facilities. 157.212 Section 157.212 Conservation of Power and Water Resources FEDERAL...

  10. 40 CFR 157.30 - Voluntary use of child-resistant packaging.

    Science.gov (United States)

    2010-07-01

    ... packaging. 157.30 Section 157.30 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PACKAGING REQUIREMENTS FOR PESTICIDES AND DEVICES Child-Resistant Packaging § 157.30 Voluntary use of child-resistant packaging. A registrant whose product is not required to be in...

  11. 33 CFR 157.12 - Oil discharge monitoring and control system.

    Science.gov (United States)

    2010-07-01

    ... control system. 157.12 Section 157.12 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... system. (a) Each vessel must have an oil discharge monitoring and control system (monitoring system) that... incorporated by reference (see § 157.02). (c) Each oil discharge monitoring and control system on a U.S. vessel...

  12. 9 CFR 381.157 - Canned boned poultry and baby or geriatric food.

    Science.gov (United States)

    2010-01-01

    ... Standards of Identity or Composition § 381.157 Canned boned poultry and baby or geriatric food. (a) Canned... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Canned boned poultry and baby or geriatric food. 381.157 Section 381.157 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE...

  13. 27 CFR 25.157 - Determination of tax on bottled beer.

    Science.gov (United States)

    2010-04-01

    ... bottled beer. 25.157 Section 25.157 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS BEER Tax on Beer Determination of Tax § 25.157 Determination of tax on bottled beer. The quantities of bottled beer removed subject to tax shall be computed...

  14. 17 CFR 1.57 - Operations and activities of introducing brokers.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Operations and activities of introducing brokers. 1.57 Section 1.57 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION GENERAL REGULATIONS UNDER THE COMMODITY EXCHANGE ACT Miscellaneous § 1.57 Operations and activities of...

  15. 10 CFR 52.157 - Contents of applications; technical information in final safety analysis report.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Contents of applications; technical information in final safety analysis report. 52.157 Section 52.157 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS Manufacturing Licenses § 52.157 Contents of applications...

  16. Survey of O-islands in Escherichia coli O157 and Other Enteric Pathogens—O-islands of E. coli O157:H7

    Institute of Scientific and Technical Information of China (English)

    徐建国; 任志鸿; 李新军; 叶长芸; 李振军; 卢珊; 逢波; 白雪梅; 吴龙飞

    2003-01-01

    The genome of the enterohemorrhagic Escherichia coli O157:H7 EDL933 contains 177 “O”-islands (OIs). Tostudy their potential contribution to the O157-specific pathogenicity, we surveyed the distribution of 22 OIs by PCR and DNA hybridization in 17 isolates of Shiga toxin producing (Stx-positive) E. coli O157:H7, and compared with their distribution in 21 isolates of Stx-negative E. coli O157 and 21 isolates of non-O157 enteric pathogens. Fourteen of 22 OIs were present innon-O157 entericpathogens analyzed. Eight of 22 OIs were found only in the 17 Shiga toxin- (Stx) positive E. coli O157:H7 isolates, but they were absent from the 21 Stx-negative E. coli O157: NM and O157 Hund isolates tested. Among the 8OIs, only OI43 or OI48 were exclusively detected in Stx-positive E. coli O157 : H7, absent from neither of Stx-negative E. coli O157 and non-O157 enteric pathogens, such as Salmonella, ShigeUa, Citrobacter, Vibrio cholera, enteropathogen-ic E. coli (EPEC), enteroadherent E. coli (EAEC), enteroinvasive E. coli (E1EC) and enterotoxingenic E. coli (ETEC). The OI43 and OI48 are 83 kb in size and identical in DNA sequences, which encode genes for urease, tellurite resistance and adherence. By analyzing their junction genes with PCR and DNA hybridization, we found that 21 Chinese isolates have OI48 only. However, for 7 Japanese patient isolates, 4 have OI43 and 3 have OI48; for American isolates, 2have both of O143 and OI48, 2 have OI48 only. These data confirmed the highly plasticity of the pathogenic E. coli genome. The unique presence of OI43/OI48 in Stx-positive E. coli 0157:H7 denotes its critical role in the pathogenicity specific to this pathogen.

  17. Global use structures of the magnetic materials neodymium and dysprosium. A scenario-based analysis of the effect of the diffusion of electromobility on the demand for rare earths; Globale Verwendungsstrukturen der Magnetwerkstoffe Neodym und Dysprosium. Eine szenariobasierte Analyse der Auswirkung der Diffusion der Elektromobilitaet auf den Bedarf an Seltenen Erden

    Energy Technology Data Exchange (ETDEWEB)

    Gloeser-Chahoud, Simon; Kuehn, Andre; Tercero Espinoza, Luis

    2016-06-15

    Neodymium-iron-boron magnets (NdFeB) have experienced a significant demand as the most powerful permanent magnet in recent years, especially for the manufacture of compact electric servomotors with high efficiency and high power density, especially for mobile applications in hybrid traction motors and electric vehicles or for electric bikes. However, NdFeB magnets are also increasingly being used in general mechanical engineering (conveying and pumping systems, tools, air conditioning systems, lift motors, etc.), in the small electric motors of conventional passenger cars or in the generators of large wind power plants with permanent magnetic direct drive. Nevertheless, there is still high uncertainty in the use structures of NdFeB magnets and the contained rare earth elements neodymium and dysprosium. An effective instrument for increasing the market transparency and the understanding of complex anthropogenic material cycles is the dynamic material flow modeling. In the present work paper, this instrument is used for an in-depth analysis of the use structures of NdFeB magnets and the contained rare earths on a global scale. The dynamic modeling of product usage cycles reveals today's usage structures and quantifies future magnetic quantities in obsolete product flows. It could be shown that the magnets in today's scrap volume are mainly contained in obsolete electronics applications such as hard disks (HDD), CD and DVD drives, which makes the recycling hardly seem to be economical due to the small magnets and the high material spread, but in the foreseeable future with larger magnetic quantities from synchronous servomotors and generators can be expected, which significantly increases the recycling potential. In a further step, the effect of the diffusion of alternative drives in the automotive market on the dysprosium requirement is analyzed using a system dynamics model and possible adaptation mechanisms in the form of different substitution effects in

  18. Prevalence of Escherichia coli O157 and verocytotoxin producing E. coil (VTEC) on Danish beef carcasses

    DEFF Research Database (Denmark)

    Breum, Solvej Østergaard; Boel, Jeppe

    2010-01-01

    The prevalence of verocytotoxin producing Escherichia coil (VTEC), E. coli O157, and VTEC O157 in 474 swab samples from Danish beef carcasses was determined. The presence of E. coli O157 was determined by a culture method that included immunomagnetic separation (IMS) followed by real time PCR...... testing of isolates for verocytotoxin (vtx) genes. E. coil O157 was recovered from 4.2% of the carcass samples and VTEC O157 from 3.4% of the samples. All VTEC O157 contaminated carcasses were from bull calves and the VTEC O157 prevalence on bull calf carcasses was 7.3%. The VTEC O157 contaminated beef...... PCR assay for the E. coil O157 specific rfbE gene was developed. In total 22.4% of the enriched samples were positive for the O157 rfbE gene. The combined results of the vtx and rfbE real time PCR screening showed that 17.5% of the carcasses potentially were contaminated with VTEC O157. Screening...

  19. The role of dysprosium on the structural and magnetic properties of (Nd1-xDyx)2Fe14B nanoparticles

    Science.gov (United States)

    Rahimi, Hamed; Ghasemi, Ali; Mozaffarinia, Reza; Tavoosi, Majid

    2017-02-01

    In current work, Nd2Fe14B nanoparticles was synthesized by sol-gel method. Dysprosium powders were added into Nd2Fe14B nanoparticles by mechanical alloying process in order to enhancement of coercivity. The phase analysis, structure, and magnetic properties of annealed (Nd1-xDyx)2Fe14B nanoparticles with different Dy-content (x=0.1, 0.2, 0.3, 0.4, 0.5, 0.6) were investigated by employing X-ray diffraction, X-ray photoelectron spectroscopy, energy dispersive spectroscopy, field emission scanning electron microscope, transmission electron microscope and vibrating sample magnetometer techniques. The results showed that with an increase in Dy amounts, the coercivity of particles increased from 2.9 kOe to 13.4 kOe and then decreased to 5.6 kOe. By adding an optimum amount of Dy (x=0.4), the coercivity was significantly increased from 2.9 kOe to 13.4 kOe. The average particle size of annealed (Nd1-xDyx)2Fe14B nanoparticles was below 10 nm. Magnetization reversal studies indicate that the coercivity of milled and annealed (Nd1-xDyx)2Fe14B nanoparticles is controlled by the nucleation of reversed magnetic domains. The experimental results in the angular dependence of coercivity for (Nd1-xDyx)2Fe14B permanent magnets showed that the normalized coercivity of the permanent magnets Hc(θ)/Hc(0) increases from 1 to about 1.2-1.5 with increasing θ from 0 to about π/3, for x=0.4-0.6.

  20. Genetically marked strains of Shiga toxin-producing O157:H7 and non-O157 Escherichia coli: Tools for detection and modelling

    Science.gov (United States)

    Shiga toxin-producing E. coli (STEC) are among the most important foodborne pathogens in the United States and worldwide. Nearly half of all STEC-induced diarrheal disease in the United States is caused by STEC O157:H7 while non-O157 STEC account for the remaining illnesses. Thus, the USDA Food Safe...

  1. Cytolethal distending toxin producing Escherichia coli O157:H43 strain T22 represents a novel evolutionary lineage within the O157 serogroup.

    Science.gov (United States)

    Sváb, Domonkos; Bálint, Balázs; Maróti, Gergely; Tóth, István

    2016-12-01

    Enterohemorrhagic Escherichia coli (EHEC) O157:H7/NM strains are significant foodborne pathogens intensively studied, while other sero- and pathotypes of the O157 serogroup only began to receive more attention. Here we report the first genome sequence of a cytolethal distending toxin (CDT-V) producing E. coli O157:H43 strain (T22) isolated from cattle. The genome consists of a 4.9Mb chromosome assembled into three contigs and one plasmid of 82.4kb. Comparative genomic investigations conducted with the core genomes of representative E. coli strains in GenBank (n=62) confirmed the separation of T22 from the EHEC and enteropathogenic (EPEC) O157 lineages. Gene content based pangenome analysis revealed as many as 261 T22-specific coding sequences without orthologs in EDL933 EHEC O157 prototypic and two phylogenetically related commensal E. coli strains. The genome sequence revealed 10 prophage-like regions which harbor several virulence-associated genes including cdt and heat-labile enterotoxin (LT-II) encoding operons. Our results indicate that the evolutionary path of T22 is largely independent from that of EHEC and EPEC O157:H7/NM strains. Thus, the CDT-producing T22 E. coli O157:H43 strain represents a unique lineage of E. coli O157.

  2. Comparison of Clinical and Epidemiological Features of Shiga Toxin-Producing Escherichia coli O157 and Non-O157 Infections in British Columbia, 2009 to 2011

    Directory of Open Access Journals (Sweden)

    Xuetao Wang

    2013-01-01

    Full Text Available INTRODUCTION: Shiga toxin-producing Escherichia coli (STEC are major foodborne agents that have the potential to cause severe enteric illnesses and large outbreaks worldwide. Several studies found non-O157 infections to be clinically milder than O157 STEC infections.

  3. Antimicrobial resistance in Escherichia coli O157 and non-O157 isolated from feces of domestic farm animals in Culiacan, Mexico

    Science.gov (United States)

    Antimicrobial resistance in E. coli O157 and non-O157 strains is a matter of increasing concern, and the association with some virulence traits in the same bacteria remains unclear. Inappropriate antimicrobial use in human and animal therapy has been associated with selective pressure in enteric mi...

  4. Antimicrobial resistance in Escherichia coli O157 and non-O157 recovered from feces of domestic farm animals in Northwestern Mexico

    Science.gov (United States)

    Antimicrobial resistance in Shiga toxin-producing Escherichia coli (STEC) O157 and non-O157 is a matter of increasing concern. Inappropriate antimicrobial use in human and animal therapy has been associated with an acquired resistance in enteric microorganisms. The aim of the present study was to de...

  5. Validation of the ANSR® E. coli O157:H7 Method for Detection of E. coli O157:H7.

    Science.gov (United States)

    2016-03-31

    A performance validation of the ANSR(®) for E. coli O157:H7 method was conducted in selected food matrixes. This assay uses selective nicking enzyme amplification technology to amplify target genes. Samples are enriched for 12-24 h and then lysed. The assay is completed within 40 min using real-time detection in a combination incubator/fluorescence detector and software. When 44 distinct strains of Escherichia coli O157:H7 and 6 strains of E. coli O157:NM were tested for inclusivity, all 50 strains produced positive results. In exclusivity testing, 57 strains representing 33 species of closely related Gram-negative bacteria belonging to the Enterobacteriaceae family, including 11 non-H7 O157 strains and shiga toxin-producing E. coli other than O157:H7, were evaluated. All 57 nontarget strains generated negative ANSR assay results. Using 80% lean ground beef and beef trim (approximately 20% fat), ANSR method performance was compared to the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure. ANSR performance with baby spinach and sprout irrigation water was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method. ANSR method performance was not statistically different to that of the reference methods using two different enrichment options. For ground beef and beef trim, the standard enrichment in modified Tryptone Soya Broth can be analyzed using the ANSR assay with a 1:10 dilution of the enrichment in phosphate-buffered saline and produces equivalent results to the reference method. Additionally, in most matrixes tested (exception is spinach which required 24 h enrichment) the assay offers great efficiency and flexibility over the reference method with a 12-24 h single-step enrichment. Equivalent results were observed at both time points (12 and 24 h) to reference methods. Small changes to the assay parameters minimally affected ANSR

  6. Antimicrobial resistance profiles of Shiga toxin-producing Escherichia coli O157 and Non-O157 recovered from domestic farm animals in rural communities in Northwestern Mexico

    Directory of Open Access Journals (Sweden)

    Bianca A. Amézquita-López

    2016-01-01

    Full Text Available Abstract Background Antimicrobial resistance in Shiga toxin-producing Escherichia coli (STEC O157 and non-O157 is a matter of increasing concern. The aim of the present study was to investigate the antimicrobial resistance profiles of STEC O157 and non-O157 recovered from feces of domestic farm animals in the agricultural Culiacan Valley in Northwestern Mexico. Findings All of the examined STEC strains showed susceptibility to five antimicrobials, ceftazidime, ceftriaxone, ciprofloxacin, nalidixic acid, and trimethoprim-sulfamethoxazole. However, resistance to the four antimicrobials, ampicillin, cephalothin, chloramphenicol, and kanamycin was commonly observed. Interestingly, non-susceptibility to cephalothin was predominant among the examined STEC strains, corresponding to 85 % (22/26 of the O157:H7 from cattle, sheep and chicken and 73 % (24/33 of the non-O157 strains from cattle and sheep. Statistical analyses revealed that resistance to ampicillin was significantly correlated to 38 % (10/26 of STEC O157:H7 strains from multiple animal sources. Another significant correlation was found between serotype, source, and antimicrobial resistance; all of the O20:H4 strains, recovered from sheep, were highly resistant to tetracycline. Multidrug resistance profiles were identified in 42 % (22/53 of the non-susceptible STEC strains with clinically-relevant serotypes O8:H9, O75:H8, O146:H21, and O157:H7. Conclusions STEC O157 and non-O157 strains, recovered from domestic farm animals in the Culiacan Valley, exhibited resistance to classes of antimicrobials commonly used in Mexico, such as aminoglycosides, tetracyclines, cephalosporins and penicillin but were susceptible to fluoroquinolones, quinolones, and sulfonamides. These findings provide fundamental information that would aid in the surveillance of antimicrobial resistance in an important agricultural region in Northwestern Mexico.

  7. Detection of water-borne E. coli O157 using the integrating waveguide biosensor☆

    OpenAIRE

    Zhu, Peixuan; Shelton, Daniel R.; Karns, Jeffrey S.; Sundaram, Appavu; Li, Shuhong; Amstutz, Pete; Tang, Cha-Mei

    2005-01-01

    Escherichia coli O157:H7, the most common serotype of enterohemorrhagic E. coli (EHEC), is responsible for numerous food-borne and water-borne infections worldwide. An integrating waveguide biosensor is described for the detection of water-borne E. coli O157, based on a fluorescent sandwich immunoassay performed inside a glass capillary waveguide. The genomic DNA of captured E. coli O157 cells was extracted and quantitative real-time PCR subsequently performed to assess biosensor-capture effi...

  8. Exploring the faint source population at 15.7 GHz

    CERN Document Server

    Whittam, Imogen H; Green, David A; Jarvis, Matt J

    2016-01-01

    We discuss our current understanding of the nature of the faint, high-frequency radio sky. The Tenth Cambridge (10C) survey at 15.7 GHz is the deepest high-frequency radio survey to date, covering 12 square degrees to a completeness limit of 0.5 mJy, making it the ideal starting point from which to study this population. In this work we have matched the 10C survey to several lower-frequency radio catalogues and a wide range of multi-wavelength data (near- and far-infrared, optical and X-ray). We find a significant increase in the proportion of flat-spectrum sources at flux densities below 1 mJy - the median radio spectral index between 15.7 GHz and 610 MHz changes from 0.75 for flux densities greater than 1.5 mJy to 0.08 for flux densities less than 0.8 mJy. The multi-wavelength analysis shows that the vast majority (> 94 percent) of the 10C sources are radio galaxies; it is therefore likely that these faint, flat spectrum sources are a result of the cores of radio galaxies becoming dominant at high frequenci...

  9. Prevalence of hydrocephalus in 157 patients with vestibular schwannoma

    Energy Technology Data Exchange (ETDEWEB)

    Rogg, Jeffrey M.; Ahn, S.H.; Tung, G.A. [Rhode Island Hospital, Department of Diagnostic Imaging, Providence, Rhode Island (United States); Reinert, S.E. [Rhode Island Hospital, Lifespan Medical Computing, Providence, Rhode Island (United States); Noren, G. [Rhode Island Hospital, Department of Neurosurgery, Providence, Rhode Island (United States)

    2005-05-01

    The purpose of this study was to determine the prevalence of hydrocephalus in patients with vestibular schwannoma. A second objective was to investigate possible etiologies for hydrocephalus in this population by attempting to correlate the incidence and severity of hydrocephalus with tumor volume and extent of fourth ventricular compression. The MRI examinations of 157 adult patients with vestibular schwannoma were retrospectively reviewed. Tumor size was quantified, and the presence of accompanying hydrocephalus was assessed, categorized as communicating type or non-communicating type and then rated as mild, moderate or severe (grades 1-3). Next, the degree of fourth ventricular distortion caused by tumor mass effect was evaluated and categorized as mild, moderate or severe (grades 1-3). Spearman's rank correlation coefficient was used to test the relationships between tumor volume and (1) the extent of fourth ventricular effacement and (2) severity of hydrocephalus. Hydrocephalus was present in 28/157 (18%) cases and was categorized as mild in 11/28 (39%), moderate in 15/28 (54%) and severe in 2/28 (7%). Communicating-type hydrocephalus was present in 17/28 (61%) and non-communicating type in 11/28 (39%). There was a positive correlation between the grade of non-communicating hydrocephalus and tumor volume (r=0.38; P<0.001) and between the severity of fourth ventricular compression and extent of hydrocephalus in this group(r=0.43; P<0.001). (orig.)

  10. The Escherichia coli O157:H7 bovine rumen fluid proteome reflects adaptive bacterial responses

    OpenAIRE

    Kudva, Indira T.; Stanton, Thaddeus B; John D Lippolis

    2014-01-01

    Background To obtain insights into Escherichia coli O157:H7 (O157) survival mechanisms in the bovine rumen, we defined the growth characteristics and proteome of O157 cultured in rumen fluid (RF; pH 6.0-7.2 and low volatile fatty acid content) obtained from rumen-fistulated cattle fed low protein content “maintenance diet” under diverse in vitro conditions. Results Bottom-up proteomics (LC-MS/MS) of whole cell-lysates of O157 cultured under anaerobic conditions in filter-sterilized RF (fRF; d...

  11. Dysprosium(III) complexes with a square-antiprism configuration featuring mononuclear single-molecule magnetic behaviours based on different β-diketonate ligands and auxiliary ligands.

    Science.gov (United States)

    Zhang, Sheng; Ke, Hongshan; Shi, Quan; Zhang, Jangwei; Yang, Qi; Wei, Qing; Xie, Gang; Wang, Wenyuan; Yang, Desuo; Chen, Sanping

    2016-03-28

    Three mononuclear dysprosium(III) complexes derived from three β-diketonate ligands, 4,4,4-trifluoro-1-(4-methylphenyl)-1,3-butanedione (tfmb), 4,4,4-trifluoro-1-(4-fluorophenyl)-1,3-butanedione (tffb) and 4,4,4-trifluoro-1-(2-naphthyl)-1,3-butanedione (tfnb) as well as auxiliary ligands, 5-nitro-1,10-phenanthroline (5-NO2-Phen), DMF and 2,2'-bipyridine (bpy) have been synthesized and structurally characterized, namely [Dy(5-NO2-Phen)(tfmb)3] (1), [Dy(DMF)2(tffb)3] (2) and [Dy(bpy)2(tfnb)3]·0.5(1,4-dioxane) (3). The metal ions in 1-3 adopt an approximately square-antiprismatic (SAP) coordination environment with D4d axial symmetry. The magnetic properties of 1-3 have been investigated, displaying weak out-of-phase AC signals under a zero-DC field. With an applied DC field of 1200 Oe, the quantum tunnelling of the magnetization was suppressed in 1-3 with the pre-exponential factor τ0 = 5.3 × 10(-7) s and the effective barrier ΔE/kB = 83 K for 1 as well as the pre-exponential factor τ0 = 3.09 × 10(-7) s and the effective barrier ΔE/kB = 39 K for 3. Interestingly, for the frequency dependence of the out-of-phase (χ'') of the AC susceptibility of 2, two slow relaxation of the magnetization processes occurred under the applied magnetic field of 1200 Oe, corresponding to the fast relaxation (FR) phase and slow relaxation (SR) phase, respectively. Arrhenius analysis gave the effective energy barrier (ΔE/kB) of 55 K and the pre-exponential factor (τ0) of 8.23 × 10(-12) for the SR. It is thus very likely that the FR process in complex 2 results from QTM enhanced by dipolar interactions between the Dy ions or the presence of the applied field. The structure-property relationship of some Dy(III) based mononuclear SMMs with the SAP configuration was further discussed.

  12. Magnetic Phase Transition of Nanocrystalline Bulk Metal Gadolinium and Dysprosium%纳米块体金属钆和镝的磁性相变分析

    Institute of Scientific and Technical Information of China (English)

    刘凤艳; 侯碧辉; 岳明; 王克军

    2011-01-01

    The magnetic properties of bulk nanocrystalline metal gadolinium (Gd) and dysprosium (Dy)samples were studied.The magnetization and Curie temperature TC of nanocrystalline Gd and Dy decreased usually as compared with the polycrystal.However,when the mean grain size was 10 nm, the Curie temperature Tc of nanocrystalline Dy increased to 100 K instead and there was an antiferromagnetic phase in nanocrystalline Gd.According to the calculation based on Ruderman-Kittel-Kasuya-Yosida exchange interaction, the exchange integral of the grain boundary atoms and crystalline surface atoms had its sign changed from plus to minus or vice versa, and there were three orderly phases in the steady state with the lowest energy, ferromagnetic phase, antiferromagnetic phase and fan phase.For the nanocrystals with mean grain size of 10 nm, the proportion of grain boundary to crystalline surface atoms was high, and as the result of superposition of the three phases, and there appeared a peak near the phase transition temperature for the nanocrystalline Gd.While for the Dy, the magnetization decreased gently with temperature, and showing a higher Curie temperature than in the case of the polycrystal.%对纳米晶钆(Gd)和镝(Dy)块体材料的磁性进行了研究.与多晶比较,通常纳米晶的磁化强度减小,居里温度TC降低,但平均粒径为10 nm的纳米晶Dy的居里温度TC反而升高到100 K,平均粒径为10 nm的纳米晶Gd中还存在明显的反铁磁相.通过RKKY交换作用的计算知道,晶面晶界处原子的交换积分会发生正负号的变化,能量最低的稳定状态对应三种有序相:铁磁相、反铁磁相和扇相,晶粒中在一定条件下出现三相共存.对于平均粒径为10 nm的纳米晶,晶面晶界处原子所占比例很大,三相叠加的结果,对于Gd,即是在相变点附近出现磁化强度尖峰;对于Dy,则是磁化强度随温度升高下降缓慢,表现为居里温度TC比多晶升高.

  13. An Escherichia coli O157-Specific Engineered Pyocin Prevents and Ameliorates Infection by E. coli O157:H7 in an Animal Model of Diarrheal Disease▿†

    OpenAIRE

    2011-01-01

    AvR2-V10.3 is an engineered R-type pyocin that specifically kills Escherichia coli O157, an enteric pathogen that is a major cause of food-borne diarrheal disease. New therapeutics to counteract E. coli O157 are needed, as currently available antibiotics can exacerbate the consequences of infection. We show here that orogastric administration of AvR2-V10.3 can prevent or ameliorate E. coli O157:H7-induced diarrhea and intestinal inflammation in an infant rabbit model of infection when the com...

  14. Identification of Protozoa in Dairy Lagoon Wastewater that Consume Escherichia coli O157:H7 Preferentially

    Science.gov (United States)

    Ravva, Subbarao V.; Sarreal, Chester Z.; Mandrell, Robert E.

    2010-01-01

    Escherichia coli O157:H7 (EcO157), an agent of life threatening hemolytic-uremic syndrome, resides in ruminants and is released in feces at numbers as high as 10 million cells/gram. EcO157 could survive in manure for as long as 21 months, but we observed a 90% decrease in cells of an outbreak strain of EcO157 within half a day in wastewater from dairy lagoons. Although chemical, environmental and biological factors may be responsible for this decrease, we observed an 11-fold increase in native protozoa when wastewater was re-inoculated with 2×107 cells of EcO157/mL. These protozoa engulfed the green fluorescent protein labeled EcO157 within 2 hours after inoculation, but expelled vacuoles filled with live EcO157 cells within 3 days into surrounding wastewater, whereas other protozoa retained the EcO157-filled vacuoles for 7 days. EcO157 was not detected by confocal microscopy either inside or outside protozoa after 7 days. Mixed cultures of protozoa enriched from wastewater consumed EcO157 preferentially as compared to native aerobic bacteria, but failed to eliminate them when EcO157 cells declined to 104/mL. We isolated three protozoa from mixed cultures and typed them by 18S sequencing as Vorticella microstoma, Platyophyra sp. and Colpoda aspera. While all three protozoa internalized EcO157, only Platyophyra and Colpoda acted as predators. Similar to mixed cultures, these protozoa failed to eliminate EcO157 from PBS containing no other supplemental nutrients or prey. However, spiking PBS with cereal grass medium as nutrients induced predation of EcO157 by Platyophyra sp. after 3 days or enhanced predation by Colpoda after 5 days. Therefore, attempts to enrich protozoa to decrease EcO157 from dairy lagoons, may correspond to an increase in protozoa similar to Vorticella and possibly facilitate transport of bacterial pathogens to food crops grown in proximity. PMID:21187934

  15. Identification of protozoa in dairy lagoon wastewater that consume Escherichia coli O157:H7 preferentially.

    Science.gov (United States)

    Ravva, Subbarao V; Sarreal, Chester Z; Mandrell, Robert E

    2010-12-20

    Escherichia coli O157:H7 (EcO157), an agent of life threatening hemolytic-uremic syndrome, resides in ruminants and is released in feces at numbers as high as 10 million cells/gram. EcO157 could survive in manure for as long as 21 months, but we observed a 90% decrease in cells of an outbreak strain of EcO157 within half a day in wastewater from dairy lagoons. Although chemical, environmental and biological factors may be responsible for this decrease, we observed an 11-fold increase in native protozoa when wastewater was re-inoculated with 2×10(7) cells of EcO157/mL. These protozoa engulfed the green fluorescent protein labeled EcO157 within 2 hours after inoculation, but expelled vacuoles filled with live EcO157 cells within 3 days into surrounding wastewater, whereas other protozoa retained the EcO157-filled vacuoles for 7 days. EcO157 was not detected by confocal microscopy either inside or outside protozoa after 7 days. Mixed cultures of protozoa enriched from wastewater consumed EcO157 preferentially as compared to native aerobic bacteria, but failed to eliminate them when EcO157 cells declined to 10(4)/mL. We isolated three protozoa from mixed cultures and typed them by 18S sequencing as Vorticella microstoma, Platyophyra sp. and Colpoda aspera. While all three protozoa internalized EcO157, only Platyophyra and Colpoda acted as predators. Similar to mixed cultures, these protozoa failed to eliminate EcO157 from PBS containing no other supplemental nutrients or prey. However, spiking PBS with cereal grass medium as nutrients induced predation of EcO157 by Platyophyra sp. after 3 days or enhanced predation by Colpoda after 5 days. Therefore, attempts to enrich protozoa to decrease EcO157 from dairy lagoons, may correspond to an increase in protozoa similar to Vorticella and possibly facilitate transport of bacterial pathogens to food crops grown in proximity.

  16. Identification of protozoa in dairy lagoon wastewater that consume Escherichia coli O157:H7 preferentially.

    Directory of Open Access Journals (Sweden)

    Subbarao V Ravva

    Full Text Available Escherichia coli O157:H7 (EcO157, an agent of life threatening hemolytic-uremic syndrome, resides in ruminants and is released in feces at numbers as high as 10 million cells/gram. EcO157 could survive in manure for as long as 21 months, but we observed a 90% decrease in cells of an outbreak strain of EcO157 within half a day in wastewater from dairy lagoons. Although chemical, environmental and biological factors may be responsible for this decrease, we observed an 11-fold increase in native protozoa when wastewater was re-inoculated with 2×10(7 cells of EcO157/mL. These protozoa engulfed the green fluorescent protein labeled EcO157 within 2 hours after inoculation, but expelled vacuoles filled with live EcO157 cells within 3 days into surrounding wastewater, whereas other protozoa retained the EcO157-filled vacuoles for 7 days. EcO157 was not detected by confocal microscopy either inside or outside protozoa after 7 days. Mixed cultures of protozoa enriched from wastewater consumed EcO157 preferentially as compared to native aerobic bacteria, but failed to eliminate them when EcO157 cells declined to 10(4/mL. We isolated three protozoa from mixed cultures and typed them by 18S sequencing as Vorticella microstoma, Platyophyra sp. and Colpoda aspera. While all three protozoa internalized EcO157, only Platyophyra and Colpoda acted as predators. Similar to mixed cultures, these protozoa failed to eliminate EcO157 from PBS containing no other supplemental nutrients or prey. However, spiking PBS with cereal grass medium as nutrients induced predation of EcO157 by Platyophyra sp. after 3 days or enhanced predation by Colpoda after 5 days. Therefore, attempts to enrich protozoa to decrease EcO157 from dairy lagoons, may correspond to an increase in protozoa similar to Vorticella and possibly facilitate transport of bacterial pathogens to food crops grown in proximity.

  17. 157 W all-fiber high-power picosecond laser.

    Science.gov (United States)

    Song, Rui; Hou, Jing; Chen, Shengping; Yang, Weiqiang; Lu, Qisheng

    2012-05-01

    An all-fiber high-power picosecond laser is constructed in a master oscillator power amplifier configuration. The self-constructed fiber laser seed is passively mode locked by a semiconductor saturable absorber mirror. Average output power of 157 W is obtained after three stages of amplification at a fundamental repetition rate of 60 MHz. A short length of ytterbium double-clad fiber with a high doping level is used to suppress nonlinear effects. However, a stimulated Raman scattering (SRS) effect occurs owing to the 78 kW high peak power. A self-made all-fiber repetition rate increasing system is used to octuple the repetition rate and decrease the high peak power. Average output power of 156.6 W is obtained without SRS under the same pump power at a 480 MHz repetition rate with 0.6 nm line width.

  18. Occurrence of Escherichia coli O157 in a river used for fresh ...

    African Journals Online (AJOL)

    PRECIOUS

    2010-01-11

    Jan 11, 2010 ... 1Department of Microbiology, University of Nigeria, Nsukka, Enugu State, ... seasonal levels of water quality parameters in Kubanni River were ... Escherichia coli O157 is an important agent of food- and ... O157 in water sources made this study imperative. .... salad crops (<1000 faecal coliforms/100 ml).

  19. Internalization of E. coli O157:H7 in spinach cultivated in soil and hydroponic media

    Science.gov (United States)

    Introduction: Internalization of E. coli O157:H7 into spinach plants through root uptake is a potential route of contamination. Previous studies that have investigated uptake of E. coli O157:H7 into leafy greens have expressed green fluorescent protein (gfp) from a plasmid, possibly limiting detecti...

  20. 33 CFR 157.210 - Approved Dedicated Clean Ballast Tanks Operations Manual.

    Science.gov (United States)

    2010-07-01

    ... RELATING TO TANK VESSELS CARRYING OIL IN BULK Dedicated Clean Ballast Tanks on Tank Vessels General § 157.210 Approved Dedicated Clean Ballast Tanks Operations Manual. If the manuals submitted under § 157.206... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Approved Dedicated Clean...

  1. 33 CFR 157.172 - Limitations on grades of crude oil carried.

    Science.gov (United States)

    2010-07-01

    ... § 157.10c(b)(2) does not have segregated ballast tanks or dedicated clean ballast tanks that meet § 157... HOMELAND SECURITY (CONTINUED) POLLUTION RULES FOR THE PROTECTION OF THE MARINE ENVIRONMENT RELATING TO TANK VESSELS CARRYING OIL IN BULK Crude Oil Washing (COW) System on Tank Vessels Cow Operations §...

  2. Detection of Escherichia Coli O157:H7 in Fecal Samples in Meat Goats

    Science.gov (United States)

    Mobley, Ray; Madden, Uford; Brooks-Walter, Alexis

    2004-01-01

    Studies have reported the isolation of Escherichia coli (E. coli)O157:H7 from pork, lamb and poultry products, and from other animals including deer, horses, dogs, birds and humans. There is limited or no information on the presence of the organism in goats. The objectives of this study were to determine if E. coli O157:H7 was naturally occurring…

  3. 42 CFR 413.157 - Return on equity capital of proprietary providers.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 2 2010-10-01 2010-10-01 false Return on equity capital of proprietary providers. 413.157 Section 413.157 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH... tangible assets of a facility acquired on or after August 1, 1970, the excess of the price paid for...

  4. Transmission electron microscopy study of enterohemorrhagic Escherichia coli O157:H7 in apple tissue.

    Science.gov (United States)

    Janes, Marlene E; Kim, K S; Johnson, M G

    2005-02-01

    We investigated the ability of enterohemorrhagic Escherichia coli O157:H7 to spread in wounded apple tissue by transmission electron microscopy. Red Delicious apples were wounded with an artist knife (7 mm depth) and either inoculated with 10 microl per wound of decimally diluted E. coli O157:H7 or submerged into E. coli O157:H7 suspended in sterile distilled water and then stored at 37 degrees C for 24 h. Transmission electron microscopy showed E. coli O157:H7 formed bacterial aggregates near the apple cell walls, and single cells were in close proximity to the apple cell wall surfaces and to plasma membranes. E. coli O157:H7 presence caused degradation of plasma membranes and release of the cytoplasm contents of the apple cortical cells into the central vacuole. Apple tissue turgor pressure tests showed that the apple cells infected with E. coli O157:H7 isolates were more likely to rupture than the control noninoculated apple cells. E. coli O157:H7 cells grown in apple tissue showed the formation of granules and vesicles within the bacterial cytoplasma and separation of the plasma membranes. Our study shows that E. coli O157:H7 can grow and survive in the apple tissue environment by causing degradation of the apple cellular components.

  5. Antibacterial activity of cinnamaldehyde and Sporan against Escherichia coli O157:H7 and Salmonella

    Science.gov (United States)

    The in vitro antimicrobial effect of cinnamaldehyde and Sporan in combination with acetic acid against E. coli O157:H7 and Salmonella was investigated. A five strain cocktail of E. coli O157:H7 and Salmonella were inoculated in Luria-Bertoni broth (LB broth, 7 log CFU ml-1) containing cinnamaldehyde...

  6. 18 CFR 157.9 - Notice of application and notice of schedule for environmental review.

    Science.gov (United States)

    2010-04-01

    ... that will require an environmental assessment or an environmental impact statement, notice of a... and notice of schedule for environmental review. 157.9 Section 157.9 Conservation of Power and Water... Amended, Concerning Any Operation, Sales, Service, Construction, Extension, Acquisition or...

  7. Verocytotoxin producing E. Coli O157 on farms : prevalences, risk factors and transmission

    NARCIS (Netherlands)

    Schouten, J.M.

    2005-01-01

    Infection with verocytotoxin producing Escherichia coli (VTEC) O157 in humans can lead to mild or bloody diarrhoea, with e.g. the haemolytic uraemic syndrome (HUS) as possible complication. Cattle appear to be important reservoirs of O157 VTEC. The main objectiv

  8. 18 CFR 157.18 - Applications to abandon facilities or service; exhibits.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Applications to abandon facilities or service; exhibits. 157.18 Section 157.18 Conservation of Power and Water Resources FEDERAL..., Concerning Any Operation, Sales, Service, Construction, Extension, Acquisition or Abandonment §...

  9. Cardiovascular disease after Escherichia coli O157:H7 gastroenteritis

    Science.gov (United States)

    Hizo-Abes, Patricia; Clark, William F.; Sontrop, Jessica M.; Young, Ann; Huang, Anjie; Thiessen-Philbrook, Heather; Austin, Peter C.; Garg, Amit X.

    2013-01-01

    Background: Escherichia coli O157:H7 is one cause of acute bacterial gastroenteritis, which can be devastating in outbreak situations. We studied the risk of cardiovascular disease following such an outbreak in Walkerton, Ontario, in May 2000. Methods: In this community-based cohort study, we linked data from the Walkerton Health Study (2002–2008) to Ontario’s large healthcare databases. We included 4 groups of adults: 3 groups of Walkerton participants (153 with severe gastroenteritis, 414 with mild gastroenteritis, 331 with no gastroenteritis) and a group of 11 263 residents from the surrounding communities that were unaffected by the outbreak. The primary outcome was a composite of death or first major cardiovascular event (admission to hospital for acute myocardial infarction, stroke or congestive heart failure, or evidence of associated procedures). The secondary outcome was first major cardiovascular event censored for death. Adults were followed for an average of 7.4 years. Results: During the study period, 1174 adults (9.7%) died or experienced a major cardiovascular event. Compared with residents of the surrounding communities, the risk of death or cardiovascular event was not elevated among Walkerton participants with severe or mild gastroenteritis (hazard ratio [HR] for severe gastroenteritis 0.74, 95% confidence interval [CI] 0.38–1.43, mild gastroenteritis HR 0.64, 95% CI 0.42–0.98). Compared with Walkerton participants who had no gastroenteritis, risk of death or cardiovascular event was not elevated among participants with severe or mild gastroenteritis. Interpretation: There was no increase in the risk of cardiovascular disease in the decade following acute infection during a major E. coli O157:H7 outbreak. PMID:23166291

  10. Enumeration of Escherichia coli O157:H7 in Outbreak-Associated Beef Patties.

    Science.gov (United States)

    Gill, Alexander; Huszczynski, George

    2016-07-01

    An outbreak of five cases of Escherichia coli O157 infection that occurred in Canada in 2012 was linked to frozen beef patties seasoned with garlic and peppercorn. Unopened retail packs of beef patties from the implicated production lot were recovered and analyzed to enumerate E. coli O157, other E. coli strains, and total coliforms. E. coli O157 was not recovered by direct enumeration on selective agar media. E. coli O157 in the samples was estimated at 3.1 most probable number per 140 g of beef patty, other E. coli was 11 CFU/g, and coliforms were 120 CFU/g. These results indicate that the presence of E. coli O157 in ground beef at levels below 0.1 CFU/g may cause outbreaks. However, the roles of temperature abuse, undercooking, and crosscontamination in amplifying the risk are unknown.

  11. Impact of Vacuum Cooling on Escherichia coli O157:H7 Infiltration into Lettuce Tissue▿

    Science.gov (United States)

    Li, Haiping; Tajkarimi, Mehrdad; Osburn, Bennie I.

    2008-01-01

    Vacuum cooling is a common practice in the California leafy green industry. This study addressed the impact of vacuum cooling on the infiltration of Escherichia coli O157:H7 into lettuce as part of the risk assessment responding to the E. coli O157:H7 outbreaks associated with leafy green produce from California. Vacuum cooling significantly increased the infiltration of E. coli O157:H7 into the lettuce tissue (2.65E+06 CFU/g) compared to the nonvacuumed condition (1.98E+05 CFU/g). A stringent surface sterilization and quadruple washing could not eliminate the internalized bacteria from lettuce. It appeared that vacuuming forcibly changed the structure of lettuce tissue such as the stomata, suggesting a possible mechanism of E. coli O157:H7 internalization. Vacuuming also caused a lower reduction rate of E. coli O157:H7 in stored lettuce leaves than that for the nonvacuumed condition. PMID:18344328

  12. Changes in Gene Transcription Induced by Hydrogen Peroxide Treatment of Verotoxin-Producing Escherichia coli O157:H7 and Non-O157 Serotypes on Romaine Lettuce

    Science.gov (United States)

    Mei, Gui-Ying; Tang, Joshua; Bach, Susan; Kostrzynska, Magdalena

    2017-01-01

    Disease outbreaks of verotoxin-producing Escherichia coli (VTEC) O157:H7 and non-O157 serotypes associated with leafy green vegetables are becoming a growing concern. A better understanding of the behavior of VTEC, particularly non-O157 serotypes, on lettuce under stress conditions is necessary for designing more effective control strategies. Hydrogen peroxide (H2O2) can be used as a sanitizer to reduce the microbial load in leafy green vegetables, particularly in fresh produce destined for the organic market. In this study, we tested the hypothesis that H2O2 treatment of contaminated lettuce affects in the same manner transcription of stress-associated and virulence genes in VTEC strains representing O157 and non-O157 serotypes. Six VTEC isolates representing serotypes O26:H11, O103:H2, O104:H4, O111:NM, O145:NM, and O157:H7 were included in this study. The results indicate that 50 mM H2O2 caused a population reduction of 2.4–2.8 log10 (compared to non-treated control samples) in all six VTEC strains present on romaine lettuce. Following the treatment, the transcription of genes related to oxidative stress (oxyR and sodA), general stress (uspA and rpoS), starvation (phoA), acid stress (gadA, gadB, and gadW), and virulence (stx1A, stx2A, and fliC) were dramatically downregulated in all six VTEC serotypes (P ≤ 0.05) compared to not treated control samples. Therefore, VTEC O157:H7 and non-O157 serotypes on lettuce showed similar survival rates and gene transcription profiles in response to 50 mM H2O2 treatment. Thus, the results derived from this study provide a basic understanding of the influence of H2O2 treatment on the survival and virulence of VTEC O157:H7 and non-O157 serotypes on lettuce.

  13. Early Attachment Sites for Shiga-toxigenic Escherichia coli O157:H7 in Experimentally Inoculated Weaned Calves

    Science.gov (United States)

    Weaned 3-to- 4-month-old calves were fasted 48 h, inoculated with 10**10 CFU of Shiga toxin-positive Escherichia coli (STEC) O157:H7 strain 86-24 (STEC O157) or STEC O91:H21 strain B2F1 (STEC O91), Shiga toxin-negative E. coli O157:H7 strain 87-23 (Stx**- O157), or non-pathogenic control E. coli, ne...

  14. Survival in acidic and alcoholic medium of Shiga toxin-producing Escherichia coli O157:H7 and non-O157:H7 isolated in Argentina

    Directory of Open Access Journals (Sweden)

    Sanz Marcelo E

    2003-08-01

    Full Text Available Abstract Background In spite of Argentina having one of the highest frequencies of haemolytic uraemic syndrome (HUS, the incidence of Escherichia coli O157:H7 is low in comparison to rates registered in the US. Isolation of several non-O157 shiga toxin-producing Escherichia coli (STEC strains from cattle and foods suggests that E. coli O157:H7 is an uncommon serotype in Argentina. The present study was undertaken to compare the survival rates of selected non-O157 STEC strains under acidic and alcoholic stress conditions, using an E. coli O157:H7 strain as reference. Results Growth at 37°C of E. coli O26:H11, O88:H21, O91:H21, O111:H-, O113:H21, O116:H21, O117:H7, O157:H7, O171:H2 and OX3:H21, was found to occur at pH higher than 4.0. When the strains were challenged to acid tolerance at pH as low as 2.5, viability extended beyond 8 h, but none of the bacteria, except E. coli O91:H21, could survive longer than 24 h, the autochthonous E. coli O91:H21 being the more resistant serotype. No survival was found after 24 h in Luria Bertani broth supplemented with 12% ethanol, but all these serotypes were shown to be very resistant to 6% ethanol. E. coli O91:H21 showed the highest resistance among serotypes tested. Conclusions This information is relevant in food industry, which strongly relies on the acid or alcoholic conditions to inactivate pathogens. This study revealed that stress resistance of some STEC serotypes isolated in Argentina is higher than that for E. coli O157:H7.

  15. 42 CFR 84.157 - Airflow resistance test; Type C supplied-air respirator, pressure-demand class; minimum...

    Science.gov (United States)

    2010-10-01

    ... respirator, pressure-demand class; minimum requirements. 84.157 Section 84.157 Public Health PUBLIC HEALTH... ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Supplied-Air Respirators § 84.157 Airflow resistance test; Type C supplied-air respirator, pressure-demand class; minimum requirements. (a) The...

  16. 33 CFR Appendix A to Part 157 - Damage Assumptions, Hypothetical Outflows, and Cargo Tank Size and Arrangements

    Science.gov (United States)

    2010-07-01

    ... Outflows, and Cargo Tank Size and Arrangements A Appendix A to Part 157 Navigation and Navigable Waters... MARINE ENVIRONMENT RELATING TO TANK VESSELS CARRYING OIL IN BULK Pt. 157, App. A Appendix A to Part 157... from tank vessels, three dimensions of the extent of damage of a parallelepiped on the side and...

  17. 75 FR 10460 - Improving Tracing Procedures for E. coli O157:H7 Positive Raw Beef Product

    Science.gov (United States)

    2010-03-08

    ... Food Safety Inspection Service Improving Tracing Procedures for E. coli O157:H7 Positive Raw Beef... raw beef product that FSIS has found positive for Escherichia coli (E. coli) O157:H7. FSIS will also... Agency procedures for identifying product that may be positive for E. coli O157:H7. DATES: The public...

  18. Super-Shed Escherichia coli O157:H7 have potential for increased pathogen persistence and antibiotic resistance dissemination

    Science.gov (United States)

    Cattle are primary reservoirs of Escherichia coli O157:H7 (O157), and super-shedding cattle shed O157 at greater than or equal to 10,000 colony-forming units/g feces. Host, bacteria, and/or the environment reportedly influence the super-shedding phenomenon. We recently demonstrated that a super-she...

  19. Influence of bacterial communities based on 454-pyrosequencing on the survival of Escherichia coli O157:H7 in soils

    Science.gov (United States)

    Shiga toxin-producing Escherichia coli O157:H7 has been implicated in many foodborne illnesses. In this study, survival of E. coli O157:H7 in 32 soils from California (CA) and Arizona (AZ) was investigated. Our goal was to correlate the survival time of E. coli O157:H7 in soils with 16S rRNA pyroseq...

  20. Sensitive detection of Escherichia coli O157:H7 based on cascade signal amplification in ELISA.

    Science.gov (United States)

    Shan, Shan; Liu, Daofeng; Guo, Qi; Wu, Songsong; Chen, Rui; Luo, Kai; Hu, Liming; Xiong, Yonghua; Lai, Weihua

    2016-09-01

    In this study, cascade signal amplification in ELISA involving double-antibody sandwich ELISA and indirectly competitive ELISA was established to sensitively detect Escherichia coli O157:H7. In the double-antibody sandwich ELISA, a complex was formed comprising anti-E. coli O157:H7 polyclonal antibody, E. coli O157:H7, biotinylated anti-E. coli O157:H7 monoclonal antibody, streptavidin, and biotinylated β-lactamase. Penicillin solution was then added into the ELISA well and hydrolyzed by β-lactamase. Afterward, the penicillin solution was transferred to indirectly competitive ELISA. The concentration of penicillin can be sensitively detected in indirectly competitive ELISA. In the cascade signal amplification system, increasing the amount of added E. coli O157:H7 resulted in more β-lactamase and less penicillin. The detection sensitivity of E. coli O157:H7, which was 20cfu/mL with the cascade signal amplification in ELISA, was 1,000-fold higher than that of traditional ELISA. Furthermore, the novel method can be used to detect E. coli O157:H7 in milk (2cfu/g). Therefore, this new signaling strategy will facilitate analyses of highly sensitive foodborne pathogens.

  1. Defects in Polynucleotide phosphorylase impairs virulence in Escherichia coli O157:H7

    Directory of Open Access Journals (Sweden)

    Jia eHu

    2015-08-01

    Full Text Available Polynucleotide phosphorylase (PNPase is reported to regulate virulence in Salmonella, Yersinia spp. and Campylobacter jejuni, yet its role in Escherichia coli O157:H7 has not been investigated. To gain insights into its roles in E. coli O157:H7 virulence, pnp deletion mutants were generated and the major virulence factors were compared to their parental wild type strains. Deletion of pnp in E. coli O157:H7 dramatically decreased stx2 mRNA expression and Stx2 protein production, and impaired lambdoid prophage activation in E. coli O157:H7. Quantitative PCR further confirmed that the Stx2 phage lytic growth was repressed by pnp deletion. Consistent with reduced Stx2 production and Stx2 phage activation, the transcriptional levels of genes involved in phage lysis and replication were down-regulated. In addition, disruption of pnp in E. coli O157:H7 decreased its adhesion to intestinal epithelial cells as well as cattle colonic explant tissues. On the other hand, PNPase inactivation in E. coli O157:H7 enhanced Tir protein content and the transcription of type three secretion system components, including genes encoding intimin, Tir and EspB as well as LEE positive regulator, Ler. Collectively, data indicate that PNPase has pleiotropic effects on the virulence of E. coli O157:H7.

  2. Cloacael Carriage and Multidrug Resistance Escherichia coli O157:H7 from Poultry Farms, Eastern Ethiopia

    Directory of Open Access Journals (Sweden)

    Mude Shecho

    2017-01-01

    Full Text Available A cross-sectional study was carried out to determine antimicrobial drug resistance patterns of E. coli O157:H7 isolates and estimate the level of the pathogen. A total of 194 cloacae swab samples were collected randomly in two poultry farms. Standard cultural, biochemical, and serological (latex agglutination methods were used to isolate E. coli O157:H7. The isolates were subjected to antimicrobial susceptibility testing using disc diffusion method. Out of 194 cloacae samples examined, 13.4% (n=26 were found to be positive for E. coli O157:H7. The finding indicated differences in E. coli O157:H7 infection among the different risk factors. Chicken from Adele Poultry Farm showed higher E. coli O157:H7 infection (OR = 3.89 than Haramaya University poultry farm and young birds had more infection (OR = 4.62 than adult birds. Of the total 14 antimicrobials included in the panel of study, the susceptibility results were varied with 96.15% and 0% E. coli O157:H7 isolates expressing resistance to erythromycin, clindamycin, spectinomycin, and ciprofloxacin, respectively. Multidrug resistance to more than two antimicrobial agents was detected in 24 (92.30% of the isolates. The study showed high presence of antimicrobial resistant isolates of E. coli O157:H7. Further study is required to better understand the ecology and evolution of bacterial resistance to antimicrobial agents.

  3. Cloacael Carriage and Multidrug Resistance Escherichia coli O157:H7 from Poultry Farms, Eastern Ethiopia

    Science.gov (United States)

    Shecho, Mude; Muktar, Yimer

    2017-01-01

    A cross-sectional study was carried out to determine antimicrobial drug resistance patterns of E. coli O157:H7 isolates and estimate the level of the pathogen. A total of 194 cloacae swab samples were collected randomly in two poultry farms. Standard cultural, biochemical, and serological (latex agglutination) methods were used to isolate E. coli O157:H7. The isolates were subjected to antimicrobial susceptibility testing using disc diffusion method. Out of 194 cloacae samples examined, 13.4% (n = 26) were found to be positive for E. coli O157:H7. The finding indicated differences in E. coli O157:H7 infection among the different risk factors. Chicken from Adele Poultry Farm showed higher E. coli O157:H7 infection (OR = 3.89) than Haramaya University poultry farm and young birds had more infection (OR = 4.62) than adult birds. Of the total 14 antimicrobials included in the panel of study, the susceptibility results were varied with 96.15% and 0% E. coli O157:H7 isolates expressing resistance to erythromycin, clindamycin, spectinomycin, and ciprofloxacin, respectively. Multidrug resistance to more than two antimicrobial agents was detected in 24 (92.30%) of the isolates. The study showed high presence of antimicrobial resistant isolates of E. coli O157:H7. Further study is required to better understand the ecology and evolution of bacterial resistance to antimicrobial agents.

  4. Pentadecapeptide BPC 157 Enhances the Growth Hormone Receptor Expression in Tendon Fibroblasts

    Directory of Open Access Journals (Sweden)

    Chung-Hsun Chang

    2014-11-01

    Full Text Available BPC 157, a pentadecapeptide derived from human gastric juice, has been demonstrated to promote the healing of different tissues, including skin, muscle, bone, ligament and tendon in many animal studies. However, the underlying mechanism has not been fully clarified. The present study aimed to explore the effect of BPC 157 on tendon fibroblasts isolated from Achilles tendon of male Sprague-Dawley rat. From the result of cDNA microarray analysis, growth hormone receptor was revealed as one of the most abundantly up-regulated genes in tendon fibroblasts by BPC 157. BPC 157 dose- and time-dependently increased the expression of growth hormone receptor in tendon fibroblasts at both the mRNA and protein levels as measured by RT/real-time PCR and Western blot, respectively. The addition of growth hormone to BPC 157-treated tendon fibroblasts dose- and time-dependently increased the cell proliferation as determined by MTT assay and PCNA expression by RT/real-time PCR. Janus kinase 2, the downstream signal pathway of growth hormone receptor, was activated time-dependently by stimulating the BPC 157-treated tendon fibroblasts with growth hormone. In conclusion, the BPC 157-induced increase of growth hormone receptor in tendon fibroblasts may potentiate the proliferation-promoting effect of growth hormone and contribute to the healing of tendon.

  5. Thermoresponsive oligomers reduce Escherichia coli O157:H7 biofouling and virulence.

    Science.gov (United States)

    Lee, Jin-Hyung; Kim, Yong-Guy; Cho, Hyun Seob; Kim, Jintae; Kim, Seong-Cheol; Cho, Moo Hwan; Lee, Jintae

    2014-01-01

    Thermoresponsive polymers have potential biomedical applications for drug delivery and tissue engineering. Here, two thermoresponsive oligomers were synthesized, viz. oligo(N-isopropylacrylamide) (ONIPAM) and oligo(N-vinylcaprolactam) (OVCL), and their anti-biofouling abilities investigated against enterohemorrhagic E. coli O157:H7, which produces Shiga-like toxins and forms biofilms. Biofilm formation (biofouling) is closely related to E. coli O157:H7 infection and constitutes a major mechanism of antimicrobial resistance. The synthetic OVCL (MW 679) and three commercial OVCLs (up to MW 54,000) at 30 μg ml(-1) were found to inhibit biofouling by E. coli O157:H7 at 37 °C by more than 80% without adversely affecting bacterial growth. The anti-biofouling activity of ONIPAM was weaker than that of OVCL. However, at 25 °C, ONIPAM and OVCL did not affect E. coli O157:H7 biofouling. Transcriptional analysis showed that OVCL temperature-dependently downregulated curli genes in E. coli O157:H7, and this finding was in line with observed reductions in fimbriae production and biofouling. In addition, OVCL downregulated the Shiga-like toxin genes stx1 and stx2 in E. coli O157:H7 and attenuated its in vivo virulence in the nematode Caenorhabditis elegans. These results suggest that OVCL has potential use in antivirulence strategies against persistent E. coli O157:H7 infection.

  6. Comparison of two methods for detection of E. coli O157H7 in unpasteurized milk.

    Science.gov (United States)

    Farahmandfar, Maryam; Moori-Bakhtiari, Naghmeh; Gooraninezhad, Saad; Zarei, Mehdi

    2016-10-01

    The most common serotype of enterohaemorrhagic Esherichia coli group or Shiga-toxin-producing E. coli is O157:H7. Domestic and wild ruminants are regarded as the main natural reservoirs. O157:H7 serotype is the major cause of gastrointestinal infections in developed countries. In this study was conducted to survey on the toxigenic E. coli O157: H7 strains in milk of industrial dairy farms. A total number of 150 milk samples were collected from dairy industry in Khuzestan, over a period of 6 months and were evaluated by cultivation in selective media (CT-SMAC) and multiplex PCR. Two isolates were identified as E. coli using biochemical tests, none of them were toxigenic E. coli O157:H7 as determined by multiplex PCR. Using direct PCR on milk samples, 45 samples contained at least one gene of the studied genes in this investigation (rfb, flic, stx1, stx2). With direct PCR, 2 milk samples were positive for toxigenic O157:H7. E. coli O157:H7 is present in this region and so the necessity for strict compliance of health standards is recommended. This is the first study on O157: H7 E. coli milk contamination in Khuzestan province. Based on these results, direct PCR is more accurate than indirect PCR.

  7. Dysprosium selective potentiometric membrane sensor

    Energy Technology Data Exchange (ETDEWEB)

    Zamani, Hassan Ali, E-mail: haszamani@yahoo.com [Department of Applied Chemistry, Mashhad Branch, Islamic Azad University, Mashhad (Iran, Islamic Republic of); Faridbod, Farnoush; Ganjali, Mohammad Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)

    2013-03-01

    A novel Dy(III) ion-selective PVC membrane sensor was made using a new synthesized organic compound, 3,4-diamino-N Prime -((pyridin-2-yl)methylene)benzohydrazide (L) as an excellent sensing element. The electrode showed a Nernstian slope of 19.8 {+-} 0.6 mV per decade in a wide concentration range of 1.0 Multiplication-Sign 10{sup -6}-1.0 Multiplication-Sign 10{sup -2} mol L{sup -1}, a detection limit of 5.5 Multiplication-Sign 10{sup -7} mol L{sup -1}, a short conditioning time, a fast response time (< 10 s), and high selectivity towards Dy(III) ion in contrast to other cations. The proposed sensor was successfully used as an indicator electrode in the potentiometric titration of Dy(III) ions with EDTA. The membrane sensor was also applied to the F{sup -} ion indirect determination of some mouth washing solutions and to the Dy{sup 3+} determination in binary mixtures. Highlights: Black-Right-Pointing-Pointer The novelty of this work is based on the high affinity of the ionophore toward the Dy{sup 3+} ions. Black-Right-Pointing-Pointer This technique is very simple, fast and inexpensive and it is not necessary to use sophisticated equipment. Black-Right-Pointing-Pointer The newly developed sensor is superior to the formerly reported Dy{sup 3+} sensors in terms of selectivity.

  8. The magnetocaloric effect in dysprosium

    Science.gov (United States)

    Benford, S. M.

    1979-01-01

    The magnetocaloric effect in polycrystalline Dy was measured in the 84-280-K range in measuring fields from 1 to 7 T. These adiabatic temperature changes reflect structural changes in Dy with applied field and temperature, and include the first magnetocaloric data for a helical antiferromagnet. Above the Neel point (179 K) a field increase always caused heating; below the Neel point fields less than about 2 T cause cooling for some values of initial temperature. The largest temperature increase with a 7 T field occurs at the Neel point and at fields below 2 T near the Curie point. For refrigeration purposes the optimal working region for a Dy cooling element is field dependent.

  9. Enhanced detection sensitivity of Escherichia coli O157:H7 using surface-modified gold nanorods

    Directory of Open Access Journals (Sweden)

    Ramasamy M

    2015-08-01

    Full Text Available Mohankandhasamy Ramasamy,1 Dong Kee Yi,2,3 Seong Soo A An4 1School of Chemical Engineering, Yeungnam University, Gyeongsan, 2Department of Chemistry, 3Department of Energy and Biotechnology, Myongji University, Yongin, 4Department of BioNano Technology, Gachon University, Seongnam, Republic of Korea Abstract: Escherichia coli O157:H7 (O157 is a Gram negative and highly virulent bacteria found in food and water sources, and is a leading cause of chronic diseases worldwide. Diagnosis and prevention from the infection require simple and rapid analysis methods for the detection of pathogens, including O157. Endogenous membrane peroxidase, an enzyme present on the surface of O157, was used for the colorimetric detection of bacteria by catalytic oxidation of the peroxidase substrate. In this study, we have analyzed the impact of the synthesized bare gold nanorods (AuNRs and silica-coated AuNRs on the growth of E. coli O157. Along with the membrane peroxidase activity of O157, other bacteria strains were analyzed. Different concentrations of nanorods were used to analyze the growth responses, enzymatic changes, and morphological alterations of bacteria by measuring optical density, 3,3',5,5'-tetramethylbenzidine assay, flow cytometry analysis, and microscopy studies. The results revealed that O157 showed higher and continuous membrane peroxidase activity than other bacteria. Furthermore, O157 treated with bare AuNRs showed a decreased growth rate in comparison with the bacteria with surface modified AuNRs. Interestingly, silica-coated AuNRs favored the growth of bacteria and also increased membrane peroxidase activity. This result can be particularly important for the enzymatic analysis of surface treated AuNRs in various microbiological applicants. Keywords: E. coli, O157:H7, endogenous membrane peroxidase, gold nanorod, silica-coated gold nanorod

  10. Inactivation of Escherichia coli O157:H7 attached to spinach harvester blade using bacteriophage.

    Science.gov (United States)

    Patel, Jitendra; Sharma, Manan; Millner, Patricia; Calaway, Todd; Singh, Manpreet

    2011-04-01

    Outbreaks associated with leafy greens have focused attention on the transfer of human pathogens to these commodities during harvest with commercial equipment. Attachment of Escherichia coli O157:H7 on new or rusty spinach harvester blades immersed in spinach extract or 10% tryptic soy broth (TSB) was investigated. Bacteriophages specific for E. coli O157:H7 were evaluated to kill cells attached to blade. A cocktail of five nalidixic acid-resistant E. coli O157:H7 isolates was transferred to 25 mL of spinach extract or 10% TSB. A piece of sterilized spinach harvester blade (2×1") was placed in above spinach extract or 10% TSB and incubated at room (22 °C) or dynamic (30 °C day, 20 °C night) temperatures. E. coli O157:H7 populations attached to blade during incubation in spinach extract or 10% TSB were determined. When inoculated at 1 log CFU/mL, E. coli O157:H7 attachment to blades after 24 and 48 h incubation at dynamic temperature (6.09 and 6.37 log CFU/mL) was significantly higher than when incubated at 22 °C (4.84 and 5.68 log CFU/mL), respectively. After 48 h incubation, two blades were sprayed on each side with a cocktail of E. coli O157-specific bacteriophages before scraping the blade, and subsequent plating on Sorbitol MacConkey media-nalidixic acid. Application of bacteriophages reduced E. coli O157:H7 populations by 4.5 log CFU on blades after 2 h of phage treatment. Our study demonstrates that E. coli O157:H7 can attach to and proliferate on spinach harvester blades under static and dynamic temperature conditions, and bacteriophages are able to reduce E. coli O157:H7 populations adhered to blades.

  11. British Escherichia coli O157 in Cattle Study (BECS): to determine the prevalence of E. coli O157 in herds with cattle destined for the food chain.

    Science.gov (United States)

    Henry, M K; Tongue, S C; Evans, J; Webster, C; McKENDRICK, I J; Morgan, M; Willett, A; Reeves, A; Humphry, R W; Gally, D L; Gunn, G J; Chase-Topping, M E

    2017-09-19

    Escherichia coli O157 are zoonotic bacteria for which cattle are an important reservoir. Prevalence estimates for E. coli O157 in British cattle for human consumption are over 10 years old. A new baseline is needed to inform current human health risk. The British E. coli O157 in Cattle Study (BECS) ran between September 2014 and November 2015 on 270 farms across Scotland and England & Wales. This is the first study to be conducted contemporaneously across Great Britain, thus enabling comparison between Scotland and England & Wales. Herd-level prevalence estimates for E. coli O157 did not differ significantly for Scotland (0·236, 95% CI 0·166-0·325) and England & Wales (0·213, 95% CI 0·156-0·283) (P = 0·65). The majority of isolates were verocytotoxin positive. A higher proportion of samples from Scotland were in the super-shedder category, though there was no difference between the surveys in the likelihood of a positive farm having at least one super-shedder sample. E. coli O157 continues to be common in British beef cattle, reaffirming public health policy that contact with cattle and their environments is a potential infection source.

  12. Enumeration of Escherichia coli O157 in Outbreak-Associated Gouda Cheese Made with Raw Milk.

    Science.gov (United States)

    Gill, Alexander; Oudit, Denise

    2015-09-01

    In this article, we discuss the enumerative analysis for Escherichia coli O157 in two raw milk Gouda cheese products (A and B), implicated in an outbreak of 29 cases of E. coli O157:H7 illness that occurred across Canada in 2013. Samples were enumerated for E. coli O157 by most probable number (MPN) over a period of 30 to 60 days after the end of the outbreak. Samples (55.55 g) of product A (n = 14) were analyzed at 146 to 180 days postproduction. E. coli O157 was isolated from six samples at 19.9 to 44.6 MPN/kg. The E. coli O157 concentration of product A estimated from the results of all 14 samples was 9.5 MPN/kg. Samples (55.55 g) of product B (n = 20) were analyzed at 133 to 149 days postproduction. E. coli O157 was isolated from four samples at 19.9 MPN/kg. The E. coli O157 concentration of product B estimated from the results of all 20 samples was 3.7 MPN/kg. Analysis of a 305-g sample of product A (n = 1) stored at 4°C until 306 days postproduction revealed that the E. coli O157 concentration had declined to 3.6 MPN/kg. E. coli O157 could not be isolated from 555-g samples of product B (n = 5) after 280 days postproduction. The physicochemical parameters (pH, water activity, percent moisture, and percent salt) of both cheese products were found to be in the normal range for this type of product. The results of this study demonstrate that E. coli O157 could not replicate during storage at 4°C in the products tested but was capable of survival following aging and prolonged storage. This indicates that, if contaminated, the minimum 60-day aging period, which is required for raw milk Gouda cheeses, is not sufficient in all cases to ensure that the product does not contain viable cells of E. coli O157. The results also indicate that samples sizes greater than 100 g may be required to reliably detect E. coli O157 in cheese products associated with outbreaks.

  13. Current epidemiological status of enterohaemorrhagic Escherichia coli O157:H7 in Africa

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    @@ Enterohaemorrhagic E. Coli (EHEC) has been isolated from human diarrhoeal disease, hemorrhagic colitis (HC), and haemolytic uremic syndrome (HUS). After 20 years since the first description of E. Coli O157: H7 in USA, EHEC has become an important public health problem worldwide.1,2 Given the magnitude and severity of recent outbreaks of E. Coli O157: H7 infection, there is an urgent need to reduce the human hazard caused by this pathogen. Cattle are considered as major reservoir of E. Coli O157:H7 because consumption of undercooked meat products from cattle has been often associated with many human infections.

  14. An Escherichia coli O157-specific engineered pyocin prevents and ameliorates infection by E. coli O157:H7 in an animal model of diarrheal disease.

    Science.gov (United States)

    Ritchie, Jennifer M; Greenwich, Jennifer L; Davis, Brigid M; Bronson, Roderick T; Gebhart, Dana; Williams, Steven R; Martin, David; Scholl, Dean; Waldor, Matthew K

    2011-12-01

    AvR2-V10.3 is an engineered R-type pyocin that specifically kills Escherichia coli O157, an enteric pathogen that is a major cause of food-borne diarrheal disease. New therapeutics to counteract E. coli O157 are needed, as currently available antibiotics can exacerbate the consequences of infection. We show here that orogastric administration of AvR2-V10.3 can prevent or ameliorate E. coli O157:H7-induced diarrhea and intestinal inflammation in an infant rabbit model of infection when the compound is administered either in a postexposure prophylactic regimen or after the onset of symptoms. Notably, administration of AvR2-V10.3 also reduces bacterial carriage and fecal shedding of this pathogen. Our findings support the further development of pathogen-specific R-type pyocins as a way to treat enteric infections.

  15. BIOTECON diagnostics foodproof E. coli O157 detection kit, 5' nuclease for E. coli O157 in combination with foodproof ShortPrep II Kit.

    Science.gov (United States)

    Junge, Benjamin; Grönewald, Cordt; Berghof-Jäger, Kornelia

    2011-01-01

    The method describes the detection of Escherichia coli O157 in food. The method is based on real-time PCR using hydrolysis probes (5' Nuclease). This advanced PCR method was designed to reduce the time necessary to achieve results from PCR reactions and enable the user to monitor the amplification of the PCR product simultaneously in real time. After DNA isolation using the BIOTECON foodproof ShortPrep II Kit designed for the rapid preparation of E. coli O157 DNA for direct use in PCR, the real-time detection of E. coli O157 DNA is carried out using the foodproof E. coli O157 Detection Kit. The kit provides primers and hydrolysis probes for sequence-specific detection, convenient premixed reagents, and controls for reliable interpretation of results. For repeatability studies three different foods (egg salad, large bockwurst/frankfurter, and apple juice) were analyzed, chosen from the 15 food groups recommended by the AOAC Research Institute for E. coli O157 detection. From each food, 20 samples were inoculated with a low level (1-10 CFU/25 g) and 20 samples with a high level (10-50 CFU/25 g) ofE. coli O157. Additionally, five nonspiked samples were prepared from each food. Depending on the matrix, the food samples were examined with the test kits and compared with the cultural methods according to the U.S. Food and Drug Administration Bacteriological Analytical Manual or the U.S. Department of Agriculture/Food Safety and Inspection Service Microbiology Laboratory Guidebook.

  16. Genotypic analyses of shiga toxin-producing Escherichia coli O157 and non-O157 recovered from feces of domestic animals on rural farms in Mexico.

    Science.gov (United States)

    Amézquita-López, Bianca A; Quiñones, Beatriz; Cooley, Michael B; León-Félix, Josefina; Castro-del Campo, Nohelia; Mandrell, Robert E; Jiménez, Maribel; Chaidez, Cristóbal

    2012-01-01

    Shiga toxin-producing Escherichia coli (STEC) are zoonotic enteric pathogens associated with human gastroenteritis worldwide. Cattle and small ruminants are important animal reservoirs of STEC. The present study investigated animal reservoirs for STEC in small rural farms in the Culiacan Valley, an important agricultural region located in Northwest Mexico. A total of 240 fecal samples from domestic animals were collected from five sampling sites in the Culiacan Valley and were subjected to an enrichment protocol followed by either direct plating or immunomagnetic separation before plating on selective media. Serotype O157:H7 isolates with the virulence genes stx2, eae, and ehxA were identified in 40% (26/65) of the recovered isolates from cattle, sheep and chicken feces. Pulse-field gel electrophoresis (PFGE) analysis grouped most O157:H7 isolates into two clusters with 98.6% homology. The use of multiple-locus variable-number tandem repeat analysis (MLVA) differentiated isolates that were indistinguishable by PFGE. Analysis of the allelic diversity of MLVA loci suggested that the O157:H7 isolates from this region were highly related. In contrast to O157:H7 isolates, a greater genotypic diversity was observed in the non-O157 isolates, resulting in 23 PFGE types and 14 MLVA types. The relevant non-O157 serotypes O8:H19, O75:H8, O111:H8 and O146:H21 represented 35.4% (23/65) of the recovered isolates. In particular, 18.5% (12/65) of all the isolates were serotype O75:H8, which was the most variable serotype by both PFGE and MLVA. The non-O157 isolates were predominantly recovered from sheep and were identified to harbor either one or two stx genes. Most non-O157 isolates were ehxA-positive (86.5%, 32/37) but only 10.8% (4/37) harbored eae. These findings indicate that zoonotic STEC with genotypes associated with human illness are present in animals on small farms within rural communities in the Culiacan Valley and emphasize the need for the development of control

  17. Surface Characteristics and Adhesion Behavior of Escherichia coli O157:H7: Role of Extracellular Macromolecules

    Science.gov (United States)

    Surface macromolecule cleavage experiments were conducted on enterohaemorrhagic Escherichia coli O157:H7 cells to investigate the influence of these macromolecules on cell surface properties. Electrophoretic mobility, hydrophobicity, and titration experiments were carried out on proteinase K treate...

  18. Heterogeneous distributions of Escherichia coli O157 within naturally infected bovine faecal pats.

    Science.gov (United States)

    Robinson, Susan E; Brown, Patrick E; John Wright, E; Bennett, Malcolm; Hart, C Anthony; French, Nigel P

    2005-03-15

    Escherichia coli O157 is an important human pathogen for which cattle are considered a reservoir. This paper describes and models the variation in counts of E. coli O157 that exists within individual bovine faecal pats. The presence and concentration of E. coli O157 in faecal samples was determined using a combination of direct spiral plating followed by a more sensitive isolation procedure. The data were modelled using multilevel random effect models, in which the random effects were allowed to be correlated to allow for the fact that pooled and individual samples come from the same pat. Up to a two log difference in the concentration of E. coli O157 was demonstrated in samples from different areas within a faecal pat. Pooling of individual samples from throughout the faecal pat and processing it as one composite sample allows this heterogeneity to be overcome.

  19. Incidence and toxin production ability of Escherichia coli O157:H7 isolated from cattle trucks.

    Science.gov (United States)

    Cuesta Alonso, E P; Gilliland, S E; Krehbiel, C R

    2007-10-01

    Twelve cattle trucks were analyzed for the presence of Escherichia coli O157:H7. Three of them had been washed prior to arrival, and the others had not. Seventy-five percent of the trailers were positive for the presence of this foodborne pathogen. A total of 54 cultures were isolated and identified as E. coli O157:H7, all from the trucks that had not been cleaned. Most of the cultures (96.4%) produced Shiga-like toxin (verotoxin). No E. coli O157:H7 was detected in cattle trucks that were cleaned before arrival at the cattle pens. The incidence of E. coli O157:H7 in transport trailers increases the potential risk of contamination of cattle and transmission from farms to feedlots and to packing plants. This contamination increases the potential of contamination of meat during harvest and the risk of foodborne illnesses.

  20. Fine mapping of an Arabidopsis thaliana male sterile mutant EC2-157

    Institute of Scientific and Technical Information of China (English)

    LIU Huijuan; ZHANG Zaibao; LI Hui; GAO Jufang; YANG Zhongnan

    2006-01-01

    An Arabidopsis thaliana male sterile mutant EC2-157 has been isolated using an EMS mutagenesis strategy.Genetic analysis indicated that it was controlled by a single recessive gene called ms157.No pollen grains have been observed in mutant anthers.ms157 Has been mapped to a region of 74 kb located in BAC clone T6K22 on chromosome Ⅳ using a map-based cloning strategy.As no male sterile genes have been reported in this region.ms157 could be a novel gene related to fertility.The further molecular cloning and functional analysis on this gene should facilitate our understanding of A.thaliana anther development.

  1. Protective effects of pentadecapeptide BPC 157 on gastric ulcer in rats

    Institute of Scientific and Technical Information of China (English)

    Xiao-Chang Xue; Yong-Jie Wu; Ming-Tang Gao; Wen-Guang Li; Ning Zhao; Zeng-Lu Wang; Chun-Jie Bao; Zhen Yan; Ying-Qi Zhang

    2004-01-01

    AIM: To investigate the protective effects of gastric pentadecapeptide BPC 157 on acute and chronic gastric ulcers in rats and to compare the results in therapy of human gastric ulcers by different administration methods.METHODS: Gastric pentadecapeptide BPC 157 was administered (initial single or continuous administration) into rats either intragastrically or intramuscularly before (induced acute gastric ulcer) or after (induced chronic gastric ulcer) the applications of inducing agents, and each animal was sacrificed to observe the protective effects of BPC 157 on gastric ulcers.RESULTS: Both intramuscular (im) and intragastric (ig) administration of BPC 157 could apparently reduce the ulcer area and accelerate the healing of induced ulcer in different models and the effect of im administered BPC 157 was better than that of ig. The rats treated with higher dosages (400 ng/kg, 800 ng/kg) of BPC 157 (im and ig) showed significantly less lesion (P<0.01 vs excipient or saline control), the inhibition ratio of ulcer formation varied between 45.7% and 65.6%, from all measurements except 400 ng/kg BPC 157 in pylorus ligation induced model (P<0.05),in which the inhibition rate was 54.2%. When im administered (800 ng/kg BPC 157) in three models, the inhibition ratio of ulcer formation was 65.5%, 65.6% and 59.9%, respectively, which was better than that of famotidine (its inhibition rate was 60.8%, 57.2% and 34.3%,respectively). Continuous application of BPC 157 (in chronic acetate induced gastric ulcer) could accelerate rebuilding of glandular epithelium and formation of granulation tissue (P<0.05 at 200 ng/kg and P<0.01 at 400 ng/kg and 800 ng/kg vs excipient or saline control).CONCLUSION: Both im and ig administered gastric pentadecapeptide BPC 157 can apparently ameliorate acute gastric ulcer in rats and antagonize the protracted effect of acetate challenge on chronic ulcer. The effect of im administration of BPC 157 is better than that of ig, and the effective

  2. Escherichia coli O157:H7 - An Emerging Pathogen in foods of Animal Origin

    Directory of Open Access Journals (Sweden)

    Ch. Bindu Kiranmayi

    Full Text Available Escherichia coli O157:H7 is an emerging public health concern in most countries of the world. E. coli O157:H7 was known to be a human pathogen for nearly 24 years. EHEC O157 infection is estimated to be the fourth most costly food borne disease in Canada and USA, not counting the cost of possible litigation. E. coli O157:H7 and Salmonella are the leading causes of produce related outbreaks, accounting for 20 and 30% respectively. The authority of the Federal Meat Inspection Act, FSIS (Food Safety and Inspection Service declared Escherichia coli O157:H7, an adulterant in raw ground beef and enforced “zero tolerance” (USDA-FSIS, 17 December 1998. Because of the severity of these illnesses and the apparent low infective dose (less than 10 cells, Escherichia coli O157:H7 is considered one of the most serious of known food borne pathogens. Escherichia coli O157:H7 is mainly pathogenic to human but in cattle and other animals, it did not induce any clinical disease except diarrhea. So, these animals act as carriers to Escherichia coli O157:H7. The majority transmission is through eating of undercooked contaminated ground meat and consumption of raw milk, raw vegetables, fruits contaminated by water, cheese, curd and also through consumption of sprouts, lettuce and juice. The conventional isolation procedure includes growth in enrichment broth like modified EC (E. coli broth or modified tryptic soy broth (mTSB Since the infection primarily occurs via faeco-oral route, the preventive measures include food hygiene measures like proper cooking of meat, consumption of pasteurized milk, washing fruits and vegetables especially those to be eaten raw and drinking chlorine treated water and personnel hygiene measures like washing hands after toilet visits. [Veterinary World 2010; 3(8.000: 382-389

  3. Lettuce cultivar mediates both phyllosphere and rhizosphere activity of Escherichia coli O157:H7.

    Directory of Open Access Journals (Sweden)

    Richard S Quilliam

    Full Text Available Plant roots and leaves can be colonized by human pathogenic bacteria, and accordingly some of the largest outbreaks of foodborne illness have been associated with salad leaves contaminated by E. coli O157. Integrated disease management strategies often exploit cultivar resistance to provide a level of protection from economically important plant pathogens; however, there is limited evidence of whether the genotype of the plant can also influence the extent of E. coli O157 colonization. To determine cultivar-specific effects on colonization by E. coli O157, we used 12 different cultivars of lettuce inoculated with a chromosomally lux-marked strain of E. coli O157:H7. Lettuce seedlings grown gnotobiotically in vitro did exhibit a differential cultivar-specific response to E. coli O157 colonization, although importantly there was no relationship between metabolic activity (measured as bioluminescence and cell numbers. Metabolic activity was highest and lowest on the cultivars Vaila-winter gem and Dazzle respectively, and much higher in endophytic and tightly bound cells than in epiphytic and loosely bound cells. The cultivar effect was also evident in the rhizosphere of plants grown in compost, which suggests that cultivar-specific root exudate influences E. coli O157 activity. However, the influence of cultivar in the rhizosphere was the opposite to that in the phyllosphere, and the higher number and activity of E. coli O157 cells in the rhizosphere may be a consequence of them not being able to gain entry to the plant as effectively. If metabolic activity in the phyllosphere corresponds to a more prepared state of infectivity during human consumption, leaf internalization of E. coli O157 may pose more of a public health risk than leaf surface contamination alone.

  4. Ruminant Gastrointestinal Cell Proliferation and Clearance of Escherichia coli O157:H7

    OpenAIRE

    Magnuson, Bernadene A.; Davis, Margaret; Hubele, Suzanna; Austin, Paula R.; Kudva, Indira T.; Christopher J Williams; Hunt, Carl W.; Hovde, Carolyn J.

    2000-01-01

    Human infections with Escherichia coli O157:H7 cause hemorrhagic colitis that can progress to a life-threatening sequelae. The most common mode of disease transmission is ingestion of contaminated bovine food products, and it is well established that E. coli O157:H7 is a transient member of the bovine microbiota. However, the conditions that induce acquisition and subsequent clearance of this bacterium from the ruminant gastrointestinal tract (GIT) are not understood. Evidence that the rates ...

  5. DETECTION OF BACTERIA Esherichia coli SEROTYPE O157 ON PORK FROM PORK TRADER IN DENPASAR CITY

    Directory of Open Access Journals (Sweden)

    Made Agus Hendrayana

    2013-03-01

    Full Text Available Escherichia coli (E.coli  is the pathogenic bacteria which commonly associated with intestine and kidney infection in human. One of the strain of zoonotic E.coli serotype O157. Human and cattle, mostly swine are predominant reservoirs for E. coli O157. Swine butchering in Bali specifically in Denpasar is increasing each year. The aim of this study was to identify E.coli serotype O157 in pork in Denpasar. They were 31 samples of pork taken from different butchers in 24 traditional markets and seven supermarkets that entirely located in Denpasar. Total Plate Count (TPC method was used to count E.coli and  coliform colonies. Plate Count agar (PCA, Eosin Methylene Blue Agar (EMBA and selective Sorbitol MacConkey Agar (SMAC were applied in this study as well. Metallic green colonies were found and taken for Gram staining then were inoculated on the media of biochemical test (IMViC. Next, the colonies were inoculated on the media of SMAC and observed for existence of colorless colonies which was identified as E.coli O157. Singlepath E.coli O157 examination was applied to confirm the identification of E.coli O157. The results of IMViC and SMAC tests on 12 from 31 samples (38,71% indicated positive of containing E.coli. Six from 31 samples (19,35% positively contained E.coli O157. The conclution showed that 19,35% porks from pork traders in Denpasar City were contaminated by E.coli O157. (MEDICINA 2012;43:3-8.

  6. A glimpse of Escherichia coli O157:H7 survival in soils from eastern China.

    Science.gov (United States)

    Wang, Haizhen; Ibekwe, A Mark; Ma, Jincai; Wu, Laosheng; Lou, Jun; Wu, Zhigang; Liu, Renyi; Xu, Jianming; Yates, Scott R

    2014-04-01

    Escherichia coli O157:H7 (E. coli O157:H7) is an important food-borne pathogen, which continues to be a major public health concern worldwide. It is known that E. coli O157:H7 survive in soil environment might result in the contamination of fresh produce or water source. To investigate how the soils and their properties affect E. coli O157:H7 survival, we studied E. coli O157:H7 survival dynamics in 14 soils collected in eastern China from the warm-temperate zone to subtropical zone. Results showed that E. coli O157:H7 survival as a function of time can be well described by the Weibull model. The calculated td values (survival time to reach the detection limit, 100 colony forming units per gram oven-dried weight of soil) for the test soils were between 1.4 and 25.8 days. A significantly longer survival time (td) was observed in neutral or alkaline soils from north-eastern China (the warm-temperate zone) than that in acidic soils from south-eastern China (the subtropical zone). Distinct E. coli O157:H7 survival dynamics was related to soil properties. Stepwise multiple regression analysis revealed that the td values were significantly enhanced by soil microbial biomass carbon and total nitrogen, but were significantly reduced by amorphous Al2O3 and relative abundance of Chloroflexi. It should pay more attention to E. coli O157:H7 long survival in soils and its potential environmental contamination risk.

  7. Effect of Genetic Database Comprehensiveness on Fractional Proteomics of Escherichia coli O157:H7

    Science.gov (United States)

    2014-01-01

    EFFECT OF GENETIC DATABASE COMPREHENSIVENESS ON FRACTIONAL PROTEOMICS OF ESCHERICHIA COLI O157:H7 ECBC-TR-1154...Database Comprehensiveness on Fractional Proteomics of Escherichia coli O157:H7 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER...are characterizing the extracellular, fimbriae, and whole cell proteins produced by the pathogenic Gram-negative bacterium Escherichia coli (E. coli

  8. [Pollution of EHEC O157:H7 in six types of food in Henan Province].

    Science.gov (United States)

    Zhang, Ding; Liao, Xingguang; Zhang, Xiuli; Li, Li

    2003-09-01

    In order to investigate the distribution of contamination of EHEC O157:H7 in 6 types of food in Henan Province and characterize the effect of seasonal factors on distribution of O157:H7 contamination so as to prevent and control food contamination, Henan Province was divided into five sampling areas according to the natural geographical features. Samples were taken randomly in summer and winter sales links. After selective culture of increasing reproduction of O157:H7, it was screened by immuno-gold reagent, and pathogenic bacterium were isolated after accumulation of immunomagnetic. Then, it was identified by the bioMérieux VITEK32 AMS system, GNI+ and sero-reaction. Results showed that 28 EHEC O157:H7 were isolated in 1463 samples among which the positive rate of raw meat and fresh vegetable was 3.3% and 3.2% respectively (the highest of all), and EHEC O157:H7 was not found in yogurt. The positive rate in summer (2.5%) was obviously higher than that in winter (1.1%). It could be concluded that the contamination of EHEC O157:H7 in food was serious. Its positive rate was positively correlated with the epidemic of infective diarrhea. Therefore, attention should be given by relevant departments concerned and spervision and testing should be strengthened in livestock and farmyard bird slaughtering link, vegetable production link and sales link for better prevention of the breaking out and epidemic of food born diseases.

  9. Tuning LeSPL-CNR expression by SlymiR157 affects tomato fruit ripening.

    Science.gov (United States)

    Chen, Weiwei; Kong, Junhua; Lai, Tongfei; Manning, Kenneth; Wu, Chaoqun; Wang, Ying; Qin, Cheng; Li, Bin; Yu, Zhiming; Zhang, Xian; He, Meiling; Zhang, Pengcheng; Gu, Mei; Yang, Xin; Mahammed, Atef; Li, Chunyang; Osman, Toba; Shi, Nongnong; Wang, Huizhong; Jackson, Stephen; Liu, Yule; Gallusci, Philippe; Hong, Yiguo

    2015-01-19

    In plants, microRNAs (miRNAs) play essential roles in growth, development, yield, stress response and interactions with pathogens. However no miRNA has been experimentally documented to be functionally involved in fruit ripening although many miRNAs have been profiled in fruits. Here we show that SlymiR157 and SlymiR156 differentially modulate ripening and softening in tomato (Solanum lycopersicum). SlymiR157 is expressed and developmentally regulated in normal tomato fruits and in those of the Colourless non-ripening (Cnr) epimutant. It regulates expression of the key ripening gene LeSPL-CNR in a likely dose-dependent manner through miRNA-induced mRNA degradation and translation repression. Viral delivery of either pre-SlymiR157 or mature SlymiR157 results in delayed ripening. Furthermore, qRT-PCR profiling of key ripening regulatory genes indicates that the SlymiR157-target LeSPL-CNR may affect expression of LeMADS-RIN, LeHB1, SlAP2a and SlTAGL1. However SlymiR156 does not affect the onset of ripening, but it impacts fruit softening after the red ripe stage. Our findings reveal that working together with a ripening network of transcription factors, SlymiR157 and SlymiR156 form a critical additional layer of regulatory control over the fruit ripening process in tomato.

  10. Prevalence estimation and risk factors for Escherichia coli O157 on Dutch dairy farms.

    Science.gov (United States)

    Schouten, J M; Bouwknegt, M; van de Giessen, A W; Frankena, K; De Jong, M C M; Graat, E A M

    2004-06-10

    To estimate the prevalence of Escherichia coli O157 on Dutch dairy herds, faecal samples were collected once from 678 randomly selected dairy farms in the period October 1996-December 2000. Samples were cultured for E. coli O157. Thirty-eight isolates were tested for virulence genes (eae, VT1 and VT2). A questionnaire about farm characteristics was taken from the farm manager, resulting in variables that could be analysed to identify and quantify factors associated with presence of E. coli O157. In total, 49 of the 678 herds (7.2%) showed at least one positive pooled sample. E. coli O157 was not isolated from herds sampled in December-April in consecutive years (except for one isolate found in March, 2000). VT- and eae-genes were found in 37 and 38 isolates, respectively. Logistic regression was performed on variables obtained from the questionnaire, comparing E. coli O157-positive herds to negative herds. To account for season, a sine function was included in the logistic regression as an offset variable. In the final model, the presence of at least one pig at the farm (OR = 3.4), purchase of animals within the last 2 years before sampling (OR = 1.9), supply of maize (OR = 0.29) to the cows, and sampling a herd in the year 1999 or 2000 (compared to sampling in 1998; OR = 2.1 and 2.9, respectively) had associations with the presence of E. coli O157.

  11. Fate of Escherichia coli O157: H7 in agricultural soils amended with different organic fertilizers.

    Science.gov (United States)

    Yao, Zhiyuan; Yang, Li; Wang, Haizhen; Wu, Jianjun; Xu, Jianming

    2015-10-15

    Five organic fertilizers (vermicompost, pig manure, chicken manure, peat and oil residue) were applied to agricultural soils to study their effects on the survival of Escherichia coli O157:H7 (E. coli O157:H7). Results showed that E. coli O157:H7 survival changed greatly after organic fertilizers application, with shorter td values (survival time needed to reach the detection limit of 100 CFU g(-1)) (12.57±6.57 days) in soils amended with chicken manure and the longest (25.65±7.12 days) in soils amended with pig manure. Soil pH, EC and free Fe/Al (hydro) oxides were significant explanatory factors for E. coli O157:H7 survival in the original soils. Soil constituents (minerals and organic matter) and changes in their surface charges with pH increased the effect of soil pH on E. coli O157:H7 survival. However, electrical conductivity played a more important role in regulating E. coli O157:H7 survival in fertilizer-amended soils. This study highlighted the importance of choosing appropriate organic fertilizers in the preharvest environment to reduce food-borne bacterial contamination.

  12. [Wide occurrence of enterohemorragic Eschrichia coli O157 in natural freshwater environment].

    Science.gov (United States)

    Kogure, K; Ikemoto, E

    1997-07-01

    Recent outbreaks of hemorrhagic colitis by Escherichia coli O157 urge us to clarify the source, distribution, and fate of those pathogens. We hypothesized that E. coli O157 enter into viable but nonculturable state (VBNC) so that the conventional culture method fails to detect those strains from natural environment. In the microcosm using sterilized river water, E. coli O157 gradually lost their viability. Total count using epifluorescent microscopy and the direct viable count (DVC), however, stayed almost constant for more than a month, indicating that the cells fell into the VBNC state. In order to see the distribution of E. coli O157 in natural environment, the DVC method and fluorescent antibody technique were applied. All river water samples from five different places in and near Tokyo metropolitan area showed occurrence of cells reacted with the antibody applied. This indicates that E. coli O157 may be widely distributed in freshwater environment as normal inhabitants. The understanding of VBNC state of E. coli O157 should be essential to investigate on the behavior of this pathogen in nature and find out a suitable method to prevent from further outbreaks.

  13. Altered protozoan and bacterial communities and survival of Escherichia coli O157:H7 in monensin-treated dairy wastewater from a dairy lagoon

    Science.gov (United States)

    We determined the role of native protozoa in controlling the populations of Escherichia coli O157:H7 (EcO157) in wastewater from dairy lagoons as both protozoa and EcO157 are released into lagoons through manure washings. We monitored the fate of an outbreak strain of EcO157 in wastewater treated wi...

  14. Contributions of EspA filaments and curli fimbriae in cellular adherence and biofilm formation of enterohemorrhagic Escherichia coli O157:H7

    Science.gov (United States)

    In Escherichia coli O157:H7 (O157), the filamentous structure of the type III secretion system is produced from the polymerization of the EspA protein. EspA filaments are essential for O157 adherence to epithelial cells. In previous studies, we demonstrated that O157 hha deletion mutants showed incr...

  15. Comparative transcriptional profiling reveals differential expression of pathways directly and indirectly influencing biofilm formation in Escherichia coli O157:H7

    Science.gov (United States)

    Introduction: Escherichia coli O157:H7 (O157) is a frequent cause of foodborne disease outbreaks. O157 encodes virulence factors for colonizing and survival in reservoir animals and the environment. For example, genetic factors promoting biofilm formation are linked to survival of O157 in and outsid...

  16. Effect of Citrus Byproducts on Survival of O157:H7 and Non-O157 Escherichia coli Serogroups within In Vitro Bovine Ruminal Microbial Fermentations

    Directory of Open Access Journals (Sweden)

    Heather A. Duoss-Jennings

    2013-01-01

    Full Text Available Citrus byproducts (CBPs are utilized as a low cost nutritional supplement to the diets of cattle and have been suggested to inhibit the growth of both Escherichia coli O157:H7 and Salmonella. The objective of this study was to examine the effects in vitro that varying concentrations of CBP in the powdered or pelleted variety have on the survival of Shiga-toxin Escherichia coli (STEC serotypes O26:H11, O103:H8, O111:H8, O145:H28, and O157:H7 in bovine ruminal microorganism media. The O26:H11, O111:H8, O145:H28, and O157:H7 serotypes did not exhibit a change in populations in media supplemented with CBP with either variety. The O103:H8 serotype displayed a general trend for an approximate 1log10 reduction in 5% powdered CBP and 20% pelleted CBP over 6 h. There was a trend for reductions in populations of a variant form of O157:H7 mutated in the stx1 and stx2 genes in higher concentrations of CBP. These results suggest that variations exist in the survival of these serotypes of STEC within mixed ruminal microorganism fluid media when supplemented with CBP. Further research is needed to determine why CBPs affect STEC serotypes differently.

  17. Growth of Escherichia coli O157:H7, Non-O157 Shiga Toxin-Producing Escherichia coli , and Salmonella in Water and Hydroponic Fertilizer Solutions.

    Science.gov (United States)

    Shaw, Angela; Helterbran, Kara; Evans, Michael R; Currey, Christopher

    2016-12-01

    The desire for local, fresh produce year round is driving the growth of hydroponic growing systems in the United States. Many food crops, such as leafy greens and culinary herbs, grown within hydroponics systems have their root systems submerged in recirculating nutrient-dense fertilizer solutions from planting through harvest. If a foodborne pathogen were introduced into this water system, the risk of contamination to the entire crop would be high. Hence, this study was designed to determine whether Escherichia coli O157:H7, non-O157 Shiga toxin-producing E. coli , and Salmonella were able to survive and reproduce in two common hydroponic fertilizer solutions and in water or whether the bacteria would be killed or suppressed by the fertilizer solutions. All the pathogens grew by 1 to 6 log CFU/ml over a 24-h period, depending on the solution. E. coli O157:H7 reached higher levels in the fertilizer solution with plants (3.12 log CFU/ml), whereas non-O157 Shiga toxin-producing E. coli and Salmonella reached higher levels in the fertilizer solution without plants (1.36 to 3.77 log CFU/ml). The foodborne pathogens evaluated here survived for 24 h in the fertilizer solution, and populations grew more rapidly in these solutions than in plain water. Therefore, human pathogens entering the fertilizer solution tanks in hydroponic systems would be expected to rapidly propagate and spread throughout the system and potentially contaminate the entire crop.

  18. Acid Resistance and Molecular Characterization of Escherichia coli O157:H7 and Different Non-O157 Shiga Toxin-Producing E. coli Serogroups.

    Science.gov (United States)

    Kim, Gwang-Hee; Breidt, Frederick; Fratamico, Pina; Oh, Deog-Hwan

    2015-10-01

    The objective of this study was to compare the acid resistance (AR) of non-O157 Shiga toxin-producing Escherichia coli (STEC) strains belonging to serogroups O26, O45, O103, O104, O111, O121, and O145 with O157:H7 STEC isolated from various sources in 400 mM acetic acid solutions (AAS) at pH 3.2 and 30 °C for 25 min with or without glutamic acid. Furthermore, the molecular subgrouping of the STEC strains was analyzed with the repetitive sequence-based PCR (rep-PCR) method using a DiversiLab(TM) system. Results for a total of 52 strains ranged from 0.31 to 5.45 log reduction CFU/mL in the absence of glutamic acid and 0.02 to 0.33 CFU/mL in the presence of glutamic acid except for B447 (O26:H11), B452 (O45:H2), and B466 (O104:H4) strains. Strains belonging to serogroups O111, O121, and O103 showed higher AR than serotype O157:H7 strains in the absence of glutamic acid. All STEC O157:H7 strains exhibited a comparable DNA pattern with more than 95% similarity in the rep-PCR results, as did the strains belonging to serogroups O111 and O121. Surprisingly, the DNA pattern of B458 (O103:H2) was similar to that of O157:H7 strains with 82% similarity, and strain B458 strain showed the highest AR to AAS among the O103 strains with 0.44 log reduction CFU/mL without glutamic acid. In conclusion, STEC serotypes isolated from different sources exhibited diverse AR and genetic subtyping patterns. Results indicated that some non-O157 STEC strains may have higher AR than STEC O157:H7 strains under specific acidic conditions, and the addition of glutamic acid provided enhanced protection against exposure to AAS.

  19. Survival of Escherichia coli O157:H7 during manufacture and storage of white brined cheese.

    Science.gov (United States)

    Osaili, Tareq M; Al-Nabulsi, Anas A; Olaimat, Amin N; Shaker, Reyad R; Taha, Mohammad; Holley, Richard A

    2014-09-01

    Escherichia coli O157:H7 is a major foodborne pathogen that causes severe disease in humans. Survival of E. coli O157:H7 during processing and storage of white brined cheese was investigated. Cheeses were prepared using pasteurized milk inoculated with a 4 strain E. coli O157:H7 cocktail (7 log(10) CFU/g) with or without yogurt starter culture (Lactobacillus delbrueckii ssp. bulgaricus and Streptococcus salivarius ssp. thermophilus) and stored in 10% or 15% NaCl brine at 10 and 21 ºC for 28 d. NaCl concentration, water activity (a(w)), pH, and numbers of E. coli O157:H7 and lactic acid bacteria (LAB) were determined in cheese and brine. E. coli O157:H7 was able to survive in cheese stored in both brines at 10 and 21 ºC regardless of the presence of starter LAB, although the latter significantly enhanced E. coli O157:H7 reduction in cheese or its brine at 10 ºC. E. coli O157:H7 numbers were reduced by 2.6 and 3.4 log(10) CFU/g in cheese stored in 10% and 15% NaCl brine, respectively, in the presence of starter LAB and by 1.4 and 2.3 log(10) CFU/g, respectively, in the absence of starter LAB at 10 ºC. The pathogen survived, but at lower numbers in the brines. The salt concentration of cheese stored in 10% brine remained about 5% during ripening, but in 15% brine, the NaCl level increased 1.6% to 8.1% (w/w) by 28 d. Values of pH and a(w) slightly decreased 1 d after exposure to brine and reached 5.5 to 6.6 and 0.88 to 0.94, respectively, in all treatments.

  20. Role of glycoside hydrolase genes in sinigrin degradation by E. coli O157:H7.

    Science.gov (United States)

    Cordeiro, Roniele P; Doria, Juan H; Zhanel, George G; Sparling, Richard; Holley, Richard A

    2015-07-16

    This work examined Escherichia coli O157:H7 strain 02-0304 for putative genes responsible for sinigrin hydrolysis. Sinigrin is a glucosinolate present in Oriental mustard (Brassica juncea), and its hydrolysis is mediated in plants by the enzyme myrosinase. Sinigrin hydrolysis by plant or bacterial myrosinase yields allyl isothiocyanate (AITC) which is bactericidal. In silico analysis using public databases found sequence similarity between plant myrosinase and enzymes encoded by genes from β-glucosidase families in E. coli O157:H7. Specifically, 6-phospho-β-glucosidase encoded by the genes bglA and ascB (family 1), and chbF (family 4) present in E. coli O157:H7 showed the highest similarity. Polymerase chain reaction (PCR) confirmed the presence of bglA, ascB, and chbF in the clinical E. coli strain tested. Disruption of these genes in wild-type E. coli O157:H7 strain 02-0304 using lambda-red replacement created single and double mutants. The relative importance of each gene in the hydrolysis of sinigrin by E. coli O157:H7 was also assessed by comparing gene expression and sinigrin degradation rates among the E. coli O157:H7 wild-type strain and its mutants. The results suggested that the genes bglA and ascB play a substantial role in the degradation of sinigrin by E. coli O157:H7 strain 02-0304. Copyright © 2015. Published by Elsevier B.V.

  1. Characterization of Shiga Toxin-Producing Escherichia coli O157 Isolates from Bovine Carcasses.

    Science.gov (United States)

    Fontcuberta, M; Planell, R; Torrents, A; Sabaté, S; Gonzalez, R; Ramoneda, M; de Simón, M

    2016-08-01

    The main purpose of this study was to determine the prevalence of Escherichia coli O157 on bovine carcasses before and after chilling at a large slaughterhouse located in the city of Barcelona, Spain, to assess the effectiveness of dry chilling on reducing E. coli O157 contamination of carcasses. In addition, the study characterized the E. coli O157 strains isolated in terms of virulence factors, antibiotic susceptibility, and their genetic diversity. Individual bovine carcasses were sampled before (n = 300) and after (n = 300) chilling over an 8-month period. Positive samples for E. coli O157 were subjected to virulence screening by PCR (stx1, stx2, and eaeA genes and the fliCH7 gene), antimicrobial susceptibility testing, and molecular typing by pulsed-field gel electrophoresis. A total of 9.7% (29 of 300) of the nonrefrigerated carcasses examined and 2.3% (7 of 300) of the refrigerated carcasses were positive for E. coli O157. All the isolates were serotype O157:H7, 92% (33 of 36) carried the stx1, stx2, and eaeA genes, and 8% (3 of 36) carried the stx2 and eaeA genes. Antimicrobial susceptibility testing showed a high degree of resistance: 29 strains (81%) were resistant to at least 1 antimicrobial of the 12 antimicrobials tested; 69% (25 of 36) were resistant to 4 or more antimicrobials. Molecular typing by pulsed-field gel electrophoresis found a high diversity of genetic types, implying little cross-contamination in the slaughterhouse. This study confirms that E. coli O157:H7 is present on the carcasses slaughtered in Spain, although its prevalence is reduced by the dry chilling process used. The recovered isolates showed potential pathogenesis and a high degree of multidrug resistance, confirming the importance of bovine meat monitoring.

  2. Molecular characterization of Escherichia coli O157:H7 strains isolated from different sources and geographic regions

    Science.gov (United States)

    Gonzalez, Alice Gonçalves M.; Cerqueira, Aloysio M. F.; Andrade, João Ramos C.

    2012-01-01

    Escherichia (E.) coli serotype O157:H7 is a globally distributed human enteropathogen and is comprised of microorganisms with closely related genotypes. The main reservoir for this group is bovine bowels, and infection mainly occurs after ingestion of contaminated water and food. Virulence genetic markers of 28 O157:H7 strains were investigated and multilocus enzyme electrophoresis (MLEE) was used to evaluate the clonal structure. O157:H7 strains from several countries were isolated from food, human and bovine feces. According to MLEE, O157:H7 strains clustered into two main clonal groups designated A and B. Subcluster A1 included 82% of the O157:H7 strains exhibiting identical MLEE pattern. Most enterohemorrhagic E. coli (EHEC) O157:H7 strains from Brazil and Argentina were in the same MLEE subgroup. Bovine and food strains carried virulence genes associated with EHEC pathogenicity in humans. PMID:22705735

  3. Fate of Escherichia coli O157:H7 in ground apples used in cider production.

    Science.gov (United States)

    Fisher, T L; Golden, D A

    1998-10-01

    Survival of Escherichia coli O157:H7 in ground Golden Delicious, Red Delicious, Rome, and Winesap apples stored at 4, 10, and 25 degrees C was determined. E. coli O157:H7 populations were monitored for up to 18 days (4 degrees C), 12 days (10 degrees C), and 5 days (25 degrees C), when mold contamination became visible. At 25 degrees C, Red Delicious apples supported survival of E. coli O157:H7 better (P 0.05). Winesap apples were the least favorable (P 0.05), but pathogen populations increased in both cultivars (P 0.05). When stored at 4 degrees C, Golden Delicious and Rome apples were not statistically different in supporting survival of the pathogen (P > 0.05). In general, apple pH increased during storage and was associated with mold growth. Results of this investigation indicate that there is no trend toward a particular apple cultivar supporting survival of E. coli O157:H7. However, variation in apple pH during storage can negatively or positively influence E. coli O157:H7 survival at 25 degrees C.

  4. Indirect immunofluorescence detection of E. coli O157:H7 with fluorescent silica nanoparticles.

    Science.gov (United States)

    Chen, Ze-Zhong; Cai, Li; Chen, Min-Yan; Lin, Yi; Pang, Dai-Wen; Tang, Hong-Wu

    2015-04-15

    A method of fluorescent nanoparticle-based indirect immunofluorescence assay using either fluorescence microscopy or flow cytometry for the rapid detection of pathogenic Escherichia coli O157:H7 was developed. The dye-doped silica nanoparticles (NPs) were synthesized using W/O microemulsion methods with the combination of 3-aminopropyltriethoxysilane (APTES) and fluorescein isothiocyanate (FITC) and polymerization reaction with carboxyethylsilanetriol sodium salt (CEOS). Protein A was immobilized at the surface of the NPs by covalent binding to the carboxyl linkers and the surface coverage of Protein A on NPs was determined by the Bradford method. Rabbit anti-E. Coli O157:H7 antibody was used as primary antibody to recognize E. coli O157:H7 and then antibody binding protein (Protein A) labeled with FITC-doped silica NPs (FSiNPs) was used to generate fluorescent signal. With this method, E. Coli O157:H7 in buffer and bacterial mixture was detected. In addition, E. coli O157:H7 in several spiked background beef samples were measured with satisfactory results. Therefore, the FSiNPs are applicable in signal-amplified bioassay of pathogens due to their excellent capabilities such as brighter fluorescence and higher photostability than the direct use of conventional fluorescent dyes.

  5. Identification of Escherichia coli O157 by using a novel colorimetric detection method with DNA microarrays.

    Science.gov (United States)

    Quiñones, Beatriz; Swimley, Michelle S; Taylor, Amber W; Dawson, Erica D

    2011-06-01

    Shiga toxin-producing Escherichia coli O157 is a leading cause of foodborne illness worldwide. To evaluate better methods to rapidly detect and genotype E. coli O157 strains, the present study evaluated the use of ampliPHOX, a novel colorimetric detection method based on photopolymerization, for pathogen identification with DNA microarrays. A low-density DNA oligonucleotide microarray was designed to target stx1 and stx2 genes encoding Shiga toxin production, the eae gene coding for adherence membrane protein, and the per gene encoding the O157-antigen perosamine synthetase. Results from the validation experiments demonstrated that the use of ampliPHOX allowed the accurate genotyping of the tested E. coli strains, and positive hybridization signals were observed for only probes targeting virulence genes present in the reference strains. Quantification showed that the average signal-to-noise ratio values ranged from 47.73 ± 7.12 to 76.71 ± 8.33, whereas average signal-to-noise ratio values below 2.5 were determined for probes where no polymer was formed due to lack of specific hybridization. Sensitivity tests demonstrated that the sensitivity threshold for E. coli O157 detection was 100-1000 CFU/mL. Thus, the use of DNA microarrays in combination with photopolymerization allowed the rapid and accurate genotyping of E. coli O157 strains.

  6. An outbreak of E. coli O157:H7 hemorrhagic colitis associated with unpasteurized gouda cheese.

    Science.gov (United States)

    Honish, Lance; Predy, Gerry; Hislop, Nyall; Chui, Linda; Kowalewska-Grochowska, Kinga; Trottier, Larry; Kreplin, Cornelia; Zazulak, Ingrid

    2005-01-01

    A cluster of E. coli O157:H7 hemorrhagic colitis was identified in metro Edmonton, Alberta through notifiable disease surveillance in late 2002. Environmental health officers collected food histories and clinical information from cases in the cluster. The provincial public health laboratory conducted pulsed field gel electrophoresis (PFGE) analysis on E. coli O157:H7 isolates from cluster cases. Public health and food regulatory agencies conducted an investigation when a food source (unpasteurized gouda cheese) was implicated. PFGE analysis revealed an "outbreak" profile in 13 cases. Onset dates for the outbreak cases ranged between October 2002 and February 2003. Two cases, aged 22 months and 4 years, developed hemolytic uremic syndrome as a result of their infection. Consumption of unpasteurized gouda cheese produced at a local dairy farm was reported by 12 of 13 outbreak cases in the 2 to 8 days prior to illness. E. coli O157:H7 was isolated from 2 of 26 cheese samples manufactured by the implicated producer. The cheese isolates had indistinguishable PFGE profiles as compared with outbreak case isolates. Implicated cheese was found to be contaminated with E. coli O157:H7 104 days after production, despite having met regulated microbiological and aging requirements. To our knowledge, this is the first confirmed outbreak of E. coli O157:H7 infection in Canada associated with raw milk hard cheese. A review of federal legislation vis-à-vis raw milk hard cheese may be in order.

  7. Inactivation of Escherichia coli O157:H7 by essential oil from Cinnamomum zeylanicum

    Directory of Open Access Journals (Sweden)

    Ouafae Senhaji

    2007-04-01

    Full Text Available Escherichia coli O157:H7 is a pathogen strain, which causes hemorrhagic colitis, hemolytic uremic syndrome and thrombotic thrombocytopenic purpura in humans. The control of bacterial cells in foods is an important factor to reduce foodborne diseases due to E. coli O157:H7. Assays to inactivate E. coli O157:H7 were carried out by using the cinnamon oil obtained by steam distillation for 6 hours. When E. coli O157:H7 cells were incubated at 37°C for 2 hours in the presence of 0.025% of the essential oil from cinnamon, a dramatic decrease was observed in the viable counts (from 10(7 to 3.10(4 CFU/mL-1. In the presence of 0.05% of the oil, most of cells were killed after 30 min, suggesting that the antimicrobial activity of essential oil is bactericidal against E. coli. The minimal inhibitory concentration of the essential oil from cinnamon was around 625 ppm against E. coli O157:H7 and E. coli ATCC 25921, around 1250 ppm against E. coli ATCC25922 and around 2500 ppm against E. coli ATCC11105.

  8. Identification and Prevalence of Escherichia coli and Escherichia coli O157: H7 in Foods

    Directory of Open Access Journals (Sweden)

    Ancuta Mihaela Rotar

    2013-11-01

    Full Text Available The objective of this study is to investigate the incidence of Escherichia coli in animal and non-animal foods, and mainly the incidence of the serotype O157: H7 producing verotoxin. The presence of common Escherichia coli and Escherichia coli O157: H7 in various foods (of animal and non animal origin was performed in Transylvania area. We analyzed a total of one hundred forty-one samples of minced meat, one hundred twenty-six samples of meat , twenty six samples of meat products, five samples of alcoholic beverages, three samples of seafood, one hundred samples of cheese from pasteurized milk, seventeen samples of butter, four samples of vegetables and one sample of milk powder, using the standard cultural method and Vidas Eco method for E. coli O157: H7 strains. E. coli was identified in 50 samples of minced meat, 55 samples of meat prepared, 4 samples of meat products, 2 samples of alcoholic beverages, 25 samples of cheese from pasteurized milk, 6 samples of butter and 1 sample of vegetables. In this study were not been identified any foods contaminated with the E. coli O157: H7 serotype. The results of this reasearch have demostrated that E. coli wich represents a hygienic indicator of recent food contamination, can be destroyed with heat treatment and hygienic handling of foods. Our country over the years has been among the few countries where the incidence of the E. coli O157: H7 serotype has been minimal.

  9. [Isolation and characterization of Escherichia coli O157 in bovine meat products and cattle in the province of Tucuman].

    Science.gov (United States)

    Jure, María A; Condorí, Marina S; Pérez Terrazzino, Gabriela; Catalán, Mariana G; López Campo, Alejandro; Zolezzi, Gisella; Chinen, Isabel; Rivas, Marta; Castillo, Marta

    2015-01-01

    Escherichia coli O157 is an emergent pathogen associated with diarrhea, hemorrhagic colitis and hemolytic uremic syndrome. Meat products constitute an important transmission source of this microorganism. The aims of this study were to characterize E. coli O157 isolated from cattle and meat products collected from abattoirs and retail stores, to establish the clonal relatedness among regional isolates and to compare them with those in the national database. Between 2004 and 2013, 169 minced meat, 35 sausage and 216 carcass samples were analyzed. Thirteen E. coli O157 isolates were identified; 6 of which were O157:H7 and characterized as stx2c(vh-a)/eae/ehxA (n = 5) and stx2/eae/ehxA (n = 1). The 7 remaining isolates were non-toxigenic E. coli strains, and serotyped as O157:NT (n = 4), O157:NM (n = 1), O157:ND (n = 1) and O157:H16 (n = 1). The strains yielded different XbaI-PFGE patterns. Compared to the E. coli O157 isolates in the National Database, none of these patterns have been previously detected in strains of different origin in Argentina.

  10. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.

    2004-01-01

    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control....... The selectivity of the assay was evaluated against 155 strains, including 32 E. coli O157, 38 E. coli non-O157, and 85 non-E. coli. It was shown to be highly inclusive (100%) and exclusive (100%). The assay has a 100% detection probability of approximately 2 x 10(3) cells per reaction....

  11. PCR for the Specific Detection of an Escherichia coli O157:H7 Laboratory Control Strain.

    Science.gov (United States)

    Knowles, Michael; Lambert, Dominic; Huszczynski, George; Gauthier, Martine; Blais, Burton W

    2015-09-01

    Control strains of bacterial pathogens such as Escherichia coli O157:H7 are commonly processed in parallel with test samples in food microbiology laboratories as a quality control measure to assure the satisfactory performance of materials used in the analytical procedure. Before positive findings can be reported for risk management purposes, analysts must have a means of verifying that pathogenic bacteria (e.g., E. coli O157:H7) recovered from test samples are not due to inadvertent contamination with the control strain routinely handled in the laboratory environment. Here, we report on the application of an in-house bioinformatic pipeline for the identification of unique genomic signature sequences in the development of specific oligonucleotide primers enabling the identification of a common positive control strain, E. coli O157:H7 (ATCC 35150), using a simple PCR procedure.

  12. Immunological Characterization of Escherichia coli O157:H7 Intimin γ1

    OpenAIRE

    Son, W.-G.; Graham, T. A.; Gannon, V. P. J.

    2002-01-01

    Portions of the intimin genes of Escherichia coli O157:H7 strain E319 and of the enteropathogenic E. coli O127:H6 strain E2348/69 were amplified by PCR and cloned into pET-28a(+) expression vectors. The entire 934 amino acids (aa) of E. coli O157:H7 intimin, the C-terminal 306 aa of E. coli O157:H7 intimin, and the C-terminal 311 aa of E. coli O127:H6 intimin were expressed as proteins fused with a six-histidine residue tag (six-His tag) in pET-28a(+). Rabbit antisera raised against the six-H...

  13. Rapid detection of Escherichia coli O157:H7 using tunneling magnetoresistance biosensor

    Science.gov (United States)

    Wu, Yuanzhao; Liu, Yiwei; Zhan, Qingfeng; Liu, J. Ping; Li, Run-Wei

    2017-05-01

    A rapid method for the sensitive detection of bacteria using magnetic immunoassay, which are measured with a tunneling magnetoresistance (TMR) sensor, is described. For the measurement of Escherichia coli O157:H7 (E. coli O157:H7) bacteria, the target was labeled by magnetic beads through magnetic immunoassay. The magnetic beads produce a weak magnetic fringe field when external field is applied, thus induce the magnetoresistance change of TMR sensor. A detection limit of 100 CFU/mL E. coli O157:H7 bacteria in 5 hours was obtained. With its high sensitive and rapid detection scheme based on the TMR biosensor, the detection system is an excellent candidate suitable and promising for food safety and biomedical detection.

  14. Outbreak of Escherichia coli O157 infection associated with a music festival.

    Science.gov (United States)

    Crampin, M; Willshaw, G; Hancock, R; Djuretic, T; Elstob, C; Rouse, A; Cheasty, T; Stuart, J

    1999-04-01

    Seven persons who attended the Glastonbury Music Festival were infected with Vero cytotoxin-producing Escherichia coli O157 and an eighth person had serological evidence of infection. Cases were reported from different parts of England. Patients were interviewed by telephone about clinical symptoms, festival attendance, camping details, food history, water exposure, and contact with mud and animals. The interviews identified no common food source, differing use of water sources and widely dispersed camping sites. Escherichia coli O157 strains from seven persons and from a cow belonging to a herd that had previously grazed the site all belonged to phage type 2 and possessed genes for Vero cytotoxin 2. Drug resistance and DNA-based tests showed that six patients were infected with strains indistinguishable from each other and from the bovine isolate. The most likely vehicle of infection was mud contaminated with Escherichia coli O157 from infected cattle.

  15. Fate of enterohemorrhagic Escherichia coli O157:H7 in apple cider with and without preservatives.

    Science.gov (United States)

    Zhao, T; Doyle, M P; Besser, R E

    1993-01-01

    A strain of enterohemorrhagic Escherichia coli serotype O157:H7 isolated from a patient in an apple cider-related outbreak was used to study the fate of E. coli O157:H7 in six different lots of unpasteurized apple cider. In addition, the efficacy of two preservatives, 0.1% sodium benzoate and 0.1% potassium sorbate, used separately and in combination was evaluated for antimicrobial effects on the bacterium. Studies were done at 8 or 25 degrees C with ciders having pH values of 3.6 to 4.0. The results revealed that E. coli O157:H7 populations increased slightly (ca. 1 log10 CFU/ml) and then remained stable for approximately 12 days in lots inoculated with an initial population of 10(5) E. coli O157:H7 organisms per ml and held at 8 degrees C. The bacterium survived from 10 to 31 days or 2 to 3 days at 8 or 25 degrees C, respectively, depending on the lot. Potassium sorbate had minimal effect on E. coli O157:H7 populations, with survivors detected for 15 to 20 days or 1 to 3 days at 8 or 25 degrees C, respectively. In contrast, survivors in cider containing sodium benzoate were detected for only 2 to 10 days or less than 1 to 2 days at 8 or 25 degrees C, respectively. The highest rates of inactivation occurred in the presence of a combination of 0.1% sodium benzoate and 0.1% potassium sorbate. The use of 0.1% sodium benzoate, an approved preservative used by some cider processors, will substantially increase the safety of apple cider in terms of E. coli O157:H7, in addition to suppressing the growth of yeasts and molds. PMID:8368839

  16. Molecular and antimicrobial susceptibility analyses distinguish clinical from bovine Escherichia coli O157 strains.

    Science.gov (United States)

    Vidovic, Sinisa; Tsoi, Sarah; Medihala, Prabhakara; Liu, Juxin; Wylie, John L; Levett, Paul N; Korber, Darren R

    2013-07-01

    A population-based study combining (i) antimicrobial, (ii) genetic, and (iii) virulence analyses with molecular evolutionary analyses revealed segregative characteristics distinguishing human clinical and bovine Escherichia coli O157 strains from western Canada. Human (n = 50) and bovine (n = 50) strains of E. coli O157 were collected from Saskatchewan and Manitoba in 2006 and were analyzed by using the six-marker lineage-specific polymorphism assay (LSPA6), antimicrobial susceptibility analysis, the colicin assay, plasmid and virulence profiling including the eae, ehxA, espA, iha, stx1, stx2, stx2c, stx2d, stx2d-activatable, stx2e, and stx2f virulence-associated genes, and structure analyses. Multivariate logistic regression and Fisher's exact test strongly suggested that antimicrobial susceptibility was the most distinctive characteristic (P = 0.00487) associated with human strains. Among all genetic, virulence, and antimicrobial determinants, resistance to tetracycline (P coli O157 strains. Among 11 virulence-associated genes, stx2c showed the strongest association with E. coli O157 strains of bovine origin. LSPA6 genotyping showed the dominance of the lineage I genotype among clinical (90%) and bovine (70%) strains, indicating the importance of lineage I in O157 epidemiology and ecology. Population structure analysis revealed that the more-diverse bovine strains came from a unique group of strains characterized by a high degree of antimicrobial resistance and high frequencies of lineage II genotypes and stx2c variants. These findings imply that antimicrobial resistance generated among bovine strains of E. coli O157 has a large impact on the population of this human pathogen.

  17. Notice to Readers: Special Podcast: "Defining Moments in MMWR History - E. coli O157:H7".

    Science.gov (United States)

    2017-06-02

    MMWR has released a special podcast that highlights the leading role that MMWR played in reporting on the deadly multistate Escherichia coli O157:H7 foodborne outbreak of 1993. "Defining Moments in MMWR History - E. coli O157:H7" features an interview with Dr. Beth Bell conducted by MMWR Editor-in-Chief Dr. Sonja Rasmussen. Dr. Bell, who served as director of the National Center for Emerging and Zoonotic Infectious Diseases (NCEZID) from 2010 to 2017 and as an Epidemic Intelligence Service Officer during 1992-1994, was one of the first public health responders on the scene for this landmark public health emergency.

  18. Evaluation of a novel antimicrobial solution and its potential for control E. coli O157:H7, non-O157:H7 shiga toxin-producing E. coli, Salmononella spp., and Listeria monocytogenes on beef

    Science.gov (United States)

    The goal of this study was to evaluate the efficacy of a novel antimicrobial solution made with chitosan, lauric arginate ester, and organic acids on Escherichia coli O157:H7, Salmonella spp., Listeria monocytogenes, and non-O157 shiga toxin-producing E. coli cocktails and to test its potential to b...

  19. Thermal tolerance of O157 and non-O157 Shiga toxigenic strains of Escherichia coli, Salmonella, and potential pathogen surrogates, in frankfurter batter and ground beef of varying fat levels.

    Science.gov (United States)

    Vasan, Akhila; Geier, Renae; Ingham, Steve C; Ingham, Barbara H

    2014-09-01

    The non-O157 Shiga toxigenic Escherichia coli (STEC) serogroups most commonly associated with illness are O26, O45, O103, O111, O121, and O145. We compared the thermal tolerance (D55°C) of three or more strains of each of these six non-O157 STEC serogroups with five strains of O157:H7 STEC in 7% fat ground beef. D55°C was also determined for at least one heat-tolerant STEC strain per serogroup in 15 and 27% fat ground beef. D55°C of single-pathogen cocktails of O157 and non-O157 STEC, Salmonella, and potential pathogen surrogates, Pediococcus acidilactici and Staphylococcus carnosus, was determined in 7, 15, and 27% fat ground beef and in frankfurter batter. Samples (25 g) were heated for up to 120 min at 55°C, survivors were enumerated, and log CFU per gram was plotted versus time. There were significant differences in D55°C across all STEC strains heated in 7% fat ground beef (P < 0.05), but no non-O157 STEC strain had D55°C greater than the range observed for O157 STEC. D55°C was significantly different for strains within serogroups O45, O145, and O157 (P < 0.05). D55°C for non-O157 STEC strains in 15 and 27% fat ground beef were less than or equal to the range of D55°C for O157. D55°C for pathogen cocktails was not significantly different when measured in 7, 15, and 27% fat ground beef (P ≥ 0.05). D55°C of Salmonella in frankfurter batter was significantly less than for O157 and non-O157 STEC (P < 0.05). Thermal tolerance of pathogen cocktails in ground beef (7, 15, or 27% fat) and frankfurter batter was significantly less than for potential pathogen surrogates (P < 0.05). Results suggest that thermal processes in beef validated against E. coli O157:H7 have adequate lethality against non-O157 STEC, that thermal processes that target Salmonella destruction may not be adequate against STEC in some situations, and that the use of pathogen surrogates P. acidilactici and S. carnosus to validate thermal processing interventions in ground beef and

  20. Validation of the ANSR(®) E. coli O157:H7 Method for Detection of E. coli O157:H7.

    Science.gov (United States)

    Viator, Ryan; Alles, Susan; Le, Quynh-Nhi; Hosking, Edan; Meister, Evan; Pinkava, Lisa; Tovar, Eric; Mozola, Mark; Rice, Jennifer

    2016-05-01

    A performance validation of the ANSR(®) for E. coli O157:H7 method was conducted in selected food matrixes. This assay uses selective nicking enzyme amplification technology to amplify target genes. Samples are enriched for 12-24 h and then lysed. The assay is completed within 40 min using real-time detection in a combination incubator/fluorescence detector and software. When 44 distinct strains of Escherichia coli O157:H7 and 6 strains of E. coli O157:NM were tested for inclusivity, all 50 strains produced positive results. In exclusivity testing, 57 strains representing 33 species of closely related Gram-negative bacteria belonging to the Enterobacteriaceae family, including 11 non-H7 O157 strains and shiga toxin-producing E. coli other than O157:H7, were evaluated. All 57 nontarget strains generated negative ANSR assay results. Using 80% lean ground beef and beef trim (approximately 20% fat), ANSR method performance was compared to the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure. ANSR performance with baby spinach and sprout irrigation water was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method. ANSR method performance was not statistically different to that of the reference methods using two different enrichment options. For ground beef and beef trim, the standard enrichment in modified Tryptone Soya Broth can be analyzed using the ANSR assay with a 1:10 dilution of the enrichment in phosphate-buffered saline and produces equivalent results to the reference method. Additionally, in most matrixes tested (exception is spinach which required 24 h enrichment) the assay offers great efficiency and flexibility over the reference method with a 12-24 h single-step enrichment. Equivalent results were observed at both time points (12 and 24 h) to reference methods. Small changes to the assay parameters minimally affected ANSR

  1. Utilization of evolutionary model, bioinformatics and heuristics for development of a multiplex Escherichia coli O157:H7 PCR assay

    Science.gov (United States)

    Introduction: Escherichia coli O157:H7 is a devastating foodborne pathogen causing many foodborne outbreaks worldwide with significant morbidity and mortality. The plasticity of the E. coli O157:H7 genome, inconsistent expression of surface antigens, and sharing of genetic elements with other non-...

  2. Evaluation of immunomagnetic separation and PCR for the detection of Escherichia coli O157 in animal feces and meats

    NARCIS (Netherlands)

    Islam, M.A.; Heuvelink, A.E.; Talukder, K.A.; Zwietering, M.H.; Boer, de E.

    2006-01-01

    Series of animal feces and meat samples artificially contaminated with strains of Escherichia coli O157 isolated from different sources were tested by both an immunomagnetic separation (IMS)-based method and a PCR method using primers specific for a portion of the rfbE gene of E. coli O157. IMS is l

  3. Evolution of a zoonotic pathogen: investigating prophage diversity in enterohaemorrhagic E. coli O157 by long-read sequencing

    Science.gov (United States)

    Enterohaemorrhagic Escherichia Coli (EHEC) is a zoonotic pathogen known to be potentially lethal in humans. Its main animal reservoir is ruminants, specifically cattle, and yearly outbreaks occur worldwide with the most prevalent serotype being EHEC O157:H7. Most virulence factors of EHEC O157, incl...

  4. Synergistic interaction in dual-species biofilms formation by Escherichia coli O157:H7 and Ralstonia spp

    Science.gov (United States)

    Introduction: Ralstonia spp., a heterotrophic bacterium that are isolated from produce processing environments as part of the native microflora, have strong potentials for formaing biofilms on various surfaces. When co-cultured, Escherichia coli O157:H7 (EcO157) and Ralstonia spp. displayed a synerg...

  5. Thermal inactivation of Escherichia coli O157:H7 in strawberry puree and its effect on anthocyanins and color

    Science.gov (United States)

    Raw whole strawberries, if contaminated with pathogens such as E. coli O157:H7, must be pasteurized prior to consumption. Therefore, the objective of this research was to investigate the thermal inactivation kinetics of E. coli O157:H7 in strawberry puree (SP), and evaluate the changes in anthocyan...

  6. Evaluation of immunomagnetic separation and PCR for the detection of Escherichia coli O157 in animal feces and meats

    NARCIS (Netherlands)

    Islam, M.A.; Heuvelink, A.E.; Talukder, K.A.; Zwietering, M.H.; Boer, de E.

    2006-01-01

    Series of animal feces and meat samples artificially contaminated with strains of Escherichia coli O157 isolated from different sources were tested by both an immunomagnetic separation (IMS)-based method and a PCR method using primers specific for a portion of the rfbE gene of E. coli O157. IMS is l

  7. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.

    2004-01-01

    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...

  8. A Novel Approach to Investigate Internalization of Escherichia coli O157:H7 in Lettuce and Spinach

    Science.gov (United States)

    The chromosomal integration of the green fluorescent protein (gfp) gene was successfully accomplished into four nalidixic acid resistant E. coli strains: two O157:H7 strains from produce outbreaks, 4407 and 5279, one O157:H7 strain from a beef-associated outbreak, 86-24h11, and a non-pathogenic comm...

  9. Ecology of E. coli O157:H7 and Salmonella enterica in the primary vegetable production chain

    NARCIS (Netherlands)

    Franz, E.; Bruggen, van A.H.C.

    2008-01-01

    There is an increased concern that plants might be more important as a carrier for human enteric pathogens like E. coli O157:H7 and Salmonella enterica serovars than previously thought. This review summarizes the knowledge available on the ecology of E. coli O157:H7 and Salmonella enterica in the pr

  10. Distribution of the urease gene cluster among and urease activities of enterohemorrhagic Escherichia coli O157 isolates from humans

    NARCIS (Netherlands)

    Friedrich, Alexander W; Köck, Robin; Bielaszewska, Martina; Zhang, Wenlan; Karch, Helge; Mathys, Werner

    2005-01-01

    Enterohemorrhagic Escherichia coli (EHEC) O157 strains belong to two closely related major groups, which are differentiated by their sorbitol fermentation phenotypes. Here we studied the conservation of urease genes and their expression in sorbitol-fermenting (SF) and non-SF EHEC O157 isolates. PCR

  11. 34 CFR 222.157 - What procedures apply for issuing or appealing an administrative law judge's decision?

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false What procedures apply for issuing or appealing an administrative law judge's decision? 222.157 Section 222.157 Education Regulations of the Offices of the Department of Education OFFICE OF ELEMENTARY AND SECONDARY EDUCATION, DEPARTMENT OF EDUCATION IMPACT...

  12. Bacterial genetic determinants of non-O157 STEC outbreaks and hemolytic-uremic syndrome after infection.

    Science.gov (United States)

    Wickham, Mark E; Lupp, Claudia; Mascarenhas, Mariola; Vazquez, Alejandra; Coombes, Brian K; Brown, Nat F; Coburn, Bryan A; Deng, Wanyin; Puente, Jose L; Karmali, Mohamed A; Finlay, B Brett

    2006-09-15

    Although O157:H7 Shiga toxin-producing Escherichia coli (STEC) are the predominant cause of hemolytic-uremic syndrome (HUS) in the world, non-O157:H7 serotypes are a medically important cause of HUS that are underdetected by current diagnostic approaches. Because Shiga toxin is necessary but not sufficient to cause HUS, identifying the virulence determinants that predict severe disease after non-O157 STEC infection is of paramount importance. Disease caused by O157:H7 STEC has been associated with a 26-gene pathogenicity island known as O island (OI) 122. To assess the public-health significance of this pathogenicity island, we examined the association between OI122 genes and outbreaks and HUS after non-O157 STEC infection. We found that a subset of OI122 genes is independently associated with outbreaks and HUS after infection with non-O157 STEC. The presence of multiple virulence genes in non-O157 serotypes strengthened this association, which suggests that the additive effects of a variable repertoire of virulence genes contribute to disease severity. In vivo, Citrobacter rodentium mutants lacking outbreak- and HUS-associated genes were deficient for virulence in mice; in particular, nleB mutant bacteria were unable to cause mortality in mice. The present study shows that virulence genes associated epidemiologically with outbreaks and HUS after non-O157 STEC infection are pivotal to the initiation, progression, and outcome of in vivo disease.

  13. PREVALENCE OF VEROCYTOTOXIGENIC ESCHERICHIA-COLI SEROTYPE O157H7 IN CHILDREN WITH DIARRHEA ATTENDING A SYDNEY HOSPITAL

    NARCIS (Netherlands)

    ONG, J; ROBINSBROWNE, R; GAPES, M; OLOUGHLIN, EV

    1993-01-01

    Verotoxin producing Escherichia coli, in particular serotype O157:H7, have been implicated as an important cause of acute gastroenteritis in children. This study was undertaken to determine if E.coli O157:H7 is an important cause of acute gastroenteritis in children in metropolitan Sydney. During th

  14. Antibiotic Susceptibility of Enterohemorrhagic Escherichia coli O157:H7 Isolated from an Outbreak in Japan in 1996

    Science.gov (United States)

    Tsuboi, Isami; Ida, Hirohisa; Yoshikawa, Eiji; Hiyoshi, Suehiro; Yamaji, Emiko; Nakayama, Issei; Nonomiya, Tomoko; Shigenobu, Fritz; Shimizu, Masaki; O’Hara, Koji; Sawai, Tetsuo; Mizuoka, Keiji

    1998-01-01

    The antibiotic susceptibilities of 43 strains of Escherichia coli O157:H7 identified in the summer of 1996 in Japan were investigated. Growth of 90% of O157 strains was inhibited at a concentration of ≤0.5 μg/ml by several agents including fosfomycin with glucose-6-phosphate. PMID:9527800

  15. Comparative survival of Escherichia coli O157:H7, Salmonella Typhimurium, and Murine Norovirus on spinach plants

    Science.gov (United States)

    Introduction: Outbreaks resulting from the consumption of leafy greens contaminated with E. coli O157:H7, Salmonella spp., and norovirus have occurred. It is unclear how the stress response factor rpoS in E. coli O157:H7 and Salmonella spp. affects their survival on spinach. Purpose: A comparison ...

  16. Functional metagenomics of Escherichia coli O157:H7 interactions with spinach indigenous microorganisms during biofilm formation

    Science.gov (United States)

    The increase in foodborne outbreaks worldwide attributed to fresh fruit and vegetables suggests that produce may serve as an ecological niche for enteric pathogens. Here we examined the interaction of E. coli O157:H7 (EcO157) with spinach leaf microflora during co-colonization and establishment of a...

  17. Control of VTEC O157 and Campylobacter jejuni/coli on cattle farms : Effective interventions and implementation

    NARCIS (Netherlands)

    Ellis-Iversen, J

    2009-01-01

    Verocytotoxogenic E. coli O157 (VTEC O157) and Campylobacter jejuni/coli are zoonotic pathogens of public health importance, which are commonly carried and shed by cattle. Control at farm level needed isto limit shedding and contamination of the environment and the human food chain. On- farm risk fa

  18. Preparation of Monoclonal Antibody and Development of Enzyme-linked Immunosorbent Assay Specific for Escherichia coli O157 in Foods

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    Objective To prepare monoclonal antibodies (Mab) and antisera specific for Escherichia coli (E.coli) O157, and to develop a sandwich enzyme-linked immunosorbent assay (ELISA) to detect E.coli O157 in foods. Methods Spleen cells from BALB/c mice immunized with the somatic antigen of E.coli O157:H7 were fused with murine Sp2/0 myeloma cells. The hybridoma cell line specific for E.coli O157 was established after having been subcloned. Antisera specific for E.coli O157 was prepared by intravenous injection into New Zealand rabbits with a stain of E.coli O157:H7. The sandwich ELISA was developed with the polyclonal antibody as the capture antibody and the Mab 3A5 as the detection antibody. The inoculated ground poultry meat and pasteurized milk were tested to confirm efficiency of the method. Results Mab 3A5 specific for E.coli O157 and O113:H21 belonged to subtype IgM. The ascetic titers of the antibody was 1:1×106. No cross-reactivity of the Mab was observed with strains of Salmonella spp, Yersinia enterocolitica, Shigella dysenteriae, etc. The purified polyclonal antibody had a titer of 1:1×105 with E.coli O157. The detection limit of this sandwich ELISA was 103-104 cfu E.coli O157/mL in pure culture with a high specificity, which was characterized by every non-O157 strain with negative response. With 10h enrichment procedure, E.coli O157:H7 recovered well from inoculated ground poultry meat and pasteurized milk at levels of 0.1 cfu/g and 0.1 cfu/mL. Conclusion Mab 3A5 specific for E.coli O157 and O113:H21 can be produced by immunizing BALB/c mice with a strain of E.coli O157:H7. Then a sandwich ELISA can be developed with the polyclonal antibody as the capture antibody and the Mab 3A5 as the detection antibody. The method is proved to be a sensitive and specific technique to detect low number of E.coli O157 in food.

  19. [Characterization of first sorbitol-fermenting shiga toxin-producing Escherichia coli O157:H- strain isolated in Poland].

    Science.gov (United States)

    Jakubczak, Aleksandra; Szych, Jolanta; Januszkiewicz, Kamil

    2008-01-01

    Sorbitol-fermenting shiga toxin-producing E. coli O157:H- strains have emerged as a cause of human disease in many European and non-European countries. The role of SF VTEC O157:H- in the etiology of pediatric HUS and diarrhea is significant. We characterized the first SF VTEC O157:H- strain isolated from 9 year old patient in Poland. Strain possessed many traits characteristics for SF VTEC O157:H-. It fermented sorbitol after overnight incubation and produced beta-glucuronidase. It possessed the stx2, eae-gamma, EhlyA and sfpA genes and did not harbour plasmid-encoded katP and espP genes. Motility was not expressed but the strain possessed the chromosomal fliC locus for H7 antigen. The spread of SF VTEC O157:H- strains demonstrates the need for appropriate procedures for their microbiological diagnosis in Poland.

  20. Microstructure and dielectric properties of dysprosium-doped barium titanate ceramics Microestrutura e propriedades dielétricas de cerâmicas de titanato de bário dopado com disprósio

    Directory of Open Access Journals (Sweden)

    Y. Pu

    2005-09-01

    Full Text Available The substitution behavior and lattice parameter of barium titanate between solid_solubility with a dopant concentration in the range of 0.25 to 1.5 mol% are studied. The influences of dysprosium-doped fraction on the grain size and dielectric properties of barium titanate ceramic, including dielectric constant and breakdown electric field strength, are investigated via scanning electronic microscopy, X-ray diffraction and electric property tester. The results show that, at a dysprosium concentration of 0.75 mol%, the abnormal grain growth is inhibited and the lattice parameters of grain rise up to the maximum because of the lowest vacancy concentration. In addition, the finegrain and high density of barium titanate ceramic result in its excellent dielectric properties. The relative dielectric constant (25 °C reaches to 4100. The temperature coefficient of the capacitance varies from -10 to 10% within the temperature range of -15 °C -100 °C, and the breakdown electric field strength (alternating current achieves 3.2 kV/mm. These data suggest that our barium titanate could be used in the manufacture of high voltage ceramic capacitors.Foram estudados o comportamento da substituição e o parâmetro de rede de titanato de bário da solubilidade sólida com uma concentração de dopante na faixa 0,25-1,5 mol%. As influências da fração do dopante disprósio no tamanho de grão e nas propriedades dielétricas da cerâmica de titanato de bário, incluindo constante dielétrica e rigidez dielétrica foram investigadas por meio de microscopia eletrônica de varredura, difração de raios X e teste de propriedades elétricas. Os resultados mostram que a uma concentração de disprósio de 0,75 mol% o crescimento anormal de grão é inibido e os parâmetros de rede aumentam até um máximo devido a menor concentração de vacâncias. Além disso, as cerâmicas de grãos pequenos e alta densidade resultam em excelentes propriedades dielétricas. A

  1. Neodymium Dysprosium Modified Starch- coated Magnetic Fluid Preparation of Ferrite%淀粉包覆镝钕改性铁氧体磁性液体的制备

    Institute of Scientific and Technical Information of China (English)

    林穗云; 周育辉

    2011-01-01

    In this paper, in order to obtain the ferrite magnetic fluids of higher saturation magnetic intensity with simple technology, nanometer magnetite ( Fe3O4 ) particles ware prepared by chemical co - precipitation. And to a certain proportion of Dysprosium Neodymium ferrite magnetic fluids on the modification, we selected starch prepara- tion for the relief of water - based coating of rare earth iron oxide magnetic fluid composites. We also investigated the amount of Nd - Dy, the amount of coating agent, reaction temperature, coating temperature on the performance of the products and the effects of particle size, and its preliminary characterization was also performed . Through experiment,we summed up, under n (Fe) : [ n ( Nd3+ ) + n ( Dy3+ ) ] = 30:1 and n ( Fe3 + ) : n ( Fe2 + ) = 1.70 ~ 1. 75, the ratio for use of dysprosium and neodymium is n(Dy3+ ) : n(Nd3+ ) =4:1, 25%NH3 · H2O(A. R. ) as precipitating agent and pH value conditioner; the reacting system temperature was controlled in 35 ℃, and the pH value was adjusted to 9 ~ 11 ; the best dosage of starch as the relief is O. 0050g each 6OraL magnetic fluids, the temperature of surfactant was controlled in 50℃ and the pH value was adjusted to 2 ~ 3. In such system under the conditions of a water - based rare - earth compound Nd Dy Fe Magnetic, fluid magnetic oxygen was higher than or- dinary water- based ferrite.%为制备工艺简单且饱和磁化强度高的磁流体,本文采用化学共沉淀法制得了纳米磁性Fe304粒子.然后以一定比例的镝钕对铁氧体磁流体改性,选择淀粉为包覆剂制备水基稀土复合铁氧磁流体.考察了镝钕的用量、包覆剂的用量、反应温度、包覆温度等因素对产物粒径及性能的影响,并对其进行了初步的性能表征.实验总结出适宜的条件:在n(Fe):[n(Nd3+)+n(Dy3+)]=30:1,n(Fe3+):n(Fe2+)=1.70~1.75

  2. Gene Expression during Survival of Escherichia coli O157:H7 in Soil and Water

    Directory of Open Access Journals (Sweden)

    Ashley D. Duffitt

    2011-01-01

    Full Text Available The in vitro survival of Escherichia coli O157:H7 at 15∘C under two experimental conditions (sterile soil and sterile natural water was examined. DNA microarrays of the entire set of E. coli O157:H7 genes were used to measure the genomic expression patterns after 14 days. Although the populations declined, some E. coli O157:H7 cells survived in sterile stream water up to 234 days and in sterile soil for up to 179 days. Cells incubated in soil microcosms for 14 days expressed genes for antibiotic resistance, biosynthesis, DNA replication and modification, metabolism, phages, transposons, plasmids, pathogenesis and virulence, antibiotic resistance, ribosomal proteins, the stress response, transcription, translation, and transport and binding proteins at significantly higher levels than cells grown in Luria broth. These results suggest that E. coli O157:H7 may develop a different phenotype during transport through the environment. Furthermore, this pathogen may become more resistant to antibiotics making subsequent infections more difficult to treat.

  3. Inactivation of Escherichia coli O157:H7 using ultraviolet light-treated bacteriophages.

    Science.gov (United States)

    Hudson, J A; Billington, C; Premaratne, A; On, S L W

    2016-01-01

    Escherichia coli O157:H7 causes serious foodborne infections warranting the development of effective control measures. One control option is to use bacteriophages (phages), which are regarded as safe to humans and an environmentally friendly alternative to chemical antimicrobials. One of the few remaining safety concerns is the potential for phages to facilitate genetic exchange between bacteria so resulting in undesirable mobilisation of genes. UV treatment of phages causes a rapid loss in their ability to replicate, while maintaining their antibacterial activity, and so the use of UV-treated phages could be an alternative to the use of viable phages. Data presented here show the inactivation of E. coli O157:H7 by UV-treated phages in milk and on the surface of raw and cooked meat. A minimum concentration of approximately 10(5) PFU cm(-2) (pre-UV treatment titre) of UV-treated phages was required before inactivation of E. coli O157:H7 on the surface of meat was measurable, and 1-2 log10 CFU cm(-2) reductions were typically obtained at concentrations of around 10(7) UV-treated phages cm(-2) (pre-UV treatment titre). Inactivation of E. coli O157:H7 by UV-treated phages was less than that for untreated phages. The production of UV-treated phages was not optimised and it is possible that better reductions in pathogen concentration could be achieved for the same input UV-treated phages concentrations.

  4. 25 CFR 900.157 - Is the recommended decision always final?

    Science.gov (United States)

    2010-04-01

    ... Payment § 900.157 Is the recommended decision always final? No. If the Indian tribe or tribal organization... days of receiving the recommended decision and the report of the informal conference. If the Indian tribe or tribal organization does not file a notice of appeal within 30 days, or before the...

  5. Transcriptomic response of Escherichia coli O157:H7 to oxidative stress.

    Science.gov (United States)

    Wang, Siyun; Deng, Kaiping; Zaremba, Sam; Deng, Xiangyu; Lin, Chiahui; Wang, Qian; Tortorello, Mary Lou; Zhang, Wei

    2009-10-01

    Chlorinated water is commonly used in industrial operations to wash and sanitize fresh-cut, minimally processed produce. Here we compared 42 human outbreak strains that represented nine distinct Escherichia coli O157:H7 genetic lineages (or clades) for their relative resistance to chlorine treatment. A quantitative measurement of resistance was made by comparing the extension of the lag phase during growth of each strain under exposure to sublethal concentrations of sodium hypochlorite in Luria-Bertani or brain heart infusion broth. Strains in clade 8 showed significantly (P resistance to chlorine than strains from other clades of E. coli O157:H7. To further explore how E. coli O157:H7 responds to oxidative stress at transcriptional levels, we analyzed the global gene expression profiles of two strains, TW14359 (clade 8; associated with the 2006 spinach outbreak) and Sakai (clade 1; associated with the 1996 radish sprout outbreak), under sodium hypochlorite or hydrogen peroxide treatment. We found over 380 genes were differentially expressed (more than twofold; P genes included several regulatory genes responsive to oxidative stress, genes encoding putative oxidoreductases, and genes associated with cysteine biosynthesis, iron-sulfur cluster assembly, and antibiotic resistance. Identification of E. coli O157:H7 strains with enhanced resistance to chlorine decontamination and analysis of their transcriptomic response to oxidative stress may improve our basic understanding of the survival strategy of this human enteric pathogen on fresh produce during minimal processing.

  6. Macromolecule Mediated Transport and Retention of Escherichia coli O157:H7 in Saturated Porous Media

    Science.gov (United States)

    The role of extracellular macromolecules on Escherichia coli O157:H7 transport and retention was investigated in saturated porous media. To compare the relative transport and retention of E. coli cells that are macromolecule rich and deficient, macromolecules were partially cleaved using a proteolyt...

  7. Chemiluminescent detect of E. coli O157:H7 using immunological method based on magnetic nanoparticles.

    Science.gov (United States)

    Li, Zhiyang; He, Lei; He, Nongyue; Shi, Zhiyang; Wang, Hua; Li, Song; Liu, Hongna; Li, Xiaolong; Dai, Yabin; Wang, Zhifei

    2010-02-01

    The system of chemiluminescent magnetic enzyme-linked immunoassay was developed. E. coli O157:H7 was sandwiched between rabbits anti-E. coli O157:H7 polyclonal antibody-coated magnetic nanoparticles (immunomagnetic nanoparticles or IMNPs) and mouse anti-E. coli O157:H7 monoclonal antibody. Commercial alkaline phosphatase conjugated horse anti-mouse immunoglobulin (ALP-Ab) was used to bind with the monoclonal antibody, finally the chemiluminescent signals were detected by adding 3-(2'-spiroadamantane)-4-methoxy-4-(3"-phosphoryloxy)phenyl-1,2-dioxetane (AMPPD) which was the substrate reagent of ALP. Different solvents of AMPPD were compared to get an optimal chemiluminescent signal. The effects of sodium borohydride and glycine on blocking the aldehyde groups of IMNPs were compared either, and the specificity and sensitivity of this system for detecting E. coli O157:H7 were researched. The results indicated that Tris buffer was the best solvent of AMPPD, sodium borohydride was better than glycine in blocking IMNPs, and this method was of good specificity when using E. coli Top 10F' and Vibrio cholera as negative controls. The detection limit was 10(3) cells mL(-1) when the antigen solution was 1 mL, and the procedure duration was about 3 h.

  8. Shiga toxin-producing Escherichia coli (STEC) O157 outbreak, The Netherlands, September-October 2005.

    Science.gov (United States)

    Doorduyn, Y; de Jager, C M; van der Zwaluw, W K; Friesema, I H M; Heuvelink, A E; de Boer, E; Wannet, W J B; van Duynhoven, Y T H P

    2006-07-01

    In September 2005, the first national food-related outbreak of Shiga toxin (Stx)-producing Escherichia coli (STEC) O157 was investigated in the Netherlands. A total of 21 laboratory-confirmed cases (including one secondary case), and another 11 probable cases (two primary and nine secondary cases) were reported in patients who became ill between 11 September and 10 October 2005. Preliminary investigation suggested consumption of a raw beef product, steak tartare (in the Netherlands also known as "filet americain"), and contact with other symptomatic persons as possible risk factors. A subsequent case-control study supported the hypothesis that steak tartare was the source of the outbreak (matched odds ratio (OR) 272, 95% confidence interval (CI) 3-23,211). Consumption of ready-to-eat vegetables was also associated with STEC O157 infection (matched OR 24, 95% CI 1.1-528), but was considered a less likely source, as only 40% of the cases were exposed. Samples of steak tartare collected from one chain of supermarkets where it is likely that most patients (67%) bought steak tartare, all tested negative for STEC O157. However, sampling was done three days after the date of symptom onset of the last reported case. Since 88% of the cases became ill within a two week period, point source contamination may explain these negative results. It is concluded that steak tartare was the most likely cause of the first national food-related outbreak of STEC O157 in the Netherlands.

  9. Shiga toxin-producing Escherichia coli (STEC) O157 outbreak, The Netherlands, September - October 2005.

    NARCIS (Netherlands)

    Doorduyn, Y; Jager, C M de; Zwaluw, W K; Friesema, Ihm; Heuvelink, Ae; Boer, E de; Wannet, W J B; Duynhoven, Y T H P van

    2006-01-01

    In September 2005, the first national food-related outbreak of Shiga toxin (Stx)-producing Escherichia coli (STEC) O157 was investigated in the Netherlands. A total of 21 laboratory-confirmed cases (including one secondary case), and another 11 probable cases (two primary and nine secondary cases) w

  10. 33 CFR 157.202 - Plans and documents for foreign tank vessels: Submission.

    Science.gov (United States)

    2010-07-01

    ... RELATING TO TANK VESSELS CARRYING OIL IN BULK Dedicated Clean Ballast Tanks on Tank Vessels General § 157..., Washington, D.C. 20593-0001— (a) Plans that include: (1) The dedicated clean ballast tank arrangement; and (2) A drawing or diagram of the pumping and piping system for the dedicated clean ballast tanks; and...

  11. 33 CFR 157.224 - Dedicated Clean Ballast Tanks Operations Manual.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Dedicated Clean Ballast Tanks... VESSELS CARRYING OIL IN BULK Dedicated Clean Ballast Tanks on Tank Vessels Design and Equipment § 157.224 Dedicated Clean Ballast Tanks Operations Manual. Each Dedicated Clean Ballast Tanks Operations Manual...

  12. 33 CFR 157.228 - Isolating Valves: Closed during a voyage.

    Science.gov (United States)

    2010-07-01

    ... SECURITY (CONTINUED) POLLUTION RULES FOR THE PROTECTION OF THE MARINE ENVIRONMENT RELATING TO TANK VESSELS CARRYING OIL IN BULK Dedicated Clean Ballast Tanks on Tank Vessels Dedicated Clean Ballast Tanks Operations § 157.228 Isolating Valves: Closed during a voyage. (a) The master of each U.S. tank vessel under §...

  13. 33 CFR 157.212 - Dedicated Clean Ballast Tanks Operations Manual: Not approved.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Dedicated Clean Ballast Tanks... RELATING TO TANK VESSELS CARRYING OIL IN BULK Dedicated Clean Ballast Tanks on Tank Vessels General § 157.212 Dedicated Clean Ballast Tanks Operations Manual: Not approved. If the Dedicated Clean...

  14. 33 CFR 157.208 - Dedicated Clean Ballast Tanks Operations Manual for foreign tank vessels: Submission.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Dedicated Clean Ballast Tanks... MARINE ENVIRONMENT RELATING TO TANK VESSELS CARRYING OIL IN BULK Dedicated Clean Ballast Tanks on Tank Vessels General § 157.208 Dedicated Clean Ballast Tanks Operations Manual for foreign tank...

  15. 33 CFR 157.200 - Plans for U.S. tank vessels: Submission.

    Science.gov (United States)

    2010-07-01

    ... CARRYING OIL IN BULK Dedicated Clean Ballast Tanks on Tank Vessels General § 157.200 Plans for U.S. tank... or documents that include the following: (1) The dedicated clean ballast tank arrangement. (2... dedicated clean ballast tanks, meets the stability standards for load line assignment in 46 CFR part 42....

  16. 33 CFR 157.214 - Required documents: U.S. tank vessels.

    Science.gov (United States)

    2010-07-01

    ... CARRYING OIL IN BULK Dedicated Clean Ballast Tanks on Tank Vessels General § 157.214 Required documents: U... ballast tank system plans; (b) The Coast Guard approved Dedicated Clean Ballast Tanks Operations Manual... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Required documents: U.S....

  17. 33 CFR 157.225 - Dedicated clean ballast tanks operations: General.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Dedicated clean ballast tanks... VESSELS CARRYING OIL IN BULK Dedicated Clean Ballast Tanks on Tank Vessels Dedicated Clean Ballast Tanks Operations § 157.225 Dedicated clean ballast tanks operations: General. The master of a tank vessel...

  18. 33 CFR 157.226 - Dedicated Clean Ballast Tanks Operations Manual: Procedures to be followed.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Dedicated Clean Ballast Tanks... ENVIRONMENT RELATING TO TANK VESSELS CARRYING OIL IN BULK Dedicated Clean Ballast Tanks on Tank Vessels Dedicated Clean Ballast Tanks Operations § 157.226 Dedicated Clean Ballast Tanks Operations...

  19. 76 FR 62494 - 30-Day Notice of Proposed Information Collection: DS-157, Supplemental Nonimmigrant Visa Form...

    Science.gov (United States)

    2011-10-07

    ...: Nonimmigrant visa applicants legally required to provide additional security and background information... Officer in the Office of Information and Regulatory Affairs at the Office of Management and Budget (OMB... provide additional security and background information who does not use the DS-160 will use the DS-157 to...

  20. 18 CFR 157.208 - Construction, acquisition, operation, replacement, and miscellaneous rearrangement of facilities.

    Science.gov (United States)

    2010-04-01

    ... in column 1 of Table I, under paragraph (d) of this section, or if the project is required to restore... of the certificate holder's system affected by the proposal; (6) The estimated cost and method of... certificate holder shall file in the manner prescribed in §§ 157.6(a) and 385.2011 of this chapter as part...

  1. Karistusseadustiku § 157² probleeme Internetiga seotud identiteedivarguste kontekstis / Merika Nimmo

    Index Scriptorium Estoniae

    Nimmo, Merika, 1990-

    2014-01-01

    Karistusseadustikus §-s 157² sisalduv kuriteokoosseis ning selle reguleerimisala ja efektiivsus Internetiga seotud identiteedivarguste kontekstis. Artikkel põhineb Tartu Ülikooli õigusteaduskonnas 2014. a kevadel kaitstud magistritööl, mille teemaks on „Internetiga seotud identiteedivargus ja selle regulatsioon Eesti karistusõiguses“

  2. Proliferation of Escherichia coli O157:H7 in soil and hydroponic microgreen production systems

    Science.gov (United States)

    Radish (Raphanus sativus var. longipinnatus) microgreens were produced from seeds inoculated with Escherichia coli O157: H7 using soil substitute and hydroponic production systems. E. coli populations on the edible and inedible parts of harvested microgreen plants and in growth medium were examined....

  3. Passive Immunization by Recombinant Ferric Enterobactin Protein (FepA from Escherichia Coli O157

    Directory of Open Access Journals (Sweden)

    Seyed Mehdi Larrie-Baghal

    2013-06-01

    Full Text Available Background: Enterohemorrhagic Escherichia coli (EHEC O157:H7 has been recognized as a major food borne pathogen responsible for frequent hemorrhagic colitis and hemolytic uremic syndrome in humans. Cattle are important reservoirs of E. coli O157:H7, in which the organism colonizes the intestinal tract and is shed in the feces.Objective: Vaccination of cattle has significant potential as a pre-harvest intervention strategy for E. coli O157:H7. The aim of this study was to evaluate active and passive immunization against E. coli O157:H7 using a recombinant protein.Materials and Methods: The recombinant FepA protein induced by IPTG was purified by nickel affinity chromatography. Antibody titre was determined by ELISA in FepA immunized rabbits sera. Sera collected from vaccinated animals were used for bacterial challenge in passive immunization studies.Results: The results demonstrate that passive immunization with serum raised against FepA protects rabbits from subsequent infection.Conclusion: Significant recognition by the antibody of ferric enterobactin binding protein may lead to its application in the restriction of Enterobacteriaceae propagation.

  4. EspA-Intimin chimeric protein, a candidate vaccine against Escherichia coli O157:H7.

    Directory of Open Access Journals (Sweden)

    Hamid Sedighian Rad

    2013-09-01

    Full Text Available Enterohemorrhagic Escherichia coli (EHEC O157:H7 is an important enteric pathogen in human causing bloody or nonbloody diarrhea, which may be complicated by hemolytic uremic syndrome (HUS. Cattle are an important reservoir of EHEC. This research aims at vaccination with a divalent chimer protein composed of EspA120 and Intimin 282 and its preventive effect of EHEC O157 colonization in mice rectal epithelium.A divalent recombinant EspA-Intimin (EI protein containing EspA120 and Intimin280 attached with a linker was amplified from a trivalent construct and cloned in pET-28a (+ vector. The immunization was conducted in mice after expression and purification of the recombinant EI (rEI.Mice subcutaneously immunized with rEI, elicited significant rEI specific serum IgG antibodies and showed significantly decreased E.coli O157:H7 shedding compared to the control group.The chimeric recombinant protein induced strong humoral response as well as protection against oral challenges with live E.coli O157:H7.

  5. Transmission and quantification of verocytotoxin-producing Escherichia coli O157 in dairy cattle and calves

    NARCIS (Netherlands)

    Schouten, J.M.; Graat, E.A.M.; Frankena, K.; Zijderveld, van F.G.; Jong, de M.C.M.

    2009-01-01

    Data from a field study of 14 months duration in a naturally colonized dairy herd and data from an experiment with calves were used to quantify transmission of verocytotoxin-producing Escherichia coli (VTEC O157) in cattle. For the latter, two groups of 10 calves were randomly assigned and put out

  6. The endophytic lifestyle of Escherichia coli O157:H7: quantification and internal localization in roots.

    Science.gov (United States)

    Wright, Kathryn M; Chapman, Sean; McGeachy, Kara; Humphris, Sonia; Campbell, Emma; Toth, Ian K; Holden, Nicola J

    2013-04-01

    The foodborne pathogen Escherichia coli O157:H7 is increasingly associated with fresh produce (fruit and vegetables). Bacterial colonization of fresh produce plants can occur to high levels on the external tissue but bacteria have also been detected within plant tissue. However, questions remain about the extent of internalization, its molecular basis, and internal location of the bacteria. We have determined the extent of internalization of E. coli O157:H7 in live spinach and lettuce plants and used high-resolution microscopy to examine colony formation in roots and pathways to internalization. E. coli O157:H7 was found within internal tissue of both produce species. Colonization occurred within the apoplast between plant cells. Furthermore, colonies were detected inside the cell wall of epidermal and cortical cells of spinach and Nicotiana benthamiana roots. Internal colonization of epidermal cells resembled that of the phytopathogen Pectobacterium atrosepticum on potato. In contrast, only sporadic cells of the laboratory strain of E. coli K-12 were found on spinach, with no internal bacteria evident. The data extend previous findings that internal colonization of plants appears to be limited to a specific group of plant-interacting bacteria, including E. coli O157:H7, and demonstrates its ability to invade the cells of living plants.

  7. [A selective nutrient medium for isolating clinical strains of Escherichia coli O157:H7].

    Science.gov (United States)

    Sultanov, Z Z; Stepanova, E D; Kakulina, E A

    2000-01-01

    A dried selective culture medium, electrolyte-deficient sorbitol agar (EDS agar), for the isolation and preliminary identification of E. coli O157:H7 from clinical material has been developed. The medium is not inferior in its quality to analogous foreign media and requires no scarce ingredients for its manufacture.

  8. Karistusseadustiku § 157² probleeme Internetiga seotud identiteedivarguste kontekstis / Merika Nimmo

    Index Scriptorium Estoniae

    Nimmo, Merika, 1990-

    2014-01-01

    Karistusseadustikus §-s 157² sisalduv kuriteokoosseis ning selle reguleerimisala ja efektiivsus Internetiga seotud identiteedivarguste kontekstis. Artikkel põhineb Tartu Ülikooli õigusteaduskonnas 2014. a kevadel kaitstud magistritööl, mille teemaks on „Internetiga seotud identiteedivargus ja selle regulatsioon Eesti karistusõiguses“

  9. Prevalence of Escherichia coli O157 in cattle and swine in central Mexico.

    Science.gov (United States)

    Callaway, T R; Anderson, R C; Tellez, G; Rosario, C; Nava, G M; Eslava, C; Blanco, M A; Quiroz, M A; Olguín, A; Herradora, M; Edrington, T S; Genovese, K J; Harvey, R B; Nisbet, D J

    2004-10-01

    Escherichia coli O157:H7 is a foodborne pathogenic bacterium that can reside undetected in the gastrointestinal tract of cattle because colonization by this bacterium is asymptomatic. Recent research has indicated that swine can carry and transmit this pathogen as well. The development of more advanced and sensitive detection techniques has improved the limit of detection and increased sensitivity for this important pathogen. This study was undertaken to determine the prevalence of E. coli O157 in cattle and swine in Mexico with the more sensitive detection technique of immunomagnetic bead separation. Samples (n = 60 per farm) were taken from four cattle and four swine farms (n = 240 cattle samples, n = 240 swine samples) located throughout central Mexico in October 2001. The prevalence of E. coli O157 was found to be only 1.25% on cattle farms and 2.1% on swine farms. The prevalence in cattle in this study is lower than that reported in the United States and could be related to the lower reported prevalence of E. coli O157 in humans in Mexico. However, further research is needed to verify prevalence throughout other regions of Mexico, as well as prevalence during other seasons of the year.

  10. Prevalence of VTEC O157 in dairy and veal herds and risk factors for veal herds

    NARCIS (Netherlands)

    Berends, I.M.G.A.; Graat, E.A.M.; Swart, W.A.J.M.; Weber, M.F.; Giessen, van de A.W.; Lam, T.J.G.M.; Heuvelink, A.E.; Weering, H.J.

    2008-01-01

    The aim of this study was to determine the herd prevalence of veal and dairy herds and to identify risk factors for VTEC O157 positive veal herds. The study was based on monitoring data from November 1996 through July 2005 of 1051 dairy herds and 930 veal herds. The herd level prevalence (95% CI) wa

  11. Escherichia coli O157 in foodstuffs: first year results of monitoring plan in Piedmont region, 2011

    Directory of Open Access Journals (Sweden)

    Antonio Barbaro

    2012-10-01

    Full Text Available A total of 260 food samples were examined for the presence of Shiga toxin-producing Escherichia coli O157 (STEC O157. Samples were collected between May 2011 and September 2011 in Piedmont region and included 120 minced meat and meat preparation (hamburger and meat balls and 180 soft and semi-soft cheeses made from raw milk with less than 60 days of ripening. Samples were collected at re-tail level. All samples were tested using an Enzyme Linked Fluorescent Assay (ELFA (AFNOR BIO 12/8 - 07/00, with kit VIDAS® ECO (bioMérieux; if positive, the samples have been tested with VIDAS® ICE and spread onto selective media to allow the growth of the strains. If present, all the strains have been tested to detect the genes encoding the pathogen factors (stx1, stx2 and eae. STEC O157 was not detected in any products. This survey on the presence of STEC O157 in foodstuffs provided data, demonstrating a low prevalence of the pathogen in our Region.

  12. Stress in gastrointestinal tract and stable gastric pentadecapeptide BPC 157. Finally, do we have a solution?

    Science.gov (United States)

    Sikiric, Predrag; Seiwerth, Sven; Rucman, Rudolf; Drmic, Domagoj; Stupnisek, Mirjana; Kokot, Antonio; Sever, Marko; Zoricic, Ivan; Zoricic, Zoran; Batelja, Lovorka; Ziger, Tihomil; Vlainic, Josipa; Rasic, Zarko; Bencic, Martina Lovric

    2017-02-20

    Selye's syndrome produced by diverse nocuous agents and "response to damage as such" means Selye's stress triad in stress coping response to reestablish homeostasis. Logically, from the gastrointestinal tract viewpoint, such organoprotective/healing response implies the angiogenic growth factors that commonly signify the healing. Thereby, the gastric pentadecapeptide BPC 157-organoprotection (huge range of beneficial effects) signifies the Selye's stress concept/stress coping response implemented in and from gastrointestinal tract, and BPC 157 as an integrative mediator that integrates the adaptive bodily response to stress. In clinical trials without side effects, LD1 was not achieved, BPC 157 healing in gastrointestinal tract, and particularly the healing of the extra-gastrointestinal tissues (i.e., skin/tendon/ligament/muscle/bone; nerve; cornea/ brain) were referred throughout its integrative capabilities (i.e., ulcerative colitis/multiple sclerosis model equally counteracted), native in gastrointestinal tract, stability in human gastric juice (and thereby, strong efficacy and applicability), its relevance for dopamine-system function (and thereby, counteracting effects of dopamine-system dysfunction and over-function, centrally and peripherally (mucosa maintenance); interaction with serotonin- and GABA-system)), afforded cytoprotection/adaptive cytoprotection/organoprotection (and thereby, beneficial effects on gastric and whole intestinal tract lesions and adaptation, wounds and fistulas healing, blood vessels, somatosensory neurons, NSAIDs-side effects (including also pancreas, liver, brain lesions, and blood disturbances, prolonged bleeding, thrombocytopenia, thrombosis)). Further, we combine such gut-brain axis and the NO-system where BPC 157 counteracts complications of either L-NAME application (i.e., various lesions aggravation, hypertension) or L-arginine application (i.e., hypotension, prolonged bleeding, thrombocytopenia). Also, BPC 157 particularly

  13. Gratings, photosensitivity, and poling in silica optical waveguides with 157-nm fluorine laser radiation

    Science.gov (United States)

    Chen, Peng (Kevin)

    2002-08-01

    The energetic 7.9-eV photons of the F2 laser directly access bandgap states in germanosilicate glasses to drive one-photon processes for inducing strong refractive index changes in silica optical waveguides. In this thesis, the author carried out the first comprehensive F2-laser photosensitivity studies with an aim to assess prospects for shaping useful photonic structures directly inside the germanosilicate waveguides. Both planar waveguides and standard telecommunication fibers were examined. Large effective index change (>10-3) was induced in both fibers and planar waveguides without any enhancement technique. With the use of hydrogen loading enhancement, asymmetric refractive index profiles were noted by atomic force microscopy and microreflection microscopy, having a peak index change of larger than 0.01 in the fiber core. The 157-nm laser radiation is effective in rapidly forming long-period gratings in standard fibers. Grating formation is over 250 times faster than that with the 248-nm KrF laser constituting the fastest photosensitivity response ever reported. For planar lightwave circuits (PLCs), the 157-nm laser exposure generate narrow profiles of large index changes (Deltan ˜ 10 -2) that is useful in trimming phase errors and controlling birefringence in frequency domain modulators (FDMs) and interleavers. The large vacuum-ultraviolet-induced birefringence was used to completely compensate the intrinsic birefringence of Deltan ˜ 10-4 in typical PLCs. With hydrogen soaking, modest 157-nm pre-irradiation (accumulated fluence >3 J/cm2) was found to 'lock-in' a permanent photosensitivity enhancement in the germanosilica, permitting the formation of strong (40 dB) and stable fiber Bragg gratings with 248-nm-KrF laser light. The F2-laser photosensitivity locking was 300-time more effective than with KrF-laser pretreatment. The practical trimming applications in PLCs were demonstrated in PLC interleavers and FDMs. The 157-nm laser pre-radiation was found to

  14. Antibacterial Activities of Wasabi against Escherichia coli O157:H7 and Staphylococcus aureus

    Science.gov (United States)

    Lu, Zhongjing; Dockery, Christopher R.; Crosby, Michael; Chavarria, Katherine; Patterson, Brett; Giedd, Matthew

    2016-01-01

    Escherichia coli O157:H7 and Staphylococcus aureus are two of the major pathogens frequently involved in foodborne outbreaks. Control of these pathogens in foods is essential to food safety. It is of great interest in the use of natural antimicrobial compounds present in edible plants to control foodborne pathogens as consumers prefer more natural “green” foods. Allyl isothiocyanate (AITC) is an antimicrobial compound naturally present in wasabi (Japanese horseradish) and several other edible plants. Although the antibacterial effects of pure AITC and wasabi extract (essential oil) against several bacteria have been reported, the antibacterial property of natural wasabi has not been well studied. This study investigated the antibacterial activities of wasabi as well as AITC against E. coli O157:H7 and S. aureus. Chemical analysis showed that AITC is the major isothiocyanate in wasabi. The AITC concentration in the wasabi powder used in this study was 5.91 ± 0.59 mg/g. The minimum inhibitory concentration (MIC) of wasabi against E. coli O157:H7 or S. aureus was 1% (or 10 mg/ml). Wasabi at 4% displayed higher bactericidal activity against S. aureus than against E. coli O157:H7. The MIC of AITC against either pathogen was between 10 and 100 μg/ml. AITC at 500 μg/ml was bactericidal against both pathogens while AITC at 1000 μg/ml eliminated E. coli O157:H7 much faster than S. aureus. The results from this study showed that wasabi has strong antibacterial property and has high potential to effectively control E. coli O157:H7 and S. aureus in foods. The antibacterial property along with its natural green color, unique flavor, and advantage to safeguard foods at the point of ingestion makes wasabi a promising natural edible antibacterial plant. The results from this study may be of significant interest to the food industry as they develop new and safe foods. These results may also stimulate more research to evaluate the antibacterial effect of wasabi against other

  15. Evaluation of Animal Genetic and Physiological Factors That Affect the Prevalence of Escherichia coli O157 in Cattle

    Science.gov (United States)

    Jeon, Soo Jin; Elzo, Mauricio; DiLorenzo, Nicolas; Lamb, G. Cliff; Jeong, Kwang Cheol

    2013-01-01

    Controlling the prevalence of Escherichia coli O157 in cattle at the pre-harvest level is critical to reduce outbreaks of this pathogen in humans. Multilayers of factors including the environmental and bacterial factors modulate the colonization and persistence of E. coli O157 in cattle that serve as a reservoir of this pathogen. Here, we report animal factors contributing to the prevalence of E. coli O157 in cattle. We observe the lowest number of E. coli O157 in Brahman breed when compared with other crosses in an Angus-Brahman multibreed herd, and bulls excrete more E. coli O157 than steers in the pens where cattle were housed together. The presence of super-shedders, cattle excreting >105 CFU/rectal anal swab, increases the concentration of E. coli O157 in the pens; thereby super-shedders enhance transmission of this pathogen among cattle. Molecular subtyping analysis reveal only one subtype of E. coli O157 in the multibreed herd, indicating the variance in the levels of E. coli O157 in cattle is influenced by animal factors. Furthermore, strain tracking after relocation of the cattle to a commercial feedlot reveals farm-to-farm transmission of E. coli O157, likely via super-shedders. Our results reveal high risk factors in the prevalence of E. coli O157 in cattle whereby animal genetic and physiological factors influence whether this pathogen can persist in cattle at high concentration, providing insights to intervene this pathogen at the pre-harvest level. PMID:23405204

  16. Transmission and quantification of verocytotoxin-producing Escherichia coli O157 in dairy cattle and calves.

    Science.gov (United States)

    Schouten, J M; Graat, E A M; Frankena, K; VAN Zijderveld, F; DE Jong, M C M

    2009-01-01

    Data from a field study of 14 months duration in a naturally colonized dairy herd and data from an experiment with calves were used to quantify transmission of verocytotoxin-producing Escherichia coli (VTEC O157) in cattle. For the latter, two groups of 10 calves were randomly assigned and put out in one of two pastures. From each group, five animals were experimentally inoculated with 109 c.f.u. O157 VTEC and, considered infectious, put back in their group. Each of the susceptible contact calves became positive within 6 days of being reunited. The estimate of the basic reproduction ratio (R0) in the experiment was 7.3 (95% CI 3.92-11.5), indicating that each infectious calf will infect seven other calves on average during an assumed infectious period of 28 days in a fully susceptible population. The R0 among dairy cows appeared to be about 10 times lower (0.70, 95% CI 0.48-1.04). After the transmission experiment, six contact-infected animals that were shedding continuously during the experiment were housed in a tie stall during winter. After 40 days, all six tested negative for O157 VTEC. In June, after a period of 34 weeks in which the heifers remained negative, they were put out in a clean and isolated pasture to observe whether they started shedding again. On each pasture that was infected with O157 VTEC during the transmission experiment the previous summer, newly purchased susceptible calves were placed. None of the heifers or calves started shedding during 14 weeks, indicating that both the heifers and the previously contaminated pasture did not function as reservoir of O157 VTEC.

  17. 18 CFR Appendix I to Subpart F of... - Procedures for Compliance With the Endangered Species Act of 1973 Under § 157.206(b)(3)(i)

    Science.gov (United States)

    2010-04-01

    ... Compliance With the Endangered Species Act of 1973 Under § 157.206(b)(3)(i) I Appendix I to Subpart F of... Transactions and Abandonment Pt. 157, Subpt. F, App. I Appendix I to Subpart F of Part 157—Procedures for Compliance With the Endangered Species Act of 1973 Under § 157.206(b)(3)(i) The following procedures apply...

  18. Human Regulatory Protein Ki-1/57 Is a Target of SUMOylation and Affects PML Nuclear Body Formation.

    Science.gov (United States)

    Saito, Ângela; Souza, Edmarcia E; Costa, Fernanda C; Meirelles, Gabriela V; Gonçalves, Kaliandra A; Santos, Marcos T; Bressan, Gustavo C; McComb, Mark E; Costello, Catherine E; Whelan, Stephen A; Kobarg, Jörg

    2017-09-01

    Ki-1/57 is a nuclear and cytoplasmic regulatory protein first identified in malignant cells from Hodgkin's lymphoma. It is involved in gene expression regulation on both transcriptional and mRNA metabolism levels. Ki-1/57 belongs to the family of intrinsically unstructured proteins and undergoes phosphorylation by PKC and methylation by PRMT1. Previous characterization of its protein interaction profile by yeast two-hybrid screening showed that Ki-1/57 interacts with proteins of the SUMOylation machinery, the SUMO E2 conjugating enzyme UBC9 and the SUMO E3 ligase PIAS3, which suggested that Ki-1/57 could be involved with this process. Here we identified seven potential SUMO target sites (lysine residues) on Ki-1/57 sequence and observed that Ki-1/57 is modified by SUMO proteins in vitro and in vivo. We showed that SUMOylation of Ki-1/57 occurred on lysines 213, 276, and 336. In transfected cells expressing FLAG-Ki-1/57 wild-type, its paralog FLAG-CGI-55 wild-type, or their non-SUMOylated triple mutants, the number of PML-nuclear bodies (PML-NBs) is reduced compared with the control cells not expressing the constructs. More interestingly, after treating cells with arsenic trioxide (As2O3), the number of PML-NBs is no longer reduced when the non-SUMOylated triple mutant Ki-1/57 is expressed, suggesting that the SUMOylation of Ki-1/57 has a role in the control of As2O3-induced PML-NB formation. A proteome-wide analysis of Ki-1/57 partners in the presence of either SUMO-1 or SUMO-2 suggests that the involvement of Ki-1/57 with the regulation of gene expression is independent of the presence of either SUMO-1 or SUMO-2; however, the presence of SUMO-1 strongly influences the interaction of Ki-1/57 with proteins associated with cellular metabolism, maintenance, and cell cycle.

  19. 77 FR 58091 - Risk-Based Sampling of Beef Manufacturing Trimmings for Escherichia coli (E. coli) O157:H7 and...

    Science.gov (United States)

    2012-09-19

    ... coli (E. coli) O157:H7 and Plans for Beef Baseline AGENCY: Food Safety and Inspection Service (FSIS), U... announcing its intention to redesign its E. coli O157:H7 verification testing program for beef manufacturing... prevalence estimates for E. coli O157:H7 in raw beef manufacturing trimmings. This notice also discusses FSIS...

  20. Short-term evolution of Shiga toxin-producing Escherichia coli O157:H7 between two food-borne outbreaks

    Science.gov (United States)

    Background: Shiga toxin-producing Escherichia coli (STEC) O157 is a public health threat and outbreaks occur worldwide. STEC O157 has a mosaic genome with extensive prophage integration, including bacteriophage-encoded Shiga toxins. Here, we investigate genomic differences in a strain of STEC O157 t...

  1. Naturally resident and exogenously applied T4-like and T5-like bacteriophages can reduce Escherichia coli O157:H7 levels in sheep guts

    Science.gov (United States)

    In preparing sheep for an in vivo Escherichia coli O157:H7 eradication trial, we found that 20/39 members of a single flock were naturally colonized by O157:H7-infecting phages. Characterization showed these were all one phage type (subsequently named CEV2) infecting 15/16 O157:H7, 7/72 ECOR, and c...

  2. Incorporation of Escherichia coli O157:H7 in dual-species biofilms with Ralstonia insidiosa, a primary colonizer for the development of heterogeneous biofilms

    Science.gov (United States)

    The presence of strong biofilm forming microflora could potentially enhance the survival of Escherichia coli O157:H7 (EcO157) in harsh environment. One strain of Ralstonia insidiosa isolated from produce processing environments, previously displayed a synergistic interaction with EcO157 in dual-spec...

  3. Cytolethal distending toxin from Shiga toxin-producing Escherichia coli O157 causes irreversible G2/M arrest, inhibition of proliferation, and death of human endothelial cells

    NARCIS (Netherlands)

    Bielaszewska, Martina; Sinha, Bhanu; Kuczius, Thorsten; Karch, Helge

    2005-01-01

    Recently, cytolethal distending toxin V (CDT-V), a new member of the CDT family, was identified in Shiga toxin-producing Escherichia coli (STEC) O157 and particular non-O157 serotypes. Here we investigated the biological effects of CDT-V from STEC O157:H(-) (strain 493/89) on human endothelial cells

  4. Vaccination with attenuated Salmonella enterica Dublin expressing E coli O157:H7 outer membrane protein Intimin induces transient reduction of fecal shedding of E coli O157:H7 in cattle

    Directory of Open Access Journals (Sweden)

    Fang Ferric C

    2010-07-01

    Full Text Available Abstract Background Escherichia coli serogroup O157:H7 has emerged as an important zoonotic bacterial pathogen, causing a range of symptoms from self-limiting bloody diarrhea to severe hemorrhagic colitis and hemolytic-uremic syndrome in humans. Beef and dairy cattle are considered the most important animal reservoirs for this pathogen. One of the important virulence characteristics of E. coli O157:H7 is the eaeA gene encoding the 97 kDa surface protein intimin. Intimin is required for attachment and effacement during the interaction of enterohemorrhagic E. coli with human and bovine neonatal enterocytes. The present study was undertaken to test the hypothesis that an adaptive mucosal immune response directed against intimin will reduce or prevent enteric colonization and fecal shedding of E. coli O157:H7 in cattle. Results Cattle were orally inoculated with either milk (control, milk with live attenuated Salmonella enterica serovar Dublin (vector, or milk with live attenuated recombinant S. Dublin expressing intimin (vaccinated on days 0, 14 and 28. On day 98, all calves were challenged orally with E. coli O157:H7 to evaluate whether vaccination with the recombinant S. Dublin expressing intimin would reduce the level of E. coli O157:H7 fecal shedding. During the first 28 days, vaccinated calves shed both the vector strain and the intimin-expressing S. Dublin strain at a similar level. The vector strain was shed for a significantly longer period as compared to the level of recombinant vaccine strain. Calves that received the intimin-expressed vaccine ceased shedding S. Dublin from day 28 to day 63. All calves were challenged with E. coli O157:H7 on day 98 to determine the effect on fecal shedding of E. coli O157:H7. The amount of E. coli O157:H7 in feces was measured for 30 days post-challenge. We observed a transient clearance of E. coli O157:H7 from the feces in the vaccinated calves. The magnitude of fecal E. coli O157:H7 shedding did not

  5. Spread and change in stress resistance of Shiga toxin-producing Escherichia coli O157 on fungal colonies.

    Science.gov (United States)

    Lee, Ken-Ichi; Kobayashi, Naoki; Watanabe, Maiko; Sugita-Konishi, Yoshiko; Tsubone, Hirokazu; Kumagai, Susumu; Hara-Kudo, Yukiko

    2014-11-01

    To elucidate the effect of fungal hyphae on the behaviour of Shiga toxin-producing Escherichia coli (STEC) O157, the spread and change in stress resistance of the bacterium were evaluated after coculture with 11 species of food-related fungi including fermentation starters. Spread distances of STEC O157 varied depending on the co-cultured fungal species, and the motile bacterial strain spread for longer distances than the non-motile strain. The population of STEC O157 increased when co-cultured on colonies of nine fungal species but decreased on colonies of Emericella nidulans and Aspergillus ochraceus. Confocal scanning microscopy visualization of green fluorescent protein-tagged STEC O157 on fungal hyphae revealed that the bacterium colonized in the water film that existed on and between hyphae. To investigate the physiological changes in STEC O157 caused by co-culturing with fungi, the bacterium was harvested after 7 days of co-culturing and tested for acid resistance. After co-culture with eight fungal species, STEC O157 showed greater acid resistance compared to those cultured without fungi. Our results indicate that fungal hyphae can spread the contamination of STEC O157 and can also enhance the stress resistance of the bacteria. © 2013 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  6. Effect of Neem (Azadirachta indica on the Survival of Escherichia coli O157:H7 in Dairy Manure

    Directory of Open Access Journals (Sweden)

    Subbarao V. Ravva

    2015-07-01

    Full Text Available Escherichia coli O157:H7 (EcO157 shed in cattle manure can survive for extended periods of time and intervention strategies to control this pathogen at the source are critical as produce crops are often grown in proximity to animal raising operations. This study evaluated whether neem (Azadirachta indica, known for its antimicrobial and insecticidal properties, can be used to amend manure to control EcO157. The influence of neem materials (leaf, bark, and oil on the survival of an apple juice outbreak strain of EcO157 in dairy manure was monitored. Neem leaf and bark supplements eliminated the pathogen in less than 10 d with a D-value (days for 90% elimination of 1.3 d. In contrast, nearly 4 log CFU EcO157/g remained after 10 d in neem-free manure control. The ethyl acetate extractable fraction of neem leaves was inhibitory to the growth of EcO157 in LB broth. Azadirachtin, a neem product with insect antifeedant properties, failed to inhibit EcO157. Application of inexpensive neem supplements to control pathogens in manure and possibly in produce fields may be an option for controlling the transfer of foodborne pathogens from farm to fork.

  7. Effect of Neem (Azadirachta indica) on the Survival of Escherichia coli O157:H7 in Dairy Manure.

    Science.gov (United States)

    Ravva, Subbarao V; Korn, Anna

    2015-07-10

    Escherichia coli O157:H7 (EcO157) shed in cattle manure can survive for extended periods of time and intervention strategies to control this pathogen at the source are critical as produce crops are often grown in proximity to animal raising operations. This study evaluated whether neem (Azadirachta indica), known for its antimicrobial and insecticidal properties, can be used to amend manure to control EcO157. The influence of neem materials (leaf, bark, and oil) on the survival of an apple juice outbreak strain of EcO157 in dairy manure was monitored. Neem leaf and bark supplements eliminated the pathogen in less than 10 d with a D-value (days for 90% elimination) of 1.3 d. In contrast, nearly 4 log CFU EcO157/g remained after 10 d in neem-free manure control. The ethyl acetate extractable fraction of neem leaves was inhibitory to the growth of EcO157 in LB broth. Azadirachtin, a neem product with insect antifeedant properties, failed to inhibit EcO157. Application of inexpensive neem supplements to control pathogens in manure and possibly in produce fields may be an option for controlling the transfer of foodborne pathogens from farm to fork.

  8. Subtractive Inhibition Assay for the Detection of E. coli O157:H7 Using Surface Plasmon Resonance

    Directory of Open Access Journals (Sweden)

    Chengyan Si

    2011-03-01

    Full Text Available A surface plasmon resonance (SPR immunosensor was developed for the detection of E. coli O157:H7 by means of a new subtractive inhibition assay. In the subtractive inhibition assay, E. coli O157:H7 cells and goat polyclonal antibodies for E. coli O157:H7 were incubated for a short of time, and then the E. coli O157:H7 cells which bound antibodies were removed by a stepwise centrifugation process. The remaining free unbound antibodies were detected through interaction with rabbit anti-goat IgG polyclonal antibodies immobilized on the sensor chip using a BIAcore 3000 biosensor. The results showed that the signal was inversely correlated with the concentration of E. coli O157:H7 cells in a range from 3.0 × 104 to 3.0 × 108 cfu/mL with a detection limit of 3.0 × 104 cfu/mL. Compared with direct SPR by immobilizing antibodies on the chip surface to capture the bacterial cells and ELISA for E. coli O157:H7 (detection limit: both 3.0 × 105 cfu/mL in this paper, the detection limit of subtractive inhibition assay method was reduced by one order of magnitude. The method simplifies bacterial cell detection to protein-protein interaction, which has the potential for providing a practical alternative for the monitoring of E. coli O157:H7 and other pathogens.

  9. Electrochemiluminescence Detection of Escherichia coli O157:H7 Based on a Novel Polydopamine Surface Imprinted Polymer Biosensor.

    Science.gov (United States)

    Chen, Shufan; Chen, Xueqian; Zhang, Lijuan; Gao, Juanjuan; Ma, Qiang

    2017-02-15

    In this paper, a facilely prepared electrochemiluminescence (ECL) biosensor was developed for Escherichia coli O157:H7 quantitative detection based on a polydopamine (PDA) surface imprinted polymer (SIP) and nitrogen-doped graphene quantum dots (N-GQDs). N-GQDs with a high quantum yield of 43.2% were synthesized. The uniform PDA SIP film for E. coli O157:H7 was established successfully with a facile route. The dopamine and target bacteria were electropolymerized directly on the electrode. After removal of the E. coli O157:H7 template, the established PDA SIP can selectively recognize E. coli O157:H7. Accordingly, E. coli O157:H7 polyclonal antibody (pAb) was labeled with N-GQDs. The bioconjugation of SIP-E. coli O157:H7/pAb-N-GQDs can generate intensive ECL irradiation with K2S2O8. As a result, E. coli O157:H7 was detected with the ECL sensing system. Under optimal conditions, the linear relationships between the ECL intensity and E. coli O157:H7 concentration were obtained from 10(1) colony-forming units (CFU) mL(-1) to 10(7) CFU mL(-1) with a limit of detection of 8 CFU mL(-1). The biosensor based on this SIP film was applied in water sample detection successfully. The N-GQD-based ECL analytical method for E. coli O157:H7 was reported for the first time. The sensing system had high selectivity to the target analyte, provided new opportunities for use, and increased the rate of disease diagnosis and treatment and the prevention of pathogens.

  10. Communication Impairment in Ultrasonic Vocal Repertoire during the Suckling Period of Cd157 Knockout Mice: Transient Improvement by Oxytocin.

    Science.gov (United States)

    Lopatina, Olga L; Furuhara, Kazumi; Ishihara, Katsuhiko; Salmina, Alla B; Higashida, Haruhiro

    2017-01-01

    Communication consists of social interaction, recognition, and information transmission. Communication ability is the most affected component in children with autism spectrum disorder (ASD). Recently, we reported that the CD157/BST1 gene is associated with ASD, and that CD157 knockout (Cd157(-/-)) mice display severe impairments in social behavior that are improved by oxytocin (OXT) treatment. Here, we sought to determine whether Cd157(-/-) mice can be used as a suitable model for communication deficits by measuring ultrasonic vocalizations (USVs), especially in the early developmental stage. Call number produced in pups due to isolation from dams was higher at postnatal day (PND) 3 in knockout pups than wild-type mice, but was lower at PNDs 7 and 10. Pups of both genotypes had similarly limited voice repertoires at PND 3. Later on, at PNDs 7 and 10, while wild-type pups emitted USVs consisting of six different syllable types, knockout pups vocalized with only two types. This developmental impairment in USV emission was rescued within 30 min by intraperitoneal OXT treatment, but quickly returned to control levels after 120 min, showing a transient effect of OXT. USV impairment was partially observed in Cd157(+/-) heterozygous mice, but not in Cd157(-/-) adult male mice examined while under courtship. These results demonstrate that CD157 gene deletion results in social communication insufficiencies, and suggests that CD157 is likely involved in acoustic communication. This unique OXT-sensitive developmental delay in Cd157(-/-) pups may be a useful model of communicative interaction impairment in ASD.

  11. Communication Impairment in Ultrasonic Vocal Repertoire during the Suckling Period of Cd157 Knockout Mice: Transient Improvement by Oxytocin

    Directory of Open Access Journals (Sweden)

    Olga L. Lopatina

    2017-05-01

    Full Text Available Communication consists of social interaction, recognition, and information transmission. Communication ability is the most affected component in children with autism spectrum disorder (ASD. Recently, we reported that the CD157/BST1 gene is associated with ASD, and that CD157 knockout (Cd157−/− mice display severe impairments in social behavior that are improved by oxytocin (OXT treatment. Here, we sought to determine whether Cd157−/− mice can be used as a suitable model for communication deficits by measuring ultrasonic vocalizations (USVs, especially in the early developmental stage. Call number produced in pups due to isolation from dams was higher at postnatal day (PND 3 in knockout pups than wild-type mice, but was lower at PNDs 7 and 10. Pups of both genotypes had similarly limited voice repertoires at PND 3. Later on, at PNDs 7 and 10, while wild-type pups emitted USVs consisting of six different syllable types, knockout pups vocalized with only two types. This developmental impairment in USV emission was rescued within 30 min by intraperitoneal OXT treatment, but quickly returned to control levels after 120 min, showing a transient effect of OXT. USV impairment was partially observed in Cd157+/− heterozygous mice, but not in Cd157−/− adult male mice examined while under courtship. These results demonstrate that CD157 gene deletion results in social communication insufficiencies, and suggests that CD157 is likely involved in acoustic communication. This unique OXT-sensitive developmental delay in Cd157−/− pups may be a useful model of communicative interaction impairment in ASD.

  12. Incidence and Tracking of Escherichia coli O157:H7 in a Major Produce Production Region in California

    OpenAIRE

    Michael Cooley; Diana Carychao; Leta Crawford-Miksza; Jay, Michele T.; Carol Myers; Christopher Rose; Christine Keys; Jeff Farrar; Mandrell, Robert E.

    2007-01-01

    Fresh vegetables have become associated with outbreaks caused by Escherichia coli O157:H7 (EcO157). Between 1995-2006, 22 produce outbreaks were documented in the United States, with nearly half traced to lettuce or spinach grown in California. Outbreaks between 2002 and 2006 induced investigations of possible sources of pre-harvest contamination on implicated farms in the Salinas and San Juan valleys of California, and a survey of the Salinas watershed. EcO157 was isolated at least once from...

  13. Absence of internalization of Escherichia coli O157:H7 into germinating tissue of field-grown leafy greens.

    Science.gov (United States)

    Erickson, Marilyn C; Webb, Cathy C; Díaz-Pérez, Juan Carlos; Davey, Lindsey E; Payton, Alison S; Flitcroft, Ian D; Phatak, Sharad C; Doyle, Michael P

    2014-02-01

    Both growth chamber and field studies were conducted to investigate the potential for Escherichia coli O157:H7 to be internalized into leafy green tissue when seeds were germinated in contaminated soil. Internalized E. coli O157:H7 was detected by enrichment in both spinach (Spinacia oleracea L.) and lettuce (Lactuca sativa L.) seedlings when seeds were germinated within the growth chamber in autoclaved and nonautoclaved soil, respectively, contaminated with E. coli O157:H7 at 2.0 and 3.8 log CFU/g, respectively. Internalized E. coli O157:H7 populations could be detected by enumeration within leafy green tissues either by increasing the pathogen levels in the soil or by autoclaving the soil. Attempts to maximize the exposure of seed to E. coli O157:H7 by increasing the mobility of the microbe either through soil with a higher moisture content or through directly soaking the seeds in an E. coli O157:H7 inoculum did not increase the degree of internalization. Based on responses obtained in growth chamber studies, internalization of E. coli O157:H7 surrogates (natural isolates of Shiga toxin-negative E. coli O157:H7 or recombinant [stx- and eae-negative] outbreak strains of E. coli O157:H7) occurred to a slightly lesser degree than did internalization of the virulent outbreak strains of E. coli O157:H7. The apparent lack of internalized E. coli O157:H7 when spinach and lettuce were germinated from seed in contaminated soil (ca. 3 to 5 log CFU/g) in the field and the limited occurrence of surface contamination on the seedlings suggest that competition from indigenous soil bacteria and environmental stresses were greater in the field than in the growth chamber. On the rare occasion that soil contamination with E. coli O157:H7 exceeded 5 log CFU/g in a commercial field, this pathogen probably would not be internalized into germinating leafy greens and/or would not still be present at the time of harvest.

  14. Functional metagenomics of Escherichia coli O157:H7 interactions with spinach indigenous microorganisms during biofilm formation.

    Directory of Open Access Journals (Sweden)

    Michelle Q Carter

    Full Text Available The increase in foodborne outbreaks worldwide attributed to fresh fruit and vegetables suggests that produce may serve as an ecological niche for enteric pathogens. Here we examined the interaction of E. coli O157:H7 (EcO157 with spinach leaf indigenous microorganisms during co-colonization and establishment of a mixed biofilm on a stainless steel surface. Stainless steel surface was selected to mimic the surface of produce-processing equipment, where retention of foodborne pathogens such as EcO157 could serve as a potential source for transmission. We observed a positive effect of spinach-associated microbes on the initial attachment of EcO157, but an antagonistic effect on the EcO157 population at the later stage of biofilm formation. Metagenomic analyses of the biofilm community with the GeoChip revealed an extremely diverse community (gene richness, 23409; Shannon-Weiner index H, 9.55. Presence of EcO157 in the mixed biofilm resulted in a significant decrease in the community α-diversity (t test, P<0.05, indicating a putative competition between the pathogen and indigenous spinach microbes. The decrease in the β-diversity of the EcO157-inoculated biofilm at 48 h (ANOVA, P<0.05 suggested a convergent shift in functional composition in response to EcO157 invasion. The success of EcO157 in the mixed biofilm is likely associated with its metabolic potential in utilizing spinach nutrients: the generation time of EcO157 in spinach lysates at 28°C is ~ 38 min, which is comparable to that in rich broth. The significant decrease in the abundance of many genes involved in carbon, nitrogen, and phosphorus cycling in the EcO157-inoculated biofilms (t test, P<0.05 further support our conclusion that competition for essential macronutrients is likely the primary interaction between the EcO157 and indigenous spinach-biofilm species.

  15. Screening Procedure From Cattle Feces and the Prevalence of Escherichia coli O157 in Taiwan‘s Dairy Cattle

    Institute of Scientific and Technical Information of China (English)

    Chin-ChengChou; Tzu-MingPan; 等

    2001-01-01

    Objective:The aims of this study were to establish a screening procedure for the identification of Escherichia coliO157(E.coli O157) from bovine feces and to apply the procedure to the detection of bacteria in dairy herds in taiwan to locate the contaminated fieled.Methods:The Estabilished procedure for screeing E.coil O157 from bovine fecs in compsed of four steps:enrichment,selective culturing,phenotyping and gentyping.Modified trypticase soy broth (mTSB) containing 20 mg/L of novobioicin was used for the enrichment step.Using sorbitol MacConkey agar containing 0.05mg/L of cefixime and 2.5mg/L of potassium tellurite did the selective culturing step.The phenotyping step included the species confirmation of E.coli,the serotyping of O157 and H7 and the ability of verocytotoxin production that were tested by different commercial kits.The genotyping step for the confirmatioon of O157 antigen and verocytotoxin producing ability were performed by polymerase chain reaction.Results:mTSB had a better enrichment effect for E.Coli O157 than gram-negative broth had in the procedure,with mTSB medium,the effect was about 100-fold for selection.The detection limit of the screening procedure was 0.56±0.13CFU/g,Using the screening procedure described above,E.coli O157 was found in 3 of 1223(0.25%) fresh bovine fecal specimens,and 2 of 21(9.52%)dariy herds in Tainwan.Two of the current three screened strains were verocytotoxin II producting E.coli O157:H7 with the titer of 1:32;the other one was E.Coli O157:NM without verocytotoxin-producing ability.Conclusion:A procedure for the screening of E.coli O157 from bovine feces had been established successfully,Fiedl sampling results showed that dairy herds in Taiwan had the potertial risk of spreading E.coli O157.Bacterial Isolation of toxin-producing strains of E.Coli O157 indicated that public health concerns are necrssary.\\

  16. 肠出血性大肠埃希菌O157:H7及其质粒O157的研究进展

    Institute of Scientific and Technical Information of China (English)

    沈定树

    2011-01-01

    @@ 致病性大肠埃希菌根据毒力性质、病理机制、临床综合征及不同的血清分型被分成肠毒性大肠埃希菌(ETEC)、肠致病性大肠埃希菌(EPEC)、肠出血性大肠埃希菌(EHEC)、肠聚集性大肠埃希菌(EAEC)、肠侵袭性大肠埃希菌(EIEC)和扩散粘附性大肠埃希菌(DAEC)6种.肠出血性大肠埃希菌(entero-hemorrhaagic Escherichia coli, EHEC)感染性腹泻是迄今世界范围内的公共卫生问题之一,其主要血清型O157:H7(以下简称E.coli O157: H7)是产志贺氏毒素大肠埃希菌(STEC)的一种亚型,产生一种或多种志贺氏毒素,诱导A/E损害.

  17. Electrochemical biosensors for rapid detection of Escherichia coli O157:H7.

    Science.gov (United States)

    Xu, Meng; Wang, Ronghui; Li, Yanbin

    2017-01-01

    Electrochemical biosensors have shown great promise in the development of rapid methods for the detection of foodborne pathogens and have been intensively studied over the past two decades. The scope of this review is to summarize the advancements made in the development of electrochemical biosensors for the rapid detection of one of the most common foodborne pathogens, Escherichia coli O157:H7. The article is intended to include different configurations of electrochemical biosensors based on the sensing principles and measured electrical parameters, as well as the latest improvements of technology in the progress of electrochemical biosensor development to detect E. coli O157:H7. By discussing the current and future trend based on some of excellent published literatures and reviews, this survey is hoped to illustrate a broad and comprehensive understanding of electrochemical biosensors for the detection of foodborne pathogens.

  18. Shiga Toxin-Producing Escherichia coli O157, England and Wales, 1983-2012.

    Science.gov (United States)

    Adams, Natalie L; Byrne, Lisa; Smith, Geraldine A; Elson, Richard; Harris, John P; Salmon, Roland; Smith, Robert; O'Brien, Sarah J; Adak, Goutam K; Jenkins, Claire

    2016-04-01

    We evaluated clinical Shiga toxin-producing Escherichia coli O157 infections in England and Wales during 1983-2012 to describe changes in microbiological and surveillance methods. A strain replacement event was captured; phage type (PT) 2 decreased to account for just 3% of cases by 2012, whereas PT8 and PT21/28 strains concurrently emerged, constituting almost two thirds of cases by 2012. Despite interventions to control and reduce transmission, incidence remained constant. However, sources of infection changed over time; outbreaks caused by contaminated meat and milk declined, suggesting that interventions aimed at reducing meat cross-contamination were effective. Petting farm and school and nursery outbreaks increased, suggesting the emergence of other modes of transmission and potentially contributing to the sustained incidence over time. Studies assessing interventions and consideration of policies and guidance should be undertaken to reduce Shiga toxin-producing E. coli O157 infections in England and Wales in line with the latest epidemiologic findings.

  19. The faint source population at 15.7 GHz - I. The radio properties

    NARCIS (Netherlands)

    Whittam, I. H.; Riley, J. M.; Green, D. A.; Jarvis, M. J.; Prandoni, I.; Guglielmino, G.; Morganti, R.; Röttgering, H. J. A.; Garrett, M. A.

    2013-01-01

    We have studied a sample of 296 faint (>0.5 mJy) radio sources selected from an area of the Tenth Cambridge (10C) survey at 15.7 GHz in the Lockman Hole. By matching this catalogue to several lower frequency surveys (e.g. including a deep GMRT survey at 610 MHz, a WSRT survey at 1.4 GHz, NVSS, FIRST

  20. 33 CFR 157.10d - Double hulls on tank vessels.

    Science.gov (United States)

    2010-07-01

    ... containing oil to the side shell plating, must not be less than the distance w as shown in Figure 157.10d(c) and specified as follows: (i) For a vessel of 5,000 DWT and above: w= meters; or, w=2.0 meters (79 in.), whichever is less, but in no case less than 1.0 meter (39 in.). (ii) For a vessel of less than 5,000 DWT:...

  1. Transcriptomic Response of Escherichia coli O157:H7 to Oxidative Stress▿ †

    OpenAIRE

    Wang, Siyun; Deng, Kaiping; Zaremba, Sam; Deng, Xiangyu; Lin, Chiahui; Wang, Qian; Tortorello, Mary Lou; Zhang, Wei

    2009-01-01

    Chlorinated water is commonly used in industrial operations to wash and sanitize fresh-cut, minimally processed produce. Here we compared 42 human outbreak strains that represented nine distinct Escherichia coli O157:H7 genetic lineages (or clades) for their relative resistance to chlorine treatment. A quantitative measurement of resistance was made by comparing the extension of the lag phase during growth of each strain under exposure to sublethal concentrations of sodium hypochlorite in Lur...

  2. Dynamic of Mutational Events in Variable Number Tandem Repeats of Escherichia coli O157:H7

    Directory of Open Access Journals (Sweden)

    A. V. Bustamante

    2013-01-01

    Full Text Available VNTRs regions have been successfully used for bacterial subtyping; however, the hypervariability in VNTR loci is problematic when trying to predict the relationships among isolates. Since few studies have examined the mutation rate of these markers, our aim was to estimate mutation rates of VNTRs specific for verotoxigenic E. coli O157:H7. The knowledge of VNTR mutational rates and the factors affecting them would make MLVA more effective for epidemiological or microbial forensic investigations. For this purpose, we analyzed nine loci performing parallel, serial passage experiments (PSPEs on 9 O157:H7 strains. The combined 9 PSPE population rates for the 8 mutating loci ranged from 4.4 × 10−05 to 1.8 × 10−03 mutations/generation, and the combined 8-loci mutation rate was of 2.5 × 10−03 mutations/generation. Mutations involved complete repeat units, with only one point mutation detected. A similar proportion between single and multiple repeat changes was detected. Of the 56 repeat mutations, 59% were insertions and 41% were deletions, and 72% of the mutation events corresponded to O157-10 locus. For alleles with up to 13 UR, a constant and low mutation rate was observed; meanwhile longer alleles were associated with higher and variable mutation rates. Our results are useful to interpret data from microevolution and population epidemiology studies and particularly point out that the inclusion or not of O157-10 locus or, alternatively, a differential weighting data according to the mutation rates of loci must be evaluated in relation with the objectives of the proposed study.

  3. Primary and secondary cases in Escherichia coli O157 outbreaks: a statistical analysis

    Directory of Open Access Journals (Sweden)

    Shaw Darren J

    2009-08-01

    Full Text Available Abstract Background Within outbreaks of Escherichia coli O157 (E. coli O157, at least 10–15% of cases are thought to have been acquired by secondary transmission. However, there has been little systematic quantification or characterisation of secondary outbreak cases worldwide. The aim of this study was to characterise secondary outbreak cases, estimate the overall proportion of outbreak cases that were the result of secondary transmission and to analyse the relationships between primary and secondary outbreak cases by mode of transmission, country and median age. Methods Published data was obtained from 90 confirmed Escherichia coli O157 outbreaks in Great Britain, Ireland, Scandinavia, Canada, the United States and Japan, and the outbreaks were described in terms of modes of primary and secondary transmission, country, case numbers and median case age. Outbreaks were tested for statistically significant differences in the number of ill, confirmed, primary and secondary cases (analysis of variance and Kruskal-Wallis and in the rate of secondary cases between these variables (Generalised Linear Models. Results The outbreaks had a median of 13.5 confirmed cases, and mean proportion of 0.195 secondary cases. There were statistically significant differences in the numbers of ill, confirmed, primary and secondary cases between modes of primary transmission (p Secondary case rates differed statistically significantly between modes of secondary and primary transmission and median age categories (all p Conclusion Our analyses indicated that ~20% of E. coli O157 outbreak cases were the result of secondary spread, and that this spread is significantly influenced by age and modes of primary and secondary transmission, but not country. In particular, the results provide further data emphasising the importance of simple but effective preventive strategies, such as handwashing, that can reduce the risk of secondary spread, particularly amongst young

  4. An outbreak of Vero cytotoxin producing Escherichia coli O157 infection associated with takeaway sandwiches.

    LENUS (Irish Health Repository)

    McDonnell, R J

    1997-12-12

    An outbreak of food poisoning due to Escherichia coli O157 phage type 2 Vero cytotoxin 2 affected 26 people in southern counties of England in May and June 1995. The organism was isolated from faecal specimens from 23 patients, 16 of whom lived in Dorset and seven in Hampshire. Isolates were indistinguishable by phage typing, Vero cytotoxin gene typing, restriction fragment length polymorphism, and pulsed field gel electrophoresis. Three associated cases, linked epidemiologically to the outbreak, were confirmed serologically by detection of antibodies to E. coli O157 lipopolysaccharide. Twenty-two of the 26 patients were adults: four were admitted to hospital with haemorrhagic colitis. Four cases were children: two were admitted to hospital with haemolytic uraemic syndrome (HUS). There were no deaths. Although E. coli O157 was not isolated from any food samples, illness was associated with having eaten cold meats in sandwiches bought from two sandwich producers, in Weymouth and in Portsmouth. Both shops were supplied by the same wholesaler, who kept no records and obtained cooked meats from several sources in packs that did not carry adequate identification marks. It was, therefore, impossible to trace back to the original producer or to investigate further to determine the origin of contamination with E. coli O157. To protect the public health it is essential that all wholesale packs of ready-to-eat food carry date codes and the producer\\'s identification mark. Detailed record keeping should be part of hazard analysis critical control point (HACCP) systems and should be maintained throughout the chain of distribution from the producer to retail outlets.

  5. Competition of Escherichia coli O157 with a drinking water bacterial community at low nutrient concentrations.

    Science.gov (United States)

    Vital, Marius; Hammes, Frederik; Egli, Thomas

    2012-12-01

    In contrast to studies on (long-term) survival of enteric pathogens in the environment, investigations on the principles of their growth and competition with autochthonous aquatic bacteria are rare and unexplored. Hence, improved basic knowledge is crucial for an adequate risk assessment and for understanding (and avoiding) the spreading of waterborne diseases. Therefore, the pathogen Escherichia coli O157 was grown in competition with a drinking water bacterial community on natural assimilable organic carbon (AOC) originating from diluted wastewater, in both batch and continuous culture. Growth was monitored by flow cytometry enabling enumeration of total cell concentration as well as specific E. coli O157 detection using fluorescently-labelled antibodies. An enhanced competitive fitness of E. coli O157 with higher AOC concentrations, higher temperatures and increased dilution rates (continuous culture) was observed. A classical "opportunist" versus "gleaner" relationship, where E. coli O157 is the "opportunist", specialised for growth at high nutrient concentrations (μ(max): 0.87 h(-1) and K(s): 489 μg consumed DOC L(-1)), and the bacterial community is the "gleaner" adapted to nutrient-poor environments (μ(max): 0.33 h(-1) and K(s): 7.4 μg consumed DOC L(-1)) was found. The obtained competition results can be explained by the growth properties of the two competitors determined in pure cultures and it was possible to model many of the observed dynamics based on Monod kinetics. The study provides new insights into the principles governing competition of an enteric pathogen with autochthonous aquatic bacteria.

  6. SAS molecular tests Escherichia coli O157 detection kit. Performance tested method 031203.

    Science.gov (United States)

    Bapanpally, Chandra; Montier, Laura; Khan, Shah; Kasra, Akif; Brunelle, Sharon L

    2014-01-01

    The SAS Molecular tests Escherichia coli O157 Detection method, a loop-mediated isothermal amplification method, performed as well as or better than the U.S. Department of Agriculture, Food Safety Inspection Service Microbiology Laboratory Guidebook and the U.S. Food and Drug Administration Bacteriological Analytical Manual reference methods for ground beef, beef trim, bagged mixed lettuce, and fresh spinach. Ground beef (30% fat, 25 g test portion) was validated for 7-8 h enrichment, leafy greens were validated in a 6-7 h enrichment, and ground beef (30% fat, 375 g composite test portion) and beef trim (375 g composite test portion) were validated in a 16-20 h enrichment. The method performance for meat and leafy green matrixes was also shown to be acceptable under conditions of co-enrichment with Salmonella. Thus, after a short co-enrichment step, ground beef, beef trim, lettuce, and spinach can be tested for both Salmonella and E. coli O157. The SAS Molecular tests Salmonella Detection Kit was validated using the same test portions as for the SAS Molecular tests E. coli O157 Detection Kit and those results are presented in a separate report. Inclusivity and exclusivity testing revealed no false negatives and no false positives among the 50 E. coli 0157 strains, including H7 and non-motile strains, and 30 non-E. coli O157 strains examined. Finally, the method was shown to be robust when variations to DNA extract hold time and DNA volume were varied. The method comparison and robustness data suggest a full 7 h enrichment time should be used for 25 g ground beef test portions.

  7. 层次分析法在比较大肠埃希菌O157:H7快速检测方法中的应用%Application of analytic hierachy process on comparison of Escherichia coil O157 : H7 rapid detection method

    Institute of Scientific and Technical Information of China (English)

    唐静; 金燕; 袁涛; 贾俊涛; 马维兴; 李正义; 谭乐义

    2009-01-01

    目的:比较目前日常检测中常用的大肠埃希菌O157:H7快速检测系统的优劣.方法:选用VIDAS ECO、Reveal O157、VIP O157、DuPont O157和GeneQuence O157分别对120个人工污染样品进行检测,引用层次分析法对影响使用的因素(检测时间、成本等)进行综合比较.结果:将总权重设为1,其中VIDAS ECO的权重为0.1703,Reveal O157的权重为0.2234,GeneQuence O157的权重为0.1779,DuPont O157的权重为0.2282,VIP O157的权重为0.2001.结论:备选方法的优先顺序由高到低依次为:DuPont O157、Reveal O157、VIP O157、GeneQuence O157、VIDAS ECO.

  8. Surveillance on Escherichia coli O157:H7 in Shanghai Pudong New Area%上海市浦东新区肠出血性大肠埃希菌O157:H7的监测研究

    Institute of Scientific and Technical Information of China (English)

    沈小明; 赵冰; 胡培玉; 张继伦; 章红红; 邬永明

    2008-01-01

    目的 了解上海浦东新区腹泻病人、宿主动物肠出血性大肠埃希杆菌(E. coli )O157:H7携带情况以及市售食品的污染状况,为疾病防治工作提供决策依据. 方法 于2003~2006年的5~10月,在设置的监测点与超市采集家禽和腹泻病人粪便及禽畜肉制品;应用免疫磁珠富集,山梨醇麦康凯平板和Chromager O157显色平板分离培养E. coli O157:H7,生化和血清学反应进行鉴定. 结果 E. coli O157:H7阳性率分别为:腹泻病人粪便0.24%,鸡粪2.95%,鸭粪3.83%,家畜肉15.05%,家禽肉2.25%.检出的67株E. coli O157:H7中,仅1株来自腹泻病人的E. coli O157:H7具有毒力基因. 结论 浦东新区腹泻病人、宿主动物及其肉类食品中存在E. coli O157:H7感染或污染,存在E. coli O157:H7感染流行的潜在危险.

  9. 表面修饰对镝铁氧体纳米磁粒子的合成及其磁性能的影响%Effect of Surface Modification on Formation and Magnetic Property of Dysprosium Ferrite Nanomagnetic Particles

    Institute of Scientific and Technical Information of China (English)

    陈静; 张茂润; 邓真娟

    2011-01-01

    利用湿化学法制备镝铁氧体纳米磁粒子时,用适量的阴离子表面活性剂进行表面修饰,能够有效地控制磁粒子的粒径,同时避免干燥时产生硬团聚.文章介绍了用月桂酸、月桂酸钠、正十二烷基硫酸钠对磁粒子进行表面修饰的研究结果,探讨了三者及其用量对磁粒子的形成及磁性能的影响.借助X射线衍射仪(XRD)、透射电镜(TEM)、振动样品磁强计(VSM)、红外光谱仪(IR)对产物的性能进行了表征.结果表明,用月桂酸修饰后的产物具有Fe3O4磁粒子的晶型结构且结晶度高、磁性能优异、平均粒径约16nm;用月桂酸钠、正十二烷基硫酸钠修饰后的产物不具有Fe3O4磁粒子的晶型结构,结晶度低且磁性能差.%When wet chemical method are use to prepare dysprosium-doped ferrite magnetic nanoparticles, right a-mount of anionic surfactant were doped as surface modification, which can effectively control the size of magnetic particles, and avoid producing hard reunion when dry out. This paper introduces the research results of magnetic particle surface modification by using lauric acid, laurel acid sodium and lauryl sodium sulfate, discusses the effect of lauric acid, laurel acid sodium and lauryl sodium sulfate and their dosages on the formation of magnetic and its magnetic property. The properties of the product can be characterized by X-ray diffraction (XRD) and transmission electron microscopy (TEM), vibrating sample magnetometer (VSM), infrared spectrometer (IR). The results showed that the product modified with lauric acid have a crystalline structure of Fe3O4 magnetic particles and high crystallin-ity, excellent magnetic properties. The average particle size is about 16 nm; the product modified with laurel acid sodium and lauryl sodium sulfate does not have the crystalline structure of Fe3O4 magnetic particles, with low crystal-linity and low magnetic property.

  10. Tylosin and chlorotetracycline decrease the duration of fecal shedding of E. coli O157:H7 by swine.

    Science.gov (United States)

    Cornick, Nancy A

    2010-07-14

    Previously we have shown that experimentally infected swine, fed an antibiotic-free diet, can become colonized and shed Escherichia coli O157:H7 for at least 2 months. However, in epidemiological studies this organism is only rarely recovered from domestic swine and the basis for this discrepancy is not clear. In this report we demonstrate that significantly fewer pigs fed diets containing subtherapeutic levels of either tylosin or chlorotetracycline shed E. coli O157:H7 for longer than 2 weeks compared to those fed an antibiotic-free diet. In contrast to tylosin and chlorotetracycline, the addition of bacitracin methylene disalicylate to the diet did not influence the recovery of E. coli O157:H7. These results suggest that some antibiotics may alter the gastrointestinal tract flora in ways that create a less favorable environment for E. coli O157:H7 in swine. (c) 2009 Elsevier B.V. All rights reserved.

  11. 33 CFR 157.24a - Submission of calculations, plans, and specifications for existing vessels installing segregated...

    Science.gov (United States)

    2010-07-01

    ... modification will be made or to the appropriate Coast Guard technical office listed in 157.100(b): (1) A drawing or diagram of the pumping and piping system for the segregated ballast tanks. (2) A drawing of...

  12. Prevalence of E. coli O157:H7 in water sources: an overview on associated diseases, outbreaks and detection methods.

    Science.gov (United States)

    Saxena, Tanushree; Kaushik, Pallavi; Krishna Mohan, Medicherla

    2015-07-01

    Escherichia coli O157:H7 is a zoonotic pathogen with its ability to cause human illness ranging from diarrheal disease to fatal hemolytic uremic syndrome. E. coli O157:H7 had been associated with waterborne outbreaks resulting in high morbidity and mortality worldwide. Therefore, it is important to investigate the prevalence of E. coli O157:H7 in water sources especially used for drinking and to develop the diagnostic methods for its early detection. The review describes traditional cultural methods, immunological techniques, and polymerase chain reaction (PCR)-based methods for detection of this bacterium in water sources. The current PCR-based techniques such as real-time PCR are more specific and sensitive and require less detection time (sources to prevent waterborne diseases due to E. coli O157:H7.

  13. Inactivation of E-coli O157 : H7 in apple cider by ozone at various temperatures and concentrations

    DEFF Research Database (Denmark)

    Steenstrup, Lotte Dock

    2004-01-01

    The effect of temperature (5-20C) at 860 ppm (v/v) ozone and different gaseous ozone concentrations above 1,000 ppm on inactivation of E. coli O157:H7 in apple cider was studied. Lag times ranged from 3.5 min at 20C to 6.7 min at 10C before the on-set of E. coli O157:H7 inactivation. D...... of dissolved ozone of about 5-6 mg/L at 20C, before the on-set of E. coli O157:H7 inactivation in the cider. Total processing times, based on lag time plus 5D, ranged from about 4 to 14 min depending on temperature and ozone concentration. Overall, inactivation of E. coli O157:H7by ozone was fast enough...

  14. Curli Temper Adherence of Escherichia coli O157:H7 to Squamous Epithelial Cells from the Bovine Recto-Anal Junction in a Strain-Dependent Manner.

    Science.gov (United States)

    Kudva, Indira T; Carter, Michelle Q; Sharma, Vijay K; Stasko, Judith A; Giron, Jorge A

    2017-01-01

    Our recent studies have shown that intimin and the locus of enterocyte effacement-encoded proteins do not play a role in Escherichia coli O157:H7 (O157) adherence to the bovine recto-anal junction squamous epithelial (RSE) cells. To define factors that play a contributory role, we investigated the role of curli, fimbrial adhesins commonly implicated in adherence to various fomites and plant and human epithelial cells, in O157 adherence to RSE cells. Specifically, we examined (i) wild-type strains of O157; (ii) curli variants of O157 strains; (iii) isogenic curli deletion mutants of O157; and (iv) adherence inhibition of O157 using anti-curlin sera. Results of these experiments conducted under stringent conditions suggest that curli do not solely contribute to O157 adherence to RSE cells and in fact demonstrate a modulating effect on O157 adherence to RSE cells in contrast to HEp-2 cells (human epidermoid carcinoma of the larynx cells with HeLa contamination). The absence of curli and presence of blocking anti-curli antibodies enhanced O157-RSE cell interactions among some strains, thus alluding to a spatial, tempering effect of curli on O157 adherence to RSE cells when present. At the same time, the presence or absence of curli did not alter RSE cell adherence patterns of another O157 strain. These observations are at variance with the reported role of curli in O157 adherence to human cell lines such as HEp-2 and need to be factored in when developing anti-adherence modalities for preharvest control of O157 in cattle.

  15. Physical Covering to control Escherichia coli O157:H7 and Salmonella in Static and Windrow Composting Process

    Science.gov (United States)

    This study investigated the effect of 30-cm covering of finished compost on survival of E. coli O157:H7 and Salmonella in active static and windrow composting systems. Feedstock inoculated with E. coli O157:H7 (7.41 log CFU/g) and Salmonella (6.46 log CFU/g) were placed in biosentry tubes (7.5 cm di...

  16. The biogenic amine tyramine modulates the adherence of Escherichia coli O157:H7 to intestinal mucosa.

    Science.gov (United States)

    Lyte, Mark

    2004-05-01

    The environmental factors that influence the ability of Escherichia coli O157:H7 to attach to the intestinal mucosa are incompletely understood. In the present study, the ability of one of the most common biogenic amines present in food, tyramine, to influence the ability of E. coli O157:H7 to adhere to murine cecal mucosa was examined. Ex vivo full-thickness sheets of murine cecum were mounted in Ussing chambers, which preserved the enteric nervous system innervation of the luminal epithelia and thereby allowed us to achieve a closer approximation of bacterial adherence than would be encountered in vivo. After exposure of the luminal aspect of the cecum to tyramine, E. coli O157:H7 was added for 90 min. The cecal tissue was then removed and washed, and adhered E. coli O157:H7 was enumerated using a selective medium. Tyramine significantly increased E. coli O157:H7 adherence to cecal mucosa when compared to that of controls. The 50% effective concentration of tyramine was 92.6 microM. Specific adrenergic antagonists were then employed to examine whether the effect of tyramine was mediated through alpha- or beta-adrenergic receptors on the intestinal tissue. Pretreatment of tissues with either the alpha-adrenergic receptor antagonist phentolamine or the beta-adrenergic receptor antagonist propranolol prevented the action of tyramine. Measurement of active transepithelial ion transport and ionic permeability in the cecal sheets before and after the addition of tyramine and E. coli O157:H7 did not show any impairment of tissue viability or transepithelial conductance. Further, tyramine did not influence either the growth of E. coli O157:H7 or the expression of the intimin attachment factor. The present findings suggest that biogenic amines, such as tyramine, present within the food matrix influence host susceptibility to E. coli O157:H7 infection.

  17. Prevalence, characterization, and genotypic analysis of Escherichia coli O157:H7/NM from selected beef exporting abattoirs of Argentina.

    Science.gov (United States)

    Masana, M O; Leotta, G A; Del Castillo, L L; D'Astek, B A; Palladino, P M; Galli, L; Vilacoba, E; Carbonari, C; Rodríguez, H R; Rivas, M

    2010-04-01

    In Argentina, Escherichia coli O157:H7/NM (STEC O157) is the prevalent serotype associated with hemolytic uremic syndrome (HUS), which is endemic in the country with more than 400 cases per year. In order to estimate the prevalence and characteristics of STEC O157 in beef cattle at slaughter, a survey of 1,622 fecal and carcass samples was conducted in nine beef exporting abattoirs from November 2006 to April 2008. A total of 54 samples were found positive for STEC O157, with an average prevalence of 4.1% in fecal content and 2.6% in carcasses. Calves and heifers presented higher percentages of prevalence in feces, 10.5 and 8.5%, respectively. All STEC O157 isolates harbored stx(2) (Shiga toxin 2), eae (intimin), ehxA (enterohemolysin), and fliC(H7) (H7 flagellin) genes, while stx(1) (Shiga toxin 1) was present in 16.7% of the strains. The prevalent (56%) stx genotype identified was stx(2) combined with variant stx(2c (vh-a)), the combination of which is also prevalent (>90%) in STEC O157 post-enteric HUS cases in Argentina. The clonal relatedness of STEC O157 strains was established by phage typing and pulsed-field gel electrophoresis (PFGE). The 54 STEC isolates were categorized into 12 different phage types and in 29 XbaI-PFGE patterns distributed in 27 different lots. STEC O157 strains isolated from 5 of 21 carcasses were identical by PFGE (100% similarity) to strains of the fecal content of the same or a contiguous bovine in the lot. Five phage type-PFGE-stx profiles of 10 strains isolated in this study matched with the profiles of the strains recovered from 18 of 122 HUS cases that occurred in the same period.

  18. rpoS regulation of acid, heat, and salt tolerance in Escherichia coli O157:H7.

    Science.gov (United States)

    Cheville, A M; Arnold, K W; Buchrieser, C; Cheng, C M; Kaspar, C W

    1996-01-01

    An rpoS mutant (rpoS::pRR10) of Escherichia coli O157:H7 ATCC 43895 was generated. Stationary-phase acid, heat, and salt tolerance was significantly reduced, and starvation-induced acid tolerance did not develop in the mutant. RpoS was also important for survival of E. coli O157:H7 in dry, fermented sausage. PMID:8633882

  19. Inactivation of E-coli O157 : H7 in apple cider by ozone at various temperatures and concentrations

    DEFF Research Database (Denmark)

    Steenstrup, Lotte Dock

    2004-01-01

    The effect of temperature (5-20C) at 860 ppm (v/v) ozone and different gaseous ozone concentrations above 1,000 ppm on inactivation of E. coli O157:H7 in apple cider was studied. Lag times ranged from 3.5 min at 20C to 6.7 min at 10C before the on-set of E. coli O157:H7 inactivation. D-values ran...

  20. Preclinical effectiveness of selective inhibitor of IRS1/2 NT157 in osteosarcoma cell lines.

    Directory of Open Access Journals (Sweden)

    Cecilia eGarofalo

    2015-05-01

    Full Text Available Osteosarcoma (OS is the most common primary bone tumor in children and young adults. Several studies have confirmed the involvement of the IGF system in the regulation of OS cell proliferation and differentiation as well as in the protection of cells from chemotherapy. IRS-1 is a critical mediator of IGF-1R signaling, and we recently reported that its overexpression in OS cells increases proliferation, migration and metastasis both in vitro and in vivo. In this study, we evaluated the efficacy of NT157, a selective inhibitor of IRS-1/2, in a panel of OS cells. A strong dose-dependent inhibition of growth was observed in the MG-63, OS-19, and U-2OS OS cell lines, displaying IC50 values at sub-micromolar doses after 72 h of treatment. Exposure to NT157 elicited dose- and time- dependent decreases in IRS-1 levels. Moreover, a protein analysis showed that the degradation of IRS-1 inhibited the activation of principal downstream mediators of the IGF pathway. NT157 significantly affected the cells’ migratory ability, as confirmed by a wound-healing assay. The inhibitor induced cytostatic effects, as evidenced by G2/M cell cycle arrest, and did not affect apoptosis. Consequently, NT157 was combined with drugs used to treat OS in order to capitalize on its therapeutic potential. Simultaneous treatments were made in association with chemotherapeutic agents in a fixed ratio for 72 h and cell proliferation was determined by MTT assay. Synergistic or addictive effects with respect to single agents are expressed as the combination index (CI. Significant synergistic effects were obtained with several targeted drugs, such as Everolimus, an mTOR inhibitor, and NVP-BEZ235, a dual inhibitor of PI3K/mTOR.Overall, these findings provide evidence for the effectiveness of a selected inhibitor of IRS1/2 NT157 in OS cells, displaying a promising approach based on the targeting of IRS-1 combined with other therapies for the treatment of this pediatric solid tumor.

  1. Preclinical Effectiveness of Selective Inhibitor of IRS-1/2 NT157 in Osteosarcoma Cell Lines

    Science.gov (United States)

    Garofalo, Cecilia; Capristo, Mariantonietta; Mancarella, Caterina; Reunevi, Hadas; Picci, Piero; Scotlandi, Katia

    2015-01-01

    Osteosarcoma (OS) is the most common primary bone tumor in children and young adults. Several studies have confirmed the involvement of the insulin-like growth factor (IGF) system in the regulation of OS cell proliferation and differentiation as well as in the protection of cells from chemotherapy. Insulin receptor substrate (IRS)-1 is a critical mediator of IGF-1R signaling, and we recently reported that its overexpression in OS cells increases proliferation, migration, and metastasis both in vitro and in vivo. In this study, we evaluated the efficacy of NT157, a selective inhibitor of IRS-1/2, in a panel of OS cells. A strong dose-dependent inhibition of growth was observed in the MG-63, OS-19, and U-2OS OS cell lines, displaying IC50 values at sub-micromolar doses after 72 h of treatment. Exposure to NT157 elicited dose- and time-dependent decreases in IRS-1 levels. Moreover, a protein analysis showed that the degradation of IRS-1 inhibited the activation of principal downstream mediators of the IGF pathway. NT157 significantly affected the cells’ migratory ability, as confirmed by a wound-healing assay. The inhibitor induced cytostatic effects, as evidenced by G2/M cell cycle arrest, and did not affect apoptosis. Consequently, NT157 was combined with drugs used to treat OS in order to capitalize on its therapeutic potential. Simultaneous treatments were made in association with chemotherapeutic agents in a fixed ratio for 72 h and cell proliferation was determined by MTT assay. Synergistic or addictive effects with respect to single agents are expressed as the combination index. Significant synergistic effects were obtained with several targeted drugs, such as Everolimus, a mammalian target of rapamycin (mTOR) inhibitor, and NVP-BEZ235, a dual inhibitor of PI-3K/mTOR. Overall, these findings provide evidence for the effectiveness of a selected inhibitor of IRS-1/2 NT157 in OS cells, displaying a promising approach based on the targeting of IRS-1 combined

  2. Bifidobacterium spp. influences the production of autoinducer-2 and biofilm formation by Escherichia coli O157:H7.

    Science.gov (United States)

    Kim, Younghoon; Lee, Jae Won; Kang, Seo-Gu; Oh, Sejong; Griffiths, Mansel W

    2012-10-01

    The effect of Bifidobacterium spp. on the production of quorum-sensing (QS) signals and biofilm formation by enterohemorrhagic Escherichia coli (EHEC) O157:H7 was investigated. In an AI-2 bioassay, cell extracts of Bifidobacterium longum ATCC 15707 resulted in a 98-fold reduction in AI-2 activity in EHEC O157:H7 as well as in the Vibrio harveyi reporter strain, even though they did not inhibit the growth of EHEC O157:H7. In addition, they resulted in a 36% reduction in biofilm formation by the organism. Consistently, the virulence of EHEC O157:H7 was significantly attenuated by the presence of cell extracts of B. longum ATCC 15707 in the Caenorhabditis elegans nematode in vivo model. By a proteome analysis using two dimensional electrophoresis (2-DE), we determined that seven proteins including formation of iron-sulfur protein (NifU), thiol:disulfide interchange protein (DsbA), and flagellar P-ring protein (FlgI) were differentially regulated in the EHEC O157:H7 when supplemented with cell extracts of B. longum ATCC 15707. Taken together, these findings propose a novel function of a dairy adjunct in repressing the virulence of EHEC O157:H7.

  3. Modified Vero cell induced by Bifidobacterium bifidum inhibits enterohemorrhagic Escherichia coli O157:H7 cytopathic effect

    Directory of Open Access Journals (Sweden)

    Tahamtan, Y.

    2014-11-01

    Full Text Available Enterohemorrhagic Escherichia coli (EHEC, such as E. coli O157:H7, are emerging food-borne pathogens worldwide. This micro-organism can damage the epithelial tissue of the large intestine. The cytotoxic effects can be neutralized by probiotics such as Bifidobacterium bifidum. Probiotics are viable cells that have beneficial effects on the health of the host. The preventing activity of B. bifidum against E. coli O157 was studied using a Vero cell model. Vero cell was pretreated with viable B. bifidum and incubated for either 3 h to 24 h and then collected from the cell to make modified Vero cell (MVC. Indirect antibacterial effects of B. bifidum were demonstrated by reduction of attachment of E. coli O157:H7 to MVC. The maximum reduction was resulted in pretreatment of Vero cell with B. bifidum for 24 h before infection. B. bifidum attenuated E. coli O157:H7 attachment to MVC up to 10 days of incubation. To our knowledge, MCV prevented Vero cell line injury induced by E. coli O157:H7. Therefore, B. bifidum can be used for inhibition of E. coli O157:H7 cytopathic effect (CPE in Vero cell model, even as pretreatment of the cell line.

  4. Shiga toxin-producing Escherichia coli O157:H7 in milk and milk products in Ogun State, Nigeria

    Directory of Open Access Journals (Sweden)

    Akhigbe Ivbade

    2014-09-01

    Full Text Available Shiga toxin producing Escherichia coli (STEC O157 is a major cause of food-borne illnesses in humans. This study investigated the presence of STEC O157 in milk and milk products in Ogun State, Nigeria. Of a total of 202 samples 10 (5% were positive for STEC O157 including 1 (2% of 50 raw milk samples, 3 (6% of 50 samples of fresh local cheese, 1 (2% of 50 samples of fried local cheese and 5 (9.6% of 52 fermented milk samples. There was no significant difference (p>0.05 in the prevalence of STEC O157 among the sample types. Of 10 isolates, shiga toxin 1 gene (stx1 was detected only in 2 samples (20%, shiga toxin 2 (stx2 was extracted only in 6 samples (60%, stx1 /stx2 in 2 samples (20.0%, intimin gene (eaeA in 5 samples (50%, and enterohaemolysin (E-hlyA gene was isolated in 7 (70% samples. Rates of resistance of the STEC O157 isolates were: amoxicillin/clavulanic acid 100%, ampicillin 100%, chloramphenicol 60%, nalidixic acid 20%, norfloxacin 10%, streptomycin 30%, sulphamethoxazole/trimethprim 20%, and tetracycline 90%. The isolates were all susceptible to ciprofloxacin and neomycin. The presence of virulent multidrug resistant E. coli O157 strains in milk and milk products as revealed by this study unveils a risk of human exposure to these potentially fatal pathogens following consumption of contaminated products.

  5. Survival mechanism of Escherichia coli O157:H7 against combined treatment with acetic acid and sodium chloride.

    Science.gov (United States)

    Lee, Sun-Young; Kang, Dong-Hyun

    2016-05-01

    The combination of salt and acid is commonly used in the production of many foods, including pickles and fermented foods. However, in our previous studies, the addition of salt significantly reduced the inhibitory effect of acetic acid on Escherichia coli O157:H7 in laboratory media and pickled cucumbers. Therefore, this study was conducted to determine the mechanism by which salt confers resistance against acetic acid in E. coli O157:H7. The addition of high concentrations (up to 9% or 15% [w/v]) of salt increased the resistance of E. coli O157:H7 to acetic acid treatment. Combined treatment with acetic acid and salt showed varying results among different bacterial strains (an antagonistic effect for E. coli O157:H7 and Shigella and a synergistic effect for Listeria monocytogenes and Staphylococcus aureus). The addition of salt increased the cytoplasmic pH of E. coli O157:H7, but decreased the cytoplasmic pH of L. monocytogenes and S. aureus on treatment with acetic acid. Therefore, the addition of salt increases the acid resistance of E. coli O157:H7 possibly by increasing its acid resistance response and consequently preventing the acidification of its cytoplasm by organic acids.

  6. Recovery and Behaviour of Stressed Escherichia coli O157:H7 Cells on Rocket Leaf Surfaces Inoculated by Different Methods

    Directory of Open Access Journals (Sweden)

    ANAS A. AL-NABULSI

    2016-03-01

    Full Text Available E. coli O157:H7 is an emerging public health concern worldwide because of its low infectious dose and ability to survive under adverse conditions. Tests were conducted to determine the abilityof unstressed E. coli O157:H7 cells or those stressed by acid, cold, salt exposure or starvation to survive on the surfaces of rocket leaves after contamination by three methods (dip, spray or spot inoculation and following storage at 10 or 25ºC. E. coli O157:H7 numbers recovered from rocket leaves contaminated by the different techniques were in the order of dip > spot > spray inoculation.Numbers of stressed E. coli O157:H7 recovered after inoculation by all three methods increased significantly over 7d storage at 10 or 25ºC, while unstressed E. coli O157:H7 only grew following dip inoculation. Exposure to adverse environmental conditions may increase the risk of E. coli O157:H7 survival and spread on leafy green vegetables.

  7. Ultrasensitive detection of E. coli O157:H7 with biofunctional magnetic bead concentration via nanoporous membrane based electrochemical immunosensor.

    Science.gov (United States)

    Chan, Ka Yiu; Ye, Wei Wei; Zhang, Yu; Xiao, Li Dan; Leung, Polly H M; Li, Yi; Yang, Mo

    2013-03-15

    In this paper, biofunctional magnetic beads were investigated for bacterial cells concentration in a nanoporous alumina membrane based immunosensor for ultra-sensitive detection of E. coli O157:H7. The specific antibody modified magnetic beads were used for concentration of E coli O157:H7 from samples in a small region to enhance sensitivity. The magnetic bead conjugated E. coli O157:H7 cells were then captured on the nanoporous alumina membrane with immobilized antibody via assembled PEG-silane linker. Scanning electron microscopy and fluorescent microscopy were used to demonstrate the magnetic bead-bacteria cell conjugation and bacteria cells magnetic concentration, respectively. Impedance spectroscopy was used to monitor the pure E coli O157:H7 cells and magnetic bead conjugated E coli O157:H7 cells binding on antibody immobilized nanoporous membrane with or without magnetic field. Compared with direct detection of pure bacteria cells, this method via magnetic bead conjugation and concentration demonstrated the ultrasensitivity of 10 CFU/mL for E coli O157:H7 detection.

  8. Curli fimbriae are conditionally required in Escherichia coli O157:H7 for initial attachment and biofilm formation.

    Science.gov (United States)

    Carter, Michelle Qiu; Louie, Jacqueline W; Feng, Doris; Zhong, Wayne; Brandl, Maria T

    2016-08-01

    Several species of enteric pathogens produce curli fimbriae, which may affect their interaction with surfaces and other microbes in nonhost environments. Here we used two Escherichia coli O157:H7 outbreak strains with distinct genotypes to understand the role of curli in surface attachment and biofilm formation in several systems relevant to fresh produce production and processing. Curli significantly enhanced the initial attachment of E. coli O157:H7 to spinach leaves and stainless steel surfaces by 5-fold. Curli was also required for E. coli O157:H7 biofilm formation on stainless steel and enhanced biofilm production on glass by 19-27 fold in LB no-salt broth. However, this contribution was not observed when cells were grown in sterile spinach lysates. Furthermore, both strains of E. coli O157:H7 produced minimal biofilms on polypropylene in LB no-salt broth but considerable amounts in spinach lysates. Under the latter conditions, curli appeared to slightly increase biofilm production. Importantly, curli played an essential role in the formation of mixed biofilm by E. coli O157:H7 and plant-associated microorganisms in spinach leaf washes, as revealed by confocal microscopy. Little or no E. coli O157:H7 biofilms were detected at 4 °C, supporting the importance of temperature control in postharvest and produce processing environments.

  9. Transmission of Escherichia coli O157:H7 in cattle is influenced by the level of environmental contamination.

    Science.gov (United States)

    Gautam, R; Kulow, M; Park, D; Gonzales, T K; Dahm, J; Shiroda, M; Stasic, A J; Döpfer, D; Kaspar, C W; Ivanek, R

    2015-01-01

    A pen infection-transmission experiment was conducted to elucidate the role of pathogen strain and environmental contamination in transmission of Escherichia coli O157:H7 (ECO157) in cattle. Five steers were inoculated with a three-strain mixture of ECO157 and joined with five susceptible steers in each of two experimental replicates. Faecal and environmental samples were monitored for ECO157 presence over 30 days. One ECO157 strain did not spread. Transmission rates for the other two strains were estimated using a generalized linear model developed based on a modified 'Susceptible-Infectious-Susceptible' mathematical model. Transmission rates estimated for the two strains (0·11 and 0·14) were similar. However, the rates significantly (P = 0·0006) increased 1·5 times for every 1-unit increase in the level of environmental contamination measured as log10 c.f.u. Depending on the level of environmental contamination, the estimated basic reproduction numbers varied from environmental contamination for ECO157 control in cattle that should be validated under field conditions.

  10. 157例妊娠期妇女口腔疾病的回顾性分析%Retrospective analysis on 157 cases of oral disease in pregnancy

    Institute of Scientific and Technical Information of China (English)

    刘华

    2015-01-01

    目的:总结分析妊娠期女性口腔疾病的临床特点和治疗方法,探索治疗方法。方法通过回顾性分析2009年1月至2014年12月口腔科治疗的157名妊娠患者临床资料,对疾病病因、诊断、治疗等进行分析。结果妊娠期牙周炎73例;妊娠期牙龈炎10例;冠周炎32例;牙髓炎和根尖炎患者42例。结论妊娠期口腔疾病以牙周炎比例最高,以冠周炎临床症状较重。孕妇口腔疾病容易引起早产,应重视孕前检查。%To analyze the clinical features and treatment of oral disease in pregnancy and to explore preventive methods. 157 patients from January 2009 to December 2014 were retrospectively reviewed. Etiology, diagnosis, treatment and outcome were analyzed. There were 73 cases of pregnancy periodontitis; 10 cases of pregnancy gingivitis; 32 cases of pericoronitis; 42 cases of pulpitis and papicitis. During pregnancy, there is the highest proportion of periodontitis, and the heaviest symptom of pericoronitis in oral disease. Oral disease may cause pre-mature birth easily, pregnant women should attach importance to pre-pregnancy check.

  11. Acid and alcohol tolerance of Escherichia coli O157:H7 in pulque, a typical Mexican beverage.

    Science.gov (United States)

    Gómez-Aldapa, Carlos A; Díaz-Cruz, Claudio A; Villarruel-López, Angelica; Del Refugio Torres-Vitela, M; Rangel-Vargas, Esmeralda; Castro-Rosas, Javier

    2012-03-01

    Pulque is a traditional Mexican fermented alcoholic beverage produced from the nectar of maguey agave plants. No data exist on the behavior of Escherichia coli O157:H7 in agave nectar and pulque. An initial trial was done of the behavior of E. coli O157:H7 during fermentation of nectar from a single producer, a nectar mixture from different producers and "seed" pulque. A second trial simulating artisanal pulque production was done by contaminating fresh nectar with a cocktail of three E. coli O157:H7 strains, storing at 16 ° and 22 °C for 14 h, adding seed pulque and fermenting until pulque was formed. A third trial used pulque from the second trial stored at 22 °C as seed to ferment fresh nectar at 22 °C for 48 h (fermentation cycle). This procedure was repeated for an additional two fermentation cycles. During incubation at 16 ° or 22 °C in the first trial, the E. coli O157:H7 strains multiplied in both the single producer nectar and nectar mixture, reaching maximum concentration at 12h. E. coli O157:H7 cell concentration then decreased slowly, although it survived at least 72 h in both fermented nectars. E. coli O157:H7 did not multiply in the seed pulque but did survive at least 72 h. In the second trial, the numbers of E. coli O157:H7 increased approximately 1.5 log CFU/ml at 22 °C and 1.2 log CFU/ml at 16 °C after 14 h. After seed pulque was added, E. coli O157:H7 concentration decreased to approximately 2 log CFU/ml, and then remained constant until pulque was produced. In the third trial, the E. coli O157:H7 cells multiplied and survived during at least three nectar fermentation cycles. The results suggest that E. coli O157:H7 can develop acid and alcohol tolerance in pulque, and constitutes a public health risk for pulque consumers.

  12. Specific detection of live Escherichia coli O157:H7 using tetracysteine-tagged PP01 bacteriophage.

    Science.gov (United States)

    Wu, Lina; Song, Yiyi; Luan, Tian; Ma, Ling; Su, Liuqin; Wang, Shuo; Yan, Xiaomei

    2016-12-15

    Sensitive and rapid detection of Escherichia coli O157:H7, one of the most notorious bacterial pathogens, is urgently needed for public health protection. Yet, the existing methods are either lack of speed or limited in discriminating viable and dead cells. Using a recombinant bacteriophage, here we report the development of a rapid and sensitive method for live E. coli O157:H7 detection. First, the wild-type PP01 phage was engineered with a tetracysteine (TC)-tag fused with the small outer capsid (SOC) protein. Then, this PP01-TC phage was used to inoculate bacterial sample for 30min. Specific infection and rapid replication of PP01-TC phage in viable E. coli O157:H7 host cell yields a large number of progeny phages with capsids displaying TC tags that can be fluorescently labeled by a membrane permeable biarsenical dye (FlAsH). The bright green fluorescence of single E. coli O157:H7 cells can be readily detected by flow cytometry (FCM) and fluorescence microscopy. High specificity of the assay was verified with seven other bacterial strains. Practical application in E. coli O157:H7 detection in drinks was successfully demonstrated with artificially contaminated 100% apple juice. In less than three hours (including sample preconcentration) and with 40mL of sample volume, as low as 1cfu/mL E. coli O157:H7 can be detected in the presence of large excess of other nontarget bacteria via fluorescence microscopic measurement. The as-developed TC-PP01-FlAsH approach shows a great potential in the safeguard of liquid food products by providing rapid, sensitive, and specific detection of live E. coli O157:H7.

  13. Dual FITC lateral flow immunoassay for sensitive detection of Escherichia coli O157:H7 in food samples.

    Science.gov (United States)

    Song, Chunmei; Liu, Jinxin; Li, Jianwu; Liu, Qing

    2016-11-15

    A pattern of signal amplification lateral flow immunoassay (LFIA) for pathogen detection, which used fluorescein isothiocyanate (FITC) labeled antigen and antibody for dual FITC-LFIA was developed. Escherichia coli O157:H7 (E.coli O157:H7) was selected as the model analyte. In the signal amplification LFIA method, FITC was mixed with sample culture medium, with the presence of E.coli O157:H7 in the samples, the bacteria could emit a yellow-green fluorescence after incubation, creating a fluorescent antigen probe. This antigen probe was added to LFIA, which already contained E.coli O157:H7 monoclonal antibodies-FITC (McAb-E.coli O157:H7-FITC) dispersed in the conjugate pad. Another E.coli O157:H7 McAb was the test line, and goat anti-mouse IgG antibody was the control line in nitrocellulose (NC) membrane. The visual limit of detection (LOD) of the strip for qualitative detection was 10(5) CFU/mL while the LOD for semi-quantitative detection could down to 10(4) CFU/mL by using scanning reader. Signal amplification LFIA was perfectly applied to the detection of food samples with E.coli O157:H7. The LOD was substantially improved to 1 CFU/mL of the original bacterial content after pre-incubation of the bread, milk and jelly samples in broth for 10, 8 and 8h respectively. The results of this method was more sensitive by 10-fold than the conventional colloidal gold (CG) based strips and comparable to the traditional ELISA. This simple, low-cost and easy to be popularized method served as a significant step towards the development of monitoring food-borne pathogens in food-safety testing.

  14. Protozoan Predation of Escherichia coli O157:H7 Is Unaffected by the Carriage of Shiga Toxin-Encoding Bacteriophages.

    Science.gov (United States)

    Schmidt, Carrie E; Shringi, Smriti; Besser, Thomas E

    2016-01-01

    Escherichia coli O157:H7 is a food-borne bacterium that causes hemorrhagic diarrhea and hemolytic uremic syndrome in humans. While cattle are a known source of E. coli O157:H7 exposure resulting in human infection, environmental reservoirs may also be important sources of infection for both cattle and humans. Bacteriophage-encoded Shiga toxins (Stx) carried by E. coli O157:H7 may provide a selective advantage for survival of these bacteria in the environment, possibly through their toxic effects on grazing protozoa. To determine Stx effects on protozoan grazing, we co-cultured Paramecium caudatum, a common ciliate protozoon in cattle water sources, with multiple strains of Shiga-toxigenic E. coli O157:H7 and non-Shiga toxigenic cattle commensal E. coli. Over three days at ambient laboratory temperature, P. caudatum consistently reduced both E. coli O157:H7 and non-Shiga toxigenic E. coli populations by 1-3 log cfu. Furthermore, a wild-type strain of Shiga-toxigenic E. coli O157:H7 (EDL933) and isogenic mutants lacking the A subunit of Stx 2a, the entire Stx 2a-encoding bacteriophage, and/or the entire Stx 1-encoding bacteriophage were grazed with similar efficacy by both P. caudatum and Tetrahymena pyriformis (another ciliate protozoon). Therefore, our data provided no evidence of a protective effect of either Stx or the products of other bacteriophage genes on protozoan predation of E. coli. Further research is necessary to determine if the grazing activity of naturally-occurring protozoa in cattle water troughs can serve to decrease cattle exposure to E. coli O157:H7 and other Shiga-toxigenic E. coli.

  15. Ki-1/57 and CGI-55 ectopic expression impact cellular pathways involved in proliferation and stress response regulation.

    Science.gov (United States)

    Costa, Fernanda C; Saito, Angela; Gonçalves, Kaliandra A; Vidigal, Pedro M; Meirelles, Gabriela V; Bressan, Gustavo C; Kobarg, Jörg

    2014-12-01

    Ki-1/57 (HABP4) and CGI-55 (SERBP1) are regulatory proteins and paralogs with 40.7% amino acid sequence identity and 67.4% similarity. Functionally, they have been implicated in the regulation of gene expression on both the transcriptional and mRNA metabolism levels. A link with tumorigenesis is suggested, since both paralogs show altered expression levels in tumor cells and the Ki-1/57 gene is found in a region of chromosome 9q that represents a haplotype for familiar colon cancer. However, the target genes regulated by Ki-1/57 and CGI-55 are unknown. Here, we analyzed the alterations of the global transcriptome profile after Ki-1/57 or CGI-55 overexpression in HEK293T cells by DNA microchip technology. We were able to identify 363 or 190 down-regulated and 50 or 27 up-regulated genes for Ki-1/57 and CGI-55, respectively, of which 20 were shared between both proteins. Expression levels of selected genes were confirmed by qRT-PCR both after protein overexpression and siRNA knockdown. The majority of the genes with altered expression were associated to proliferation, apoptosis and cell cycle control processes, prompting us to further explore these contexts experimentally. We observed that overexpression of Ki-1/57 or CGI-55 results in reduced cell proliferation, mainly due to a G1 phase arrest, whereas siRNA knockdown of CGI-55 caused an increase in proliferation. In the case of Ki-1/57 overexpression, we found protection from apoptosis after treatment with the ER-stress inducer thapsigargin. Together, our data give important new insights that may help to explain these proteins putative involvement in tumorigenic events. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Sequence variability of P2-like prophage genomes carrying the cytolethal distending toxin V operon in Escherichia coli O157.

    Science.gov (United States)

    Sváb, Domonkos; Horváth, Balázs; Maróti, Gergely; Dobrindt, Ulrich; Tóth, István

    2013-08-01

    Cytolethal distending toxins (CDT) are potent cytotoxins of several Gram-negative pathogenic bacteria, including Escherichia coli, in which five types (CDT-I to CDT-V) have been identified so far. CDT-V is frequently associated with Shiga-toxigenic E. coli (STEC), enterohemorrhagic E. coli (EHEC) O157 strains, and strains not fitting any established pathotypes. In this study, we were the first to sequence and annotate a 31.2-kb-long, noninducible P2-like prophage carrying the cdt-V operon from an stx- and eae-negative E. coli O157:H43 strain of bovine origin. The cdt-V operon is integrated in the place of the tin and old phage immunity genes (termed the TO region) of the prophage, and the prophage itself is integrated into the bacterial chromosome between the housekeeping genes cpxP and fieF. The presence of P2-like genes (n = 20) was investigated in a further five CDT-V-positive bovine E. coli O157 strains of various serotypes, three EHEC O157:NM strains, four strains expressing other variants of CDT, and eight CDT-negative strains. All but one CDT-V-positive atypical O157 strain uniformly carried all the investigated genomic regions of P2-like phages, while the EHEC O157 strains missed three regions and the CDT-V-negative strains carried only a few P2-like sequences. Our results suggest that P2-like phages play a role in the dissemination of cdt-V between E. coli O157 strains and that after integration into the bacterial chromosome, they adapted to the respective hosts and became temperate.

  17. Protozoan Predation of Escherichia coli O157:H7 Is Unaffected by the Carriage of Shiga Toxin-Encoding Bacteriophages.

    Directory of Open Access Journals (Sweden)

    Carrie E Schmidt

    Full Text Available Escherichia coli O157:H7 is a food-borne bacterium that causes hemorrhagic diarrhea and hemolytic uremic syndrome in humans. While cattle are a known source of E. coli O157:H7 exposure resulting in human infection, environmental reservoirs may also be important sources of infection for both cattle and humans. Bacteriophage-encoded Shiga toxins (Stx carried by E. coli O157:H7 may provide a selective advantage for survival of these bacteria in the environment, possibly through their toxic effects on grazing protozoa. To determine Stx effects on protozoan grazing, we co-cultured Paramecium caudatum, a common ciliate protozoon in cattle water sources, with multiple strains of Shiga-toxigenic E. coli O157:H7 and non-Shiga toxigenic cattle commensal E. coli. Over three days at ambient laboratory temperature, P. caudatum consistently reduced both E. coli O157:H7 and non-Shiga toxigenic E. coli populations by 1-3 log cfu. Furthermore, a wild-type strain of Shiga-toxigenic E. coli O157:H7 (EDL933 and isogenic mutants lacking the A subunit of Stx 2a, the entire Stx 2a-encoding bacteriophage, and/or the entire Stx 1-encoding bacteriophage were grazed with similar efficacy by both P. caudatum and Tetrahymena pyriformis (another ciliate protozoon. Therefore, our data provided no evidence of a protective effect of either Stx or the products of other bacteriophage genes on protozoan predation of E. coli. Further research is necessary to determine if the grazing activity of naturally-occurring protozoa in cattle water troughs can serve to decrease cattle exposure to E. coli O157:H7 and other Shiga-toxigenic E. coli.

  18. Thermal inactivation of Escherichia coli O157:H7 in strawberry puree and its effect on anthocyanins and color.

    Science.gov (United States)

    Hsu, Hsin-Yun; Huang, Lihan; Wu, James Swi-Bea

    2014-01-01

    Raw whole strawberries, if contaminated with pathogens, such as Escherichia coli O157:H7, must be pasteurized prior to consumption. Therefore, the objective of this research was to investigate the thermal inactivation kinetics of E. coli O157:H7 in strawberry puree (SP), and evaluate the changes in anthocyanins and color, and the survival of yeasts and molds (YM) after thermal processing. Inoculated with a 5-strain cocktail, fresh SP, with or without added sugar (20 and 40 °Brix), was heated at 50, 52, 54, 57.5, 60, and 62.5 °C to determine the thermal resistance of E. coli O157:H7. In raw SP, the average D-values of E. coli O157:H7 were 909.1, 454.6, 212.8, 46.1, and 20.2 s at 50, 52, 54, 57.5, and 60 °C, respectively, with a z-value of 5.9 °C. While linearly decreasing with temperature, the log D-values of E. coli O157:H7 increased slightly with sugar concentration. The log degradation rates of anthocyanins increased linearly with temperature, but decreased slightly with sugar concentrations. These results suggest that sugar may provide some protection to both E. coli O157: H7 and anthocyanins in SP. The browning index was not affected by heating at 50 and 52 °C at low sugar concentrations, but increased by an average of 1.28%, 2.21%, and 10.1% per min when SP was exposed to heating at 54, 57.5, and 60 °C, respectively. YM was also inactivated by heating. This study demonstrated that properly designed thermal processes can effectively inactivate E. coli O157:H7 and YM in contaminated SP, while minimizing the changes in anthocyanins and color.

  19. Biofilm formation and sanitizer resistance of Escherichia coli O157:H7 strains isolated from "high event period" meat contamination.

    Science.gov (United States)

    Wang, Rong; Kalchayanand, Norasak; King, David A; Luedtke, Brandon E; Bosilevac, Joseph M; Arthur, Terrance M

    2014-11-01

    In the meat industry, a "high event period" (HEP) is defined as a time period during which commercial meat plants experience a higher than usual rate of Escherichia coli O157:H7 contamination. Genetic analysis indicated that within a HEP, most of the E. coli O157:H7 strains belong to a singular dominant strain type. This was in disagreement with the current beef contamination model stating that contamination occurs when incoming pathogen load on animal hides, which consists of diverse strain types of E. coli O157:H7, exceeds the intervention capacity. Thus, we hypothesize that the HEP contamination may be due to certain in-plant colonized E. coli O157:H7 strains that are better able to survive sanitization through biofilm formation. To test our hypothesis, a collection of 45 E. coli O157:H7 strains isolated from HEP beef contamination incidents and a panel of 47 E. coli O157:H7 strains of diverse genetic backgrounds were compared for biofilm formation and sanitizer resistance. Biofilm formation was tested on 96-well polystyrene plates for 1 to 6 days. Biofilm cell survival and recovery growth after sanitization were compared between the two strain collections using common sanitizers, including quaternary ammonium chloride, chlorine, and sodium chlorite. No difference in "early stage" biofilms was observed between the two strain collections after incubation at 22 to 25°C for 1 or 2 days. However, the HEP strains demonstrated significantly higher potency of "mature" biofilm formation after incubation for 4 to 6 days. Biofilms of the HEP strains also exhibited significantly stronger resistance to sanitization. These data suggest that biofilm formation and sanitization resistance could have a role in HEP beef contamination by E. coli O157:H7, which highlights the importance of proper and complete sanitization of food contact surfaces and food processing equipment in commercial meat plants.

  20. E. coli O157 outbreaks in the United Kingdom: past, present, and future

    Directory of Open Access Journals (Sweden)

    Pennington TH

    2014-08-01

    Full Text Available Thomas Hugh Pennington University of Aberdeen, Aberdeen, United Kingdom Abstract: This review describes Escherichia coli O157 outbreaks in the United Kingdom, beginning from the first, in the 1980s, to those recorded in 2013. We point out that the United Kingdom differs from other countries, particularly the United States, in that it has had a considerable number of outbreaks associated with butchers, but very few caused by contaminated burgers. Two of the butcher-associated outbreaks (in central Scotland in 1996 and South Wales in 2005 were very large and are considered here in detail; the reviewer conducted detailed investigations into both outbreaks. Also considered is the very large outbreak that occurred in visitors to an open farm in Surrey in 2009. Detailed descriptions of some milk-borne outbreaks and incidents connected with camping and childrens' nurseries have been published, and these are also considered in this review. Large outbreaks in the United Kingdom have sometimes led to policy developments regarding food safety, and these are considered, together with public reactions to them, their health effect, and their value, as examples to follow or eschew in terms of the procedures to be adopted in response to incidents of this kind. Regulatory and legal consequences are also considered. As a wise man said, making predictions is difficult, particularly about the future. This review follows this position but points out that although human infections caused by E. coli O157 are rare in the United Kingdom, their incidence has not changed significantly in the last 17 years. This review points out that although a response to an outbreak is to say "lessons must be learned", this response has been tempered by forgetfulness. Accordingly, this review restricts its recommendations regarding outbreaks to two: the crucial importance of a rapid response and the importance of experience, and even "gut feeling", when an inspector is evaluating the

  1. Insight into Shiga toxin genes encoded by Escherichia coli O157 from whole genome sequencing

    Directory of Open Access Journals (Sweden)

    Philip M. Ashton

    2015-02-01

    Full Text Available The ability of Shiga toxin-producing Escherichia coli (STEC to cause severe illness in humans is determined by multiple host factors and bacterial characteristics, including Shiga toxin (Stx subtype. Given the link between Stx2a subtype and disease severity, we sought to identify the stx subtypes present in whole genome sequences (WGS of 444 isolates of STEC O157. Difficulties in assembling the stx genes in some strains were overcome by using two complementary bioinformatics methods: mapping and de novo assembly. We compared the WGS analysis with the results obtained using a PCR approach and investigated the diversity within and between the subtypes. All strains of STEC O157 in this study had stx1a, stx2a or stx2c or a combination of these three genes. There was over 99% (442/444 concordance between PCR and WGS. When common source strains were excluded, 236/349 strains of STEC O157 had multiple copies of different Stx subtypes and 54 had multiple copies of the same Stx subtype. Of those strains harbouring multiple copies of the same Stx subtype, 33 had variants between the alleles while 21 had identical copies. Strains harbouring Stx2a only were most commonly found to have multiple alleles of the same subtype (42%. Both the PCR and WGS approach to stx subtyping provided a good level of sensitivity and specificity. In addition, the WGS data also showed there were a significant proportion of strains harbouring multiple alleles of the same Stx subtype associated with clinical disease in England.

  2. 亚甲基蓝对大肠杆菌O157的光动力杀伤作用及机理%Mechanisms of Anti-microbial Photodynamic Technology Against Escherichia coli O157 by Methylene Blue

    Institute of Scientific and Technical Information of China (English)

    唐姝姝; 唐书泽; 李红爱; 吴希阳; 陈振强

    2012-01-01

    探讨亚甲基蓝对革兰氏阴性菌肠出血性大肠杆菌O157的光动力杀伤作用及机理。通过细菌平板菌落计数法研究亚甲基蓝对肠出血性大肠杆菌O157的光动力杀伤作用,同时运用实时荧光定量PCR技术和聚丙烯酰胺凝胶电泳观察光动力技术对O157的基因组DNA的损伤程度和蛋白质降解效果。结果表明,当亚甲基蓝的浓度为10mg/L,可见光(光功密度为200mW/cm2)光照30rain时,几乎全部的肠出血性大肠杆菌O157能被杀死,并伴随有DNA断裂和蛋白质降解。亚甲基蓝对革兰氏阴性菌肠出血性大肠杆菌O157有非常明显的光灭活效应,其灭活机理可能是对基因组DNA的损伤以及蛋白质的降解。%The mechanisms of anti-microbial photodynamic technology(APDT) against Gram-negative bacteria Escherichia coli O157 by methylene blue (MB) was investigated. The bactericidal effect of MB-APDT on E. coli O157 was measured by counting the reduction of colony forming unit(CFU). The damage of DNA was observed by real-time polymerase chain reaction (RT-PCR) and the degradation of proteins was investigated by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE). Results showed that almost all of the E. coli O157 were photo inactivated by illumination with 30 min visible light (power density 200 mW/cm2) in the presence of 10 mg/L MB. The significant photo-inactivation of Gram-negative bacteria Escherichia coli O157 may be due to the damage of DNAs and the degradation of proteins.

  3. Pentadecapeptide BPC 157 attenuates chronic amphetamineinduced behavior disturbances%十五肽BPC 157减弱慢性苯丙胺诱导的行为障碍

    Institute of Scientific and Technical Information of China (English)

    Predrag SIKIRIC; Gorana ARALICA; Gojko BULJAT; Ingrid PRKACIN; Martina LOVRIC-BENCIC; Jadranka SEPAROVIC; Sven SEIWERTH; Rudolf RUCMAN; Marijan PETEK; Branko TURKOVIC; Tihomil ZIGER; Nikola JELOVAC; Alenka BOBAN-BLAGAIC; Vlado BEDEKOVIC; Ante TONKIC; Slaven BABIC; Andjelka JELOVAC-GJELDUM; Goran DODIG; Mario STARESINIC; Tomislav ANIC; Ivan ZORICIC; Davor RAK; Darko PEROVIC

    2002-01-01

    AIM: To investigate the effect of pentadecapeptide BPC 157 on chronic exposure to amphetamine in rats,particularly the changes commonly referred in chronic amphetamine studies as tolerance (lesser grade of stereotyped behavior, without increased excitability) and reverse tolerance (ie, prominent stereotyped behavior and heightened startle response upon late amphetamine challenges ). METHODS: After initial application (initial single dose-regimen), amphetamine (10 mg/kg,ip) was given once daily till d 5 (continuous administration-regimen ), and thereafter on d 8, 16, and 46(intermittent administration regimen). For stereotyped behavior and heightened startle response the observation period was 120 min after amphetamine application, and each animal was observed for 10 s in 5 min intervals.Pentadecapeptide BPC 157 (10 μg/kg or 10 ng/kg, ip)or saline (5.0 mL/kg, ip) were given only at the beginning of the experiment, simultaneously with the initial dose of amphetamine. RESULTS: In relation to applied initial-single/continuous/intermittent amphetamine applications regimen, the control amphetamine rats throughout the experiment showed the changes in stereotyped behavior and heightened startle response,increment or decrement, commonly explained in chronic amphetamine studies as tolerance and reverse tolerance.After the initial application of the amphetamine, the higher BPC 157 dosage apparently attenuated the stereotyped behavior, while the lower dosage of BPC 157 did not reach a statistical significance. Considering the forthcoming amphetamine challenges, in the rats initially treated with pentadecapeptide BPC 157, either 10 μg- or 10 ng-dose, at the time of the first application of amphetamine, the stereotyped behavior remains to be attenuated after all additional amphetamine challenges (on d 2- 5, 8, 16, and 46). This attenuation was not limited to stereotyped behavior only. After the initial application of the amphetamine the heightened startle response was also

  4. An adult case of combined encephalopathy and hemolytic uremic syndrome caused by Escherichia coli O157.

    Science.gov (United States)

    Yoshimitsu, Masashi; Hayashi, Nobuaki; Kaneko, Yoshibumi; Doyama, Hisashi

    2011-01-01

    We report a 28-year-old woman with O157 enterohemorrhagic colitis-associated hemolytic uremic syndrome in whom seizures and transient hemiparesis developed on the 12th day after admission to hospital. Her subsequent recovery was characterized by improvements in renal function and platelet count. The patient recovered after treatment with steroid pulse and plasma exchange therapy, without any sequelae. As there have been few reports on the onset of encephalopathy in adults, we report this interesting case, with reference to the literature for possible effective treatment.

  5. A complete look at the dissociation dynamics of vinylfluoride at 157 nm

    Science.gov (United States)

    Tu, Jinying; Lin, Jim J.; Lee, Yuan T.; Yang, Xueming

    2002-04-01

    Photodissociation of vinylfluoride (H2CCFH) at 157 nm has been investigated using the photofragment translational spectroscopy technique. Five dissociation pathways have been clearly observed: H2CCF/HCCHF+H, HCCF+2H, HCCH+H+F, HCCH/H2CC:+HF, and HCCF/HFCC:+H2. Molecular HF elimination and the HCCH+H+F triple dissociation channel are found to be equally important, while other channels are all minor. The product kinetic energy distributions for all dissociation channels have been determined. Branching ratios for different channels have also been estimated.

  6. Primary and secondary cases in Escherichia coli O157 outbreaks: a statistical analysis.

    LENUS (Irish Health Repository)

    Snedeker, Kate G

    2009-01-01

    BACKGROUND: Within outbreaks of Escherichia coli O157 (E. coli O157), at least 10-15% of cases are thought to have been acquired by secondary transmission. However, there has been little systematic quantification or characterisation of secondary outbreak cases worldwide. The aim of this study was to characterise secondary outbreak cases, estimate the overall proportion of outbreak cases that were the result of secondary transmission and to analyse the relationships between primary and secondary outbreak cases by mode of transmission, country and median age. METHODS: Published data was obtained from 90 confirmed Escherichia coli O157 outbreaks in Great Britain, Ireland, Scandinavia, Canada, the United States and Japan, and the outbreaks were described in terms of modes of primary and secondary transmission, country, case numbers and median case age. Outbreaks were tested for statistically significant differences in the number of ill, confirmed, primary and secondary cases (analysis of variance and Kruskal-Wallis) and in the rate of secondary cases between these variables (Generalised Linear Models). RESULTS: The outbreaks had a median of 13.5 confirmed cases, and mean proportion of 0.195 secondary cases. There were statistically significant differences in the numbers of ill, confirmed, primary and secondary cases between modes of primary transmission (p < 0.021), and in primary and secondary cases between median age categories (p < 0.039) and modes of secondary transmission (p < 0.001).Secondary case rates differed statistically significantly between modes of secondary and primary transmission and median age categories (all p < 0.001), but not between countries (p = 0.23). Statistically significantly higher rates of secondary transmission were found in outbreaks with a median age <6 years and those with secondary transmission via person to person spread in nurseries. No statistically significant interactions were found between country, mode of transmission and age

  7. Defining Moments in MMWR History: 1993 E. coli O157:H7 Hamburger Outbreak

    Centers for Disease Control (CDC) Podcasts

    2017-05-31

    During the 1993 E. coli O157 outbreak, four children died, and approximately 700 persons in four states became ill with severe and often bloody diarrhea after eating hamburgers from fast food restaurants. The first reports of CDC’s investigation into this deadly outbreak were published in MMWR. In this podcast, Dr. Beth Bell shares what it was like to serve as one of CDC’s lead investigators – a boots-on-the-ground disease detective -- for the historic outbreak.  Created: 5/31/2017 by MMWR.   Date Released: 5/31/2017.

  8. Measurement of the Gd157(n,γ) reaction with the DANCE γ calorimeter array

    Science.gov (United States)

    Chyzh, A.; Baramsai, B.; Becker, J. A.; Bečvář, F.; Bredeweg, T. A.; Couture, A.; Dashdorj, D.; Haight, R. C.; Jandel, M.; Kroll, J.; Krtička, M.; Mitchell, G. E.; O'Donnell, J. M.; Parker, W.; Rundberg, R. S.; Ullmann, J. L.; Vieira, D. J.; Walker, C. L.; Wilhelmy, J. B.; Wouters, J. M.; Wu, C. Y.

    2011-07-01

    The Gd157(n,γ) reaction was measured with the DANCE γ calorimeter (consisting of 160 BaF2 scintillation detectors) at the Los Alamos Neutron Science Center. The multiplicity distributions of the γ decay were used to determine the resonance spins up to En=300 eV. The γ-ray energy spectra for different multiplicities were measured for the s-wave resonances. The shapes of these spectra were compared with simulations based on the use of the DICEBOX statistical model code. Simulations showed that the scissors mode is required not only for the ground-state transitions but also for transitions between excited states.

  9. Comparison of different sample preparation procedures for the detection and isolation of Escherichia coli O157:H7 and Non-O157 STECs from leafy greens and cilantro.

    Science.gov (United States)

    Kase, Julie A; Maounounen-Laasri, Anna; Son, Insook; Deer, Deanne M; Borenstein, Stacey; Prezioso, Samantha; Hammack, Thomas S

    2012-12-01

    The FDA Bacteriological Analytical Manual (BAM) method for the detection/isolation of Shiga toxin-producing Escherichia coli (STEC) involves enrichment of produce rinses, blended homogenates or stomached homogenates. However, the effectiveness of rinsing produce to remove attached bacteria is largely unknown. Moreover, PCR inhibitors can be released under physical treatment. The study objective was to determine the relative effectiveness of recovery methods for STEC contaminated produce. Spinach, lettuce, and cilantro were contaminated with E. coli O157:H7 or a non-O157 STEC, subjected to both the BAM method and a soak method, and tested by real-time PCR and cultural methods. For O157:H7 and non-O157:H7 STECs, the soak method was significantly more productive than leafy green rinses. Of 320 test portions, PCR of recovered colonies confirmed 148 were positive by rinsing and 271 were positive by soaking (an 83% increase in sensitivity). For recovery of O157:H7 from cilantro, of 60 test portions, positives were 38 by soaking, 41 by stomaching, and 28 by blending. Soaking and stomaching were significantly more productive than blending, although soaking was only arithmetically superior to stomaching. Based upon these results, it is recommended that a soak method replace the current BAM procedures. Published by Elsevier Ltd.

  10. ISOLASI DAN IDENTIFIKASI ESCHERICHIA COLI O157:H7 PADA DAGING SAPI DI KABUPATEN BADUNG PROVINSI BALI. ISOLATION AND IDENTIFICATION ESCHERICHIA COLI O157:H7 ON BEEF AT BADUNG REGENCY PROVINCE OF BALI

    Directory of Open Access Journals (Sweden)

    I Wayan Suardana

    2007-03-01

    Full Text Available Keamanan bahan pangan merupakan masalah yang amat penting bagi konsumen dan industri pangan. Cemaran bakteri Escherichia coli dan Coliform dianggap sebagai indikator sanitasi dalam proses pengolahan bahan pangan. Pelacakan bakteri patogen dalam pangan juga telah dilakukan secara rutin, termasuk yang bersifat zoonosis seperti Escherichia coli O157:H7. Bakteri ini menghasilkan toksin yang dikenal dengan Shiga toxin. Toksin ini dapat menimbulkan diare berdarah, colitis haemorrhagi dan hemolytic uremic syndrome (HUS pada manusia. Dalam penelitian ini dipelajari hubungan antara tingkat cemaran dan insidensi Coliform, E.coli, E.coli O157 dan E.coli O157:H7 pada daging sapi. Bakteri pertama ditumbuhkan pada media EMBA, selanjutnya dipupuk pada media SMAC dan diakhiri dengan uji aglutinasi lateks untuk memastikan keberadaan bakteri E.coli O157 dan uji antiserum H7 untuk memastikan isolat yang diisolasi merupakan isolat E.coli O157:H7. Hasil isolasi dan identifikasi terhadap 89 sampel daging sapi diperoleh hasil rata-rata tingkat cemran coliform dan E.coli sebesar 93,01+ 2,64x103 cfu/g dan

  11. EMA-PCR技术检测肠出血性大肠杆菌O157∶H7%EMA-PCR Detection of Enterohemorrhagic Eschrichia Coli O157 ∶ H7

    Institute of Scientific and Technical Information of China (English)

    黄偌颖; 方梅; 罗影殊; 刘衡川; 陆巧荣; 王国庆

    2014-01-01

    目的 将叠氮溴化乙锭(ethidium monoazide bromide,EMA)与PCR技术相结合,建立一种有效、快速检测活肠出血性大肠杆菌O157∶H7的方法.方法 以rfbE为PCR检测靶基因,O157∶H7培养物经EMA处理后制备模板进行PCR检测,并对EMA使用浓度、作用时间等进行优化.结果 不抑制O157∶H7活菌PCR扩增的最大EMA浓度为10 μg/mL;抑制2×107 CFU/mL死菌PCR反应的最小EMA浓度为0.5 μg/mL;该法对O157∶H7检测的灵敏度为2×104 CFU/mL,结果显示能检出混合体系中含有的1%的活菌.结论 EMA PCR技术能有效检测活的O157∶H7,在突发公共卫生事件的快速检测中具有良好的应用前景.

  12. Evaluation of lactic acid as an initial and secondary subprimal intervention for Escherichia coli O157:H7, non-O157 Shiga toxin-producing E. coli, and a nonpathogenic E. coli surrogate for E. coli O157:H7.

    Science.gov (United States)

    Pittman, C I; Geornaras, I; Woerner, D R; Nightingale, K K; Sofos, J N; Goodridge, L; Belk, K E

    2012-09-01

    Lactic acid can reduce microbial contamination on beef carcass surfaces when used as a food safety intervention, but effectiveness when applied to the surface of chilled beef subprimal sections is not well documented. Studies characterizing bacterial reduction on subprimals after lactic acid treatment would be useful for validations of hazard analysis critical control point (HACCP) systems. The objective of this study was to validate initial use of lactic acid as a subprimal intervention during beef fabrication followed by a secondary application to vacuum-packaged product that was applied at industry operating parameters. Chilled beef subprimal sections (100 cm(2)) were either left uninoculated or were inoculated with 6 log CFU/cm(2) of a 5-strain mixture of Escherichia coli O157:H7, a 12-strain mixture of non-O157 Shiga toxin-producing E. coli (STEC), or a 5-strain mixture of nonpathogenic (biotype I) E. coli that are considered surrogates for E. coli O157:H7. Uninoculated and inoculated subprimal sections received only an initial or an initial and a second "rework" application of lactic acid in a custombuilt spray cabinet at 1 of 16 application parameters. After the initial spray, total inoculum counts were reduced from 6.0 log CFU/cm(2) to 3.6, 4.4, and 4.4 log CFU/cm(2) for the E. coli surrogates, E. coli O157:H7, and non-O157 STEC inoculation groups, respectively. After the second (rework) application, total inoculum counts were 2.6, 3.2, and 3.6 log CFU/cm(2) for the E. coli surrogates, E. coli O157:H7, and non-O157 STEC inoculation groups, respectively. Both the initial and secondary lactic acid treatments effectively reduced counts of pathogenic and nonpathogenic strains of E. coli and natural microflora on beef subprimals. These data will be useful to the meat industry as part of the HACCP validation process.

  13. Body protective compound-157 enhances alkali-burn wound healing in vivo and promotes proliferation, migration, and angiogenesis in vitro

    Directory of Open Access Journals (Sweden)

    Huang T

    2015-04-01

    Full Text Available Tonglie Huang,1,* Kuo Zhang,2,* Lijuan Sun,3 Xiaochang Xue,1 Cun Zhang,1 Zhen Shu,1 Nan Mu,1 Jintao Gu,1 Wangqian Zhang,1 Yukun Wang,1 Yingqi Zhang,1 Wei Zhang1 1State Key Laboratory of Cancer Biology, Department of Biopharmaceutics, School of Pharmacy, The Fourth Military Medical University, 2National Engineering Research Center for Miniaturized Detection Systems, School of Life Sciences, Northwest University, 3Department of Ophthalmology, Xijing Hospital, The Fourth Military Medical University, Xi’an, People’s Republic of China *These authors contributed equally to this work Abstract: Chemical burns take up a high proportion of burns admissions and can penetrate deep into tissues. Various reagents have been applied in the treatment of skin chemical burns; however, no optimal reagent for skin chemical burns currently exists. The present study investigated the effect of topical body protective compound (BPC-157 treatment on skin wound healing, using an alkali burn rat model. Topical treatment with BPC-157 was shown to accelerate wound closure following an alkali burn. Histological examination of skin sections with hematoxylin–eosin and Masson staining showed better granulation tissue formation, reepithelialization, dermal remodeling, and a higher extent of collagen deposition when compared to the model control group on the 18th day postwounding. BPC-157 could promote vascular endothelial growth factor expression in wounded skin tissues. Furthermore, 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide and cell cycle analysis demonstrated that BPC-157 enhanced the proliferation of human umbilical vein endothelial cells (HUVECs. Transwell assay and wound healing assay showed that BPC-157 significantly promoted migration of HUVECs. We also observed that BPC-157 upregulated the expression of VEGF-a and accelerated vascular tube formation in vitro. Moreover, further studies suggested that BPC-157 regulated the phosphorylation level of

  14. Inactivation of Escherichia coli O157:H7 in apple juice and apple cider by trans-cinnamaldehyde.

    Science.gov (United States)

    Baskaran, Sangeetha Ananda; Amalaradjou, Mary Anne Roshni; Hoagland, Thomas; Venkitanarayanan, Kumar

    2010-06-30

    This study investigated the antimicrobial effect of low concentrations of trans-cinnamaldehyde (TC) on Escherichia coli O157:H7 in apple juice and apple cider. A five-strain mixture of E. coli O157:H7 was inoculated into apple juice or cider at approximately 6.0 log CFU/ml, followed by the addition of TC (0%v/v, 0.025%v/v, 0.075%v/v and 0.125%v/v). The inoculated apple juice samples were incubated at 23 degrees C and 4 degrees C for 21 days, whereas the cider samples were stored only at 4 degrees C. The pH of apple juice and cider, and E. coli O157:H7 counts were determined on days 0, 1, 3, 5, 7, 14 and 21. TC was effective (Pcider. At 23 degrees C, 0.125 and 0.075%v/v TC completely inactivated E. coli O157:H7 in apple juice (negative by enrichment) on days 1 and 3, respectively. At 4 degrees C, 0.125 and 0.075%v/v TC decreased the pathogen counts in the juice and cider to undetectable levels on days 3 and 5, respectively. Results indicate that low concentrations of TC could be used as an effective antimicrobial to inactivate E. coli O157:H7 in apple juice and apple cider. 2010 Elsevier B.V. All rights reserved.

  15. Rapid and selective detection of E. coli O157:H7 combining phagomagnetic separation with enzymatic colorimetry.

    Science.gov (United States)

    Zhang, Yun; Yan, Chenghui; Yang, Hang; Yu, Junping; Wei, Hongping

    2017-11-01

    Mammal IgG antibodies are normally used in conventional immunoassays for E. coli O157:H7, which could lead to false positive results from the presence of protein A producing S. aureus. In this study, a natural specific bacteriophage was isolated and then conjugated with magnetic beads as a capture element in a sandwich format for the rapid and selective detection of E. coli O157:H7. To the best of our knowledge, it was the first time to utilize a natural bacteriophage to develop a phagomagnetic separation combined with colorimetric assay for E. coli O157:H7. The method has an overall time less than 2h with a detection limit of 4.9×10(4)CFU/mL. No interference from S. aureus was observed. Furthermore, the proposed method was successfully applied to detect E. coli O157:H7 in spiked skim milk. The proposed detection system provided a potential method for E. coli O157:H7 and other pathogenic bacteria in food samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. A longitudinal study of Escherichia coli O157 in cattle of a Dutch dairy farm and in the farm environment.

    Science.gov (United States)

    Schouten, J M; Graat, E A M; Frankena, K; van de Giessen, A W; van der Zwaluw, W K; de Jong, M C M

    2005-05-20

    From July 1999 till November 2000, a longitudinal study was conducted on a dairy farm in The Netherlands to study within herd prevalence and types of verocytotoxin producing Escherichia coli (VTEC) of serogroup O157 over time, and determine environmental reservoirs and possible transmission routes. Faeces, blood, milk and environmental samples were collected 14 times with intervals varying from 4 to 10 weeks during the study period. Faecal samples were selectively cultured for Escherichia coli O157. Isolates were tested by PCR for the most common virulence genes, VTI, VTII and eae, and typed by pulsed field gel electrophoresis. In total, 71 isolates were obtained, of which 49 from dairy cows, 8 from young stock, 5 from other animals and 9 from the environment. Positive samples were all detected in summer and early fall. VT- and eae-genes were found in all tested isolates, except in one. DNA typing showed that three clusters of O157 isolates could be identified. One of these clusters contained samples of two shedding seasons, indicating persistence on the farm during winter and spring. Repeated measures analysis of variance showed that cows with O157 VTEC infection had higher daily milk production in the period preceding sampling (p = 0.0055). There was no significant association between the results of the LPS-ELISA on serum samples from dairy cows and their O157 status.

  17. DNA aptamer identification and characterization for E. coli O157 detection using cell based SELEX method.

    Science.gov (United States)

    Amraee, Masoum; Oloomi, Mana; Yavari, Afsaneh; Bouzari, Saeid

    2017-08-14

    Escherichia coli (E. coli) O157:H7 is a foodborne pathogen that causes symptoms in humans. Its rapid identification should be considered to avoid toxic effects of the pathogen. In this study, systematic evolution of ligands by exponential enrichment using whole cells (Cell-SELEX) method was used for recognizing E. coli strain, O157 by single-stranded DNA library of aptamer. Nine rounds of cell-selex procedure were applied using O157, as a whole-cell target, with O42, K12, Top10, DH5α E. coli cells, Shigella flexneri and Salmonella typhi as counterparts. The specific interaction between selected DNA aptamers and targeted cell was assessed. After applying six rounds of SELEX for selection of DNA aptamers, the candidate sequences were obtained. Finally, specific aptamer was selected as an ideal aptamer for detection and capturing of E. coli O157. Dissociation constant of the selected aptamer were calculated (107.6 ± 67.8 pM). In addition, the secondary structure prediction and cross reactivity assays were performed. The isolated aptamer efficiency was confirmed and it was shown that the new DNA aptamer sequence has the ability to use for detection. This specific O157:H7 aptamer have the potential for application as a diagnostic ligand and could be used for detection of the related food borne diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Effect of salt addition on acid resistance response of Escherichia coli O157:H7 against acetic acid.

    Science.gov (United States)

    Bae, Young-Min; Lee, Sun-Young

    2017-08-01

    A combination of salt and acid is commonly used in the production of many foods, such as pickles and fermented foods. However, in our previous studies, addition of salt significantly reduced the inhibitory effect of acetic acid against E. coli O157:H7 in laboratory media and pickled cucumbers. Therefore, this study was conducted to determine the effect of salt addition on the acid resistance (AR) response of E. coli O157:H7 after treatment with acetic acid. The combined effect of acetic acid and salt showed different results depending on media tested. Organic compounds such as yeast extract and tryptone were required to observe the antagonistic effect of salt and acetic acid in combination. However, use of an rpoS mutant or addition of chloramphenicol resulted in no changes in the antagonistic effect of acetic acid and salt. The addition of glutamate to phosphate buffer significantly increased the survival levels of E. coli O157:H7 after the acetic acid treatment; however, the survival levels were lower than those after the treatment with acetic acid alone. Thus, the addition of salt may increase the AR response of E. coli O157:H7; however, these survival mechanisms were not proven clearly. Therefore, further studies need to be performed to better understand the antagonism of acetic acid salt against E. coli O157:H7. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Proliferation of Escherichia coli O157:H7 in Soil-Substitute and Hydroponic Microgreen Production Systems.

    Science.gov (United States)

    Xiao, Zhenlei; Bauchan, Gary; Nichols-Russell, Lydia; Luo, Yaguang; Wang, Qin; Nou, Xiangwu

    2015-10-01

    Radish (Raphanus sativus var. longipinnatus) microgreens were produced from seeds inoculated with Escherichia coli O157:H7 by using peat moss-based soil-substitute and hydroponic production systems. E. coli populations on the edible and inedible parts of harvested microgreen plants (7 days postseeding) and in growth medium were examined. E. coli O157:H7 was shown to survive and proliferate significantly during microgreen growth in both production systems, with a higher level in the hydroponic production system. At the initial seed inoculation level of 3.7 log CFU/g, E. coli O157:H7 populations on the edible part of microgreen plants reached 2.3 and 2.1 log CFU/g (overhead irrigation and bottom irrigation, respectively) for microgreens from the soil-substitute production system and reached 5.7 log CFU/g for those hydroponically grown. At a higher initial inoculation of 5.6 log CFU/g seeds, the corresponding E. coli O157:H7 populations on the edible parts of microgreens grown in these production systems were 3.4, 3.6, and 5.3 log CFU/g, respectively. Examination of the spatial distribution of bacterial cells on different parts of microgreen plants showed that contaminated seeds led to systematic contamination of whole plants, including both edible and inedible parts, and seed coats remained the focal point of E. coli O157:H7 survival and growth throughout the period of microgreen production.

  20. High power 1.57-μm OPO pumped by MOPA with SBS

    Institute of Scientific and Technical Information of China (English)

    Youlun Ju; Baoquan Yao; Sheng Qi

    2005-01-01

    @@ A Nd:YAG master oscillator power amplifier (MOPA) system, pumped by a pulse flash-lamps as the pump source of optical parametric oscillator (OPO), is employed to improve the pump beam quality of OPO pump source. A back amplifying configuration with stimulated Brillouin scattering (SBS) phase conjugation mirror is used. OPO pump laser energy of 611 mJ/pulse with 30-ns pulse duration is obtained, and near diffraction limited beam quality is achieved. Based on the type Ⅱ degenerate non-critically phase-matched KTP crystal, the OPO is used to convert pump beam from 1.064μm to 1.57μm, eye-safe near infrared laser range source. 1.57-μm output energy of 209 mJ/pulse with 18-ns pulse duration is attained with a short cavity KTP OPO, when pump laser energy is approximately 611 mJ. OPO conversion efficiency is up to 38.7% when pump laser energy is approximately 200 mJ.

  1. Corrosion barriers processed by Al electroplating and their resistance against flowing Pb–15.7Li

    Energy Technology Data Exchange (ETDEWEB)

    Krauss, Wolfgang, E-mail: wolfgang.krauss@kit.edu; Konys, Jürgen; Wulf, Sven-Erik

    2014-12-15

    In the HCLL blanket design, ferritic–martensitic steels are in direct contact with the flowing liquid breeder Pb–15.7Li and have to withstand severe corrosion attack. Beyond corrosion, T-permeation from the breeder into the RAFM-steels is also an important issue and has to be reduced significantly. Earlier work showed that Al-based coatings can act as barriers for both, however, applied processes e.g. HDA or VPS exhibited strong drawbacks in the past. Meanwhile new industrial relevant coating processes, using electroplating technology are under development and called ECA (electrochemical aluminization) and ECX (electrochemical deposition from ionic liquids) process. In this study electrochemically Al-coated and heat-treated Eurofer samples were tested in PICOLO loop for exposure times up to 12,000 h (ECA) and 2000 h (first results ECX) respectively to determine corrosion properties in flowing Pb–15.7Li (550 °C, 0.1 m/s). Cross section analysis afterward corrosion testing proved the ability of thin Al-based barriers made by electrochemical techniques to protect the bare Eurofer from corrosion attack even at exposure times of 12,000 h. Determined radial corrosion rates lay between 10 and 20 μm/a. First results for ECX coated samples (2000 h) revealed more homogeneous corrosion behavior of the barrier layer itself compared to ECA.

  2. Evaluation of zoonotic potency of Escherichia coli O157:H7 through arbitrarily primed PCR methods

    Institute of Scientific and Technical Information of China (English)

    I Wayan Suardana; Dyah Ayu Widiasih; I Gusti Ngurah Kade Mahardika; Komang Januartha Putra Pinatih; Budi Setiadi Daryono

    2015-01-01

    Objective:To evaluate the zoonotic potency of Escherichia coli O157:H7 through arbitrarily primed-PCR (AP-PCR) methods as one of the DNA fingerprinting methods. Methods:A total of 14 isolates consisted of 11 isolates originated from human feces with renal failure symptoms, 2 isolates originated from cattle feces, and 1 control isolate were used in this study. DNA of each isolate was extracted, and their profiles were studied by using AP-PCR method with M13 F and M13 R arbitrary primers. Results:The results founded that all of 14 isolates had similarity range from 54.6%to 88.5%. Isolates KL-106(3) and KL-55(6) originated from humans showed the degree of similarity with isolates SM-25(1) and SM-7(1) originated from cattle as high as 85%and 77%, respectively. Conclusions:The high degree of similarity between isolates originated from cattle and human indicated the high potency of zoonoses. The results also concluded AP-PCR method as a briefly fingerprinting method in order to trace the epidemiological of E. coli O157:H7.

  3. Evaluation of zoonotic potency of Escherichia coli O157:H7 through arbitrarily primed PCR methods

    Institute of Scientific and Technical Information of China (English)

    I; Wayan; Suardana; Dyah; Ayu; Widiasih; I; Gusti; Ngurah; Kade; Mahardika; Komang; Januartha; Putra; Pinatih; Budi; Setiadi; Daryono

    2015-01-01

    Objective: To evaluate the zoonotic potency of Escherichia coli O157:H7 through arbitrarily primed-PCR(AP-PCR) methods as one of the DNA fingerprinting methods.Methods: A total of 14 isolates consisted of 11 isolates originated from human feces with renal failure symptoms, 2 isolates originated from cattle feces, and 1 control isolate were used in this study. DNA of each isolate was extracted, and their pro files were studied by using AP-PCR method with M13 F and M13 R arbitrary primers.Results: The results founded that all of 14 isolates had similarity range from 54.6% to88.5%. Isolates KL-106(3) and KL-55(6) originated from humans showed the degree of similarity with isolates SM-25(1) and SM-7(1) originated from cattle as high as 85% and77%, respectively.Conclusions: The high degree of similarity between isolates originated from cattle and human indicated the high potency of zoonoses. The results also concluded AP-PCR method as a brie fly fingerprinting method in order to trace the epidemiological of E. coli O157:H7.

  4. Genomic typing of Escherichia coli O157:H7 by semi-automated fluorescent AFLP analysis.

    Science.gov (United States)

    Zhao, S; Mitchell, S E; Meng, J; Kresovich, S; Doyle, M P; Dean, R E; Casa, A M; Weller, J W

    2000-02-01

    Escherichia coli serotype O157:H7 isolates were analyzed using a relatively new DNA fingerprinting method, amplified fragment length polymorphism (AFLP). Total genomic DNA was digested with two restriction endonucleases (EcoRI and MseI), and compatible oligonucleotide adapters were ligated to the ends of the resulting DNA fragments. Subsets of fragments from the total pool of cleaved DNA were then amplified by the polymerase chain reaction (PCR) using selective primers that extended beyond the adapter and restriction site sequences. One of the primers from each set was labeled with a fluorescent dye, which enabled amplified fragments to be detected and sized automatically on an automated DNA sequencer. Three AFLP primer sets generated a total of thirty-seven unique genotypes among the 48 E. coli O157:H7 isolates tested. Prior fingerprinting analysis of large restriction fragments from these same isolates by pulsed-field gel electrophoresis (PFGE) resulted in only 21 unique DNA profiles. Also, AFLP fingerprinting was successful for one DNA sample that was not typable by PFGE, presumably because of template degradation. AFLP analysis, therefore, provided greater genetic resolution and was less sensitive to DNA quality than PFGE. Consequently, this DNA typing technology should be very useful for genetic subtyping of bacterial pathogens in epidemiologic studies.

  5. Spitzer observations of the N157B supernova remnant and its surroundings

    CERN Document Server

    Micelotta, E R; Israel, F P; 10.1051/0004-6361/200809849

    2009-01-01

    (Aims): We study the LMC interstellar medium in the field of the nebula N157B, which contains a supernova remnant, an OB association, ionized gas, and high-density dusty filaments in close proximity. We investigate the relative importance of shock excitation by the SNR and photo-ionization by the OB stars, as well as possible interactions between the supernova remnant and its environment. (Methods): We apply multiwavelength mapping and photometry, along with spatially resolved infrared spectroscopy, to identifying the nature of the ISM using new infrared data from the Spitzer space observatory and X-ray, optical, and radio data from the literature. (Results): The N157B SNR has no infrared counterpart. Infrared emission from the region is dominated by the compact blister-type HII region associated with 2MASS J05375027-6911071 and excited by an O8-O9 star. This object is part of an extended infrared emission region that is associated with a molecular cloud. We find only weak emission from the shock-indicator [F...

  6. Antibody Microarray for E. coli O157:H7 and Shiga Toxin in Microtiter Plates

    Directory of Open Access Journals (Sweden)

    Andrew G. Gehring

    2015-12-01

    Full Text Available Antibody microarray is a powerful analytical technique because of its inherent ability to simultaneously discriminate and measure numerous analytes, therefore making the technique conducive to both the multiplexed detection and identification of bacterial analytes (i.e., whole cells, as well as associated metabolites and/or toxins. We developed a sandwich fluorescent immunoassay combined with a high-throughput, multiwell plate microarray detection format. Inexpensive polystyrene plates were employed containing passively adsorbed, array-printed capture antibodies. During sample reaction, centrifugation was the only strategy found to significantly improve capture, and hence detection, of bacteria (pathogenic Escherichia coli O157:H7 to planar capture surfaces containing printed antibodies. Whereas several other sample incubation techniques (e.g., static vs. agitation had minimal effect. Immobilized bacteria were labeled with a red-orange-fluorescent dye (Alexa Fluor 555 conjugated antibody to allow for quantitative detection of the captured bacteria with a laser scanner. Shiga toxin 1 (Stx1 could be simultaneously detected along with the cells, but none of the agitation techniques employed during incubation improved detection of the relatively small biomolecule. Under optimal conditions, the assay had demonstrated limits of detection of ~5.8 × 105 cells/mL and 110 ng/mL for E. coli O157:H7 and Stx1, respectively, in a ~75 min total assay time.

  7. Behavior of Escherichia coli O157:H7 in leafy vegetables.

    Science.gov (United States)

    Delaquis, Pascal; Bach, Susan; Dinu, Laura-Dorina

    2007-08-01

    Leafy vegetables, including lettuce and spinach, have been implicated in several outbreaks of foodborne disease caused by Escherichia coli O157:H7, a pathogen of increasing public health significance because of the severity of the gastrointestinal illness and long-term, chronic sequelae that can result from infection. A definitive association between the consumption of leafy vegetables and human disease provides implicit evidence of transfer from animal sources to field crops and retail commodities, including minimally processed or fresh-cut products. Understanding the behavior of E. coli O157:H7 in leafy vegetables during production, after harvest, in storage, during processing, and in packaged fresh-cut products is essential for the development of effective control measures. To this end, previous research on the fate of the species at each step in the production of market-ready leafy vegetables is reviewed in this study. Several critical gaps in knowledge are identified, notably uncertainty about the location of contaminating cells on or in plant tissues, behavior in packaged products stored at low temperatures, and the influence of environmental stresses on growth and infectivity.

  8. THE (UN? FAIRNESS OF FAIR VALUE: SFAS 157, IRVING FISHER AND GECON

    Directory of Open Access Journals (Sweden)

    Paulo Roberto Barbosa Lustosa

    2017-01-01

    Full Text Available Objective: The objective of this study is to assess the level of adherence of explicit and implicit measurement concepts present in SFAS 157 – Fair Value Measurements to traditional economic-accounting concepts. Background: The expansion of situations in which fair value measurement is required makes more difficult to ensure that the computed measure of value is actually fair. Out of the objectivity of current sales prices in an active market, all other measures of value are expectations about the future, inherently uncertain and inaccurate. Thus, the desired justice of the computed figures lies not in its accuracy, but in the using of the correct concepts for measuring accounting transactions and events. Method: To reach the objective, the characteristics of this standard are confronted with the secular concept of capital and income set by the laureate American neoclassical economist Irving Fisher, which were incorporated into Information System for Economic Management (Gecon. Results: The results indicate that SFAS 157 fair value concept and measurement structure are incorrect or incomplete, suggesting that the maintenance of the fair value expression in accounting seems inadequate. Contributions: This paper contributes to the literature on accounting measurement showing that as a measurement concept in accounting fair value seems inadequate. In abnormal situations or absence of a market, the measure found is always inexact and subjective, and therefore is not correct to call fair the quantity resulting from this arbitrary calculation.

  9. Assessment of commercial chromogenic solid media for the detection of non-O157 Shiga toxin-producing Escherichia coli (STEC).

    Science.gov (United States)

    Zelyas, Nathan; Poon, Alan; Patterson-Fortin, Laura; Johnson, Roger P; Lee, Winki; Chui, Linda

    2016-07-01

    Detection of Shiga toxin-producing Escherichia coli (STEC) has evolved significantly since the introduction of sorbitol-MacConkey agar. This study compares four chromogenic media (CHROMagar™ STEC, Rainbow® O157 agar, CHROMagar™ O157, and Colorex® O157) in their identification of non-O157 STEC. When 161 non-O157 STEC were directly inoculated onto each medium, detection rates on CHROMagar™ STEC, Rainbow® O157 agar, CHROMagar™ O157 and Colorex® O157 were 90%, 70%, 3.7% and 6.8%, respectively. Tellurite minimal inhibitory concentrations (MICs) correlated with growth on CHROMagar™ STEC as 20 of 22 isolates with poor or no growth had MICs ≤1μg/mL. Stool spiking experiments revealed that CHROMagar™ STEC had the highest recovery of the six most common non-O157 STEC, ranging from 30% (in mucoid stool) to 98% (in watery stool). When using clinical stool samples, CHROMagar™ STEC had a sensitivity, specificity, positive predictive value, and negative predictive value of 84.6%, 87%, 13.9%, and 99.6%, respectively.

  10. Risk of Escherichia coli O157:H7, Non-O157 Shiga Toxin-Producing Escherichia coli, and Campylobacter spp. in Food Animals and Their Products in Qatar.

    Science.gov (United States)

    Mohammed, Hussni O; Stipetic, Korana; Salem, Ahmed; McDonough, Patrick; Chang, Yung Fu; Sultan, Ali

    2015-10-01

    Escherichia coli O157:H7, non-O157 E. coli, and Campylobacter spp. are among the top-ranked pathogens that threaten the safety of food supply systems around the world. The associated risks and predisposing factors were investigated in a dynamic animal population using a repeat-cross-sectional study design. Animal and environmental samples were collected from dairy and camel farms, chicken processing plants, and abattoirs and analyzed for the presence of these pathogens using a combination of bacterial enrichment and real-time PCR tests without culture confirmation. Data on putative risk factors were also collected and analyzed. E. coli O157:H7 was detected by PCR at higher levels in sheep and camel feces than in cattle feces (odds ratios [OR], 6.8 and 21.1, respectively). Although the genes indicating E. coli O157:H7 were detected at a relatively higher rate (4.3%) in fecal samples from dairy cattle, they were less common in milk and udder swabs from the same animals (1 and 2%, respectively). Among the food adulterants, E. coli O103 was more common in cattle fecal samples, whereas O26 was more common in sheep feces and O45 in camel feces compared with cattle (OR, 2.6 and 3.1, respectively). The occurrence of E. coli in the targeted populations differed by the type of sample and season of the year. Campylobacter jejuni and Campylobacter coli were more common in sheep and camel feces than in cattle feces. Most of the survey and surveillance of E. coli focused on serogroup O157 as a potential foodborne hazard; however, based on the PCR results, non-O157 Shiga toxin-producing E. coli serotypes appeared to be more common, and efforts should be made to include them in food safety programs.

  11. Biofilm formation by Shiga toxin-producing Escherichia coli O157:H7 and Non-O157 strains and their tolerance to sanitizers commonly used in the food processing environment.

    Science.gov (United States)

    Wang, Rong; Bono, James L; Kalchayanand, Norasak; Shackelford, Steven; Harhay, Dayna M

    2012-08-01

    Shiga toxin-producing Escherichia coli (STEC) strains are important foodborne pathogens. Among these, E. coli O157:H7 is the most frequently isolated STEC serotype responsible for foodborne diseases. However, the non-O157 serotypes have been associated with serious outbreaks and sporadic diseases as well. It has been shown that various STEC serotypes are capable of forming biofilms on different food or food contact surfaces that, when detached, may lead to cross-contamination. Bacterial cells at biofilm stage also are more tolerant to sanitizers compared with their planktonic counterparts, which makes STEC biofilms a serious food safety concern. In the present study, we evaluated the potency of biofilm formation by a variety of STEC strains from serotypes O157:H7, O26:H11, and O111:H8; we also compared biofilm tolerance with two types of common sanitizers, a quaternary ammonium chloride-based sanitizer and chlorine. Our results demonstrated that biofilm formation by various STEC serotypes on a polystyrene surface was highly strain-dependent, whereas the two non-O157 serotypes showed a higher potency of pellicle formation at air-liquid interfaces on a glass surface compared with serotype O157:H7. Significant reductions of viable biofilm cells were achieved with sanitizer treatments. STEC biofilm tolerance to sanitization was strain-dependent regardless of the serotypes. Curli expression appeared to play a critical role in STEC biofilm formation and tolerance to sanitizers. Our data indicated that multiple factors, including bacterial serotype and strain, surface materials, and other environmental conditions, could significantly affect STEC biofilm formation. The high potential for biofilm formation by various STEC serotypes, especially the strong potency of pellicle formation by the curli-positive non-O157 strains with high sanitization tolerance, might contribute to bacterial colonization on food contact surfaces, which may result in downstream product

  12. Quantifying exposure to vero-cytotoxigenic Escherichia coli O157 in milk sold as pasteurized: a model-based approach.

    Science.gov (United States)

    Clough, Helen E; Clancy, Damian; French, Nigel P

    2009-05-31

    Milk sold as pasteurized has historically been implicated in the UK and worldwide as a vehicle for outbreaks of food-borne gastrointestinal disease, with a number of causative pathogenic organisms. One such organism is verocytotoxigenic Escherichia coli, or E. coli, O157 (VTEC O157). We present a quantitative assessment of likely exposure to VTEC O157 via milk sold as pasteurized in the UK. Particular interest in our assessment concerns whether there is any differential risk between milk which is processed in on- and off-farm dairies. We model the milk production chain from the farm through to the point of retail and make a comparison between these two production environments. Our model is an example of the Modular Process Risk Modelling (MPRM) approach and represents uncertainty and variability in input parameters using probability distributions. We conclude that milk processed on farm poses the comparatively greater risk, although that risk is still small.

  13. Shape co-existence and structural evolution of the Vi13/2 band in 157Yb

    Institute of Scientific and Technical Information of China (English)

    郑勇; 周小红; 张玉虎; 郭应祥; 雷相国; 刘忠; 刘敏良; 罗万居; 温书贤; 竺礼华; 杨春祥

    2003-01-01

    The high-spin states of 157Yb have been studied via the reaction of 144Sm(16O, 3n) at 16O energy of 90 MeV using techniques of in-beam γ-ray spectroscopy. Measurement of γ-γ-t coincidences was performed with 11 BGO(AC)HPGe detectors. Based on the γ-γ coincidence relationships and the measured results of γ-ray anisotropies and DCO ratios, the level scheme for 157Yb was established. The shape co-existence and structural evolution of the Vi13/2 band with increasing angular momentum in 157Yb have been discussed. The systematics of the Vi13/2 bands in the N = 87 odd-A isotones have been compared.

  14. Efficacy of (+-Lariciresinol to Control Bacterial Growth of Staphylococcus aureus and Escherichia coli O157:H7

    Directory of Open Access Journals (Sweden)

    Vivek K. Bajpai

    2017-05-01

    Full Text Available This study was undertaken to assess the antibacterial potential of a polyphenolic compound (+-lariciresinol isolated from Rubia philippinensis against selected foodborne pathogens Staphylococcus aureus KCTC1621 and Escherichia coli O157:H7. (+-Lariciresinol at the tested concentrations (250 μg/disk evoked a significant antibacterial effect as a diameter of inhibition zones (12.1–14.9 mm with minimum inhibitory concentration (MIC, and minimum bactericidal concentration values of 125–250 and 125–250 μg/mL, respectively. Furthermore, (+-lariciresinol at MIC showed reduction in bacterial cell viabilities, efflux of potassium (K+ ions and release of 260 nm materials against E. coli O157:H7 and S. aureus KCTC1621. Moreover, deteriorated cell wall morphology of E. coli O157:H7 and S. aureus KCTC1621 cells treated with (+-lariciresinol at MIC further confirmed its inhibitory effect against the tested pathogens, suggesting it to be an alternative means of antimicrobials.

  15. Combining risk assessment and epidemiological risk factors to elucidate the sources of human E. coli O157 infection.

    Science.gov (United States)

    Rotariu, O; Ogden, I D; MacRitchie, L; Forbes, K J; Williams, A P; Cross, P; Hunter, C J; Teunis, P F M; Strachan, N J C

    2012-08-01

    E. coli O157 can be transmitted to humans by three primary (foodborne, environmental, waterborne) and one secondary (person-to-person transmission) pathways. A regression model and quantitative microbiological risk assessments (QMRAs) were applied to determine the relative importance of the primary transmission pathways in NE Scotland. Both approaches indicated that waterborne infection was the least important but it was unclear whether food or the environment was the main source of infection. The QMRAs over-predicted the number of cases by a factor of 30 and this could be because all E. coli O157 strains may not be equally infective and/or the level of infectivity in the dose-response model was too high. The efficacy of potential risk mitigation strategies to reduce human exposure to E. coli O157 using QMRAs was simulated. Risk mitigation strategies focusing on food and environment are likely to have the biggest impact on infection figures.

  16. Modeling the fate of Escherichia coli O157:H7 and Salmonella enterica in the agricultural environment: current perspective.

    Science.gov (United States)

    Ongeng, Duncan; Haberbeck, Leticia U; Mauriello, Gianluigi; Ryckeboer, Jaak; Springael, Dirk; Geeraerd, Annemie H

    2014-04-01

    The significance of fresh vegetable consumption on human nutrition and health is well recognized. Human infections with Escherichia coli O157:H7 and Salmonella enterica linked to fresh vegetable consumption have become a serious public health problem inflicting a heavy economic burden. The use of contaminated livestock wastes such as manure and manure slurry in crop production is believed to be one of the principal routes of fresh vegetable contamination with E. coli O157:H7 and S. enterica at preharvest stage because both ruminant and nonruminant livestock are known carriers of E. coli O157:H7 and S. enterica in the environment. A number of challenge-testing studies have examined the fate of E. coli O157:H7 and S. enterica in the agricultural environment with the view of designing strategies for controlling vegetable contamination preharvest. In this review, we examined the mathematical modeling approaches that have been used to study the behavior of E. coli O157:H7 and S. enterica in the manure, manure-amended soil, and in manure-amended soil-plant ecosystem during cultivation of fresh vegetable crops. We focused on how the models have been applied to fit survivor curves, predict survival, and assess the risk of vegetable contamination preharvest. The inadequacies of the current modeling approaches are discussed and suggestions for improvements to enhance the applicability of the models as decision tools to control E. coli O157:H7 and S. enterica contamination of fresh vegetables during primary production are presented.

  17. Efficacy of gamma radiation and aqueous chlorine on Escherichia coli O157:H7 in hydroponically grown lettuce plants.

    Science.gov (United States)

    Nthenge, Agnes K; Weese, Jean S; Carter, Melvin; Wei, Cheng-I; Huang, Tung-Shi

    2007-03-01

    Interaction of Escherichia coli O157:H7/pGFP with hydroponically grown lettuce plants was evaluated in this study. Lettuce seedlings were planted in contaminated Hoagland's nutrient solution and thereafter subjected to gamma radiation at 0.25, 0.5, and 0.75 kGy, and aqueous chlorine at 200 ppm. There was no trace of E. coli O157:H7/pGFP in lettuce leaves harvested from noncontaminated nutrient solution (control); however, for plants grown in contaminated nutrient solution, the pathogen was recovered from the leaves disinfected with 80% ethanol and 0.1% mercuric chloride. Most of the lettuce seedlings grown in contaminated nutrient solution tested negative for E. coli O157:H7/pGFP under controlled conditions. Gamma radiation at 0.25 and 0.5 kGy, and aqueous chlorine at 200 ppm failed to eliminate E. coli O157:H7/pGFP in lettuce tissue completely; however, the bacteria were not detected in 0.75-kGy treated plants. The presence of E. coli O157:H7/pGFP in lettuce leaves is an indication that the pathogen migrated from the contaminated hydroponic system through the roots to the internal locations of lettuce tissue. Due to inaccessibility and limited penetrating power, aqueous chlorine could not eliminate the bacteria localized in the internal tissue. Findings from this study suggest that gamma irradiation was more efficacious than was aqueous chlorine to control internal contamination in hydroponically grown lettuce. Gamma irradiation is a process that processors can use to inactivate E. coli O157:H7 and therefore, consumers benefit from a safer food product [corrected

  18. Bacteriophages reduce experimental contamination of hard surfaces, tomato, spinach, broccoli, and ground beef by Escherichia coli O157:H7.

    Science.gov (United States)

    Abuladze, Tamar; Li, Manrong; Menetrez, Marc Y; Dean, Timothy; Senecal, Andre; Sulakvelidze, Alexander

    2008-10-01

    A bacteriophage cocktail (designated ECP-100) containing three Myoviridae phages lytic for Escherichia coli O157:H7 was examined for its ability to reduce experimental contamination of hard surfaces (glass coverslips and gypsum boards), tomato, spinach, broccoli, and ground beef by three virulent strains of the bacterium. The hard surfaces and foods contaminated by a mixture of three E. coli O157:H7 strains were treated with ECP-100 (test samples) or sterile phosphate-buffered saline buffer (control samples), and the efficacy of phage treatment was evaluated by comparing the number of viable E. coli organisms recovered from the test and control samples. Treatments (5 min) with the ECP-100 preparation containing three different concentrations of phages (10(10), 10(9), and 10(8) PFU/ml) resulted in statistically significant reductions (P = E. coli O157:H7 organisms recovered from the glass coverslips. Similar treatments resulted in reductions of 100%, 95%, and 85%, respectively, in the number of E. coli O157:H7 organisms recovered from the gypsum board surfaces; the reductions caused by the two most concentrated phage preparations were statistically significant. Treatment with the least concentrated preparation that elicited significantly less contamination of the hard surfaces (i.e., 10(9) PFU/ml) also significantly reduced the number of viable E. coli O157:H7 organisms on the four food samples. The observed reductions ranged from 94% (at 120 +/- 4 h posttreatment of tomato samples) to 100% (at 24 +/- 4 h posttreatment of spinach samples). The data suggest that naturally occurring bacteriophages may be useful for reducing contamination of various hard surfaces, fruits, vegetables, and ground beef by E. coli O157:H7.

  19. Screening of the novel colicinogenic gram-negative rods against pathogenic Escherichia coli O157:H7

    Directory of Open Access Journals (Sweden)

    H Mushtaq

    2015-01-01

    Full Text Available Purpose: Escherichia coli (E. coli O157:H7 is gram-negative enteric pathogen producing different types of Shiga toxin. This bacterium is the most corporate cause of haemorrhagic colitis in human. Administration of antibiotics (particularly sulfa drugs against this pathogen is a debatable topic as this may increase the risk of uremic syndrome; especially in children and aged people. Around the world, microbiologists are in search of alternative therapeutic methods specially probiotics against this pathogen. In the present study, we have focused on the investigation of alternate bio-therapeutics (probiotics for the treatment of patients infected with E. coli O157:H7. This study is based on the identification of colicin-producing gram-negative bacteria (particularly enterobacteriaceae which can competently exclude E. coli O157:H7 from the gut of the infected individual. Materials and Methods: Hundred samples from human, animal faeces and septic tank water were analysed for nonpathogenic gram-negative rods (GNRs. Results: Out of these samples, 175 isolates of GNRs were checked for their activity against E. coli O157:H7. Only 47 isolates inhibited the growth of E. coli O157:H7, among which majority were identified as E. coli. These E. coli strains were found to be the efficient producers of colicin. Some of the closely related species i. e., Citrobacter sp, Pantoea sp. and Kluyvera sp. also showed considerable colicinogenic activity. Moreover, colicinogenic species were found to be nonhaemolytic, tolerant to acidic environment (pH 3 and sensitive to commonly used antibiotics. Conclusion: Nonhaemolytic, acid tolerant and sensitive to antibiotics suggests the possible use of these circulating endothelial cells (CEC as inexpensive and inoffensive therapeutic agent (probiotics in E. coli O157:H7 infections.

  20. VUV 157nm laser ablation of spherical particles and modelling of whispering gallery mode optical antenna structures

    Energy Technology Data Exchange (ETDEWEB)

    Walton, C. D.; Cockcroft, S.; Metheringham, W. J. [Department of Physics, University of Hull, HU6 7RX (United Kingdom)

    2012-07-30

    We report on VUV 157nm F{sub 2} laser irradiation of CR-39 polymer substrates that have been intentionally seeded with spherical glass particles. We discuss the importance of adhesive forces for realizing spherical cavity structures by laser ablation. Strong optical absorption at 157nm in CR-39 enables precise control of pedestal height by controlling the laser fluence and the number of laser pulses. Resonant modes for free-standing spherical cavities have been calculated and we discuss briefly the potential applications for use as optical sources on-board lab-on-chip devices.

  1. Regional variation in the prevalence of E. coli O157 in cattle: a meta-analysis and meta-regression.

    Directory of Open Access Journals (Sweden)

    Md Zohorul Islam

    Full Text Available Escherichia coli O157 (EcO157 infection has been recognized as an important global public health concern. But information on the prevalence of EcO157 in cattle at the global and at the wider geographical levels is limited, if not absent. This is the first meta-analysis to investigate the point prevalence of EcO157 in cattle at the global level and to explore the factors contributing to variation in prevalence estimates.Seven electronic databases- CAB Abstracts, PubMed, Biosis Citation Index, Medline, Web of Knowledge, Scirus and Scopus were searched for relevant publications from 1980 to 2012. A random effect meta-analysis model was used to produce the pooled estimates. The potential sources of between study heterogeneity were identified using meta-regression.A total of 140 studies consisting 220,427 cattle were included in the meta-analysis. The prevalence estimate of EcO157 in cattle at the global level was 5.68% (95% CI, 5.16-6.20. The random effects pooled prevalence estimates in Africa, Northern America, Oceania, Europe, Asia and Latin America-Caribbean were 31.20% (95% CI, 12.35-50.04, 7.35% (95% CI, 6.44-8.26, 6.85% (95% CI, 2.41-11.29, 5.15% (95% CI, 4.21-6.09, 4.69% (95% CI, 3.05-6.33 and 1.65% (95% CI, 0.77-2.53, respectively. Between studies heterogeneity was evidenced in most regions. World region (p<0.001, type of cattle (p<0.001 and to some extent, specimens (p = 0.074 as well as method of pre-enrichment (p = 0.110, were identified as factors for variation in the prevalence estimates of EcO157 in cattle.The prevalence of the organism seems to be higher in the African and Northern American regions. The important factors that might have influence in the estimates of EcO157 are type of cattle and kind of screening specimen. Their roles need to be determined and they should be properly handled in any survey to estimate the true prevalence of EcO157.

  2. Survival of escherichia coli o157:h7 co-cultured with different levels of pseudomonas fluorescens and lactobacillus plantarum on fresh beef

    Directory of Open Access Journals (Sweden)

    P. A. Tshabalala

    2012-12-01

    Full Text Available The purpose of this study was to investigate the effect of different levels of Pseudomonas fluorescens (10² and 10(6log10 cfu/mland Lactobacillus plantarum (10² and 10(4log10 cfu/mlon the growth of Escherichia coli O157:H7 on beef loins. Beef loins inoculated with E. coli O157:H7 and P. fluorescens were aerobically stored for 7 days at 4 ºC, while those inoculated with E. coli O157:H7 and L. plantarum were vacuum packaged and stored for 8 weeks at 4 ºC. Aerobic Plate Counts (APC, E. coli O157:H7 and either P. fluorescens or L. plantarum counts were determined at different storage intervals. For the aerobically packaged beef loins, E. coli O157:H7 was detected throughout the 7 day storage period regardless of the P. fluorescens level in the inoculum. For the vacuum packaged beef loins, similar inoculum levels of E. coli O157:H7 and L. plantarum allowed E. coli O157:H7 to survive until week 5 of storage, while a higher inoculum level of L. plantarum inhibited E. coli O157:H7 from week 3. Once fresh beef has been contaminated with E. coli O157:H7, the level of P. fluorescens in the background flora does not inhibit its survival and growth. However, under vacuum storage, the application of L. plantarum as a biopreservative inhibits the survival of E. coli O157:H7 on beef. The higher the level of L. plantarum in the system, the earlier the onset of the inhibition. Farmers and abattoirs have to strengthen preventive strategies to eliminate contamination of beef carcasses with E. coli O157:H7.

  3. Characterizing the Escherichia coli O157:H7 proteome including protein associations with higher order assemblies.

    Directory of Open Access Journals (Sweden)

    Rembert Pieper

    Full Text Available BACKGROUND: The recent outbreak of severe infections with Shiga toxin (Stx producing Escherichia coli (STEC serotype O104:H4 highlights the need to understand horizontal gene transfer among E. coli strains, identify novel virulence factors and elucidate their pathogenesis. Quantitative shotgun proteomics can contribute to such objectives, allowing insights into the part of the genome translated into proteins and the connectivity of biochemical pathways and higher order assemblies of proteins at the subcellular level. METHODOLOGY/PRINCIPAL FINDINGS: We examined protein profiles in cell lysate fractions of STEC strain 86-24 (serotype O157:H7, following growth in cell culture or bacterial isolation from intestines of infected piglets, in the context of functionally and structurally characterized biochemical pathways of E. coli. Protein solubilization in the presence of Triton X-100, EDTA and high salt was followed by size exclusion chromatography into the approximate M(r ranges greater than 280 kDa, 280-80 kDa and 80-10 kDa. Peptide mixtures resulting from these and the insoluble fraction were analyzed by quantitative 2D-LC-nESI-MS/MS. Of the 2521 proteins identified at a 1% false discovery rate, representing 47% of all predicted E. coli O157:H7 gene products, the majority of integral membrane proteins were enriched in the high M(r fraction. Hundreds of proteins were enriched in a M(r range higher than that predicted for a monomer supporting their participation in protein complexes. The insoluble STEC fraction revealed enrichment of aggregation-prone proteins, including many that are part of large structure/function entities such as the ribosome, cytoskeleton and O-antigen biosynthesis cluster. SIGNIFICANCE: Nearly all E. coli O157:H7 proteins encoded by prophage regions were expressed at low abundance levels or not detected. Comparative quantitative analyses of proteins from distinct cell lysate fractions allowed us to associate uncharacterized

  4. Potential immunosuppressive effects of Escherichia coli O157:H7 experimental infection on the bovine host.

    Science.gov (United States)

    Kieckens, E; Rybarczyk, J; Li, R W; Vanrompay, D; Cox, E

    2016-12-21

    Enterohaemorrhagic Escherichia coli (EHEC), like E. coli O157:H7 are frequently detected in bovine faecal samples at slaughter. Cattle do not show clinical symptoms upon infection, but for humans the consequences after consuming contaminated beef can be severe. The immune response against EHEC in cattle cannot always clear the infection as persistent colonization and shedding in infected animals over a period of months often occurs. In previous infection trials, we observed a primary immune response after infection which was unable to protect cattle from re-infection. These results may reflect a suppression of certain immune pathways, making cattle more prone to persistent colonization after re-infection. To test this, RNA-Seq was used for transcriptome analysis of recto-anal junction tissue and ileal Peyer's patches in nine Holstein-Friesian calves in response to a primary and secondary Escherichia coli O157:H7 infection with the Shiga toxin (Stx) negative NCTC12900 strain. Non-infected calves served as controls. In tissue of the recto-anal junction, only 15 genes were found to be significantly affected by a first infection compared to 1159 genes in the ileal Peyer's patches. Whereas, re-infection significantly changed the expression of 10 and 17 genes in the recto-anal junction tissue and the Peyer's patches, respectively. A significant downregulation of 69 immunostimulatory genes and a significant upregulation of seven immune suppressing genes was observed. Although the recto-anal junction is a major site of colonization, this area does not seem to be modulated upon infection to the same extent as ileal Peyer's patches as the changes in gene expression were remarkably higher in the ileal Peyer's patches than in the recto-anal junction during a primary but not a secondary infection. We can conclude that the main effect on the transcriptome was immunosuppression by E. coli O157:H7 (Stx(-)) due to an upregulation of immune suppressive effects (7/12 genes) or a

  5. Non-O157 Shiga toxin-producing Escherichia coli in U. S. retail ground beef.

    Science.gov (United States)

    Liao, Yen-Te; Miller, Markus F; Loneragan, Guy H; Brooks, J Chance; Echeverry, Alejandro; Brashears, Mindy M

    2014-07-01

    Shiga toxin-producing Escherichia coli (STEC) serotype O157:H7 and serogroups O26, O45, O103, O111, O121, and O145 are the leading cause of STEC-associated infections in humans in the United States. In the United States, these organisms are considered adulterants in raw nonintact beef products and in intact beef destined to be made into or used in nonintact raw beef products. The objective of this study was to provide an estimate of the burden of the six serogroups of non-O157 STEC in ground beef obtained from retail stores across the United States. A convenience sample of commercial ground beef products (n = 1,129) were purchased from retail stores in 24 states from October 2011 to May 2012. The samples had various lean/fat proportions, muscle group of origin (chuck, round, sirloin, or not specified), and packaging types. For each ground beef sample, 25 g was inoculated in 225 ml of modified tryptic soy broth, stomached for 1 min, and then incubated at 41°C for 18 ± 2 h. These enrichment cultures were then screened for stx, eae, and O group genes using a commercially available, closed-platform PCR-based method. The potential positive samples were subjected to immunomagnetic separation and plated on modified Rainbow agar. Morphologically typical colonies were subjected to latex agglutination and PCR determination of stx and eae genes. Nine (0.8%) of the ground beef samples were potentially positive for at least one STEC serogroup after PCR screening. The serogroups detected by PCR assay were O26 (four samples), O103 (four samples), O145 (three samples), O45 (two samples), and O121 (one sample). No STEC isolates belonging to these serogroups were recovered from the sample cultures. The current research provides updated surveillance data for non-O157 STEC isolates among commercial ground beef products and information regarding the potential sources of contamination from different parts of beef trims destined for ground beef production.

  6. Design and evaluation of two-stage multiplex real-time PCR method for detecting O157:H7 and non-O157 STEC strains from beef samples

    Science.gov (United States)

    Introduction: E. coli O157:H7 was first recognized as a human pathogen in 1982 and until recently was the only E. coli strain mandated for testing by the USDA. In June 2012, the USDA declared six additional Shiga-toxin producing E. coli serogroups (O26, O45, O103, O111, O121, and O145) as adulterant...

  7. Escherichia coli O157:H7 strains isolated from High-Event Period beef contamination have strong biofilm-forming ability and low sanitizer susceptibility, which are associated with high pO157 plasmid copy number

    Science.gov (United States)

    In the meat industry, a “High Event Period” (HEP) is defined as a time period when beef processing establishments experience an increased occurrence of product contamination by E. coli O157:H7. Our previous studies suggested that bacterial biofilm formation and sanitizer resistance might contribute...

  8. Immunoconcentration of Shiga toxin-producing Escherichia coli O157 from animal faeces and raw meats by using Dynabeads anti-E. coli O157 and the VIDAS system

    NARCIS (Netherlands)

    Islam, M.A.; Heuvelink, A.E.; Talukder, K.A.; Boer, de E.

    2006-01-01

    To identify the reservoirs and routes of transmission of Shiga toxin-producing Escherichia coli (STEC) O157, sensitive detection and isolation methods are necessary. The sensitivity of traditional culture methods can be improved significantly by the inclusion of an immunoconcentration step, resultin

  9. Vigilancia de Escherichia coli O157: H7 en alimentos y aguas

    OpenAIRE

    Guerrero Barrantes, César; Facultad de Tecnología Médica. Universidad Nacional Federico Villarreal. Calle Río Chepén s/n. El Agustino. Lima - Perú.; Guillén Oneeglio, Alfredo; Facultad de Tecnología Médica. Universidad Nacional Federico Villarreal. Calle Río Chepén s/n. El Agustino. Lima - Perú.; Rojas León, Roberto; Facultad de Tecnología Médica. Universidad Nacional Federico Villarreal. Calle Río Chepén s/n. El Agustino. Lima - Perú.

    2015-01-01

    Los alimentos como la carne molida de vacuno, queso, jamón y lechuga son de alta demanda de consumo por la población y son susceptibles de contaminación. Así mismo, las aguas de los ríos son usadas por pobladores de las riberas. En nuestro medio, no contamos con reportes sobre estudios de vigilancia de E. coli O157:H7 en muestras de aguas del río Rímac este, ni en alimentos en los mercados de Lima. Para la evaluación de alimentos se procedió como lo describe Feng & Weagant (2002) y para a...

  10. Control of Escherichia coli O157:H7 in contaminated alfalfa silage: Effects of silage additives.

    Science.gov (United States)

    Ogunade, I M; Kim, D H; Jiang, Y; Weinberg, Z G; Jeong, K C; Adesogan, A T

    2016-06-01

    This study was conducted to examine if adding microbial inoculants or propionic acid to alfalfa silages contaminated with Escherichia coli O157:H7 would inhibit the growth of the pathogen during or after ensiling. Alfalfa forage was harvested at the early bloom stage, wilted to a dry matter concentration of 54%, chopped to 19-mm lengths, and ensiled after treatment with one of the following: (1) distilled water (control); (2) 1×10(5) cfu/g of E. coli O157:H7 (EC); (3) EC and 1×10(6) cfu/g of Lactobacillus plantarum (EC+LP); (4) EC and 1×10(6) cfu/g of Lactobacillus buchneri (EC+LB); and (5) EC and 2.2g/kg of propionic acid (EC+PA). Each treatment was ensiled in quadruplicate in laboratory silos for 0, 3, 7, 16, and 100d and analyzed for EC counts, pH, and organic acids. In addition, samples from d 100 were analyzed for chemical composition, ammonia-N, counts of yeasts and molds, and aerobic stability. Escherichia coli O157:H7 was detected in all silages until d 7, but by d 16 it was not detected in those treated with EC+LB and EC+LP, though it was still detected in EC and EC+PA silages. However, by d 100, the pathogen was not detected in any silage. The rate of pH decrease to 5.0 was fastest for the EC+LP silage (7d), followed by the EC+LB silage (16d). Nevertheless, all silages had attained a pH of or less than 5.0 by d 100. The rapid decrease in pH in EC+LP and EC+LB silages was observed due to higher lactate and acetate concentrations, respectively, relative to the other silages during the early fermentation phase (d 3-16). Propionic acid was only detected in the EC+PA silage. Yeast counts were lowest in EC+LB and EC+PA silages. Subsamples of all d-100 silages were reinoculated with 1×10(5) cfu/g of EC immediately after silo opening. When the pathogen was subsequently enumerated after 168h of aerobic exposure, it was not detected in silages treated with EC+PA, EC+LB, or EC+LP, which all had pH values less than 5.0. Whereas the EC silage had a pH value of 5

  11. Prolonged and mixed non-O157 Escherichia coli infection in an Australian household.

    Science.gov (United States)

    Staples, M; Graham, R M A; Doyle, C J; Smith, H V; Jennison, A V

    2012-05-01

    An Australian family was identified through a Public Health follow up on a Shiga-toxigenic Escherichia coli (STEC) positive bloody diarrhoea case, with three of the four family members experiencing either symptomatic or asymptomatic STEC shedding. Bacterial isolates were submitted to stx sequence sub-typing, multi-locus variable number tandem repeat analysis (MLVA), multi-locus sequence typing (MLST) and binary typing. The analysis revealed that there were multiple strains of STEC being shed by the family members, with similar virulence gene profiles and the same serogroup but differing in their MLVA and MLST profiles. This study illustrates the potentially complicated nature of non-O157 STEC infections and the importance of molecular epidemiology in understanding disease clusters.

  12. Planar waveguide Michelson interferometer fabricated by using 157nm mask laser micromachining

    Science.gov (United States)

    Bao, Haihong; Ran, Zengling; Wu, Xuezhong; Yang, Ke; Jiang, Yuan; Rao, Yunjiang

    2015-07-01

    A Michelson interferometer is fabricated on silica planar waveguide by using the one-step technology based on 157nm mask laser micromachining. The fabrication time for one device is ~10s. Experimental results show that such an interferometer has an excellent fringe contrast of >20dB. Its temperature and refractive index (RI) responses are tested by observing the wavelength shift of the interferometric fringes, which shows linear characteristics with a thermo-coefficient of ~9.5pm/°C and a RI-coefficient of ~36.7nm/RIU, respectively. The fabrication technology may pave a new way for direct writing of planar silica waveguide devices for sensing applications with high efficiency and quality.

  13. WASP-157b, a Transiting Hot Jupiter Observed with K2

    CERN Document Server

    Močnik, T; Brown, D J A; Cameron, A Collier; Delrez, L; Gillon, M; Hellier, C; Jehin, E; Lendl, M; Maxted, P F L; Neveu-VanMalle, M; Pepe, F; Pollacco, D; Queloz, D; Ségransan, D; Smalley, B; Southworth, J; Triaud, A H M J; Udry, S; West, R G

    2016-01-01

    We announce the discovery of the transiting hot Jupiter WASP-157b in a 3.95-d orbit around a V = 12.9 G2 main-sequence star. This moderately inflated planet has a Saturn-like density with a mass of $0.57 \\pm 0.10$ M$_{\\rm Jup}$ and radius $1.04 \\pm 0.04$ R$_{\\rm Jup}$. The small projected stellar rotational velocity of $1.0 \\pm 0.9$ km s$^{-1}$ suggests that the host star is a slow rotator or that the star rotates close to pole-on. We do not detect any rotational or phase-curve modulations, nor the secondary eclipse, with conservative semi-amplitude upper limits of 250 and 30 ppm, respectively.

  14. Measured Thermal and Fast Neutron Fluence Rates for ATF-1 Holders During ATR Cycle 157D

    Energy Technology Data Exchange (ETDEWEB)

    Smith, Larry Don [Idaho National Lab. (INL), Idaho Falls, ID (United States); Miller, David Torbet [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2016-03-01

    This report contains the thermal (2200 m/s) and fast (E>1MeV) neutron fluence rate data for the ATF-1 holders located in core for ATR Cycle 157D which were measured by the Radiation Measurements Laboratory (RML) as requested by the Power Reactor Programs (ATR Experiments) Radiation Measurements Work Order. This report contains measurements of the fluence rates corresponding to the particular elevations relative to the 80-ft. core elevation. The data in this report consist of (1) a table of the ATR power history and distribution, (2) a hard copy listing of all thermal and fast neutron fluence rates, and (3) plots of both the thermal and fast neutron fluence rates. The fluence rates reported are for the average power levels given in the table of power history and distribution.

  15. Factors Affecting the Production of Aromatic Immonium Ions in MALDI 157 nm Photodissociation Studies

    Science.gov (United States)

    DeGraan-Weber, Nick; Ashley, Daniel C.; Keijzer, Karlijn; Baik, Mu-Hyun; Reilly, James P.

    2016-05-01

    Immonium ions are commonly observed in the high energy fragmentation of peptide ions. In a MALDI-TOF/TOF mass spectrometer, singly charged peptides photofragmented with 157 nm VUV light yield a copious abundance of immonium ions, especially those from aromatic residues. However, their intensities may vary from one peptide to another. In this work, the effect of varying amino acid position, peptide length, and peptide composition on immonium ion yield is investigated. Internal immonium ions are found to have the strongest intensity, whereas immonium ions arising from C-terminal residues are the weakest. Peptide length and competition among residues also strongly influence the immonium ion production. Quantum calculations provide insights about immonium ion structures and the fragment ion conformations that promote or inhibit immonium ion formation.

  16. Production of Shiga-like toxins by Escherichia coli O157:H7: Effects of other bacteria and analogues of quorum sensing molecules

    Science.gov (United States)

    During the growth of Escherichia coli O157:H7, shiga-like toxins are produced. Time course studies indicated that the accumulation of toxins in the medium occurrs mainly at the stationary phase of cell growth. The growth of E. coli O157:H7 in culture media was not significantly affected by the pre...

  17. Phenotypic and genotypic characterization of sorbitol-negative of slow-fermenting (suspected O157) Escherichia coli isolated from milk samples in Lombardy region

    NARCIS (Netherlands)

    Picozzi, C.; Foschino, R.; Heuvelink, A.E.; Beumer, R.R.

    2005-01-01

    Aims: To investigate phenotypic and genotypic aspects of sorbitol-negative or slow-fermenting Escherichia coli, suspected to belong to O157 serogroup, isolated in Italy. Methods and Results: Milk samples originating from goats and cows were screened for the presence of E. coli O157 with cultural met

  18. Application of polylactic acid coating with antimicrobials in reduction of Escherichia coli O157:H7 and Salmonella stanley on apples

    Science.gov (United States)

    Survival of Escherichia coli O157:H7 and Salmonella Stanley on apples as affected by application of an antimicrobial polylactic acid (PLA) coating were investigated. Golden Delicious apples were spot inoculated with E. coli O157:H7 or S. Stanley and spray coated with PLA/solvent solutions containing...

  19. Fate of naturally occurring Escherichia coli O157:H7 and other zoonotic pathogens during minimally managed bovine feedlot manure composting processes

    Science.gov (United States)

    Reducing Escherichia coli O157:H7 in livestock manures before application to cropland is critical for reducing the risk of foodborne illness associated with produce. Our objective was to determine the fate of naturally occurring E. coli O157:H7 and other pathogens during minimally managed on-farm bo...

  20. A novel approach to investigate the uptake and internalization of Escherichia coli O157:H7 in spinach cultivated in soil and hydroponic media

    Science.gov (United States)

    Internalization of E. coli O157:H7 into spinach plants through root uptake is a potential route of contamination. A Tn7-based plasmid vector was used to insert the green fluorescent protein (gfp) gene into the attTn7 site in the E. coli chromosome. Three gfp-labeled E. coli inocula, O157:H7 strains ...

  1. Fate of Escherichia coli O157:H7 in manure and amended soil: effects of cattle feeding, manure type and dairy management

    NARCIS (Netherlands)

    Franz, E.; Diepeningen, van A.D.; Visser, A.A.; Blok, W.J.; Bruggen, van A.H.C.

    2005-01-01

    In the present study, we studied the effect of cattle diet on the survival of E. coli O157:H7 in manure from dairy cattle subjected to 6 different feeding regimes consisting of 3 different roughage types and 2 levels of crude protein concentrates. In addition, the rate of survival of E. coli O157:H7

  2. Assessing the relative contributions of EspA and CsgA in cellular adherence and biofilm formation of enterohemorrhagic Escherichia coli O157:H7

    Science.gov (United States)

    In enterohemorrhagic Escherichia coli O157:H7 (O157), the locus of enterocyte effacement (LEE) encodes a type III secretion system with an extracellular filamentous structure consisting of the polymerized translocator protein EspA. The EspA filaments provide transient interactions between bacterial ...

  3. Sensitivity of pathogenic and attenuated E. coli O157:H7 strains to ultraviolet-C light as assessed by conventional plating methods and ethidium monoazide-PCR

    Science.gov (United States)

    In this study, the UV-C sensitivity of six pathogenic E. coli O157:H7 strains associated with recent outbreaks of foodborne illnesses and four attenuated E. coli O157:H7 strains was investigated. Futhermore, the mechanism of UV-C impact on two pathogenic E. coli strains with different UV-C sensitiv...

  4. Role of curli and contamination level on Escherichia coli O157:H7 internalization into organic spinach plants grown on hydroponics and in soil

    Science.gov (United States)

    Introduction: E. coli O157:H7 may be internalized into organic leafy greens via root uptake. Understanding the mechanisms of E. coli O157:H7 internalization into organic leafy greens is important as produce wash treatment may not remove internalized pathogens. Purpose: The internalization potential...

  5. Complete genome sequences of Escherichia coli O157:H7 strains SRCC 1675 and 28RC that vary in acid resistance

    Science.gov (United States)

    The level of acid resistance among Escherichia coli O157:H7 strains varies, and strains with higher resistance to acid may have a lower infectious dose. The complete genome sequences belonging to two strains of Escherichia coli O157:H7 with different levels of acid resistance are presented....

  6. The use of a novel nanoLuc-based reporter phage for the detection of Escherichia coli O157:H7

    Science.gov (United States)

    Rapid detection of the foodborne pathogen Escherichia coli O157:H7 is of vital importance for public health worldwide. Among detection methods, reporter phages represent unique and sensitive tools for the detection of E. coli O157:H7 from food, as they are host-specific and able to differentiate liv...

  7. Evaluation of bacteriophage application to cattle in lairage at beef processing plants to reduce Escherichia coli O157:H7 prevalence on hides and carcasses

    Science.gov (United States)

    Escherichia coli O157:H7 is a major food safety concern for the beef industry. Several studies have provided evidence that cattle hides are the main source of beef carcass contamination during processing and that reductions in the E. coli O157:H7 load on the hides of cattle entering processing faci...

  8. Hha controls Escherichia coli O157:H7 biofilm formation by differential regulation of global transcriptional regulators FlhDC and CsgD

    Science.gov (United States)

    Enterohemorrhagic Escherichia coli (EHEC) O157:H7 is a zoonotic pathogen that produces a broad-spectrum of diarrheal illnesses in infected humans. Although molecular mechanisms enabling EHEC O157:H7 to produce characteristic adherence on epithelial cells are well characterized, regulatory mechanisms...

  9. Effectiveness of lytic bacteriophages in reducing E. coli O157:H7 populations introduced through cross-contamination on fresh cut lettuce

    Science.gov (United States)

    Previous research has shown that lytic bacteriophages (phages) can kill E. coli O157:H7 on produce surfaces. The role of lytic bacteriophages in preventing cross contamination of produce has not been evaluated. A cocktail of three lytic phages specific for E. coli O157:H7 (EcoShield) at 10^8 PFU/m...

  10. Incorporation of Escherichia coli O157:H7 in biofilms with Ralstonia insidiosa, a primary localizer for the development of heterogeneous biofilms

    Science.gov (United States)

    It is hypothesized that the presence of strong biofilm forming microflora could potentially enhance the survival of Escherichia coli O157:H7 (EcO157) in harsh environment. In this study, a strong biofilm forming bacterium, Ralstonia insidiosa, previously isolated from a fresh-cut produce plant was c...

  11. Anxiety- and depression-like behavior in mice lacking the CD157/BST1 gene, a risk factor for Parkinson’s disease

    Directory of Open Access Journals (Sweden)

    Olga eLopatina

    2014-04-01

    Full Text Available CD157, known as bone marrow stromal cell antigen-1, is a glycosylphosphatidylinositol-anchored ADP-ribosyl cyclase that supports the survival and function of B-lymphocytes and hematopoietic or intestinal stem cells. Although CD157/Bst1 is a risk locus in Parkinson’s disease (PD, little is known about the function of CD157 in the nervous system and contribution to PD progression. Here, we show that no apparent motor dysfunction was observed in young knockout (CD157-/- male mice under less aging-related effects on behaviors. CD157-/- mice exhibited anxiety-related and depression-like behaviors compared with wild-type mice. These behaviors were rescued through treatment with anti-psychiatric drugs and oxytocin. CD157 was weakly expressed in the amygdala and c-Fos immunoreactivity was less evident in CD157-/- mice than in wild-type mice. These results demonstrate for the first time that CD157 plays a role as a neuro-regulator and suggest a potential role in pre-motor symptoms in PD.

  12. Inactivation of Escherichia Coli JM109, DH5 ALPHA and O157:H7 Suspended in Butterfields Phosphate Buffer by Gamma Irradiation

    Science.gov (United States)

    Food irradiation is a safe and effective method for inactivation of pathogenic bacteria including Escherichia coli O157:H7 in meat, leafy greens, and complex ready-to-eat foods without affecting food product quality. Determining the radiation dose needed to inactivate E. coli O157:H7 in foods, and ...

  13. Toward an international standard for PCR-based detection of Escherichia coli O157 - Part 1. Assay development and multi-center validation

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Cook, N.

    2003-01-01

    As part of a major European research project, a diagnostic PCR assay, including an internal amplification control, was developed and validated in a collaborative trial for the detection of Escherichia coli O157. The assay is based on amplification of sequences of the rJbE O157 gene. The collabora...

  14. Modeling the Survival of Escherichia coli O157:H7 During Fermentation, Drying, and Storage of a Soudjouk-Style Fermented Dry or Semi-Dry Sausage

    Science.gov (United States)

    Cases of foodborne illness have been linked to the consumption of fermented dry or semi-dry sausages (FDSS) contaminated with Escherichia coli O157:H7. The purpose of this study was to model the inactivation of E. coli O157:H7 during FDSS manufacturing and storage. Beef batter (20% fat) containing...

  15. MODELING THE SURVIVAL OF ESCHERICHIA COLI O157:H7, LISTERIA MONOCYTOGENES AND SALMONELLA TYPHIMURIUM DURING FERMENTATION, DRYING, AND STORAGE OF SOUDJOUK-STYLE FEREMENTED SAUSAGE

    Science.gov (United States)

    Outbreaks of foodborne illnesses have been linked to the consumption of fermented dry and semi-dry sausage (FDDS) contaminated with E. coli O157:H7 and Salmonella spp. This study quantified and modeled the survival of E. coli O157:H7, L. monocytogenes and S. typhimurium in soudjouk-style sausage ...

  16. Anxiety- and depression-like behavior in mice lacking the CD157/BST1 gene, a risk factor for Parkinson's disease.

    Science.gov (United States)

    Lopatina, Olga; Yoshihara, Toru; Nishimura, Tomoko; Zhong, Jing; Akther, Shirin; Fakhrul, Azam A K M; Liang, Mingkun; Higashida, Chiharu; Sumi, Kohei; Furuhara, Kazumi; Inahata, Yuki; Huang, Jian-Jung; Koizumi, Keita; Yokoyama, Shigeru; Tsuji, Takahiro; Petugina, Yulia; Sumarokov, Andrei; Salmina, Alla B; Hashida, Koji; Kitao, Yasuko; Hori, Osamu; Asano, Masahide; Kitamura, Yoji; Kozaka, Takashi; Shiba, Kazuhiro; Zhong, Fangfang; Xie, Min-Jue; Sato, Makoto; Ishihara, Katsuhiko; Higashida, Haruhiro

    2014-01-01

    CD157, known as bone marrow stromal cell antigen-1, is a glycosylphosphatidylinositol-anchored ADP-ribosyl cyclase that supports the survival and function of B-lymphocytes and hematopoietic or intestinal stem cells. Although CD157/Bst1 is a risk locus in Parkinson's disease (PD), little is known about the function of CD157 in the nervous system and contribution to PD progression. Here, we show that no apparent motor dysfunction was observed in young knockout (CD157 (-/-)) male mice under less aging-related effects on behaviors. CD157 (-/-) mice exhibited anxiety-related and depression-like behaviors compared with wild-type mice. These behaviors were rescued through treatment with anti-psychiatric drugs and oxytocin. CD157 was weakly expressed in the amygdala and c-Fos immunoreactivity in the amygdala was less evident in CD157 (-/-) mice than in wild-type mice. These results demonstrate for the first time that CD157 plays a role as a neuro-regulator and suggest a potential role in pre-motor symptoms in PD.

  17. RcsB contributes to the distinct stress fitness between Escherichia coli O157:H7 curli variants of 1993 hamburger-associated outbreak strains

    Science.gov (United States)

    Curli are adhesive fimbriae of Enterobactericaeae and are involved in surface attachment, cell aggregation and biofilm formation. We previously reported that natural curli variants of E. coli O157:H7 (EcO157) displayed distinct acid resistance; however, this difference was not linked to the curli fi...

  18. Effect of Thai medicinal plant extracts on cell aggregation of Escherichia coli O157: H7.

    Directory of Open Access Journals (Sweden)

    Limsuwan, S.

    2005-08-01

    Full Text Available Medicinal plants have been used for treating diarrhoea but the interference mechanisms are not clearly understood. One possible hypothesis is that of an effect on cell surface hydrophobicity of microbial cells. In this study, we examined cell aggregation affected by crude extracts of Thai medicinal plants on cell surface hydrophobicity of Escherichia coli strains by salt aggregation test. Correlation between minimal inhibitory concentration and cell aggregation was performed. Aqueous and ethanolic extracts of 8 medicinal plants including Acacia catechu, Holarrhena antidysenterica, Peltophorum pterocarpum, Piper sarmentosum, Psidium guajava, Punica granatum, Quercus infectoria, and Tamarindus indica were tested with E. coli O157: H7 and other E. coli strains isolated from human, porcine, and foods. Aqueous extracts of Peltophorum pterocarpum, Psidium guajava, and Punica granatum were highly effective against E. coli O157: H7 with the MIC values of 0.09 to 0.39, 0.19 to 0.78, and 0.09 to 1.56 mg/ml, respectively. Ethanolic extract of Quercus infectoria and Punica granatum demonstrated good MIC values of 0.09 to 0.78, and 0.19 to 0.78 mg/ml, respectively. It was established that aqueous extracts of Punica granatum and Piper sarmentosum at high concentration (25 mg/ml enhanced cell aggregation of almost all E. coli strains while aqueous and ethanolic extracts ofQuercus infectoria enhanced cell aggregation of some E. coli strains. Correlation between minimal inhibitory concentration and cell aggregation was not found in this study.

  19. Microstructure, crystallography of phase transformations and multiple precipitations in PH 15-7Mo stainless steel

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Hongwei [The Australia Centre Microscopy and Microanalysis, The University of Sydney, NSW, 2006 (Australia); Liu, Jiangwen, E-mail: mejwliu@scut.edu.cn [School of Materials Science and Engineering, South China University of Technology, Guangzhou, 510640 (China); Luo, Chengping [School of Materials Science and Engineering, South China University of Technology, Guangzhou, 510640 (China); Liu, Zhijian [Guangdong Research Institute of Iron and Steel, Guangzhou, 510640 (China)

    2016-07-05

    The microstructure and crystallographic features of a semi-austenitic precipitation hardening steel PH 15-7Mo during solution treatment, roddrawing and aging were investigated by means of optical microscope, X-ray diffraction analyzer and transmission electron microscope. It was found that the microstructure of the steel was consist of dominant austenite, small amount of martensite and 10–15 vol.% δ-ferrite after solution treatment at 1050 °C followed by cooling in water at room temperature. The austenite transformed into lath martensite during tensile roddrawing about 60% deforming companied with some coherent fine β-NiAl particles precipitated within martensite. With higher aging temperature and longer holding time, tiny carbide M{sub 23}C{sub 6} particles precipitated from martensite, which kept the cubic–cubic orientation relationship (OR) with austenite and G-T OR with martensite which is different with all the reported orientations. The OR between tiny carbide M{sub 23}C{sub 6} particles G-T OR with martensite was discussed in terms of crystallography of phase transformations. - Highlights: • Microstructure changes of austenitic steel PH15-7Mo were due to alloying elements, service condition and carbide M{sub 23}C{sub 6}. • Lath-shape martensitic laths keep pseudo {112} twinning relationship. • β-NiAl particles hold a typical cubic-to-cubic orientation relationship with martensite. • M{sub 23}C{sub 6} carbide kept a cubic–cubic orientation relationship (OR) with austenite and an unusual G-T OR with martensite. • Multiple orientation relationship between M{sub 23}C{sub 6} and austenite is correlative with their structural similarity.

  20. Surface characteristics and adhesion behavior of Escherichia coli O157:H7: role of extracellular macromolecules.

    Science.gov (United States)

    Kim, Hyunjung N; Hong, Yongsuk; Lee, Ilkeun; Bradford, Scott A; Walker, Sharon L

    2009-09-14

    Experiments were conducted using enterohemorrhagic Escherichia coli O157:H7 cells to investigate the influence of extracellular macromolecules on cell surface properties and adhesion behavior to quartz sand. Partial removal of the extracellular macromolecules on cells by a proteolytic enzyme (proteinase K) was confirmed using Fourier transform infrared spectroscopy analyses. The proteinase K treated cells exhibited more negative electrophoretic mobility (EPM) at an ionic strength (IS) macromolecules resulted in polymeric layers outside the cell surface that were less electrophoretically soft. The more negative mobility for the treated cells was likely due to the combined effects of a change in the distribution of functional groups and an increase in the charges per unit volume after enzyme treatment and not just removal of extracellular macromolecules. The proteolytic digestion of extracellular macromolecules led to a significant difference in the cell adhesion to quartz sand. The adhesion behavior for treated cells was consistent with DLVO theory and increased with IS due to less negativity in the EPM. In contrast, the adhesion behavior of untreated cells was much more complex and exhibited a maximum at IS = 1 mM. The treated cells exhibited less adhesion than the untreated cells when the IS or = 10 mM, a sudden decrease in the removal efficiency was observed only for the untreated cells even through EPM values were similar for both treated and untreated cells. This result suggested that an additional non-DLVO type interaction, electrosteric repulsion, occurred at higher IS (> or =10 mM in this study) for the untreated cells due to the presence of extracellular macromolecules that hindered cell adhesion to the quartz surface. This finding provides important insight into the role of macromolecule-induced E. coli O157:H7 interactions in aquatic environments.

  1. Diminazene aceturate: an antibacterial agent for Shiga-toxin-producing Escherichia coli O157:H7

    Science.gov (United States)

    Wu, Si-Ying; Park, Gil-Yong; Kim, So-Hee; Hulme, John; An, Seong Soo A

    2016-01-01

    The aim of this study was to investigate the bacteriostatic and bactericidal effects of diminazene aceturate (DA) against five strains of pathogenic bacteria and two strains of nonpathogenic bacteria. The results showed that 5 μg/mL of DA suppressed the growth of pathogenic Escherichia coli by as much as 77% compared with the controls. Enterohemorrhagic E. coli EDL933 (an E. coli O157:H7 strain) was the most sensitive to DA with a minimum inhibitory concentration of 20 μg/mL. Additional investigations showed that DA induced the highest level of intracellular reactive oxygen species in EDL933. A positive correlation between the reactive oxygen species levels and DA concentration was demonstrated. DA (5 μg/mL) was also a potent uncoupler, inducing a stationary phase collapse (70%–75%) in both strains of E. coli O157:H7. Further investigation showed that the collapse was due to the NaCl:DA ratio in the broth and was potassium ion dependent. A protease screening assay was conducted to elucidate the underlying mechanism. It was found that at neutral pH, the hydrolysis of H-Asp-pNA increased by a factor of 2–3 in the presence of DA, implying that DA causes dysregulation of the proton motive force and a decrease in cellular pH. Finally, a commercial verotoxin test showed that DA did not significantly increase toxin production in EDL933 and was a suitable antibacterial agent for Shiga-toxin-producing E. coli.

  2. Radiosensitivity of E.coli O157: H7 and Salmonella typhimurium on swiss chard

    Energy Technology Data Exchange (ETDEWEB)

    Pereira, Marco A.S.; Mastro, Nelida L. del [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)]. E-mails: masperei@ipen.br; nlmastro@ipen.br

    2007-07-01

    Swiss Chard is a beet (Beta vulgaris cicla) producing large yellowish green leaves with thick succulent stalks and often cooked as a potherb, called also seakale beet or chard. It is a nutritive vegetable rich in potassium, calcium, magnesium, sodium, phosphorus and vitamin C. Ionising radiation is an effective method to reduce pathogens. Radiation sensitivity of bacteria, however, depends on several factors. Particularly, few data are available on the ability of low-dose ionizing radiation to inactivate pathogenic bacteria on ready to eat vegetables. The aim of this study was the evaluation of the radiation sensitivity of pathogens experimentally contaminating the mentioned vegetable. Swiss chard leaves minimally processed were inoculated separately either with E. coli O157:H7 or Salmonella typhimurium by immersion to contain 6 log CFU/g and 1h later gamma-irradiated with 0.25 kGy, 0.5 kGy, 1 kGy and 1.5 kGy, dose rate of 2.94 kGy/h. The assay of pathogen survivors was made by direct plating. After applying a radiation dose of 0.5 kGy reductions of at least 3 log were achieved for both bacteria. The average D10 values, the radiation dose needed to inactivate 1 log of pathogen were 0.12 and 0.10 for E.coli O157:H7 and S.typhimurium respectively. These results indicate that irradiation may be an effective means for inactivating common foodborne pathogens that can eventually contaminate ready to eat vegetables. (author)

  3. Faktor-faktor Risiko Penyebaran Escherichia coli O157:H7 pada Sapi Bali di Kuta Selatan, Badung, Bali (RISK FACTORS FOR DISSEMINATION OF ESCHERICHIA COLI O157:H7 IN BALIN CATTLE IN SOUTH KUTA, BADUNG, BALI

    Directory of Open Access Journals (Sweden)

    Korbinianus Feribertus Rinca

    2016-11-01

    Full Text Available Escherichia coli O157:H7 is a strain of E.coli which has ability to produce toxin known as shiga-liketoxin. Shiga like toxin can cause colitis haemorrhagic and hemolytic uremic syndrome in human. However,in calves, it can cause diarrhea, while in adult cattle can be career. Cattle are primary reservoir of E. coliO157:H7. Study of dissemination pattern of E.coli O157:H7 was carried out using 60 samples of cattlefeces. This is a cross sectional study and samples were collected using purposive sampling technique.Based on statistic calculation using chi-square and Odds ratio tests, it was found some risk factorsaffected the dissemination of E.coli O157:H7 infection in South Kuta District, Badung, Bali. Some of thosewere the altitude of sea level that showed the cattle which were maintained in highland showed more riskthan cattle that was in the lowland, with odds ratio value 1.12. The management animal husbandryshowed cattle that maintained in captive management were in higher risk than cattle that was notmanaged in captive system, with odds ratio value 2.50. The type of captive floor, which made from cementwas higher risk than cattle that was raised in captive floor which were made from non cement with oddsratio value 6.22. The chi-square test result did not show a significant difference to the dissemination of E.coli O157:H7 in the South Kuta-district.

  4. Recipes for Antimicrobial Wine Marinades against Bacillus cereus, Escherichia coli O157:H7, Listeria monocytogenes, and Salmonella enterica

    Science.gov (United States)

    We evaluated bactericidal activities of several antimicrobial wine recipes consisting of red and white wine extracts of oregano leaves with added garlic juice and oregano oil against Bacillus cereus, Escherichia coli O157:H7, Listeria monocytogenes, and Salmonella enterica. Dose-response plots were...

  5. Inactivation of Listeria monocytogenes, Salmonella spp. and Escherichia coli O157:H7 on cantaloupes by octenidine hydrochloride

    Science.gov (United States)

    This study investigated the efficacy of a new generation disinfectant, namely octenidine dihydrochloride (OH) as wash and coating treatments for reducing Listeria monocytogenes, Salmonella spp., and Escherichia coli O157:H7 on cantaloupe surface. Cantaloupe rind plugs inoculated separately with L. m...

  6. Antagonistic effect of probiotic strains against two pathogens: Salmonella Typhimurium and E. coli O157:H7 resistant to antibiotics.

    Directory of Open Access Journals (Sweden)

    A. Berenice Arias O

    2013-01-01

    Full Text Available El objetivo de este estudio fue probar la eficiencia de las cepas probióticas Lactobacillus acidophilus NCFM (L. acidophilus, Lactobacillus rhamnosus HN001 (L. rhmanosus y Bifidobacterium animalis BI07 (B. animalis para antagonizar los patógenos resistentes a antibióticos Salmonella enteritidis var Thyphimurium (Salmonella Thyphimurium y Escherichia coli O157:H7 (E. coli O157:H7. Las tres cepas probióticas mostraron poseer un efecto antagónico contra las cepas patógenas Salmonella Thyphimurium y E. coli O157:H7 resistentes a antibióticos. En la prueba de “Well Diffusion”, L. acidophilus y L. rhamnosus presentaron reducciones estadísticamente semejantes entre ellas (P >0.05 de 37-41 mm para E. coli O157:H7 y de 32 – 41 mm para Salmonella Thyphimurium, mientras que B. animalis mostró reducciones menores (P0.05.

  7. Inactivation of Escherichia coli O157:H7 and Salmonella Typhimurium in black pepper and red pepper by gamma irradiation.

    Science.gov (United States)

    Song, Won-Jae; Sung, Hye-Jung; Kim, Sung-Youn; Kim, Kwang-Pyo; Ryu, Sangryeol; Kang, Dong-Hyun

    2014-02-17

    This study evaluated the efficacy of gamma irradiation to inactivate foodborne pathogens in black pepper (Piper nigrum) and red pepper (dried Capsicum annuum). Black pepper and red pepper inoculated with Escherichia coli O157:H7 and Salmonella Typhimurium were subjected to gamma irradiation in the range of 0, 1, 2, 3 and 5 kGy, and color change was evaluated after treatment. Pathogen populations decreased with increasing treatment doses. A gamma irradiation dose of 5 kGy decreased E. coli O157:H7 and S. Typhimurium populations >4.4 to >5.2 log CFU/g in black pepper without causing color change. Similarly, 5 kGy of gamma irradiation yielded reduction of 3.8 to >5.2 log CFU/g for E. coli O157:H7 and S. Typhimurium in red pepper. During gamma irradiation treatment, L*, a* and b* values of red pepper were not significantly changed except for 297 μm to 420 μm size red pepper treated with 5 kGy of gamma irradiation. Based on the D-value of pathogens in black pepper and red pepper, S. Typhimurium showed more resistant to gamma irradiation than did E. coli O157:H7. These results show that gamma irradiation has potential as a non-thermal process for inactivating foodborne pathogens in spices with minimal color changes.

  8. Classification of non-O157 shiga toxin-producing escherichia coli(STEC) serotypes with hyperspectral microscope imaging

    Science.gov (United States)

    Non-O157 Shiga toxin-producing Escherichia coli (STEC) strains such as O26, O45, O103, O111, O121 and O145 are recognized as serious outbreak to cause human illness due to their toxicity. A conventional microbiological method for cell counting is laborious and needs long time for the results. Since ...

  9. Ultrasound enhanced sanitizer efficacy in reduction of Escherichia coli O157:H7 population on spinach leaves

    Science.gov (United States)

    The use of ultrasound to enhance the efficacy of selected sanitizers in reduction of Escherichia coli O157:H7 populations on spinach was investigated. Spot-inoculated spinach samples were treated with water, chlorine, acidified sodium chlorite (ASC), peroxyacetic acid (POAA), and acidic electrolyzed...

  10. Potential application of high hydrostatic pressure to eliminate Escherichia coli O157:H7 on alfalfa sprouted seeds.

    Science.gov (United States)

    Neetoo, Hudaa; Ye, Mu; Chen, Haiqiang

    2008-12-10

    Sprouts eaten raw are increasingly being perceived as hazardous foods as they have been implicated in Escherichia coli O157:H7 outbreaks where the seeds were found to be the likely source of contamination. The objective of our study was to evaluate the potential of using high hydrostatic pressure (HHP) technology for alfalfa seed decontamination. Alfalfa seeds inoculated with a cocktail of five strains of E. coli O157:H7 were subjected to pressures of 500 and 600 MPa for 2 min at 20 degrees C in a dry or wet (immersed in water) state. Immersing seeds in water during pressurization considerably enhanced inactivation of E. coli O157:H7 achieving reductions of 3.5 log and 5.7 log at 500 and 600 MPa, respectively. When dry seeds were pressurized, both pressure levels reduced the counts by 5 log reduction in the population was achieved when 600 MPa was applied for durations of > or =6 min although survivors were still detected by enrichment. When the pressure was stepped up to 650 MPa, the threshold time required to achieve complete elimination was 15 min. Un-inoculated seeds pressure-treated at 650 MPa for 15 min at 20 degrees C successfully sprouted achieving a germination rate identical to untreated seeds after eight days of sprouting. These results therefore demonstrate the promising application of HHP on alfalfa seeds to eliminate the risk of E. coli O157:H7 infections associated with consumption of raw alfalfa sprouts.

  11. Ecology and modelling of Escherichia coli O157:H7 and Salmonella enterica serovar Typhimurium in cattle manure and soil

    NARCIS (Netherlands)

    Semenov, A.V.

    2008-01-01

    The number of food poisoning cases caused by enteropathogens has increased in recent years. A significant part of the outbreaks associated with the consumption of raw vegetables has been attributed to Escherichia coli O157:H7 and Salmonella enterica subsp. enterica serovar Typhimurium. Bovine manure

  12. Carvacrol induces heat shock protein 60 and inhibits synthesis of flagellin in Escherichia coli O157:H7

    NARCIS (Netherlands)

    Burt, S.A.; van der Zee, R.; Koets, A.P.; de Graaff, A.M.; van Knapen, F.; Gaastra, W.; Haagsman, H.P.; Veldhuizen, E.J.A.

    2007-01-01

    The essential oils of oregano and thyme are active against a number of food-borne pathogens, such as Escherichia coli O157:H7. Carvacrol is one of the major antibacterial components of these oils, and p-cymene is thought to be its precursor in the plant. The effects of carvacrol and p-cymene on prot

  13. Genetic Features Differentiating Bovine, Food, and Human Isolates of Shiga Toxin-Producing Escherichia coli O157 in The Netherlands

    NARCIS (Netherlands)

    Franz, E.; Hoek, van A.H.A.M.; Wal, van der F.J.; Boer, de A.G.; Zwartkruis-Nahuis, A.; Zwaluw, van der K.; Aarts, H.J.M.; Heuvelink, A.E.

    2012-01-01

    The frequency of Escherichia coli O157 genotypes among bovine, food, and human clinical isolates from The Netherlands was studied. Genotyping included the lineage-specific polymorphism assay (LSPA6), the Shiga-toxin-encoding bacteriophage insertion site assay (SBI), and PCR detection and/or subtypin

  14. Filet américain oorzaak van eerste landelijke uitbraak van Shigatoxine-producerende Escherichia coli O157-infecties

    NARCIS (Netherlands)

    Doorduyn, Y; Jager, C M de; Zwaluw, W K van der; Friesema, I H M; Heuvelink, A E; Boer, E de; Wannet, Wim J B; Duynhoven, Yvonne T H P van

    2006-01-01

    In September 2005, the first nationwide outbreak of Shiga toxin-producing Escherichia coli (STEC) O157 infections was observed. A total of 21 confirmed and 11 probable patients were reported, who fell ill between September 11 and October 10. Preliminary investigation by the local public health servi

  15. An unusual dual infection with Salmonella bredeney, including bacteraemia, and enterohaemorrhagic Escherichia coli O157 that posed a therapeutic dilemma.

    Science.gov (United States)

    Grynik, Alina; Shaukat, Syed; Htut, Ei Ei Phyu; Karas, Johannis Andreas

    2012-10-01

    In this case report, we describe an unusual case of a patient who had a dual infection with Salmonella bredeney including bacteraemia and enterohaemorrhagic Escherichia coli O157 following travel to Cyprus. This posed a therapeutic dilemma. We delayed treatment of the Salmonella infection until signs of colitis had resolved.

  16. Detection of non-O157 STEC in ground beef using the GeneDisc real-time PCR system

    Science.gov (United States)

    Certain non-O157 Shiga toxin-producing Escherichia coli (STEC) serogroups have emerged as important public health threats. The development of methods for rapid and reliable detection of this heterogeneous group of pathogens has been challenging. A GeneDisc real-time PCR assay was evaluated for det...

  17. Cytolethal distending toxin in Escherichia coli O157:H7 : spectrum of conservation, structure, and endothelial toxicity

    NARCIS (Netherlands)

    Friedrich, Alexander W; Lu, Shan; Bielaszewska, Martina; Prager, Rita; Bruns, Phillip; Xu, Jian-Guo; Tschäpe, Helmut; Karch, Helge

    2006-01-01

    We identified the cytolethal distending toxin V (CDT-V) gene cluster in 19 (4.9%) of 391 enterohemorrhagic Escherichia coli O157:H7. cdt-V+ strains belonged to five phage types (PTs) and were most frequent within PTs 14 and 34. CDT-V was expressed in all but two cdt-V+ strains and was lethal to cult

  18. Presence and persistence of wastewater pathogen Escherichia coli O157:H7 in hydroponic reactors of treatment wetland species.

    Science.gov (United States)

    VanKempen-Fryling, R J; Stein, O R; Camper, A K

    2015-01-01

    Treatment wetlands (TWs) efficiently remove many pollutants including a several log order reduction of pathogens from influent to effluent; however, there is evidence to suggest that pathogen cells are sequestered in a subsurface wetland and may remain viable months after inoculation. Escherichia coli is a common pathogen in domestic and agricultural wastewater and the O157:H7 strain causes most environmental outbreaks in the United States. To assess attachment of E. coli to the TW rhizosphere, direct measurements of E. coli levels were taken. Experiments were performed in chemostats containing either Teflon nylon as an abiotic control or roots of Carex utriculata or Schoenoplectus acutus. Flow of simulated wastewater through the chemostat was set to maintain a 2 hour residence time. The influent was inoculated with E. coli O157:H7 containing DsRed fluorescent protein. Root samples were excised and analyzed via epifluorescent microscopy. E. coli O157:H7 was detected on the root surface at 2 hours after inoculation, and were visible as single cells. Microcolonies began forming at 24 hours post-inoculation and were detected for up to 1 week post-inoculation. Image analysis determined that the number of microcolonies with >100 cells increased 1 week post-inoculation, confirming that E. coli O157:H7 is capable of growth within biofilms surrounding wetland plant roots.

  19. 33 CFR Appendix D to Part 157 - Example of a Procedure for Dedicated Clean Ballast Tanks Operations

    Science.gov (United States)

    2010-07-01

    ... Dedicated Clean Ballast Tanks Operations D Appendix D to Part 157 Navigation and Navigable Waters COAST... Procedure for Dedicated Clean Ballast Tanks Operations 1. Source. The example procedure for dedicated clean... Protocol. 2. Example Procedure. Dedicated clean ballast tanks operational procedure: (a) Before arrival...

  20. 33 CFR 157.206 - Dedicated Clean Ballast Tanks Operations Manual for U.S. tank vessels: Submission.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Dedicated Clean Ballast Tanks... MARINE ENVIRONMENT RELATING TO TANK VESSELS CARRYING OIL IN BULK Dedicated Clean Ballast Tanks on Tank Vessels General § 157.206 Dedicated Clean Ballast Tanks Operations Manual for U.S. tank...