Charge transfer cross sections for dysprosium and cerium

Energy Technology Data Exchange (ETDEWEB)

Adachi, Hajime; Tamura, Koji; Okazaki, Tetsuji; Shibata, Takemasa [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

1998-06-01

Symmetric resonant charge transfer cross sections between singly ionized ions and the parent atoms were measured for dysprosium and cerium in the impact energy of 200-2000eV. The cross sections were determined from the ratio between the number of ions produced by charge transfer and those in primary ion beam. The primary ion beam was produced by a laser ion source in which their atoms were ionized by laser resonant photo-ionization. The slow ions produced by charge transfer and fast primary ions were detected with Faraday cups. The obtained cross sections were (1.82{+-}0.14) x 10{sup -14} cm{sup 2} for dysprosium and (0.88{+-}0.12) x 10{sup -14} cm{sup 2} for cerium in the above energy range. The difference of these values can mostly be explained by considering the electron configurations of these atoms and ions. (author)

Charge transfer cross sections for dysprosium and cerium

International Nuclear Information System (INIS)

Adachi, Hajime; Tamura, Koji; Okazaki, Tetsuji; Shibata, Takemasa

1998-06-01

Symmetric resonant charge transfer cross sections between singly ionized ions and the parent atoms were measured for dysprosium and cerium in the impact energy of 200-2000eV. The cross sections were determined from the ratio between the number of ions produced by charge transfer and those in primary ion beam. The primary ion beam was produced by a laser ion source in which their atoms were ionized by laser resonant photo-ionization. The slow ions produced by charge transfer and fast primary ions were detected with Faraday cups. The obtained cross sections were (1.82±0.14) x 10 -14 cm 2 for dysprosium and (0.88±0.12) x 10 -14 cm 2 for cerium in the above energy range. The difference of these values can mostly be explained by considering the electron configurations of these atoms and ions. (author)

Synthesis, structural characterization and in vitro testing of dysprosium containing silica particles as potential MRI contrast enhancing agents

International Nuclear Information System (INIS)

Chiriac, L.B.; Trandafir, D.L.; Turcu, R.V.F.; Todea, M.; Simon, S.

2016-01-01

Highlights: • Dysprosium containing silica microparticles obtained by freeze and spray drying. • Higher structural units interconnection achieved in freeze vs. spray dried samples. • Dy occurance on the outermost layer of the microparticles evidenced by XPS. • Enhanced MRI contrast observed for freeze dried samples with 5% mol Dy_2O_3. - Abstract: The work is focused on synthesis and structural characterization of novel dysprosium-doped silica particles which could be considered as MRI contrast agents. Sol-gel derived silica rich particles obtained via freeze-drying and spray-drying processing methods were structurally characterized by XRD, "2"9Si MAS-NMR and XPS methods. The occurrence of dysprosium on the outermost layer of dysprosium containing silica particles was investigated by XPS analysis. The MRI contrast agent characteristics have been tested using RARE-T_1 and RARE-T_2 protocols. The contrast of MRI images delivered by the investigated samples was correlated with their local structure. Dysprosium disposal on microparticles with surface structure characterised by decreased connectivity of the silicate network units favours dark T_2-weighted MRI contrast properties.

Dysprosium-containing layered double hydroxides nanoparticles intercalated with biologically active species as an approach for theranostic systems

Energy Technology Data Exchange (ETDEWEB)

Arratia-Quijada, Jenny [Departamento de Ciencias de la Salud, Centro Universitario Tonalá, Universidad de Guadalajara, Av. Nuevo Periférico No. 555, C.P. 48525, Tonalá, Jalisco (Mexico); Sánchez Jiménez, Cecilia [Departamento de Química, Universidad de Guadalajara, Boulevard Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico); Gurinov, Andrey [Research Resources Center for Magnetic Resonance, St. Petersburg State University, Universitetskiy pr. 26, 198504 St. Petersburg (Russian Federation); NMR Core Lab, King Abdullah University of Science and Technology, Thuwal 23955-6900 (Saudi Arabia); Pérez Centeno, Armando; Ceja Andrade, Israel [Departamento de Física, Universidad de Guadalajara, Boulevard Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico); Carbajal Arízaga, Gregorio Guadalupe, E-mail: gregoriocarbajal@yahoo.com.mx [Departamento de Química, Universidad de Guadalajara, Boulevard Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico)

2016-01-15

Graphical abstract: - Highlights: • LDH structure including dysprosium was prepared by co-precipitation. • LDH was capable to produce contrast in the T1 mode of MRI. • LDH were intercalated with folate, ibuprofen and gallate ions. - Abstract: A layered double hydroxide structure including dysprosium cations was prepared by co-precipitation. The nanoparticles showed a linear relationship with the reciprocal relaxation spin-lattice (T1) time of water protons which is reflected as contrast in aqueous suspensions analyzed by magnetic resonance imaging. The interlayer space of dysprosium containing LDH was successfully intercalated with folate, ibuprofen and gallate ions, which are key molecules for recognition of some cancer cells and treatment of diseases. The paramagnetic property of the dysprosium-containing LDH detected in this work beside the ability to transport drugs open up the opportunity to design theranostic materials in a single crystal phase with nanometric dimensions.

Dysprosium-containing layered double hydroxides nanoparticles intercalated with biologically active species as an approach for theranostic systems

International Nuclear Information System (INIS)

Arratia-Quijada, Jenny; Sánchez Jiménez, Cecilia; Gurinov, Andrey; Pérez Centeno, Armando; Ceja Andrade, Israel; Carbajal Arízaga, Gregorio Guadalupe

2016-01-01

Graphical abstract: - Highlights: • LDH structure including dysprosium was prepared by co-precipitation. • LDH was capable to produce contrast in the T1 mode of MRI. • LDH were intercalated with folate, ibuprofen and gallate ions. - Abstract: A layered double hydroxide structure including dysprosium cations was prepared by co-precipitation. The nanoparticles showed a linear relationship with the reciprocal relaxation spin-lattice (T1) time of water protons which is reflected as contrast in aqueous suspensions analyzed by magnetic resonance imaging. The interlayer space of dysprosium containing LDH was successfully intercalated with folate, ibuprofen and gallate ions, which are key molecules for recognition of some cancer cells and treatment of diseases. The paramagnetic property of the dysprosium-containing LDH detected in this work beside the ability to transport drugs open up the opportunity to design theranostic materials in a single crystal phase with nanometric dimensions.

Semiconductor composition containing iron, dysprosium, and terbium

Science.gov (United States)

Pooser, Raphael C.; Lawrie, Benjamin J.; Baddorf, Arthur P.; Malasi, Abhinav; Taz, Humaira; Farah, Annettee E.; Kalyanaraman, Ramakrishnan; Duscher, Gerd Josef Mansfred; Patel, Maulik K.

2017-09-26

An amorphous semiconductor composition includes 1 to 70 atomic percent iron, 15 to 65 atomic percent dysprosium, 15 to 35 atomic percent terbium, balance X, wherein X is at least one of an oxidizing element and a reducing element. The composition has an essentially amorphous microstructure, an optical transmittance of at least 50% in at least the visible spectrum and semiconductor electrical properties.

Synthesis, structural characterization and in vitro testing of dysprosium containing silica particles as potential MRI contrast enhancing agents

Energy Technology Data Exchange (ETDEWEB)

Chiriac, L.B.; Trandafir, D.L. [Faculty of Physics & National Magnetic Resonance Center, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Interdisciplinary Research Institute on Bio-Nano-Sciences & Faculty of Physics, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Turcu, R.V.F. [Faculty of Physics & National Magnetic Resonance Center, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Todea, M. [Interdisciplinary Research Institute on Bio-Nano-Sciences & Faculty of Physics, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Simon, S., E-mail: simons@phys.ubbcluj.ro [Faculty of Physics & National Magnetic Resonance Center, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania); Interdisciplinary Research Institute on Bio-Nano-Sciences & Faculty of Physics, Babeş-Bolyai University, Cluj-Napoca, RO-400084 (Romania)

2016-11-01

Highlights: • Dysprosium containing silica microparticles obtained by freeze and spray drying. • Higher structural units interconnection achieved in freeze vs. spray dried samples. • Dy occurance on the outermost layer of the microparticles evidenced by XPS. • Enhanced MRI contrast observed for freeze dried samples with 5% mol Dy{sub 2}O{sub 3}. - Abstract: The work is focused on synthesis and structural characterization of novel dysprosium-doped silica particles which could be considered as MRI contrast agents. Sol-gel derived silica rich particles obtained via freeze-drying and spray-drying processing methods were structurally characterized by XRD, {sup 29}Si MAS-NMR and XPS methods. The occurrence of dysprosium on the outermost layer of dysprosium containing silica particles was investigated by XPS analysis. The MRI contrast agent characteristics have been tested using RARE-T{sub 1} and RARE-T{sub 2} protocols. The contrast of MRI images delivered by the investigated samples was correlated with their local structure. Dysprosium disposal on microparticles with surface structure characterised by decreased connectivity of the silicate network units favours dark T{sub 2}-weighted MRI contrast properties.

Ethanolamine derivatives of dysprosium and holmium

International Nuclear Information System (INIS)

Gharia, K.S.; Singh, M.; Mathur, S.; Sankhla, B.S.

1981-01-01

The preparation and properties of dysprosium and holmium derivatives of mono-, di- and tri-ethanolamine derivatives are described. Compounds of general formulae: Ln(OPrsup(i)) 2 (mea), Ln(OPrsup(i))(mea) 2 , Ln(mea) 3 , Ln(OPrsup(i))(dea), Ln 2 (dea) 3 , Ln(dea)(deaH) and Ln(tea) (where Ln = Dy or Ho and mea, dea and tea are the anions of respective ethanolamine) were obtained and characterized by elemental analysis and IR spectra. (author)

Synthesis, characterization and sup 23 Na NMR shift studies of a novel dysprosium(III) crown ether texaphyrin

Energy Technology Data Exchange (ETDEWEB)

Sessler, J.L.; Mody, T.D. (Texas Univ., Austin, TX (United States). Dept. of Chemistry); Ramasamy, R.; Sherry, A.D. (Texas Univ., Dallas, TX (United States))

1992-05-01

The synthesis and characterization of a novel dysprosium(III) crown-ether texaphyrin (Dy(BCTxp)){sup 2+} is reported. This complex was designed to serve as a ditopic chelate for both dysprosium(III) and sodium cations. {sup 23}Sodium NMR spectroscopic studies indicates that titration of Na{sup +} with increasing concentrations of (Dy(BCTxp)){sup 2+} results in a shift toward higher frequency and gives a net hyperfine shift of 0.86 ppm. Sodium complexation is taking place into the crown subunit in (Dy(BCTxp)){sup 2+} and the degree of complexation is not reduced substantially by the positive charge on the dysprosium(III) portion of this binucleating system.

Dysprosium-containing layered double hydroxides nanoparticles intercalated with biologically active species as an approach for theranostic systems

KAUST Repository

Arratia-Quijada, Jenny

2015-10-23

A layered double hydroxide structure including dysprosium cations was prepared by co-precipitation. The nanoparticles showed a linear relationship with the reciprocal relaxation spin-lattice (T1) time of water protons which is reflected as contrast in aqueous suspensions analyzed by magnetic resonance imaging. The interlayer space of dysprosium containing LDH was successfully intercalated with folate, ibuprofen and gallate ions, which are key molecules for recognition of some cancer cells and treatment of diseases. The paramagnetic property of the dysprosium-containing LDH detected in this work beside the ability to transport drugs open up the opportunity to design theranostic materials in a single crystal phase with nanometric dimensions.

Dysprosium-containing layered double hydroxides nanoparticles intercalated with biologically active species as an approach for theranostic systems

KAUST Repository

Arratia-Quijada, Jenny; Sá nchez Jimé nez, Cecilia; Gurinov, Andrei; Pé rez Centeno, Armando; Ceja Andrade, Israel; Carbajal Arí zaga, Gregorio Guadalupe

2015-01-01

A layered double hydroxide structure including dysprosium cations was prepared by co-precipitation. The nanoparticles showed a linear relationship with the reciprocal relaxation spin-lattice (T1) time of water protons which is reflected as contrast in aqueous suspensions analyzed by magnetic resonance imaging. The interlayer space of dysprosium containing LDH was successfully intercalated with folate, ibuprofen and gallate ions, which are key molecules for recognition of some cancer cells and treatment of diseases. The paramagnetic property of the dysprosium-containing LDH detected in this work beside the ability to transport drugs open up the opportunity to design theranostic materials in a single crystal phase with nanometric dimensions.

Development and mastering of production of dysprosium hafnate as absorbing material for control rods of promising thermal neutron reactors

International Nuclear Information System (INIS)

Zakharov, A.V.; Risovany, V.D.; Muraleva, E.M.; Sokolov, V.F.

2011-01-01

The main advantages of dysprosium hafnate as an absorbing material for LWR control rods are the following: -) unlimited radiation resistance; - two absorbing components, Dy and Hf, increasing physical efficiency of the material compared to Dy 2 O 3 -TiO 2 and alloy 80% Ag - 15% In - 5% Cd; -) variability of physical efficiency by changing a composition, but maintaining other performance characteristics of the material; -) high process-ability due to the absence of phase transients and single-phase structure (solid solution); -) production of high density pellets. Lab-scale mastering of dysprosium hafnate pellets production showed a possibility of material synthesis using a solid-phase method, as well as of dysprosium hafnate pellets production by cold pressing and subsequent sintering. Within a whole range of examined compositions (23 mol% - 75 mol% Dy 2 O 3 ), a single-phase material with a highly radiation resistant fluorite-like structure was produced. Experiments on cold pressing and sintering of pellets confirmed a possibility of producing high quality dysprosium hafnate pellets from synthesized powder. A pilot batch of dysprosium hafnate pellets with standard sizes was produced. The standard sizes corresponded to the absorbing elements of the WWER-1000 control rods and met the main requirements to the absorbing element columns. The pilot batch size was approximately 6 kg. Acceptance testing of the pilot batch of dysprosium hafnate pellets was conducted, fulfillment of the requirements of technical conditions was checked and preirradiation properties of the pellets were examined. High quality of the produced pellets was confirmed, thus, demonstrating a real possibility of producing large batches of the dysprosium hafnate pellets. The next step is the production of test absorbing elements and cluster assemblies for the WWER-1000 control rods with their further installation for pilot operation at one of the Russian nuclear power plants

Dual responsive dysprosium-doped hydroxyapatite particles and toxicity reduction after functionalization with folic and glucuronic acids

Energy Technology Data Exchange (ETDEWEB)

Sánchez Lafarga, Ana Karen; Pacheco Moisés, Fermín P. [Departamento de Química, Universidad de Guadalajara, Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico); Gurinov, Andrey [Research Resources Center for Magnetic Resonance, Saint Petersburg State University, Universitetskij pr. 26, 198504 St. Petersburg (Russian Federation); Ortiz, Genaro Gabriel [Laboratorio Desarrollo-Envejecimiento, Enfermedades Neurodegenerativas, Centro de Investigación Biomédica de Occidente (CIBO), Instituto Mexicano de Seguro Social (IMSS), Guadalajara, Jalisco (Mexico); Carbajal Arízaga, Gregorio Guadalupe, E-mail: gregoriocarbajal@yahoo.com.mx [Departamento de Química, Universidad de Guadalajara, Marcelino García Barragán 1421, C.P. 44430, Guadalajara, Jalisco (Mexico)

2015-03-01

The development of probes for biomedical applications demands materials with low toxicity levels besides fluorescence or magnetic properties to be detected by confocal microscopes or MRI resonators. Several drug delivery systems or other biomedical materials prepared with hydroxyapatite have been proposed, however, toxicity effects might arise when the size of particles is nanometric. In this study, hydroxyapatite functionalized with glucuronic or folic acids presented lower oxidative stress, measured from lipoperoxides and nitric oxide indicators in rats than pure hydroxyapatite. In separated experiments, hydroxyapatite was doped with dysprosium cations by coprecipitation producing a single crystal phase with fluorescent properties easily visualized by confocal microscopy when excited at 488 nm. These particles also presented the ability to modify the proton relaxation time in T1 maps collected by magnetic resonance imaging. These modified hydroxyapatite nanoparticles could be candidates to design bimodal probes with low toxicity. - Highlights: • Hydroxyapatite functionalized with glucuronic acid reduced oxidative stress in rats. • Functionalization with folic acid reduced oxidative stress in rats. • Dysprosium doping does not affect the crystalline structure of hydroxyapatite. • Dysprosium doped particles are visible in fluorescent microscope. • Dysprosium doped particles act as MRI contrast agents.

Dual responsive dysprosium-doped hydroxyapatite particles and toxicity reduction after functionalization with folic and glucuronic acids

International Nuclear Information System (INIS)

Sánchez Lafarga, Ana Karen; Pacheco Moisés, Fermín P.; Gurinov, Andrey; Ortiz, Genaro Gabriel; Carbajal Arízaga, Gregorio Guadalupe

2015-01-01

The development of probes for biomedical applications demands materials with low toxicity levels besides fluorescence or magnetic properties to be detected by confocal microscopes or MRI resonators. Several drug delivery systems or other biomedical materials prepared with hydroxyapatite have been proposed, however, toxicity effects might arise when the size of particles is nanometric. In this study, hydroxyapatite functionalized with glucuronic or folic acids presented lower oxidative stress, measured from lipoperoxides and nitric oxide indicators in rats than pure hydroxyapatite. In separated experiments, hydroxyapatite was doped with dysprosium cations by coprecipitation producing a single crystal phase with fluorescent properties easily visualized by confocal microscopy when excited at 488 nm. These particles also presented the ability to modify the proton relaxation time in T1 maps collected by magnetic resonance imaging. These modified hydroxyapatite nanoparticles could be candidates to design bimodal probes with low toxicity. - Highlights: • Hydroxyapatite functionalized with glucuronic acid reduced oxidative stress in rats. • Functionalization with folic acid reduced oxidative stress in rats. • Dysprosium doping does not affect the crystalline structure of hydroxyapatite. • Dysprosium doped particles are visible in fluorescent microscope. • Dysprosium doped particles act as MRI contrast agents

Dysprosium-Catalyzed Growth of Single-Walled Carbon Nanotube Arrays on Substrates

Directory of Open Access Journals (Sweden)

Qian Yong

2009-01-01

Full Text Available Abstract In this letter, we report that dysprosium is an effective catalyst for single-walled carbon nanotubes (SWNTs growth via a chemical vapor deposition (CVD process for the first time. Horizontally superlong well-oriented SWNT arrays on SiO2/Si wafer can be fabricated by EtOH-CVD under suitable conditions. The structure and properties are characterized by scanning electron microscopy, transition electron microscopy, Raman spectroscopy and atomic force microscopy. The results show that the SWNTs from dysprosium have better structural uniformity and better conductivity with fewer defects. This rare earth metal provides not only an alternative catalyst for SWNTs growth, but also a possible method to generate high percentage of superlong semiconducting SWNT arrays for various applications of nanoelectronic device.

Dysprosium complexes with the tetraphenylporphyrin macrocyclic ligand; Complejos de disprosio con el ligante macrociclico tetrafenilporfirina

Energy Technology Data Exchange (ETDEWEB)

Martinez M, V.; Padilla, J.; Ramirez, F.M

1992-04-15

In this report, the results obtained on the synthesis, characterization and study of the chemical behavior of dysprosium complex with the acetylacetone chelating agent (Hacac) and the tetraphenylporphyrin macrocyclic ligand (H{sub 2}TFP) are given. Based on the literature but according to our necessities and interest, the appropriate methodology settled down from the synthesis of prime matters until the obtaining and characterization of the products. The acetyl acetonate complex was obtained of mono hydrated dysprosium [Dy(acac){sub 3}. H{sub 2}0] and trihydrated [Dy(acac){sub 3} .3 H{sub 2}0], the mono tetra phenyl porphyrinate [Dy(TFP)(acac). 2 ac] the double sandwich of the dysprosium porphyrinate [Dy(TFP){sub 2}] and the triple sandwich of the dysprosium porphyrinate [Dy(TFP){sub 3}. 2 TCB] (TCB = trichlorobenzene). Its were characterized by their melting points, solubility, IR, UV, TGA and DTA both first and besides the techniques already mentioned for NMR'H, RPE and Magnetic susceptibility the three last complexes. From the spectroscopic point of view, IR and RPE its suggested the existence of a complex of inverse mixed valence [Dy(TFP){sup 2-} (TFP) {sup 1-}] for the Dy(TFP){sub 2} as a result of the existence of the free radical (TFP' {sup 1-} and that it was not in none of the other porphyrin compounds. In the NMR'H spectra of the compounds were not observed signals in the region from 0 to 10 ppm that which shows that the dysprosium complexes in special those of the porphyrin type are highly paramagnetic and its could be used as displacement reagents, creators of images and contrast agents of great utility in these days in studies of NMR, technique today by today used in medical diagnoses. (Author)

Dysprosium complexes with the tetraphenylporphyrin macrocyclic ligand; Complejos de disprosio con el ligante macrociclico tetrafenilporfirina

Energy Technology Data Exchange (ETDEWEB)

Martinez M, V; Padilla, J; Ramirez, F M

1992-04-15

In this report, the results obtained on the synthesis, characterization and study of the chemical behavior of dysprosium complex with the acetylacetone chelating agent (Hacac) and the tetraphenylporphyrin macrocyclic ligand (H{sub 2}TFP) are given. Based on the literature but according to our necessities and interest, the appropriate methodology settled down from the synthesis of prime matters until the obtaining and characterization of the products. The acetyl acetonate complex was obtained of mono hydrated dysprosium [Dy(acac){sub 3}. H{sub 2}0] and trihydrated [Dy(acac){sub 3} .3 H{sub 2}0], the mono tetra phenyl porphyrinate [Dy(TFP)(acac). 2 ac] the double sandwich of the dysprosium porphyrinate [Dy(TFP){sub 2}] and the triple sandwich of the dysprosium porphyrinate [Dy(TFP){sub 3}. 2 TCB] (TCB = trichlorobenzene). Its were characterized by their melting points, solubility, IR, UV, TGA and DTA both first and besides the techniques already mentioned for NMR'H, RPE and Magnetic susceptibility the three last complexes. From the spectroscopic point of view, IR and RPE its suggested the existence of a complex of inverse mixed valence [Dy(TFP){sup 2-} (TFP) {sup 1-}] for the Dy(TFP){sub 2} as a result of the existence of the free radical (TFP' {sup 1-} and that it was not in none of the other porphyrin compounds. In the NMR'H spectra of the compounds were not observed signals in the region from 0 to 10 ppm that which shows that the dysprosium complexes in special those of the porphyrin type are highly paramagnetic and its could be used as displacement reagents, creators of images and contrast agents of great utility in these days in studies of NMR, technique today by today used in medical diagnoses. (Author)

Study on the electrochemical of the metal deposition from ionic liquids for lithium, titanium and dysprosium

International Nuclear Information System (INIS)

Berger, Claudia A.

2017-01-01

The thesis was aimed to the characterization of electrochemically deposited film of lithium, titanium and dysprosium on Au(111) from different ionic liquids, finally dysprosium on neodymium-iron-boron magnate for industrial applications. The investigation of the deposits were performed using cyclic voltametry, in-situ scanning tunneling microscopy, electrochemical quartz microbalance, XPS and Auger electron spectroscopy. The sample preparation is described in detail. The deposition rate showed a significant temperature dependence.

21 CFR 146.146 - Frozen concentrated orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Frozen concentrated orange juice. 146.146 Section... Fruit Juices and Beverages § 146.146 Frozen concentrated orange juice. (a) Frozen concentrated orange juice is the food prepared by removing water from the juice of mature oranges as provided in § 146.135...

Synthesis and X-ray structure of the dysprosium(III) complex derived ...

African Journals Online (AJOL)

Synthesis and X-ray structure of the dysprosium(III) complex derived from the ligand 5-chloro-1 ... Bulletin of the Chemical Society of Ethiopia ... synthesized and its crystal structure determined by single X-ray diffraction at room temperature.

Phosphor Dysprosium-Doped Layered Double Hydroxides Exchanged with Different Organic Functional Groups

Directory of Open Access Journals (Sweden)

David Ricardo Martínez Vargas

2013-01-01

Full Text Available The layers of a Zn/Al layered double hydroxide (LDH were doped with Dy3+ cations. Among some compositions, the Zn2+ : Al3+ : Dy3+ molar ratio equal to 30 : 9 : 1 presented a single crystalline phase. Organic anions with carboxylic, amino, sulfate, or phosphate functional groups were intercalated as single layers between LDH layers as confirmed by X-ray diffraction and infrared spectroscopy. Photoluminescence spectra of the nitrate intercalated LDH showed a wide emission band with strong intensity in the yellow region (around 574 nm, originated due to symmetry distortion of the octahedral coordination in dysprosium centers. Moreover, a broad red band emission was also detected apparently due to the presence of zinc oxide. The distorted symmetry of the dysprosium coordination environment, also confirmed by X-ray photoelectron spectroscopy analysis, was modified after the intercalation with phenyl phosphonate (PP, aspartate (Asp, adipate (Adip, and serinate (Ser anions; the emission as measured from PL spectra of these LDH was more intense in the blue region (ca. 486 nm, thus indicating an increase in symmetry of dysprosium octahedrons. The red emission band from zinc oxide kept the same intensity after intercalation of dodecyl sulfate (DDS. An additional emission of unknown origin at λ = 767 nm was present in all LDHs.

Neutronography of an intermediate phase in dysprosium near the Neel point

Energy Technology Data Exchange (ETDEWEB)

Bessergenev, V G; Gogava, V V; Kovalevskaya, Yu A; Mandzhavidze, A G; Fedorov, V M; Shilo, S I

1985-11-25

Neutronographical study of dysprosium magnetic structure near the point of magnetic disordering depending on thermal prehistory of the sample is carried out. Intermediate vortex phase transformed then into the helical one is shown to occur from the paramagnetic phase under cooling.

Sandwich-type tetrakis(phthalocyaninato) dysprosium-cadmium quadruple-decker SMM.

Science.gov (United States)

Wang, Hailong; Qian, Kang; Wang, Kang; Bian, Yongzhong; Jiang, Jianzhuang; Gao, Song

2011-09-14

Homoleptic tetrakis[2,3,9,10,16,17,23,24-octa(butyloxy)phthalocyaninato] dysprosium-cadmium quadruple-decker complex 1 was isolated in relatively good yield of 43% from a simple one-pot reaction. This compound represents the first sandwich-type tetrakis(phthalocyaninato) rare earth-cadmium quadruple-decker SMM that has been structurally characterized. This journal is © The Royal Society of Chemistry 2011

Synovectomy of the rheumatoid knee using intra-articular injection of dysprosium-165-ferric hydroxide macroaggregates

International Nuclear Information System (INIS)

Sledge, C.B.; Zuckerman, J.D.; Shortkroff, S.; Zalutsky, M.R.; Venkatesan, P.; Snyder, M.A.; Barrett, W.P.

1987-01-01

One hundred and eleven patients who had seropositive rheumatoid arthritis and persistent synovitis of the knee were treated with intra-articular injection of 270 millicuries of dysprosium-165 bound to ferric hydroxide macroaggregates. A two-year follow-up was available for fifty-nine of the treated knees. Thirty-nine had a good result; nine, a fair result; and eleven, a poor result. Of the twenty-five knees that had Stage-I radiographic changes, nineteen had a good result. Of the thirty-four knees that had Stage-II radiographic changes, twenty showed a good result. Systemic spread of the radioactivity from the injected joint was minimum. The mean whole-body dose was calculated to be 0.3 rad and that to the liver twenty-four hours after injection, 3.2 rads. The results indicated that dysprosium-165-ferric hydroxide macroaggregate is an effective agent for performing radiation synovectomy, particularly in knees that have Stage-I radiographic changes. Because of the minimum rate of systemic spread of the dysprosium-165, it offers a definite advantage over agents that previously have been used

On polymorphism of dysprosium trichloride

International Nuclear Information System (INIS)

Zakiryanova, Irina D.; Khokhlov, Vladimir A.; Salyulev, Alexander B.; Korzun, Iraida V.

2015-01-01

For the first time, the structure of crystalline DyCl 3 over a wide temperature range from room temperature to melting point was studied by Raman spectroscopy. The phonon modes (cm -1 ) of dysprosium trichloride (monoclinic crystal lattice of AlCl 3 type, Z = 4, CN = 6) at room temperature are 257 (A 1g ), 201 (E g ), 112 (E g ), 88 (A 1g ), and 63 (E g ). The monoclinic structure of the crystalline DyCl 3 C 2h 3 symmetry was found to remain constant over the studied temperature range. No polymorphic transformation in the solid state was detected. Gravimetry, calorimetry, and mass spectrometry have been used in addition to support the conclusions made on the basis of Raman spectroscopic data.

Mixed (phthalocyaninato)(Schiff-base) di-dysprosium sandwich complexes. Effect of magnetic coupling on the SMM behavior.

Science.gov (United States)

Wang, Hailong; Liu, Chenxi; Liu, Tao; Zeng, Suyuan; Cao, Wei; Ma, Qi; Duan, Chunying; Dou, Jianmin; Jiang, Jianzhuang

2013-11-21

Reaction between Schiff-base ligand and half-sandwich complex M(Pc)(acac) led to the isolation of new sandwich-type mixed (phthalocyaninato)(Schiff-base) di-lanthanide compounds M2(Pc)2(L)H2O (M = Dy, Gd) (1, 2) [H2Pc = metal free phthalocyanine, Hacac = acetylacetone, H2L = N,N'-bis(3-methyloxysalicylidene)benzene-1,2-diamine] with the triple-decker molecular structure clearly revealed by single crystal X-ray diffraction analysis. For the comparative studies, sandwich triple-decker analogues with pure Schiff-base ligand M2(L)3H2O (M = Dy, Gd) (3, 4) were also prepared. Dynamic magnetic measurement result reveals the single-molecule magnet (SMM) nature of the di-dysprosium derivative 1, while the static magnetic investigation over both pure and the diamagnetic diluted samples of this compound discloses the interionic ferromagnetic coupling between the two dysprosium ions, which in turn effectively suppresses the QTM and enhances the energy barrier of this SMM. Nevertheless, comparative studies over the static magnetic properties of the di-dysprosium triple-decker complexes 1 and 3 indicate the stronger magnetic coupling between the two lanthanide ions in mixed (phthalocyaninato)(Schiff-base) species than in the pure Schiff-base triple-decker analogue, suggesting the special coordination sphere around the dysprosium ions in the former compound over the latter one on the more intense inter-ionic ferromagnetic coupling. As a very small step towards understanding the structure-property relationship, the present result will be surely helpful for the design and synthesis of the multinuclear lanthanide-based SMMs with good properties.

On polymorphism of dysprosium trichloride

Energy Technology Data Exchange (ETDEWEB)

Zakiryanova, Irina D.; Khokhlov, Vladimir A.; Salyulev, Alexander B.; Korzun, Iraida V. [RAS Ural Branch, Ekaterinburg (Russian Federation). Institute of High-Temperature Electrochemistry

2015-07-01

For the first time, the structure of crystalline DyCl{sub 3} over a wide temperature range from room temperature to melting point was studied by Raman spectroscopy. The phonon modes (cm{sup -1}) of dysprosium trichloride (monoclinic crystal lattice of AlCl{sub 3} type, Z = 4, CN = 6) at room temperature are 257 (A{sub 1g}), 201 (E{sub g}), 112 (E{sub g}), 88 (A{sub 1g}), and 63 (E{sub g}). The monoclinic structure of the crystalline DyCl{sub 3} C{sub 2h}{sup 3} symmetry was found to remain constant over the studied temperature range. No polymorphic transformation in the solid state was detected. Gravimetry, calorimetry, and mass spectrometry have been used in addition to support the conclusions made on the basis of Raman spectroscopic data.

Systematic study on surface and magnetostructural changes in Mn-substituted dysprosium ferrite by hydrothermal method

Energy Technology Data Exchange (ETDEWEB)

Rekha, G. [Department of Physics, College of Engineering Guindy, Anna University, Sardar Patel Road, Chennai 600025 (India); Tholkappiyan, R. [Department of Physics, College of Engineering Guindy, Anna University, Sardar Patel Road, Chennai 600025 (India); Department of Physics, College of Science, UAE University, Al-Ain 15551 (United Arab Emirates); Vishista, K., E-mail: raovishista@gmail.com [Department of Physics, College of Engineering Guindy, Anna University, Sardar Patel Road, Chennai 600025 (India); Hamed, Fathalla [Department of Physics, College of Science, UAE University, Al-Ain 15551 (United Arab Emirates)

2016-11-01

Highlights: • Garnet type Dy{sub 3}Fe{sub 5-x}Mn{sub x}O{sub 12} (x = 0–0.06) nanoparticles of 88.4–86.8 nm were synthesized by hydrothermal method. • The Dy, Mn, Fe and O elements in the ferrites were confirmed from XPS. • The multiple oxidation states of Fe and Mn ions, bonding energy and cationic distributions of the samples were examined by XPS. • The magnetic property shows ferromagnetic behavior from VSM technique. • The results from these studies are correlated with respect to Mn dopant. - Abstract: Dysprosium iron garnets are of scientific importance because of the wide range of magnetic properties that can be obtained in substituting dysprosium by a rare earth metal. In the present work, the effect of Mn substitution on magnetostructural changes in dysprosium ferrite nanoparticles is studied. Highly crystalline pure and Mn doped dysprosium ferrite nanoparticles were synthesized by hydrothermal method. The samples were calcined at 1100 °C for 2 h in air atmosphere which is followed by characterization using XRD, FT-IR analysis, SEM, XPS and VSM. The average crystallite size of synthesized samples were calculated by X-ray diffraction falls in the range of 88.4–86.8 nm and was found to be in cubic garnet structure. For further investigation of the structure and corresponding changes in the tetrahedral and octahedral stretching vibrational bonds, FT-IR was used. The synthesized samples consist of multiple oxidation (Fe{sup 3+} and Fe{sup 2+}) states for Fe ions and (Mn{sup 3+} and Mn{sup 2+}) Mn ions analyzed in three ways of Fe 2p and Mn 2p spectra from the XPS analysis. With respect to Mn dopant in Dy{sub 3}Fe{sub 5}O{sub 12}, the cationic distributions of elements were discussed from high resolution XPS spectra by peak position and shift, area, width. To find out the porous/void surface morphology of the sample, scanning electron microscopy was used. From XPS analysis, the presence of elements (Dy, Mn, Fe and O) and their composition in the

Dysprosium (holmium) determination in the presence of erbium and dysprosium (holmium, erbium) determination in the presence of cerium

International Nuclear Information System (INIS)

Tolubara, A.I.; Kochubej, A.I.; Usatenko, Yu.I.

1978-01-01

Effect of salicylic acid upon complex formation in the systems REE - boronsulfoalizarinate, REE - oxine and REE - boronsulfoalizarinate - oxine is investigated. Comparison of optical characteristics of the above systems in the absence and in the presence of salicylic acid is carried out. It is established that in all the cases the effect of salicylic acid depends both on the nature of REE and the ratio of all the components of the system. Under certain conditions the given dependence is observed only for erbium complexes. Extraction-photometric methods of dysprosium and holmium determination in the presence of equal erbium amounts, as well as holmium and erbium determination in the presence of cerium equal amounts is developed

Dysprosium (holmium) determination in the presence of erbium and dysprosium (holmium, erbium) determination in the presence of cerium

Energy Technology Data Exchange (ETDEWEB)

Tolubara, A I; Kochubei, A I; Usatenko, Yu I

1978-01-01

Effect of salicylic acid upon complex formation in the systems REE - boronsulfoalizarinate, REE - oxine and REE - boronsulfoalizarinate - oxine is investigated. Comparison of optical characteristics of the above systems in the absence and in the presence of salicylic acid is carried out. It is established that in all the cases the effect of salicylic acid depends both on the nature of REE and the ratio of all the components of the system. Under certain conditions the given dependence is observed only for erbium complexes. Extraction-photometric methods of dysprosium and holmium determination in the presence of equal erbium amounts, as well as holmium and erbium determination in the presence of cerium equal amounts is developed.

{Delta}I = 2 energy staggering in normal deformed dysprosium nuclei

Energy Technology Data Exchange (ETDEWEB)

Riley, M.A.; Brown, T.B.; Archer, D.E. [Florida State Univ., Tallahassee, FL (United States)] [and others

1996-12-31

Very high spin states (I{ge}50{Dirac_h}) have been observed in {sup 155,156,157}Dy. The long regular band sequences, free from sharp backbending effects, observed in these dysprosium nuclei offer the possibility of investigating the occurence of any {Delta}I = 2 staggering in normal deformed nuclei. Employing the same analysis techniques as used in superdeformed nuclei, certain bands do indeed demonstrate an apparent staggering and this is discussed.

Resonance ionization spectroscopy in dysprosium

Energy Technology Data Exchange (ETDEWEB)

Studer, D., E-mail: dstuder@uni-mainz.de; Dyrauf, P.; Naubereit, P.; Heinke, R.; Wendt, K. [Johannes Gutenberg-Universität Mainz, Institut für Physik (Germany)

2017-11-15

We report on resonance ionization spectroscopy (RIS) of high-lying energy levels in dysprosium. We developed efficient excitation schemes and re-determined the first ionization potential (IP) via analysis of Rydberg convergences. For this purpose both two- and three-step excitation ladders were investigated. An overall ionization efficiency of 25(4) % could be demonstrated in the RISIKO mass separator of Mainz University, using a three-step resonance ionization scheme. Moreover, an extensive analysis of the even-parity 6sns- and 6snd-Rydberg-series convergences, measured via two-step excitation was performed. To account for strong perturbations in the observed s-series, the approach of multichannel quantum defect theory (MQDT) was applied. Considering all individual series limits we extracted an IP-value of 47901.76(5) cm{sup −1}, which agrees with the current literature value of 47901.7(6) cm{sup −1}, but is one order of magnitude more precise.

Simultaneous determination of dysprosium, holmium and erbium in high purity rare earth oxides by second order derivative spectrophotometry

International Nuclear Information System (INIS)

Anbu, M.; Prasada Rao, T.; Iyer, C. S. P.; Damodaran, A. D.

1996-01-01

High purity individual rare earth oxides are increasingly used as major components in lasers (Y 2 O 3 ), phosphors (YVO 3 , Eu 2 O 3 ), magnetic bubble memory films (Gd 2 O 3 ) and refractive-index lenses and fibre optics (La 2 O 3 ). The determination of individual lanthanides in high purity rare earth oxides is a more important and difficult task. This paper reports the utilization of higher order derivative spectrophotometry for the simultaneous determination of dysprosium, holmium and erbium in high purity rare earth oxides. The developed procedure is simple, reliable and allows the determination of 0.001 to 0.2% of dysprosium, holmium and erbium in several rare earth. (author). 9 refs, 2 figs, 2 tabs

Terbium and dysprosium complexes luminescence at low temperatures

Energy Technology Data Exchange (ETDEWEB)

Meshkova, S B; Kravchenko, T B; Kononenko, L.I.; Poluehktov, N S [AN Ukrainskoj SSR, Odessa. Fiziko-Khimicheskij Inst.

1979-01-01

The variation is studied of the luminescence intensity of terbium and dysprosium complexes used in the analysis as solutions are cooled down to the liquid nitrogen temperature. Three groups of methods have been studied: observation of fluorescence of aqueous solutions, precipitate and extract suspensions in organic solvents. The brightest luminescence and greatest increase in luminescence intensity are observed at freezing of complex solvents with 1,2-dioxybenzene-3,5-disulfonic acid (DBSA) and iminodiacetic acid (IDA) and DBSA+EDTA, as well as in the case of benzene extracting of complexes with phenanthroline and salicylic acid. Otherwise the intensity increases 2-14-fold and for the complex of terbium with acetoacetic ester 36-fold.

22 CFR 146.310 - Recruitment.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 146.310 Section 146.310 Foreign... Recruitment Prohibited § 146.310 Recruitment. (a) Nondiscriminatory recruitment. A recipient to which §§ 146.300 through 146.310 apply shall not discriminate on the basis of sex in the recruitment and admission...

A model for additive transport in metal halide lamps containing mercury and dysprosium tri-iodide

NARCIS (Netherlands)

Beks, M.L.; Haverlag, M.; Mullen, van der J.J.A.M.

2008-01-01

The distribution of additives in a metal halide lamp is examined through numerical modelling. A model for a lamp containing sodium iodide additives has been modified to study a discharge containing dysprosium tri-iodide salts. To study the complex chemistry the method of Gibbs minimization is used

The application of x-ray spectrometry to isotopic-source activation analysis of dysprosium and holmium

International Nuclear Information System (INIS)

Pillay, A.E.; Mboweni, R.C.M.

1990-01-01

A novel aspect of activation analysis is described for the determination of dysprosium and holmium at low concentrations. The method involves the measurement of K x-rays from radionuclides produced by thermal neutron activation using a 1 mg 252 Cf source. The basis for elemental selection depends largely on the demand for analysis and on the existence of favourable nuclear properties for the production of a practicable x-ray yield. A full appraisal of the analytical potential of the method is presented with particular emphasis on its application to geological matrices. The sensitivity was optimised by employing a detector that was particularly effective at photon energies below 150 keV. Analytical conditions are demonstrated for the elements of interest over a wide range of concentrations in small powdered samples. The investigation formed the basis of a feasibility study to establish if the application could be developed for the routine off-line determination of dysprosium and holmium using an isotopic-neutron source. (author)

On-line complexation/cloud point preconcentration for the sensitive determination of dysprosium in urine by flow injection inductively coupled plasma-optical emission spectrometry

International Nuclear Information System (INIS)

Ortega, Claudia; Cerutti, Soledad; Silva, Maria F.; Olsina, Roberto A.; Martinez, Luis D.

2003-01-01

An on-line dysprosium preconcentration and determination system based on the hyphenation of cloud point extraction (CPE) to flow injection analysis (FIA) associated with ICP-OES was studied. For the preconcentration of dysprosium, a Dy(III)-2-(5-bromo-2-pyridylazo)-5-diethylaminophenol complex was formed on-line at pH 9.22 in the presence of nonionic micelles of PONPE-7.5. The micellar system containing the complex was thermostated at 30 C in order to promote phase separation, and the surfactant-rich phase was retained in a microcolumn packed with cotton at pH 9.2. The surfactant-rich phase was eluted with 4 mol L -1 nitric acid at a flow rate of 1.5 mL min -1 , directly in the nebulizer of the plasma. An enhancement factor of 50 was obtained for the preconcentration of 50 mL of sample solution. The detection limit value for the preconcentration of 50 mL of aqueous solution of Dy was 0.03 μg L -1 . The precision for 10 replicate determinations at the 2.0 μg L -1 Dy level was 2.2% relative standard deviation (RSD), calculated from the peak heights obtained. The calibration graph using the preconcentration system for dysprosium was linear with a correlation coefficient of 0.9994 at levels near the detection limits up to at least 100 μg L -1 . The method was successfully applied to the determination of dysprosium in urine. (orig.)

47 CFR 80.146 - [Reserved

Science.gov (United States)

2010-10-01

... MARITIME SERVICES Operating Requirements and Procedures Shipboard General Purpose Watches § 80.146 [Reserved] ... 47 Telecommunication 5 2010-10-01 2010-10-01 false [Reserved] 80.146 Section 80.146...

Incinerator carryover tests with dysprosium as a stand-in for plutonium

International Nuclear Information System (INIS)

Hooker, R.L.

1981-11-01

A full-scale (5 kg/h) incinerator is being tested with nonradioactive feed materials which simulate SRP-generator combustible transuranic wastes. The incinerator is two-stage and is designed to provide relatively quiescent conditions in the primary chamber where the ash is formed. This feature should minimize entrainment of Pu-bearing particles into the off-gas system. A series of runs have been completed in which incinerator feed was spiked with dysprosium to simulate Pu. Carryover of Dy into the off-gas system was found to be low (about 1/4%). 4 figures, 3 tables

Graphite furnace atomic absorption spectrometry with a tantalum boat for the determination of yttrium, samarium, and dysprosium in a mish metal

International Nuclear Information System (INIS)

Daidoji, Hidehiro; Tamura, Shohei

1982-01-01

The determination of yttrium, samarium, and dysprodium by means of graphite-furnace atomic absorption spectrometry (AAS) was studied by a tantalum boat inserted into a graphite tube atomizer. These elements could not be determined by the use of a commercial graphite tube, In the atomization from a tantalum boat, better analytical sensitivities and negligible memory effects for these rare earths are obtained. The analytical sensitivities of yttrium, samarium, and dysprodium with the tantalum boat were 0.60 ng, 0.86 ng, and 0.17 ng respectively. This method was applied for the determination of yttrium, samarium, and dysprosium in a mish metal. The measurements were performed with slightly acidified solutions (0.01 mol dm 3 HCI or HNO 3 ). The sensitivities and the precisions for these elements decreased with increasing acid concentration. An enhancement in the sensitivities of yttrium and dysprosium upon the addition of a large excess of lanthanum, neodymium, and praseodymium salts were observed. The yttrium, samarium, and dysprosium in a mish metal were determined with both analytical curves of standard solutions containing an excess of lanthanum, cerium, and neodymium ions and of the standard addition. The precisions for this work were in the 3 - 9.3% range. (author)

7 CFR 1955.146 - Advertising.

Science.gov (United States)

2010-01-01

... 7 Agriculture 14 2010-01-01 2009-01-01 true Advertising. 1955.146 Section 1955.146 Agriculture... REGULATIONS (CONTINUED) PROPERTY MANAGEMENT Disposal of Inventory Property General § 1955.146 Advertising. (a... real estate brokers, it is the servicing official's responsibility to ensure adequate advertising of...

Analysis of the x-ray spectrum emitted by laser-produced plasma of dysprosium

International Nuclear Information System (INIS)

Marcus, Gilad; Louzon, Einat; Henis, Zohar; Maman, Shlomo; Mandelbaum, Pinchas

2007-01-01

A detailed analysis of the x-ray spectrum (5-10.2 A ring ) emitted by laser-produced plasma of dysprosium (Dy) is given using ab initio calculations with the HULLAC relativistic code and isoelectronic trends. Resonance 3d-4p, 3d-nf (n=4 to 7), 3p-4s, and 3p-4d transitions of Ni I-like Dy XXXIX and neighboring ion satellite transitions (from Dy XXXIV to Dy XL) are identified

22 CFR 146.510 - Recruitment.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Recruitment. 146.510 Section 146.510 Foreign... Education Programs or Activities Prohibited § 146.510 Recruitment. (a) Nondiscriminatory recruitment and hiring. A recipient shall not discriminate on the basis of sex in the recruitment and hiring of employees...

22 CFR 146.500 - Employment.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employment. 146.500 Section 146.500 Foreign... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Employment in Education Programs or Activities Prohibited § 146.500 Employment. (a) General. (1) No person shall, on the...

24 CFR 146.35 - Mediation.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Mediation. 146.35 Section 146.35... ASSISTANCE Investigation, Settlement, and Enforcement Procedures § 146.35 Mediation. (a) HUD shall refer to the Federal Mediation and Conciliation Service, a mediation agency designated by the Secretary of...

22 CFR 146.540 - Advertising.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Advertising. 146.540 Section 146.540 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR... Education Programs or Activities Prohibited § 146.540 Advertising. A recipient shall not in any advertising...

Dosimetric properties of dysprosium doped calcium magnesium borate glass subjected to Co-60 gamma ray

Energy Technology Data Exchange (ETDEWEB)

Omar, R. S., E-mail: ratnasuffhiyanni@gmail.com; Wagiran, H., E-mail: husin@utm.my; Saeed, M. A. [Department of Physics, Faculty of Science, Universiti Teknologi Malaysia, 81310 Johor Bahru (Malaysia)

2016-01-22

Thermoluminescence (TL) dosimetric properties of dysprosium doped calcium magnesium borate (CMB:Dy) glass are presented. This study is deemed to understand the application of calcium as the modifier in magnesium borate glass with the presence of dysprosium as the activator to be performed as TL dosimeter (TLD). The study provides fundamental knowledge of a glass system that may lead to perform new TL glass dosimetry application in future research. Calcium magnesium borate glass systems of (70-y) B{sub 2}O{sub 3} − 20 CaO – 10 MgO-(y) Dy{sub 2}O{sub 3} with 0.05  mol % ≤ y ≤ 0.7  mol % of dyprosium were prepared by melt-quenching technique. The amorphous structure and TL properties of the prepared samples were determined using powder X-ray diffraction (XRD) and TL reader; model Harshaw 4500 respectively. The samples were irradiated to Co-60 gamma source at a dose of 50 Gy. Dosimetric properties such as annealing procedure, time temperature profile (TTP) setting, optimization of Dy{sub 2}O{sub 3} concentration of 0.5 mol % were determined for thermoluminescence dosimeter (TLD) reader used.

Kinetic stability of the dysprosium(3) complex with tetraazaporphine in acetic acid-water and acetic acid-methanol mixtures

International Nuclear Information System (INIS)

Khelevina, O.G.; Vojnov, A.A.

1999-01-01

Water-soluble dysprosium tetraazaporphine with acetylacetonate-ion as extraligand is synthesized for the first time. Its kinetic stability in acetic acid solutions is investigated. It is shown that the complex is dissociated with formation of free tetraazaporphine. Kinetic parameters of dissociation reaction are determined [ru

Incorporation of dysprosium ions into PbTiO3 ferroelectric ceramic system

Directory of Open Access Journals (Sweden)

A. Peláiz-Barranco

2015-03-01

Full Text Available A structural analysis concerning the incorporation of dysprosium into A- and/or B-sites of the lead titanate is shown. The two "boundary" refinements are presented, i.e., Dy2+ substitutes for Pb2+ (Dy3+ substitutes for Ti4+ and Dy3+ substitutes for Pb2+ (Dy3+ substitutes for Ti4+. The results offer quantitative information about the incorporation into both crystallographic sites. The increase of Dy3+ fraction into B-site provides the increase of the Ti4+ atomic displacement along the [001] direction and the tetragonal distortion.

22 CFR 146.405 - Housing.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Housing. 146.405 Section 146.405 Foreign... Activities Prohibited § 146.405 Housing. (a) Generally. A recipient shall not, on the basis of sex, apply... benefits related to housing, except as provided in this section (including housing provided only to married...

33 CFR 211.146 - Price.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Price. 211.146 Section 211.146 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE REAL ESTATE... Industrial Facilities § 211.146 Price. No conveyance shall be made for a price less than the fair market...

Proton NMR relaxivity of blood samples in the presence of some gadolinium and dysprosium compounds

International Nuclear Information System (INIS)

Coroiu, I.; Darabont, Al.; Bogdan, M.

1999-01-01

The use of some new compounds in MRI tissue and blood characterisation based on nuclear spin relaxation time measurements cannot be sustained until the molecular sources of these variations are understood. Tissues and blood are complex molecular systems with complex NMR properties. A better comprehension of the molecular basis of relaxation offers the possibility to predict the changes expected for a given pathology. The purpose of this contribution is to evidence the different relaxation characteristics of some gadolinium and dysprosium compounds in the presence and absence of the blood and to give a possible explanation about the molecular processes that cause occurrence of changes. Some gadolinium and dysprosium compounds such as: Gd-CIT (gadolinium citrate), Dy-DTPA (DTPA-diethylenetriamine pentaacetic acid), iron oxide - gadolinium oxide (or dysprosium oxide)- dextran complexes were prepared. The longitudinal T 1 -1 and transverse T 2 -1 'relaxation rates' measurements have been carried out as a function of molar concentrations. All measurements have been made at room temperature (about 25 deg.C) and the proton Larmor frequency ν o = 90 MHz. The pulsed NMR spectrometer utilised was a commercial Bruker SXP4/100 spectrometer. Transverse relaxation rate measurements have been made using the Carr-Purcell method, while longitudinal relaxation rate measurements using the inversion recovery pulse sequence, 180 angle-τ-90 angle. The accuracy was about 2-3% for the longitudinal relaxation rates and about 5-7% for the transverse relaxation rates. R 1 and R 2 relaxivities, in mM -1 s -1 were determined from the least square determination of the slopes of plots 1/T 1,2 versus compound molar concentration, using at least five independent measurements at several concentrations between 0 and 2 mM. Increased R 2 relaxivity observed for dysprosium compounds in the blood presence can be explained by PRE effect. The largest gain in R 2 relaxivity seems to imply a noncovalent

21 CFR 146.141 - Canned orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned orange juice. 146.141 Section 146.141 Food... Beverages § 146.141 Canned orange juice. (a) Canned orange juice is the food prepared from orange juice as specified in § 146.135 or frozen orange juice as specified in § 146.137, or a combination of both, to which...

Photoluminescence study on amino functionalized dysprosium oxide-zinc oxide composite bifunctional nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Joseph, Aswathy; Praveen, G.L; Abha, K.; Lekha, G.M [Department of Chemistry, University of Kerala, Kariavattom, Kerala 695581 (India); George, Sony, E-mail: emailtosony@gmail.com [Department of Chemistry, University of Kerala, Kariavattom, Kerala 695581 (India)

2012-08-15

An organic dispersion of 9-15 nm size stable dysprosium oxide incorporated zinc oxide nanocomposites exhibiting luminescence in the visible region has been synthesised by a wet chemical precipitation technique at room temperature. Tetraethoxysilane TEOS [(C{sub 2}H{sub 5}O){sub 4}Si], (3-aminopropyl) trimethoxysilane (APTS) and a 1:1 mixture of TEOS-APTS have been used as capping agents to control the particle size as well as to achieve uniform dispersion of composite nanoparticles in methanol medium. X-ray diffractometer (XRD) analysis reveals the formation phase of amino-functionalised colloidal dysprosium oxide incorporated ZnO composite nanoparticles to be of zincite structure. The Transmission Electron Microscopy (TEM) images show that the particles are spheroids in shape, having average crystalline sizes ranging from 9 to 15 nm. The photoluminescence (PL) observed in these composites has been attributed to the presence of near band edge excitonic emission and existence of defect centres. The time correlated single photon counting studies of the composite nanoparticles exhibited three decay pathways. The enhanced PL emission intensity of solid state fluorescence spectra of samples is attributed to the absence of vibrational relaxation process. - Highlights: Black-Right-Pointing-Pointer Nano-composites are synthesised using a one step wet chemical precipitation method. Black-Right-Pointing-Pointer A significant fluorescence life time of 8.25 ns is obtained for the nano-composite. Black-Right-Pointing-Pointer Nano-composite particles exhibited pale yellow fluorescence rather than blue. Black-Right-Pointing-Pointer Vibrational cascade free enhanced fluorescence is obtained for the dry sample.

Reduction of titanocene dichloride with dysprosium: access to a stable titanocene(ii) equivalent for phosphite-free Takeda carbonyl olefination.

Science.gov (United States)

Bousrez, G; Déchamps, I; Vasse, J-L; Jaroschik, F

2015-05-28

The reduction of titanocene dichloride with dysprosium yields a new titanocene(ii) equivalent without the need for further stabilising ligands. This reagent can be employed in combination with dithioacetals for the olefination of different carbonyl groups and allows for a simplified all-in-one procedure.

Major conformations of the ligand skeleton of a tetranuclear dysprosium (3) tartrate complex

International Nuclear Information System (INIS)

Chevela, V.V.; Semenov, V.Eh.; Bezryadin, S.G.; Savitskaya, T.V.; Kolesar, I.R.; Matveev, S.N.; Shamov, G.A.

1999-01-01

By the molecular mechanics method (MIND program, stoichiometry was studied and basic conformations of ligand frame of dysprosium (3) tetranuclear complex bis-(d-tartrato) bis-(l-tartrato)tetradysprosiate (3) - anion Dy 4 (d-L) 2 (l-L) 2 4- (1) (d-H 4 L = d-tartaric acid, l-H 4 L = l - tartaric acid) were revealed. It is shown that theoretically calculated mP τ constants for so-called compact conformations of 1, where tartratoligands are in gosh conformation, agree with experimentally obtained constant of paramagnetic birefringence (mP e ) of complex 1 [ru

19 CFR 146.26 - System review.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false System review. 146.26 Section 146.26 Customs... (CONTINUED) FOREIGN TRADE ZONES Inventory Control and Recordkeeping System § 146.26 System review. The operator shall perform an annual internal review of the inventory control and recordkeeping system and...

22 CFR 146.525 - Fringe benefits.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Fringe benefits. 146.525 Section 146.525... Employment in Education Programs or Activities Prohibited § 146.525 Fringe benefits. (a) “Fringe benefits” defined. For purposes of these Title IX regulations, fringe benefits means: Any medical, hospital...

21 CFR 146.140 - Pasteurized orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized orange juice. 146.140 Section 146.140... and Beverages § 146.140 Pasteurized orange juice. (a) Pasteurized orange juice is the food prepared from unfermented juice obtained from mature oranges as specified in § 146.135, to which may be added...

19 CFR 146.3 - Customs supervision.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs supervision. 146.3 Section 146.3 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.3 Customs supervision. (a) Assignment of Customs officers. Customs officers will be...

21 CFR 146.137 - Frozen orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Frozen orange juice. 146.137 Section 146.137 Food... Beverages § 146.137 Frozen orange juice. (a) Frozen orange juice is orange juice as defined in § 146.135, except that it is frozen. (b) The name of the food is “Frozen orange juice”. Such name may be preceded on...

21 CFR 146.145 - Orange juice from concentrate.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice from concentrate. 146.145 Section 146... Juices and Beverages § 146.145 Orange juice from concentrate. (a) Orange juice from concentrate is the food prepared by mixing water with frozen concentrated orange juice as defined in § 146.146 or with...

Automated spectrofluorimetric determinations of terbium and dysprosium in rare earth mixtures

Energy Technology Data Exchange (ETDEWEB)

Lyle, S.J.; Za' tar, N. (Kent Univ., Canterbury (UK))

1983-12-01

Several methods involving the use of water-soluble binary and ternary complexes have been proposed for the spectrofluorimetric determination based on terbium(III) emission at 545 nm. These are terbium(III) with (A) ethylenediamine-N,N'-bis(o-hydroxyphenylacetic acid), (B) o-hydroxyphenyliminodiacetic acid, (C) EDTA + 5-sulphosalicylic acid, (D) EDTA + 1,2-dihydroxybenzene-3,5-disulphonic acid disodium salt (Tiron), and (E) iminodiacetic acid (IDA) + Tiron. Two of the reagent mixtures (D and E) can also be used for the fluorimetric determination of dysprosium(III) at 582 nm. A comparison has been made of these methods in order to select the most satisfactory procedure with respect to selectivity, sensitivity and suitability for adaption to automatic operation. Results are given and discussed.

76 FR 31459 - Airworthiness Directives; BAE SYSTEMS (OPERATIONS) LIMITED Model BAe 146 and Avro 146-RJ Airplanes

Science.gov (United States)

2011-06-01

... crack was present at the time of the embodiment of M-D SB 146-32-150, Part B or Part C, it could... inspections, by embodiment of Messier-Dowty (M-D) Service Bulletin (SB) SB.146-32-150. Later, as part of an... optional closing action of EASA AD 2010-0001-E is embodiment of M-D SB 146-32-150 (polishing and shot...

42 CFR 410.146 - Diabetes outcome measurements.

Science.gov (United States)

2010-10-01

... 42 Public Health 2 2010-10-01 2010-10-01 false Diabetes outcome measurements. 410.146 Section 410.146 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Training and Diabetes Outcome Measurements § 410.146 Diabetes outcome measurements. (a) Information...

21 CFR 146.150 - Canned concentrated orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned concentrated orange juice. 146.150 Section... Fruit Juices and Beverages § 146.150 Canned concentrated orange juice. (a) Canned concentrated orange... labeling of ingredients prescribed for frozen concentrated orange juice by § 146.146, except that it is not...

Dysprosium disilicide nanostructures on silicon(001) studied by scanning tunneling microscopy and transmission electron microscopy

International Nuclear Information System (INIS)

Ye Gangfeng; Nogami, Jun; Crimp, Martin A.

2006-01-01

The microstructure of self-assembled dysprosium silicide nanostructures on silicon(001) has been studied by scanning tunneling microscopy and transmission electron microscopy. The studies focused on nanostructures that involve multiple atomic layers of the silicide. Cross-sectional high resolution transmission electron microscopy images and fast Fourier transform analysis showed that both hexagonal and orthorhombic/tetragonal silicide phases were present. Both the magnitude and the anisotropy of lattice mismatch between the silicide and the substrate play roles in the morphology and epitaxial growth of the nanostructures formed

27 CFR 24.146 - Bonds.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Bonds. 24.146 Section 24.146 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE.... (c) Wine vinegar plant bond. The proprietor of a wine vinegar plant who withdraws wine from a bonded...

19 CFR 146.63 - Entry for consumption.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Entry for consumption. 146.63 Section 146.63... TREASURY (CONTINUED) FOREIGN TRADE ZONES Transfer of Merchandise From a Zone § 146.63 Entry for consumption... status may be entered for consumption from a zone. (b) Zone-restricted merchandise. Merchandise in a zone...

Treatment of rheumatoid synovitis of the knee with intraarticular injection of dysprosium 165-ferric hydroxide macroaggregates

International Nuclear Information System (INIS)

Sledge, C.B.; Zuckerman, J.D.; Zalutsky, M.R.

1986-01-01

One hundred eight knees of 93 patients with seropositive rheumatoid arthritis and persistent synovitis of the knee were treated with an intraarticular injection of 270 mCi of dysprosium 165 bound to ferric hydroxide macroaggregate. Leakage of radioactivity from the injected joint was minimal. Mean leakage to the venous blood 3 hours after injection was 0.11% of the injected dose; this corresponds to a mean whole body dose of 0.2 rads. Mean leakage to the liver 24 hours after injection was 0.64% of the injected dose; this corresponds to a mean liver dose of 3.2 rads. In 7 additional patients examined, there was negligible or near negligible activity found in the draining inguinal lymph nodes. One-year followup was possible for 74 knees (63 patients). Sixty-one percent of the knees had good results, 23% had fair results, and 16% had poor results. There was a direct correlation between the radiographic stage and response to treatment. In knees with stage I radiographic changes, 72% showed good results; 93% showed improvement. In knees with stage II changes, 59% showed good results; 81% showed improvement. These preliminary results indicate that dysprosium 165-ferric hydroxide macroaggregate is an effective agent for radiation synovectomy. The low leakage rates observed offer a definite advantage over agents previously used

21 CFR 146.187 - Canned prune juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Canned prune juice. 146.187 Section 146.187 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR... Beverages § 146.187 Canned prune juice. (a) Canned prune juice is the food prepared from a water extract of...

40 CFR 146.2 - Law authorizing these regulations.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Law authorizing these regulations. 146.2 Section 146.2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM: CRITERIA AND STANDARDS General Provisions § 146.2 Law...

Chemoselective reduction of 1,4,6-cholestatrien-3-one and 1,4,6-androstatriene-3,17-dione by various hydride reagents.

Science.gov (United States)

Kim, Eunjeong; Ma, Eunsook

2007-04-01

The chemoselectivity of rigid cyclic alpha,beta-unsaturated carbonyl group on the reducing agents was influenced by the ring size and steric factor. Cholesterol (cholest-5-en-3beta-ol) and dehydroepiandrosterone (DHEA) were oxidized with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone to form 1,4,6-cholestatrien-3-one and 1,4,6-androstatriene-3,17-dione. They were reduced with NaBH(4), lithium tri-sec-butylborohydride (l-Selectride), LiAlH(4), 9-borabicyclo[3.3.1]nonane (9-BBN), lithium triethylborohydride (Super-hydride), and BH(3) x (CH(3))(2)S in various conditions, respectively. Reduction of 1,4,6-cholestatrien-3-one and 1,4,6-androstatriene-3,17-dione by NaBH(4) (4 equiv.) produced 4,6-cholestadien-3beta-ol and 4,6-androstadiene-3beta,17beta-diol, respectively. Reduction by l-Selectride (12 equiv.) afforded 4,6-cholestadien-3alpha-ol and 4,6-androstadiene-3alpha,17beta-diol, chemoselectively. Reaction with Super-hydride (12 equiv.) produced 4,6-cholestadien-3-one and 3-oxo-4,6-androstadien-17beta-ol. Reduction of 1,4,6-cholestatrien-3-one by 9-BBN (14 equiv.) produced 1,4,6-cholestatrien-3alpha-ol, but 1,4,6-androstatriene-3,17-dione was not reacted with 9-BBN in the reaction conditions. Reaction of LiAlH(4) (6 equiv.) formed 4,6-cholestadien-3beta-ol and 3-oxo-1,4,6-androstatrien-17beta-ol. Reduction of 1,4,6-cholestatrien-3-one by BH(3) x (CH(3))(2)S (11 equiv.) gave cholestane as major compound and unlike reactivity of cholesterol, 1,4,6-androstatriene-3,17-dione by 8 equiv. of BH(3) x (CH(3))(2)S formed 3-oxo-1,4,6-androstatrien-17beta-ol. LiAlH(4) and BH(3) x (CH(3))(2)S showed relatively low chemoselectivity.

Electrocatalytic approach for the efficiency increase of electrolytic hydrogen production: Proof-of-concept using platinum-dysprosium alloys

International Nuclear Information System (INIS)

Santos, D.M.F.; Šljukić, B.; Sequeira, C.A.C.; Macciò, D.; Saccone, A.; Figueiredo, J.L.

2013-01-01

Development of electrocatalytic materials for the hydrogen evolution reaction (HER) is attempted with the aim of reducing the water electrolysis overpotential and increasing its efficiency. Using linear scan voltammetry measurements of the hydrogen discharge enables evaluation of the electrocatalytic activity for the HER of platinum–dysprosium (Pt–Dy) intermetallic alloy electrodes of different compositions. Understanding of materials electrocatalytic performance is based on determination of several crucial kinetic parameters, including the Tafel coefficients, b, charge transfer coefficients, α, exchange current densities, j 0 , and activation energies, E a . Influence of temperature on HER is investigated by performing studies at temperatures ranging from 25 °C to 85 °C. The effect of the Dy amount in the efficiency of the HER on the Pt–Dy alloys is analysed. Results demonstrate that Dy can substantially increase the electrocatalytic activity of the Pt alloys, in comparison to the single Pt electrode. Efforts are made to correlate the microstructure of the alloys with their performance towards the HER. - Highlights: ► Development of electrocatalysts to increase efficiency of electrolytic hydrogen production. ► Synthesis and evaluation of composition and morphology of platinum–dysprosium (Pt–Dy) alloys. ► Hydrogen evolution reaction on Pt–Dy alloys electrodes studied using linear scan voltammetry in alkaline medium. ► Pt–Dy alloy with equiatomic composition enhances kinetics of hydrogen discharge compared to single Pt

Electrochemical behaviour of dysprosium in the eutectic LiCl-KCl at W and Al electrodes

International Nuclear Information System (INIS)

Castrillejo, Y.; Bermejo, M.R.; Barrado, A.I.; Pardo, R.; Barrado, E.; Martinez, A.M.

2005-01-01

The electrochemical behaviour of DyCl 3 was studied in the eutectic LiCl-KCl at different temperatures. The cathodic reaction can be written:Dy(III)+3e-bar Dy(0)which can be divided in two very close cathodic steps:Dy(III)+1e-bar Dy(II)andDy(II)+2e-bar Dy(0)Transient electrochemical techniques, such as cyclic voltammetry, chronopotentiometry, and chronoamperometry were used in order to study the reaction mechanism and the transport parameters of electroactive species at a tungsten electrode. The results showed that in the eutectic LiCl-KCl, electrocrystallization of dysprosium seems to be the controlling electrochemical step. Chronoamperometric studies indicated instantaneous nucleation of dysprosium with three dimensional growth of the nuclei whatever the applied overpotential.Mass transport towards the electrode is a simple diffusion process, and the diffusion coefficient of the electroactive species, i.e. Dy(III), has been calculated. The validity of the Arrhenius law was also verified by plotting the variation of the logarithm of the diffusion coefficient versus 1/T.In addition, the electrode reactions of the LiCl-KCl-DyCl 3 solutions at an Al wire were also investigated by cyclic voltammetry and open circuit chronopotentiometry. The redox potential of the Dy(III)/Dy couple at the Al electrode was observed at more positive potentials values than those at the inert electrode. This potential shift was thermodynamically analyzed by a lowering of activity of Dy in the metal phase due to the formation of intermetallic compounds

22 CFR 146.400 - Education programs or activities.

Science.gov (United States)

2010-04-01

... Basis of Sex in Education Programs or Activities Prohibited § 146.400 Education programs or activities... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Education programs or activities. 146.400 Section 146.400 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX...

19 CFR 146.13 - Customs forms and procedures.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs forms and procedures. 146.13 Section 146.13 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.13 Customs forms and procedures...

19 CFR 146.10 - Authority to examine merchandise.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Authority to examine merchandise. 146.10 Section 146.10 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.10 Authority to examine...

19 CFR 146.51 - Customs control of merchandise.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Customs control of merchandise. 146.51 Section 146.51 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES Handling of Merchandise in a Zone § 146.51 Customs...

10 CFR 72.146 - Design control.

Science.gov (United States)

2010-01-01

... 10 Energy 2 2010-01-01 2010-01-01 false Design control. 72.146 Section 72.146 Energy NUCLEAR... Design control. (a) The licensee, applicant for a license, certificate holder, and applicant for a CoC... shall establish measures for the identification and control of design interfaces and for coordination...

21 CFR 146.151 - Orange juice for manufacturing.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice for manufacturing. 146.151 Section... Fruit Juices and Beverages § 146.151 Orange juice for manufacturing. (a) Orange juice for manufacturing... from oranges as provided in § 146.135, except that the oranges may deviate from the standards for...

21 CFR 146.152 - Orange juice with preservative.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice with preservative. 146.152 Section... Fruit Juices and Beverages § 146.152 Orange juice with preservative. (a) Orange juice with preservative... of orange juice for manufacturing as provided for in § 146.151, except that a preservative is added...

75 FR 38953 - Airworthiness Directives; BAE Systems (OPERATIONS) LIMITED Model BAe 146 and Avro 146-RJ Airplanes

Science.gov (United States)

2010-07-07

... oleo. The AD also provided an optional terminating action for the repetitive inspections, by embodiment... for the repetitive inspections, by embodiment of Messier-Dowty SB.146-32-150. As part of a recent... inspections, by embodiment of Messier-Dowty SB.146-32-150. As part of a recent accident investigation, the...

21 CFR 146.135 - Orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Orange juice. 146.135 Section 146.135 Food and....135 Orange juice. (a) Orange juice is the unfermented juice obtained from mature oranges of the... name of the food is “orange juice”. The name “orange juice” may be preceded on the label by the...

A model for additive transport in metal halide lamps containing mercury and dysprosium tri-iodide

International Nuclear Information System (INIS)

Beks, M L; Haverlag, M; Mullen, J J A M van der

2008-01-01

The distribution of additives in a metal halide lamp is examined through numerical modelling. A model for a lamp containing sodium iodide additives has been modified to study a discharge containing dysprosium tri-iodide salts. To study the complex chemistry the method of Gibbs minimization is used to decide which species have to be taken into account and to fill lookup tables with the chemical composition at different combinations of elemental abundance, lamp pressure and temperature. The results from the model with dysprosium additives were compared with earlier results from the lamp containing sodium additives and a simulation of a pure mercury lamp. It was found that radial segregation creates the conditions required for axial segregation. Radial segregation occurs due to the unequal diffusion of atoms and molecules. Under the right conditions convection currents in the lamp can cause axial demixing. These conditions depend on the ratio of axial convection and radial diffusion as expressed by the Peclet number. At a Peclet number of unity axial segregation is most pronounced. At low Peclet numbers radial segregation is at its worst, while axial segregation is not present. At large Peclet numbers the discharge becomes homogeneously mixed. The degree of axial segregation at a Peclet number of unity depends on the temperature at which the additive under consideration fully dissociates. If the molecules dissociate very close to the walls no molecules are transported by the convective currents in the lamp, and hence axial segregation is limited. If they dissociate further away from the walls in the area where the downward convective currents are strongest, more axial segregation is observed

Dysprosium lithium borate glass mircrospheres for radiation synovectomy: The in vitro and in vivo performance evaluation

Energy Technology Data Exchange (ETDEWEB)

Zhao Di; Yu Jing [Institute of Bioengineering and Information Technology Materials, Center for Advanced Materials and Nano-Biomedicine, Tongji University, Shanghai, 200092 (China); Huang Wenhai, E-mail: whhuang@tongji.edu.cn [Institute of Bioengineering and Information Technology Materials, Center for Advanced Materials and Nano-Biomedicine, Tongji University, Shanghai, 200092 (China); Zhou Nai; Wang Deping [Institute of Bioengineering and Information Technology Materials, Center for Advanced Materials and Nano-Biomedicine, Tongji University, Shanghai, 200092 (China); Yin Wei [Institute of Isotope Research, Sinitic Academy of Atomic Energy, Beijing 102413 (China); Chen Yaqing [The Sixth People' s Hospital, Shanghai 200233 (China)

2010-08-30

The radioactive dysprosium lithium borate glass (DyLB) microspheres with different glass compositions were prepared for radiation synovectomy. The biodegradability and biocompatibility of these DyLB microspheres were evaluated in vitro and in vivo. The DyLB microspheres studied in this work were partially biodegradable in a simulated body fluid (SBF), with the final weight loss of the microspheres in the range of 24.6% and 55.0% (wt.%) after 8 days of immersion. The ICP results revealed that the dissolution of lithium significantly decreased from 100% to 53.7% with increasing content of Dy{sub 2}O{sub 3} in the microspheres from 18% to 22% (wt.%, from S-1 to S-3). However, for all of the three samples, nearly all of the dysprosium (> 99.997%, wt.%) remained in the microspheres, in the form of insoluble phosphates and carbonates, which was proved by the SEM and EDX analyses. The degradation of DyLB microspheres in SBF gradually decreased with immersion time and eventually reached equilibrium after 7 days of immersion. Compared to the other two samples, the S-3 sample with the lowest Dy{sup 3+} dissolution (about 0.002%) was considered more secure for clinical application. Furthermore, the S-3 DyLB microspheres exhibited good biocompatibility, since neither tissue damage nor inflammation was observed, after they were implanted in the liver of rat for two weeks. After neutron activation, the radionuclide purity of radioactive S-3 DyLB microspheres was 99.999%, which were suitable for radiation synovectomy.

Custom Coordination Environments for Lanthanoids: Tripodal Ligands Achieve Near-Perfect Octahedral Coordination for Two Dysprosium-Based Molecular Nanomagnets.

Science.gov (United States)

Lim, Kwang Soo; Baldoví, José J; Jiang, ShangDa; Koo, Bong Ho; Kang, Dong Won; Lee, Woo Ram; Koh, Eui Kwan; Gaita-Ariño, Alejandro; Coronado, Eugenio; Slota, Michael; Bogani, Lapo; Hong, Chang Seop

2017-05-01

Controlling the coordination sphere of lanthanoid complexes is a challenging critical step toward controlling their relaxation properties. Here we present the synthesis of hexacoordinated dysprosium single-molecule magnets, where tripodal ligands achieve a near-perfect octahedral coordination. We perform a complete experimental and theoretical investigation of their magnetic properties, including a full single-crystal magnetic anisotropy analysis. The combination of electrostatic and crystal-field computational tools (SIMPRE and CONDON codes) allows us to explain the static behavior of these systems in detail.

Kinetics of the nitridation of dysprosium during mechanochemical processing

Energy Technology Data Exchange (ETDEWEB)

Alanko, Gordon A.; Osterberg, Daniel D.; Jaques, Brian J. [Department of Materials Science and Engineering, College of Engineering, Boise State University, 1910 University Drive, Boise, ID 83725 (United States); Hurley, Michael F. [Department of Materials Science and Engineering, College of Engineering, Boise State University, 1910 University Drive, Boise, ID 83725 (United States); Center for Advanced Energy Studies, 995 University Boulevard, Idaho Falls, ID 83401 (United States); Butt, Darryl P., E-mail: darrylbutt@boisestate.edu [Department of Materials Science and Engineering, College of Engineering, Boise State University, 1910 University Drive, Boise, ID 83725 (United States); Center for Advanced Energy Studies, 995 University Boulevard, Idaho Falls, ID 83401 (United States)

2015-01-25

Highlights: • DyN was mechanochemically synthesized by milling pure metal under nitrogen. • Temperature and pressure were monitored to investigate reaction progress. • The effects of metal adhered to media on the impact energetics was measured. • The reactive milling kinetics are described in terms of reactive surface formation. - Abstract: Dysprosium nitride was synthesized by the reactive milling of the rare earth metal under 400 kPa nitrogen gas in a planetary ball mill. The nitrogen consumption rate was calculated from in situ temperature and pressure measurements to find the reaction extent as a function of milling time at milling speeds from 350 to 650 rpm. The results are analyzed in terms of a fundamental milling dynamics model in which the input milling energy is the primary driving force for reaction and the rate limiting step of the nitridation kinetics is the formation of chemically active surfaces. The model differs from traditional gas–solid reactions which are often limited by diffusion of a species through a surface layer or by dissociation of the gas molecule. These results give fresh insight into reactive gas–solid milling kinetics.

CD146 Expression Influences Periapical Cyst Mesenchymal Stem Cell Properties.

Science.gov (United States)

Paduano, Francesco; Marrelli, Massimo; Palmieri, Francesca; Tatullo, Marco

2016-10-01

Recent studies have identified a new human dental derived progenitor cell population with multi-lineage differentiation potential referred to as human periapical cyst mesenchymal stem cells (hPCy-MSCs). In the present study, we compared two subpopulations of hPCy-MSCs characterised by the low or high expression of CD146 to establish whether this expression can regulate their stem cell properties. Using flow cytometry, we evaluated the stem cell marker profile of hPCy-MSCs during passaging. Furthermore, CD146 Low and CD146 High cells were sorted by magnetic beads and subsequently both cell populations were evaluated for differences in their proliferation, self-renewal, stem cell surface markers, stemness genes expression and osteogenic differentiation potential.We found that hPCy-MSCs possessed a stable expression of several mesenchymal stem cell surface markers, whereas CD146 expression declined during passaging.In addition, sorted CD146 Low cells proliferated significantly faster, displayed higher colony-forming unit-fibroblast capacity and showed higher expression of Klf4 when compared to the CD146 High subset. Significantly, the osteogenic potential of hPCy-MSCs was greater in the CD146 Low than in CD146 High population. These results demonstrate that CD146 is spontaneously downregulated with passaging at both mRNA and protein levels and that the high expression of CD146 reduces the proliferative, self-renewal and osteogenic differentiation potential of hPCy-MSCs. In conclusion, our study demonstrates that changes in the expression of CD146 can influence the stem cell properties of hPCy-MSCs.

Self-organized dysprosium-directed alginate hydrogels and its chemical features

Energy Technology Data Exchange (ETDEWEB)

Ma, Qianmin [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Gao, Jinwei [Institute for Advanced Materials, Academy of Advanced Optoelectronics, South China Normal University, Guangzhou 510006 (China); Peng, Huojun [School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Wang, Qianming, E-mail: qmwang@scnu.edu.cn [Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Guangzhou Key Laboratory of Materials for Energy Conversion and Storage, Guangzhou 510006 (China)

2016-09-15

Rational use of self-organized materials may contribute in developing new structures and devices in practical technology. Synthetic metallo-supramolecular gels are generally designed with transitional metal-directed process. However, the assembly of both lanthanide and sodium alginate in macromolecular systems would find a new way of utilizing its physical properties. The stimuli-responsive molecule (alginate) could firmly form stable hydrogels upon the encapsulation of dysprosium ions. In addition, the immobilization of YVO{sub 4}: Eu{sup 3+} nanoparticle in the soft matrix has been achieved and it has never been explored in the fabrication of phosphor-incorporated luminescent alginate gels. The key feature of the present soft matter is that its red emission could be switched off in the presence of sodium ascorbate and the results may have a tremendous impact on the extension of photophysical application based on soft nanoscale devices. - Highlights: • Dy{sup 3+} can be used for the gelation of the dissolved alginate. • Lanthanide hydrogels could exhibit red emissions under excitations. • Luminescence could be switched “off” in the presence of sodium ascorbate.

13 CFR 146.500 - Secretary of Defense.

Science.gov (United States)

2010-01-01

... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Secretary of Defense. 146.500 Section 146.500 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW RESTRICTIONS ON LOBBYING..., a covered Federal action from the prohibition whenever the Secretary determines, in writing, that...

13 CFR 146.600 - Semi-annual compilation.

Science.gov (United States)

2010-01-01

... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Semi-annual compilation. 146.600 Section 146.600 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW RESTRICTIONS ON LOBBYING.... (c) Information that involves intelligence matters shall be reported only to the Select Committee on...

Evaluating United States and world consumption of neodymium, dysprosium, terbium, and praseodymium in final products

Science.gov (United States)

Hart, Matthew

This paper develops scenarios of future rare-earth-magnet metal (neodymium, dysprosium, terbium, and praseodymium) consumption in the permanent magnets used in wind turbines and hybrid electric vehicles. The scenarios start with naive base-case scenarios for growth in wind-turbine and hybrid-electric-vehicle sales over the period 2011 to 2020, using historical data for each good. These naive scenarios assume that future growth follows time trends in historical data and does not depend on any exogenous variable. Specifically, growth of each technological market follows historical time trends, and the amount of rare earths used per unit of technology remains fixed. The chosen reference year is 2010. Implied consumptions of the rare earth magnet metals are calculated from these scenarios. Assumptions are made for the material composition of permanent magnets, the market share of permanent-magnet wind turbines and vehicles, and magnet weight per unit of technology. Different scenarios estimate how changes in factors like the material composition of magnets, growth of the economy, and the price of a substitute could affect future consumption. Each scenario presents a different method for reducing rare earth consumption and could be interpreted as potential policy choices. In 2010, the consumption (metric tons, rare-earth-oxide equivalent) of each rare-earth-magnet metal was as follows. Total neodymium consumption in the world for both technologies was 995 tons; dysprosium consumption was 133 tons; terbium consumption was 50 tons; praseodymium consumption was zero tons. The base scenario for wind turbines shows there could be strong, exponential growth in the global wind turbine market. New U.S. sales of hybrid vehicles would decline (in line with the current economic recession) while non-U.S. sales increase through 2020. There would be an overall increase in the total amount of magnetic rare earths consumed in the world. Total consumption of each rare earth in the short

Watt-level dysprosium fiber laser at 315 μm with 73% slope efficiency

Science.gov (United States)

Woodward, R. I.; Majewski, M. R.; Bharathan, G.; Hudson, D. D.; Fuerbach, A.; Jackson, S. D.

2018-04-01

Rare-earth-doped fiber lasers are emerging as promising high-power mid-infrared sources for the 2.6-3.0 {\\mu}m and 3.3-3.8 {\\mu}m regions based on erbium and holmium ions. The intermediate wavelength range, however, remains vastly underserved, despite prospects for important manufacturing and defense applications. Here, we demonstrate the potential of dysprosium-doped fiber to solve this problem, with a simple in-band pumped grating-stabilized linear cavity generating up to 1.06 W at 3.15 {\\mu}m. A slope efficiency of 73% with respect to launched power (77% relative to absorbed power) is achieved: the highest value for any mid-infrared fiber laser to date, to the best of our knowledge. Opportunities for further power and efficiency scaling are also discussed.

Expression patterns of miR-146a and miR-146b in mastitis infected dairy cattle.

Science.gov (United States)

Wang, Xing Ping; Luoreng, Zhuo Ma; Zan, Lin Sen; Raza, Sayed Haidar Abbas; Li, Feng; Li, Na; Liu, Shuan

2016-10-01

This study reports a significant up-regulation of bta-miR-146a and bta-miR-146b expression levels in bovine mammary tissues infected with subclinical, clinical and experimental mastitis. Potential target genes are involved in multiple immunological pathways. These results suggest a regulatory function of both miRNAs for the bovine inflammatory response in mammary tissue. Copyright © 2016 Elsevier Ltd. All rights reserved.

Dicty_cDB: AFO146 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available GTAACAAAAATTAGTAATTTAAAA AAAAAAAAACCAAAAAAAAAAXXXXXXXXXXTGTCGAATGTCCAGATTTCCATANA...AAAAA---------- Length of 5' end seq. 141 3' end seq. ID AFO146Z 3' end seq. >AFO146Z.Seq ----------TGTCGAATGTCCAGATTTCCATANA...AAAAAAGTTAAAATTAAATTTGTAAAATCAATTTGTAACAAAAATTAGTAATTTAAAA AAAAAAAAACCAAAAAAAAAA----------TGTCGAATGTCCAGATTTCCATANA

29 CFR 4.146 - Contract obligations after award, generally.

Science.gov (United States)

2010-07-01

... 29 Labor 1 2010-07-01 2010-07-01 true Contract obligations after award, generally. 4.146 Section 4.146 Labor Office of the Secretary of Labor LABOR STANDARDS FOR FEDERAL SERVICE CONTRACTS Application of the McNamara-O'Hara Service Contract Act Period of Coverage § 4.146 Contract obligations after...

34 CFR 300.146 - Responsibility of SEA.

Science.gov (United States)

2010-07-01

... special education and related services— (1) In conformance with an IEP that meets the requirements of... 34 Education 2 2010-07-01 2010-07-01 false Responsibility of SEA. 300.146 Section 300.146 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF SPECIAL EDUCATION...

19 CFR 146.93 - Inventory control and recordkeeping system.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Inventory control and recordkeeping system. 146.93... § 146.93 Inventory control and recordkeeping system. (a) Attribution. All final products removed from or... provided for under § 146.95(b) of this subpart. (3) Other inventory method. An operator may use the FIFO...

New AMS method to measure the atom ratio {sup 146}Sm/{sup 147}Sm for a half-life determination of {sup 146}Sm

Energy Technology Data Exchange (ETDEWEB)

Kinoshita, N. [Tandem Accelerator Complex, Research Facility Center for Science and Technology, University of Tsukuba (Japan); Paul, M., E-mail: paul@vms.huji.ac.il [Racah Institute of Physics, Hebrew University, Jerusalem 91904 (Israel); Alcorta, M. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Bowers, M.; Collon, P. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); Deibel, C.M. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Joint Institute for Nuclear Astrophysics, Michigan State University, East Lansing, MI 46624 (United States); DiGiovine, B. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Goriely, S. [Universite Libre de Bruxelles, CP-226, Brussels 1050 (Belgium); Greene, J.P.; Henderson, D.J.; Jiang, C.L. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Kashiv, Y. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); Kay, B.P.; Lee, H.Y.; Marley, S.T. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Nakanishi, T. [Faculty of Chemistry, Institute of Science and Engineering, Kanazawa University (Japan); Pardo, R.C.; Patel, N.; Rehm, K.E. [Physics Division, Argonne National Laboratory, Argonne, IL 60439 (United States); Robertson, D. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556-5670 (United States); and others

2013-01-15

The extinct p-process nuclide {sup 146}Sm (t{sub 1/2} = 103 {+-} 5 Myr) is known to have been present in the Early-Solar System and has been proposed as an astrophysical chronometer. {sup 146}Sm is also intensely used to date meteorite and planetary differentiation processes, enhancing the importance of an accurate knowledge of the {sup 146}Sm half-life. We are engaged in a new determination of the {sup 146}Sm half-life in which the {sup 146}Sm/{sup 147}Sm atom ratio is determined by accelerator mass spectrometry at the ATLAS facility of Argonne National Laboratory. In order to reduce systematic errors in the AMS determination of the {sup 146}Sm/{sup 147}Sm ratios (in the range of 10{sup -7}-10{sup -9}), {sup 146}Sm and {sup 147}Sm ions were alternately counted in the same detector in the focal plane of a gas-filled magnet, respectively in continuous-wave and attenuated mode. Quantitative attenuation is obtained with the 12 MHz pulsed and ns-bunched ATLAS beam by chopping beam pulses with an RF sweeper in a ratio (digitally determined) down to 1:10{sup 6}. The experiments and preliminary results are discussed.

Influence of modifiers on the separation of dysprosium from neodymium using organophosphorus acid derivates

Energy Technology Data Exchange (ETDEWEB)

Elwert, Tobias; Schwarz, Sabrina; Goldmann, Daniel [TU Clausthal, Clausthal-Zellerfeld (Germany). Lehrstuhl fuer Rohstoffaufbereitung und Recycling

2016-01-15

The aim of this study was to investigate the applicability of three organophosphorus acid derivates (D2EHPA, EHEHPA and Cyanex 572) for the separation of terbium and dysprosium from praseodymium and neodymium from NdFeB magnets in chloride solution. A special focus was put on the effect of phase modifiers. The investigations revealed that all extractants show in general a similar extraction behavior but the extraction is shifted to higher pH values in the order D2EHPA < EHEHPA < Cyanex 572. Therefore, and due to higher realizable loadings, EHEHPA and Cyanex 572 are more suitable for the investigated separation problem than D2EHPA. Whereas EHEHPA requires 1-decanol as phase modifier, Cyanex 572 can be employed without modifier addition.

Spectrographic determination of dysprosium in doped crystals of calcium sulfate used for dosimetric material

International Nuclear Information System (INIS)

Grigoletto, T.; Lordello, A.R.

1984-01-01

A spectrographic method is described for the quantitative determination of dysprosium in doped crystals of calcium sulphate. The consequences of the changes in some parameters of the excitation conditions, such as arc current, electrode type and total or partial burning of sample, in the analytical results are discussed. Matrix effects are investigated. Variations in the intensity of the spectral lines are verified by recording the spectrum in distinct photographic plates. The role of internal standard in analytical reproducibility and in counterbalance of the variations in the arc current and in the weight of sample is studied. Accuracy is estimated by comparative analysis of two calcium sulphate samples by X-Ray Fluorescence, Neutron Activation and Inductive Coupled Plasma Emission Spectroscopy. (M.A.C.) [pt

Immunohistochemical Expression of MCAM/CD146 in Canine Melanoma.

Science.gov (United States)

Abou Asa, S

2017-07-01

MCAM/CD146 (melanoma cell adhesion molecule/CD146) is a transmembrane immunoglobulin superfamily cell adhesion molecule involved in transendothelial migration and signal transduction. It is expressed in melanoma, squamous cell carcinoma, prostatic, ovarian, cervical and endometrial cancers and promotes tumour growth, angiogenesis and metastasis. Melanoma is the most common malignant oral tumour of dogs and also arises in the skin, nail bed and footpad. The aim of this study was to investigate the immunohistochemical expression of MCAM/CD146 in 51 canine melanomas, including oral, cutaneous and ocular tumours. Seventeen of the 51 (33.3%) cases were negative, eight (15.7%) were weakly positive, seven (13.7%) were moderately positive and 19 (37.3%) were strongly positive. MCAM/CD146 was expressed by both oral and cutaneous melanomas; however, the intensity and the extent of the immunoreactivity was higher in oral (P = 0.009) than in cutaneous tumours (P = 0.058). Most ocular melanomas did not express MCAM/CD146 (P = 0.256). Expression of MCAM/CD146 by canine melanomas may suggest the molecule as a target for treatment, especially in oral melanomas. Copyright © 2017 Elsevier Ltd. All rights reserved.

Low Field Magnetic and Thermal Hysteresis in Antiferromagnetic Dysprosium

Directory of Open Access Journals (Sweden)

Iuliia Liubimova

2017-06-01

Full Text Available Magnetic and thermal hysteresis (difference in magnetic properties on cooling and heating have been studied in polycrystalline Dy (dysprosium between 80 and 250 K using measurements of the reversible Villari effect and alternating current (AC susceptibility. We argue that measurement of the reversible Villari effect in the antiferromagnetic phase is a more sensitive method to detect magnetic hysteresis than the registration of conventional B(H loops. We found that the Villari point, recently reported in the antiferromagnetic phase of Dy at 166 K, controls the essential features of magnetic hysteresis and AC susceptibility on heating from the ferromagnetic state: (i thermal hysteresis in AC susceptibility and in the reversible Villari effect disappears abruptly at the temperature of the Villari point; (ii the imaginary part of AC susceptibility is strongly frequency dependent, but only up to the temperature of the Villari point; (iii the imaginary part of the susceptibility drops sharply also at the Villari point. We attribute these effects observed at the Villari point to the disappearance of the residual ferromagnetic phase. The strong influence of the Villari point on several magnetic properties allows this temperature to be ranked almost as important as the Curie and Néel temperatures in Dy and likely also for other rare earth elements and their alloys.

The liquid membrane for extraction of Yttrium and Dysprosium from Acid Nitric

International Nuclear Information System (INIS)

Johny, W.S.; Raldi-Artono-Koestoer; Kris-Tri-Basuki; Sudibyo

1996-01-01

The determination of surfactant in liquid membrane has been done. The surfactant is span-80 (sorbitol-monooleate), the liquid membrane phase was the organic phase (O), the internal liquid phase (W) with ratio O/W = 1, and surfactant. The organic phase using D 2 EHPA in the kerosene and the internal liquid phase using aqua des or acid nitric. The determination of surfactant with variation of span-80 (0,25 - 2%) in the liquid membrane volume. The speed of stirrer was 3500 rpm in 20 minute. The ratio of liquid membrane phase form and external phase (aqua des or acid nitric) was 1, the speed of stirrer was 350 rpm in 10 minute (permeation process). The liquid phase and the liquid membrane phase was separated and then determinated the volume of liquid membrane, the result of percentage of span-80 was 0,25 % volume. The extraction of yttrium and dysprosium in 2 M HNO 3 was Kd y = 2.945 and Kd D y = 0.019

Design and validation of a photon insensitive multidetector neutron spectrometer based on Dysprosium activation foils

International Nuclear Information System (INIS)

Gómez-Ros, J.M.; Bedogni, R.; Palermo, I.; Esposito, A.; Delgado, A.; Angelone, M.; Pillon, M.

2011-01-01

This communication describes a photon insensitive passive neutron spectrometer consisting of Dysprosium (Dy) activation foils located along three perpendicular axes within a single moderating polyethylene sphere. The Monte Carlo code MCNPX 2.6 was used to optimize the spatial arrangement of the detectors and to derive the spectrometer response matrix. Nearly isotropic response in terms of neutron fluence for energies up to 20 MeV was obtained by combining the readings of the detectors located at the same radius value. The spectrometer was calibrated using a previously characterized 14 MeV neutron beam produced in the ENEA Frascati Neutron Generator (FNG). The overall uncertainty of the spectrometer response matrix at 14 MeV, assessed on the basis of this experiment, was ±3%.

Optical amplifier operating at 1.3 microns useful for telecommunications and based on dysprosium-doped metal chloride host materials

Energy Technology Data Exchange (ETDEWEB)

Page, R.H.; Schaffers, K.I.; Payne, S.A.; Krupke, W.F.; Beach, R.J.

1997-12-02

Dysprosium-doped metal chloride materials offer laser properties advantageous for use as optical amplifiers in the 1.3 {micro}m telecommunications fiber optic network. The upper laser level is characterized by a millisecond lifetime, the host material possesses a moderately low refractive index, and the gain peak occurs near 1.31 {micro}m. Related halide materials, including bromides and iodides, are also useful. The Dy{sup 3+}-doped metal chlorides can be pumped with laser diodes and yield 1.3 {micro}m signal gain levels significantly beyond those currently available. 9 figs.

Optical amplifier operating at 1.3 microns useful for telecommunications and based on dysprosium-doped metal chloride host materials

Energy Technology Data Exchange (ETDEWEB)

Page, Ralph H. (San Ramon, CA); Schaffers, Kathleen I. (Pleasanton, CA); Payne, Stephen A. (Castro Valley, CA); Krupke, William F. (Pleasanton, CA); Beach, Raymond J. (Livermore, CA)

1997-01-01

Dysprosium-doped metal chloride materials offer laser properties advantageous for use as optical amplifiers in the 1.3 .mu.m telecommunications fiber optic network. The upper laser level is characterized by a millisecond lifetime, the host material possesses a moderately low refractive index, and the gain peak occurs near 1.31 .mu.m. Related halide materials, including bromides and iodides, are also useful. The Dy.sup.3+ -doped metal chlorides can be pumped with laser diodes and yield 1.3 .mu.m signal gain levels significantly beyond those currently available.

Investigation on rare earth magnets recycling by organophosphoric extractant encapsulated polymeric beads for separation of dysprosium

International Nuclear Information System (INIS)

Yadav, Kartikey K.; Singh, D.K.; Kain, V.

2017-01-01

Rare earth elements (REEs) are a basic requirement of the electronics and new industries including green technology. In the present work an organophosphoric extractant encapsulating polyethersulfone (PES) beads has been developed and employed for dysprosium (Dy) separation from aqueous stream. Polyethersulfonic beads encapsulating PC88A were prepared by phase inversion method. During the synthesis of the beads, preparatory parameters were also optimized to obtain best suited beads which were subsequently characterized for their encapsulation capacity and micro structural investigation. The results obtained in the present investigation suggested that PES/PVAJPC88A composite beads could be used for separation of rare earths from aqueous medium obtained from the solubilisation of magnetic scrap materials

CD146 positive human dental pulp stem cells promote regeneration of dentin/pulp-like structures.

Science.gov (United States)

Matsui, Mikiko; Kobayashi, Tomoko; Tsutsui, Takeo W

2018-04-01

CD146 and STRO-1 are endothelial biomarkers that are co-expressed on the cellular membranes of blood vessels within human dental pulp tissue. This study characterized the percentage of dentin-like structures produced by CD146-positive (CD146 + ) human dental pulp stem cells (DPSCs), compared with their CD146-negative (CD146 - ) counterparts. DPSC populations were enriched using magnetic-activated cell sorting (MACS), yielding CD146 + and CD146 - cells, as well as mixtures composed of 25% CD146 + cells and 75% CD146 - cells (CD146 +/- ). Cell growth assays indicated that CD146 + cells exhibit an approximate 3-4 h difference in doubling time, compared with CD146 - cells. Cell cycle distributions were determined by flow cytometry analysis. The low percentage of CD146 + cells' DNA content in G 0 /G 1 phase were compared with CD146 - and non-separated cells. In contrast to CD146 - and non-separated cells, prompt mineralization was observed in CD146 + cells. Subsequently, qRT-PCR revealed high mRNA expression of CD146 and Alkaline phosphatase in mineralization-induced CD146 + cells. CD146 + cells were also observed high adipogenic ability by Oil red O staining. Histological examinations revealed an increased area of dentin/pulp-like structures in transplanted CD146 + cells, compared with CD146 - and CD146 +/- cells. Immunohistochemical studies detected dentin matrix protein-1 (DMP1) and dentin sialophosphoprotein (DSPP), as well as human mitochondria, in transplanted DPSCs. Co-expression of CD146 and GFP indicated that CD146 was expressed in transplanted CD146 + cells. CD146 + cells may promote mineralization and generate dentin/pulp-like structures, suggesting a role in self-renewal of stem cells and dental pulp regenerative therapy.

33 CFR 146.120 - Manning of survival craft.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Manning of survival craft. 146.120 Section 146.120 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... craft. The owner, the owner's agent, or the person in charge shall assign a person to each life float...

22 CFR 146.455 - Textbooks and curricular material.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Textbooks and curricular material. 146.455 Section 146.455 Foreign Relations DEPARTMENT OF STATE CIVIL RIGHTS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities...

Levels in 146Ce and the N = 88 isotones

International Nuclear Information System (INIS)

Gowdy, G.M.; Chrien, R.E.; Chu, Y.Y.

1981-01-01

An investigation of the level structure of 146 Ce following the beta decay of the low-spin isomer of 146 La has been carried out at the ISOL facility TRISTAN at Brookhaven National Laboratory. The half-life for the low spin isomer was found to be 6.0 +- 0.4s. A partial level scheme for 146 Ce below 2 MeV is given. The level energies and some B(E2) values extracted from our data have been compared with IBA-2 calculations done entirely with extrapolated parameters from neighboring Z nuclei in order to check the predictive power of the model. Systematics of the Z = 58 isotopes and N = 88 isotones indicate that although 146 Ce is more deformed than its isotones with Z greater than or equal to 60, the transition to the well-deformed region can probably more correctly be thought to occur after 146 Ce, between N = 88 and N = 90, as it does for Z greater than or equal to 60. The abrupt onset of deformation present in the higher Z isotopes is not seen in the Ce isotopes where the trend is found to be rather smooth throughout

Excited states in 146Sm and 147Sm

International Nuclear Information System (INIS)

Kownacki, J.; Sujkowski, Z.; Hammaren, E.; Liukkonen, E.; Piiparinen, M.; Lindblad, Th.; Ryde, H.

1979-10-01

The sup(144,146)Nd(α,xn) and sup(146,148)Nd( 3 He,xn) reactions with Esub(α) = 20 - 43 MeV and E 3 sub(He) = 19 - 27 MeV are used to investigate excited states in the isotopes 146 Sm and 147 Sm. The experiments involve measurements of singles γ-ray spectra and conversion electron spectra, γ-ray angular distributions and three parameter (E sub(γ)E sub(γ) time) coincidences. From these experiments information is obtained for states with spin up to I = 13 + and I = 27/2 - , respectively, These states are interpeted within the framework of the cluster-vibration model (CVM) as well as the shell model. (author)

29 CFR 1990.146 - Issues to be considered in the rulemaking.

Science.gov (United States)

2010-07-01

... 29 Labor 9 2010-07-01 2010-07-01 false Issues to be considered in the rulemaking. 1990.146 Section 1990.146 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION... CARCINOGENS Regulation of Potential Occupational Carcinogens § 1990.146 Issues to be considered in the...

Global use structures of the magnetic materials neodymium and dysprosium. A scenario-based analysis of the effect of the diffusion of electromobility on the demand for rare earths; Globale Verwendungsstrukturen der Magnetwerkstoffe Neodym und Dysprosium. Eine szenariobasierte Analyse der Auswirkung der Diffusion der Elektromobilitaet auf den Bedarf an Seltenen Erden

Energy Technology Data Exchange (ETDEWEB)

Gloeser-Chahoud, Simon; Kuehn, Andre; Tercero Espinoza, Luis

2016-06-15

Neodymium-iron-boron magnets (NdFeB) have experienced a significant demand as the most powerful permanent magnet in recent years, especially for the manufacture of compact electric servomotors with high efficiency and high power density, especially for mobile applications in hybrid traction motors and electric vehicles or for electric bikes. However, NdFeB magnets are also increasingly being used in general mechanical engineering (conveying and pumping systems, tools, air conditioning systems, lift motors, etc.), in the small electric motors of conventional passenger cars or in the generators of large wind power plants with permanent magnetic direct drive. Nevertheless, there is still high uncertainty in the use structures of NdFeB magnets and the contained rare earth elements neodymium and dysprosium. An effective instrument for increasing the market transparency and the understanding of complex anthropogenic material cycles is the dynamic material flow modeling. In the present work paper, this instrument is used for an in-depth analysis of the use structures of NdFeB magnets and the contained rare earths on a global scale. The dynamic modeling of product usage cycles reveals today's usage structures and quantifies future magnetic quantities in obsolete product flows. It could be shown that the magnets in today's scrap volume are mainly contained in obsolete electronics applications such as hard disks (HDD), CD and DVD drives, which makes the recycling hardly seem to be economical due to the small magnets and the high material spread, but in the foreseeable future with larger magnetic quantities from synchronous servomotors and generators can be expected, which significantly increases the recycling potential. In a further step, the effect of the diffusion of alternative drives in the automotive market on the dysprosium requirement is analyzed using a system dynamics model and possible adaptation mechanisms in the form of different substitution effects in

Dysregulation of endothelial colony-forming cell function by a negative feedback loop of circulating miR-146a and -146b in cardiovascular disease patients.

Directory of Open Access Journals (Sweden)

Ting-Yu Chang

Full Text Available Functional impairment of endothelial colony-forming cells (ECFCs, a specific cell lineage of endothelial progenitor cells (EPCs is highly associated with the severity of coronary artery disease (CAD, the most common type of cardiovascular disease (CVD. Emerging evidence show that circulating microRNAs (miRNAs in CAD patients' body fluid hold a great potential as biomarkers. However, our knowledge of the role of circulating miRNA in regulating the function of ECFCs and the progression of CAD is still in its infancy. We showed that when ECFCs from healthy volunteers were incubated with conditioned medium or purified exosomes of cultured CAD ECFCs, the secretory factors from CAD ECFCs dysregulated migration and tube formation ability of healthy ECFCs. It is known that exosomes influence the physiology of recipient cells by introducing RNAs including miRNAs. By using small RNA sequencing (smRNA-seq, we deciphered the circulating miRNome in the plasma of healthy individual and CAD patients, and found that the plasma miRNA spectrum from CAD patients was significantly different from that of healthy control. Interestingly, smRNA-seq of both healthy and CAD ECFCs showed that twelve miRNAs that had a higher expression in the plasma of CAD patients also showed higher expression in CAD ECFCs when compared with healthy control. This result suggests that these miRNAs may be involved in the regulation of ECFC functions. For identification of potential mRNA targets of the differentially expressed miRNA in CAD patients, cDNA microarray analysis was performed to identify the angiogenesis-related genes that were down-regulated in CAD ECFCs and Pearson's correlation were used to identify miRNAs that were negatively correlated with the identified angiogenesis-related genes. RT-qPCR analysis of the five miRNAs that negatively correlated with the down-regulated angiogenesis-related genes in plasma and ECFC of CAD patients showed miR-146a-5p and miR-146b-5p up

Optical properties of zinc borotellurite glass doped with trivalent dysprosium ion

Science.gov (United States)

Ami Hazlin, M. N.; Halimah, M. K.; Muhammad, F. D.; Faznny, M. F.

2017-04-01

The zinc borotellurite doped with dysprosium oxide glass samples with chemical formula {[(TeO2) 0 . 7(B2O3) 0 . 3 ] 0 . 7(ZnO) 0 . 3 } 1 - x(Dy2O3)x (where x=0.01, 0.02, 0.03, 0.04 and 0.05 M fraction) were prepared by using conventional melt quenching technique. The structural and optical properties of the proposed glass systems were characterized by using X-ray diffraction (XRD) spectroscopy, Fourier Transform Infrared (FTIR) spectroscopy, and UV-VIS spectroscopy. The amorphous nature of the glass systems is confirmed by using XRD technique. The infrared spectra of the glass systems indicate three obvious absorption bands which are assigned to BO3 and TeO4 vibrational groups. Based on the absorption spectra obtained, the direct and indirect optical band gaps, as well as the Urbach energy were calculated. It is observed that both the direct and indirect optical band gaps increase with the concentration of Dy3+ ions. On the other hand, the Urbach energy is observed to decrease as the concentration of Dy3+ ions increases.

Spectrographic determination of dysprosium dopant in calcium sulphate used as dosimetric material

International Nuclear Information System (INIS)

Grigoletto, T.

1982-01-01

A spectrographic method is described for the quantitative determination of dysprosium in doped crystals of calcium sulphate. The consequences of the changes in some parameters of the excitation conditions, such as arc current, electrode type and total or partial burning of sample, in the analytical results are discussed. Matrix effects are investigated by comparison among analytical curves obtained from three different methods of standard preparations. Variations in the intensity of the spectral lines are verificated by recording the spectrum in distinct photographic plates (SA-1). The role of internal standard in analytical reproducibility and in counterbalance of the variations in the arc current and in the weight of sample are studied. The great similarity in excitation behavior of many of the rare earths is used to provide a high degree of internal standardization. Precision studies show a standard deviation of about + - 2,4 percent by use of lanthanum as an internal standard. Accuracy is estimate by comparative analysis of two calcium sulphate samples by X-Rays Fluorescence, Neutron Activation and Inductive Coupled Plasma (ICP) Emission Spectroscopy. (Author) [pt

40 CFR 146.9 - Criteria for establishing permitting priorities.

Science.gov (United States)

2010-07-01

....9 Criteria for establishing permitting priorities. In determining priorities for setting times for... priorities. 146.9 Section 146.9 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER... (a), (c), (g) or § 144.22(f), the Director shall base these priorities upon consideration of the...

On the annealing behaviour of dysprosium ion implanted nickel: a combined study using Rutherford backscattering, transmission electron microscopy, and total current spectroscopy

International Nuclear Information System (INIS)

Chadderton, L.T.; Johnson, E.

1977-01-01

Despite continuing improvements in applications of the analytical method of Rutherford backscattering (RBS) to solid state physics it is recognized that more complete information can be obtained if other techniques - for example transmission electron microscopy (TEM) - are employed simultaneously. Experiments are described in which a combined RBS and TEM study of the annealing of nickel, rendered amorphous by implantation of 20 keV dysprosium ions is supplemented with a completely new technique - total current spectroscopy (TCS). In TCS low energy electrons (0-15 eV) are used to probe the damaged nickel. Observations have been made during annealing of both the reappearance of the bulk band structure of the metal and of a 'surface peak' which is highly sensitive to the recovery process. Changes in the height of the surface peak reveal three sharp annealing stages, the first two being preceded by reverse annealing which correlates well with RBS and TEM results. The first annealing stage - following the amorphous to crystalline transition - may be associated with electronic effects in the vicinity of the Curie point. Changes in the position of the surface peak allow one to trace the diffusion of dysprosium to the surface. Quantum mechanical resonances at the damage/crystal interface have also been followed throughout annealing. The initially amorphous layer (approximately 2.2nm) increases in thickness slightly during recovery. (Auth.)

21 CFR 146.154 - Concentrated orange juice with preservative.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Concentrated orange juice with preservative. 146... Canned Fruit Juices and Beverages § 146.154 Concentrated orange juice with preservative. (a) Concentrated orange juice with preservative complies with the requirements for composition and labeling of optional...

7 CFR 1260.146 - Vacancies.

Science.gov (United States)

2010-01-01

... Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE BEEF PROMOTION AND RESEARCH Beef Promotion and Research Order Cattlemen's Beef Promotion and Research Board § 1260.146 Vacancies. To fill any...

19 CFR 146.61 - Constructive transfer to Customs territory.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Constructive transfer to Customs territory. 146.61 Section 146.61 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY... Constructive transfer to Customs territory. The port director shall accept receipt of any entry in proper form...

9 CFR 146.33 - Terminology and classification; meat-type chicken slaughter plants.

Science.gov (United States)

2010-01-01

...-type chicken slaughter plants. 146.33 Section 146.33 Animals and Animal Products ANIMAL AND PLANT... PLAN FOR COMMERCIAL POULTRY Special Provisions for Meat-Type Chicken Slaughter Plants § 146.33 Terminology and classification; meat-type chicken slaughter plants. Participating meat-type chicken slaughter...

Watt-level dysprosium fiber laser at 3.15  μm with 73% slope efficiency.

Science.gov (United States)

Woodward, R I; Majewski, M R; Bharathan, G; Hudson, D D; Fuerbach, A; Jackson, S D

2018-04-01

Rare-earth-doped fiber lasers are emerging as promising high-power mid-infrared sources for the 2.6-3.0 μm and 3.3-3.8 μm regions based on erbium and holmium ions. The intermediate wavelength range, however, remains vastly underserved, despite prospects for important manufacturing and defense applications. Here, we demonstrate the potential of dysprosium-doped fiber to solve this problem, with a simple in-band pumped grating-stabilized linear cavity generating up to 1.06 W at 3.15 μm. A slope efficiency of 73% with respect to launched power (77% relative to absorbed power) is achieved-the highest value for any mid-infrared fiber laser to date, to the best of our knowledge. Opportunities for further power and efficiency scaling are also discussed.

22 CFR 146.105 - Definitions.

Science.gov (United States)

2010-04-01

... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.105 Definitions. As used in these Title... financial assistance, or by a recipient, as a condition to becoming a recipient. Designated agency official... education, or an institution of vocational education, as defined in this section. Federal financial...

11 CFR 100.146 - Legal or accounting services to other political committees.

Science.gov (United States)

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false Legal or accounting services to other political committees. 100.146 Section 100.146 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) Exceptions to Expenditures § 100.146 Legal or accounting services to other...

Synergistic Effect of MiR-146a Mimic and Cetuximab on Hepatocellular Carcinoma Cells

Directory of Open Access Journals (Sweden)

Suning Huang

2014-01-01

Full Text Available Previously, we found that the expression of microRNA-146a (miR-146a was downregulated in hepatocellular carcinoma (HCC formalin-fixed paraffin-embedded (FFPE tissues compared to the adjacent noncancerous hepatic tissues. In the current study, we have explored the in vitro effect of miR-146a on the malignant phenotypes of HCC cells. MiR-146a mimic could suppress cell growth and increase cellular apoptosis in HCC cell lines HepG2, HepB3, and SNU449, as assessed by spectrophotometry, fluorimetry, and fluorescence microscopy, respectively. Furthermore, western blot showed that miR-146a mimic downregulated EGFR, ERK1/2, and stat5 signalings. These effects were less potent compared to that of a siRNA targeting EGFR, a known target gene of miR-146a. Moreover, miR-146a mimic could enhance the cell growth inhibition and apoptosis induction impact of various EGFR targeting agents. The most potent combination was miR-146a mimic with cetuximab, presenting a synergistic effect. In conclusion, miR-146a plays a vital role in the cell growth and apoptosis of HCC cells and inducing miR-146a level might be a critical targeted molecular therapy strategy for HCC.

Synergistic effect of MiR-146a mimic and cetuximab on hepatocellular carcinoma cells.

Science.gov (United States)

Huang, Suning; He, Rongquan; Rong, Minhua; Dang, Yiwu; Chen, Gang

2014-01-01

Previously, we found that the expression of microRNA-146a (miR-146a) was downregulated in hepatocellular carcinoma (HCC) formalin-fixed paraffin-embedded (FFPE) tissues compared to the adjacent noncancerous hepatic tissues. In the current study, we have explored the in vitro effect of miR-146a on the malignant phenotypes of HCC cells. MiR-146a mimic could suppress cell growth and increase cellular apoptosis in HCC cell lines HepG2, HepB3, and SNU449, as assessed by spectrophotometry, fluorimetry, and fluorescence microscopy, respectively. Furthermore, western blot showed that miR-146a mimic downregulated EGFR, ERK1/2, and stat5 signalings. These effects were less potent compared to that of a siRNA targeting EGFR, a known target gene of miR-146a. Moreover, miR-146a mimic could enhance the cell growth inhibition and apoptosis induction impact of various EGFR targeting agents. The most potent combination was miR-146a mimic with cetuximab, presenting a synergistic effect. In conclusion, miR-146a plays a vital role in the cell growth and apoptosis of HCC cells and inducing miR-146a level might be a critical targeted molecular therapy strategy for HCC.

STUDY OF THE HIGH-SPIN STRUCTURE OF PM-146

NARCIS (Netherlands)

RZACAURBAN, T; DURELL, JL; PHILLIPS, WR; VARLEY, BJ; HESS, CP; PEARSON, CJ; VERMEER, WJ; VIEU, C; DIONISIO, JS; PAUTRAT, M; Urban, W

1995-01-01

Excited states in Pm-146 have been investigated through the Xe-136(N-15,5n) and the Nd-146(d,xn) compound-nucleus reactions. A level scheme extending up to 6.9 MeV of excitation energy and (I = 25HBAR) is proposed. Most of the high-spin levels are interpreted in terms of multi-particle-hole states

19 CFR 146.8 - Seals, authority of operator to break and affix.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Seals, authority of operator to break and affix. 146.8 Section 146.8 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.8 Seals, authority of...

14 CFR 1260.146 - Procurement records.

Science.gov (United States)

2010-01-01

... Higher Education, Hospitals, and Other Non-Profit Organizations Procurement Standards § 1260.146... of competition when competitive bids or offers are not obtained, and (c) Basis for award cost or price. ...

27 CFR 44.146 - Closing.

Science.gov (United States)

2010-04-01

... PAYMENT OF TAX, OR WITH DRAWBACK OF TAX Operations by Export Warehouse Proprietors Inventories § 44.146 Closing. A closing inventory shall be made by the export warehouse proprietor when he transfers ownership or concludes business. Where the proprietor transfers ownership the closing inventory shall be made...

Association of microRNA 146 with middle ear hyperplasia in pediatric otitis media.

Science.gov (United States)

Samuels, Tina L; Yan, Justin; Khampang, Pawjai; MacKinnon, Alexander; Hong, Wenzhou; Johnston, Nikki; Kerschner, Joseph E

2016-09-01

Toll-like receptor signaling activated by bacterial otitis media pathogens in the middle ear has been shown to play a key role in OM susceptibility, pathogenesis and recovery. Recent studies implicate microRNA 146 (miR-146) in regulation of inflammation via negative feedback of toll-like receptor signaling (TLR) in a wide variety of tissues, however its involvement in otitis media is unknown. Human middle ear epithelial cells were stimulated with proinflammatory cytokines, interleukin 1 beta or tumor necrosis factor alpha, for two to twenty-four hours. Middle ear biopsies were collected from children with otitis media with effusion (n = 20), recurrent otitis media (n = 9), and control subjects undergoing cochlear implantation (n = 10). miR-146a, miR-146b expression was assayed by quantitative PCR (qPCR). Expression of miR-146 targets involved in TLR signaling, IRAK1 and TRAF6, was assayed by qPCR in middle ear biopsies. Middle ear biopsies were cryosectioned and epithelial thickness measured by a certified pathologist. Proinflammatory cytokines induced expression of miR-146 in middle ear epithelial cells in vitro. Middle ear miR-146a and miR-146b expression was elevated in otitis media patients relative to control subjects and correlated with middle ear epithelial thickness. A trend towards inverse correlation was observed between miR-146 and TRAF6 expression in the clinical population. This report is the first to assess miRNA expression in a clinical population with OM. Findings herein suggest miR-146 may play a role in OM. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Transcriptional regulation of miR-146b by C/EBPβ LAP2 in esophageal cancer cells

International Nuclear Information System (INIS)

Li, Junxia; Shan, Fabo; Xiong, Gang; Wang, Ju-Ming; Wang, Wen-Lin; Xu, Xueqing; Bai, Yun

2014-01-01

Highlights: • MiR-146b promotes esophageal cancer cell proliferation. • MiR-146b inhibits esophageal cancer cell apoptosis. • C/EBPβ directly binds to miR-146b promoter conserved region. • MiR-146b is up-regulated by C/EBPβ LAP2 transcriptional activation. - Abstract: Recent clinical study indicated that up-regulation of miR-146b was associated with poor overall survival of patients in esophageal squamous cell carcinoma. However, the underlying mechanism of miR-146b dysregulation remains to be explored. Here we report that miR-146b promotes cell proliferation and inhibits cell apoptosis in esophageal cancer cell lines. Mechanismly, two C/EBPβ binding motifs are located in the miR-146b promoter conserved region. Among the three isoforms of C/EBPβ, C/EBPβ LAP2 positively regulated miR-146b expression and increases miR-146b levels in a dose-dependent manner through transcription activation of miR-146b gene. Together, these results suggest a miR-146b regulatory mechanism involving C/EBPβ, which may contribute to the up-regulation of miR-146b in esophageal squamous cell carcinoma

Magnetic anisotropy of dysprosium(III) in a low-symmetry environment: a theoretical and experimental investigation.

Science.gov (United States)

Bernot, Kevin; Luzon, Javier; Bogani, Lapo; Etienne, Mael; Sangregorio, Claudio; Shanmugam, Muralidharan; Caneschi, Andrea; Sessoli, Roberta; Gatteschi, Dante

2009-04-22

A mixed theoretical and experimental approach was used to determine the local magnetic anisotropy of the dysprosium(III) ion in a low-symmetry environment. The susceptibility tensor of the monomeric species having the formula [Dy(hfac)(3)(NIT-C(6)H(4)-OEt)(2)], which contains nitronyl nitroxide (NIT-R) radicals, was determined at various temperatures through angle-resolved magnetometry. These results are in agreement with ab initio calculations performed using the complete active space self-consistent field (CASSCF) method, validating the predictive power of this theoretical approach for complex systems containing rare-earth ions, even in low-symmetry environments. Susceptibility measurements performed with the applied field along the easy axis eventually permitted a detailed analysis of the temperature and field dependence of the magnetization, providing evidence that the Dy ion transmits an antiferromagnetic interaction between radicals but that the Dy-radical interaction is ferromagnetic.

UL146 variability among clinical isolates of Human Cytomegalovirus from Japan

Directory of Open Access Journals (Sweden)

Francisco Aguayo

2010-01-01

Full Text Available Human Cytomegalovirus (HCMV is a herpesvirus associated with serious diseases in immunocompromised subjects. The region between ORF UL133 and UL151 from HCMV, named ULb' is frequently deleted in attenuated AD169 and in highly passaged laboratory strains. However, this region is conserved in low-passaged and more virulent HCMV, like the Toledo strain. The UL146 gene, which is located in the ULb' region, encodes a CXC-chemokine analogue. The diversity of UL146 gene was evaluated among fifty-six clinical isolates of HCMV from Japan. Results show that UL146 gene was successfully amplified by the polymerase chain reaction (PCR in only 17/56 strains (30%, while the success rate for UL145/UL147 gene was 18/56 strains (32%. After DNA sequencing, the 35 amplified strains were classified into 8 groups. When compared, variability of UL146 ranged from 25.1% to 52.9% at the DNA level and from 34.5% to 67% at the amino acid level. Seven groups had the interleukin-8 (IL-8 motif ERL (Glu-Leu-Arg CXC and one group had only the CXC motif, suggesting the absence of the IL-8 function of UL146. In conclusion, we found that UL146 gene of HCMV is hyper-variable in clinical strains from Japan suggesting the possibility of a different function in each sequence group.

CD146/MCAM defines functionality of human bone marrow stromal stem cell populations

DEFF Research Database (Denmark)

Harkness, Linda; Zaher, Walid; Ditzel, Nicholas

2016-01-01

BACKGROUND: Identification of surface markers for prospective isolation of functionally homogenous populations of human skeletal (stromal, mesenchymal) stem cells (hMSCs) is highly relevant for cell therapy protocols. Thus, we examined the possible use of CD146 to subtype a heterogeneous hMSC...... population. METHODS: Using flow cytometry and cell sorting, we isolated two distinct hMSC-CD146(+) and hMSC-CD146(-) cell populations from the telomerized human bone marrow-derived stromal cell line (hMSC-TERT). Cells were examined for differences in their size, shape and texture by using high...... and adipocytes on the basis of gene expression and protein production of lineage-specific markers. In vivo, hMSC-CD146(+) and hMSC-CD146(-) cells formed bone and bone marrow organ when implanted subcutaneously in immune-deficient mice. Bone was enriched in hMSC-CD146(-) cells (12.6 % versus 8.1 %) and bone...

Inhibition of KLF7-Targeting MicroRNA 146b Promotes Sciatic Nerve Regeneration.

Science.gov (United States)

Li, Wen-Yuan; Zhang, Wei-Ting; Cheng, Yong-Xia; Liu, Yan-Cui; Zhai, Feng-Guo; Sun, Ping; Li, Hui-Ting; Deng, Ling-Xiao; Zhu, Xiao-Feng; Wang, Ying

2018-06-01

A previous study has indicated that Krüppel-like factor 7 (KLF7), a transcription factor that stimulates Schwann cell (SC) proliferation and axonal regeneration after peripheral nerve injury, is a promising therapeutic transcription factor in nerve injury. We aimed to identify whether inhibition of microRNA-146b (miR-146b) affected SC proliferation, migration, and myelinated axon regeneration following sciatic nerve injury by regulating its direct target KLF7. SCs were transfected with miRNA lentivirus, miRNA inhibitor lentivirus, or KLF7 siRNA lentivirus in vitro. The expression of miR146b and KLF7, as well as SC proliferation and migration, were subsequently evaluated. In vivo, an acellular nerve allograft (ANA) followed by injection of GFP control vector or a lentiviral vector encoding an miR-146b inhibitor was used to assess the repair potential in a model of sciatic nerve gap. miR-146b directly targeted KLF7 by binding to the 3'-UTR, suppressing KLF7. Up-regulation of miR-146b and KLF7 knockdown significantly reduced the proliferation and migration of SCs, whereas silencing miR-146b resulted in increased proliferation and migration. KLF7 protein was localized in SCs in which miR-146b was expressed in vivo. Similarly, 4 weeks after the ANA, anti-miR-146b increased KLF7 and its target gene nerve growth factor cascade, promoting axonal outgrowth. Closer analysis revealed improved nerve conduction and sciatic function index score, and enhanced expression of neurofilaments, P0 (anti-peripheral myelin), and myelinated axon regeneration. Our findings provide new insight into the regulation of KLF7 by miR-146b during peripheral nerve regeneration and suggest a potential therapeutic strategy for peripheral nerve injury.

Color maps of Arp 146

Science.gov (United States)

Schultz, A. B.; Spight, L. D.; Colegrove, P. T.; Disanti, M. A.; Fink, U.

1990-01-01

Four color maps of Arp 146 are given. The structure and color of the ring galaxy and its companion show evidence of a bridge of material between the companion and the remnant nucleus of the original galaxy now forming the ring. Broad band spatial coverage clearly defines regions of starburst occurrence.

19 CFR 146.23 - Accountability for merchandise in a zone.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Accountability for merchandise in a zone. 146.23 Section 146.23 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY....23 Accountability for merchandise in a zone. (a) Identification of merchandise—(1) General. A zone...

22 CFR 146.440 - Health and insurance benefits and services.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Health and insurance benefits and services. 146... the Basis of Sex in Education Programs or Activities Prohibited § 146.440 Health and insurance... insurance benefit, service, policy, or plan to any of its students, a recipient shall not discriminate on...

21 CFR 146.148 - Reduced acid frozen concentrated orange juice.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Reduced acid frozen concentrated orange juice. 146... Canned Fruit Juices and Beverages § 146.148 Reduced acid frozen concentrated orange juice. (a) Reduced acid frozen concentrated orange juice is the food that complies with the requirements for composition...

21 CFR 146.3 - Definitions.

Science.gov (United States)

2010-04-01

... CONSUMPTION CANNED FRUIT JUICES General Provisions § 146.3 Definitions. For the purposes of this part: (a) The... hydrolyzed starch. (c) The term dried glucose sirup means the product obtained by drying glucose sirup. (d... following: Unless otherwise provided in a standard, a lot of canned fruits shall be deemed in compliance for...

MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota

Directory of Open Access Journals (Sweden)

Chong-Tao Du

2018-03-01

Full Text Available The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes. High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes, Blautia, Coprococcus_1, and Ruminococcus_1. Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes, indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

MicroRNA-146a Deficiency Protects against Listeria monocytogenes Infection by Modulating the Gut Microbiota.

Science.gov (United States)

Du, Chong-Tao; Gao, Wei; Ma, Ke; Yu, Shui-Xing; Li, Na; Yan, Shi-Qing; Zhou, Feng-Hua; Liu, Zhen-Zhen; Chen, Wei; Lei, Lian-Cheng; Yang, Yong-Jun; Han, Wen-Yu

2018-03-26

The gut microbiota and microRNAs play important roles in the defense against infection. However, the role of miR-146a in L. monocytogenes infection and gut microbiota remains unclear. We tried to determine whether miR-146a controlled L. monocytogenes infection by regulating the gut microbiota. Wild-type and miR-146a-deficient mice or macrophages were used to characterize the impact of miR-146a on animal survival, cell death, bacterial clearance, and gut microbiota following L. monocytogenes challenge. We found that L. monocytogenes infection induced miR-146a expression both in vitro and in vivo. When compared to wild-type mice, miR-146a-deficient mice were more resistant to L. monocytogenes infection. MiR-146a deficiency in macrophages resulted in reduced invasion and intracellular survival of L. monocytogenes . High-throughput sequencing of 16S rRNA revealed that the gut microbiota composition differed between miR-146a-deficient and wild-type mice. Relative to wild-type mice, miR-146a-deficient mice had decreased levels of the Proteobacteria phylum, Prevotellaceae family, and Parasutterella genus, and significantly increased short-chain fatty acid producing bacteria, including the genera Alistipes , Blautia , Coprococcus_1, and Ruminococcus_1 . Wild-type mice co-housed with miR-146a-deficient mice had increased resistance to L. monocytogenes , indicating that miR-146a deficiency guides the gut microbiota to alleviate infection. Together, these results suggest that miR-146a deficiency protects against L. monocytogenes infection by regulating the gut microbiota.

Isotopic shifts and configuration mixing in the dysprosium II spectrum

International Nuclear Information System (INIS)

Aufmuth, P.

1977-01-01

Using a photoelectric Fabry-Perot spectrometer with digital data acquisition, the isotopic shifts of all stable dysprosium isotopes (Z = 66, A = 156, 158, 160, 161, 162, 163, 164) have been measured in transitions from the groundstate configuration 4f 10 6s to the excited configurations 4f 9 5d6s, 4f 9 5d 2 , and 4f 10 6p of the spark spectrum. Mass and volume effects have been seperated; the results are compared with arc spectrum measurements. From the volume effect of a pure s-p transition the change of the mean electric quadratic nuclear radius delta 2 > has been calculated. In order to test fine structure calculations of the Dy II spectrum, the isotopic shifts of 29 lines of the isotopes 162 Dy and 164 Dy have been measured. Based on the sharing rule, the reported configuration mixing could be confirmed in principle; for one energy level (E = 22908 K) the asignement has been proved to be false, in the case of three other levels (E = 22467, 22672, and 28885 K) the asignement is doubtfull. For the ground state levels 4f 10 6s 6 I the influence of relativistic effects could be proved; these effects can be interpreted in the framework of a parametric representation of the isotopic shift. The order of magnitude of the crossed second order effects has been estimated. (orig.) [de

Use of dispersive liquid-liquid microextraction for simultaneous preconcentration of samarium, europium, gadolinium and dysprosium

International Nuclear Information System (INIS)

Mallah, M.H.; Atomic Energy Organization of Iran, Tehran; Shemirani, F.; Ghannadi Maragheh, M.

2008-01-01

A new preconcentration method of dispersive liquid-liquid microextraction (DLLME) was developed for simultaneous preconcentration of samarium, europium, gadolinium and dysprosium. DLLME technique was successfully used as a sample preparation method. In this preconcentration method, an appropriate mixture of extraction solvent, disperser solvent was injected rapidly into an aqueous solution containing Sm, Eu, Gd and Dy after complex formation using chelating reagent of the 1-(2-pyridylazo)-2-naphthol (PAN). After phase separation, 0.5 mL of the settled phase containing enriched analytes was determined by inductively coupled plasma optical emission spectrometry (ICP-OES). The main factors affected the preconcentration of Sm, Eu, Gd and Dy were extraction and dispersive solvent type and their volume, extraction time, volume of chelating agent (PAN), centrifuge speed and drying temperature of the samples. Under the best operating condition simultaneous preconcentration factors of 80, 100, 103 and 78 were obtained for Sm, Eu, Gd and Dy, respectively. (author)

Oxide perovskites with tetravalent dysprosium and compounds of the type Ba/sub 3/RE/sub 4/O/sub 9/ (RE = Rare Earth Element)

Energy Technology Data Exchange (ETDEWEB)

Brauer, G; Kristen, H [Freiburg Univ. (Germany, F.R.)

1980-03-01

In analogy to our investigations concerning tetravalent Nd in oxide perovskites, we also tried to stabilize dysprosium(IV) by incorporation in host-lattices with the perovskite structure. As host-lattices we used BaCeO/sub 3/, BaTbO/sub 3/, and SrTbO/sub 3/. Only in Ba(Ce, Dy)O/sub 3/ we could trace Dy(IV) with certainty. Among the prepared mixed oxides, also the phase Ba/sub 3/Dy/sub 4/O/sub 9/ occured. The lattice parameters of several phases of this latter type were redetermined.

19 CFR 146.21 - General requirements.

Science.gov (United States)

2010-04-01

... TREASURY (CONTINUED) FOREIGN TRADE ZONES Inventory Control and Recordkeeping System § 146.21 General requirements. (a) Systems capability. The operator shall maintain either manual or automated inventory control... English language copy of its written inventory control and recordkeeping systems procedures manual in...

38 CFR 21.146 - Independent instructor course.

Science.gov (United States)

2010-07-01

.... Chapter 31 Special Rehabilitation Services § 21.146 Independent instructor course. (a) Definition. An... the customary channels leading to employment may not be readily available to a veteran requiring an...

22 CFR 146.120 - Transfers of property.

Science.gov (United States)

2010-04-01

... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.120 Transfers of property... financial assistance to a transferee that operates any education program or activity, and the Federal share...

21 CFR 146.185 - Pineapple juice.

Science.gov (United States)

2010-04-01

... reconstituted with water suitable for the purpose of maintaining essential composition and quality factors of... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CANNED FRUIT JUICES Requirements for Specific Standardized Canned Fruit Juices and Beverages § 146...

22 CFR 146.115 - Assurance required.

Science.gov (United States)

2010-04-01

... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.115 Assurance required. (a... applications for Federal financial assistance or awards of Federal financial assistance contain, be accompanied... assurance. (b) Duration of obligation. (1) In the case of Federal financial assistance extended to provide...

ImmunoPET for assessing the differential uptake of a CD146-specific monoclonal antibody in lung cancer

Energy Technology Data Exchange (ETDEWEB)

Sun, Haiyan; Kamkaew, Anyanee; Jiang, Dawei; Yang, Yunan [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); England, Christopher G.; Hernandez, Reinier; Graves, Stephen A.; Barnhart, Todd E. [University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); Majewski, Rebecca L. [University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); Cai, Weibo [University of Wisconsin-Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin-Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin-Madison, Department of Biomedical Engineering, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)

2016-11-15

Overexpression of CD146 in solid tumors has been linked to disease progression, invasion, and metastasis. We describe the generation of a {sup 64}Cu-labeled CD146-specific antibody and its use for quantitative immunoPET imaging of CD146 expression in six lung cancer models. The anti-CD146 antibody (YY146) was conjugated to 1,4,7-triazacyclononane-triacetic acid (NOTA) and radiolabeled with {sup 64}Cu. CD146 expression was evaluated in six human lung cancer cell lines (A549, NCI-H358, NCI-H522, HCC4006, H23, and NCI-H460) by flow cytometry and quantitative western blot studies. The biodistribution and tumor uptake of {sup 64}Cu-NOTA-YY146 was assessed by sequential PET imaging in athymic nude mice bearing subcutaneous lung cancer xenografts. The correlation between CD146 expression and tumor uptake of {sup 64}Cu-NOTA-YY146 was evaluated by graphical software while ex vivo biodistribution and immunohistochemistry studies were performed to validate the accuracy of PET data and spatial expression of CD146. Flow cytometry and western blot studies showed similar findings with H460 and H23 cells showing high levels of expression of CD146. Small differences in CD146 expression levels were found among A549, H4006, H522, and H358 cells. Tumor uptake of {sup 64}Cu-NOTA-YY146 was highest in CD146-expressing H460 and H23 tumors, peaking at 20.1 ± 2.86 and 11.6 ± 2.34 %ID/g at 48 h after injection (n = 4). Tumor uptake was lowest in the H522 model (4.1 ± 0.98 %ID/g at 48 h after injection; n = 4), while H4006, A549 and H358 exhibited similar uptake of {sup 64}Cu-NOTA-YY146. A positive correlation was found between tumor uptake of {sup 64}Cu-NOTA-YY146 (%ID/g) and relative CD146 expression (r {sup 2} = 0.98, p < 0.01). Ex vivo biodistribution confirmed the accuracy of the PET data. The strong correlation between tumor uptake of {sup 64}Cu-NOTA-YY146 and CD146 expression demonstrates the potential use of this radiotracer for imaging tumors that elicit varying levels of CD146

Optical isotype shifts of 146Sm and 151Sm

International Nuclear Information System (INIS)

Eastham, D.A.; Walker, P.M.; Griffith, J.A.R.; Evans, D.E.; England, J.G.; Grant, I.S.

1984-01-01

We have measured the optical isotope shifts of 146 Sm and 151 Sm by laser resonance fluorescence. From these measurements the changes in the mean square nuclear radii are: delta 2 > (A=144 to 146)=0.266(10) fm 2 , and delta 2 > (A=151 to 152)=0.262(10) fm 2 . These results, together with those of the stable isotopes, show that the average nuclear expansion of samarium can be accounted for by the liquid drop model with deformations. (orig.)

10 CFR 1.46 - Office of Nuclear Security and Incident Response.

Science.gov (United States)

2010-01-01

... 10 Energy 1 2010-01-01 2010-01-01 false Office of Nuclear Security and Incident Response. 1.46... Headquarters Program Offices § 1.46 Office of Nuclear Security and Incident Response. The Office of Nuclear... evaluation and assessment of technical issues involving security at nuclear facilities, and is the agency...

Soluble CD146, an innovative and non-invasive biomarker of embryo selection for in vitro fertilization.

Directory of Open Access Journals (Sweden)

Sylvie Bouvier

Full Text Available Although progress was made in in vitro fertilization (IVF techniques, the majority of embryos transferred fail to implant. Morphology embryo scoring is the standard procedure for most of IVF centres for choosing the best embryo, but remains limited since even the embryos classified as "top quality" may not implant. As it has been shown that i CD146 is involved in embryo implantation and ii membrane form is shed to generate soluble CD146 (sCD146, we propose that sCD146 in embryo supernatants may constitute a new biomarker of embryo selection. Immunocytochemical staining showed expression of CD146 in early embryo stages and sCD146 was detected by ELISA and Western-blot in embryo supernatants from D2. We retrospectively studied 126 couples who underwent IVF attempt. The embryo culture medium from each transferred embryo (n = 222 was collected for measurement of sCD146 by ELISA. Significantly higher sCD146 concentrations were present in embryo supernatants that did not implant (n = 185 as compared to those that successfully implanted (n = 37 (1310 +/- 1152 pg.mL-1 vs. 845+/- 1173 pg.mL-1, p = 0.024. Sensitivity analysis performed on single embryo transfers (n = 71 confirmed this association (p = 0.0054. The computed ROC curve established that the optimal sCD146 concentration for embryo implantation is under 1164 pg.mL-1 (sensitivity: 76%, specificity: 48%, PPV: 25% and NPV: 92%. Over this sCD146 threshold, the implantation rate was significantly lower (9% with sCD146 levels >1164 pg.ml-1 vs. 22% with sCD146 levels ≤ 1164 pg.mL-1, p = 0.01. Among the embryos preselected by morphologic scoring, sCD146 determination could allow a better selection of the embryo(s, thus improving the success of elective single embryo transfer. This study establishes the proof of concept for the use of sCD146 as a biomarker for IVF by excluding the embryo with the highest sCD146 level. A multicentre prospective study will now be necessary to further establish its use in

microRNA-146a promotes mycobacterial survival in macrophages through suppressing nitric oxide production.

Science.gov (United States)

Li, Miao; Wang, Jinli; Fang, Yimin; Gong, Sitang; Li, Meiyu; Wu, Minhao; Lai, Xiaomin; Zeng, Gucheng; Wang, Yi; Yang, Kun; Huang, Xi

2016-03-30

Macrophages play a crucial role in host innate anti-mycobacterial defense, which is tightly regulated by multiple factors, including microRNAs. Our previous study showed that a panel of microRNAs was markedly up-regulated in macrophages upon mycobacterial infection. Here, we investigated the biological function of miR-146a during mycobacterial infection. miR-146a expression was induced both in vitro and in vivo after Mycobacterium bovis BCG infection. The inducible miR-146a could suppress the inducible nitric oxide (NO) synthase (iNOS) expression and NO generation, thus promoting mycobacterial survival in macrophages. Inhibition of endogenous miR-146a increased NO production and mycobacterial clearance. Moreover, miR-146a attenuated the activation of nuclear factor κB and mitogen-activated protein kinases signaling pathways during BCG infection, which in turn repressed iNOS expression. Mechanistically, miR-146a directly targeted tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) at post-transcriptional level. Silencing TRAF6 decreased iNOS expression and NO production in BCG-infected macrophages, while overexpression of TRAF6 reversed miR-146a-mediated inhibition of NO production and clearance of mycobacteria. Therefore, we demonstrated a novel role of miR-146a in the modulation of host defense against mycobacterial infection by repressing NO production via targeting TRAF6, which may provide a promising therapeutic target for tuberculosis.

40 CFR 146.67 - Operating requirements.

Science.gov (United States)

2010-07-01

... serving as a water supply, place a notice in a newspaper of general circulation. (2) The Director may... 146.67 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED... steps to determine the presence or absence of a leak; and (3) Notify the Director within 24 hours after...

MicroRNA-146a Contributes to SCI Recovery via Regulating TRAF6 and IRAK1 Expression.

Science.gov (United States)

Wei, Jinsong; Wang, Jiafeng; Zhou, Yulan; Yan, Shouquan; Li, Keshen; Lin, Hongsheng

2016-01-01

MicroRNA-146a participates in spinal cord injury (SCI) recovery. Until recently, how miRNA-146a participates in SCI remained unclear. In this study, we tried to explore the roles of miRNA-146a in the recovery of SCI using a rat model. The expression of the probable target genes of miRNA-146a (including IRAK1 and TARF6) as well as proinflammation cytokines were measured until 7 days after surgery in the three groups (sham group, SCI group, and miRNA-146a antagomir injection group). Also, the animals' motivations were estimated using Basso Beattie Bresnahan (BBB) during the whole experiment. A luciferase assay was performed to demonstrate that miRNA-146a could directly target the mRNAs of IRAK1 and TRAF6 . Our experiments indicate that miRNA-146a inhibits proinflammatory cytokine secretion by suppressing IRAK1 and TRAF6 expression in the SCI model. In contrast, miRNA-146a may be upregulated by inflammatory mediators via the IRAK1 / TRAF6 pathway in the spinal cord. As a negative feedback element, miRNA-146a could make sure that the expression of IRAK1 - and TRAF6 -mediated genes was under tight control. Thus, miRNA-146a may serve as a novel therapeutic target for SCI interventions.

New levels and reinvestigation of octupole correlations in {sup 146,147}La

Energy Technology Data Exchange (ETDEWEB)

Wang, E.H.; Zachary, C.J.; Hamilton, J.H.; Ramayya, A.V.; Hwang, J.K.; Liu, S.H.; Brewer, N.T. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Lewis, W. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Furman University, Department of Physics, Greenville, SC (United States); Luo, Y.X. [Vanderbilt University, Department of Physics and Astronomy, Nashville, TN (United States); Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Rasmussen, J.O. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Zhu, S.J. [Tsinghua University, Department of Physics, Beijing (China); Ter-Akopian, G.M.; Oganessian, Yu.Ts. [Joint Institute for Nuclear Research, Dubna (Russian Federation)

2017-12-15

High spin states of neutron-rich {sup 146,147}La have been reinvestigated by γ-γ-γ and γ-γ-γ-γ coincidence data from a {sup 252}Cf spontaneous fission experiment by using Gammasphere. Thirty-two new transitions in {sup 146}La are observed. Two new bands in {sup 146}La have been established. One of them is proposed to be the octupole parity partner of the previously known band. Twenty new transitions in {sup 147}La are observed. The ground state band of {sup 147}La has been established with a proposed 5/2{sup +} band-head. Angular correlation of cascades has been used to study the spins and parities of the states. The B(E1)/B(E2) ratios and dipole moments of bands in {sup 146,} {sup 147}La have been measured. (orig.)

Dual responsive dysprosium-doped hydroxyapatite particles and toxicity reduction after functionalization with folic and glucuronic acids.

Science.gov (United States)

Sánchez Lafarga, Ana Karen; Pacheco Moisés, Fermín P; Gurinov, Andrey; Ortiz, Genaro Gabriel; Carbajal Arízaga, Gregorio Guadalupe

2015-03-01

The development of probes for biomedical applications demands materials with low toxicity levels besides fluorescence or magnetic properties to be detected by confocal microscopes or MRI resonators. Several drug delivery systems or other biomedical materials prepared with hydroxyapatite have been proposed, however, toxicity effects might arise when the size of particles is nanometric. In this study, hydroxyapatite functionalized with glucuronic or folic acids presented lower oxidative stress, measured from lipoperoxides and nitric oxide indicators in rats than pure hydroxyapatite. In separated experiments, hydroxyapatite was doped with dysprosium cations by coprecipitation producing a single crystal phase with fluorescent properties easily visualized by confocal microscopy when excited at 488nm. These particles also presented the ability to modify the proton relaxation time in T1 maps collected by magnetic resonance imaging. These modified hydroxyapatite nanoparticles could be candidates to design bimodal probes with low toxicity. Copyright © 2014 Elsevier B.V. All rights reserved.

19 CFR 146.7 - Zone changes.

Science.gov (United States)

2010-04-01

... the risk and expense of the operator. The port director may require an accounting of all merchandise.... An operator shall make written application to the port director for approval of an alteration of an... accompanied by the supporting document requirements specified in § 146.6, as applicable. The port director may...

Exploration of dysprosium: the most critical element for Japan

Science.gov (United States)

Watanabe, Y.

2012-04-01

Dysprosium (Dy), one of the heavy rare earth elements, is used mainly as an additive for NdFeB permanent magnets which are installed in various modern industrial products such as voice coil motors in computers, factory automation machinery, hybrid and electric vehicles, home electronics, and wind turbine, to improve heat resistance of the magnets. Dy has been produced about 2,000t per year from the ores from ion adsorption type deposits in southern China. However, the produced amount of Dy was significantly reduced in 2011 in China due to reservation of heavy rare earth resources and protection of natural environment, resulting in soaring of Dy price in the world. In order to respond the increasing demand of Dy, unconventional supply sources are inevitably developed, in addition to heavy rare earth enriched ion adsorption type deposits outside China. Heavy rare earth elements including Dy are dominantly hosted in xenotime, fergusonite, zircon, eudialyte, keiviite, kainosite, iimoriite, etc. Concentration of xenotime is found in placer deposits in Malaysia and India, hydrothermal deposits associated with unconformity-type uranium mineralization (Athabasca basin in Canada, Western Australia), iron-oxide fluorite mineralization (South Africa) and Sn-bearing alkaline granite (Brazil). Zircon and fergusontie concentration is found as igneous and hydrothermal products in peralkaline syenite, alkaline granite and pegmatite (e.g., Nechalacho in Canada). Eudialyte concentration is found in some peralkaline syenite bodies in Greenland, Canada, Sweden and Russia. Among these sources, large Dy resources are estimated in the deposits hosted in peralkaline rocks (Nechalacho: 79,000t, Kvanefjeld: 49,000t, Norra Karr: 15,700t, etc.) compared to the present demand of Dy. Thus, Dy will be supplied from the deposits associated with peralkaline and alkaline deposits in future instead of ion adsorption type deposits in southern China.

Octupole excitations in 146Sm

International Nuclear Information System (INIS)

Bizzeti, P.G.; Bizzetti-Sona, A.M.

1998-01-01

The mean lives of the lowest 9 - and 12 + states of 146 Sm have been measured by means of the RDM. Their (preliminary) values are r m (9 - )=0.97±0.05 ns and r m (12 + )=15±2 ps, respectively. The strengths of the collective E3 transitions of the 12 + →9 - →6 6 cascade are compared with the corresponding ones in 148 Gd

21 CFR 133.146 - Grated cheeses.

Science.gov (United States)

2010-04-01

... Products § 133.146 Grated cheeses. (a) Description. Grated cheeses is the class of foods prepared by..., and skim milk cheese for manufacturing may not be used. All cheese ingredients used are either made... ___ cheese”, the name of the cheese filling the blank. (ii) If only parmesan and romano cheeses are used and...

MicroRNA-146a Regulates Perfusion Recovery in Response to Arterial Occlusion via Arteriogenesis

Directory of Open Access Journals (Sweden)

Joshua L. Heuslein

2018-01-01

Full Text Available The growth of endogenous collateral arteries that bypass arterial occlusion(s, or arteriogenesis, is a fundamental shear stress-induced adaptation with implications for treating peripheral arterial disease. MicroRNAs (miRs are key regulators of gene expression in response to injury and have strong therapeutic potential. In a previous study, we identified miR-146a as a candidate regulator of vascular remodeling. Here, we tested whether miR-146a regulates in vitro angiogenic endothelial cell (EC behaviors, as well as perfusion recovery, arteriogenesis, and angiogenesis in response to femoral arterial ligation (FAL in vivo. We found miR-146a inhibition impaired EC tube formation and migration in vitro. Following FAL, Balb/c mice were treated with a single, intramuscular injection of anti-miR-146a or scramble locked nucleic acid (LNA oligonucleotides directly into the non-ischemic gracilis muscles. Serial laser Doppler imaging demonstrated that anti-miR-146a treated mice exhibited significantly greater perfusion recovery (a 16% increase compared mice treated with scramble LNA. Moreover, anti-miR-146a treated mice exhibited a 22% increase in collateral artery diameter compared to controls, while there was no significant effect on in vivo angiogenesis or muscle regeneration. Despite exerting no beneficial effects on angiogenesis, the inhibition of mechanosensitive miR-146a enhances perfusion recovery after FAL via enhanced arteriogenesis.

Isolation of {sup 163}Ho from dysprosium target material by HPLC for neutrino mass measurements

Energy Technology Data Exchange (ETDEWEB)

Mocko, Veronika; Taylor, Wayne A.; Nortier, Francois M.; Engle, Jonathan W.; Pollington, Anthony D.; Kunde, Gerd J.; Rabin, Michael W.; Birnbaum, Eva R. [Los Alamos National Laboratory, Los Alamos, NM (United States). Chemistry Div.; Barnhart, Todd E.; Nickles, Robert J. [Univ. Wisconsinn, Madison, WI (United States). Dept. of Medical Physics

2015-07-01

The rare earth isotope {sup 163}Ho is of interest for neutrino mass measurements. This report describes the isolation of {sup 163}Ho from a proton-irradiated dysprosium target and its purification. A Dy metal target was irradiated with 16 MeV protons for 10 h. After target dissolution, {sup 163}Ho was separated from the bulk Dy via cation-exchange high performance liquid chromatography using 70 mmol dm{sup -3} α-hydroxyisobutyric acid as the mobile phase. Subsequent purification of the collected Ho fraction was performed to remove the α-hydroxyisobutyrate chelating agent and to concentrate the Ho in a low ionic strength aqueous matrix. The final solution was characterized by MC-ICP-MS to determine the {sup 163}Ho/{sup 165}Ho ratio, {sup 163}Ho and the residual Dy content. The HPLC purification process resulted in a decontamination factor 1.4 x 10{sup 5} for Dy. The isolated Ho fraction contained 24.8 ± 1.3 ng of {sup 163}Ho corresponding to holmium recovery of 72 ± 3%.

Global use structures of the magnetic materials neodymium and dysprosium. A scenario-based analysis of the effect of the diffusion of electromobility on the demand for rare earths

International Nuclear Information System (INIS)

Gloeser-Chahoud, Simon; Kuehn, Andre; Tercero Espinoza, Luis

2016-01-01

Neodymium-iron-boron magnets (NdFeB) have experienced a significant demand as the most powerful permanent magnet in recent years, especially for the manufacture of compact electric servomotors with high efficiency and high power density, especially for mobile applications in hybrid traction motors and electric vehicles or for electric bikes. However, NdFeB magnets are also increasingly being used in general mechanical engineering (conveying and pumping systems, tools, air conditioning systems, lift motors, etc.), in the small electric motors of conventional passenger cars or in the generators of large wind power plants with permanent magnetic direct drive. Nevertheless, there is still high uncertainty in the use structures of NdFeB magnets and the contained rare earth elements neodymium and dysprosium. An effective instrument for increasing the market transparency and the understanding of complex anthropogenic material cycles is the dynamic material flow modeling. In the present work paper, this instrument is used for an in-depth analysis of the use structures of NdFeB magnets and the contained rare earths on a global scale. The dynamic modeling of product usage cycles reveals today's usage structures and quantifies future magnetic quantities in obsolete product flows. It could be shown that the magnets in today's scrap volume are mainly contained in obsolete electronics applications such as hard disks (HDD), CD and DVD drives, which makes the recycling hardly seem to be economical due to the small magnets and the high material spread, but in the foreseeable future with larger magnetic quantities from synchronous servomotors and generators can be expected, which significantly increases the recycling potential. In a further step, the effect of the diffusion of alternative drives in the automotive market on the dysprosium requirement is analyzed using a system dynamics model and possible adaptation mechanisms in the form of different substitution effects in the

22 CFR 146.100 - Purpose and effective date.

Science.gov (United States)

2010-04-01

... EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.100 Purpose and... basis of sex in any education program or activity receiving Federal financial assistance, whether or not...

45 CFR 146.122 - Additional requirements prohibiting discrimination based on genetic information.

Science.gov (United States)

2010-10-01

... genetic information and should review the records to excise any genetic information. N assembles the data requested by M and, although N reviews it to delete genetic information, the data from a specific region... based on genetic information. 146.122 Section 146.122 Public Welfare DEPARTMENT OF HEALTH AND HUMAN...

76 FR 6575 - Airworthiness Directives; BAE Systems (Operations) Limited Model BAe 146 and Avro 146-RJ Airplanes

Science.gov (United States)

2011-02-07

.... * * * * * * * * * * * [I]nvestigation by M-D showed that if any undetected crack was present at the time of the embodiment... terminating action for the repetitive inspections, by embodiment of Messier-Dowty (M-D) Service Bulletin (SB... optional closing action of EASA AD 2010-0001-E is embodiment of M-D B 146-32-150 (polishing and shot...

Synthesis and X-ray diffraction studies of dysprosium-calcium ferrites Dy1-xCaxFeO3-y (0≤x≤2/3)

International Nuclear Information System (INIS)

Li, J.; Song, D.; Su, Z.; Wang, T.M.

1997-01-01

Samples of dysprosium-calcium ferrites Dy 1-x Ca x FeO 3-y with x ranging from 0 to 2/3 were novelly prepared in air by solid state reaction and characterized by X-ray powder diffraction. These samples are single-phased orthorhombic perovskite-type compounds belonging to the space group D 2h 16 -Pbnm. The lattice constants of the Dy 1-x Ca x FeO 3-y samples have been refined by Cohen's least-squares method. The initial substitution of Ca for Dy leads to a decrease of the lattice constants. Further substitution of Ca for Dy has hardly any influence on the lattice dimensions. (orig.)

Experimental Demyelination and Axonal Loss Are Reduced in MicroRNA-146a Deficient Mice.

Science.gov (United States)

Martin, Nellie A; Molnar, Viktor; Szilagyi, Gabor T; Elkjaer, Maria L; Nawrocki, Arkadiusz; Okarmus, Justyna; Wlodarczyk, Agnieszka; Thygesen, Eva K; Palkovits, Miklos; Gallyas, Ferenc; Larsen, Martin R; Lassmann, Hans; Benedikz, Eirikur; Owens, Trevor; Svenningsen, Asa F; Illes, Zsolt

2018-01-01

The cuprizone (CPZ) model of multiple sclerosis (MS) was used to identify microRNAs (miRNAs) related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO) mice: this miRNA is differentially expressed in MS lesions and promotes differentiation of oligodendrocyte precursor cells (OPCs) during remyelination, but its role has not been examined during demyelination. MicroRNAs were examined by Agilent Mouse miRNA Microarray in the corpus callosum during CPZ-induced demyelination and remyelination. Demyelination, axonal loss, changes in number of oligodendrocytes, OPCs, and macrophages/microglia was compared by histology/immunohistochemistry between KO and WT mice. Differential expression of target genes and proteins of miR-146a was analyzed in the transcriptome (4 × 44K Agilent Whole Mouse Genome Microarray) and proteome (liquid chromatography tandem mass spectrometry) of CPZ-induced de- and remyelination in WT mice. Levels of proinflammatory molecules in the corpus callosum were compared in WT versus KO mice by Meso Scale Discovery multiplex protein analysis. miR-146a was increasingly upregulated during CPZ-induced de- and remyelination. The absence of miR-146a in KO mice protected against demyelination, axonal loss, body weight loss, and atrophy of thymus and spleen. The number of CNP + oligodendrocytes was increased during demyelination in the miR-146a KO mice, while there was a trend of increased number of NG2 + OPCs in the WT mice. miR-146a target genes, SNAP25 and SMAD4, were downregulated in the proteome of demyelinating corpus callosum in WT mice. Higher levels of SNAP25 were measured by ELISA in the corpus callosum of miR-146a KO mice, but there was no difference between KO and WT mice during demyelination. Multiplex protein analysis of the corpus callosum lysate revealed upregulated TNF-RI, TNF-RII, and CCL2 in the WT mice in contrast to KO mice. The number of Mac3 + and Iba1 + macrophages/microglia was

The effect of stem cell factor on proliferation of human endometrial CD146+ cells

Directory of Open Access Journals (Sweden)

Mehri Fayazi

2016-07-01

Full Text Available Background: Stem cell factor (SCF is a transcriptional factor which plays crucial roles in normal proliferation, differentiation and survival in a range of stem cells. Objective: The aim of the present study was to examine the proliferation effect of different concentrations of SCF on expansion of human endometrial CD146+ cells. Materials and Methods: In this experimental study, total populations of isolated human endometrial suspensions after fourth passage were isolated by magnetic activated cell sorting (MACS into CD146+ cells. Human endometrial CD146+ cells were karyotyped and tested for the effect of SCF on proliferation of CD146+ cells, then different concentrations of 0, 12.5, 25, 50 and 100 ng/ml was carried out and mitogens-stimulated endometrial CD146+ cells proliferation was assessed by MTT assay. Results: Chromosomal analysis showed a normal metaphase spread and 46XX karyotype. The proliferation rate of endometrial CD146P + P cells in the presence of 0, 12.5, 25, 50 and 100 ng/ml SCF were 0.945±0.094, 0.962±0.151, 0.988±0.028, 1.679±0.012 and 1.129±0.145 respectively. There was a significant increase in stem/ stromal cell proliferation following in vitro treatment by 50 ng/ml than other concentrations of SCF (p=0.01. Conclusion: The present study suggests that SCF could have effect on the proliferation and cell survival of human endometrial CD146P+P cells and it has important implications for medical sciences and cell therapies

Promotion of Hendra Virus Replication by MicroRNA 146a

Science.gov (United States)

Marsh, Glenn A.; Jenkins, Kristie A.; Gantier, Michael P.; Tizard, Mark L.; Middleton, Deborah; Lowenthal, John W.; Haining, Jessica; Izzard, Leonard; Gough, Tamara J.; Deffrasnes, Celine; Stambas, John; Robinson, Rachel; Heine, Hans G.; Pallister, Jackie A.; Foord, Adam J.; Bean, Andrew G.; Wang, Lin-Fa

2013-01-01

Hendra virus is a highly pathogenic zoonotic paramyxovirus in the genus Henipavirus. Thirty-nine outbreaks of Hendra virus have been reported since its initial identification in Queensland, Australia, resulting in seven human infections and four fatalities. Little is known about cellular host factors impacting Hendra virus replication. In this work, we demonstrate that Hendra virus makes use of a microRNA (miRNA) designated miR-146a, an NF-κB-responsive miRNA upregulated by several innate immune ligands, to favor its replication. miR-146a is elevated in the blood of ferrets and horses infected with Hendra virus and is upregulated by Hendra virus in human cells in vitro. Blocking miR-146a reduces Hendra virus replication in vitro, suggesting a role for this miRNA in Hendra virus replication. In silico analysis of miR-146a targets identified ring finger protein (RNF)11, a member of the A20 ubiquitin editing complex that negatively regulates NF-κB activity, as a novel component of Hendra virus replication. RNA interference-mediated silencing of RNF11 promotes Hendra virus replication in vitro, suggesting that increased NF-κB activity aids Hendra virus replication. Furthermore, overexpression of the IκB superrepressor inhibits Hendra virus replication. These studies are the first to demonstrate a host miRNA response to Hendra virus infection and suggest an important role for host miRNAs in Hendra virus disease. PMID:23345523

45 CFR 146.120 - Interaction with the Family and Medical Leave Act. [Reserved

Science.gov (United States)

2010-10-01

... 45 Public Welfare 1 2010-10-01 2010-10-01 false Interaction with the Family and Medical Leave Act. [Reserved] 146.120 Section 146.120 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES REQUIREMENTS... Interaction with the Family and Medical Leave Act. [Reserved] ...

Single-molecule magnet behavior in an octanuclear dysprosium(iii) aggregate inherited from helical triangular Dy3 SMM-building blocks.

Science.gov (United States)

Zhang, Li; Zhang, Peng; Zhao, Lang; Wu, Jianfeng; Guo, Mei; Tang, Jinkui

2016-06-28

An unprecedented octanuclear dysprosium(iii) cluster with the formula [Dy8L6(μ3-OH)4(μ2-CH3O)2(CH3OH)6(H2O)2]·6H2O·10CH3OH·2CH3CN () based on a nonlinearly tritopic aroylhydrazone ligand H3L has been isolated, realizing the successful linking of pairwise interesting triangular Dy3 SMMs. It is noteworthy that two enantiomers (Λ and Δ configurations) individually behaving as a coordination-induced chirality presented in the Dy3 helicate are connected in the meso Dy8 cluster. Remarkably, alternating-current magnetic susceptibility measurements revealed that the Dy8 cluster shows typical SMM behavior inherited from its Dy3 helical precursor. It is one of the rare polynuclear Lnn SMMs (n > 7) under zero dc field.

Effect of solvents on relation of intensities of bands of luminescence spectra of terbium and dysprosium ions in solutions of their complexes with acetoacetic ester

International Nuclear Information System (INIS)

Kononenko, L.I.; Bel'tyukova, S.V.; Meshkova, S.B.; Kravchenko, T.B.; Poluehktov, N.S.

1978-01-01

An investigation is made of the effect of different solvents on the ratio of the intensity of luminescence spectrum bands of terbium and dysprosium ions, corresponding and not corresponding to ''supersensitive'' transitions in complex compounds with acetoacetic ether. A dependence is established between these values and the dielectric constant of the solvent, and also parallels in their changes, which indicate the similar manifestation of the effect of solvents in both elements. A correlation is observed between ratios of the intensity of luminescence spectrum bands and values of forces of neodymium complex absorption band oscillators in different solvents

BDNF VAL66MET Polymorphism Elevates the Risk of Bladder Cancer via MiRNA-146b in Micro-Vehicles

Directory of Open Access Journals (Sweden)

Cong Li

2018-01-01

Full Text Available Background/Aims: Emerging studies on brain-derived neurotrophic factor (BDNF have shown that might be novel biomarkers and therapeutic targets for cancer. We explore the role of BDNF in the tumorigenesis of bladder cancer and the underlying molecular mechanism. Methods: 368 patients with diagnosed bladder cancer and 352 healthy controls were enrolled to evaluate the association of BDNF and the miR-146b. Bioinformatics algorithm analysis and luciferase assay were performed to identify the target genes of miR-146b. Real-time PCR and western-blot were carried out to validate the relationship between miR-146b and CRK. MTT assay and FACS were used to evaluated the proliferation and apoptosis of cancer cells. MVs were isolated and transfect into the culture cells to confirm the above observation. Results: The clinical study shows that BDNF Met/Met was significantly associated with the risk of bladder cancer. In addition, comparing with Val/Val and Val/Met, Met/Met has lower miR-146b level. Luciferase assay shows that BDNF Val/Val is apparently enhanced miR-146b promoter-luciferase, but not BDNF Met/Met. Based on luciferase assay, CRK is a direct target gene of miR-146b. MiR-146b mimics significantly inhibited the expression of CRK and activation of AKT level. The expression of CRK and the activation of AKT (p-AKT were significantly inhibited by MV-BDNF Val/Val-miR-146b or MV-BDNF Val/Met-miR-146b, but not MV-BDNF Met/Met-miR-146b. MV-BDNF Val/Val-miR-146b or Val/Met-miR-146b obviously inhibited cell proliferation, which eliminated by CRK. Meanwhile, with MV-BDNF Met/Met-miR-146b or Met/Met-miR-146b+CRK did not affect the proliferation. MV-BDNF Val/Val-miR-146b or Val/Met-miR-146b enhanced cell apoptosis, which could be eliminated by CRK. Meanwhile, MV-BDNF Met/Met-miR-146b or Met/Met-miR-146b+CRK did not promote apoptosis. Conclusion: BDNF VAL66MET polymorphism is associated with miR-146b and its target gene CRK. MiR-146b and CRK mediated BDNF VAL66

TR146 cells grown on filters as a model of human buccal epithelium

DEFF Research Database (Denmark)

Mørck Nielsen, H; Rømer Rassing, M; Nielsen, Hanne Mørck

2000-01-01

cell culture model, and human and porcine buccal epithelium were compared. The esterase activity in the intact cell culture model and in the porcine buccal mucosa was compared. Further, the TR146 cell culture model was used to study the permeability rate and metabolism of leu-enkephalin. The activity...... of the three enzymes in the TR146 homogenate supernatants was in the same range as the activity in homogenate supernatants of human buccal epithelium. In the TR146 cell culture model, the activity of aminopeptidase (13.70+/-2.10 nmol/min per mg protein) was approx. four times the activity of carboxypeptidase...

Experimental Demyelination and Axonal Loss Are Reduced in MicroRNA-146a Deficient Mice

Directory of Open Access Journals (Sweden)

Nellie A. Martin

2018-03-01

Full Text Available BackgroundThe cuprizone (CPZ model of multiple sclerosis (MS was used to identify microRNAs (miRNAs related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO mice: this miRNA is differentially expressed in MS lesions and promotes differentiation of oligodendrocyte precursor cells (OPCs during remyelination, but its role has not been examined during demyelination.MethodsMicroRNAs were examined by Agilent Mouse miRNA Microarray in the corpus callosum during CPZ-induced demyelination and remyelination. Demyelination, axonal loss, changes in number of oligodendrocytes, OPCs, and macrophages/microglia was compared by histology/immunohistochemistry between KO and WT mice. Differential expression of target genes and proteins of miR-146a was analyzed in the transcriptome (4 × 44K Agilent Whole Mouse Genome Microarray and proteome (liquid chromatography tandem mass spectrometry of CPZ-induced de- and remyelination in WT mice. Levels of proinflammatory molecules in the corpus callosum were compared in WT versus KO mice by Meso Scale Discovery multiplex protein analysis.ResultsmiR-146a was increasingly upregulated during CPZ-induced de- and remyelination. The absence of miR-146a in KO mice protected against demyelination, axonal loss, body weight loss, and atrophy of thymus and spleen. The number of CNP+ oligodendrocytes was increased during demyelination in the miR-146a KO mice, while there was a trend of increased number of NG2+ OPCs in the WT mice. miR-146a target genes, SNAP25 and SMAD4, were downregulated in the proteome of demyelinating corpus callosum in WT mice. Higher levels of SNAP25 were measured by ELISA in the corpus callosum of miR-146a KO mice, but there was no difference between KO and WT mice during demyelination. Multiplex protein analysis of the corpus callosum lysate revealed upregulated TNF-RI, TNF-RII, and CCL2 in the WT mice in contrast to KO mice. The number of Mac3+ and

TR146 cells grown on filters as a model of human buccal epithelium

DEFF Research Database (Denmark)

Nielsen, H M; Rassing, M R; Nielsen, Hanne Mørck

2000-01-01

The objective of the present study was to evaluate the TR146 cell culture model as an in vitro model of human buccal epithelium. For this purpose, the permeability of water, mannitol and testosterone across the TR146 cell culture model was compared to the permeability across human, monkey...

Combustion of gadolinium and dysprosium chelates as a cellular integrity marker in MR imaging

International Nuclear Information System (INIS)

Ericsson, A.; Bach-Gansmo, T.; Niklasson, F.; Hemmingsson, A.

1995-01-01

A combination of gadolinium (Gd) and dysprosium (Dy) chelates was investigated as a potential marker of cell-membrane integrity by means of a double-contrast effect in MR imaging. Blood samples with varying hematocrit (Hct) levels containing intact or lysed cells were used as model systems. With intact cells, the agents were assumed to be distributed solely extracellularly and the highest Hct studied (69%) was assumed to mimic the ratio of extracellular to intracellular water in tissue. The combined effect on image intensity of Gd (in a concentration corresponding to 0.2 mmol/kg b.w. in humans) and Dy (0.6 mmol/kg b.w.) applied simultaneously was a marked difference in signal intensity between samples with intact and lysed cells in both the T1- and T2-weighted spin-echo images with a corresponding increase in the contrast-to-noise ratio. This was the result of a T1 reduction caused by Gd with a negligible Dy susceptibility effect in areas with lysed cells. On the other hand, the Dy susceptibility effect (i.e. reduced apparent T2) dominated in areas with intact cells. Thus, the combination of Gd and Dy may serve as a marker of cell-membrane integrity in MR examinations. (orig.)

Dysprosium doping induced shape and magnetic anisotropy of Fe{sub 3−x}Dy{sub x}O{sub 4} (x=0.01–0.1) nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Jain, Richa [School of Sciences, Indira Gandhi National Open University, Maidan Garhi, New Delhi 110068 (India); Department of Physics, ARSD college, University of Delhi, New Delhi 110021 (India); Luthra, Vandna [Department of Physics, Gargi College, Siri Fort Road, New Delhi 110049 (India); Gokhale, Shubha, E-mail: sgokhale@ignou.ac.in [School of Sciences, Indira Gandhi National Open University, Maidan Garhi, New Delhi 110068 (India)

2016-09-15

The effect of dysprosium doping on evolution of structural and magnetic properties of magnetite (Fe{sub 3}O{sub 4}) nanoparticles is reported. A standard route of co-precipitation was used for the synthesis of undoped and doped magnetite nanoparticles Fe{sub 3−x}Dy{sub x}O{sub 4} (x=0.0–0.1). Transmission electron microscopy (TEM) shows formation of round shaped particles with diameter in the range of 8–14 nm for undoped sample. On doping beyond x=0.01, the formation of rod like structures is initiated along with the round shaped particles. The number of rods is found to increase with increasing doping concentration. Magnetic characterization using Vibrating Sample Magnetometer (VSM) revealed doping dependent magnetic properties which can be correlated with the crystallite size as determined from X-ray diffraction (XRD). Enhancement in the saturation magnetization in the initial stages of doping can be explained on the basis of incorporation of Dy{sup 3+} ions in the inverse spinel structure at the octahedral site in place of Fe{sup 3+} ions. Subsequent decrease in saturation magnetization observed beyond x=0.03 could be attributed to precipitation of excess Dy in form of dysprosium ferrite phase. - Highlights: • Report on formation of nanorods in magnetite prompted by Dy doping. • Observation of anisotropic magnetic behaviour emanating from the shape anisotropy. • Evidence of Dy{sup 3+} ions occupying octahedral site in place of Fe{sup 3+} ions. • Nanorods envisaged to be useful as catalysts and in biomedical applications.

miR-146a modulates autoreactive Th17 cell differentiation and regulates organ-specific autoimmunity.

Science.gov (United States)

Li, Bo; Wang, Xi; Choi, In Young; Wang, Yu-Chen; Liu, Siyuan; Pham, Alexander T; Moon, Heesung; Smith, Drake J; Rao, Dinesh S; Boldin, Mark P; Yang, Lili

2017-10-02

Autoreactive CD4 T cells that differentiate into pathogenic Th17 cells can trigger autoimmune diseases. Therefore, investigating the regulatory network that modulates Th17 differentiation may yield important therapeutic insights. miR-146a has emerged as a critical modulator of immune reactions, but its role in regulating autoreactive Th17 cells and organ-specific autoimmunity remains largely unknown. Here, we have reported that miR-146a-deficient mice developed more severe experimental autoimmune encephalomyelitis (EAE), an animal model of human multiple sclerosis (MS). We bred miR-146a-deficient mice with 2D2 T cell receptor-Tg mice to generate 2D2 CD4 T cells that are deficient in miR-146a and specific for myelin oligodendrocyte glycoprotein (MOG), an autoantigen in the EAE model. miR-146a-deficient 2D2 T cells induced more severe EAE and were more prone to differentiate into Th17 cells. Microarray analysis revealed enhancements in IL-6- and IL-21-induced Th17 differentiation pathways in these T cells. Further study showed that miR-146a inhibited the production of autocrine IL-6 and IL-21 in 2D2 T cells, which in turn reduced their Th17 differentiation. Thus, our study identifies miR-146a as an important molecular brake that blocks the autocrine IL-6- and IL-21-induced Th17 differentiation pathways in autoreactive CD4 T cells, highlighting its potential as a therapeutic target for treating autoimmune diseases.

Expression of miR-146a-5p in patients with intracranial aneurysms and its association with prognosis.

Science.gov (United States)

Zhang, H-L; Li, L; Cheng, C-J; Sun, X-C

2018-02-01

The study aims to detect the association of miR-146a-5p with intracranial aneurysms (IAs). The expression of miR-146a-5p was compared from plasma samples between 72 patients with intracranial aneurysms (IAs) and 40 healthy volunteers by quantitative Real-time polymerase chain reaction (qRT-PCR). Statistical analysis was performed to analyze the relationship between miR-146a-5p expression and clinical data and overall survival (OS) time of IAs patients. Univariate and multivariate Cox proportional hazards have also been performed. Notably, higher miR-146a-5p expression was found in plasma samples from 72 patients with intracranial aneurysms (IAs) compared with 40 healthy controls. Higher miR-146a-5p expression was significantly associated with rupture and Hunt-Hess level in IAs patients. Kaplan-Meier survival analysis verified that higher miR-146a-5p expression predicted a shorter overall survival (OS) compared with lower miR-146a-5p expression in IAs patients. Univariate and multivariate Cox proportional hazards demonstrated that higher miR-146a-5p expression, rupture, and Hunt-Hess were independent risk factors of OS in patients with intracranial aneurysms (IAs). MiR-146a-5p expression may serve as a biomarker for predicting prognosis in patients with IAs.

MicroRNA-146a and AMD3100, two ways to control CXCR4 expression in acute myeloid leukemias

Energy Technology Data Exchange (ETDEWEB)

Spinello, I; Quaranta, M T; Riccioni, R; Riti, V; Pasquini, L; Boe, A; Pelosi, E [Department of Hematology, Oncology and Molecular Medicine, Istituto Superiore di Sanità, Rome (Italy); Vitale, A; Foà, R [Department of Cellular Biotechnologies and Hematology, Division of Hematology, ‘Sapienza' University, Rome (Italy); Testa, U; Labbaye, C [Department of Hematology, Oncology and Molecular Medicine, Istituto Superiore di Sanità, Rome (Italy)

2011-06-01

CXCR4 is a negative prognostic marker in acute myeloid leukemias (AMLs). Therefore, it is necessary to develop novel ways to inhibit CXCR4 expression in leukemia. AMD3100 is an inhibitor of CXCR4 currently used to mobilize cancer cells. CXCR4 is a target of microRNA (miR)-146a that may represent a new tool to inhibit CXCR4 expression. We then investigated CXCR4 regulation by miR-146a in primary AMLs and found an inverse correlation between miR-146a and CXCR4 protein expression levels in all AML subtypes. As the lowest miR-146a expression levels were observed in M5 AML, we analyzed the control of CXCR4 expression by miR-146a in normal and leukemic monocytic cells and showed that the regulatory miR-146a/CXCR4 pathway operates during monocytopoiesis, but is deregulated in AMLs. AMD3100 treatment and miR-146a overexpression were used to inhibit CXCR4 in leukemic cells. AMD3100 treatment induces the decrease of CXCR4 protein expression, associated with miR-146a increase, and increases sensitivity of leukemic blast cells to cytotoxic drugs, this effect being further enhanced by miR-146a overexpression. Altogether our data indicate that miR-146a and AMD3100, acting through different mechanism, downmodulate CXCR4 protein levels, impair leukemic cell proliferation and then may be used in combination with anti-leukemia drugs, for development of new therapeutic strategies.

MicroRNA-146a and AMD3100, two ways to control CXCR4 expression in acute myeloid leukemias

International Nuclear Information System (INIS)

Spinello, I; Quaranta, M T; Riccioni, R; Riti, V; Pasquini, L; Boe, A; Pelosi, E; Vitale, A; Foà, R; Testa, U; Labbaye, C

2011-01-01

CXCR4 is a negative prognostic marker in acute myeloid leukemias (AMLs). Therefore, it is necessary to develop novel ways to inhibit CXCR4 expression in leukemia. AMD3100 is an inhibitor of CXCR4 currently used to mobilize cancer cells. CXCR4 is a target of microRNA (miR)-146a that may represent a new tool to inhibit CXCR4 expression. We then investigated CXCR4 regulation by miR-146a in primary AMLs and found an inverse correlation between miR-146a and CXCR4 protein expression levels in all AML subtypes. As the lowest miR-146a expression levels were observed in M5 AML, we analyzed the control of CXCR4 expression by miR-146a in normal and leukemic monocytic cells and showed that the regulatory miR-146a/CXCR4 pathway operates during monocytopoiesis, but is deregulated in AMLs. AMD3100 treatment and miR-146a overexpression were used to inhibit CXCR4 in leukemic cells. AMD3100 treatment induces the decrease of CXCR4 protein expression, associated with miR-146a increase, and increases sensitivity of leukemic blast cells to cytotoxic drugs, this effect being further enhanced by miR-146a overexpression. Altogether our data indicate that miR-146a and AMD3100, acting through different mechanism, downmodulate CXCR4 protein levels, impair leukemic cell proliferation and then may be used in combination with anti-leukemia drugs, for development of new therapeutic strategies

Dioxin induces expression of hsa-miR-146b-5p in human neuroblastoma cells.

Science.gov (United States)

Xu, Tuan; Xie, Heidi Q; Li, Yunping; Xia, Yingjie; Sha, Rui; Wang, Lingyun; Chen, Yangsheng; Xu, Li; Zhao, Bin

2018-01-01

Dioxin can cause a series of neural toxicological effects. MicroRNAs (miRs) play important roles in regulating nervous system function and mediating cellular responses to environmental pollutants, such as dioxin. Hsa-miR-146b-5p appears to be involved in neurodegenerative diseases and brain tumors. However, little is known about effects of dioxin on the expression of hsa-miR-146b-5p. We found that the hsa-miR-146b-5p expression and its promoter activity were significantly increased in dioxin treated SK-N-SH cells, a human-derived neuroblastoma cell line. Potential roles of hsa-miR-146b-5p in mediating neural toxicological effects of dioxin may be due to the regulation of certain target genes. We further confirmed that hsa-miR-146b-5p significantly suppressed acetylcholinesterase (AChE) activity and targeted the 3'-untranslated region of the AChE T subunit, which has been down-regulated in dioxin treated SK-N-SH cells. Functional bioinformatic analysis showed that the known and predicted target genes of hsa-miR-146b-5p were involved in some brain functions or cyto-toxicities related to known dioxin effects, including synapse transmission, in which AChE may serve as a responsive gene for mediating the effect. Copyright © 2017. Published by Elsevier B.V.

22 CFR 146.445 - Marital or parental status.

Science.gov (United States)

2010-04-01

... EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 146.445 Marital or parental status. (a) Status..., or marital status that treats students differently on the basis of sex. (b) Pregnancy and related...

Association of MicroRNA-146a rs2910164 Gene Polymorphism with Metabolic Syndrome.

Science.gov (United States)

Mehanna, E T; Ghattas, M H; Mesbah, N M; Saleh, S M; Abo-Elmatty, D M

2015-01-01

Alteration in microRNA-146a (miRNA-146a) expression is an important event in the pathogenesis of many human diseases. MiRNA-146a rs2910164 is a functional polymorphism that showed association with several diseases. Metabolic syndrome is an aggregation of multiple risk factors including impaired glucose tolerance, increased highdensity lipoprotein, abdominal obesity, and high blood pressure. The aim of this study was to assess the relation of miRNA-146a rs2910164 with metabolic syndrome and its component traits in Egyptian women from the Suez Canal area. The study included 100 healthy female subjects and 100 metabolic syndrome patients. The component traits of metabolic syndrome were determined and the genotypes of the polymorphisms were assessed using the polymerase chain reaction-restriction fragment length polymorphism technique using the restriction enzyme Hpy188I. The rare C allele had a significantly higher frequency in metabolic syndrome patients (P = 0.013). The heterozygote GC and the rare CC genotypes showed a significant increase in body mass index, waist circumference, triglycerides, total cholesterol, low-density lipoprotein, systolic and diastolic blood pressure. The GC genotype was associated with higher fasting blood glucose, fasting serum insulin and insulin resistance. The carriers of CC genotype had significantly lower HDL compared with the GG genotype carriers. In conclusion, The C allele of miRNA-146a rs2910164 showed positive association with increased susceptibility to metabolic syndrome and its phenotypes in the study population.

MiR-146a modulates macrophage polarization by inhibiting Notch1 pathway in RAW264.7 macrophages.

Science.gov (United States)

Huang, Cheng; Liu, Xue-Jiao; QunZhou; Xie, Juan; Ma, Tao-Tao; Meng, Xiao-Ming; Li, Jun

2016-03-01

Macrophages are heterogeneous and plastic cells which are able to undergo dynamic transition between M1 and M2 polarized phenotypes in response to the microenvironment signals. However, the underlying molecular mechanisms of macrophage polarization are still obscure. In the current study, it was revealed that miR-146a might play a pivotal role in macrophage polarization. As our results indicated, miR-146a was highly expressed in M2 macrophages rather than M1 macrophages. Over-expression of miR-146a resulted in significantly decreased production of pro-inflammatory cytokines including iNOS and TNF-α in M1 macrophages, while increased production of M2 marker genes such as Arg1 and CD206 in M2 macrophages. In contrast, knockdown of miR-146a promoted M1 macrophage polarization but diminished M2 macrophage polarization. Mechanistically, it was revealed that miR-146a modulated macrophage polarization by targeting Notch1. Of note, PPARγ was responsible as another target for miR-146a-mediated macrophage polarization. Taken together, it was suggested that miR-146a might serve as a molecular regulator in macrophage polarization and is a potential therapeutic target for inflammatory diseases. Copyright © 2016 Elsevier B.V. All rights reserved.

Textured dysprosium and gadolinium poles for high-field, short-period hybrid undulators

International Nuclear Information System (INIS)

Murokh, Alex; Solovyov, Vyacheslav; Agustsson, Ron; O'Shea, Finn H.; Chubar, Oleg; Chen, Yung; Grandsaert, Thomas

2014-01-01

We discuss the feasibility of enhancement of the gap field in a short-period hybrid undulator by using pole inserts with the saturation inductance B s , over that of iron, 2 T. Dysprosium metal, with the saturation inductance of 3.4 T below 90 K, and Gadolinium with B s =2.7 T, appear as good candidates as the optimized pole material. However, due to the high magnetic anisotropy of Dy, such a high level of magnetization can only be realized when the external field lies in the basal plane. This implies that the pole has to be single-crystalline or highly textured. Considering that growing large, >10mm, Dy single crystals is difficult, we propose secondary recrystallization as a method to induce the required texture in thin Dy and Gd foils. The textured foils can be stacked to produce pole inserts of the desired geometry and orientation. Results of small-scale processing and magnetic measurements of thin (20–60 μ) foils provide evidence that the required texture quality can be achieved by a relatively simple sequence of heat-treatments and cold rolling. The advantage of textured Dy and Gd poles is demonstrated in a several period test undulator. -- Highlights: • Textured rare-earth materials for use as undulator pole materials. • We measure the development of texture in Dy and Gd. • We compare the rare-earth materials with high saturation steel in undulators. • Thin sheets of Dy and Gd materials perform similar to single crystals

22 CFR 146.520 - Job classification and structure.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Job classification and structure. 146.520... IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the... and structure. A recipient shall not: (a) Classify a job as being for males or for females; (b...

40 CFR 146.4 - Criteria for exempted aquifers.

Science.gov (United States)

2010-07-01

... (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM: CRITERIA AND STANDARDS General Provisions § 146.4 Criteria... of a permit application for a Class II or III operation to contain minerals or hydrocarbons that... public water system. (Clean Water Act, Safe Drinking Water Act, Clean Air Act, Resource Conservation and...

CD146 expression on primary nonhematopoietic bone marrow stem cells is correlated with in situ localization

Science.gov (United States)

Tormin, Ariane; Li, Ou; Brune, Jan Claas; Walsh, Stuart; Schütz, Birgit; Ehinger, Mats; Ditzel, Nicholas; Kassem, Moustapha

2011-01-01

Nonhematopoietic bone marrow mesenchymal stem cells (BM-MSCs) are of central importance for bone marrow stroma and the hematopoietic environment. However, the exact phenotype and anatomical distribution of specified MSC populations in the marrow are unknown. We characterized the phenotype of primary human BM-MSCs and found that all assayable colony-forming units-fibroblast (CFU-Fs) were highly and exclusively enriched not only in the lin−/CD271+/CD45−/CD146+ stem-cell fraction, but also in lin−/CD271+/CD45−/CD146−/low cells. Both populations, regardless of CD146 expression, shared a similar phenotype and genotype, gave rise to typical cultured stromal cells, and formed bone and hematopoietic stroma in vivo. Interestingly, CD146 was up-regulated in normoxia and down-regulated in hypoxia. This was correlated with in situ localization differences, with CD146 coexpressing reticular cells located in perivascular regions, whereas bone-lining MSCs expressed CD271 alone. In both regions, CD34+ hematopoietic stem/progenitor cells were located in close proximity to MSCs. These novel findings show that the expression of CD146 differentiates between perivascular versus endosteal localization of non-hematopoietic BM-MSC populations, which may be useful for the study of the hematopoietic environment. PMID:21415267

Portland cement induces human periodontal ligament cells to differentiate by upregulating miR-146a

Directory of Open Access Journals (Sweden)

Min-Ching Wang

2018-04-01

Full Text Available Background/Purpose: Bioaggregates such as Portland cement (PC can be an economical alternative for mineral trioxide aggregate (MTA with additional benefit of less discoloration. MTA has been known to induce differentiations of several dental cells. MicroRNAs are important regulators of biological processes, including differentiation, physiologic homeostasis, and disease progression. This study is to explore how PC enhances the differentiation of periodontal ligament (PDL cells in microRNAs level. Methods: PDL cells were cultured in a regular PC- or MTA-conditioned medium or an osteoinduction medium (OIM. Alizarin red staining was used to evaluate the extent of mineralization. Transfection of microRNA mimics induced exogenous miR-31 and miR-146a expression. The expression of microRNAs and differentiation markers was assayed using reverse-transcriptase polymerase chain reaction. Results: PC enhanced the mineralization of PDL cells in a dose-dependent manner in the OIM. Exogenous miR-31 and miR-146a expression upregulated alkaline phosphatase (ALP, bone morphogenic protein (BMP, and dentin matrix protein 1 (DMP1 expression. However, miR-31 and miR-146a modulates cementum protein 1 (CEMP1 expression in different ways. PC also enhanced ALP and BMP but attenuated CEMP1 in the OIM. Although the OIM or PC treatment upregulated miR-21, miR-29b, and miR-146a, only miR-146a was able to be induced by PC in combination with OIM. Conclusion: This study demonstrated that PC enhances the differentiation of PDL cells, especially osteogenic through miR-146a upregulation. In order to control the ankylosis after regenerative endodontics with the usage of bioaggregates, further investigations to explore these differentiation mechanisms in the miRNA level may be needed. Keywords: Portland cement, Bioaggregate, miR-146a, Osteogenic differentiation, Periodontal ligament (PDL

A single nucleotide polymorphism in primary-microRNA-146a reduces the expression of mature microRNA-146a in patients with Alzheimer's disease and is associated with the pathogenesis of Alzheimer's disease.

Science.gov (United States)

Zhang, Bin; Wang, Aihong; Xia, Cuiping; Lin, Qunfeng; Chen, Chunfu

2015-09-01

Alzheimer's disease (AD) is a progressive neurodegenerative disorder and is the most common form of dementia among the aging population. Although the incidence of the disease continues to increase, no cure has been developed. Effective treatment is restricted not only due to the lack of curative medicine, but also due to limited understanding of the underlying mechanisms and the difficulties in accurately diagnosing AD in its earliest stages prior to clinical symptoms. Micro (mi) RNAs (miR) have gained increasing attention in the investigation of neurodegenerative diseases. Previous reports have demonstrated that deregulation of miR‑146a‑5p is associated with the pathogenesis of human AD. In the present study, the coding region of primary (pri)‑miR‑146a in patients with AD was scanned and the rare C allele of rs2910164 was found to be associated with AD. Using reverse transcription quantitative polymerase chain reaction, it was demonstrated that site variation reduced the expression of mature miR‑146a‑5p. Notably, a reduction in the expression of miR‑146a‑5p led to less efficient inhibition of target genes, including Toll‑like receptor (TLR)2, which is important in the pathogenesis of AD. Biological function investigations in RAW264.7 cells indicated that, compared with the G allele, the rare C allele upregulated the expression of tumor necrosis factor‑α following stimulation with β‑amyloid. These findings suggested that one common polymorphism in pri‑miR‑146a may contribute to the genetic predisposition to AD by disrupting the production of miR‑146a‑5p and affecting the expression and function of TLR2.

miR-146a Suppresses Invasion of Pancreatic Cancer Cells

Science.gov (United States)

Li, Yiwei; VandenBoom, Timothy G.; Wang, Zhiwei; Kong, Dejuan; Ali, Shadan; Philip, Philip A.; Sarkar, Fazlul H.

2010-01-01

The aggressive course of pancreatic cancer is believed to reflect its unusually invasive and metastatic nature, which is associated with epidermal growth factor receptor (EGFR) overexpression and NF-κB activation. MicroRNAs (miRNA) have been implicated in the regulation of various pathobiological processes in cancer, including metastasis in pancreatic cancer and in other human malignancies. In this study, we report lower expression of miR-146a in pancreatic cancer cells compared with normal human pancreatic duct epithelial cells. Reexpression of miR-146a inhibited the invasive capacity of pancreatic cancer cells with concomitant downregulation of EGFR and the NF-κB regulatory kinase interleukin 1 receptor–associated kinase 1 (IRAK-1). Cellular mechanism studies revealed crosstalk between EGFR, IRAK-1, IκBα, NF-κB, and MTA-2, a transcription factor that regulates metastasis. Treatment of pancreatic cancer cells with the natural products 3,3′-diinodolylmethane (DIM) or isoflavone, which increased miR-146a expression, caused a downregulation of EGFR, MTA-2, IRAK-1, and NF-κB, resulting in an inhibition of pancreatic cancer cell invasion. Our findings reveal DIM and isoflavone as nontoxic activators of a miRNA that can block pancreatic cancer cell invasion and metastasis, offering starting points to design novel anticancer agents. PMID:20124483

146----10 Dec indd [ FINAL VERSION].indd

African Journals Online (AJOL)

23 Sep 2009 ... e o lo g ic a l S tu d ie s http://www.hts.org.za. HTS. Original Research. A ... phronēsis and Paul Ricoeur's movement from mimēsis1 ... It is not only pastors' knowledge of the Bible, theological tradition and ...... way that we are led into the truth and life (John 14:6). ..... human brain, Harper Collins, New York.

miR-146a negatively regulates the induction of proinflammatory cytokines in response to Japanese encephalitis virus infection in microglial cells.

Science.gov (United States)

Deng, Minnan; Du, Ganqin; Zhao, Jiegang; Du, Xiaowei

2017-06-01

Increasing evidence confirms the involvement of virus infection and miRNA, such as miR-146a, in neuroinflammation-associated epilepsy. In the present study, we investigated the upregulation of miR-146a with RT-qPCR and in situ hybridization methods in a mice infection model of Japanese encephalitis virus (JEV) and in vitro. Subsequently we investigated the involvement of miR-146a in modulating JEV-induced neuroinflammation. It was demonstrated that JEV infection promoted miR-146a production in BALB/c mice brain and in cultured mouse microglial C8-B4 cells, along with pro-inflammatory cytokines, such as IL-1β, IL-6, TNF-α, IFN-β and IFN-α. We also found that miR-146a exerted negative regulatory effects upon IL-1β, IL-6, TNF-α, IFN-β and IFN-α in C8-B4 cells. Accordingly, miR-146a downregulation with a miR-146a inhibitor promoted the upregulation of IL-1β, IL-6, TNF-α, IFN-β and IFN-α, whereas miR-146a upregulation with miR-146a mimics reduced the upregulation of these cytokines. Moreover, miR-146a exerted no regulation upon JEV growth in C8-B4 cells. In conclusion, JEV infection upregulated miR-146a and pro-inflammatory cytokine production, in mice brain and in cultured C8-B4 cells. Furthermore, miR-146a negatively regulated the production of JEV-induced pro-inflammatory cytokines, in virus growth independent fashion, identifying miR-146a as a negative feedback regulator in JEV-induced neuroinflammation, and possibly in epilepsy.

MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer

Science.gov (United States)

2015-09-01

determined whether miR-146a inhibitor promotes CRPC phenotype by upregulating SIAH2 in LNCaP and MDAPCa2b cells. First we determined the effect of DHT (5α...dihydrotestosterone) on proliferation of these cells grown in the presence of charcoal stripped calf serum. The results indicated that DHT increased...proliferation of both parental LNCaP and MDAPCa2b cells but DHT did not increase proliferation of miR-146a inhibitor expressing cell lines (Fig. 6

Experimental demyelination and axonal loss are reduced in MicroRNA-146a deficient mice

DEFF Research Database (Denmark)

Martin, Nellie A.; Molnar, Viktor; Szilagyi, Gabor T.

2018-01-01

Background: The cuprizone (CPZ) model of multiple sclerosis (MS) was used to identify microRNAs (miRNAs) related to in vivo de- and remyelination. We further investigated the role of miR-146a in miR-146a-deficient (KO) mice: this miRNA is differentially expressed in MS lesions and promotes differ...

The E3 ubiquitin ligase RNF146 promotes colorectal cancer by activating the Wnt/β-catenin pathway via ubiquitination of Axin1.

Science.gov (United States)

Shen, Jiangli; Yu, Zhaohui; Li, Na

2018-06-20

The E3 ubiquitin ligase ring finger protein 146 (RNF146) has been implicated in tumor development. However, the role and clinical significance of RNF146 in colorectal cancer (CRC) remain unknown. In this study, we reported for the first time that RNF146 was upregulated in CRC tissues as well as in cell lines. Further, RNF146 expression was independent prognostic factor for poor outcome of CRC patients. RNF146 knockdown in cell lines inhibited cell growth, promoted cell apoptosis in vitro and suppressed colorectal tumor growth in vivo. Mechanistic investigations revealed that RNF146 exerted oncogenic role through ubiquitination of Axin1 to activate β-catenin signalling. In addition, RNF146 expression was positively correlated with β-catenin expression in CRC tissues. Collectively, our data suggest that RNF146 might function as a oncogene in human CRC, and represent a promising prognostic factor and a valuable therapeutic target for CRC. Copyright © 2018. Published by Elsevier Inc.

Targeted delivery of microRNA 146b mimic to hepatocytes by lactosylated PDMAEMA nanoparticles for the treatment of NAFLD.

Science.gov (United States)

He, Shuying; Guo, Weihong; Deng, Feihong; Chen, Kequan; Jiang, Yonghong; Dong, Minyu; Peng, Liang; Chen, Xueqing

2018-03-21

Non-alcoholic fatty liver disease (NAFLD) is one of the most common chronic liver diseases worldwide, and precision therapeutic will be a benefit for the NAFLD regression. In this study, we observed low microRNA 146 b (miR-146 b) expression in NAFLD mice model induced by methionine-choline-deficient diet (MCD) compared with control group. Furthermore, miR-146b -/- mice induced MCD exhibited severe liver steatosis and hepatitis. A bio-distribution study showed that novel Lactosylated PDMAEMA nanoparticles effectively targeted hepatocytes Lac-PDMAEMA. We coupled miR-146b mimic with Lac-PDMAEMA and then were administrated to NAFLD mice model, which could obviously alleviate the hepatic steatosis. Lac-PDMAEMA effectively delivered miR-146b mimic to hepatocytes with a ∼8-fold upregulation of miR-146b mimic targeting MyD88 and IRAK1, and in turn suppressed the expression of PPARγ. Meanwhile, TNF-α and IL-6 mRNA levels were decreased after administration of Lac-PDMAEMA/miR-146b mimic. So, we made a conclusion that targeted delivering miR-146b mimic to the hepatocytes by, coupling Lac-PDMAEMA nanoparticles could effectively alleviate the hepatic steatosis in NAFLD mice, which maybe bring a new and effective way to intervene and therapy the NAFLD.

Inhibition of miR-146b expression increases radioiodine-sensitivity in poorly differential thyroid carcinoma via positively regulating NIS expression

Energy Technology Data Exchange (ETDEWEB)

Li, Luchuan; Lv, Bin; Chen, Bo [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China); Guan, Ming [Department of General Surgery, Qihe People' s Hospital, Qihe, Shandong 251100 (China); Sun, Yongfeng [Department of General Surgery, Licheng District People' s Hospital, Jinan, Shandong 250115 (China); Li, Haipeng [Department of General Surgery, Caoxian People' s Hospital, Caoxian, Shandong 274400 (China); Zhang, Binbin; Ding, Changyuan; He, Shan [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China); Zeng, Qingdong, E-mail: qingdz0201@163.com [Department of General Surgery, Shandong University Qilu Hospital, Jinan, Shandong 250012 (China)

2015-07-10

Dedifferentiated thyroid carcinoma (DTC) with the loss of radioiodine uptake (RAIU) is often observed in clinical practice under radioiodine therapy, indicating the challenge for poor prognosis. MicroRNA (miRNA) has emerged as a promising therapeutic target in many diseases; yet, the role of miRNAs in RAIU has not been generally investigated. Based on recent studies about miRNA expression in papillary or follicular thyroid carcinomas, the expression profiles of several thyroid relative miRNAs were investigated in one DTC cell line, derived from normal DTC cells by radioiodine treatment. The top candidate miR-146b, with the most significant overexpression profiles in dedifferentiated cells, was picked up. Further research found that miR-146b could be negatively regulated by histone deacetylase 3 (HDAC3) in normal cells, indicating the correlation between miR-146b and Na{sup +}/I{sup −} symporter (NIS)-mediated RAIU. Fortunately, it was confirmed that miR-146b could regulate NIS expression/activity; what is more important, miR-146b interference would contribute to the recovery of radioiodine-sensitivity in dedifferentiated cells via positively regulating NIS. In the present study, it was concluded that NIS-mediated RAIU could be modulated by miR-146b; accordingly, miR-146b might serve as one of targets to enhance efficacy of radioactive therapy against poorly differential thyroid carcinoma (PDTC). - Highlights: • Significant upregulated miR-146b was picked up from thyroid relative miRNAs in DTC. • MiR-146b was negatively regulated by HDAC3 in normal thyroid carcinoma cells. • NIS activity and expression could be regulated by miR-146b in thyroid carcinoma. • MiR-146b inhibition could recover the decreased radioiodine-sensitivity of DTC cells.

Study of nano - second isomers near 146Gd

International Nuclear Information System (INIS)

Pramanik, Dibyadyuti; Sarkar, S.; Bisoi, Abhijit; Ray, Sudatta; Ray, I.; Pradhan, M.K.; Goswami, A.; Banerjee, P.; Mukherjee, A.; Bhattacharya, S.; Saha Sarkar, M.; Chakraborty, A.; Dey, Gautam; Krishichayan; Kshetri, R.; Ganguly, S.; Raut, R.; Ray Basu, M.; Ganguly, G.; Ghugre, S.S.; Sinha, A.K.; Basu, S.K.

2010-01-01

The nuclei near 146 Gd show rich variety in their excitation spectra. Spectra exhibiting characteristics of extreme single particle, multi-particle-hole excitation, magnetic bands to strong collectivity manifested through superdeformation, and triaxial superdeformation have been widely studied. In the present work, a few isomers in the mass ≅150 region using the RF - gamma coincidence data are studied

Evaluation of σ-1 receptor radioligand 18F-FTC-146 in rats and squirrel monkeys using PET

DEFF Research Database (Denmark)

James, Michelle L; Shen, Bin; Nielsen, Carsten Haagen

2014-01-01

. Pretreatment with known S1R compounds, haloperidol, or BD1047, before radioligand administration, significantly attenuated (18)F-FTC-146 accumulation in all rat brain regions by approximately 85% (P ...-FTC-146 was observed in rat plasma. Preliminary monkey PET/MRI studies demonstrated specific accumulation of (18)F-FTC-146 in the brain (mainly in cortical structures, cerebellum, and vermis) that could be attenuated by pretreatment with haloperidol. HPLC of monkey plasma suggested radioligand metabolism...

Bio-functionalized dense-silica nanoparticles for MR/NIRF imaging of CD146 in gastric cancer

Directory of Open Access Journals (Sweden)

Wang P

2015-01-01

Full Text Available Pu Wang,1,* Yazhuo Qu,2,* Chuan Li,3 Li Yin,2 Caifei Shen,1 Wei Chen,3 Shiming Yang,4 Xiuwu Bian,2 Dianchun Fang11Institute of Gastroenterology, 2Institute of Pathology, 3Department of Radiology, Southwest Hospital, The Third Military Medical University, Chongqing, People’s Republic of China; 4Department of Gastroenterology, Xinqiao Hospital, The Third Military Medical University, Chongqing, People’s Republic of China*These authors contributed equally to this workPurpose: Nano dense-silica (dSiO2 has many advantages such as adjustable core–shell structure, multiple drug delivery, and controllable release behavior. Improving the gastric tumor-specific targeting efficiency based on the development of various strategies is crucial for anti-cancer drug delivery systems.Methods: Superparamagnetic iron oxide nanoparticles (SPION were coated with dSiO2 as core–shell nanoparticles, and labeled with near infra-red fluorescence (NIRF dye 800ZW (excitation wavelength: 778 nm/­emission wavelength: 806 nm and anti-CD146 monoclonal antibody YY146 for magnetic resonance (MR/NIRF imaging study in xenograft gastric cancer model. The morphology and the size of pre- and postlabeling SPION@dSiO2 core–shell nanoparticles were characterized using transmission electron microscopy. Iron content in SPION@dSiO2 nanoparticles was measured by inductively coupled plasma optical emission spectrometry. Fluorescence microscopy and fluorescence-activated cell sorter studies were carried out to confirm the binding specificity of YY146 and 800ZW–SPION@dSiO2–YY146 on MKN45 cells. In vivo and in vitro NIRF imaging, control (nanoparticles only and blocking studies, and histology were executed on MKN45 tumor-bearing nude mice to estimate the affinity of 800ZW–SPION@dSiO2–YY146 to target tumor CD146.Results: 800ZW–SPION@dSiO2–YY146 nanoparticles were uniformly spherical in shape and dispersed evenly in a cell culture medium. The diameter of the nanoparticle

31 CFR 363.146 - May a certificate of indebtedness be pledged or used as collateral?

Science.gov (United States)

2010-07-01

... pledged or used as collateral? 363.146 Section 363.146 Money and Finance: Treasury Regulations Relating to... certificate of indebtedness be pledged or used as collateral? A certificate of indebtedness may not be pledged or used as collateral for the performance of an obligation. [69 FR 50309, Aug. 16, 2004. Redesignated...

MicroRNA-146a provides feedback regulation of lyme arthritis but not carditis during infection with Borrelia burgdorferi.

Directory of Open Access Journals (Sweden)

Robert B Lochhead

2014-06-01

Full Text Available MicroRNAs have been shown to be important regulators of inflammatory and immune responses and are implicated in several immune disorders including systemic lupus erythematosus and rheumatoid arthritis, but their role in Lyme borreliosis remains unknown. We performed a microarray screen for expression of miRNAs in joint tissue from three mouse strains infected with Borrelia burgdorferi. This screen identified upregulation of miR-146a, a key negative regulator of NF-κB signaling, in all three strains, suggesting it plays an important role in the in vivo response to B. burgdorferi. Infection of B6 miR-146a-/- mice with B. burgdorferi revealed a critical nonredundant role of miR-146a in modulating Lyme arthritis without compromising host immune response or heart inflammation. The impact of miR-146a was specifically localized to the joint, and did not impact lesion development or inflammation in the heart. Furthermore, B6 miR-146a-/- mice had elevated levels of NF-κB-regulated products in joint tissue and serum late in infection. Flow cytometry analysis of various lineages isolated from infected joint tissue of mice showed that myeloid cell infiltration was significantly greater in B6 miR-146a-/- mice, compared to B6, during B. burgdorferi infection. Using bone marrow-derived macrophages, we found that TRAF6, a known target of miR-146a involved in NF-κB activation, was dysregulated in resting and B. burgdorferi-stimulated B6 miR-146a-/- macrophages, and corresponded to elevated IL-1β, IL-6 and CXCL1 production. This dysregulated protein production was also observed in macrophages treated with IL-10 prior to B. burgdorferi stimulation. Peritoneal macrophages from B6 miR-146a-/- mice also showed enhanced phagocytosis of B. burgdorferi. Together, these data show that miR-146a-mediated regulation of TRAF6 and NF-κB, and downstream targets such as IL-1β, IL-6 and CXCL1, are critical for modulation of Lyme arthritis during chronic infection with B

Workplace testing of the new single sphere neutron spectrometer based on Dysprosium activation foils (Dy-SSS)

International Nuclear Information System (INIS)

Bedogni, R.; Gómez-Ros, J.M.; Esposito, A.; Gentile, A.; Chiti, M.; Palacios-Pérez, L.; Angelone, M.; Tana, L.

2012-01-01

A photon insensitive passive neutron spectrometer consisting of a single moderating polyethylene sphere with Dysprosium activation foils arranged along three perpendicular axes was designed by CIEMAT and INFN. The device is called Dy-SSS (Dy foil-based Single Sphere Spectrometer). It shows nearly isotropic response in terms of neutron fluence up to 20 MeV. The first prototype, previously calibrated with 14 MeV neutrons, has been recently tested in workplaces having different energy and directional distributions. These are a 2.5 MeV nearly mono-chromatic and mono-directional beam available at the ENEA Frascati Neutron Generator (FNG) and the photo-neutron field produced in a 15 MV Varian CLINAC DHX medical accelerator, located in the Ospedale S. Chiara (Pisa). Both neutron spectra are known through measurements with a Bonner Sphere Spectrometer. In both cases the experimental response of the Dy-SSS agrees with the reference data. Moreover, it is demonstrated that the spectrometric capability of the new device are independent from the directional distribution of the neutron field. This opens the way to a new generation of moderation-based neutron instruments, presenting all advantages of the Bonner sphere spectrometer without the disadvantage of the repeated exposures. This concept is being developed within the NESCOFI@BTF project of INFN (Commissione Scientifica Nazionale 5).

Workplace testing of the new single sphere neutron spectrometer based on Dysprosium activation foils (Dy-SSS)

Science.gov (United States)

Bedogni, R.; Gómez-Ros, J. M.; Esposito, A.; Gentile, A.; Chiti, M.; Palacios-Pérez, L.; Angelone, M.; Tana, L.

2012-08-01

A photon insensitive passive neutron spectrometer consisting of a single moderating polyethylene sphere with Dysprosium activation foils arranged along three perpendicular axes was designed by CIEMAT and INFN. The device is called Dy-SSS (Dy foil-based Single Sphere Spectrometer). It shows nearly isotropic response in terms of neutron fluence up to 20 MeV. The first prototype, previously calibrated with 14 MeV neutrons, has been recently tested in workplaces having different energy and directional distributions. These are a 2.5 MeV nearly mono-chromatic and mono-directional beam available at the ENEA Frascati Neutron Generator (FNG) and the photo-neutron field produced in a 15 MV Varian CLINAC DHX medical accelerator, located in the Ospedale S. Chiara (Pisa). Both neutron spectra are known through measurements with a Bonner Sphere Spectrometer. In both cases the experimental response of the Dy-SSS agrees with the reference data. Moreover, it is demonstrated that the spectrometric capability of the new device are independent from the directional distribution of the neutron field. This opens the way to a new generation of moderation-based neutron instruments, presenting all advantages of the Bonner sphere spectrometer without the disadvantage of the repeated exposures. This concept is being developed within the NESCOFI@BTF project of INFN (Commissione Scientifica Nazionale 5).

Workplace testing of the new single sphere neutron spectrometer based on Dysprosium activation foils (Dy-SSS)

Energy Technology Data Exchange (ETDEWEB)

Bedogni, R., E-mail: roberto.bedogni@lnf.infn.it [INFN-LNF (Frascati National Laboratories), Via E. Fermi n. 40-00044 Frascati (Italy); Gomez-Ros, J.M. [INFN-LNF (Frascati National Laboratories), Via E. Fermi n. 40-00044 Frascati (Italy); CIEMAT, Av. Complutense 40, 28040 Madrid (Spain); Esposito, A.; Gentile, A.; Chiti, M.; Palacios-Perez, L. [INFN-LNF (Frascati National Laboratories), Via E. Fermi n. 40-00044 Frascati (Italy); Angelone, M. [ENEA C.R. Frascati, C.P. 65, 00044 Frascati (Italy); Tana, L. [A.O. Universitaria Pisana-Ospedale S. Chiara, Via Bonanno Pisano, Pisa (Italy)

2012-08-21

A photon insensitive passive neutron spectrometer consisting of a single moderating polyethylene sphere with Dysprosium activation foils arranged along three perpendicular axes was designed by CIEMAT and INFN. The device is called Dy-SSS (Dy foil-based Single Sphere Spectrometer). It shows nearly isotropic response in terms of neutron fluence up to 20 MeV. The first prototype, previously calibrated with 14 MeV neutrons, has been recently tested in workplaces having different energy and directional distributions. These are a 2.5 MeV nearly mono-chromatic and mono-directional beam available at the ENEA Frascati Neutron Generator (FNG) and the photo-neutron field produced in a 15 MV Varian CLINAC DHX medical accelerator, located in the Ospedale S. Chiara (Pisa). Both neutron spectra are known through measurements with a Bonner Sphere Spectrometer. In both cases the experimental response of the Dy-SSS agrees with the reference data. Moreover, it is demonstrated that the spectrometric capability of the new device are independent from the directional distribution of the neutron field. This opens the way to a new generation of moderation-based neutron instruments, presenting all advantages of the Bonner sphere spectrometer without the disadvantage of the repeated exposures. This concept is being developed within the NESCOFI@BTF project of INFN (Commissione Scientifica Nazionale 5).

Effect of miR-146a-5p on proliferation and metastasis of triple-negative breast cancer via regulation of SOX5.

Science.gov (United States)

Si, Chengshuai; Yu, Qiao; Yao, Yufeng

2018-05-01

MicroRNA (miR)-146a-5p functions as a tumor suppressor in various types of cancer. However, the role of miR-146a-5p in the development of triple-negative breast cancer (TNBC) is unclear. The present study aimed to investigate the role of miR-146a-5p in TNBC. The expression level of miR-146a-5p in TNBC tissues and cell lines was initially detected using reverse transcription-quantitative polymerase chain reaction. To predict the target gene of miR-146a-5p, TargetScan software was used and a dual luciferase assay was performed to verify the prediction. Furthermore, in order to explore the role of miR-146a-5p in TNBC, miR-146a-5p was overexpressed in TNBC cells using miR-146a-5p mimics. An MTT assay was performed to detect cell proliferation, and a Transwell assay was conducted to determine cell migration and invasion. Furthermore, western blotting was performed to measure associated protein expression. It was revealed that miR-146a-5p was downregulated in TNBC tissues and cell lines. SOX5 was indicated to be a target gene of miR-146a-5p and was upregulated in TNBC cells. Additionally, miR-146a-5p could inhibit TNBC cell proliferation, migration and invasion, repress the expression of mesenchymal markers (N-cadherin, vimentin and fibronectin) and increase epithelial marker (E-cadherin) expression. Furthermore, SOX5 overexpression eliminated the effects of miR-146a-5p mimics on TNBC cells. In conclusion, the data of the present study indicated that miR-146a-5p inhibits the proliferation and metastasis of TNBC cells by regulating SOX5.

Nuclear statistics of dysprosium resonance parameters in the energy range 10 - 1000 eV

International Nuclear Information System (INIS)

Shin, S. G.; Kye, Y. U.; Cho, M. H.; Kim, G. N.; Namkung, W.; Lee, M. W.; Kang, Y. R.; Roe, T. I.

2016-01-01

A resonance parameter analysis is often performed in the Resolved Resonance Region (RRR) in order to estimate the average level spacing, distribution of the reduced widths and so on. Neutron Capture experiments on dysprosium isotopes were performed at the electron linear accelerator (LINAC) facility of the Rensselear Polytechnic Institute (RPI) in the neutron energy region from 10 eV to 1 keV. The following nuclear statistics of the resonance parameters will be discussed in this paper. The D 0 for 161 Dy and 163 Dy were judged to be constant up to 120.6 and 163.9 eV, respectively. It was assumed that the D 0 of 162 Dy and 164 Dy is constant up to 1000 eV because they have few resonances. The results were compared with the values from Reference 11 as shown in Figure 1. Statistical distributions of reduced neutron were investigated for the three isotopes in the region from 0 to 1000 eV; 161 Dy, 162 Dy, and 163 Dy, but not for 164 Dy because of a few number of resonances. The reduced neutron widths Γ n 0 were divided by the unweighted average reduced neutron width < Γ n 0 > for each isotope. A cumulative distribution of these unitless ratios is compared with the integral of the Porter-Thomas distribution (χ 2 distribution with one degree of freedom). The results agree reasonably with the Porter Thomas distributions.

CDCP1 identifies a CD146 negative subset of marrow fibroblasts involved with cytokine production.

Directory of Open Access Journals (Sweden)

Mineo Iwata

Full Text Available In vitro expanded bone marrow stromal cells contain at least two populations of fibroblasts, a CD146/MCAM positive population, previously reported to be critical for establishing the stem cell niche and a CD146-negative population that expresses CUB domain-containing protein 1 (CDCP1/CD318. Immunohistochemistry of marrow biopsies shows that clusters of CDCP1+ cells are present in discrete areas distinct from areas of fibroblasts expressing CD146. Using a stromal cell line, HS5, which approximates primary CDCP1+ stromal cells, we show that binding of an activating antibody against CDCP1 results in tyrosine-phosphorylation of CDCP1, paralleled by phosphorylation of Src Family Kinases (SFKs Protein Kinase C delta (PKC-δ. When CDCP1 expression is knocked-down by siRNA, the expression and secretion of myelopoietic cytokines is increased. These data suggest CDCP1 expression can be used to identify a subset of marrow fibroblasts functionally distinct from CD146+ fibroblasts. Furthermore the CDCP1 protein may contribute to the defining function of these cells by regulating cytokine expression.

Study for the determination of samarium, europium,terbium, dysprosium and yttrium in gadolinium oxide matrix by means of atomic absorption spectrophotometry using a graphite furnace

International Nuclear Information System (INIS)

Caires, A.C.F.

1985-01-01

A study for determination of samarium, europium, terbium, dysprosium and yttrium in a gadolinium oxide matrix by atomic absorption spectrophotometry using a graphite furnace is presented. The best charrring and atomization conditions were estabilished for each element, the most convenient ressonance lines being selected as well. The study was carried out for the mentioned lanthanides both when pure and when in binary mixtures with gadolinium, besides those where all for them were together with gadolinium. The determination limits for pure lanthanides were found to be between 1.3 and 9.6 ng assuming a 20% relative standard deviation as acceptable. The detection limits were in the range 0.51 and 7.5 ng, assuming as positive any answer higher than twofold the standard deviation. (author) [pt

Cyclic stretch induced miR-146a upregulation delays C2C12 myogenic differentiation through inhibition of Numb

International Nuclear Information System (INIS)

Kuang Wei; Tan Jiali; Duan Yinzhong; Duan Jianmin; Wang Weijian; Jin Fang; Jin Zuolin; Yuan Xiao; Liu Yanpu

2009-01-01

Proliferation and differentiation of muscle stem cells must be tightly regulated by intrinsic and extrinsic signals for effective regeneration and adaptive response. MicroRNAs have been implicated as potent regulators in diverse biological processes at the level of posttranscriptional repression. In this study, we found that miR-146a was significantly upregulated upon a 48-h cyclic stretch of 5% elongation/10cycles/min. Importantly, miR-146 was predicted to base-pair with sequences in the 3' UTR of Numb, which promotes satellite cell differentiation towards muscle cells by inhibiting Notch signaling. Through reporter assay and exogenous expression experiment, we confirmed Numb was inhibited by miR-146a. Inhibition of miR-146a by antago-miR-146a rescued the expression of Numb and facilitated the differentiation of C2C12 at a cost of compromised proliferation. Thus, for the first time, we propose a role of miR-146a in skewing the balance of muscle differentiation and proliferation through inhibiting the expression of Numb.

22 CFR 146.110 - Remedial and affirmative action and self-evaluation.

Science.gov (United States)

2010-04-01

... THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Introduction § 146.110 Remedial and affirmative action and self-evaluation. (a) Remedial action. If the...

Experimental and theoretical approach on the optical properties of zinc borotellurite glass doped with dysprosium oxide

Science.gov (United States)

Halimah, M. K.; Ami Hazlin, M. N.; Muhammad, F. D.

2018-04-01

A series of glass samples with chemical formula {[(TeO2)0.7(B2O3)0.3]0.7(ZnO)0.3}1 - x(Dy2O3)x where x = 0.01, 0.02, 0.03, 0.04 and 0.05 M fraction were synthesized through conventional melt-quenching method. The most common way to fabricate a glass material is by fusion of two or more component oxides followed by their quenching. This technique is known as melt-quenching technique. Kaur et al. (2016) [1] highlighted that the melt-quenching method able to enhance the mechanical properties like hardness and flexural strength of the material. The nature of the glass systems is proven to be amorphous based on the XRD pattern. The FTIR spectra of the glass systems confirm the existence of five bands which are assigned for the BO4, BO3, TeO4 and TeO3 vibrational groups. The density of the glass systems is increased with the addition of Dy2O3 while the molar volume is found to be inversely proportional to the density of the proposed glass. The optical properties of the glasses are determined through the absorption spectra obtained from the UV-VIS spectrophotometer. From the absorption spectra, the indirect and direct optical band gaps and the Urbach energy are found to be inversely proportional to each other. As the molar fraction of the Dy2O3 increased, the optical band gaps are observed to increase as opposed to the Urbach energy. For this glass system, the values of refractive index, electronic polarizability, oxide ion polarizability and the optical basicity are found to decrease as the addition of the dysprosium oxide is increased. From the emission spectra, two intense blue and yellow emission bands are observed, which correspond to the 4F9/2 → 6H15/2 and 4F9/2 → 6H13/2 transitions of Dy3 + ions respectively. The CIE chromaticity coordinates of the zinc borotellurite glass systems are found to be located in the white light region. Generation of white light The generation of the white light can be achieved by using two emission bands which comprise of the yellow

9 CFR 146.23 - Terminology and classification; flocks and products.

Science.gov (United States)

2010-01-01

... layers through routine serological surveillance of each participating commercial table-egg layer flock. A... SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT NATIONAL POULTRY IMPROVEMENT PLAN FOR COMMERCIAL POULTRY Special Provisions for Commercial Table-Egg Layer Flocks § 146.23 Terminology and classification...

Characterization of cleavage events in the multifunctional cilium adhesin Mhp684 (P146) reveals a mechanism by which Mycoplasma hyopneumoniae regulates surface topography.

Science.gov (United States)

Bogema, Daniel R; Deutscher, Ania T; Woolley, Lauren K; Seymour, Lisa M; Raymond, Benjamin B A; Tacchi, Jessica L; Padula, Matthew P; Dixon, Nicholas E; Minion, F Chris; Jenkins, Cheryl; Walker, Mark J; Djordjevic, Steven P

2012-01-01

Mycoplasma hyopneumoniae causes enormous economic losses to swine production worldwide by colonizing the ciliated epithelium in the porcine respiratory tract, resulting in widespread damage to the mucociliary escalator, prolonged inflammation, reduced weight gain, and secondary infections. Protein Mhp684 (P146) comprises 1,317 amino acids, and while the N-terminal 400 residues display significant sequence identity to the archetype cilium adhesin P97, the remainder of the molecule is novel and displays unusual motifs. Proteome analysis shows that P146 preprotein is endogenously cleaved into three major fragments identified here as P50(P146), P40(P146), and P85(P146) that reside on the cell surface. Liquid chromatography with tandem mass spectrometry (LC-MS/MS) identified a semitryptic peptide that delineated a major cleavage site in Mhp684. Cleavage occurred at the phenylalanine residue within sequence (672)ATEF↓QQ(677), consistent with a cleavage motif resembling S/T-X-F↓X-D/E recently identified in Mhp683 and other P97/P102 family members. Biotinylated surface proteins recovered by avidin chromatography and separated by two-dimensional gel electrophoresis (2-D GE) showed that more-extensive endoproteolytic cleavage of P146 occurs. Recombinant fragments F1(P146)-F3(P146) that mimic P50(P146), P40(P146), and P85(P146) were constructed and shown to bind porcine epithelial cilia and biotinylated heparin with physiologically relevant affinity. Recombinant versions of F3(P146) generated from M. hyopneumoniae strain J and 232 sequences strongly bind porcine plasminogen, and the removal of their respective C-terminal lysine and arginine residues significantly reduces this interaction. These data reveal that P146 is an extensively processed, multifunctional adhesin of M. hyopneumoniae. Extensive cleavage coupled with variable cleavage efficiency provides a mechanism by which M. hyopneumoniae regulates protein topography. Vaccines used to control Mycoplasma

CD146+ human umbilical cord perivascular cells maintain stemness under hypoxia and as a cell source for skeletal regeneration.

Directory of Open Access Journals (Sweden)

Wing Pui Tsang

Full Text Available The human umbilical cord perivascular cells (HUCPVCs have been considered as an alternative source of mesenchymal progenitors for cell based regenerative medicine. However, the biological properties of these cells remain to be well characterized. In the present study, HUCPVCs were isolated and sorted by CD146(+ pericyte marker. The purified CD146(+ HUCPVCs were induced to differentiate efficiently into osteoblast, chondrocyte and adipocyte lineages in vitro. Six weeks following subcutaneous transplantation of CD146(+ HUCPVCs-Gelfoam-alginate 3D complexes in severe combined immunodeficiency (SCID mice, newly formed bone matrix with embedded osteocytes of donor origin was observed. The functional engraftment of CD146(+ HUCPVCs in the new bone regenerates was further confirmed in a critical-sized bone defect model in SCID mice. Hypoxic conditions suppressed osteogenic differentiation while increased cell proliferation and colony-forming efficiency of CD146(+ HUCPVCs as compared to that under normoxic conditions. Re-oxygenation restored the multi-differentiation potential of the CD146(+ HUCPVCs. Western blot analysis revealed an upregulation of HIF-1α, HIF-2α, and OCT-4 protein expression in CD146(+ HUCPVCs under hypoxia, while there was no remarkable change in SOX2 and NANOG expression. The gene expression profiles of stem cell transcription factors between cells treated by normoxia and hypoxic conditions were compared by PCR array analysis. Intriguingly, PPAR-γ was dramatically downregulated (20-fold in mRNA expression under hypoxia, and was revealed to possess a putative binding site in the Hif-2α gene promoter region. Chromatin immunoprecipitation assays confirmed the binding of PPAR-γ protein to the Hif-2α promoter and the binding was suppressed by hypoxia treatment. Luciferase reporter assay showed that the Hif-2α promoter activity was suppressed by PPAR expression. Thus, PPAR-γ may involve in the regulation of HIF-2α for stemness

20 CFR 702.146 - Source of the special fund.

Science.gov (United States)

2010-04-01

... by the employer into the fund. Compensation orders shall be made and filed in accordance with the... during that period for compensation, and (2) the ratio of the amount of payments made by the special fund... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Source of the special fund. 702.146 Section...

9 CFR 146.14 - Diagnostic surveillance program for H5/H7 low pathogenic avian influenza.

Science.gov (United States)

2010-01-01

.../H7 low pathogenic avian influenza. 146.14 Section 146.14 Animals and Animal Products ANIMAL AND PLANT... pathogenic avian influenza. (a) The Official State Agency must develop a diagnostic surveillance program for H5/H7 low pathogenic avian influenza for all poultry in the State. The exact provisions of the...

MicroRNA-146a expression as a potential biomarker for rheumatoid ...

African Journals Online (AJOL)

MicroRNA-146a expression as a potential biomarker for rheumatoid arthritis in Egypt. Heba Mohamed Abdelkader Elsayed, Walaa Shawky Khater, Ayman Asaad Ibrahim, Maha Salah El-din Hamdy, Nashwa Aly Morshedy ...

Expression profile of microRNA-146a along HPV-induced multistep carcinogenesis: a study in HPV16 transgenic mice.

Science.gov (United States)

Araújo, Rita; Santos, Joana M O; Fernandes, Mara; Dias, Francisca; Sousa, Hugo; Ribeiro, Joana; Bastos, Margarida M S M; Oliveira, Paula A; Carmo, Diogo; Casaca, Fátima; Silva, Sandra; Medeiros, Rui; Gil da Costa, Rui M

2018-02-01

Persistent human papillomavirus (HPV) infection is associated with the development of certain types of cancer and the dysregulation of microRNAs has been implicated in HPV-associated carcinogenesis. This is the case of microRNA-146a (miR-146a), which is thought to regulate tumor-associated inflammation. We sought to investigate the expression levels of miR-146a during HPV16-mediated carcinogenesis using skin samples from K14-HPV16 transgenic mice which develop the consecutive phases of the carcinogenesis process. Female transgenic (HPV +/- ) and wild-type (HPV -/- ) mice were sacrificed at 24-26 weeks-old or 28-30 weeks-old. Chest and ear skin samples from HPV +/- and HPV -/- mice were histologically classified and used for microRNA extraction and quantification by qPCR. Chest skin samples from 24 to 26 weeks-old HPV +/- mice presented diffuse epidermal hyperplasia and only 22.5% showed multifocal dysplasia, while at 28-30 weeks-old all (100.0%) HPV +/- animals showed epidermal dysplasia. All HPV +/- ear skin samples showed carcinoma in situ (CIS). MiR-146a expression levels were higher in HPV +/- compared to HPV -/- mice (p = 0.006). There was also an increase in miR-146a expression in dysplastic skin lesions compared with hyperplasic lesions (p = 0.011). Samples showing CIS had a significant decrease in miR-146a expression when compared to samples showing epidermal hyperplasia (p = 0.018) and epidermal dysplasia (p = 0.009). These results suggest that HPV16 induces the overexpression of miR-146a in the initial stages of carcinogenesis (hyperplasia and dysplasia), whereas decreases its expression at later stages (CIS). Taken together, these data implicate and suggest different roles of miR-146a in HPV-mediated carcinogenesis.

19 CFR 146.2 - Port director as Board representative.

Science.gov (United States)

2010-04-01

...; DEPARTMENT OF THE TREASURY (CONTINUED) FOREIGN TRADE ZONES General Provisions § 146.2 Port director as Board representative. The appropriate port director shall be in charge of the zone as the representative of the Board. [T.D. 86-16, 51 FR 5049, Feb. 11, 1986, as amended by T.D. 99-27, 64 FR 13676, Mar. 22, 1999] ...

Dysprosium, the balance problem, and wind power technology

International Nuclear Information System (INIS)

Elshkaki, Ayman; Graedel, T.E.

2014-01-01

Highlights: • We investigate the impacts of the increasing market share of wind power on the demand and supply of REE. • The analysis is carried out using a dynamic material flow and stock model and three scenarios for Dy supply. • The supply of Dy from all deposits will likely lead to an oversupply of the total REEs, Nd, La, Ce and Y. • The supply of Dy from critical REE or Dy rich deposits will likely lead to an oversupply of Ce and Y only. • Large quantities of thorium will be co-produced as a result of Dy demand that needs to be managed carefully. - Abstract: Wind power technology is one of the cleanest electricity generation technologies that are expected to have a substantial share in the future electricity mix. Nonetheless, the expected increase in the market share of wind technology has led to an increasing concern of the availability, production capacity and geographical concentration of the metals required for the technology, especially the rear earth elements (REE) neodymium (Nd) and the far less abundant dysprosium (Dy), and the impacts associated with their production. Moreover, Nd and Dy are coproduced with other rare earth metals mainly from iron, titanium, zirconium, and thorium deposits. Consequently, an increase in the demand for Nd and Dy in wind power technology and in their traditional applications may lead to an increase in the production of the host metals and other companion REE, with possible implications on their supply and demand. In this regard, we have used a dynamic material flow and stock model to study the impacts of the increasing demand for Nd and Dy on the supply and demand of the host metals and other companion REE. In one scenario, when the supply of Dy is covered by all current and expected producing deposits, the increase in the demand for Dy leads to an oversupply of 255 Gg of total REE and an oversupply of the coproduced REE Nd, La, Ce and Y. In the second and third scenarios, however, when the supply of Dy is

40 CFR 146.73 - Financial responsibility for post-closure care.

Science.gov (United States)

2010-07-01

...-closure by using a trust fund, surety bond, letter of credit, financial test, insurance or corporate... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Financial responsibility for post... Standards Applicable to Class I Hazardous Waste Injection Wells § 146.73 Financial responsibility for post...

Influence of intramolecular f-f interactions on nuclear spin driven quantum tunneling of magnetizations in quadruple-decker phthalocyanine complexes containing two terbium or dysprosium magnetic centers.

Science.gov (United States)

Fukuda, Takamitsu; Matsumura, Kazuya; Ishikawa, Naoto

2013-10-10

Nuclear spin driven quantum tunneling of magnetization (QTM) phenomena, which arise from admixture of more than two orthogonal electronic spin wave functions through the couplings with those of the nuclear spins, are one of the important magnetic relaxation processes in lanthanide single molecule magnets (SMMs) in the low temperature range. Although recent experimental studies have indicated that the presence of the intramolecular f-f interactions affects their magnetic relaxation processes, little attention has been given to their mechanisms and, to the best of our knowledge, no rational theoretical models have been proposed for the interpretations of how the nuclear spin driven QTMs are influenced by the f-f interactions. Since quadruple-decker phthalocyanine complexes with two terbium or dysprosium ions as the magnetic centers show moderate f-f interactions, these are appropriate to investigate the influence of the f-f interactions on the dynamic magnetic relaxation processes. In the present paper, a theoretical model including ligand field (LF) potentials, hyperfine, nuclear quadrupole, magnetic dipolar, and the Zeeman interactions has been constructed to understand the roles of the nuclear spins for the QTM processes, and the resultant Zeeman plots are obtained. The ac susceptibility measurements of the magnetically diluted quadruple-decker monoterbium and diterbium phthalocyanine complexes, [Tb-Y] and [Tb-Tb], have indicated that the presence of the f-f interactions suppresses the QTMs in the absence of the external magnetic field (H(dc)) being consistent with previous reports. On the contrary, the faster magnetic relaxation processes are observed for [Tb-Tb] than [Tb-Y] at H(dc) = 1000 Oe, clearly demonstrating that the QTMs are rather enhanced in the presence of the external magnetic field. Based on the calculated Zeeman diagrams, these observations can be attributed to the enhanced nuclear spin driven QTMs for [Tb-Tb]. At the H(dc) higher than 2000 Oe, the

Siparex hits target with '146m for third mid-market fund

CERN Multimedia

2003-01-01

Sigefi Private Equity has reached its target final closing of '146m ($155m) for its third mid-market buy-out and expansion capital fund. International investors contributed 26% of the capital including commitments from CERN, Switzerland (1 paragraph).

24 CFR 146.3 - Purpose of HUD's age discrimination regulation.

Science.gov (United States)

2010-04-01

... RECEIVING FEDERAL FINANCIAL ASSISTANCE General § 146.3 Purpose of HUD's age discrimination regulation. The purpose of this part is to state HUD's policies and procedures under the Age Discrimination Act of 1975... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Purpose of HUD's age discrimination...

MicroRNA-146a modulates human bronchial epithelial cell survival in response to the cytokine-induced apoptosis

International Nuclear Information System (INIS)

Liu Xiangde; Nelson, Amy; Wang Xingqi; Kanaji, Nobuhiro; Kim, Miok; Sato, Tadashi; Nakanishi, Masanori; Li Yingji; Sun Jianhong; Michalski, Joel; Patil, Amol; Basma, Hesham; Rennard, Stephen I.

2009-01-01

MicroRNA plays an important role in cell differentiation, proliferation and cell death. The current study found that miRNA-146a was up-regulated in human bronchial epithelial cells (HBECs) in response to stimulation by TGF-ss1 plus cytomix (a mixture of IL-1ss, IFN-γ and TNF-α). TGF-ss1 plus cytomix (TCM) induced apoptosis in HBECs (3.4 ± 0.6% of control vs 83.1 ± 4.0% of TCM treated cells, p < 0.01), and this was significantly blocked by the miRNA-146a mimic (8.8 ± 1.5%, p < 0.01). In contrast, a miRNA-146a inhibitor had only a modest effect on cell survival but appeared to augment the induction of epithelial-mesenchymal transition (EMT) in response to the cytokines. The MicroRNA-146a mimic appears to modulate HBEC survival through a mechanism of up-regulating Bcl-XL and STAT3 phosphorylation, and by this mechanism it could contribute to tissue repair and remodeling.

miR-146a down-regulation alleviates H2O2-induced cytotoxicity of PC12 cells by regulating MCL1/JAK/STAT pathway : miR-146a down-regulation relieves H2O2-induced PC12 cells cytotoxicity by MCL1/JAK/STAT.

Science.gov (United States)

Yang, Xuecheng; Mao, Xin; Ding, Xuemei; Guan, Fengju; Jia, Yuefeng; Luo, Lei; Li, Bin; Tan, Hailin; Cao, Caixia

2018-02-26

Oxidative stress and miRNAs have been confirmed to play an important role in neurological diseases. The study aimed to explore the underlying effect and mechanisms of miR-146a in H 2 O 2 -induced injury of PC12 cells. Here, PC12 cells were stimulated with 200 μM of H 2 O 2 to construct oxidative injury model. Cell injury was evaluated on the basis of the changes in cell viability, migration, invasion, apoptosis, and DNA damage. Results revealed that miR-146a expression was up-regulated in H 2 O 2 -induced PC12 cells. Functional analysis showed that down-regulation of miR-146a alleviated H 2 O 2 -induced cytotoxicity in PC12 cells. Dual-luciferase reporter and western blot assay verified that MCL1 was a direct target gene of miR-146a. Moreover, anti-miR-146a-mediated suppression on cell cytotoxicity was abated following MCL1 knockdown in H 2 O 2 -induced PC12 cells. Furthermore, MCL1 activated JAK/STAT signaling pathway and MCL1 overexpression attenuated H 2 O 2 -induced cytotoxicity in PC12 cells by JAK/STAT signaling pathway. In conclusion, this study suggested that suppression of miR-146a abated H 2 O 2 -induced cytotoxicity in PC12 cells via regulating MCL1/JAK/STAT pathway.

Compounds of divalent thulium, neodymium, and dysprosium

International Nuclear Information System (INIS)

Bochkarev, M.N.; Fedushkin, I.L.; Trifonov, A.A.; Fagin, A.A.; Kirillov, E.N.

1998-01-01

Full text: Judging on the Ln(II)/Ln(III) potentials Tm, Nd, and Dy are the first candidates after Sm, Eu, and Yb for the preparation of Ln(II) compounds. The first molecular Tm(II) derivatives, TmI 2 (DME) 3 (I), has been obtained recently by the reduction of TmI 3 with thulium metal in DME (1,2-dimethoxyethane). The tetrahydrofuran (THF) analogue, TmI 2 (THF) 5 , was synthesized similarly. In the case of TmBI 3 and TmCl 3 the same reaction does not occur. The compound I is inert toward naphthalene, anthracene, phenylacetylene, CpH, (Me 3 Si) 2 NH, 2,4,6-t-Bu 3 C 6 H 2 OH, Cp 2 V, Cp 2 Fe, or Cp 3 Er. The reactions of I with PhOH, Ph 3 COH, 3,6-t-Bu 2 C 6 H 2 (OH) 2 -1,2 (Cat), and calixarene (Cal) produce, Ph 3 COTmI 2 (DME) 2 , (Cat)TmI(DME) 2 , and (Cal)TmI, correspondingly. The attempts to use I for preparation of the other Tm(II) complexes failed. In all cases (reactions with C 10 H 8 Li, CpK, [1,3-(Me 3 Si) 2 C 5 H 3 ]MgCl, and [Cp'-SiMe 2 -Ind']K 2 ) the Tm(III) derivatives (respectively, (C 10 H 8 Tm) 2 C 10 H 8 , Cp 3 Tm, [1,3-(Me 3 Si) 2 C 5 H 3 ] 2 TmCl, and Cp'-SiMe 2 -Ind')TmI) were obtained. The new stable Tm(II) complex, PhOTmI(DME) 2 (II), has been synthesized by the reduction of I with potassium metal in DME. The product was isolated as the green crystals with μ eff 4.6 BM. Unlike TmI 3 , NdI 3 and DyI 3 can not be reduced by metallic neodymium, dysprosium or sodium in DME or THF. Re-investigation of the product formed in the reaction of NdCl 3 with a lack of Li and naphthalene which was claimed before as NdCl 2 (THF) 2 has shown that this is a mixture of Nd(III) naphthalene complexes of the type [(NdCl 2 (THF) 2 ]nC 10 H 8 (n = 4- 7) (III). Nevertheless the product may be used instead of NdCl 2 for the preparation of RNdCl 2 type complexes. The reactions of III with t-BuNCH=CHNBu-t (DAD), PhCH=CHCH=CHPh (DBD), and PhCH=CHPh afford (DAD)NdCl 2 (THF) 2 , (DBD)[NdCl 2 (THF) 2 ] 2 , and (PhCHCHPh)[NdCl 2 ] 2 (THF) 3 , respectively. The iodides of Nd

Isolation of Single-Domain Antibody Fragments That Preferentially Detect Intact (146S Particles of Foot-and-Mouth Disease Virus for Use in Vaccine Quality Control

Directory of Open Access Journals (Sweden)

Michiel M. Harmsen

2017-08-01

Full Text Available Intact (146S foot-and-mouth disease virus (FMDVs can dissociate into specific (12S viral capsid degradation products. FMD vaccines normally consist of inactivated virions. Vaccine quality is dependent on 146S virus particles rather than 12S particles. We earlier isolated two llama single-domain antibody fragments (VHHs that specifically recognize 146S particles of FMDV strain O1 Manisa and shown their potential use in quality control of FMD vaccines during manufacturing. These 146S-specific VHHs were specific for particular O serotype strains and did not bind strains from other FMDV serotypes. Here, we describe the isolation of 146S-specific VHHs against FMDV SAT2 and Asia 1 strains by phage display selection from llama immune libraries. VHHs that bind both 12S and 146S particles were readily isolated but VHHs that bind specifically to 146S particles could only be isolated by phage display selection using prior depletion for 12S particles. We obtained one 146S-specific VHH—M332F—that binds to strain Asia 1 Shamir and several VHHs that preferentially bind 146S particles of SAT2 strain SAU/2/00, from which we selected VHH M379F for further characterization. Both M332F and M379F did not bind FMDV strains from other serotypes. In a sandwich enzyme-linked immunosorbent assay (ELISA employing unlabeled and biotinylated versions of the same VHH M332F showed high specificity for 146S particles but M379F showed lower 146S-specificity with some cross-reaction with 12S particles. These ELISAs could detect 146S particle concentrations as low as 2.3–4.6 µg/l. They can be used for FMD vaccine quality control and research and development, for example, to identify virion stabilizing excipients.

Increased risk of polycystic ovary syndrome (PCOS) associated with CC genotype of miR-146a gene variation.

Science.gov (United States)

Ebrahimi, Seyed Omar; Reiisi, Somayeh; Parchami Barjui, Shahrbanou

2018-04-11

Polycystic ovary syndrome (PCOS) is an endocrinopathy in reproductive-age women believed to be affected by several genetics and environmental factors or both. Different miRNAs are one of such genetic factors that their associations with PCOS have been implicated. For instance, miR-146a that is well known for strongly regulating the immune response and inflammation was upregulated in serum plasma, follicular fluid and granulosa cells of PCOS patients. Different studies have shown that genetic changes in pre-miRNA can cause change in the expression or biological function of mature miRNA. Therefore, the main aim of this study was to investigate the association of miR-146a gene variation (rs2910164) with the susceptibility to PCOS. This study consists of 180 patients with PCOS and 192 healthy women matched by age and geographical region. Genotyping were determined by using PCR-RFLP in all subjects. The genotype frequency and allele distributions of all subjects were evaluated using Fisher's exact test directed by SPSS v.20. The genotype and allele frequencies of the miR-146a polymorphism (rs2910164) significantly differ between PCOS and healthy controls. The frequencies of CC genotype (p = .054) and 'C' allele (p = .0001) of the miR-146a variant indicated a significant incidence in cases compared to controls. Such association was obtained in co-dominant (OR = 3.16) and dominant (OR = 2.29) models. Result of this study can be proposed that women with miR-146a variation are at a higher risk for developing PCOS, which can be due to up-regulation of miR-146a.

9 CFR 146.53 - Terminology and classification; slaughter plants and premises.

Science.gov (United States)

2010-01-01

... from which the commercial waterfowl and commercial upland game bird industry may conduct a program to... COMMERCIAL POULTRY Special Provisions for Commercial Upland Game Birds, Commercial Waterfowl, Raised-for-Release Upland Game Birds, and Raised-for-Release Waterfowl § 146.53 Terminology and classification...

Lipopolysaccharide induces the migration of human dental pulp cells by up-regulating miR-146a.

Science.gov (United States)

Wang, Min-Ching; Hung, Pei-Shih; Tu, Hsi-Feng; Shih, Wen-Yu; Li, Wan-Chun; Chang, Kuo-Wei

2012-12-01

MicroRNAs are small noncoding RNAs that play crucial roles in regulating normal and pathologic functions. Bacterial lipopolysaccharide (LPS) is one of the key regulators of pulpal pathogenesis. This study investigated how LPS regulates microRNA expression and affects the phenotype of human dental pulp cells (DPCs). Primary DPCs were established and immortalized to achieve immortalized DPCs (I-DPCs). DPCs and I-DPCs were treated with LPS and examined to identify changes in microRNA expression, cell proliferation, and cell migration. Quantitative reverse-transcriptase polymerase chain reaction was used to detect changes in gene expression. Exogenous miR-146a expression was performed transfection with pre-mir-146a mimic. Knockdown of interleukin receptor-associated kinase (IRAK1) and tumor necrosis factor receptor-associated factor 6 (TRAF6) expression was performed by small interference oligonucleotide transfection. Western blot analysis was used to detect changes in the expression of the IRAK1 and TRAF6 proteins. The differentiation of DPCs was induced by osteogenic medium. I-DPCs had a higher level of human telomerase reverse transcriptase gene than the parental DPCs. Up-regulation of miR-146a expression and an increase in migration was induced by LPS treatment of DPCs and I-DPCs. Exogenous miR-146a expression increased the migration of DPCs and I-DPCs and down-regulated the expression of IRAK1 and TRAF6. Knockdown of IRAK1 and/or TRAF6 increased the migration of DPCs. The results suggested that LPS is able to increase the migration of DPCs by modulating the miR-146a-TRAF6/IRAK1 regulatory cascade. Copyright © 2012 American Association of Endodontists. All rights reserved.

Pharmacological studies of the mechanism and function of interleukin-1β-induced miRNA-146a expression in primary human airway smooth muscle

Directory of Open Access Journals (Sweden)

Jiang Xiaoying

2010-06-01

Full Text Available Abstract Background Despite the widespread induction of miR-146a during the innate immune response little is known regarding its biogenesis, function and mechanism. We have therefore examined the role of miR-146a during the interleukin (IL-1β-stimulated IL-6 and IL-8 release and proliferation in primary human airway smooth muscle (HASM cells. Methods HASM cells were isolated from human lung re-section, cultured to a maximum of 3 - 6 passages and then exposed to IL-1β. miR-146a expression were determined by qRT-PCR, IL-6 and IL-8 release by ELISA and proliferation using bromodeoxyuridine incorporation. The role of NF-κB and the MAP kinase pathways was assessed using pharmacological inhibitors of IKK2 (TPCA-1, JNK (SP600125, p38 MAP kinase (SB203580 and MEK-1/2 (PD98059. miR-146a function was determined following transfection of HASM with inhibitors and mimics using Amaxa electroporation. Results IL-1β induced a time-dependent and prolonged 100-fold induction in miR-146a expression, which correlated with release of IL-6 and IL-8. Exposure to IL-1β had no effect upon HASM proliferation. Pharmacological studies showed that expression of primary miR-146a was regulated at the transcriptional levels by NF-κB whilst post-transcriptional processing to mature miR-146a was regulated by MEK-1/2 and JNK-1/2. Functional studies indicated that IL-1β-induced miR-146a expression does not negatively regulate IL-6 and IL-8 release or basal proliferation. However, inhibition of IL-1β-induced IL-6 and IL-8 release was observed at the super-maximal intracellular miR-146a levels obtained by transfection with miR-146a mimics and indicates that studies using miRNA mimics can produce false positive results. Mechanistic studies showed that in the presence of super-maximal levels, the action of miR-146a mimics was mediated at a step following IL-6 and IL-8 mRNA transcription and not through down-regulation of IL-1 receptor associated kinase 1 (IRAK-1 and TNF

Intranasal Delivery of miR-146a Mimics Delayed Seizure Onset in the Lithium-Pilocarpine Mouse Model

Directory of Open Access Journals (Sweden)

Hua Tao

2017-01-01

Full Text Available Unveiling the key mechanism of temporal lobe epilepsy (TLE for the development of novel treatments is of increasing interest, and anti-inflammatory miR-146a is now considered a promising molecular target for TLE. In the current study, a C57BL/6 TLE mouse model was established using the lithium-pilocarpine protocol. The seizure degree was evaluated according to the Racine scale, and level 5 was considered the threshold for generalized convulsions. Animals were sacrificed to analyze the hippocampus at three time points (2 h and 4 and 8 weeks after pilocarpine administration to evaluate the acute, latent, and chronic phases, resp.. After intranasal delivery of miR-146a mimics (30 min before pilocarpine injection, the percent of animals with no induced seizures increased by 6.7%, the latency to generalized convulsions was extended, and seizure severity was reduced. Additionally, hippocampal damage was alleviated. While the relative miR-146a levels significantly increased, the expression of its target mRNAs (IRAK-1 and TRAF-6 and typical inflammatory modulators (NF-κB, TNF-α, IL-1β, and IL-6 decreased, supporting an anti-inflammatory role of miR-146a via the TLR pathway. This study is the first to demonstrate that intranasal delivery of miR-146a mimics can improve seizure onset and hippocampal damage in the acute phase of lithium-pilocarpine-induced seizures, which provides inflammation-based clues for the development of novel TLE treatments.

Extraction of Dysprosium Ions with DTPA Functionalized Superparamagnetic Nanoparticles Probed by Energy Dispersive X-ray Fluorescence and TEM/High-Angle Annular Dark Field Imaging.

Science.gov (United States)

Melo, Fernando Menegatti de; Almeida, Sabrina da Nobrega; Uezu, Noemi Saori; Ramirez, Carlos Alberto Ospina; Santos, Antonio Domingues Dos; Toma, Henrique Eisi

2018-06-01

The extraction of dysprosium (Dy3+) ions from aqueous solution was carried out successfully, using magnetite (Fe3O4) nanoparticles functionalized with diethylenetriaminepentaacetic acid (MagNP@DTPA). The process was monitored by energy dispersive X-ray fluorescence spectroscopy, as a function of concentration, proceeding according to a Langmuir isotherm with an equilibrium constant of 2.57 × 10-3 g(MagNP) L-1 and a saturation limit of 63.2 mgDy/gMagNP. The presence of paramagnetic Dy3+ ions attached to the superparamagnetic nanoparticles led to an overall decrease of magnetization. By imaging the nanoparticles surface using scanning transmission electron microscopy equipped with high resolution elemental analysis, it was possible to probe the binding of the Dy3+ ions to DTPA, and to show their distribution in a region of negative magnetic field gradients. This finding is coherent with the observed decrease of magnetization, associated with the antiferromagnetic coupling between the lanthanide ions and the Fe3O4 core.

Alteration in Inflammation-related miR-146a Expression in NF-KB Signaling Pathway in Diabetic Rat Hippocampus.

Science.gov (United States)

Habibi, Fatemeh; Ghadiri Soufi, Farhad; Ghiasi, Rafighe; Khamaneh, Amir Mahdi; Alipour, Mohammad Reza

2016-03-01

The purpose of the present study is to evaluate the expression of miR-146a gene, its adaptor genes (TRAF6, NF-KB, and IRAK1), and possible changes in the cellular signaling pathway in diabetic hippocampus tissue. Male Sprague-Dawley rats are randomly selected and divided into control and diabetic (n=6) groups. Diabetes induced by the single-dose injection of nicotinamide [110 mg/kg, (i.p.)], 15 min before streptozotocin (50 mg/kg; i.p.) in 12-h fasted rats. The rats are kept at the laboratory for two months. After anaesthetization, hippocampus of the rats was removed in order to measure the expression of miR-146a, NFK-B, IRAK1, and TRAF6 genes using real-time PCR and activity of NF-KB as well as amount of apoptosis rate using ELISA. The results indicated a reduction in expression of miR-146a and an increase in expression of IRAK1, NF-KB, and TRAF6 genes in the hippocampus of diabetic rats compared to control. Also it reveals an increase in the activity of NF-KB and apoptosis rate in the hippocampus of diabetic rats. Our results report the probability that reduction of miR-146a expression in the negative feedback loop between miR-146a and NF-KB increases NF-kB expression and thus intensifies inflammation and apoptosis in hippocampus.

Nicotine permeability across the buccal TR146 cell culture model and porcine buccal mucosa in vitro

DEFF Research Database (Denmark)

Nielsen, Hanne Mørck; Rassing, Margrethe Rømer

2002-01-01

The present study was conducted to investigate and compare the effect of pH and drug concentration on nicotine permeability across the TR146 cell culture model and porcine buccal mucosa in vitro. As a further characterization of the TR146 cell culture model, it was explored whether the results were...... comparable for bi-directional and uni-directional transport in the presence of a transmembrane pH gradient. Nicotine concentrations between 10(-5) and 10(-2) M were applied to the apical side of the TR146 cell culture model or the mucosal side of porcine buccal mucosa. Buffers with pH values of 5.5, 7.......4 and 8.1 were used to obtain different fractions of non- and mono-ionized nicotine. The apparent permeability (P(app)) of nicotine across both models increased significantly with increasing pH, and the P(app) values obtained with the two models could be correlated in a linear manner. With increasing...

Up-regulation of miR-146a contributes to the inhibition of invasion of pancreatic cancer cells

Science.gov (United States)

Li, Yiwei; VandenBoom, Timothy G.; Wang, Zhiwei; Kong, Dejuan; Ali, Shadan; Philip, Philip A.; Sarkar, Fazlul H.

2009-01-01

Pancreatic cancer (PC) is an aggressive malignancy with high mortality and is believed to be in part due to its highly invasive and metastatic behavior, which is associated with over-expression of EGFR and activation of NF-κB. Emerging evidence also suggest critical roles of microRNAs (miRNAs) in the regulation of various pathobiological processes including metastasis in PC and in other human malignancies. In the present study, we found lower expression of miR-146a in PC cells compared to normal human pancreatic duct epithelial (HPDE) cells. Interestingly, re-expression of miR-146a inhibited the invasive capacity of Colo357 and Panc-1 PC cells with concomitant down-regulation of EGFR and IRAK-1. Mechanistic studies including miR-146a re-expression, anti-miR-146 transfection, and EGFR knock-down experiment showed that there was a crosstalk between EGFR, MTA-2, IRAK-1, IκBα and NF-κB. Most importantly, we found that the treatment of PC cells with “natural agents” [3,3′-diinodolylmethane (DIM) or isoflavone] led to an increase in the expression of miR-146a and consequently down-regulated the expression of EGFR, MTA-2, IRAK-1 and NF-κB, resulting in the inhibition of invasion of Colo357 and Panc-1 cells. These results provide experimental evidence in support of the role of DIM and isoflavone as potential non-toxic agents as regulators of miRNA, which could be useful for the inhibition of cancer cell invasion and metastasis, and further suggesting that these agents could be important for designing novel targeted strategy for the treatment of PC. PMID:25242818

12 CFR 563.146 - Will the OTS permit my capital distribution?

Science.gov (United States)

2010-01-01

... under 12 U.S.C. 1831o(d)(1)(B). (b) Your proposed capital distribution raises safety or soundness... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Will the OTS permit my capital distribution... SAVINGS ASSOCIATIONS-OPERATIONS Capital Distributions § 563.146 Will the OTS permit my capital...

27 CFR 70.146 - 45-day period for making disbursements.

Science.gov (United States)

2010-04-01

... tax lien filing, to the lien imposed by 26 U.S.C. 6321 if, and to the extent, a right to payment has... Collection of Excise and Special (Occupational) Tax Lien for Taxes § 70.146 45-day period for making disbursements. Even though a notice of a lien imposed by 26 U.S.C. 6321 is filed in accordance with § 70.149 of...

MicroRNA-146 protects A549 and H1975 cells from LPS-induced ...

Indian Academy of Sciences (India)

Qiang Wang

2017-10-26

Oct 26, 2017 ... States, pneumonia is the sixth most common cause of dis- ease-related deaths. In addition, pneumonia is the most common hospital-acquired fatal infections. ... 146 targets the messengers of bacterial lipopolysaccharide.

Declining Physical Performance Associates with Serum FasL, miR-21, and miR-146a in Aging Sprinters

Directory of Open Access Journals (Sweden)

Reeta Kangas

2017-01-01

Full Text Available Aging is associated with systemic inflammation and cellular apoptosis accelerating physiological dysfunctions. Whether physically active way of life affects these associations is unclear. This study measured the levels of serum inflammatory and apoptotic molecules, their change over 10 years, and their associations with physical performance in sprint-trained male athletes. HsCRP, cell counts, HGB, FasL, miR-21, and miR-146a were measured cross-sectionally (n=67, 18–90 yrs and serum FasL, miR-21, and miR-146a and their aging-related associations with physical performance were assessed over a 10-year follow-up (n=49, 50–90 yrs. The cross-sectional study showed positive age correlations for neutrophils and negative for lymphocytes, red blood cells, HGB, FasL, and miR-146a. During the 10-year follow-up, FasL decreased (P=0.017 and miR-21 (P<0.001 and miR-146a (P=0.005 levels increased. When combining the molecule levels, aging, and physical performance, FasL associated with countermovement jump and bench press (P<0.001, miR-21 and miR-146a with knee flexion (P=0.023; P<0.001, and bench press (P=0.004; P<0.001 and miR-146a with sprint performance (P<0.001. The studied serum molecules changed in an age-dependent manner and were associated with declining physical performance. They have potential as biomarkers of aging-related processes influencing the development of physiological dysfunctions. Further research is needed focusing on the origins and targets of circulating microRNAs to clarify their function in various tissues with aging.

Evaluation of the miRNA-146a and miRNA-155 Expression Levels in Patients with Oral Lichen Planus.

Science.gov (United States)

Ahmadi-Motamayel, Fatemeh; Bayat, Zeynab; Hajilooi, Mehrdad; Shahryar-Hesami, Soroosh; Mahdavinezhad, Ali; Samie, Lida; Solgi, Ghasem

2017-12-01

Oral Lichen Planus (OLP) is a chronic autoimmune disease that could be considered as a potential premalignant status. To evaluate the miRNA-146a and miRNA-155 expression levels in patients with oral Lichen planus lesions compared to healthy subjects with normal oral mucosa. Forty patients with oral lichen planus and 18 healthy age and gender-matched controls were recruited in this case-control study. Oral lichen planus was diagnosed clinically and pathologically. The expression levels of two miRNAs in peripheral blood samples were determined using commercial TaqMan MicroRNA Assays. Relative quantification of gene expression was calculated by the 2-ΔΔct method. The expression levels of miRNA-146a and miRNA-155 in patients with oral Lichen planus were significantly higher than those of healthy controls. Also, a direct but insignificant correlation was found between miRNA-155 and miRNA-146a expression levels among the patient group. Our findings indicate that miRNA-146a and miRNA-155 could be potential biomarkers for the immunopathogenesis of oral lichen planus.

Downregulation of Melanoma Cell Adhesion Molecule (MCAM/CD146) Accelerates Cellular Senescence in Human Umbilical Cord Blood-Derived Mesenchymal Stem Cells.

Science.gov (United States)

Jin, Hye Jin; Kwon, Ji Hye; Kim, Miyeon; Bae, Yun Kyung; Choi, Soo Jin; Oh, Wonil; Yang, Yoon Sun; Jeon, Hong Bae

2016-04-01

Therapeutic applications of mesenchymal stem cells (MSCs) for treating various diseases have increased in recent years. To ensure that treatment is effective, an adequate MSC dosage should be determined before these cells are used for therapeutic purposes. To obtain a sufficient number of cells for therapeutic applications, MSCs must be expanded in long-term cell culture, which inevitably triggers cellular senescence. In this study, we investigated the surface markers of human umbilical cord blood-derived MSCs (hUCB-MSCs) associated with cellular senescence using fluorescence-activated cell sorting analysis and 242 cell surface-marker antibodies. Among these surface proteins, we selected the melanoma cell adhesion molecule (MCAM/CD146) for further study with the aim of validating observed expression differences and investigating the associated implications in hUCB-MSCs during cellular senescence. We observed that CD146 expression markedly decreased in hUCB-MSCs following prolonged in vitro expansion. Using preparative sorting, we found that hUCB-MSCs with high CD146 expression displayed high growth rates, multilineage differentiation, expression of stemness markers, and telomerase activity, as well as significantly lower expression of the senescence markers p16, p21, p53, and senescence-associated β-galactosidase, compared with that observed in hUCB-MSCs with low-level CD146 expression. In contrast, CD146 downregulation with small interfering RNAs enhanced the senescence phenotype. In addition, CD146 suppression in hUCB-MSCs caused downregulation of other cellular senescence regulators, including Bmi-1, Id1, and Twist1. Collectively, our results suggest that CD146 regulates cellular senescence; thus, it could be used as a therapeutic marker to identify senescent hUCB-MSCs. One of the fundamental requirements for mesenchymal stem cell (MSC)-based therapies is the expansion of MSCs during long-term culture because a sufficient number of functional cells is required

24 CFR 146.1 - Purpose of the Age Discrimination Act of 1975.

Science.gov (United States)

2010-04-01

... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE General § 146.1 Purpose of the Age Discrimination Act of... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Purpose of the Age Discrimination... programs or activities receiving Federal financial assistance. The Act, however, permits federally assisted...

19 CFR 146.52 - Manipulation, manufacture, exhibition or destruction; Customs Form 216.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Manipulation, manufacture, exhibition or... Merchandise in a Zone § 146.52 Manipulation, manufacture, exhibition or destruction; Customs Form 216. (a... application) on Customs Form 216 for permission to manipulate, manufacture, exhibit, or destroy merchandise in...

Increased Expression of miR-146a in Children With Allergic Rhinitis After Allergen-Specific Immunotherapy.

Science.gov (United States)

Luo, Xi; Hong, Haiyu; Tang, Jun; Wu, Xingmei; Lin, Zhibin; Ma, Renqiang; Fan, Yunping; Xu, Geng; Liu, Dabo; Li, Huabin

2016-03-01

MicroRNAs (miRs) were recently recognized to be important for immune cell differentiation and immune regulation. However, whether miRs were involved in allergen-specific immunotherapy (SIT) remains largely unknown. This study sought to examine changes in miR-146a and T regulatory cells in children with persistent allergic rhinitis (AR) after 3 months of subcutaneous immunotherapy (SCIT) and sublingual immunotherapy (SLIT). Twenty-four HDM-sensitized children with persistent AR were enrolled and treated with SCIT (n=13) or SLIT (n=11) for 3 months. Relative miR-146a and Foxp3 mRNA expression, the TRAF6 protein level, and the ratio of post-treatment to baseline IL-10+CD4+ T cells between the SCIT and SLIT groups were examined in the peripheral blood mononuclear cells (PBMCs) of AR patients using quantitative reverse transcription polymerase chain reaction (qRT-PCR), flow cytometry, and Western blot analysis, respectively. Serum levels of IL-5 and IL-10 were determined using ELISA. After 3 months of SIT, both the TNSS and INSS scores were significantly decreased compared to the baseline value (P<0.01). The relative expression of miR-146a and Foxp3 mRNA was significantly increased after both SCIT and SLIT (P<0.01). The ratio of post-treatment to baseline IL-10⁺CD4⁺ T cells and the serum IL-10 level were significantly increased in both the SCIT and SLIT groups (P<0.01), whereas the TRAF6 protein level and serum IL-5 level were significantly decreased (P<0.01). No significant differences in these biomarkers were observed between the SCIT and SLIT groups. Our findings suggest that miR-146a and its related biomarkers may be comparably modulated after both SCIT and SLIT, highlighting miR-146a as a potential therapeutic target for the improved management of AR.

Extension of the energy range of the experimental activation cross-sections data of longer-lived products of proton induced nuclear reactions on dysprosium up to 65MeV.

Science.gov (United States)

Tárkányi, F; Ditrói, F; Takács, S; Hermanne, A; Ignatyuk, A V

2015-04-01

Activation cross-sections data of longer-lived products of proton induced nuclear reactions on dysprosium were extended up to 65MeV by using stacked foil irradiation and gamma spectrometry experimental methods. Experimental cross-sections data for the formation of the radionuclides (159)Dy, (157)Dy, (155)Dy, (161)Tb, (160)Tb, (156)Tb, (155)Tb, (154m2)Tb, (154m1)Tb, (154g)Tb, (153)Tb, (152)Tb and (151)Tb are reported in the 36-65MeV energy range, and compared with an old dataset from 1964. The experimental data were also compared with the results of cross section calculations of the ALICE and EMPIRE nuclear model codes and of the TALYS nuclear reaction model code as listed in the latest on-line libraries TENDL 2013. Copyright © 2015. Published by Elsevier Ltd.

MicroED Structure of Au146(p-MBA)57 at Subatomic Resolution Reveals a Twinned FCC Cluster.

Science.gov (United States)

Vergara, Sandra; Lukes, Dylan A; Martynowycz, Michael W; Santiago, Ulises; Plascencia-Villa, Germán; Weiss, Simon C; de la Cruz, M Jason; Black, David M; Alvarez, Marcos M; López-Lozano, Xochitl; Barnes, Christopher O; Lin, Guowu; Weissker, Hans-Christian; Whetten, Robert L; Gonen, Tamir; Yacaman, Miguel Jose; Calero, Guillermo

2017-11-16

Solving the atomic structure of metallic clusters is fundamental to understanding their optical, electronic, and chemical properties. Herein we present the structure of the largest aqueous gold cluster, Au 146 (p-MBA) 57 (p-MBA: para-mercaptobenzoic acid), solved by electron micro-diffraction (MicroED) to subatomic resolution (0.85 Å) and by X-ray diffraction at atomic resolution (1.3 Å). The 146 gold atoms may be decomposed into two constituent sets consisting of 119 core and 27 peripheral atoms. The core atoms are organized in a twinned FCC structure, whereas the surface gold atoms follow a C 2 rotational symmetry about an axis bisecting the twinning plane. The protective layer of 57 p-MBAs fully encloses the cluster and comprises bridging, monomeric, and dimeric staple motifs. Au 146 (p-MBA) 57 is the largest cluster observed exhibiting a bulk-like FCC structure as well as the smallest gold particle exhibiting a stacking fault.

A functional polymorphism of the microRNA-146a gene is associated with susceptibility to drug-resistant epilepsy and seizures frequency.

Science.gov (United States)

Cui, Lili; Tao, Hua; Wang, Yan; Liu, Zhou; Xu, Zhien; Zhou, Haihong; Cai, Yujie; Yao, Lifen; Chen, Beichu; Liang, Wandong; Liu, Yu; Cheng, Wanwen; Liu, Tingting; Ma, Guoda; Li, You; Zhao, Bin; Li, Keshen

2015-04-01

Epilepsy is the third most common chronic brain disorder and is characterized by an enduring predisposition for seizures. Recently, a growing body of evidence has suggested that microRNA-146a (miR-146a) is upregulated in the brains of epilepsy patients and of mouse models; furthermore, miR-146a may be involved in the development and progression of seizures through the regulation of inflammation and immune responses. In this report, we performed a case-control study to analyze the relationship between the two potentially functional single nucleotide polymorphisms (SNPs) of the miR-146a gene (rs2910464 and rs57095329) and the risk of epilepsy in a Chinese population comprising 249 cases and 249 healthy controls. Our study comprised 249 epilepsy patients and 249 healthy controls in two regions of China. The DNA was genotyped using the ABI PRISM SNapShot method. The statistical analysis was estimated using the chi-square test or Fisher's exact test. Our results indicated a significant association between the rs57095329 SNP of the miR-146a gene and the risk of drug resistant epilepsy (DRE) (genotypes, p = 0.0258 and alleles, p = 0.0108). Moreover, the rs57095329 A allele was found to be associated with a reduced risk of seizures frequency in DRE patients (all p epilepsy. Our data indicate that the rs57095329 polymorphism in the promoter region of miR-146a is involved in the genetic susceptibility to DRE and the seizures frequency. Copyright © 2015 British Epilepsy Association. Published by Elsevier Ltd. All rights reserved.

Multiple Myeloma-Derived Exosomes Regulate the Functions of Mesenchymal Stem Cells Partially via Modulating miR-21 and miR-146a

Directory of Open Access Journals (Sweden)

Qian Cheng

2017-01-01

Full Text Available Exosomes derived from cancer cells can affect various functions of mesenchymal stem cells (MSCs via conveying microRNAs (miRs. miR-21 and miR-146a have been demonstrated to regulate MSC proliferation and transformation. Interleukin-6 (IL-6 secreted from transformed MSCs in turn favors the survival of multiple myeloma (MM cells. However, the effects of MM exosomes on MSC functions remain largely unclear. In this study, we investigated the effects of OPM2 (a MM cell line exosomes (OPM2-exo on regulating the proliferation, cancer-associated fibroblast (CAF transformation, and IL-6 secretion of MSCs and determined the role of miR-21 and miR-146a in these effects. We found that OPM2-exo harbored high levels of miR-21 and miR-146a and that OPM2-exo coculture significantly increased MSC proliferation with upregulation of miR-21 and miR-146a. Moreover, OPM2-exo induced CAF transformation of MSCs, which was evidenced by increased fibroblast-activated protein (FAP, α-smooth muscle actin (α-SMA, and stromal-derived factor 1 (SDF-1 expressions and IL-6 secretion. Inhibition of miR-21 or miR-146a reduced these effects of OPM2-exo on MSCs. In conclusion, MM could promote the proliferation, CAF transformation, and IL-6 secretion of MSCs partially through regulating miR21 and miR146a.

Pre-miR-146a (rs2910164 G>C single nucleotide polymorphism is genetically and functionally associated with leprosy.

Directory of Open Access Journals (Sweden)

Paula F T Cezar-de-Mello

2014-09-01

Full Text Available Mycobacterium leprae infects macrophages and Schwann cells inducing a gene expression program to facilitate its replication and progression to disease. MicroRNAs (miRNAs are key regulators of gene expression and could be involved during the infection. To address the genetic influence of miRNAs in leprosy, we enrolled 1,098 individuals and conducted a case-control analysis in order to study four miRNAs genes containing single nucleotide polymorphism (miRSNP. We tested miRSNP-125a (rs12975333 G>T, miRSNP-223 (rs34952329 *>T, miRSNP-196a-2 (rs11614913 C>T and miRSNP-146a (rs2910164 G>C. Amongst them, miRSNP-146a was the unique gene associated with risk to leprosy per se (GC OR = 1.44, p = 0.04; CC OR = 2.18, p = 0.0091. We replicated this finding showing that the C-allele was over-transmitted (p = 0.003 using a transmission-disequilibrium test. A functional analysis revealed that live M. leprae (MOI 100:1 was able to induce miR-146a expression in THP-1 (p<0.05. Furthermore, pure neural leprosy biopsies expressed augmented levels of that miRNA as compared to biopsy samples from neuropathies not related with leprosy (p = 0.001. Interestingly, carriers of the risk variant (C-allele produce higher levels of mature miR-146a in nerves (p = 0.04. From skin biopsies, although we observed augmented levels of miR-146a, we were not able to correlate it with a particular clinical form or neither host genotype. MiR-146a is known to modulate TNF levels, thus we assessed TNF expression (nerve biopsies and released by peripheral blood mononuclear cells infected with BCG Moreau. In both cases lower TNF levels correlates with subjects carrying the risk C-allele, (p = 0.0453 and p = 0.0352; respectively, which is consistent with an immunomodulatory role of this miRNA in leprosy.

22 CFR 146.425 - Counseling and use of appraisal and counseling materials.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Counseling and use of appraisal and counseling... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 146.425 Counseling and use of appraisal and counseling materials. (a) Counseling. A recipient shall not discriminate against any person on...

The N=82 gap in /sup 146/Gd from beta -decay studies of Tb isotopes

CERN Document Server

Styczen, J; Kleinheinz, P; Piiparinen, M

1981-01-01

The beta -decay study of 23 s /sup 146/Tb suggests a ( pi h/sub 11/2/ nu d/sup -1//sub 3/2/) 5/sup -/ configuration for this activity. In its decay the authors have identified a pi h/sub 11/2/ to nu h/sub 9/2 / GT decay branch which populates neutron particle-hole states in /sup 146/Gd. Hence the N=82 single particle energy gap is less than 4 MeV. Neutron one-particle two-hole and two-particle one-hole states in /sup 145/Gd and /sup 147/Gd were identified in the beta -decays of 29 s /sup 145/Tb and 1.6 h /sup 147/Tb. (11 refs).

Luminescence properties of dysprosium doped calcium magnesium silicate phosphor by solid state reaction method

Energy Technology Data Exchange (ETDEWEB)

Sahu, Ishwar Prasad, E-mail: ishwarprasad1986@gmail.com [School of Studies in Physics & Astrophysics, Pt. Ravishankar Shukla University, Raipur, C.G. 492010 (India); Chandrakar, Priya; Baghel, R.N.; Bisen, D.P.; Brahme, Nameeta [School of Studies in Physics & Astrophysics, Pt. Ravishankar Shukla University, Raipur, C.G. 492010 (India); Tamrakar, Raunak Kumar [Department of Applied Physics, Bhilai Institute of Technology, Durg, C.G. 491001 (India)

2015-11-15

Dysprosium doped calcium magnesium silicate (CaMgSi{sub 2}O{sub 6}:Dy{sup 3+}) white light emitting phosphor was synthesized by solid state reaction process. The crystal structure of sintered phosphor was monoclinic structure with space group C2/c. Chemical composition of the sintered CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor was confirmed by EDX. The prepared CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor was excited from 352 nm and their corresponding emission spectra were recorded at blue (470 nm), yellow (570 nm) and red (675 nm) line due to the {sup 4}F{sub 9/2} → {sup 6}H{sub 15/2}, {sup 4}F{sub 9/2} → {sup 6}H{sub 13/2}, {sup 4}F{sub 9/2} → {sup 6}H{sub 11/2} transitions of Dy{sup 3+} ions. The combination of these three emissions constituted as white light confirmed by the Commission Internationale de L'Eclairage (CIE) chromatic coordinate diagram. The possible mechanism of the white light emitting long lasting CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor was also investigated. Investigation on afterglow property show that phosphor held fast and slow decay process. The peak of mechanoluminescence (ML) intensity increases linearly with increasing impact velocity of the moving piston. Thus the present investigation indicates that the local piezoelectricity-induced electron bombardment model is responsible to produce ML in prepared CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor. - Highlights: • The crystal structure of CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor is consistent with standard monoclinic structure. • CIE coordinates of CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor is suitable as white light emitting phosphor. • The local piezoelectricity-induced electron bombardment model is responsible to produce ML in CaMgSi{sub 2}O{sub 6}:Dy{sup 3+} phosphor.

Expression of MicroRNA-146a and MicroRNA-155 in Placental Villi in Early- and Late-Onset Preeclampsia.

Science.gov (United States)

Nizyaeva, N V; Kulikova, G V; Nagovitsyna, M N; Kan, N E; Prozorovskaya, K N; Shchegolev, A I; Sukhikh, G T

2017-07-01

We studied the expression of microRNA-146a and microRNA-155 in placental villi from 18 women (26-39 weeks of gestation) of reproductive age with early- or late-onset preeclampsia. The reference group consisted of women with physiological pregnancy and full-term gestation and with preterm birth after caesarian section on gestation week 26-31. MicroRNA-146a and microRNA-155 were detected by in situ hybridization with digoxigenin on paraffin sections. It was found that the expression of microRNA-146a in both syncytiotrophoblast of the intermediate villi and syncytial knots was lower at late-onset preeclampsia than at physiologic pregnancy of full-term period (p=0.037 and p=0.001 respectively). The expression of microRNA-155 in syncytiotrophoblast of intermediate placental villi in early-onset preeclampsia was higher than in group with preterm delivery (p=0.003). However, in syncytiotrophoblast of intermediate villi and in syncytial knots, the expression of microRNA-155 was lower at late-onset preeclampsia in comparison with full-term physiological pregnancy (p=0.005). In addition, the expression of microRNA-146a and microRNA-155 did not increase in the later terms in preeclampsia, while in the reference groups demonstrating gradual increase in the expression of these markers with increasing gestational age. Expression microRNA-146a and microRNA-155 little differed in early- and late-onset preeclampsia. These findings suggest that different variants of preeclampsia are probably characterized by common pathogenetic pathways. Damaged trophoblast cannot maintain of microRNAs synthesis at the required level, which determines the formation of a vicious circle in preeclampsia and further progression of the disease.

Relationship between miR-146a rs2910164 (G>C) Polymorphism and Digestive System Cancer Susceptibility: A Meta-Analysis.

Science.gov (United States)

Xiong, Xin; Yan, Junfeng; Li, Linghua; Li, Yun; Cao, Yi; Tu, Yi; Mei, Jinhong

2017-08-01

MicroRNAs (miRNAs) are identified negatively regulating gene expression and acting as oncogenes or tumor suppressors in tumorigenesis. The association between miR-146a rs2910164 (G>C) polymorphism and susceptibility to digestive system cancers was contradictory and inconsistent in previously published studies. Presently, we performed a comprehensive literature retrieve on PubMed, Web of Science, Embase, Wanfang and CNKI databases to identify all relevant studies published before July 30, 2016. Odds ratio (OR) and 95% confidential interval (95%CI) were used to calculate the relationship between miR-146a rs2910164 (G>C) polymorphism and digestive system cancers susceptibility. Finally, a total of 45 publications comprising 47 separate case-control studies were enrolled in the present updated meta-analysis including 20,281 cases and 26,099 controls. However, no significant association was uncovered for miR-146a rs2910164 polymorphism and digestive system cancers susceptibility in all the genetic models. Moreover, in the stratification analyses by cancer type, the source of control, ethnicity and Hardy-Weinberg Equilibrium (HWE) status, we also revealed a negative result. To conclude, our work suggests that miR-146a rs2910164 (G>C) polymorphism is not a susceptibility factor for digestive system cancers. © 2017 by the Association of Clinical Scientists, Inc.

Antiphospholipid antibody-induced miR-146a-3p drives trophoblast interleukin-8 secretion through activation of Toll-like receptor 8.

Science.gov (United States)

Gysler, Stefan M; Mulla, Melissa J; Guerra, Marta; Brosens, Jan J; Salmon, Jane E; Chamley, Lawrence W; Abrahams, Vikki M

2016-07-01

What is the role of microRNAs (miRs) in antiphospholipid antibody (aPL)-induced trophoblast inflammation? aPL-induced up-regulation of trophoblast miR-146a-3p is mediated by Toll-like receptor 4 (TLR4), and miR-146a-3p in turn drives the cells to secrete interleukin (IL)-8 by activating the RNA sensor, TLR8. Obstetric antiphospholipid syndrome (APS) is an autoimmune disorder characterized by circulating aPL and an increased risk of pregnancy complications. We previously showed that aPL recognizing beta2 glycoprotein I (β2GPI) elicit human first trimester trophoblast secretion of IL-8 by activating TLR4. Since some miRs control TLR responses, their regulation in trophoblast cells by aPL and functional role in the aPL-mediated inflammatory response was investigated. miRs can be released from cells via exosomes, and therefore, miR exosome expression was also examined. A panel of miRs was selected based on their involvement with TLR signaling: miR-9; miR-146a-5p and its isomiR, miR-146a-3p; miR-155, miR-210; and Let-7c. Since certain miRs can activate the RNA sensor, TLR8, this was also investigated. For in vitro studies, the human first trimester extravillous trophoblast cell line, HTR8 was studied. HTR8 cells transfected to express a TLR8 dominant negative (DN) were also used. Plasma was evaluated from pregnant women who have aPL, either with or without systemic lupus erythematous (SLE) (n = 39); SLE patients without aPL (n = 30); and healthy pregnant controls (n = 20). Trophoblast HTR8 wildtype and TLR8-DN cells were incubated with or without aPL (mouse anti-human β2GPI mAb) for 48-72 h. HTR8 cells were also treated with or without aPL in the presence and the absence of a TLR4 antagonist (lipopolysaccharide from Rhodobacter sphaeroides; LPS-RS), specific miR inhibitors or specific miR mimics. miR expression levels in trophoblast cells, trophoblast-derived exosomes and exosomes isolated from patient plasma were measured by qPCR. Trophoblast IL-8 secretion was

MS2 VLP-based delivery of microRNA-146a inhibits autoantibody production in lupus-prone mice

Directory of Open Access Journals (Sweden)

Pan Y

2012-12-01

Full Text Available Yang Pan,1,2 Tingting Jia,1,2 Yuan Zhang,1,2 Kuo Zhang,1 Rui Zhang,1 Jinming Li,1 Lunan Wang11National Center for Clinical Laboratories, Beijing Hospital of the Ministry of Health, Beijing, People’s Republic of China; 2Graduate School, Peking Union Medical College, Chinese Academy of Medical Sciences, Beijing, People’s Republic of ChinaBackground: Systemic lupus erythematosus (SLE is a chronic autoimmune disease characterized by the presence of pathogenic autoantibodies. Recent studies suggest that microRNAs (miRNAs play an essential role in immunoregulation and may be involved in the pathogenesis of SLE. Therefore, it was of interest to investigate the potential therapeutic application of miRNAs in SLE, a concept that has not been thoroughly investigated thus far. Virus-like particles (VLPs are a type of recombinant nanoparticle enveloped by certain proteins derived from the outer coat of a virus. Herein, we describe a novel miRNA-delivery approach via bacteriophage MS2 VLPs and investigate the therapeutic effects of miR-146a, a well-studied and SLE-related miRNA, in BXSB lupus-prone mice.Methods: VLPs containing miR-146a, and the control VLPs, were prepared using an Escherichia coli expression system and then administered to lupus-prone mice over a 12-day period. We performed an enzyme-linked immunosorbent assay to evaluate the anti-dsDNA antibody, autoantibody to nuclear antigen (ANA, total IgG and total IgM levels in serum. The expression of miR-146a was analyzed by qRT-PCR. SLE-related cytokines as well as some toll-like receptor signaling pathway molecules were also measured.Results: Treatment with MS2-miR146a VLP showed profound effects on lupus-prone BXSB mice, including an increased level of mature miR-146a, which led to a significant reduction in the expression of autoantibodies and total IgG. Remarkably, these mice also exhibited reduced levels of proinflammatorycytokines, including IFN-Interferon-α (IFN-α, Interleukin-1β (Il-1

TR146 cells grown on filters as a model of human buccal epithelium

DEFF Research Database (Denmark)

Nielsen, Hanne Mørck; Rassing, M R

1999-01-01

The aim of the present study was to evaluate the TR146 cell culture model as an in vitro model of human buccal epithelium with respect to the permeability enhancement by different pH values, different osmolality values or bile salts. For this purpose, the increase in the apparent permeability (P...

Generation of induced pluripotent stem cells (iPSCs) from an Alzheimer's disease patient carrying a M146I mutation in PSEN1

DEFF Research Database (Denmark)

Li, Tong; Pires, Carlota; Nielsen, Troels Tolstrup

2016-01-01

Skin fibroblasts were obtained from a 46-year-old symptomatic man carrying a M146I mutation in the presenilin 1 gene (PSEN1), responsible for causing Alzheimer's disease (AD). Induced pluripotent stem cells (iPSCs) were derived via transfection with episomal vectors carrying hOCT4, hSOX2, hKLF2, h......L-MYC, hLIN28 and shTP53 genes. M146I-iPSCs were free of genomically integrated reprogramming genes, had the specific mutation but no additional genomic aberrancies, expressed the expected pluripotency markers and displayed in vitro differentiation potential to the three germ layers. The reported M146I...

MicroRNA-146a expression as a potential biomarker for rheumatoid ...

African Journals Online (AJOL)

Heba Mohamed Abdelkader Elsayed

2016-07-26

Jul 26, 2016 ... lows; enzyme activation at 95 °C, followed by 40 cycles of denaturation at 94 °C for 15s annealing at 55 °C for 30 s and extension at 70 °C for 30 s. The expression of the U6B small nuclear RNA (RNU6B) was used as endogenous control for data normalization. The RQ level (fold change) for miR-146a was ...

MicroR-146 blocks the activation of M1 macrophage by targeting signal transducer and activator of transcription 1 in hepatic schistosomiasis

Directory of Open Access Journals (Sweden)

Xing He

2016-11-01

Full Text Available Schistosomiasis is a chronic disease caused by the parasite of the Schistosoma genus and is characterized by egg-induced hepatic granulomas and fibrosis. Macrophages play a central role in schistosomiasis with several studies highlighting their differentiation into M2 cells involved in the survival of infected mice through limitation of immunopathology. However, little is known regarding the mechanisms of regulating macrophage differentiation. Here, we showed that the early stage of infection by Schistosoma japonicum induced expression of type 1 T-helper-cell (Th1 cytokine, interferon-γ (IFN-γ, leading to increase in M1 cells. However, the presence of liver-trapped eggs induced the expression of Th2 cytokines including interleukin-4 (IL-4, IL-10, and IL-13 that upregulated the transcription of miR-146b by activating signal transducer and activator of transcription 3/6 (STAT3/6 that bind to the promoter of the pre-miR-146b gene. We found that the miR-146a/b was significantly upregulated in macrophages during the progression of hepatic schistosomiasis. The elevated miR-146a/b inhibited the IFN-γ-induced differentiation of macrophages to M1 cells through targeting STAT1. Our data indicate the protective roles of miR-146a/b in hepatic schistosomiasis through regulating the differentiation of macrophages into M2 cells.

29 CFR 780.146 - Importance of relationship of the practice to farming generally.

Science.gov (United States)

2010-07-01

... to include typical factory workers or industrial operations, and the sponsors of the bill made it clear that the erection and operation on a farm by a farmer of a factory, even one using raw materials... in Conjunction Withâ the Farming Operations § 780.146 Importance of relationship of the practice to...

Magnetic anisotropy and neutron scattering studies of some rare earth metals

International Nuclear Information System (INIS)

Day, R.

1978-08-01

The thesis is concerned with magnetic anisotropy of dysprosium and alloys of gadolinium: yttrium, and also neutron scattering studies of dysprosium. The experiments are discussed under the topic headings: magnetic anisotropy, rare earths, torque measurements, elastic neutron scattering, inelastic neutron scattering, dysprosium measurements, and results for the gadolinium: yttrium alloys. (U.K.)

45 CFR 146.136 - Parity in mental health and substance use disorder benefits.

Science.gov (United States)

2010-10-01

... 45 Public Welfare 1 2010-10-01 2010-10-01 false Parity in mental health and substance use disorder... Benefits § 146.136 Parity in mental health and substance use disorder benefits. (a) Meaning of terms. For... benefits and mental health or substance use disorder benefits must comply with paragraph (b)(2), (b)(3), or...

Roles of the β 146 histidyl residue in the molecular basis of the Bohr Effect of hemoglobin: A proton nuclear magnetic resonance study

International Nuclear Information System (INIS)

Busch, M.R.; Mace, J.E.; Ho, N.T.; Ho, Chien

1991-01-01

Assessment of the roles of the carboxyl-terminal β146 histidyl residues in the alkaline Bohr effect in human and normal adult hemoglobin by high-resolution proton nuclear magnetic resonance spectroscopy requires assignment of the resonances corresponding to these residues. By a careful spectroscopic study of human normal adult hemoglobin, enzymatically prepared des(His146β)-hemoglobin, and the mutant hemoglobins Cowtown (β146His → Leu) and York (β146His → Pro), the authors have resolved some of these conflicting results. By a close incremental variation of pH over a wide range in chloride-free 0.1 M N-(2-hydroxyethyl)piperazine-N'-2-ethanesulfonic acid buffer, a single resonance has been found to be consistently missing in the proton nuclear magnetic resonance spectra of these hemoglobin variants. The results indicate that the contribution of the β146 histidyl residues is 0.52 H + /hemoglobin tetramer at pH 7.6, markedly less than 0.8 H + /hemoglobin tetramer estimated by study of the mutant hemoglobin Cowtown (β146His → Leu) by Shih and Perutz. They have found that at least two histidyl residues in the carbonmonoxy form of this mutant have pK values that are perturbed, and they suggest that these pK differences may in part account for this discrepancy. The results show that the pK values of β146 histidyl residues in the carbonmonoxy form of hemoglobin are substantially affected by the presence of chloride and other anions in the solvent, and thus, the contribution of this amino acid residue to the alkaline Bohr effect can be shown to vary widely in magnitude, depending on the solvent composition. These results demonstrate that the detailed molecular mechanisms of the alkaline Bohr effect are not unique but are affected both by the hemoglobin structure and by the interactions with the solvent components in which the hemoglobin molecule resides

A functional polymorphism in the promoter region of microRNA-146a is associated with the risk of Alzheimer disease and the rate of cognitive decline in patients.

Directory of Open Access Journals (Sweden)

Lili Cui

Full Text Available miR146a is well known for its regulatory role in the immune response and inflammation. Recent studies have demonstrated the links between miR146a and Alzheimer disease (AD and suggested that miR146a may be involved in neuroinflammation and the metabolism of amyloid-β (Aβ, which are critical events in AD pathology. Although genetic studies have focused on the association between the miR146a gene and susceptibility to several diseases, no association study of miR146a variability with AD has been conducted. In this report, we performed a case-control association study to analyze the genotype and allele distributions of the miR146a, rs2910464 and rs57095329 polymorphisms in a Chinese population consisting of 292 AD cases and 300 healthy controls. We found a significant difference in the genotypes and allele frequencies of rs57095329 between the AD cases and the controls (p = 0.0147 and p = 0.0184, respectively, where the AA genotype of rs57095329 was associated with an increased risk of AD as well the cognitive decline in AD patients. Additionally, the AA genotype of rs57095329 exhibited significantly higher miR146a expression than the GG+GA genotypes of rs2910164 in the peripheral blood cells (PBMCs of healthy individuals and had a stronger effect on the production of IL-6 and IL-1β when the cells were stimulated with LPS. Our data provide preliminary evidence that the rs57095329 polymorphism in the miR146a promoter is involved in the genetic susceptibility to AD, and this risk AA genotype may increase the expression of miR146a and influence certain proinflammatory cytokines, thus playing a role in the pathogenesis of AD.

Neutral V production with 14.6 x A GeV/c silicon beams

International Nuclear Information System (INIS)

Eiseman, S.E.; Etkin, A.; Foley, K.J.; Hackenburg, R.W.; Longacre, R.S.; Love, W.A.; Morris, T.W.; Platner, E.D.; Saulys, A.C.; Lindenbaum, S.J.; Chan, C.S.; Kramer, M.A.; Zhao, K.; Hallman, T.J.; Madansky, L.; Bonner, B.E.; Buchanan, J.A.; Chiou, C.N.; Clement, J.M.; Corcoran, M.D.; Kruk, J.W.; Mutchler, G.S.; Nessi-Tedaldi, F.; Nessi, M.; Roberts, J.B.

1990-01-01

We present the results of a measurement of neutral V production with 14.6xA GeV/c Si beams on Au and Cu targets. The Λ and K s 0 yields were measured as a function of negative particle multiplicity. Effective temperatures were determined from an exponential fit to the transverse mass distributions. (orig.)

Effect of miR-146a/bFGF/PEG-PEI Nanoparticles on Inflammation Response and Tissue Regeneration of Human Dental Pulp Cells

Directory of Open Access Journals (Sweden)

Lu Liu

2016-01-01

Full Text Available Introduction. Inflammation in dental pulp cells (DPCs initiated by Lipopolysaccharide (LPS results in dental pulp necrosis. So far, whether there is a common system regulating inflammation response and tissue regeneration remains unknown. miR-146a is closely related to inflammation. Basic fibroblast growth factor (bFGF is an important regulator for differentiation. Methods. To explore the effect of miR-146a/bFGF on inflammation and tissue regeneration, polyethylene glycol-polyethyleneimine (PEG-PEI was synthesized, and physical characteristics were analyzed by dynamic light scattering and gel retardation analysis. Cell absorption, transfection efficiency, and cytotoxicity were assessed. Alginate gel was combined with miR-146a/PEG-PEI nanoparticles and bFGF. Drug release ratio was measured by ultraviolet spectrophotography. Proliferation and odontogenic differentiation of DPCs with 1 μg/mL LPS treatment were determined. Results. PEG-PEI prepared at N/P 2 showed complete gel retardation and smallest particle size and zeta potential. Transfection efficiency of PEG-PEI was higher than lipo2000. Cell viability decreased as N/P ratio increased. Drug release rate amounted to 70% at the first 12 h and then maintained slow release afterwards. Proliferation and differentiation decreased in DPCs with LPS treatment, whereas they increased in miR-146a/bFGF gel group. Conclusions. PEG-PEI is a promising vector for gene therapy. miR-146a and bFGF play critical roles in inflammation response and tissue regeneration of DPCs.

Expression of Toll-Like Receptor 2 by Dendritic Cells Is Essential for the DnaJ-ΔA146Ply-Mediated Th1 Immune Response against Streptococcus pneumoniae.

Science.gov (United States)

Wang, Xiaofang; Yuan, Taixian; Yuan, Jun; Su, Yufeng; Sun, Xiaoyu; Wu, Jingwen; Zhang, Hong; Min, Xun; Zhang, Xuemei; Yin, Yibing

2018-03-01

The fusion protein DnaJ-ΔA146Ply could induce cross-protective immunity against pneumococcal infection via mucosal and subcutaneous immunization in mice in the absence of additional adjuvants. DnaJ and Ply are both Toll-like receptor 4 (TLR4) but not TLR2 ligands. However, we found that TLR2 -/- mice immunized subcutaneously with DnaJ-ΔA146Ply showed significantly lower survival rates and higher bacterial loads in nasal washes than did wild-type (WT) mice after being challenged with pneumococcal strain D39 or 19F. The gamma interferon (IFN-γ) level in splenocytes decreased in TLR2 -/- mice, indicating that Th1 immunity elicited by DnaJ-ΔA146Ply was impaired in these mice. We explored the mechanism of protective immunity conferred by DnaJ-ΔA146Ply and the role of TLR2 in this process. DnaJ-ΔA146Ply effectively promoted dendritic cell (DC) maturation via TLR4 but not the TLR2 signaling pathway. In a DnaJ-ΔA146Ply-treated DC and naive CD4 + T cell coculture system, the deficiency of TLR2 in DCs resulted in a significant decline of IFN-γ production and Th1 subset differentiation. The same effect was observed in adoptive-transfer experiments. In addition, TLR2 -/- DCs showed remarkably lower levels of the Th1-polarizing cytokine IL-12p70 than did WT DCs, suggesting that TLR2 was indispensable for DnaJ-ΔA146Ply-induced IL-12 production and Th1 proliferation. Thus, our findings illustrate that dendritic cell expression of TLR2 is essential for optimal Th1 immune response against pneumococci in mice immunized subcutaneously with DnaJ-ΔA146Ply. Copyright © 2018 American Society for Microbiology.

MiR-146a regulates PM1 -induced inflammation via NF-κB signaling pathway in BEAS-2B cells.

Science.gov (United States)

Liu, Limin; Wan, Chong; Zhang, Wei; Guan, Longfei; Tian, Guoxiong; Zhang, Fang; Ding, Wenjun

2018-04-18

Exposure to particulate matter (PM) leads to kinds of cardiopulmonary diseases, such as asthma, COPD, arrhythmias, lung cancer, etc., which are related to PM-induced inflammation. We have found that PM 2.5 (aerodynamics diameter <2.5 µm) exposure induces inflammatory response both in vivo and in vitro. Since the toxicity of PM is tightly associated with its size and components, PM 1 (aerodynamics diameter <1.0 µm) is supposed to be more toxic than PM 2.5 . However, the mechanism of PM 1 -induced inflammation is not clear. Recently, emerging evidences prove that microRNAs play a vital role in regulating inflammation. Therefore, we studied the regulation of miR-146a in PM 1 -induced inflammation in human lung bronchial epithelial BEAS-2B cells. The results show that PM 1 induces the increase of IL-6 and IL-8 in BEAS-2B cells and up-regulates the miR-146a expression by activating NF-κB signaling pathway. Overexpressed miR-146a prevents the nuclear translocation of p65 through inhibiting the IRAK1/TRAF6 expression, and downregulates the expression of IL-6 and IL-8. Taken together, these results demonstrate that miR-146a can negatively feedback regulate PM 1 -induced inflammation via NF-κB signaling pathway in BEAS-2B cells. © 2018 Wiley Periodicals, Inc.

Selection of HLA-B57-associated Gag A146P mutant by HLA-B∗48:01-restricted Gag140-147-specific CTLs in chronically HIV-1-infected Japanese.

Science.gov (United States)

Naruto, Takuya; Murakoshi, Hayato; Chikata, Takayuki; Koyanagi, Madoka; Kawashima, Yuka; Gatanaga, Hiroyuki; Oka, Shinichi; Takiguchi, Masafumi

2011-08-01

We previously showed the possibility that Gag A146P, which is an escape mutant from HLA-B∗57-restricted CTLs, was selected by HLA-B∗48:01-restricted Gag138-147(LI10)-specific CTLs in a Japanese cohort in which HLA-B∗57 individuals were not detected. We herein demonstrated Gag140-147(GI8) to be the optimal epitope rather than LI10 and that GI8-specific T cells failed to recognize the A146P mutant virus-infected cells. The sequence analysis of Gag146 in 261 chronically HIV-1-infected Japanese showed the accumulation of the A146P mutation in HLA-B∗48:01(+) individuals. These findings together indicate that the A146P mutant is accumulating in Japanese by selection by GI8-specific CTLs. Copyright © 2011 Institut Pasteur. Published by Elsevier SAS. All rights reserved.

Search for hyperdeformation in 146Gd using the microball and gammasphere

International Nuclear Information System (INIS)

Hua, P.F.; LaFosse, D.; Korolija, M.; Sarantites, D.G.; Baktash, C.; Cross, C.; Cederwall, B.; Fallon, P.; Lee, I.Y.; Machiavelli, A.

1994-01-01

Results from the first attempt to observe hyperdeformation in 146 Gd by the 100 Mo( 51 V, p4n) reaction are presented. The γ-ray spectra were recorded with Gammasphere. The Microball was used to select protons with an efficiency of 90%. A total of 2 x 10 9 proton selected triple events were obtained. The pxn channels comprised ∼25% of the total events. The proton gating decreased the background from competing xn, αxn and fission by a factor of 4

microRNA-146a inhibits G protein-coupled receptor-mediated activation of NF-κB by targeting CARD10 and COPS8 in gastric cancer

DEFF Research Database (Denmark)

Crone, Stephanie Geisler; Jacobsen, Anders; Federspiel, Birgitte

2012-01-01

Gastric cancer is the second most common cause of cancer-related death in the world. Inflammatory signals originating from gastric cancer cells are important for recruiting inflammatory cells and regulation of metastasis of gastric cancer. Several microRNAs (miRNA) have been shown to be involved...... in development and progression of gastric cancer. miRNA-146a (miR-146a) is a modulator of inflammatory signals, but little is known about its importance in gastric cancer. We therefore wanted to identify targets of miR-146a in gastric cancer and examine its biological roles....

Measurement and Evaluation of the Activation Resonance Integral of 146Nd, 148Nd and 150Nd

International Nuclear Information System (INIS)

Ricabarra, M. D.; Turjanski, R.; Ricabarra, G. H.

2012-01-01

Values of the ratio of the reduced activation resonance integral to the thermal cross section, I'/σ 0 of 146 Nd, 148 Nd and 150 Nd were determined relative to gold by measuring cadmium ratios. A lithium-drifted germanium gamma ray spectrometer was used to resolve the activities of the irradiated samples. The results are for 146 Nd I'/σ 0 = 1.42±0.1 0 and with an assumed σ 0 = 1.4 barn, I' = 1 .99±0.20; for 148 Nd I'/ σ 0 = 4.22±0.1 4 and with an assumed σ 0 = 2.5 barn, I' = 10.5±0. 9 barn, and for 150 Nd I'/σ 0 = 13.7±0. 8 and with an assumed σ 0 = 1.2 barn, I' = 16.4±2.8. The resolved and unresolved epithermal integrals of 146 Nd, 148 Nd and 150 Nd were calculated. Values of the spectral correction factor were also calculated, so the resonance integral could be obtained from the epithermal integral data measured in our reactor spectrum in this experiment. Epithermal integral and spectral correction factors are listed in the text. The most important result of this investigation is that the 148 Nd activation reduced resonance integral is about half of the previously recommended value and consequently the radiative width for 148 Nd is also about half of the previously accepted value. (author)

Structure of the neutral capsular polysaccharide of Acinetobacter baumannii NIPH146 that carries the KL37 capsule gene cluster.

Science.gov (United States)

Arbatsky, Nikolay P; Shneider, Mikhail M; Kenyon, Johanna J; Shashkov, Alexander S; Popova, Anastasiya V; Miroshnikov, Konstantin A; Volozhantsev, Nikolay V; Knirel, Yuriy A

2015-09-02

Capsular polysaccharide (CPS) was isolated from Acinetobacter baumannii NIPH146, and the following structure of branched pentasaccharide repeating unit was established by sugar analyses along with 1D and 2D NMR spectroscopy: In comparison to most other known capsular polysaccharides of A. baumannii, the CPS studied is neutral and lacks any specific monosaccharide component. The synthesis, assembly and export of this structure could be attributed to genes in a novel capsule biosynthesis gene cluster, designated KL37, which was found in the NIPH146 genome. The CPS of A. baumannii NIPH146 shares the α-d-Galp-(1→6)-β-d-Glcp-(1→3)-d-GalpNAc-(1→ trisaccharide fragment with the CPS units of several A. baumannii strains, including ATCC 17978 and LUH 5537 that carry the KL3 and KL22 gene clusters, respectively. KL37 contains two genes for glycosyltransferases that are related to two glycosyltransferase genes present in both KL3 and KL22, and the encoded proteins could be tentatively assigned to linkages between sugars in the CPS repeat. Copyright © 2015 Elsevier Ltd. All rights reserved.

Decrease of miR-146b-5p in monocytes during obesity is associated with loss of the anti-inflammatory but not insulin signaling action of adiponectin.

Directory of Open Access Journals (Sweden)

Maarten Hulsmans

Full Text Available BACKGROUND: Low adiponectin, a well-recognized antidiabetic adipokine, has been associated with obesity-related inflammation, oxidative stress and insulin resistance. Globular adiponectin is an important regulator of the interleukin-1 receptor-associated kinase (IRAK/NFκB pathway in monocytes of obese subjects. It protects against inflammation and oxidative stress by inducing IRAK3. microRNA (miR-146b-5p inhibits NFκB-mediated inflammation by targeted repression of IRAK1 and TNF receptor-associated factor-6 (TRAF6. Therefore, we measured the expression of miR-146b-5p in monocytes of obese subjects. Because it was low we determined the involvement of this miR in the anti-inflammatory, antioxidative and insulin signaling action of globular adiponectin. METHODS: miR-146b-5p expression in monocytes of obese subjects was determined by qRT-PCR. The effect of miR-146b-5p silencing on molecular markers of inflammation, oxidative stress and insulin signaling and the association with globular adiponectin was assessed in human THP-1 monocytes. RESULTS: miR-146b-5p was downregulated in monocytes of obese persons. Low globular adiponectin decreased miR-146b-5p and IRAK3 in THP-1 monocytes, associated with increased mitochondrial reactive oxygen species (ROS. Intracellular ROS and insulin receptor substrate-1 (IRS1 protein were unchanged. Silencing of miR-146b-5p with an antisense inhibitor resulted in increased expression of IRAK1 and TRAF6 leading to more NFκB p65 DNA binding activity and TNFα. As a response IRAK3 and IRS1 protein increased. Mitochondrial and intracellular ROS production did not increase despite more inflammation. In addition, exposure of miR-146b-5p-depleted THP-1 monocytes to high levels of globular adiponectin resulted in an increased production of TNFα and intracellular ROS. Still, they did not lose their potential to increase IRAK3 and IRS1 protein and to decrease mitochondrial ROS. CONCLUSION: miR-146b-5p, decreased in monocytes

42 CFR 84.146 - Method of measuring the power and torque required to operate blowers.

Science.gov (United States)

2010-10-01

... 42 Public Health 1 2010-10-01 2010-10-01 false Method of measuring the power and torque required... RESPIRATORY PROTECTIVE DEVICES Supplied-Air Respirators § 84.146 Method of measuring the power and torque.... These are used to facilitate timing. To determine the torque or horsepower required to operate the...

The potential of chitosan in enhancing peptide and protein absorption across the TR146 cell culture model-an in vitro model of the buccal epithelium

DEFF Research Database (Denmark)

Portero, Ana; Remuñán-López, Carmen; Nielsen, Hanne Mørck

2002-01-01

To investigate the potential of chitosan (CS) to enhance buccal peptide and protein absorption, the TR146 cell culture model, a model of the buccal epithelium, was used.......To investigate the potential of chitosan (CS) to enhance buccal peptide and protein absorption, the TR146 cell culture model, a model of the buccal epithelium, was used....

The NF-κB family member RelB regulates microRNA miR-146a to suppress cigarette smoke-induced COX-2 protein expression in lung fibroblasts.

Science.gov (United States)

Zago, Michela; Rico de Souza, Angela; Hecht, Emelia; Rousseau, Simon; Hamid, Qutayba; Eidelman, David H; Baglole, Carolyn J

2014-04-21

Diseases due to cigarette smoke exposure, including chronic obstructive pulmonary disease (COPD) and lung cancer, are associated with chronic inflammation typified by the increased expression of cyclooxygenase-2 (COX-2) protein. RelB is an NF-κB family member that suppresses cigarette smoke induction of COX-2 through an unknown mechanism. The ability of RelB to regulate COX-2 expression may be via miR-146a, a miRNA that attenuates COX-2 in lung fibroblasts. In this study we tested whether RelB attenuation of cigarette smoke-induced COX-2 protein is due to miR-146a. Utilizing pulmonary fibroblasts deficient in RelB expression, together with siRNA knock-down of RelB, we show the essential role of RelB in diminishing smoke-induced COX-2 protein expression despite robust activation of the canonical NF-κB pathway and subsequent induction of Cox-2 mRNA. RelB did not regulate COX-2 protein expression at the level of mRNA stability. Basal levels of miR-146a were significantly lower in Relb-deficient cells and cigarette smoke increased miR-146a expression only in Relb-expressing cells. Inhibition of miR-146a had no effects on Relb expression or induction of Cox-2 mRNA by cigarette smoke but significantly increased COX-2 protein. These data highlight the potential of a RelB-miR-146a axis as a novel regulatory pathway that attenuates inflammation in response to respiratory toxicants. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

The assessment of CD146-based cell sorting and telomere length analysis for establishing the identity of mesenchymal stem cells in human umbilical cord [v2; ref status: indexed, http://f1000r.es/48d

Directory of Open Access Journals (Sweden)

Dimitrios Kouroupis

2014-08-01

Full Text Available Adult stem cells are characterised by longer telomeres compared to mature cells from the same tissue. In this study, candidate CD146+ umbilical cord (UC mesenchymal stem cells (MSCs were purified by cell sorting from UC tissue digests and their telomere lengths were measured in comparison to donor-matched CD146-negative fraction.   UC tissue fragments were enzymatically treated with collagenase and the cells were used for cell sorting, colony-forming fibroblast (CFU-F assay or for long-term MSC cultivation. Telomere lengths were measured by qPCR in both culture-expanded MSCs and candidate native UC MSCs. Immunohistochemistry was undertaken to study the topography of CD146+ cells.   Culture-expanded UC MSCs had a stable expression of CD73, CD90 and CD105, whereas CD146 declined in later passages which correlated with the shortening of telomeres in the same cultures. In five out of seven donors, telomeres in candidate native UC MSCs (CD45-CD235α-CD31-CD146+ were longer compared to donor-matched CD146- population (CD45-CD235α-CD31-CD146-. The frequency of CD45-CD235α-CD31-CD146+ cells measured by flow cytometry was ~1000-fold above that of CFU-Fs (means 10.4% and 0.01%, respectively. CD146+ cells were also abundant in situ having a broad topography including high levels of positivity in muscle areas in addition to vessels.   Although qPCR-based telomere length analysis in sorted populations could be limited in its sensitivity, very high frequency of CD146+ cells in UC tissue suggests that CD146 expression alone is unlikely to be sufficient to identify and purify native MSCs from the UC tissue.

Comparison of inclusive particle production in 14.6 GeV/c proton-nucleus collisions with simulation

International Nuclear Information System (INIS)

Jaffe, D.E.; Lo, K.H.; Comfort, J.R.; Sivertz, M.

2006-01-01

Inclusive charged pion, kaon, proton and deuteron production in 14.6 GeV/c proton-nucleus collisions measured by BNL experiment E802 is compared with results from the GEANT3, GEANT4 and FLUKA simulation packages. The FLUKA package is found to have the best overall agreement

Particle production in Si + A and p + A collisions at 14.6 A·GeV/c

International Nuclear Information System (INIS)

Miake, Y.

1990-01-01

Particle production (π ± , K ± , p) has been measured in both Si+A and p+A collisions at 14.6 A·GeV/c. Comparisons of m t and dn/dy distributions between p+Be, p+Au and central Si+Au collisions are discussed. 8 refs., 3 figs

Increasing of miR-148a 0061nd Decreasing of miR-146a Gene Expression in the Stomach with Ageing in Men

Directory of Open Access Journals (Sweden)

Shirin Abdolvand

2017-06-01

Full Text Available Abstract Background: The incidence of gastric cancer is different in two sexes with ratio 2 to 1 that it is more common in men. The most important biologically reason is sexual hormones between two sexes that lead to sexual dimorphism and in turn can cause a sex bias in incidence of disease between two sexes. Recently, studies have shown that microRNA is involved in sexual dimorphism in gene expression. Given the sexual dimorphism in the incidence of gastric cancer and sex hormones response elements in the regulatory regions of miR-146a and miR-148a genes, in this study, the expression of these two genes in the stomach of healthy men and women at different age groups were compared. Materials and Methods: Using endoscopy, gastric antrum tissues of 35 healthy women and 35 healthy men were collected. After RNA extraction and synthesis of cDNA, the expression of miR-146a and miR-148a genes were compared between sexes by Real time RT-PCR and data were analyzed using independent sample t and ANOVA tests. Results: There was no difference between men and women in genes expression of miR-146a and miR-148a. However, expression of miR-146a gene was significantly more in men under 45 years than men over 45 years (p= 0.017, df= 14, t= 1.47. Also, expression of miR-148a gene was significantly more in men over 45 years than men under 45 years (p=0.001, df= 12, t= 1.28. But the expression of both genes had no significant difference between women under 45 years and women over 45 years. Conclusion: Expression of miR-146a and miR-148a genes in the stomach is increased and decreased with aging in men, respectively.

Development of frequency step tunable 1 MW gyrotron at 131 to 146.5 GHz

Energy Technology Data Exchange (ETDEWEB)

Samartsev, A.; Gantenbein, G.; Dammertz, G.; Illy, S.; Kern, S.; Leonhardt, W.; Schlaich, A.; Schmid, M.; Thumm, M., E-mail: andrey.samartsev@kit.edu [Karlsruhe Institute of Technology, Association EURATOM-KIT, Karlsruhe (Germany)

2011-07-01

Effective control of power absorption in tokamaks and stellarators could be achieved by the frequency tuning of ECH and CD power delivered by high-power gyrotrons. In this report some results of the development of a frequency tunable gyrotron with fused-silica Brewster window are presented. Excitation of several modes at 1 MW power level in the range of frequencies from 131 to 146.5 GHz is achieved. (author)

Study on Magnetic Responsibility of Rare Earth Ferrite/Polyacrylamide Magnetic Microsphere

Institute of Scientific and Technical Information of China (English)

Zhang Ming; Wang Zhifeng; Zhang Hong; Dai Shaojun; Qiu Guanming; Okamoto Hiroshi

2005-01-01

In inverse microemulsion, rare earth ferrite/polyacrylamide magnetic microsphere were prepared and their magnetic responsibility were studied by magnetic balance. Results indicate that the magnetic responsibility of microsphere relates to magnetic moment of rare earth ion, and it can be improved by the addition of dysprosium ion of high magnetic moment. Dysprosium content has an effect on magnetic responsibility of dysprosium ferrite/polyacrylamide magnetic microsphere. The microsphere displays strong magnetic responsibility when the molar ratio of Dy3+/iron is 0.20.

Determination of Diclofenac on a Dysprosium Nanowire- Modified Carbon Paste Electrode Accomplished in a Flow Injection System by Advanced Filtering

Directory of Open Access Journals (Sweden)

Ali Akbar Moosavi-Movahedi

2009-09-01

Full Text Available A new detection technique called Fast Fourier Transform Square-Wave Voltammetry (FFT SWV is based on measurements of electrode admittance as a function of potential. The response of the detector (microelectrode, which is generated by a redox processes, is fast, which makes the method suitable for most applications involving flowing electrolytes. The carbon paste electrode was modified by nanostructures to improve sensitivity. Synthesized dysprosium nanowires provide a more effective nanotube-like surface [1-4] so they are good candidates for use as a modifier for electrochemical reactions. The redox properties of diclofenac were used for its determination in human serum and urine samples. The support electrolyte that provided a more defined and intense peak current for diclofenac determination was a 0.05 mol L−1 acetate buffer pH = 4.0. The drug presented an irreversible oxidation peak at 850 mV vs. Ag/AgCl on a modified nanowire carbon paste electrode which produced high current and reduced the oxidation potential by about 100 mV. Furthermore, the signal-to-noise ratio was significantly increased by application of a discrete Fast Fourier Transform (FFT method, background subtraction and two-dimensional integration of the electrode response over a selected potential range and time window. To obtain the much sensivity the effective parameters such as frequency, amplitude and pH was optimized. As a result, CDL of 2.0 × 10−9 M and an LOQ of 5.0 × 10−9 M were found for the determination for diclofenac. A good recovery was obtained for assay spiked urine samples and a good quantification of diclofenac was achieved in a commercial formulation.

Effect of Polymorphisms at Codon 146 of the Goat PRNP Gene on Susceptibility to Challenge with Classical Scrapie by Different Routes.

Science.gov (United States)

Papasavva-Stylianou, Penelope; Simmons, Marion Mathieson; Ortiz-Pelaez, Angel; Windl, Otto; Spiropoulos, John; Georgiadou, Soteria

2017-11-15

This report presents the results of experimental challenges of goats with scrapie by both the intracerebral (i.c.) and oral routes, exploring the effects of polymorphisms at codon 146 of the goat PRNP gene on resistance to disease. The results of these studies illustrate that while goats of all genotypes can be infected by i.c. challenge, the survival distribution of the animals homozygous for asparagine at codon 146 was significantly shorter than those of animals of all other genotypes (chi-square value, 10.8; P = 0.001). In contrast, only those animals homozygous for asparagine at codon 146 (NN animals) succumbed to oral challenge. The results also indicate that any cases of infection in non-NN animals can be detected by the current confirmatory test (immunohistochemistry), although successful detection with the rapid enzyme-linked immunosorbent assay (ELISA) was more variable and dependent on the polymorphism. Together with data from previous studies of goats exposed to infection in the field, these data support the previously reported observations that polymorphisms at this codon have a profound effect on susceptibility to disease. It is concluded that only animals homozygous for asparagine at codon 146 succumb to scrapie under natural conditions. IMPORTANCE In goats, like in sheep, there are PRNP polymorphisms that are associated with susceptibility or resistance to scrapie. However, in contrast to the polymorphisms in sheep, they are more numerous in goats and may be restricted to certain breeds or geographical regions. Therefore, eradication programs must be specifically designed depending on the identification of suitable polymorphisms. An initial analysis of surveillance data suggested that such a polymorphism in Cypriot goats may lie in codon 146. In this study, we demonstrate experimentally that NN animals are highly susceptible after i.c. inoculation. The presence of a D or S residue prolonged incubation periods significantly, and prions were detected

Altered spinal microRNA-146a and the microRNA-183 cluster contribute to osteoarthritic pain in knee joints.

Science.gov (United States)

Li, Xin; Kroin, Jeffrey S; Kc, Ranjan; Gibson, Gary; Chen, Di; Corbett, Grant T; Pahan, Kalipada; Fayyaz, Sana; Kim, Jae-Sung; van Wijnen, Andre J; Suh, Joon; Kim, Su-Gwan; Im, Hee-Jeong

2013-12-01

The objective of this study was to examine whether altered expression of microRNAs in central nervous system components is pathologically linked to chronic knee joint pain in osteoarthritis. A surgical animal model for knee joint OA was generated by medial meniscus transection in rats followed by behavioral pain tests. Relationships between pathological changes in knee joint and development of chronic joint pain were examined by histology and imaging analyses. Alterations in microRNAs associated with OA-evoked pain sensation were determined in bilateral lumbar dorsal root ganglia (DRG) and the spinal dorsal horn by microRNA array followed by individual microRNA analyses. Gain- and loss-of-function studies of selected microRNAs (miR-146a and miR-183 cluster) were conducted to identify target pain mediators regulated by these selective microRNAs in glial cells. The ipsilateral hind leg displayed significantly increased hyperalgesia after 4 weeks of surgery, and sensitivity was sustained for the remainder of the 8-week experimental period (F = 341, p pain was correlated with pathological changes in the knee joints as assessed by histological and imaging analyses. MicroRNA analyses showed that miR-146a and the miR-183 cluster were markedly reduced in the sensory neurons in DRG (L4/L5) and spinal cord from animals experiencing knee joint OA pain. The downregulation of miR-146a and/or the miR-183 cluster in the central compartments (DRG and spinal cord) are closely associated with the upregulation of inflammatory pain mediators. The corroboration between decreases in these signature microRNAs and their specific target pain mediators were further confirmed by gain- and loss-of-function analyses in glia, the major cellular component of the central nervous system (CNS). MicroRNA therapy using miR-146a and the miR-183 cluster could be powerful therapeutic intervention for OA in alleviating joint pain and concomitantly regenerating peripheral knee joint cartilage. © 2013

Association of MiRNA-146a, MiRNA-499, IRAK1 and PADI4 Polymorphisms with Rheumatoid Arthritis in Egyptian Population

Directory of Open Access Journals (Sweden)

Olfat Gamil Shaker

2018-05-01

Full Text Available Background/Aims: Rheumatoid arthritis (RA is a systemic autoimmune disease affecting up to 1% of the population worldwide. The aim of the present study was to investigate whether miRNA-146a rs2910164, miRNA-499 rs3746444, IRAK1 rs3027898 and PADI4 rs1748033 polymorphisms are associated with susceptibility to RA in Egyptians and whether they influence disease severity and activity. Methods: The study was performed on 104 unrelated RA patients and 112 healthy subjects. RA patients were further subdivided into active and inactive RA groups. Polymorphisms were genotyped by using real-time polymerase chain reaction with TaqMan allelic discrimination assay. Results: Significant differences in the frequency of miRNA-146a rs2910164, miRNA-499 rs3746444, IRAK1 rs3027898 and PADI4 rs1748033 alleles and genotypes were observed between RA patients and controls. Only CA and AA genotypes of IRAK1 rs3027898 shows a significant difference between active and inactive subgroups. MiRNA-146a rs2910164 and IRAK1 rs3027898 polymorphisms were a risk factor for predisposition to RA in codominant and dominant tested inheritance models, while, the miRNA-499 rs3746444 and PADI4 rs1748033 polymorphisms were a risk factor in codominant and recessive one. CG and GG genotypes of miRNA-146a rs2910164 were associated with positive erosions. CA genotype of IRAK1 rs3027898 was associated with low disease activity and negative erosions, while, the AA genotype was associated with high disease activity. CC genotype of PADI4 rs1748033 was associated with negative rheumatoid factor. Conclusion: The 4 studied SNPs were likely to play an important role in the susceptibility to RA and can influence disease severity and activity in Egyptian population.

Natural killer cells inhibit oxaliplatin-resistant colorectal cancer by repressing WBSCR22 via upregulating microRNA-146b-5p.

Science.gov (United States)

Zhao, Haiyan; Su, Wuyun; Kang, Qingmei; Xing, Ze; Lin, Xue; Wu, Zhongjun

2018-01-01

Natural killer (NK) cells have exhibited promising efficacy in inhibiting cancer growth. We aimed to explorer the effect of NK cells on oxaliplatin-resistant colorectal cancer and the underlying molecular mechanism. Oxaliplatin-resistant colorectal cancer cell lines were co-cultured with NK cells to evaluate the effect on viability, proliferation, migration and invasion in vitro . Oxaliplatin-resistant colorectal cancer cells were also co-injected with NK cells into mice to establish xenograft tumor model, to assess the in vivo effect of NK cells on tumorigenesis of the oxaliplatin-resistant colorectal cancer cells. Expression of WBSCR22 gene was assessed in the oxaliplatin-resistant colorectal cancer cells following NK cell treatment to elucidate the mechanism. NK cell treatment significantly reduces growth of oxaliplatin-resistant colorectal cancer cells both in vitro and in vivo , as well as reduced WBSCR22 expression. MicroRNAs potentially targeting WBSCR22 were analyzed, and microRNA-146b-5p was found to be significantly upregulated following NK cell treatment. MicroRNA-146b-5p directly targeted WBSCR22 mRNA 3'-UTR to inhibit its expression, which was required for NK cell-induced inhibition of oxaliplatin-resistant colorectal cancer cell lines. NK cells inhibit oxaliplatin-resistant colorectal cancer by repressing WBSCR22 via upregulating microRNA-146b-5p, both of which could serve as candidates for targeted therapy against oxaliplatin-resistant colorectal cancer.

Genetic profile of scrapie codons 146, 211 and 222 in the PRNP gene locus in three breeds of dairy goats.

Science.gov (United States)

Vouraki, Sotiria; Gelasakis, Athanasios I; Alexandri, Panoraia; Boukouvala, Evridiki; Ekateriniadou, Loukia V; Banos, Georgios; Arsenos, Georgios

2018-01-01

Polymorphisms at PRNP gene locus have been associated with resistance against classical scrapie in goats. Genetic selection on this gene within appropriate breeding programs may contribute to the control of the disease. The present study characterized the genetic profile of codons 146, 211 and 222 in three dairy goat breeds in Greece. A total of 766 dairy goats from seven farms were used. Animals belonged to two indigenous Greek, Eghoria (n = 264) and Skopelos (n = 287) and a foreign breed, Damascus (n = 215). Genomic DNA was extracted from blood samples from individual animals. Polymorphisms were detected in these codons using Real-Time PCR analysis and four different Custom TaqMan® SNP Genotyping Assays. Genotypic, allelic and haplotypic frequencies were calculated based on individual animal genotypes. Chi-square tests were used to examine Hardy-Weinberg equilibrium state and compare genotypic distribution across breeds. Genetic distances among the three breeds, and between these and 30 breeds reared in other countries were estimated based on haplotypic frequencies using fixation index FST with Arlequin v3.1 software; a Neighbor-Joining tree was created using PHYLIP package v3.695. Level of statistical significance was set at P = 0.01. All scrapie resistance-associated alleles (146S, 146D, 211Q and 222K) were detected in the studied population. Significant frequency differences were observed between the indigenous Greek and Damascus breeds. Alleles 222K and 146S had the highest frequency in the two indigenous and the Damascus breed, respectively (ca. 6.0%). The studied breeds shared similar haplotypic frequencies with most South Italian and Turkish breeds but differed significantly from North-Western European, Far East and some USA goat breeds. Results suggest there is adequate variation in the PRNP gene locus to support breeding programs for enhanced scrapie resistance in goats reared in Greece. Genetic comparisons among goat breeds indicate that separate

40 CFR 264.146 - Use of a mechanism for financial assurance of both closure and post-closure care.

Science.gov (United States)

2010-07-01

... facilities by using a trust fund, surety bond, letter of credit, insurance, financial test, or corporate... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Use of a mechanism for financial... HAZARDOUS WASTE TREATMENT, STORAGE, AND DISPOSAL FACILITIES Financial Requirements § 264.146 Use of a...

Dual-mode T_1 and T_2 magnetic resonance imaging contrast agent based on ultrasmall mixed gadolinium-dysprosium oxide nanoparticles: synthesis, characterization, and in vivo application

International Nuclear Information System (INIS)

Tegafaw, Tirusew; Xu, Wenlong; Ahmad, Md Wasi; Lee, Gang Ho; Baeck, Jong Su; Chang, Yongmin; Bae, Ji Eun; Chae, Kwon Seok; Kim, Tae Jeong

2015-01-01

A new type of dual-mode T_1 and T_2 magnetic resonance imaging (MRI) contrast agent based on mixed lanthanide oxide nanoparticles was synthesized. Gd"3"+ ("8S_7_/_2) plays an important role in T_1 MRI contrast agents because of its large electron spin magnetic moment resulting from its seven unpaired 4f-electrons, and Dy"3"+ ("6H_1_5_/_2) has the potential to be used in T_2 MRI contrast agents because of its very large total electron magnetic moment: among lanthanide oxide nanoparticles, Dy_2O_3 nanoparticles have the largest magnetic moments at room temperature. Using these properties of Gd"3"+ and Dy"3"+ and their oxide nanoparticles, ultrasmall mixed gadolinium-dysprosium oxide (GDO) nanoparticles were synthesized and their potential to act as a dual-mode T_1 and T_2 MRI contrast agent was investigated in vitro and in vivo. The D-glucuronic acid coated GDO nanoparticles (d_a_v_g = 1.0 nm) showed large r_1 and r_2 values (r_2/r_1 ≈ 6.6) and as a result clear dose-dependent contrast enhancements in R_1 and R_2 map images. Finally, the dual-mode imaging capability of the nanoparticles was confirmed by obtaining in vivo T_1 and T_2 MR images. (paper)

TR146 cells grown on filters as a model of human buccal epithelium

DEFF Research Database (Denmark)

Nielsen, Hanne Mørck; Verhoef, J C; Ponec, M

1999-01-01

The aim of the present study was to characterize the TR146 cell culture model as an in vitro model of human buccal epithelium with respect to the permeability of test substances with different molecular weights (M(w)). For this purpose, the apparent permeability (P(app)) values for mannitol...... and for fluorescein isothiocyanate (FITC)-labelled dextrans (FD) with various M(w) (4000-40000) were compared to the P(app) values obtained using porcine buccal mucosa as an in vitro model of the human buccal epithelium. The effect of 10 mM sodium glycocholate (GC) on the P(app) values was examined. To identify...

Function of miR-146a-5p in Tumor Cells As a Regulatory Switch between Cell Death and Angiogenesis: Macrophage Therapy Revisited

Directory of Open Access Journals (Sweden)

Elina Simanovich

2018-01-01

Full Text Available Tumors survive and progress by evading killing mechanisms of the immune system, and by generating a tumor microenvironment (TME that reprograms macrophages in situ to produce factors that support tumor growth, angiogenesis, and metastasis. We have previously shown that by blocking the translation of the enzyme inducible nitric oxide synthase (iNOS, miR-146a-5p inhibits nitric oxide (NO production in a mouse renal carcinoma cell line (RENCA, thereby endowing RENCA cells with resistance to macrophage-induced cell death. Here, we expand these findings to the mouse colon carcinoma CT26 cell line and demonstrate that neutralizing miR-146a-5p’s activity by transfecting both RENCA and CT26 cells with its antagomir restored iNOS expression and NO production and enhanced susceptibility to macrophage-induced cell death (by 48 and 25%, respectively, p < 0.001. Moreover, miR-146a-5p suppression simultaneously inhibited the expression of the pro-angiogenic protein EMMPRIN (threefolds, p < 0.001, leading to reduced MMP-9 and vascular endothelial growth factor secretion (twofolds and threefolds, respectively, p < 0.05, and reduced angiogenesis, as estimated by in vitro tube formation and scratch assays. When we injected tumors with pro-inflammatory-stimulated RAW 264.7 macrophages together with i.v. injection of the miR-146a-5p antagomir, we found inhibited tumor growth (sixfolds, p < 0.001 and angiogenesis (twofolds, p < 0.01, and increased apoptosis (twofolds, p < 0.01. This combination therapy increased nitrites and reduced TGFβ concentrations in tumor lysates, alleviated immune suppression, and allowed enhanced infiltration of cytotoxic CD8+ T cells. Thus, miR-146a-5p functions as a control switch between angiogenesis and cell death, and its neutralization can manipulate the crosstalk between tumor cells and macrophages and profoundly change the TME. This strategy can be therapeutically utilized in combination with the macrophage

Acute dysprosium toxicity to Daphnia pulex and Hyalella azteca and development of the biotic ligand approach

Energy Technology Data Exchange (ETDEWEB)

Vukov, Oliver, E-mail: vuko3930@mylaurier.ca [Biology Department, Wilfrid Laurier University, Waterloo, Ontario N2L 3C5 (Canada); Smith, D. Scott [Chemistry Department, Wilfrid Laurier University, Waterloo, Ontario N2L 3C5 (Canada); McGeer, James C. [Biology Department, Wilfrid Laurier University, Waterloo, Ontario N2L 3C5 (Canada)

2016-01-15

The toxicological understanding of rare earth elements (REEs) in the aquatic environment is very limited but of increasing concern. The objective of this research is to compare the toxicological effect of the REE dysprosium to the freshwater invertebrates Daphnia pulex and Hyalella azteca and in the more sensitive organism, understand the toxicity modifying influence of Ca, Na, Mg, pH and dissolved organic matter (DOM). Standard methods (Environment Canada) were followed for testing and culture in media of intermediate hardness (60 mg CaCO{sub 3} mg/L) at pH 7.8 with Ca at 0.5, Na 0.5, Mg 0.125 (mM) and 23 °C. Acute toxicity tests were done with <24 h old neonates for 48 h in the case of D. pulex and with 2–9 days old offspring for 96 h tests with Hyalella. The potential protective effect of cationic competition was tested with Ca (0.5–2.0 mM), Na (0.5–2.0 mM) and Mg (0.125–0.5 mM). The effect of pH (6.5–8.0) and Suwannee River DOM complexation (at dissolved organic carbon (DOC) concentrations of 9 and 13 mg C/L) were evaluated. Dissolved Dy concentrations were lower than total (unfiltered) indicating precipitation, particularly at higher concentrations. Acute toxicity of Dy to H. azteca and D. pulex revealed Hyalella to be 1.4 times more sensitive than Daphnia. Additions of Ca and Na but not Mg provided significant protection against Dy toxicity to Hyalella. Similarly, low pH was associated with reduction in toxicity. Exposures which were pH buffered with and without MOPS were significantly different and indicated that MOPS enhanced Dy toxicity. DOM also mitigated Dy toxicity. Biotic ligand based parameters (Log K values) were calculated based on free ion relationships as determined by geochemical equilibrium modeling software (WHAM ver. 7.02). The log K value for Dy{sup 3+} toxicity to Hyalella was 7.75 while the protective influence of Ca and Na were 3.95 and 4.10, respectively. This study contributes data towards the development of site specific

Synthesis and characterization of phosphors based on calcium and magnesium silicates doped with europium and dysprosium

International Nuclear Information System (INIS)

Misso, Agatha Matos

2016-01-01

Ca and Mg silicates based phosphors were prepared by sol-gel method combined with the molten salts process. The gel of silica was obtained from Na 2 SiO 3 solution by using europium, dysprosium, calcium and magnesium chloride solutions. Therefore, those chlorides were homogeneously dispersed into the gel. The obtained gel was dried and heat treated to 900° C for 1h to allow the fusion of the present salts. Then it was water washed until negative test for Cl - , and dried. The reduction of the europium to Eu 2+ was performed under atmosphere of 5% of H 2 and 95% of Ar to 900° C for 3h, to reach CaMgSi 2 O 6 :Eu 2+ and CaMgSi 2 O 6 :Eu 2+ :Dy 3+ phosphors. Diopside was identified as main crystalline phase and quartz, as secondary phase from XRD (X-ray diffraction) patterns. SEM (scanning electron microscopy) micrographs, of the samples showed needles, spheres, leaves and rods of particles and agglomerates. Thermal analysis (TGA-DTGA) curves revealed that the crystallization temperature of CaMgSi 2 O 6 :Eu 2+ lies around 765° C. Photoluminescence spectroscopy of the phosphors was studied based on interconfigurational 4f N → 4f N-1 5d transition of Eu 2+ ion. The spectra of excitation showed 4f N → 4f N-1 5d transition of Eu 2+ ion broad band, related to the ligand to metal charge transfer transition (LMCT) O 2- (2p) → Eu 3+ in the 250 nm region, when the emission is monitored at 583,5 nm. It also presents the 4f ↔ 4f transitions of Eu 3+ ion bands, showing the 7 F 0 → 5 L 6 transition at 393 nm. From emission spectra with excitation monitored at 393 nm, it can be observed fine peaks between 570 and 750 nm which are characteristics of 5 D 0 → 7 F J (J = 0 - 5) transition of Eu 3+ ion, indicating that the Eu 3+ ion occupies a site with center of inversion. Finally, the obtained results indicate that the developed method is suitable to synthesize CaMgSi 2 O 6 :Eu 2+ and CaMgSi 2 O 6 :Eu 2+ :Dy 3+ phosphors, as it has been proposed. (author)

Acute dysprosium toxicity to Daphnia pulex and Hyalella azteca and development of the biotic ligand approach

International Nuclear Information System (INIS)

Vukov, Oliver; Smith, D. Scott; McGeer, James C.

2016-01-01

The toxicological understanding of rare earth elements (REEs) in the aquatic environment is very limited but of increasing concern. The objective of this research is to compare the toxicological effect of the REE dysprosium to the freshwater invertebrates Daphnia pulex and Hyalella azteca and in the more sensitive organism, understand the toxicity modifying influence of Ca, Na, Mg, pH and dissolved organic matter (DOM). Standard methods (Environment Canada) were followed for testing and culture in media of intermediate hardness (60 mg CaCO 3 mg/L) at pH 7.8 with Ca at 0.5, Na 0.5, Mg 0.125 (mM) and 23 °C. Acute toxicity tests were done with <24 h old neonates for 48 h in the case of D. pulex and with 2–9 days old offspring for 96 h tests with Hyalella. The potential protective effect of cationic competition was tested with Ca (0.5–2.0 mM), Na (0.5–2.0 mM) and Mg (0.125–0.5 mM). The effect of pH (6.5–8.0) and Suwannee River DOM complexation (at dissolved organic carbon (DOC) concentrations of 9 and 13 mg C/L) were evaluated. Dissolved Dy concentrations were lower than total (unfiltered) indicating precipitation, particularly at higher concentrations. Acute toxicity of Dy to H. azteca and D. pulex revealed Hyalella to be 1.4 times more sensitive than Daphnia. Additions of Ca and Na but not Mg provided significant protection against Dy toxicity to Hyalella. Similarly, low pH was associated with reduction in toxicity. Exposures which were pH buffered with and without MOPS were significantly different and indicated that MOPS enhanced Dy toxicity. DOM also mitigated Dy toxicity. Biotic ligand based parameters (Log K values) were calculated based on free ion relationships as determined by geochemical equilibrium modeling software (WHAM ver. 7.02). The log K value for Dy 3+ toxicity to Hyalella was 7.75 while the protective influence of Ca and Na were 3.95 and 4.10, respectively. This study contributes data towards the development of site specific water quality

MiR-146b-5p overexpression attenuates stemness and radioresistance of glioma stem cells by targeting HuR/lincRNA-p21/β-catenin pathway

Science.gov (United States)

Yang, Wei; Yu, Hongquan; Shen, Yueming; Liu, Yingying; Yang, Zhanshan; Sun, Ting

2016-01-01

A stem-like subpopulation existed in GBM cells, called glioma stem cells (GSCs), might contribute to cancer invasion, angiogenesis, immune evasion, and therapeutic resistance, providing a rationale to eliminate GSCs population and their supporting niche for successful GBM treatment. LincRNA-p21, a novel regulator of cell proliferation, apoptosis and DNA damage response, is found to be downregulated in several types of tumor. However, little is known about the role of lincRNA-p21 in stemness and radioresistance of GSCs and its regulating mechanisms. In this study, we found that lincRNA-p21 negatively regulated the expression and activity of β-catenin in GSCs. Downregulation of lincRNA-p21 in GSCs was resulted from upregulation of Hu antigen R (HuR) expression caused by miR-146b-5p downregulation. MiR-146b-5p overexpression increased apoptosis and radiosensitivity, decreased cell viability, neurosphere formation capacity and stem cell marker expression, and induced differentiation in GSCs. Moreover, knock-down lincRNA-p21 or HuR and β-catenin overexpression could rescue the phenotypic changes resulted from miR-146b-5p overexpression in GSCs. These findings suggest that targeting the miR-146b-5p/HuR/lincRNA-p21/β-catenin signaling pathway may be valuable therapeutic strategies against glioma. PMID:27166258

Microstructure and thermal properties of dysprosium and thulium co-doped barium titanate ceramics for high performance multilayer ceramic capacitors

Energy Technology Data Exchange (ETDEWEB)

Kim, Jinseong; Kim, Dowan; Noh, Taimin [School of Materials Science and Engineering, Pusan National University, Busan 609-735 (Korea, Republic of); Ahn, Byungmin [Department of Chemical Engineering and Materials Science, University of Southern California, Los Angeles, CA 90089-0241 (United States); Lee, Heesoo, E-mail: heesoo@pusan.ac.kr [School of Materials Science and Engineering, Pusan National University, Busan 609-735 (Korea, Republic of)

2011-09-15

Highlights: > Dy/Tm co-doping method in BaTiO{sub 3} was suggested to improve electrical properties and temperature stability simultaneously. > We examined these properties in terms of microstructural analysis and substitution rate. > Increase of Dy{sub 2}O{sub 3} addition enhanced dielectric constant. > Increase of Tm{sub 2}O{sub 3} addition enhanced temperature stability. > Improved electrical properties and temperature stability through Dy/Tm co-doping were deduced from formation of electrons and core-shell structure. - Abstract: The co-doping characteristics on microstructure and thermal properties of barium titanate (BaTiO{sub 3}) were investigated to elucidate formation of core-shell structure by dysprosium (Dy) and thulium (Tm) addition in the BaTiO{sub 3}-Dy{sub 2}O{sub 3}-Tm{sub 2}O{sub 3} system. The dielectrics co-doped with 0.7 mol% Dy{sub 2}O{sub 3} and 0.3 mol% Tm{sub 2}O{sub 3} had the dielectric constant up to 2200 as a function of temperature, which was 30% higher than that of specimen containing only Tm{sub 2}O{sub 3} at the room temperature. It could be explained by the fact that the increase of Dy{sub 2}O{sub 3} addition contributed to the improvement of dielectric constant. On the other hand, the rapid diffusion rate of Dy{sup 3+} ions in BaTiO{sub 3} showed an adverse effect on temperature stability caused by destruction of core-shell. As the compensation for shell expansion in BaTiO{sub 3}, the reinforcement of the core-shell structure through the addition of Tm{sub 2}O{sub 3} was confirmed by TEM-EDS analysis and attributed the temperature coefficient of capacitance (TCC) in a reliability condition (-55 deg. C to 125 deg. C, {Delta}C = {+-}15% or less). The enhanced electrical properties and temperature stability could be deduced from the generation of electrons and the formation core-shell structure in co-doped BaTiO{sub 3} system respectively.

An ICP AES method for determination of dysprosium and terbium in high purity yttrium oxide

International Nuclear Information System (INIS)

Rupawate, V.H.; Hareendran, K.N.; Roy, S.B.

2011-01-01

High purity yttrium finds interesting application in astronavigation, luminescence, nuclear energy and metallurgical industries. Most of these applications require yttrium oxide of highest purity. Consequently there is a need for production of high purity yttrium oxide. Separation and purification of yttrium from other rare earths is a challenging task due to their close chemical properties. Liquid-liquid extraction and ion exchange have been widely used in the production of yttrium oxide of highest purity. Determination of impurities, especially other rare earths, in ppm level is required for process development and chemical characterization of the high purity Y 2 O 3 . Many methods have been described in literature. However since the advent of ICP AES much work in this area has been carried out by this technique. This paper describes the work done for determination of dysprosium (Dy) and terbium (Tb) in yttrium oxide using a high resolution sequential ICP AES. Emission spectra of rare earth elements are very complex and due to this complexity it is important to select spectral interference free analyte lines for determination of rare earths in rare earth matrix. For the determination of Dy and Tb in Y 2 O 3 , sensitive lines of Dy and Tb are selected from the instrument wavelength table and spectral interference free emission lines for the determination is selected by scanning around the selected wavelengths using 5 g/L Y solution and 5 mg/L standard solutions of Dy and Tb prepared in 4% nitric acid. It is found 353.170 nm line of Dy and 350.917 nm line Tb is suitable for quantitative determination. The signal to background ratio increases with increase in matrix concentration, i.e. from 1 to 5 mg/L. The optimum forward power is determined and it is found to be 1100W for Dy and 1000W for Tb. The instrument is calibrated using matrix matched standards containing 5g/L of Y matrix. Samples are dissolved in nitric acid and Y concentration is maintained at 5g/L. Two

Multi-element analysis of crude-oil samples by 14.6 MeV neutron activation

International Nuclear Information System (INIS)

Cam, N.F.; Cigeroglu, F.; Erduran, M.N.

1997-01-01

The instrumental neutron activation technique, using the SAMEST T-400 neutron generator with 14.6 MeV neutrons produced from 3 H(d,n) 4 He reaction, is demonstrated for multi-element analysis of Saudi-Arabian crude-oil samples. The system parameters for the absolute method (e.g., the counting solid-angle, intrinsic efficiency of the γ-ray detector, effective neutron flux, activation cross sections, etc.)were determined and the results of elemental concentrations were presented with the corrections for all possible interferences having been carefully considered. (author)

Analysis of pion production data from E-802 at 14.6 GeV/c using ARC

International Nuclear Information System (INIS)

Kahana, D.; Torun, Yagmur

1995-07-01

We compared the invariant cross sections for pion production by a 14.6 GeV/c proton beam on Be, Al, Cu and Au targets from the measurements of Abbott et.al. with predictions of the ARC program. The agreement was found to be good in the region where data exists. Most pions are found at low momenta in the lab frame. Unfortunately very little data exists for low momentum pions

24 CFR 943.146 - What impact does the use of a subsidiary, affiliate, or joint venture have on financial...

Science.gov (United States)

2010-04-01

... subsidiary, affiliate, or joint venture have on financial accountability to HUD and the Federal government... URBAN DEVELOPMENT PUBLIC HOUSING AGENCY CONSORTIA AND JOINT VENTURES Subsidiaries, Affiliates, Joint Ventures in Public Housing § 943.146 What impact does the use of a subsidiary, affiliate, or joint venture...

Study of intermittency of target fragments in the interactions of 28Si-Em collisions at 14.6 A GeV

International Nuclear Information System (INIS)

Ayaz Ahmad, M.; Ashraf T, M.; Ahmad, Shafiq

2008-01-01

An attempt has been made to investigate the intermittent behaviour and fractal properties of emission spectra of fast and slow target associated particles from 28 Si-emulsion interactions at 14.6 A GeV using nuclear emulsion in cosθ phase space

MiR-146a rs2910164 polymorphism increases the risk of digestive system cancer: A meta-analysis.

Science.gov (United States)

Xie, Wen Qun; Wang, Xiao Fan

2017-02-01

There is merging evidence suggesting that the miR-146a polymorphism might be associated with susceptibility to digestive system cancer. However, previous published studies have failed to achieve a definitive conclusion. To address this issue, an updated meta-analysis was performed. A comprehensive electronic search was conducted using the following source to identify the eligible studies: PubMed, Embase, China BioMedicine, the Cochrane Library, and Google Scholar. Odds ratios and its corresponding 95% confidence interval (CI) was used in the quantitative synthesis. The database search identified 1344 eligible studies, of which 32 (comprising 12,541 cases and 15,925 controls) were included. The results indicate that the miR-146a rs2910164 polymorphism was significantly associated with increased risk of digestive system cancer in heterozygote comparison (GC vs. CC: OR=1.15, 95% CI: 1.02-1.30, P=0.02), and recessive model (GG vs. GC+CC: OR=1.11, 95% CI: 1.04-1.17, P=0.006). Subgroup analysis by cancer site revealed increased risk in gastric cancer above heterozygote comparison (GG vs. GC: OR=1.13, 95% CI: 1.02-1.25, P=0.02), and recessive model (GG vs. GC+CC: OR=1.15, 95% CI: 1.04-1.26, P=0.006). Similarly, increased cancer risk was observed in hepatocellular carcinoma when compared with homozygote comparison (GG vs. CC: OR=1.21, 95% CI: 1.04-1.42, P=0.02), heterozygote comparison (GC vs. CC: OR=1.15, 95% CI: 1.02-1.29, P=0.02), and dominant model (GG+GC vs. CC: OR=1.16, 95% CI: 1.04-1.29, P=0.009). When stratified by ethnicity and quality score, increased cancer risks were also observed among Asians, Caucasians and high quality studies subgroup. The current study revealed that miR-146a G/C genetic polymorphism was more likely to be associated with digestive system cancer risk. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Evidence for an Opportunistic and Endophytic Lifestyle of the Bursaphelenchus xylophilus-Associated Bacteria Serratia marcescens PWN146 Isolated from Wilting Pinus pinaster.

Science.gov (United States)

Vicente, Cláudia S L; Nascimento, Francisco X; Barbosa, Pedro; Ke, Huei-Mien; Tsai, Isheng J; Hirao, Tomonori; Cock, Peter J A; Kikuchi, Taisei; Hasegawa, Koichi; Mota, Manuel

2016-10-01

Pine wilt disease (PWD) results from the interaction of three elements: the pathogenic nematode, Bursaphelenchus xylophilus; the insect-vector, Monochamus sp.; and the host tree, mostly Pinus species. Bacteria isolated from B. xylophilus may be a fourth element in this complex disease. However, the precise role of bacteria in this interaction is unclear as both plant-beneficial and as plant-pathogenic bacteria may be associated with PWD. Using whole genome sequencing and phenotypic characterization, we were able to investigate in more detail the genetic repertoire of Serratia marcescens PWN146, a bacterium associated with B. xylophilus. We show clear evidence that S. marcescens PWN146 is able to withstand and colonize the plant environment, without having any deleterious effects towards a susceptible host (Pinus thunbergii), B. xylophilus nor to the nematode model C. elegans. This bacterium is able to tolerate growth in presence of xenobiotic/organic compounds, and use phenylacetic acid as carbon source. Furthermore, we present a detailed list of S. marcescens PWN146 potentials to interfere with plant metabolism via hormonal pathways and/or nutritional acquisition, and to be competitive against other bacteria and/or fungi in terms of resource acquisition or production of antimicrobial compounds. Further investigation is required to understand the role of bacteria in PWD. We have now reinforced the theory that B. xylophilus-associated bacteria may have a plant origin.

Capillary electrophoresis fingerprinting, quantification and mass-identification of various 9-aminopyrene-1,4,6-trisulfonate-derivatized oligomers derived from plant polysaccharides

NARCIS (Netherlands)

Kabel, M.A.; Heijnis, W.H.; Bakx, E.J.; Kuijpers, I.J.; Voragen, A.G.J.; Schols, H.A.

2006-01-01

Various plant polysaccharide derived mono- and oligosaccharides were derivatized with the fluorescent 9-aminopyrene-1,4,6-trisulfonate (APTS) and subjected to capillary electrophoresis (CE) in combination with laser induced fluorescence (LIF) detection. CE-LIF was suitable for mol-based

Study of reaction mechanisms in 40Ar+68Zn interaction at 14.6 and 27.6 MeV/N

International Nuclear Information System (INIS)

Rami, F.

1985-01-01

The competing mechanisms in the 40 Ar+ 68 Zn reaction have been investigated at two bombarding energies: 14.6 and 27.6 MeV/nucleon. Mass, charge and energy spectra of the reaction products have been measured in a large angular range (3 0 0 ). The results show that important changes occur in this energy region. At 14.6 MeV/nucleon the production of the projectile-like fragments results mainly from deep inelastic and direct nucleon transfer reactions; while at 27.6 MeV/nucleon a strong component corresponding to process similar to projectile fragmentation is also observed. A distinction between the fragmentation process and direct transfer of few nucleons has been possible by analysing the linear momentum distributions of the detected fragments. The energy dependance of the fusion cross section indicates that this process should disappear for incident energies E/A > approximately 30 MeV/nucleon. The maximum temperature reached by the compound nucleus has been deduced i.e. Tmax approximately equal 7 MeV; this value is in agreement with recent theoretical predictions [fr

Aneurysm-Specific miR-221 and miR-146a Participates in Human Thoracic and Abdominal Aortic Aneurysms

Directory of Open Access Journals (Sweden)

Premakumari Venkatesh

2017-04-01

Full Text Available Altered microRNA expression is implicated in cardiovascular diseases. Our objective was to determine microRNA signatures in thoracic aortic aneurysms (TAAs and abdominal aortic aneurysms (AAAs compared with control non-aneurysmal aortic specimens. We evaluated the expression of fifteen selected microRNA in human TAA and AAA operative specimens compared to controls. We observed significant upregulation of miR-221 and downregulation of miR-1 and -133 in TAA specimens. In contrast, upregulation of miR-146a and downregulation of miR-145 and -331-3p were found only for AAA specimens. Upregulation of miR-126 and -486-5p and downregulation of miR-30c-2*, -155, and -204 were observed in specimens of TAAs and AAAs. The data reveal microRNA expression signatures unique to aneurysm location and common to both thoracic and abdominal pathologies. Thus, changes in miR-1, -29a, -133a, and -221 are involved in TAAs and miR-145, -146, and -331-3p impact AAAs. This work validates prior studies on microRNA expression in aneurysmal diseases.

Is the largest aqueous gold cluster a superatom complex? Electronic structure & optical response of the structurally determined Au146(p-MBA)57.

Science.gov (United States)

López-Lozano, Xóchitl; Plascencia-Villa, G; Calero, G; Whetten, R L; Weissker, Hans-Christian

2017-12-07

The new water-soluble gold cluster Au 146 (p-MBA) 57 , the structure of which has been recently determined at sub-atomic resolution by Vergara et al., is the largest aqueous gold cluster ever structurally determined and likewise the smallest cluster with a stacking fault. The core presents a twinned truncated octahedron, while additional peripheral gold atoms follow a C 2 rotational symmetry. According to the usual counting rules of the superatom complex (SAC) model, the compound attains a number of 92 SAC electrons if the overall net charge is 3- (three additional electrons). As this is the number of electrons required for a major shell closing, the question arises of whether Au 146 (p-MBA) 57 should be regarded as a superatom complex. Starting from the experimental coordinates we have analyzed the structure using density-functional theory. The optimized (relaxed) structure retains all the connectivity of the experimental coordinates, while removing much of its irregularities in interatomic distances, thereby enhancing the C 2 -symmetry feature. On analyzing the angular-momentum-projected states, we show that, despite a small gap, the electronic structure does not exhibit SAC model character. In addition, optical absorption spectra are found to be relatively smooth compared to the example of the Au 144 (SR) 60 cluster. The Au 146 (SR) 57 does not derive its stability from SAC character; it cannot be considered as a superatom complex.

Four new dysprosium and neodymium octamolybdate hydrates: assembly of RE2(Mo8O27) sheets and topotactic transformations.

Science.gov (United States)

Kuang, Xiaojun; Evans, Ivana R

2010-07-05

Four new Dy and Nd hydrated octamolybdate materials have been prepared: [Dy(2)(H(2)O)(12)](Mo(8)O(27)) x 8 H(2)O, [Dy(2)(H(2)O)(6)](Mo(8)O(27)), [Nd(2)(H(2)O)(12)](Mo(8)O(27)) x 6 H(2)O, and [Nd(2)(H(2)O)(6)]Mo(8)O(27) x 3 H(2)O. They adopt one known and three new structure types, which we have determined ab initio from powder X-ray diffraction data. The four compounds contain the same basic structural building block, in the form of RE(2)Mo(8)O(27) (RE = Dy, Nd) chains, which are arranged differently for the two rare earths in the fully hydrated precursor materials. [Dy(2)(H(2)O)(12)](Mo(8)O(27)) x 8 H(2)O comprises isolated Dy(2)Mo(8)O(27) chains assembled in a zigzag manner along the a axis with interspersed crystallized water molecules, which differs from the parallel arrangements of isolated Nd(2)Mo(8)O(27) chains in [Nd(2)(H(2)O)(12)](Mo(8)O(27)) x 6 H(2)O. Partial dehydration of the two precursors leads to new phases [Dy(2)(H(2)O)(6)](Mo(8)O(27)) and [Nd(2)(H(2)O)(6)]Mo(8)O(27) x 3 H(2)O, respectively, prior to complete dehydration, which leads to initially amorphous and eventually crystalline rare-earth molybdenum mixed metal oxides. Both initial transformations occur topotactically. Partial dehydration of the Dy phase condenses the assembly of the Dy(2)Mo(8)O(27) chains principally along the a axis, leading to a 3-dimensional (3D) framework, with each Dy bridging two (Mo(8)O(27))(6-) sheets in the product. The partial dehydration of the Nd precursor condenses the assembly of Nd(2)Mo(8)O(27) chains along the [110] axis, leading to a 3D framework where each Nd bridges three (Mo(8)O(27))(6-) units. Both new dysprosium octamolybdates adopt noncentrosymmetric polar structures in space group P2(1) and are second harmonic generation (SHG) active.

Chemical composition and microstructure of magnetically melt-textured Bi2Sr2Ca0.8Dy0.2Cu2O8-y

International Nuclear Information System (INIS)

Stassen, S.; Rulmont, A.; Krekels, T.; Ausloos, M.; Cloots, R.

1996-01-01

Dysprosium-doped Bi-based 2212 materials have been synthesized in the presence of a magnetic field, applied perpendicularly to the lateral face of a cylinder, by a melt-textured growth process. Thick (well oriented) layers of different chemical composition have been observed. A dysprosium-doped 2212 phase (the expected D phase) and a dysprosium-free bismuth-rich and strontium-deficient 2212 phase have been found. It is argued that the latter is a so-called M phase. Other impurity phases have been observed, connected with both 2212-type layers. A novel aspect of this work is the calcium solubility at the strontium site in the 2201 structure, and inversely the strontium solubility at the calcium site in the 8250 structure. (orig.)

Intensities of two-quanta cascades at different excitation energies of compound nuclei 146Nd, 174Yb, 183W

International Nuclear Information System (INIS)

Boneva, S.T.; Khitrov, V.A.; Sukhovoj, A.M.; Vojnov, A.V.

1990-01-01

Intensities of two-quanta cascades are obtained for 2-3 final low-lying levels of the following nuclei 146 Nd, 174 Yb and 183 W. These measured intensities are compared with the intensities calculated in the frame of various models at primary transition energies ranging from 0.5 MeV to the neutron binding energy. Some excitation energy intervals are revealed, experimentally obtained intensities of cascade are inconsistent with model calculations. 15 refs.; 7 figs

Global observables in Si + nucleus collisions at 14.6 GeV per nucleon

International Nuclear Information System (INIS)

Shivakumar, B.; Greene, S.V.; Hemmick, T.K.; Majka, R.; Mitchell, J.T.; Rotondo, F.; Sandweiss, J.; Barrette, J.; Mark, S.K.; Pruneau, C.; Bellwied, R.; Braun-Munzinger, P.; David, G.; Herrmann, N.; Ingold, G.; Llope, W.J.; Muthuswamy, M.; Stachel, J.; Waters, L.; Cleland, W.E.; Jayananda, K.; Kraus, D.; Sonnadara, U.; Fatyga, M.; Hogue, R.W.; Lissauer, D.; Ludlam, T.; Makowiecki, D.; O'Brien, E.; Polychronakos, V.; Takai, H.; Throwe, T.; Woody, C.; Fox, D.; Sunier, J.; Van Hecke, H.; Hall, J.; Wolfe, D.; Heifetz, R.; Rawool-Sullivan, M.; Simon, J.; Sullivan, J.P.; Wolf, K.

1990-01-01

A simultaneous determination of the transverse energy produced, and the multiplicity of beam rapidity nucleons surviving nucleus interactions provides an effective way to quantify the extent of stopping achieved therein. The authors have studied collisions between 28 Si projectiles with energies E lab /A = 14.6 GeV and targets of Al, Cu, and Pb. Transverse energy production has been measured calorimetrically in a pseudorapidity interval -0.5 < η < 0.8, and correlated with the multiplicity of beam rapidity protons and neutrons detected in a 0.8 degree cone centered on the beam direction. Theoretical calculations have been performed to describe the data, and demonstrate quantitatively the large amount of nuclear stopping in these collisions. They also indicate the importance of rescattering in the production of transverse energy

Results of the radiological survey at 146 W. Central Avenue, Maywood, New Jersey (MJ034)

International Nuclear Information System (INIS)

Foley, R.D.; Carrier, R.F.

1989-11-01

Maywood Chemical Works (MCW) of Maywood, New Jersey, generated process wastes and residues associated with the production and reining of thorium and thorium compounds from monazite ores from 1916 to 1956. MCW supplied rare earth metals and thorium compounds to the Atomic Energy Commission and various other government agencies from the late 1940s to the mid-1950s. Area residents used the sandlike waste from this thorium extraction process mixed with tea and cocoa leaves as mulch in their yards. Some of these contaminated wastes were also eroded from the site into Lodi Brook. At the request of the US Department of Energy (DOE), a group from OaK Ridge National Laboratory conducts investigative radiological surveys of properties in the vicinity of MCW to determine whether a property is contaminated with radioactive residues, principally 232 Th, derived from the MCW site. These surveys typically include direct measurement of gamma radiation levels and soil sampling for radionuclide analyses. The survey of this site, a private property at 146 West Central Avenue, Maywood, New Jersey (MJ034), was conducted during 1987 and 1988. While some measurements at this property were greater than background levels typically encountered in the New jersey area, no radiation levels nor radionuclide concentrations exceeded the guidelines established by the DOE for the Maywood, New Jersey, area remedial action plan. However, because of the proximity of the railroad property, which will be remediated, and the DOE's ALARA (As Low As Reasonably Achievable) policy, concurrent removal of the slightly elevated soil layers at 146 W. Central Avenue may be justified. 6 refs., 6 figs., 3 tabs

Inositol-Requiring Enzyme 1-Mediated Downregulation of MicroRNA (miR)-146a and miR-155 in Primary Dermal Fibroblasts across Three TNFRSF1A Mutations Results in Hyperresponsiveness to Lipopolysaccharide.

Science.gov (United States)

Harrison, Stephanie R; Scambler, Thomas; Oubussad, Lylia; Wong, Chi; Wittmann, Miriam; McDermott, Michael F; Savic, Sinisa

2018-01-01

Tumor necrosis factor (TNF)-receptor-associated periodic fever syndrome (TRAPS) is a rare monogenic autoinflammatory disorder characterized by mutations in the TNFRSF1A gene, causing TNF-receptor 1 (TNFR1) misfolding, increased cellular stress, activation of the unfolded protein response (UPR), and hyperresponsiveness to lipopolysaccharide (LPS). Both microRNA (miR)-146a and miR-155 provide negative feedback for LPS-toll-like receptor 2/4 signaling and cytokine production, through regulation of nuclear factor kappa B (NF-κB). In this study, we hypothesized that proinflammatory cytokine signaling in TRAPS downregulates these two miRs, resulting in LPS-induced hyperresponsiveness in TRAPS dermal fibroblasts (DFs), irrespective of the underlying genetic mutation. Primary DF were isolated from skin biopsies of TRAPS patients and healthy controls (HC). TNFR1 cell surface expression was measured using immunofluorescence. DF were stimulated with LPS, interleukin (IL)-1β, thapsigargin, or TNF, with and without inositol-requiring enzyme 1 (IRE1) inhibitor (4u8C), following which miR-146a and miR-155 expression was measured by RT-qPCR. IL-1β, IL-6, and TNF secretion was measured by enzyme-linked immunosorbent assays, and baseline expression of 384 different miRs was assessed using microfluidics assays. TNFR1 was found to be expressed on the surface of HC DF but expression was deficient in all samples with TRAPS-associated mutations. HC DF showed significant dose-dependent increases in both miR-146a and miR-155 expression levels in response to LPS; however, TRAPS DF failed to upregulate either miR-146a or miR-155 under the same conditions. This lack of miR-146a and miR-155 upregulation was associated with increased proinflammatory cytokine production in TRAPS DF in response to LPS challenge, which was abrogated by 4u8C. Incubation of HC DF with IL-1β led to downregulation of miR-146a and miR-155 expression, which was dependent on IRE1 enzyme. We observed global

Structure-activity relationship studies of 1,7-diheteroarylhepta-1,4,6-trien-3-ones with two different terminal rings in prostate epithelial cell models.

Science.gov (United States)

Wang, Rubing; Zhang, Xiaojie; Chen, Chengsheng; Chen, Guanglin; Sarabia, Cristian; Zhang, Qiang; Zheng, Shilong; Wang, Guangdi; Chen, Qiao-Hong

2017-06-16

To systematically investigate the structure-activity relationships of 1,7-diheteroarylhepta-1,4,6-trien-3-ones in three human prostate cancer cell models and one human prostate non-neoplastic epithelial cell model, thirty five 1,7-diarylhepta-1,4,6-trien-3-ones with different terminal heteroaromatic rings have been designed for evaluation of their anti-proliferative potency in vitro. These target compounds have been successfully synthesized through two sequential Horner-Wadsworth-Emmons reactions starting from the appropriate aldehydes and tetraethyl (2-oxopropane-1,3-diyl)bis(phosphonate). Their anti-proliferative potency against PC-3, DU-145 and LNCaP human prostate cancer cell lines can be significantly enhanced by the manipulation of the terminal heteroaromatic rings, further demonstrating the utility of 1,7-diarylhepta-1,4,6-trien-3-one as a potential scaffold for the development of anti-prostate cancer agents. The optimal analog 40 is 82-, 67-, and 39-fold more potent than curcumin toward the three prostate cancer cell lines, respectively. The experimental data also reveal that the trienones with two different terminal aromatic rings possess greater potency toward three prostate cancer cell lines, but also have greater capability of suppressing the proliferation of PWR-1E benign human prostate epithelial cells, as compared to the corresponding counterparts with two identical terminal rings and curcumin. The terminal aromatic rings also affect the cell apoptosis perturbation. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Vascular Cell Adhesion Molecule 1, Intercellular Adhesion Molecule 1, and Cluster of Differentiation 146 Levels in Patients with Type 2 Diabetes with Complications.

Science.gov (United States)

Hocaoglu-Emre, F Sinem; Saribal, Devrim; Yenmis, Guven; Guvenen, Guvenc

2017-03-01

Type 2 diabetes mellitus (T2DM) is a multisystemic, chronic disease accompanied by microvascular complications involving various complicated mechanisms. Intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), and cluster of differentiation-146 (CD146) are mainly expressed by endothelial cells, and facilitate the adhesion and transmigration of immune cells, leading to inflammation. In the present study, we evaluated the levels of soluble adhesion molecules in patients with microvascular complications of T2DM. Serum and whole blood samples were collected from 58 T2DM patients with microvascular complications and 20 age-matched healthy subjects. Levels of soluble ICAM-1 (sICAM-1) and soluble VCAM-1 (sVCAM-1) were assessed using enzyme-linked immunosorbent assay, while flow cytometry was used to determine CD146 levels. Serum sICAM-1 levels were lower in T2DM patients with microvascular complications than in healthy controls (Pmolecule levels were not correlated with the complication type. In the study group, most of the patients were on insulin therapy (76%), and 95% of them were receiving angiotensin-converting enzyme (ACE)-inhibitor agents. Insulin and ACE-inhibitors have been shown to decrease soluble adhesion molecule levels via various mechanisms, so we suggest that the decreased or unchanged levels of soluble forms of cellular adhesion molecules in our study group may have resulted from insulin and ACE-inhibitor therapy, as well as tissue-localized inflammation in patients with T2DM. Copyright © 2017 Korean Endocrine Society

Two Distinct Interferon-γ in the Orange-Spotted Grouper (Epinephelus coioides: Molecular Cloning, Functional Characterization, and Regulation in Toll-Like Receptor Pathway by Induction of miR-146a

Directory of Open Access Journals (Sweden)

Wan Peng

2018-02-01

Full Text Available Interferon gamma (IFNγ is a Th1 cytokine that is critical for innate and adaptive immunity. Toll-like receptors (TLRs signaling pathways are critical in early host defense against invading pathogens. miR-146a has been reported to participate in the regulation of host immunity. The known mechanisms of integrations between the IFNγ and TLR signaling pathways are incompletely understood, especially in teleosts. In this study, orange-spotted grouper (Epinephelus coioides IFNγ1 and IFNγ2, their biological activities, especially their involvements in TLR pathway, were explored. We identified and cloned two IFNγ genes of E. coioides, namely EcIFNγ1 and EcIFNγ2. The produced recombinant E. coioides IFNγ1 (rEcIFNγ1 and IFNγ2 (rEcIFNγ2 proteins showed functions, which are similar to those of other bony fishes, such as enhancing nitric oxide responses and respiratory burst response. rEcIFNγ2 could regulate TLR pathway by enhancing the promoter activity of miR-146a upstream sequence and thus increasing the expression level of miR-146a, which possibly targets TNF receptor-associated factor 6 (TRAF6, a key adapter molecule in TLR signaling pathway. Taken together, these findings unravel a novel regulatory mechanism of anti-inflammatory response by IFNγ2, which could mediate TLR pathway through IFNγ2–miR-146a–TRAF6 negative regulation loop. It is suggested that IFNγ2 may provide a promising therapeutic, which may help to fine tune the immune response.

Hyperfine structure and isotope shift of the neutron-rich barium isotopes 139-146Ba and 148Ba

International Nuclear Information System (INIS)

Wendt, K.; Ahmad, S.A.; Klempt, W.; Neugart, R.; Otten, E.W.

1988-01-01

The hyperfine structure and isotope shift in the 6s 2 S 1/2 -6p 2 P 3/2 line of Ba II (455.4 nm) have been measured by collinear fast-beam laser spectroscopy for the neutron-rich isotopes 139-146 Ba and 148 Ba. Nuclear moments and mean square charge radii of these isotopes have been recalculated. The isotope shift of the isotope 148 Ba (T 1/2 = 0.64 s) could be studied for the first time, yielding δ 2 > 138,148 = 1.245(3) fm 2 . (orig.)

Bose-Einstein correlations in Si + Al and Si + Au collisions at 14.6A GeV/c

Science.gov (United States)

Abbott, T.; Akiba, Y.; Beavis, D.; Bloomer, M. A.; Bond, P. D.; Chasman, C.; Chen, Z.; Chu, Y. Y.; Cole, B. A.; Costales, J. B.

1992-01-01

The E802 Spectrometer at the Brookhaven Alternating Gradient Synchrotron has been used to measure the correlation in relative momentum between like-sign pions emitted in central Si + Al and Si + Au collisions at 14.6A GeV/c. Data are presented in terms of the correlation function for both identified pi(-) and pi(+) pairs near the nucleon-nucleon center-of-mass rapidity. All parametrizations of the correlation function are consistent with a spherically symmetric source of rms radius 3.5 +/- 0.4 fm and lifetime fm/c.

A Novel Approach to Reinstating Tolerance in Experimental Autoimmune Myasthenia Gravis Using a Targeted Fusion Protein, mCTA1–T146

Directory of Open Access Journals (Sweden)

Alessandra Consonni

2017-09-01

Full Text Available Reinstating tissue-specific tolerance has attracted much attention as a means to treat autoimmune diseases. However, despite promising results in rodent models of autoimmune diseases, no established tolerogenic therapy is clinically available yet. In the experimental autoimmune myasthenia gravis (EAMG model several protocols have been reported that induce tolerance against the prime disease-associated antigen, the acetylcholine receptor (AChR at the neuromuscular junction. Using the whole AChR, the extracellular part or peptides derived from the receptor, investigators have reported variable success with their treatments, though, usually relatively large amounts of antigen has been required. Hence, there is a need for better formulations and strategies to improve on the efficacy of the tolerance-inducing therapies. Here, we report on a novel targeted fusion protein carrying the immunodominant peptide from AChR, mCTA1–T146, which given intranasally in repeated microgram doses strongly suppressed induction as well as ongoing EAMG disease in mice. The results corroborate our previous findings, using the same fusion protein approach, in the collagen-induced arthritis model showing dramatic suppressive effects on Th1 and Th17 autoaggressive CD4 T cells and upregulated regulatory T cell activities with enhanced IL10 production. A suppressive gene signature with upregulated expression of mRNA for TGFβ, IL10, IL27, and Foxp3 was clearly detectable in lymph node and spleen following intranasal treatment with mCTA1–T146. Amelioration of EAMG disease was accompanied by reduced loss of muscle AChR and lower levels of anti-AChR serum antibodies. We believe this targeted highly effective fusion protein mCTA1–T146 is a promising candidate for clinical evaluation in myasthenia gravis patients.

Bose-Einstein correlation of kaons in Si + Au collisions at 14.6 A GeV/c

Science.gov (United States)

Akiba, Y.; Beavis, D.; Beery, P.; Britt, H. C.; Budick, B.; Chasman, C.; Chen, Z.; Chi, C. Y.; Chu, Y. Y.; Cianciolo, V.

1993-01-01

The E-802 spectrometer at the Brookhaven Alternating Gradient Synchrotron, enhanced by a trigger for selection of events with one or more specified particles, has been used to measure the momentum-space correlation between pairs of K(+)s emitted in central Si + Au collisions at 14.6 A GeV/c. This correlation has been projected onto the Lorentz-invariant relative four-momentum axis. Fits to this correlation function yield a size for the kaon source that is comparable to that found using pi(+) pairs from a similar rapidity range, once a transformation from the particle-pair frames to a single source frame is made.

The role of dysprosium on the structural and magnetic properties of (Nd_1_−_xDy_x)_2Fe_1_4B nanoparticles

International Nuclear Information System (INIS)

Rahimi, Hamed; Ghasemi, Ali; Mozaffarinia, Reza; Tavoosi, Majid

2017-01-01

In current work, Nd2Fe14B nanoparticles was synthesized by sol-gel method. Dysprosium powders were added into Nd2Fe14B nanoparticles by mechanical alloying process in order to enhancement of coercivity. The phase analysis, structure, and magnetic properties of annealed (Nd_1_−_xDy_x)_2Fe_1_4B nanoparticles with different Dy-content (x=0.1, 0.2, 0.3, 0.4, 0.5, 0.6) were investigated by employing X-ray diffraction, X-ray photoelectron spectroscopy, energy dispersive spectroscopy, field emission scanning electron microscope, transmission electron microscope and vibrating sample magnetometer techniques. The results showed that with an increase in Dy amounts, the coercivity of particles increased from 2.9 kOe to 13.4 kOe and then decreased to 5.6 kOe. By adding an optimum amount of Dy (x=0.4), the coercivity was significantly increased from 2.9 kOe to 13.4 kOe. The average particle size of annealed (Nd_1_−_xDy_x)_2Fe_1_4B nanoparticles was below 10 nm. Magnetization reversal studies indicate that the coercivity of milled and annealed (Nd_1_−_xDy_x)_2Fe_1_4B nanoparticles is controlled by the nucleation of reversed magnetic domains. The experimental results in the angular dependence of coercivity for (Nd_1_−_xDy_x)_2Fe_1_4B permanent magnets showed that the normalized coercivity of the permanent magnets H_c(θ)/H_c(0) increases from 1 to about 1.2–1.5 with increasing θ from 0 to about π/3, for x=0.4–0.6. - Highlights: • Dy was added to Nd_2Fe_1_4B nanoparticles to improve the coercivity. • A maximum squareness ratio of 0.99 was obtained. • The average particle size decreased with an increase in Dy-content.

Evaluation of a Panel of Single-Nucleotide Polymorphisms in miR-146a and miR-196a2 Genomic Regions in Patients with Chronic Periodontitis.

Science.gov (United States)

Venugopal, Priyanka; Lavu, Vamsi; RangaRao, Suresh; Venkatesan, Vettriselvi

2017-04-01

Periodontitis is an inflammatory disease caused by bacterial triggering of the host immune-inflammatory response, which in turn is regulated by microRNAs (miRNA). Polymorphisms in the miRNA pathways affect the expression of several target genes such as tumor necrosis factor-α and interleukins, which are associated with progression of disease. The objective of this study was to identify the association between the MiR-146a single nucleotide polymorphisms (SNPs) (rs2910164, rs57095329, and rs73318382), the MiR-196a2 (rs11614913) SNP and chronic periodontitis. Genotyping was performed for the MiR-146a (rs2910164, rs57095329, and rs73318382) and the MiR-196a2 (rs11614913) polymorphisms in 180 healthy controls and 190 cases of chronic periodontitis by the direct Sanger sequencing technique. The strength of the association between the polymorphisms and chronic periodontitis was evaluated using logistic regression analysis. Haplotype and linkage analyses among the polymorphisms was performed. Multifactorial dimensionality reduction was performed to determine epistatic interaction among the polymorphisms. The MiR-196a2 polymorphism revealed a significant inverse association with chronic periodontitis. Haplotype analysis of MiR-146a and MiR-196a2 polymorphisms revealed 13 different combinations, of which 5 were found to have an inverse association with chronic periodontitis. The present study has demonstrated a significant inverse association of MiR-196a2 polymorphism with chronic periodontitis.

Material flow analysis of NdFeB magnets for Denmark: a comprehensive waste flow sampling and analysis approach.

Science.gov (United States)

Habib, Komal; Schibye, Peter Klausen; Vestbø, Andreas Peter; Dall, Ole; Wenzel, Henrik

2014-10-21

Neodymium-iron-boron (NdFeB) magnets have become highly desirable for modern hi-tech applications. These magnets, in general, contain two key rare earth elements (REEs), i.e., neodymium (Nd) and dysprosium (Dy), which are responsible for the very high strength of these magnets, allowing for considerable size and weight reduction in modern applications. This study aims to explore the current and future potential of a secondary supply of neodymium and dysprosium from recycling of NdFeB magnets. For this purpose, material flow analysis (MFA) has been carried out to perform the detailed mapping of stocks and flows of NdFeB magnets in Denmark. A novel element of this study is the value added to the traditionally practiced MFAs at national and/or global levels by complementing them with a comprehensive sampling and elemental analysis of NdFeB magnets, taken out from a sample of 157 different products representing 18 various product types. The results show that the current amount of neodymium and dysprosium in NdFeB magnets present in the Danish waste stream is only 3 and 0.2 Mg, respectively. However, this number is estimated to increase to 175 Mg of neodymium and 11.4 Mg of dysprosium by 2035. Nevertheless, efficient recovery of these elements from a very diverse electronic waste stream remains a logistic and economic challenge.

Scanning Electron Microscope-Cathodoluminescence Analysis of Rare-Earth Elements in Magnets.

Science.gov (United States)

Imashuku, Susumu; Wagatsuma, Kazuaki; Kawai, Jun

2016-02-01

Scanning electron microscope-cathodoluminescence (SEM-CL) analysis was performed for neodymium-iron-boron (NdFeB) and samarium-cobalt (Sm-Co) magnets to analyze the rare-earth elements present in the magnets. We examined the advantages of SEM-CL analysis over conventional analytical methods such as SEM-energy-dispersive X-ray (EDX) spectroscopy and SEM-wavelength-dispersive X-ray (WDX) spectroscopy for elemental analysis of rare-earth elements in NdFeB magnets. Luminescence spectra of chloride compounds of elements in the magnets were measured by the SEM-CL method. Chloride compounds were obtained by the dropwise addition of hydrochloric acid on the magnets followed by drying in vacuum. Neodymium, praseodymium, terbium, and dysprosium were separately detected in the NdFeB magnets, and samarium was detected in the Sm-Co magnet by the SEM-CL method. In contrast, it was difficult to distinguish terbium and dysprosium in the NdFeB magnet with a dysprosium concentration of 1.05 wt% by conventional SEM-EDX analysis. Terbium with a concentration of 0.02 wt% in an NdFeB magnet was detected by SEM-CL analysis, but not by conventional SEM-WDX analysis. SEM-CL analysis is advantageous over conventional SEM-EDX and SEM-WDX analyses for detecting trace rare-earth elements in NdFeB magnets, particularly dysprosium and terbium.

Systematics of (n,t) reactions in medium and heavy mass nuclei at 14.6 MeV

International Nuclear Information System (INIS)

Woo, T.T.

1979-01-01

The production cross sections for (n,t) reactions of 14.6-MeV neutrons with isotopes of the natural elements Ca, Ti, Cr, Fe, Ni, Y, Mo, Pd, Cd, Sn, Pb, La, and with the enriched isotopes 86 Sr, 114 Cd, 130 Te, 205 Tl were measured by the activation technique using high-energy resolution gamma-ray spectrometry. The systematics for the (n,t) reactions were investigated as a function of the relative neutron excess. The experimentally determined values of the cross sections are in good agreement with values calculated by an empirical equation. The cross section ratios (n,t) and (n,p) reactions were calculated on the basis of the statistical model

The estimation of the control rods absorber burn-up during the VVER-1000 operation

Energy Technology Data Exchange (ETDEWEB)

Bolshagin, Sergey N.; Gorodkov, Sergey S.; Sukhino-Khomenko, Evgeniya A. [National Research Centre ' Kurchatov Institute' , Moscow (Russian Federation)

2013-09-15

The isotopic composition of the control rods absorber changes under the neutron flux influence, so the control rods efficiency can decrease. In the VVER-1000 control rods boron carbide and dysprosium titanate are used as absorbing materials. In boric part the efficiency decreases due to the {sup 10}B isotope burn-up. Dysprosium isotopes turn into other absorbing isotopes, so the absorbing properties of dysprosium part decrease to a lesser degree. Also the control rod's shells may be deformed as a consequence of boron carbide radiation swelling. This fact should be considered in substantiation of control rods durability. For the estimation of the control rods absorber burn-up two models are developed: VVER-1000 3-D fuel assembly with control rods partially immersed (imitation of the control rods operation in the working group) and VVER-1000 3-D fuel assembly with control rods, located at the upper limit switch (imitation of the control rods operation in groups of the emergency shutdown system). (orig.)

Cermet electrode

Science.gov (United States)

Maskalick, Nicholas J.

1988-08-30

Disclosed is a cermet electrode consisting of metal particles of nickel, cobalt, iron, or alloys or mixtures thereof immobilized by zirconia stabilized in cubic form which contains discrete deposits of about 0.1 to about 5% by weight of praseodymium, dysprosium, terbium, or a mixture thereof. The solid oxide electrode can be made by covering a substrate with particles of nickel, cobalt, iron, or mixtures thereof, growing a stabilized zirconia solid oxide skeleton around the particles thereby immobilizing them, contacting the skeleton with a compound of praseodymium, dysprosium, terbium, or a mixture thereof, and heating the skeleton to a temperature of at least 500.degree. C. The electrode can also be made by preparing a slurry of nickel, cobalt, iron, or mixture and a compound of praseodymium, dysprosium, terbium, or a mixture thereof, depositing the slurry on a substrate, heating the slurry to dryness, and growing a stabilized zirconia skeleton around the metal particles.

miR-146a C/G polymorphism increased the risk of head and neck cancer, but overall cancer risk: an analysis of 89 studies.

Science.gov (United States)

Sun, Dezhong; Zhang, Xiaoyan; Zhang, Xiaolei

2018-02-28

Several studies have evaluated the association of miR-146a C/G with head and neck cancer (HNC) susceptibility, and overall cancer risk, but with inconclusive outcomes. To drive a more precise estimation, we carried out this meta-analysis. The literature was searched from MEDLINE (mainly PubMed), Embase, the Cochrane Library, and Google Scholar databases to identify eligible studies. A total of 89 studies were included. The results showed that miR-146a C/G was significantly associated with increased HNC risk in dominant model ( I 2 =15.6%, P heterogeneity =0.282, odds ratio (OR) =1.088, 95% confidence interval (CI) =1.002-1.182, P =0.044). However, no cancer risk was detected under all genetic models. By further stratified analysis, we found that rs4919510 mutation contributed to the risk of HNC amongst Asians under homozygote model ( I 2 =0, P heterogeneity =0.541, OR =1.189, 95% CI =1.025-1.378, P =0.022), and dominant model ( I 2 =0, P heterogeneity =0.959, OR =1.155, 95% CI =1.016-1.312, P =0.028). Simultaneously, in the stratified analysis by source of controls, a significantly increased cancer risk amongst population-based studies was found under homozygote model, dominant model, recessive model, and allele comparison model. However, no significant association was found in the stratified analysis by ethnicity and source of control. The results indicated that miR-146a C/G polymorphism may contribute to the increased HNC susceptibility and could be a promising target to forecast cancer risk for clinical practice. However, no significant association was found in subgroup analysis by ethnicity and source of control. To further confirm these results, well-designed large-scale case-control studies are needed in the future. © 2018 The Author(s).

Synthesis and characterization of a family of structurally characterized dysprosium alkoxides for improved fatigue-resistance characteristics of PDyZT thin films.

Science.gov (United States)

Boyle, Timothy J; Bunge, Scott D; Clem, Paul G; Richardson, Jacob; Dawley, Jeffrey T; Ottley, Leigh Anna M; Rodriguez, Mark A; Tuttle, Bruce A; Avilucea, Gabriel R; Tissot, Ralph G

2005-03-07

Using either an ammoniacal route, the reaction between DyCl3, Na0, and HOR in liquid ammonia, or preferentially reacting Dy(N(SiMe3)2)3 with HOR in a solvent, we isolated a family of dysprosium alkoxides as [Dy(mu-ONep)2(ONep)]4 (1), (ONep)2Dy[(mu3-ONep)(mu-ONep)Dy(ONep)(THF)]2(mu-ONep) (2), (ONep)2Dy[(mu3-ONep)(mu-ONep)Dy(ONep)(py)]2(mu-ONep) (3), [Dy3(mu3-OBut)2(mu-OBut3(OBut)4(HOBut)2] (4), [Dy3(mu3-OBut)2(mu-OBut)3(OBut)4(THF)2] (5), [Dy3(mu3-OBut)2(mu-OBut)3(OBut)4(py)2] (6), (DMP)Dy(mu-DMP)4[Dy(DMP)2(NH3)]2 (7), [Dy(eta6-DMP)(DMP)2]2 (8), Dy(DMP)3(THF)3 (9), Dy(DMP)3(py)3 (10), Dy(DIP)3(NH3)2 (11), [Dy(eta6-DIP)(DIP)2]2 (12), Dy(DIP)3(THF)2 (13), Dy(DIP)3(py)3 (14), Dy(DBP)3(NH3) (15), Dy(DBP)3 (16), Dy(DBP)3(THF) (17), Dy(DBP)3(py)2 (18), [Dy(mu-TPS)(TPS2]2 (19), Dy(TPS)3(THF)3 (20), and Dy(TPS)3(py)3 (21), where ONep = OCH2CMe3, OBut) = OCMe3, DMP = OC6H3(Me)(2)-2,6, DIP = OC6H3(CHMe2)(2)-2,6, DBP = OC6H3(CMe3)(2)-2,6, TPS = OSi(C6H5)3, tol = toluene, THF = tetrahydrofuran, and py = pyridine. We were not able to obtain X-ray quality crystals of compounds 2, 8, and 9. The structures observed and data collected for the Dy compounds are consistent with those reported for its other congeners. A number of these precursors were used as Dy dopants in Pb(Zr0.3Ti0.7)O3 (PZT 30/70) thin films, with compound 12 yielding the highest-quality films. The resulting Pb0.94Dy0.04(Zr0.3Ti0.7)O3 [PDyZT (4/30/70)] had similar properties to PZT (30/70), but showed substantial resistance to polarization reversal fatigue.

Steric structure and thermodynamic aspects of Dy3+ complexes with aminobenzoic acids in aqueous solutions

International Nuclear Information System (INIS)

Kondrashina, Yu.G.; Mustafina, A.R.; Vul'fson, S.G.

1994-01-01

Stability and structure of dysprosium(3) aminobenzoate complexes with molar ratios Dy:L 1:1 and 1:2 (HL-aminobenzoic acid) in aqueous solutions are determined on the basis of pH-metric and paramagnetic birefringence data. The increase of conjugation effect in the series of benzoic, meta- ortho-, and para-aminobenzoic acid results in the increase of stability of 1:1 and 1:2 complexes. Features of the structure and coordination of ligands in dysprosium complexes with meta-, ortho-, and para-aminobenzoic acid are considered. 11 refs.; 4 figs.; 2 tabs

Influence of a solvent on thermodynamics of electrolytic dissociation of simple and complex rare earth salts

Energy Technology Data Exchange (ETDEWEB)

Gorodyskij, A.V.; Fialkov, Yu.Ya.; Chernyj, D.B. (AN Ukrainskoj SSR, Kiev. Inst. Obshchej i Neorganicheskoj Khimii; Kievskij Politekhnicheskij Inst. (Ukrainian SSR))

1982-03-01

Influence of the double mixed solvent on thermodynamic characteristics of ionic migration of lanthanum, neodymium, europium and dysprosium chlorides as well as their phenanthroline complexes is considered. Decrease of lambdasub(c) of simple and complex rare earth salts in the lanthanum, neodymium-europium-dysprosium series as explained by increase of solvation degree, associated with lanthanum compression. It is shown that increase of methanol or propanol content results in exothermicity decrease of the ionic migration process. The temperature constituents of enthalpy and entropy of dissociation of the simple and complex rare earth salts are presented.

Scattering of 14.6 MeV neutrons from Fe and evidence for structure in the emitted neutron spectra

International Nuclear Information System (INIS)

Gul, K.; Anwar, M.; Ahmad, M.; Saleem, S.M.; Khan, N.A.

1984-06-01

Structure in the spectra of neutrons emitted from iron on bombardment with 14.6 MeV neutrons has been investigated and explained in terms of excitation of levels in iron 56. The energies of scattered neutrons have been measured by the time-of-flight technique based on the associated particle method. The observed excitations have been correlated with the reported levels in a satisfactory manner. Evidence for new excitations at 8.8 +- 0.02, 9.8 +- 0.1, 10.2 +- 0.1, 12.44 +- 0.03 and 12.52 +- 0.03 MeV has been obtained. The excitation of possible components of Ml giant resonance in iron 56 is discussed. (author)

Applicability of IBAMA normative instruction 146-2007 to pipeline environmental licensing

Energy Technology Data Exchange (ETDEWEB)

Basbaum, Marcos A.; Fonseca, Renata A.A. [Servicos de Engenharia Emilio Baumgart Ltda. (SEEBLA), Rio de Janeiro, RJ(Brazil)], e-mail: mbasbaum.seebla@petrobras.com.br, e-mail: renataamorim.seebla@petrobras.com.br; Torggler, Bianca F.; Fernandes, Renato; Guimaraes, Ricardo Z.P. [Petroleo do Brasil S.A. (PETROBRAS), Rio de Janeiro, RJ (Brazil)], e-mail: torggler@petrobras.com.br, e-mail: renatofer@petrobras.com.br, e-mail: rzaluar@petrobras.com.br

2009-07-01

PETROBRAS has been conducting several wildlife programs in response to environmental licensing requirements from IBAMA (Brazilian environmental agency). Since 2007, IBAMA has been requiring the application of the Normative Instruction n. 146 (NI), which establishes criteria for wildlife management in the influence areas of new enterprises. However, experience from PETROBRAS has shown that many of the NI articles are not applicable to pipelines. Thus, a critical analysis of this NI was done based on data from company's wildlife programs. Our analysis indicated that the main NI items that do not apply to pipelines are: 1 - Animal rescue programs in deforested areas and selection of release areas, 2 - More than two fauna monitoring campaigns a year, 3 - Monitoring programs involving all groups of terrestrial vertebrates and also invertebrate classes. The non-applicability of these items is due to: 1 - The majority of pipelines are built in areas without significant native vegetation or with small fragments only, which are usually in secondary stage of ecological succession. Most pipelines scarcely involve removal of primary vegetation, 2 - Pipelines have an influence area restricted to a range of 800 m and the construction directly affects only strips from 20 m to 30 m, 3 - The most relevant impacts associated with pipelines are temporary, and do not persist during their operation. (author)

Measurement of the Neutron Slowing-Down Time Distribution at 1.46 eV and its Space Dependence in Water

Energy Technology Data Exchange (ETDEWEB)

Moeller, E

1965-12-15

The use of the time dependent reaction rate method for the measurement of neutron slowing-down time distributions in hydrogen has been analyzed and applied to the case of sloping down in water. Neutrons with energies of about 1 MeV were slowed down, and the time-dependent neutron density at 1.46 eV and its space dependence was measured with a time resolution of 0.042 {mu}s. The results confirm the well known theory for time-dependent slowing down in hydrogen. The space dependence of the distributions is well described by the P{sub 1}-calculations by Claesson.

Measurement of the Neutron Slowing-Down Time Distribution at 1.46 eV and its Space Dependence in Water

International Nuclear Information System (INIS)

Moeller, E.

1965-12-01

The use of the time dependent reaction rate method for the measurement of neutron slowing-down time distributions in hydrogen has been analyzed and applied to the case of sloping down in water. Neutrons with energies of about 1 MeV were slowed down, and the time-dependent neutron density at 1.46 eV and its space dependence was measured with a time resolution of 0.042 μs. The results confirm the well known theory for time-dependent slowing down in hydrogen. The space dependence of the distributions is well described by the P 1 -calculations by Claesson

Polymorphisms in STAT-4, IL-10, PSORS1C1, PTPN2 and MIR146A genes are associated differently with prognostic factors in Italian patients affected by rheumatoid arthritis.

Science.gov (United States)

Ciccacci, C; Conigliaro, P; Perricone, C; Rufini, S; Triggianese, P; Politi, C; Novelli, G; Perricone, R; Borgiani, P

2016-11-01

Rheumatoid arthritis (RA) is a systemic autoimmune disease resulting in chronic inflammation of the synovium and consequent cartilage and bone erosion. RA is associated strongly with the presence of rheumatoid factor (RF), and consists of clinical subsets of anti-citrullinated protein antibody (ACPA)-positive and -negative patients. This study was designed to evaluate whether relevant single nucleotide polymorphisms (SNPs) associated with RA and other autoimmune disorders are related to RF, ACPA and clinical phenotype in a cohort of biologic drugs naive Italian RA patients; 192 RA patients and 278 age-matched healthy controls were included. Clinical and laboratory data were registered. We analysed a total of 12 single nucleotide polymorphisms (SNPs) in signal transducer and activator of transcription-4 (STAT-4), interleukin (IL)-10, psoriasis susceptibility 1 candidate 1 (PSORS1C1), protein tyrosine phosphatase, non-receptor type 2 (PTPN2), endoplasmic reticulum aminopeptidase 1 (ERAP1), tumour necrosis factor receptor-associated 3 interacting protein 2 (TRAF3IP2) and microRNA 146a (MIR146A) genes by allelic discrimination assays. Case-control association studies and genotype/phenotype correlation analyses were performed. A higher risk to develop RA was observed for rs7574865 in the STAT-4 gene, while the rs1800872 in the IL-10 gene showed a protective effect. The presence of RF was associated significantly with rs1800872 variant in IL-10, while rs2910164 in MIR146A was protective. ACPA were associated significantly with rs7574865 in STAT-4. The SNP rs2233945 in the PSORS1C1 gene was protective regarding the presence of bone erosions, while rs2542151 in PTPN2 gene was associated with joint damage. Our results confirm that polymorphisms in STAT-4 and IL-10 genes confer susceptibility to RA. For the first time, we described that SNPs in PSORS1C1, PTPN2 and MIR146A genes were associated differently with a severe disease phenotype in terms of autoantibody status and

Polymorphisms in STAT‐4, IL‐10, PSORS1C1, PTPN2 and MIR146A genes are associated differently with prognostic factors in Italian patients affected by rheumatoid arthritis

Science.gov (United States)

Ciccacci, C.; Conigliaro, P.; Rufini, S.; Triggianese, P.; Politi, C.; Novelli, G.; Perricone, R.; Borgiani, P.

2016-01-01

Summary Rheumatoid arthritis (RA) is a systemic autoimmune disease resulting in chronic inflammation of the synovium and consequent cartilage and bone erosion. RA is associated strongly with the presence of rheumatoid factor (RF), and consists of clinical subsets of anti‐citrullinated protein antibody (ACPA)‐positive and ‐negative patients. This study was designed to evaluate whether relevant single nucleotide polymorphisms (SNPs) associated with RA and other autoimmune disorders are related to RF, ACPA and clinical phenotype in a cohort of biologic drugs naive Italian RA patients; 192 RA patients and 278 age‐matched healthy controls were included. Clinical and laboratory data were registered. We analysed a total of 12 single nucleotide polymorphisms (SNPs) in signal transducer and activator of transcription‐4 (STAT‐4), interleukin (IL)‐10, psoriasis susceptibility 1 candidate 1 (PSORS1C1), protein tyrosine phosphatase, non‐receptor type 2 (PTPN2), endoplasmic reticulum aminopeptidase 1 (ERAP1), tumour necrosis factor receptor‐associated 3 interacting protein 2 (TRAF3IP2) and microRNA 146a (MIR146A) genes by allelic discrimination assays. Case‐control association studies and genotype/phenotype correlation analyses were performed. A higher risk to develop RA was observed for rs7574865 in the STAT‐4 gene, while the rs1800872 in the IL‐10 gene showed a protective effect. The presence of RF was associated significantly with rs1800872 variant in IL‐10, while rs2910164 in MIR146A was protective. ACPA were associated significantly with rs7574865 in STAT‐4. The SNP rs2233945 in the PSORS1C1 gene was protective regarding the presence of bone erosions, while rs2542151 in PTPN2 gene was associated with joint damage. Our results confirm that polymorphisms in STAT‐4 and IL‐10 genes confer susceptibility to RA. For the first time, we described that SNPs in PSORS1C1, PTPN2 and MIR146A genes were associated differently with a severe disease

The Politics of Deception and the French Lais in the Roman de Fauvel, Manuscript Paris, Bibliothèque nationale de France, fonds français 146

NARCIS (Netherlands)

Marinescu, R.C.I.

2014-01-01

The interpolated version of the French allegorical satire, the Roman de Fauvel, transmitted in manuscript Paris, Bibliothèque nationale de France, fonds français 146 (produced in Paris ca. 1317), targets the corruption within the French royal court in the last years of the rule of King Philip IV of

Combustion of Corn Stover Bales in a Small 146-kW Boiler

Directory of Open Access Journals (Sweden)

Joey Villeneuve

2011-07-01

Full Text Available Spring harvested corn stover was used for direct combustion in a 146 kW dual chamber boiler designed for wood logs. Stover had a very low moisture content (6.83 ± 0.17%, a gross calorific value (GCV of 18.57 MJ/kg of dry matter (±0.32 MJ/kg DM and an ash content of 5.88% (±1.15%. Small stover bales (8.83 ± 0.90 kg were placed manually in the upper combustion chamber at a rate of 10.5 to 12.8 kg/h over a 24-h period, with three replications, and compared to a control wood combustion trial (12.1 kg/h during 24 h. The overall heat transfer efficiency for stover was lower than for wood (57% vs. 77%. Stover bales produced on average 7.5% ash which included about 2% of unburned residues while wood produced 1.7% ash. CO gas emissions averaged 1324 mg/m³ for stover (118 mg/m³ for wood. The corn stover showed a good calorific potential, but it would have to be densified and the boiler should be modified to improve airflow, completeness of combustion and handling of the large amount of ash formed.

The role of dysprosium on the structural and magnetic properties of (Nd{sub 1−x}Dy{sub x}){sub 2}Fe{sub 14}B nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Rahimi, Hamed; Ghasemi, Ali, E-mail: ali13912001@yahoo.com; Mozaffarinia, Reza; Tavoosi, Majid

2017-02-15

In current work, Nd2Fe14B nanoparticles was synthesized by sol-gel method. Dysprosium powders were added into Nd2Fe14B nanoparticles by mechanical alloying process in order to enhancement of coercivity. The phase analysis, structure, and magnetic properties of annealed (Nd{sub 1−x}Dy{sub x}){sub 2}Fe{sub 14}B nanoparticles with different Dy-content (x=0.1, 0.2, 0.3, 0.4, 0.5, 0.6) were investigated by employing X-ray diffraction, X-ray photoelectron spectroscopy, energy dispersive spectroscopy, field emission scanning electron microscope, transmission electron microscope and vibrating sample magnetometer techniques. The results showed that with an increase in Dy amounts, the coercivity of particles increased from 2.9 kOe to 13.4 kOe and then decreased to 5.6 kOe. By adding an optimum amount of Dy (x=0.4), the coercivity was significantly increased from 2.9 kOe to 13.4 kOe. The average particle size of annealed (Nd{sub 1−x}Dy{sub x}){sub 2}Fe{sub 14}B nanoparticles was below 10 nm. Magnetization reversal studies indicate that the coercivity of milled and annealed (Nd{sub 1−x}Dy{sub x}){sub 2}Fe{sub 14}B nanoparticles is controlled by the nucleation of reversed magnetic domains. The experimental results in the angular dependence of coercivity for (Nd{sub 1−x}Dy{sub x}){sub 2}Fe{sub 14}B permanent magnets showed that the normalized coercivity of the permanent magnets H{sub c}(θ)/H{sub c}(0) increases from 1 to about 1.2–1.5 with increasing θ from 0 to about π/3, for x=0.4–0.6. - Highlights: • Dy was added to Nd{sub 2}Fe{sub 14}B nanoparticles to improve the coercivity. • A maximum squareness ratio of 0.99 was obtained. • The average particle size decreased with an increase in Dy-content.

Extraction spectrophotometric determination of rare earth with trioctylethylammonium bromide and Xylenol Orange

International Nuclear Information System (INIS)

Shijo, Yoshio

1976-01-01

A spectrophotometric method of determination of the rare earth was studied by the solvent extraction of rare earth-Xylenol Orange chelate into xylene solution of trioctylethylammonium bromide(TOEA). The rare earth-XO-TOEA complexes are extracted into aromatic hydrocarbons such as benzene, toluene, and xylene, but not into polar solvents such as n-butanol ethylacetate, methylisobutylketone, and nitrobenzene. The optimum pH range for the extraction were 6.3 -- 6.7, 6.3 -- 6.5, 5.8 -- 6.9, 5.7 -- 6.9, and 5.5 -- 6.8 for lanthanum, praseodymium, cerium, gadolinium, and dysprosium, respectively. The absorption maximum of the complexes extracted into xylene were found at 605 nm for lanthanum, praseodymium, and cerium, 596 nm for gadolinium, and 590 nm for dysprosium. Beer's law held for about 0 -- 4.5 μg of rare earth per 5 ml of xylene. The molar absorptivity of the extracted species were 1.53x10 5 , 1.42x10 5 , 1.35x10 5 , 8.5x10 4 , 8.2x10 4 cm -1 mol -1 l for lanthanum, praseodymium, cerium, gadolinium, and dysprosium, respectively. The composition of the ternary complexes were estimated to be M:XO:TOEA=1:1:2 for gadolinium and dysprosium, whereas 1:2:n for lanthanum, praseodymium and cerium. Combination ratio n of TOEA to metal-XO chelates in the latters could not be estimated by the commonly available methods. Thorium, vanadium, uranium, bismuth, aluminum, zirconium, chromium, nitrate, perchlorate and iodide interfered when triethylenetetramine and 1,10-phenanthroline were added as masking agent. (auth.)

Enhanced E3 Excitations in 144,146Ba and the Evolution of Octupole Collectivity

Science.gov (United States)

Bucher, B.; Zhu, S.; ANL, LLNL, LBNL, INL, UAM, Rochester, Maryland Collaboration

2017-09-01

Recent Coulomb excitation studies on 144,146Ba using the GRETINA-CHICO2 detection system with post-accelerated CARIBU beams have confirmed the existence of enhanced E3 transitions in these isotopes which are centered in a region that has long been predicted to exhibit stable octupole-deformed shapes. Furthermore, the widely-varying E1 strength observed between these isotopes is well-accounted for by models having octupole-deformed potentials, and the variation has been linked to increased occupancies of specific single-particle orbitals in the reflection-asymmetric potential. This talk will summarize the most recent experimental and theoretical results. In addition, data on octupole-related properties in the surrounding isotopes will be discussed in an attempt to better understand the origin and evolution of octupole collectivity in this mass region. This work is supported by the U.S. Department of Energy, Office of Nuclear Physics, under Contract No. DE-AC02-06CH11357 (ANL), DE-AC02-05CH11231 (LBNL, GRETINA), DOE DE-AC52-07NA27344 (LLNL), DE-AC07-05ID14517 (INL), and MINECO (Spain).

A comparative study of superdeformation in 146,147,148Gd. Possible manifestations of the pseudo-SU3 symmetry, octupole shape susceptibility and superdeformed deep-hole excitations

International Nuclear Information System (INIS)

Zuber, K.; Balouka, D.; Beck, F.A.; Byrski, T.; Curien, D.; France, G. de; Duchene, G.; Gehringer, C.; Haas, B.; Merdinger, J.C.; Romain, P.; Santos, D.; Styczen, J.; Vivien, J.P.; Dudek, J.; Szymanski, Z.; Werner, T.R.

1991-01-01

Two discrete superdeformed (SD) bands have been identified in the nucleus 147 Gd and the twin-band mechanism studied by comparison with SD results for 146,148 Gd. Theoretical interprettion in terms of nucleonic orbitals with the Woods-Saxon potential is consistent with the pseudo-spin symmetry picture and the octupole susceptibility mechanism predicted by theory. (orig.)

The (146,147)Sm-(142,143)Nd systematics of early terrestrial differentiation and the lost continents of the early Earth

Science.gov (United States)

Harper, Charles L., Jr.; Jacobsen, Stein B.

1992-01-01

The very early history of the Earth has been one of the great enduring puzzles in the history of geology. We report evidence which clearly can be described as a vestige of a beginning, because the evidence that we report cannot be interpreted in any other way except as a geochemical signal of processes active in the very early history of the Earth. The evidence itself is a very small anomaly in the abundance of SM-146. The primary aims of this study were to: (1) verify the existence of the 'lost continents' of the Hadean era; and (2) determine their mean age.

Scaling properties of charged particle multiplicity distributions in oxygen induced emulsion interactions at 14.6, 60 and 200 A GeV

International Nuclear Information System (INIS)

Adamovich, M.I.; Aggarwal, M.M.; Arora, R.

1988-12-01

The multiplicity distributions of shower particles (n s ) are measured in inclusive inelastic oxygen emulsion interactions. Scaling in observed in the normalized variable n s / ave.(n s ) for 14.6, 60 and 200 A GeV. The dependence of ave. (n s ) on the charge flow in the forward direction (Q ZD ) and the distribution of the number of participating projectile protons is examined. The normalized multiplicities as a function of Q ZD seem also to be independent of incident energies. A comparison with the Lund Model Fritiof yields satisfactory agreement. (authors)

Investigation of nuclei near N = 82 and Z = 64 VIA radioactive decay of high-spin isomers

International Nuclear Information System (INIS)

Toth, K.S.

1979-01-01

An island of very high spin isomers was found recently in neutron-deficient Gd-Lu nuclei near the N = 82 closed shell in (H.I.,xn) measurements. This exciting discovery has led to a large number of experiments trying to identify the structures of these isomers and the nuclei in which they occur. These attempts have been helped in many instances by available spectroscopic information at low excitation energies. A systematic investigation of the low-lying structure of nuclei near N = 82 and Z greater than or equal to 64 was carried out. Heavy-ion beams were used to produce proton-rich isotopes which were then transported, with the use of gas-jet systems, to shielded areas where singles and coincidence γ-ray measurements could be made. Earlier investigations dealt with the decay of terbium ( 146-149 Tb) and dysprosium ( 147-152 Dy) nuclei. During the past two years the research program was extended to holmium nuclides (A less than or equal to 152) produced in 10 B bombardments of samarium. Two new isotopes, 149 Ho and 148 Ho, were identified. The decay data of 21-s 149 Ho supplement in-beam results and locate the hg/ 2 neutron state in 149 Dy to be at 1091 keV. The most intense γ-ray associated with 9-s 148 Ho has an energy of 1688 keV. It is possibly the first-excited to ground-state transition in 148 Dy. Recent in-beam measurements have shown that the first-excited state in 146 Gd is, unespectedly, 3 - in contrast to doubly evenN = 82 nuclei below gadolinium where it is 2 + . It would be interesting to determine whether the 1688-keV level in 148 Dy, the next nucleus in this isotonic series, is 2reverse arrow or 3 - in character. 12 references

Analysis of Patients' X-ray Exposure in 146 Percutaneous Radiologic Gastrostomies.

Science.gov (United States)

Petersen, Tim-Ole; Reinhardt, Martin; Fuchs, Jochen; Gosch, Dieter; Surov, Alexey; Stumpp, Patrick; Kahn, Thomas; Moche, Michael

2017-09-01

Purpose  Analysis of patient´s X-ray exposure during percutaneous radiologic gastrostomies (PRG) in a larger population. Materials and Methods  Data of primary successful PRG-procedures, performed between 2004 and 2015 in 146 patients, were analyzed regarding the exposition to X-ray. Dose-area-product (DAP), dose-length-product (DLP) respectively, and fluoroscopy time (FT) were correlated with the used x-ray systems (Flatpanel Detector (FD) vs. Image Itensifier (BV)) and the necessity for periprocedural placement of a nasogastric tube. Additionally, the effective X-ray dose for PRG placement using fluoroscopy (DL), computed tomography (CT), and cone beam CT (CBCT) was estimated using a conversion factor. Results  The median DFP of PRG-placements under fluoroscopy was 163 cGy*cm 2 (flat panel detector systems: 155 cGy*cm 2 ; X-ray image intensifier: 175 cGy*cm 2 ). The median DLZ was 2.2 min. Intraprocedural placement of a naso- or orogastric probe (n = 68) resulted in a significant prolongation of the median DLZ to 2.5 min versus 2 min in patients with an already existing probe. In addition, dose values were analyzed in smaller samples of patients in which the PRG was placed under CBCT (n = 7, median DFP = 2635 cGy*cm 2 ), or using CT (n = 4, median DLP = 657 mGy*cm). Estimates of the median DFP and DLP showed effective doses of 0.3 mSv for DL-assisted placements (flat panel detector 0.3 mSv, X-ray image converter 0.4 mSv), 7.9 mSv using a CBCT - flat detector, and 9.9 mSv using CT. This corresponds to a factor 26 of DL versus CBCT, or a factor 33 of DL versus CT. Conclusion  In order to minimize X-ray exposure during PRG-procedures for patients and staff, fluoroscopically-guided interventions should employ flat detector systems with short transmittance sequences in low dose mode and with slow image frequency. Series recordings can be dispensed with. The intraprocedural placement of a naso- or orogastric probe

Glass microspheres for medical applications

Science.gov (United States)

Conzone, Samuel David

Radioactive dysprosium lithium borate glass microspheres have been developed as biodegradable radiation delivery vehicles for the radiation synovectomy treatment of rheumatoid arthritis. Once injected into a diseased joint, the microspheres deliver a potent dose of radiation to the diseased tissue, while a non-uniform chemical reaction converts the glass into an amorphous, porous, hydrated dysprosium phosphate reaction product. The non-radioactive, lithium-borate component is dissolved from the glass (up to 94% weight loss), while the radioactive 165Dy reacts with phosphate anions in the body fluids, and becomes "chemically" trapped in a solid, dysprosium phosphate reaction product that has the same size as the un-reacted glass microsphere. Ethylene diamine tetraacetate (EDTA) chelation therapy can be used to dissolve the dysprosium phosphate reaction product after the radiation delivery has subsided. The dysprosium phosphate reaction product, which formed in vivo in the joint of a Sprague-Dawley rat, was dissolved by EDTA chelation therapy in 100 Gy) of localized beta radiation to a treatment site within the body, followed by complete biodegradability. The non-uniform reaction process is a desirable characteristic for a biodegradable radiation delivery vehicle, but it is also a novel material synthesis technique that can convert a glass to a highly porous materials with widely varying chemical composition by simple, low-temperature, glass/solution reaction. The reaction product formed by nonuniform reaction occupies the same volume as the un-reacted glass, and after drying for 1 h at 300°C, has a specific surface area of ≈200 m2/g, a pore size of ≈30 nm, and a nominal crushing strength of ≈10 MPa. Finally, rhenium glass microspheres, composed of micron-sized, metallic rhenium particles dispersed within a magnesium alumino borate glass matrix were produced by sintering ReO2 powder and glass frit at 1050°C. A 50 mg injection of radioactive rhenium glass

Geology of the Terre Adélie Craton (135 – 146˚ E)

Science.gov (United States)

Ménot, R.P.; Duclaux, G.; Peucat, J.J.; Rolland, Y.; Guillot, S.; Fanning, M.; Bascou, J.; Gapais, D.; Pêcher, A.

2007-01-01

More than 15 years of field and laboratory investigations on samples from Terre Adélie to the western part of George Vth Land (135 to 146°E) during the GEOLETA program allow a reassessment of the Terre Adélie Craton (TAC) geology. The TAC represents the largest exposed fragment of the East Antarctic Shield preserved from both Grenville and Ross tectono-metamorphic events. Therefore it corresponds to a well-preserved continental segment that developed from the Neoarchean to the Paleoproterozoic. Together with the Gawler Craton in South Australia, the TAC is considered as part of the Mawson continent, i.e. a striking piece of the Rodinia Supercontinent. However, this craton represents one of the less studied parts of the East Antarctic Shield. The three maps presented here clearly point out the extent of two distinct domains within the Terre Adélie Craton and suggest that the TAC was built up through a polyphased evolution during the Neoarchean-Siderian (c.a. 2.5Ga) and the Statherian (c.a. 1.7Ga) periods. These data support a complete re-assessment of the TAC geology and represent a valuable base for the understanding of global geodynamics changes during Paleoproterozoic times.

Remaining Sites Verification Package for the 100-F-33, 146-F Aquatic Biology Fish Ponds, Waste Site Reclassification Form 2006-021

Energy Technology Data Exchange (ETDEWEB)

L. M. Dittmer

2006-08-25

The 100-F-33, 146-F Aquatice Biology Fish Ponds waste site was an area with six small rectangular ponds and one large circular pond used to conduct tests on fish using various mixtures of river and reactor effluent water. The current site conditions achieve the remedial action objectives specified in the Remaining Sites ROD. The results of verification and applicable confirmatory sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River.

Faraday effect in γ-Dy2S3 and c-Dy2O3 paramagnetic crystals

International Nuclear Information System (INIS)

Shelykh, A.I.

1987-01-01

Studies of spectral and temperature dependences of Faraday effect in γ-Dy 2 S 3 and C-Dy 2 O 3 paramagnetic crystals are conducted. Paramagnetism of these crystals is brought about by Dy 3+ ions. Estimation of the effect of such factors as the value of paramagnetic ion concentration, width of the forbidden band, crystallochemical composition on magnetooptical effect in the considered compounds of dysprosium is carried out on the basis of the obtained experimental data and theoretical analysis. It is shown, that the Faraday effect in the considered compounds of dysprosium as well as the value of paramagnetic moment may be regarded rather accurately in free ion approximation

A comparative study of superdeformation in sup 146,147,148 Gd. Possible manifestations of the pseudo-SU sub 3 symmetry, octupole shape susceptibility and superdeformed deep-hole excitations

Energy Technology Data Exchange (ETDEWEB)

Zuber, K.; Balouka, D.; Beck, F.A.; Byrski, T.; Curien, D.; France, G. de; Duchene, G.; Gehringer, C.; Haas, B.; Merdinger, J.C.; Romain, P.; Santos, D.; Styczen, J.; Vivien, J.P.; Dudek, J.; Szymanski, Z.; Werner, T.R. (Strasbourg-1 Univ., 67 (France). Centre de Recherches Nucleaires)

1991-01-24

Two discrete superdeformed (SD) bands have been identified in the nucleus {sup 147}Gd and the twin-band mechanism studied by comparison with SD results for {sup 146,148}Gd. Theoretical interprettion in terms of nucleonic orbitals with the Woods-Saxon potential is consistent with the pseudo-spin symmetry picture and the octupole susceptibility mechanism predicted by theory. (orig.).

Molecular Gas Reservoirs in Cluster Galaxies at z = 1.46

Science.gov (United States)

Hayashi, Masao; Tadaki, Ken-ichi; Kodama, Tadayuki; Kohno, Kotaro; Yamaguchi, Yuki; Hatsukade, Bunyo; Koyama, Yusei; Shimakawa, Rhythm; Tamura, Yoichi; Suzuki, Tomoko L.

2018-04-01

We present molecular gas reservoirs of 18 galaxies associated with the XMMXCS J2215.9–1738 cluster at z = 1.46. From Band 7 and Band 3 data of the Atacama Large Millimeter/submillimeter Array, we detect dust continuum emission at 870 μm and the CO J = 2–1 emission line from 8 and 17 member galaxies, respectively, within a clustercentric radius of R 200. The molecular gas masses derived from the CO and/or dust continuum luminosities show that the fraction of molecular gas mass and the depletion timescale for the cluster galaxies are larger than expected from the scaling relations of molecular gas on stellar mass and offset from the main sequence of star-forming galaxies in general fields. The galaxies closer to the cluster center in terms of both projected position and accretion phase seem to show a larger deviation from the scaling relations. We speculate that the environment of the galaxy cluster helps feed the gas through inflow to the member galaxies and reduce the efficiency of star formation. The stacked Band 3 spectrum of 12 quiescent galaxies with M stellar ∼ 1011 M ⊙ within 0.5R 200 shows no detection of a CO emission line, giving the upper limit of molecular gas mass and molecular gas fraction to be ≲1010 M ⊙ and ≲10%, respectively. Therefore, the massive galaxies in the cluster core quench the star formation activity while consuming most of the gas reservoirs.

The Cytomegalovirus UL146 Gene Product vCXCL1 Targets Both CXCR1 and CXCR2 as an Agonist

DEFF Research Database (Denmark)

Luttichau, H.R.

2010-01-01

Large DNA viruses, such as herpesvirus and poxvirus, encode proteins that target and exploit the chemokine system of their host. UL146 and UL147 in the cytomegalovirus (CMV) genome encode the two CXC chemokines vCXCL1 and vCXCL2. In this study, vCXCL1 was probed against a panel of the 18 classified...... human chemokine receptors. In calcium mobilization assays vCXCL1 acted as an agonist on both CXCR1 and CXCR2 but did not activate or block any of the other 16 chemokine receptors. vCXCL1 was characterized and compared with CXCL1/GRO alpha, CXCL2/GRO beta, CXCL3/GRO gamma, CXCL5/ENA-78, CXCL6/GCP2, CXCL7...

Early mantle differentiation: constraint from {sup 146}Sm-{sup 142}Nd systematics; Radioactivite eteinte du {sup 146}Sm et differenciation precoce du manteau terrestre

Energy Technology Data Exchange (ETDEWEB)

Caro, G

2005-07-15

We present new ultra-high precision {sup 142}Nd/{sup 144}Nd measurements of early Archaean rocks using the new generation thermal ionization mass spectrometer TRITON. Repeated measurements of the Ames Nd standard demonstrate that the {sup 142}Nd/{sup 144}Nd ratio can be determined with external precision of 2 ppm (2s), allowing confident resolution of anomalies as small as 5 ppm. A major analytical improvement lies in the elimination of the double normalization procedure required to correct our former measurements from a secondary mass fractionation effect. Our new results indicate that metasediments, meta-basalts and orthogneisses from the 3.6 - 3.8 Ga West Greenland craton display positive {sup 142}Nd anomalies ranging from 8 to 15 ppm. Using a simple two-stage model with initial e{sup 143}Nd value of 1.9 {+-} 0.6 e-units, coupled {sup 147}Sm-{sup 143}Nd and {sup 146}Sm-{sup 142}Nd chronometry constrains mantle differentiation to 50 to 200 Ma after formation of the solar system. This chronological constraint is consistent with differentiation of the Earth's mantle during the late stage of crystallization of a magma ocean. We have developed a two-box model describing {sup 142}Nd and {sup 143}Nd isotopic evolution of depleted mantle during the subsequent evolution of the crust-mantle system. Our results indicate that early terrestrial proto-crust had a lifetime of ca. 500 Ma in order to produce the observed Nd isotope signature of Archaean rocks. In the context of this two box mantle-crust system, we model the evolution of isotopic and chemical heterogeneity of depleted mantle as a function of the mantle stirring time. Using the dispersion of {sup 142}Nd/{sup 144}Nd and {sup 143}Nd/{sup 144}Nd ratios observed in early Archaean rocks, we constrain the stirring time of early Earth's mantle to 100 - 150 Ma, a factor of 5 to 10 shorter than stirring time inferred from modern oceanic basalts. (author)

Local particle densities and global multiplicities in central heavy ion interactions at 3.7, 14.6, 60 and 200 A GeV

International Nuclear Information System (INIS)

Adamovich, M.I.; Alexandrov, Y.A.; Aggarwal, M.M.

1992-03-01

The energy and centrality dependence of local particle pseudorapidity densities as well as validity of various parametrizations of the distributions are examined. The dispersion, σ, of the rapidity density distribution of produced particles varies slowly with centrality and is 0.80, 0.98, 1.21 and 1.41 for central interactions at 3.7, 14.6, 60 and 200 A GeV incident energy, respectively. σ is found to be independent of the size of the interacting system at fixed energy. A novel way of representing the window dependence of the multiplicity as normalized variance versus inverse average multiplicity is outlined. (au)

Local particle densities and global multiplicities in central heavy ion interactions at 3.7, 14.6, 60 and 200 A GeV

International Nuclear Information System (INIS)

Adamovich, M.I.; Alexandrov, Y.A.; Chernyavsky, M.M.; Gerassimov, S.G.; Larionova, V.G.; Maslennikova, N.V.; Orlova, G.I.; Peresadko, N.G.; Rappoport, V.M.; Salmanova, N.A.; Tretyakova, M.I.; Aggarwal, M.M.; Arora, R.; Bhatia, V.S.; Mittra, I.S.; Andreeva, N.P.; Anson, Z.V.; Bubnov, V.I.; Chasnikov, I.Y.; Eligbaeva, G.Z.; Eremenko, L.E.; Gaitinov, A.S.; Kalyachkina, G.S.; Kanygina, E.K.; Lepetan, V.N.; Shakhova, T.I.; Avetyan, F.A.; Marutyan, N.A.; Sarkisova, L.G.; Sarkisyan, V.R.; Badyal, S.K.; Bhasin, A.; Gupta, V.K.; Kachroo, S.; Kaul, G.L.; Kitroo, S.; Mangotra, L.K.; Rao, N.K.; Basova, E.; Nasrulaeva, H.; Nasyrov, S.H.; Petrov, N.V.; Qarshiev, D.A.; Trofimova, T.P.; Tuleeva, U.; Bhalla, K.B.; Gupta, S.K.; Kumar, V.; Lal, P.; Lokanathan, S.; Mookerjee, S.; Palsania, H.S.; Raniwala, R.; Raniwala, S.; Bogdanaov, V.G.; Plyushchev, V.A.; Solovjeva, Z.I.; Burnett, T.H.; Grote, J.; Lord, J.; Skelding, D.; Wilkes, R.J.; Chernova, L.P.; Gulamov, K.G.; Lukicheva, N.S.; Navotny, V.S.; Saidkhanov, N.; Shpilev, S.N.; Surin, E.L.; Svechnikova, L.N.; Zhochova, S.I.; Ganssauge, E.R.; Rhee, J.T.; Garpman, S.; Jakobsson, B.; Nystrand, J.; Otterlund, I.; Soederstroem, K.; Stenlund, E.; Heckman, H.H.; Cai, X.; Huang, H.; Liu, L.S.; Qian, W.Y.; Wang, H.Q.; Zhou, D.C.; Judek, B.; Just, L.; Tothova, M.; Karabova, M.; Vokal, S.; Krasnov, S.A.; Kulikova, S.; Maksimkina, T.N.; Shabratova, G.S.; Tolstov, K.D.; Luo, S.B.; Qin, Y.M.; Zhang, D.H.; Weng, Z.Q.; Xia, Y.L.; Xu, G.F.; Zheng, P.Y.

1992-01-01

The energy and centrality dependence of local particle pseudorapidity densities as well as validity of various parameterizations of the distributions are examined. The dispersion, σ, of the rapidity density distribution of produced particles varies slowly with centrality and is 0.80, 0.98, 1.21 and 1.41 for central interactions at 3.7, 14.6, 60 and 200 A GeV incident energy, respectively, σ is found to be independent of the size of the interacting system at fixed energy. A novel, way of representing the window dependence of the multiplicity as normalized variance versus inverse average multiplicity is outlined. (orig.)

Role of hydrogen in Nd–Fe–B sintered magnets with DyH{sub x} addition

Energy Technology Data Exchange (ETDEWEB)

Liu, Pan [State Key Laboratory of Silicon Materials, Department of Materials Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Ma, Tianyu, E-mail: maty@zju.edu.cn [Key Laboratory of Novel Materials for Information Technology of Zhejiang Province, Zhejiang University, Hangzhou 310027 (China); Wang, Xinhua, E-mail: xinhwang@zju.edu.cn [State Key Laboratory of Silicon Materials, Department of Materials Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Zhang, Yujing [State Key Laboratory of Silicon Materials, Department of Materials Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Yan, Mi [State Key Laboratory of Silicon Materials, Department of Materials Science and Engineering, Zhejiang University, Hangzhou 310027 (China); Key Laboratory of Novel Materials for Information Technology of Zhejiang Province, Zhejiang University, Hangzhou 310027 (China)

2015-04-15

Highlights: • DyH{sub 2} and DyH{sub 3} fine powder were prepared. • Effect of DyH{sub x} on the magnetic properties of Nd–Fe–B sintered magnets was studied. • The effect mechanism of Dy hydrides was discussed. • The magnetic properties are greatly improved by DyH{sub 2} and DyH{sub 3} addition. - Abstract: In order to improve the coercivity of Nd–Fe–B sintered magnets, DyH{sub 2} and DyH{sub 3} fine powders were prepared and used as additive for preparing Nd–Fe–B sintered magnets. The effects of DyH{sub x} powders addition on the microstructures and the magnetic properties of the magnets have been investigated. It was found that hydrogen will react with oxygen of NdO{sub x} rich intergranular phases to form Nd rich phases by dysprosium hydride addition. The Nd-rich grain boundary phases are more homogenous and continuous because the volume fraction of Nd-rich grain boundary phases increases with respect to the Nd oxide phases. After desorption, fine dysprosium powders become more active and wrap matrix phases well so that the diffusion of dysprosium to the surface layer of matrix phases is convenient, so dysprosium decreases in grain boundary phases and aggregates in surface layer of matrix phases. Then, intrinsic coercivity of NdFeB sintered magnets is improved from 14.96 kOe to 20.5 kOe and 20.31 kOe by 2.0 wt.% DyH{sub 3} and 2.0 wt.% DyH{sub 2} addition, respectively. This study has shown that DyH{sub x} addition can reduce the content of oxygen in grain boundary phases. This can be an effective method for massive production.

Dependence of ion - photon emission characteristics on the concentration of implanted atoms of the bombarding beam

International Nuclear Information System (INIS)

Belykh, S.F.; Evtukhov, R.N.; Redina, I.V.; Ferleger, V.Kh.

1989-01-01

Results of experiment, where Dy + beams, its spraying products emitting intensively optical radiation with continuous spectrum (CSR), are used for tantalum surface bombardment, are presented. The given experiment allowed one to separate the scattered particle CSR contribution and was conducted under controlled beam n atom concentration on the target surface. E 0 energy and j 0 dysprosium ion flux density made up respectively 3.5 keV and 3x10 5 Axcm -2 . The obtained result analysis has shown that a notable dependence of spectrum type on n value is detected. Dy scattered atoms to not emit CSR. The main contribution to CSR is made by sprayed particles, containing dysprosium atoms

Early mantle differentiation: constraint from 146Sm-142Nd systematics

International Nuclear Information System (INIS)

Caro, G.

2005-07-01

We present new ultra-high precision 142 Nd/ 144 Nd measurements of early Archaean rocks using the new generation thermal ionization mass spectrometer TRITON. Repeated measurements of the Ames Nd standard demonstrate that the 142 Nd/ 144 Nd ratio can be determined with external precision of 2 ppm (2s), allowing confident resolution of anomalies as small as 5 ppm. A major analytical improvement lies in the elimination of the double normalization procedure required to correct our former measurements from a secondary mass fractionation effect. Our new results indicate that metasediments, meta-basalts and orthogneisses from the 3.6 - 3.8 Ga West Greenland craton display positive 142 Nd anomalies ranging from 8 to 15 ppm. Using a simple two-stage model with initial e 143 Nd value of 1.9 ± 0.6 e-units, coupled 147 Sm- 143 Nd and 146 Sm- 142 Nd chronometry constrains mantle differentiation to 50 to 200 Ma after formation of the solar system. This chronological constraint is consistent with differentiation of the Earth's mantle during the late stage of crystallization of a magma ocean. We have developed a two-box model describing 142 Nd and 143 Nd isotopic evolution of depleted mantle during the subsequent evolution of the crust-mantle system. Our results indicate that early terrestrial proto-crust had a lifetime of ca. 500 Ma in order to produce the observed Nd isotope signature of Archaean rocks. In the context of this two box mantle-crust system, we model the evolution of isotopic and chemical heterogeneity of depleted mantle as a function of the mantle stirring time. Using the dispersion of 142 Nd/ 144 Nd and 143 Nd/ 144 Nd ratios observed in early Archaean rocks, we constrain the stirring time of early Earth's mantle to 100 - 150 Ma, a factor of 5 to 10 shorter than stirring time inferred from modern oceanic basalts. (author)

Ultrasound-guided percutaneous transhepatic biliary drainage: Experiences in 146 patients

Energy Technology Data Exchange (ETDEWEB)

Kim, Jai Keun [Sohwa Children' s Hospital, Seoul(Korea, Republic of); Yu, Jeong Sik; Kim, Ki Whang; Chung, Soo Yoon; Jeong, Mi Gyoung [Yonsei University College of Medicine, Seoul (Korea, Republic of); Choi, Deuk Lin; Kwon, Gui Hyang; Lee, Hae Kyung [Soonchunhyang University College of Medicine, Seoul (Korea, Republic of)

1999-03-15

Percutaneous biliary drainage is an important technique for palliative therapy of obstructive biliary disease and diagnostic information. The purpose of this study is to review and evaluate the experiences of ultrasound-guided percutaneous transhepatic biliary drainage. Ultrasound-guided percutaneous transhepatic biliary drainage was performed on 146 occasions in 134 patients. The causes of biliary obstruction were: benign diseases (19 cases, 14.2%) such as bile duct stones or stricture, cholangiocarcinoma (37 cases, 27.6%), pancreatic carcinoma (35 cases, 26.1%), metastasis (22 cases, 16.5%), gall bladder cancer (14 cases, 10.4%), ampulla of Vater cancer (4 cases, 3.0%), hepatocellular carcinoma (3 cases, 2.2%). Retrospectively reviewing medical records, we found out frequency of external or external/internal biliary drainages, puncture of left or right hepatic duct, and presence of bileinfection. Ultrasound-guided percutaneous transhepatic biliary drainage was compared with conventional biliary drainage of previous reports on the basis of frequency of complications. External (124 procedures, 84.9%) and external/internal biliary drainage (22 procedures, 15.1%) were carried out by puncture of dilated right (59.6%) or left (40.4%) intrahepatic duct. Sixty-nine complications occurred in 47 patients. Catheter related complications (33/69, 47.8%) were most common: catheter dislodgement (17/69, 24.6%), malfunction (9/69, 13.1%), leakage (7/69, 10.1%). Other minor complications such as simple fever (16/69, 23.2%), cholangitis (7/69, 10.1%), hemobilia (4/69, 5.8%), biloma (2/69, 2.9%) and wound infection (1/69, 1.5%) occurred. Major complications including sepsis (4/69, 5.8%) and bile peritonitis (2/69, 2.9%) were also noted. Puncture-related complications such as hemobilia, biloma and bile peritonitis occurred in 8 cases (5.5%). Comparing with conventional X-ray guided drainage, ultrasound-guided percutaneous transhepatic biliary drainage is a safe procedure for

Determination of trace amounts of rare earth elements in samarium, terbium and disprosium oxides by graphite furnace atomic-absorption spectrometry

International Nuclear Information System (INIS)

Dantas, E.S.K.

1990-01-01

A graphite furnace atomic-absorption spectrometry method for the determination of neodymium, europium, terbium, dysprosium and yttrium at trace level in samarium oxide; of samarium, europium, dysprosium, holmium, erbium and yttrium in terbium oxide and of europium, terbium, holmium, erbium and yttrium in dysprosium oxide was established. The best pyrolysis and atomization temperatures were determined for each lanthanide considered. Calibration curves were obtained for the pure elements, for binary mixtures formed by the matrix and each of the lanthanides studied and, finally, for the complex mixtures constituted by the matrix and all the other lanthanide of the group under scrutiny. This study has been carried out to examine the interference of the presence of one lanthanide on the behaviour of the other, since a lack of linearity on the calibration curves has been observed in some cases. Detection and determination limits have been determined as well. The detection limits encountered were within the range 0.002 to 0.3% for different elements. The precision of the method expressed as the relative standard deviation was calculated for each element present in each of the matrices studied. The conclusion arrived at is that the method can be applied for determining the above mentioned lanthanides present in the matrices studied with purity up to 99.50%. (author)

Performance assessment of imaging plates for the JHR transfer Neutron Imaging System

Science.gov (United States)

Simon, E.; Guimbal, P. AB(; )

2018-01-01

The underwater Neutron Imaging System to be installed in the Jules Horowitz Reactor (JHR-NIS) is based on a transfer method using a neutron activated beta-emitter like Dysprosium. The information stored in the converter is to be offline transferred on a specific imaging system, still to be defined. Solutions are currently under investigation for the JHR-NIS in order to anticipate the disappearance of radiographic films commonly used in these applications. We report here the performance assessment of Computed Radiography imagers (Imaging Plates) performed at LLB/Orphée (CEA Saclay). Several imaging plate types are studied, in one hand in the configuration involving an intimate contact with an activated dysprosium foil converter: Fuji BAS-TR, Fuji UR-1 and Carestream Flex XL Blue imaging plates, and in the other hand by using a prototypal imaging plate doped with dysprosium and thus not needing any contact with a separate converter foil. The results for these imaging plates are compared with those obtained with gadolinium doped imaging plate used in direct neutron imaging (Fuji BAS-ND). The detection performances of the different imagers are compared regarding resolution and noise. The many advantages of using imaging plates over radiographic films (high sensitivity, linear response, high dynamic range) could palliate its lower intrinsic resolution.

Transverse energy and charged particle multiplicity in 14.6 GeV/c proton-nucleus collisions

International Nuclear Information System (INIS)

Wang, Gang

1995-01-01

Transverse energy and charged particle multiplicity produced in 14.6 GeV/c p + Al and p + Pb collisions have been studied using the E814 set-up at the BNL-AGS. Measurements of dσ/dE T , dE T /dη,dσ/dN c , and dN c /dη are presented. From the present data the mean transverse energy per particle is obtained and it is compared to values observed in Si induced collisions at the same energy In contrast to what is observed in nucleus-nucleus collisions, a very weak correlation is found between the transverse energy and the charged particle multiplicity. These results are compared to the predictions of various theoretical models used to describe heavy-ion collisions. The event generators RQMD and HIJET reproduce well the pseudorapidity distribution of both the transverse energy and charged particle multiplicity, whereas FRITIOF fails to reproduce the measured distributions. Contrary to what had been suggested previously in a Si + A study, the present study shows that the pseudorapidity dependence of charged particle multiplicity distributions do not follow KNO scaling. (author)

Remaining Sites Verification Package for the 100-F-33, 146-F Aquatic Biology Fish Ponds. Attachment to Waste Site Reclassification Form 2006-021

International Nuclear Information System (INIS)

Dittmer, L.M.

2006-01-01

The 100-F-33, 146-F Aquatice Biology Fish Ponds waste site was an area with six small rectangular ponds and one large circular pond used to conduct tests on fish using various mixtures of river and reactor effluent water. The current site conditions achieve the remedial action objectives specified in the Remaining Sites ROD. The results of verification and applicable confirmatory sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River

1-(4-(6-Fluorobenzo [d] isoxazol-3-yl) piperidin-1-yl)-2-(4-(hydroxymethyl)-1H-1,2,3-triazol-1-yl) ethanone: Synthesis, spectroscopic characterization, Hirshfeld surface analysis, cytotoxic studies and docking studies

Science.gov (United States)

Govindhan, M.; Viswanathan, V.; Karthikeyan, S.; Subramanian, K.; Velmurugan, D.

2017-08-01

Compound 1-(4-(6-fluorobenzo[d] isoxazol-3-yl) piperidin-1-yl)-2-(4-(hydroxymethyl)-1H-1, 2,3-triazol-1-yl) ethanone was synthesized in good yield by using click chemistry approach with 2-azido-1-(4-(6-flurobenzo[d]isooxazol-3-yl)piperidin-1-yl)ethanone as a starting material. The synthesized compound was characterized using IR, NMR and MS studies. Thermal stability of the compound was analyzed by using TGA and DSC technique. The single crystal XRD analysis was taken part, to confirm the structure of the compound. The intercontacts in the crystal structure are analyzed using Hirshfeld surfaces computational method. Cytotoxicity of the synthesized compound was evaluated and the results were reported. The binding analysis carried out between the newly synthesized molecule with human serum albumin using fluorescence spectroscopy technique to understand the pharmacokinetics nature of the compound for further biological application. The molecular docking studies were evaluated for the compound to elucidate insights of new molecules in carrier protein.

Study of fractal behaviour of target fragments produced in 28Si and 32S emulsion collisions at 14.6 and 200 AGeV

International Nuclear Information System (INIS)

Rasool, Mir Hashim; Ahmad, Shafiq; Ahmad, M. Ayaz

2013-01-01

The experimental data based on 951 and 380 events of 28 Si-emulsion and 32 S-emulsion interactions at 14.6 and 200 AGeV/c respectively have been analysed to investigate intermittent behaviour and fractal properties of emission spectra of fast and slow target associated particles. The observed increasing trend in the values of fractal moments, Fqcorr and modified Gq-moments with decreasing bin size clearly reflects the evaporation model and gives an evidence for an intermittency pattern of fluctuations. The experimental data have been compared with randomly generated uncorrelated Monte Carlo of 10,000 events to check the presence of the statistical fluctuations in the target fragmentation region

Quantitative Detection of the Foot-And-Mouth Disease Virus Serotype O 146S Antigen for Vaccine Production Using a Double-Antibody Sandwich ELISA and Nonlinear Standard Curves.

Directory of Open Access Journals (Sweden)

Xia Feng

Full Text Available The efficacy of an inactivated foot-and-mouth disease (FMD vaccine is mainly dependent on the integrity of the foot-and-mouth disease virus (FMDV particles. At present, the standard method to quantify the active component, the 146S antigen, of FMD vaccines is sucrose density gradient (SDG analysis. However, this method is highly operator dependent and difficult to automate. In contrast, the enzyme-linked immunosorbent assay (ELISA is a time-saving technique that provides greater simplicity and sensitivity. To establish a valid method to detect and quantify the 146S antigen of a serotype O FMD vaccine, a double-antibody sandwich (DAS ELISA was compared with an SDG analysis. The DAS ELISA was highly correlated with the SDG method (R2 = 0.9215, P<0.01. In contrast to the SDG method, the DAS ELISA was rapid, robust, repeatable and highly sensitive, with a minimum quantification limit of 0.06 μg/mL. This method can be used to determine the effective antigen yields in inactivated vaccines and thus represents an alternative for assessing the potency of FMD vaccines in vitro. But it still needs to be prospectively validated by analyzing a new vaccine preparation and determining the proper protective dose followed by an in vivo vaccination-challenge study to confirm the ELISA findings.

Quantitative Detection of the Foot-And-Mouth Disease Virus Serotype O 146S Antigen for Vaccine Production Using a Double-Antibody Sandwich ELISA and Nonlinear Standard Curves

Science.gov (United States)

Feng, Xia; Ma, Jun-Wu; Sun, Shi-Qi; Guo, Hui-Chen; Yang, Ya-Min; Jin, Ye; Zhou, Guang-Qing; He, Ji-Jun; Guo, Jian-Hong; Qi, Shu-yun; Lin, Mi; Cai, Hu; Liu, Xiang-Tao

2016-01-01

The efficacy of an inactivated foot-and-mouth disease (FMD) vaccine is mainly dependent on the integrity of the foot-and-mouth disease virus (FMDV) particles. At present, the standard method to quantify the active component, the 146S antigen, of FMD vaccines is sucrose density gradient (SDG) analysis. However, this method is highly operator dependent and difficult to automate. In contrast, the enzyme-linked immunosorbent assay (ELISA) is a time-saving technique that provides greater simplicity and sensitivity. To establish a valid method to detect and quantify the 146S antigen of a serotype O FMD vaccine, a double-antibody sandwich (DAS) ELISA was compared with an SDG analysis. The DAS ELISA was highly correlated with the SDG method (R2 = 0.9215, P<0.01). In contrast to the SDG method, the DAS ELISA was rapid, robust, repeatable and highly sensitive, with a minimum quantification limit of 0.06 μg/mL. This method can be used to determine the effective antigen yields in inactivated vaccines and thus represents an alternative for assessing the potency of FMD vaccines in vitro. But it still needs to be prospectively validated by analyzing a new vaccine preparation and determining the proper protective dose followed by an in vivo vaccination-challenge study to confirm the ELISA findings. PMID:26930597

Dysprosium selective potentiometric membrane sensor

Energy Technology Data Exchange (ETDEWEB)

Zamani, Hassan Ali, E-mail: haszamani@yahoo.com [Department of Applied Chemistry, Mashhad Branch, Islamic Azad University, Mashhad (Iran, Islamic Republic of); Faridbod, Farnoush; Ganjali, Mohammad Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)

2013-03-01

A novel Dy(III) ion-selective PVC membrane sensor was made using a new synthesized organic compound, 3,4-diamino-N Prime -((pyridin-2-yl)methylene)benzohydrazide (L) as an excellent sensing element. The electrode showed a Nernstian slope of 19.8 {+-} 0.6 mV per decade in a wide concentration range of 1.0 Multiplication-Sign 10{sup -6}-1.0 Multiplication-Sign 10{sup -2} mol L{sup -1}, a detection limit of 5.5 Multiplication-Sign 10{sup -7} mol L{sup -1}, a short conditioning time, a fast response time (< 10 s), and high selectivity towards Dy(III) ion in contrast to other cations. The proposed sensor was successfully used as an indicator electrode in the potentiometric titration of Dy(III) ions with EDTA. The membrane sensor was also applied to the F{sup -} ion indirect determination of some mouth washing solutions and to the Dy{sup 3+} determination in binary mixtures. Highlights: Black-Right-Pointing-Pointer The novelty of this work is based on the high affinity of the ionophore toward the Dy{sup 3+} ions. Black-Right-Pointing-Pointer This technique is very simple, fast and inexpensive and it is not necessary to use sophisticated equipment. Black-Right-Pointing-Pointer The newly developed sensor is superior to the formerly reported Dy{sup 3+} sensors in terms of selectivity.

Structure, magnetic behavior, and anisotropy of homoleptic trinuclear lanthanoid 8-quinolinolate complexes.

Science.gov (United States)

Chilton, Nicholas F; Deacon, Glen B; Gazukin, Olga; Junk, Peter C; Kersting, Berthold; Langley, Stuart K; Moubaraki, Boujemaa; Murray, Keith S; Schleife, Frederik; Shome, Mahasish; Turner, David R; Walker, Julia A

2014-03-03

Three complexes of the form [Ln(III)3(OQ)9] (Ln = Gd, Tb, Dy; OQ = 8-quinolinolate) have been synthesized and their magnetic properties studied. The trinuclear complexes adopt V-shaped geometries with three bridging 8-quinolinolate oxygen atoms between the central and peripheral eight-coordinate metal atoms. The magnetic properties of these three complexes differ greatly. Variable-temperature direct-current (dc) magnetic susceptibility measurements reveal that the gadolinium and terbium complexes display weak antiferromagnetic nearest-neighbor magnetic exchange interactions. This was quantified in the isotropic gadolinium case with an exchangecoupling parameter of J = -0.068(2) cm(-1). The dysprosium compound displays weak ferromagnetic exchange. Variable-frequency and -temperature alternating-current magnetic susceptibility measurements on the anisotropic cases reveal that the dysprosium complex displays single-molecule-magnet behavior, in zero dc field, with two distinct relaxation modes of differing time scales within the same molecule. Analysis of the data revealed anisotropy barriers of Ueff = 92 and 48 K for the two processes. The terbium complex, on the other hand, displays no such behavior in zero dc field, but upon application of a static dc field, slow magnetic relaxation can be observed. Ab initio and electrostatic calculations were used in an attempt to explain the origin of the experimentally observed slow relaxation of the magnetization for the dysprosium complex.

Late bone and soft tissue sequelae of childhood radiotherapy. Relevance of treatment age and radiation dose in 146 children treated between 1970 and 1997

Energy Technology Data Exchange (ETDEWEB)

Doerr, W. [Technical Univ. of Dresden (Germany). Dept. of Radiotherapy and Radiation Oncology; Medical University / AKH Vienna (Austria). Dept. of Radiation Oncology; Kallfels, S. [Technical Univ. of Dresden (Germany). Dept. of Radiotherapy and Radiation Oncology; Kinder- und Jugendmedizin, Chemnitz [Germany; Herrmann, T. [Technical Univ. of Dresden (Germany). Dept. of Radiotherapy and Radiation Oncology

2013-07-15

Purpose: The present retrospective study was initiated to characterize the effect of oncological treatments in children and adolescents on bone and soft tissues, and to assess their dependence on radiation dose and age at exposure. Patients and methods: The study included 146 patients treated between 1970 and 1997. All patients received external beam radiotherapy to the trunk or extremities, but no cranial irradiation. Median age at treatment was 8.8 years. Patients were screened at 18 years (median time interval since treatment 9.2 years, range 0.9-17.7 years) for pathological changes in the skeletal system and soft tissues (scoliosis, kyphosis, bony hypoplasia, soft tissue defects, asymmetries), which were classified as minor/moderate (grade 1) or substantial (grade 2). Results: Pathological findings were recorded in 75/146 patients (51 %). These were scored as minor in 44 (59 %) and substantial in 31 patients (41 %). Most pathological changes occurred in children treated under the age of 6 years. At 6 years and older, only doses > 35 Gy caused an effect, and no substantial changes were seen for treatment ages exceeding 12 years. Significant effects of radiation dose and age at exposure were observed for kyphoscoliosis (with vertebral body dose gradients < 35 Gy), hypoplasia and soft tissue defects and asymmetrical growth. Conclusion: Tolerance doses of 20 Gy need to be respected for growing bone, particularly in children treated under the age of 6 years. The late treatment sequelae analysed in the present study are largely avoided with the use of current therapeutic protocols. However, the systematic evaluation, documentation and continuous analysis of adverse events in paediatric oncology remains essential, as does the evaluation of novel radio(chemo)therapeutic approaches. (orig.)

Wavelet signatures of K-splitting of the Isoscalar Giant Quadrupole Resonance in deformed nuclei from high-resolution (p,p‧) scattering off 146, 148, 150Nd

Science.gov (United States)

Kureba, C. O.; Buthelezi, Z.; Carter, J.; Cooper, G. R. J.; Fearick, R. W.; Förtsch, S. V.; Jingo, M.; Kleinig, W.; Krugmann, A.; Krumbolz, A. M.; Kvasil, J.; Mabiala, J.; Mira, J. P.; Nesterenko, V. O.; von Neumann-Cosel, P.; Neveling, R.; Papka, P.; Reinhard, P.-G.; Richter, A.; Sideras-Haddad, E.; Smit, F. D.; Steyn, G. F.; Swartz, J. A.; Tamii, A.; Usman, I. T.

2018-04-01

The phenomenon of fine structure of the Isoscalar Giant Quadrupole Resonance (ISGQR) has been studied with high energy-resolution proton inelastic scattering at iThemba LABS in the chain of stable even-mass Nd isotopes covering the transition from spherical to deformed ground states. A wavelet analysis of the background-subtracted spectra in the deformed 146, 148, 150Nd isotopes reveals characteristic scales in correspondence with scales obtained from a Skyrme RPA calculation using the SVmas10 parameterization. A semblance analysis shows that these scales arise from the energy shift between the main fragments of the K = 0 , 1 and K = 2 components.

Operation of resonant-tunneling diodes with strong back injection from the collector at frequencies up to 1.46 THz

International Nuclear Information System (INIS)

Feiginov, Michael; Kanaya, Hidetoshi; Suzuki, Safumi; Asada, Masahiro

2014-01-01

In search for possibilities to increase the operating frequencies of resonant-tunneling diodes (RTDs), we are studying RTDs working in an unusual regime. The collector side of our diodes is so heavily doped that the collector depletion region is fully eliminated in our RTDs and the ground quantum-well subband stays immersed under (or stays close to) the collector quasi-Fermi level. The electron injection from the collector into the RTD quantum well is very strong in our diodes and stays comparable to that from the emitter in the whole range of RTD operating biases. Our RTDs exhibit well pronounced negative-differential-conductance region and peak-to-valley current ratio around 1.8. We demonstrate operation of our diodes in RTD oscillators up to 1.46 THz. We also observe a fine structure in the emission spectra of our RTD oscillators, when they are working in the regime close to the onset of oscillations.

President Barack Obama addresses the 146th annual meeting of the National Academy of Sciences.

Science.gov (United States)

2009-06-16

On April 27, 2009, President Barack Obama addressed members of the National Academy of Sciences (NAS) gathered at its 146th annual meeting in Washington, D.C. In his speech, the president shared his plans to give science and technology a central role in the nation's future and an immediate place in America's economic renewal. He outlined steps he is taking to increase research spending, achieve energy independence, and improve science education. Included was what Mr. Obama cited as the largest commitment to scientific research in American history-devoting more than 3% of our gross domestic product to research and development. "Next, we are restoring science to its rightful place," Mr. Obama told a packed NAS auditorium audience. "Under my administration, the days of science taking a backseat to ideology are over." He appealed to scientists' sense of personal responsibility to reach and educate young Americans: "I want to challenge you to use your love and knowledge of science to spark a sense of wonder and excitement in a new generation." President Obama was welcomed to the National Academy of Sciences by President Ralph J. Cicerone and John P. Holdren, Assistant to the President for Science and Technology and Director of the White House Office of Science and Technology Policy. The following is a transcript of that speech.

Genetic polymorphisms of miR-146a and miR-27a, H. pylori infection, and risk of gastric lesions in a Chinese population.

Directory of Open Access Journals (Sweden)

Ming-yang Song

Full Text Available BACKGROUND: MicroRNAs (miRNAs have been implicated in various human diseases. Single nucleotide polymorphisms (SNPs in inflammation-related miRNA may play an important role in Helicobacter pylori (H. pylori-induced gastric lesions. To evaluate the associations between miRNA SNPs, H. pylori and gastric lesions, a population-based study was conducted in Linqu County, China. METHODOLOGY/PRINCIPAL FINDINGS: Based on serum miRNA array conducted in this population, two SNP loci (miR-146a rs2910164: G>C and miR-27a rs895819: T>C were determined by polymerase chain reaction-restriction fragment length polymorphism in 2,380 participants with diverse gastric lesions. Using participants with superficial gastritis and mild chronic atrophic gastritis as the reference group, we found that rs2910164 CC carriers had a significantly increased risk of intestinal metaplasia [adjusted odds ratio (OR, 1.42; 95% confidence interval (CI, 1.03-1.97] and dysplasia (OR, 1.54; 95% CI, 1.05-2.25 compared to GG carriers, whereas no significant association was observed for rs895819. Stratified analysis by H. pylori infection indicated that rs2910164 C allele was associated with an increased risk of intestinal metaplasia and dysplasia only among individuals infected with H. pylori (CC vs. GG: OR, 1.53; 95% CI, 1.12-2.08, P for trend = 0.004. Participants who simultaneously carried variant alleles and H. pylori infection were more likely to develop intestinal metaplasia and dysplasia, although the interaction between genetic variants and H. pylori infection was not significant (P for interaction = 0.35 for rs2910164 and 0.92 for rs895819. CONCLUSIONS/SIGNIFICANCE: These findings suggest that miR-146a rs2910164 polymorphism may contribute to the evolution of H. pylori-associated gastric lesions in this high-risk population.

Analysis of patients' X-ray exposure in 146 percutaneous radiologic gastrostomies; Analyse der Strahlenexposition fuer Patienten bei 146 perkutanen radiologischen Gastrostomien

Energy Technology Data Exchange (ETDEWEB)

Petersen, Tim-Ole; Reinhardt, Martin; Fuchs, Jochen; Gosch, Dieter; Surov, Alexey; Stumpp, Patrick; Kahn, Thomas; Moche, Michael [Univ. Hospital Leipzig (Germany). Dept. of Diagnostic and Interventional Radiology

2017-09-15

Analysis of patient's X-ray exposure during percutaneous radiologic gastrostomies (PRG) in a larger population. Data of primary successful PRG-procedures, performed between 2004 and 2015 in 146 patients, were analyzed regarding the exposition to X-ray. Dose-area-product (DAP), dose-length-product (DLP) respectively, and fluoroscopy time (FT) were correlated with the used x-ray systems (Flatpanel Detector (FD) vs. Image Itensifier (BV)) and the necessity for periprocedural placement of a nasogastric tube. Additionally, the effective X-ray dose for PRG placement using fluoroscopy (DL), computed tomography (CT), and cone beam CT (CBCT) was estimated using a conversion factor. The median DFP of PRG-placements under fluoroscopy was 163 cGy{sup *}cm{sup 2} (flat panel detector systems: 155 cGy{sup *}cm{sup 2}; X-ray image intensifier: 175 cGy{sup *}cm{sup 2}). The median DLZ was 2.2min. Intraprocedural placement of a naso- or orogastric probe (n=68) resulted in a significant prolongation of the median DLZ to 2.5min versus 2min in patients with an already existing probe. In addition, dose values were analyzed in smaller samples of patients in which the PRG was placed under CBCT (n=7, median DFP=2635 cGy{sup *}cm{sup 2}), or using CT (n=4, median DLP=657mGy{sup *}cm). Estimates of the median DFP and DLP showed effective doses of 0.3mSv for DL-assisted placements (flat panel detector 0.3mSv, X-ray image converter 0.4mSv), 7.9mSv using a CBCT - flat detector, and 9.9mSv using CT. This corresponds to a factor 26 of DL versus CBCT, or a factor 33 of DL versus CT. In order to minimize X-ray exposure during PRG-procedures for patients and staff, fluoroscopically-guided interventions should employ flat detector systems with short transmittance sequences in low dose mode and with slow image frequency. Series recordings can be dispensed with. The intraprocedural placement of a naso- or orogastric probe significantly extends FT, but has little effect on the overall dose of the

Radiative properties of ceramic metal-halide high intensity discharge lamps containing additives in argon plasma

Science.gov (United States)

Cressault, Yann; Teulet, Philippe; Zissis, Georges

2016-07-01

The lighting represents a consumption of about 19% of the world electricity production. We are thus searching new effective and environment-friendlier light sources. The ceramic metal-halide high intensity lamps (C-MHL) are one of the options for illuminating very high area. The new C-MHL lamps contain additives species that reduce mercury inside and lead to a richer spectrum in specific spectral intervals, a better colour temperature or colour rendering index. This work is particularly focused on the power radiated by these lamps, estimated using the net emission coefficient, and depending on several additives (calcium, sodium, tungsten, dysprosium, and thallium or strontium iodides). The results show the strong influence of the additives on the power radiated despite of their small quantity in the mixtures and the increase of visible radiation portion in presence of dysprosium.

Axial segregation in high intensity discharge lamps measured by laser absorption spectroscopy

NARCIS (Netherlands)

Stoffels, W.W.; Flikweert, A.J.; Nimalasuriya, T.; Groothuis, C.H.J.M.; Haverlag, M.; Kroesen, G.M.W.

2005-01-01

HID lamps containing rare earth additives (in our case dysprosium) show color separation because of axial segregation, caused by diffusion and convection. Two-dimensional atomic Dy density profiles are measured by means of laser absorption spectroscopy. The radially resolved atomic density

Remaining Sites Verification Package for the 100-F-52, 146-FR Radioecology and Aquatic Biology Laboratory Soil, Waste Site Reclassification Form 2008-022

Energy Technology Data Exchange (ETDEWEB)

J. M. Capron

2008-06-27

The 100-F-52 waste site consisted of the soil under and around the former 146-FR Radioecology and Aquatic Biology Laboratory. The laboratory was used for studies of the effects of pre-reactor and post-reactor process water on fish eggs, young fish, and other small river creatures of interest. In accordance with this evaluation, the confirmatory sampling results support a reclassification of this site to No Action. The current site conditions achieve the remedial action objectives and the corresponding remedial action goals established in the Remaining Sites ROD. The results of confirmatory sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River.

The association between methacholine challenge test and respiratory symptoms: a study on 146 patients

Directory of Open Access Journals (Sweden)

Paknejad O

2011-02-01

Full Text Available "nBackground: Asthma is a life-threatening disease that can cause death due to bronchospasm. In addition to clinical symptoms such as wheezing, acute paroxysmal dyspnea, chronic cough after exposure to cold air or cough after exercise, spirometry is also necessary for the diagnosis of asthma. The association between respiratory symptoms and a positive methacholine challenge test (MCT is still controversial. The aim of this study was to determine the association between methacholine test results and respiratory symptoms and allergy."n "nMethods: One hundred and forty-six patients with respiratory symptoms and normal baseline pulmonary function tests were enrolled in this cross-sectional study. The participants were divided into two groups according to their positive or negative response to MCT. The association between MCT and the clinical symptoms and allergy was later evaluated statistically."n "nResults: Out of 146 participants of the study 59 (40.4% were female and 87 (59.6% were male. The mean age of the participants was 33.8±13.8 years. Sixty-one patients (41.8% had positive results for the test. There was an association between a history of allergy, wheezing and age with positive MCT results. The other clinical signs had no association with the test."n "nConclusion: Methacholine challenge test is the best diagnostic test for ruling out asthma in patients with normal pulmonary function tests in whom we cannot definitely rule out asthma based solely on clinical symptoms. Nevertheless, in adults with a history of allergy, wheezing and also in patients below 30, the probability for a positive MCT is high.

Enstatite chondrites EL3 as building blocks for the Earth: The debate over the 146Sm-142Nd systematics

Science.gov (United States)

Boyet, M.; Bouvier, A.; Frossard, P.; Hammouda, T.; Garçon, M.; Gannoun, A.

2018-04-01

The 146Sm-142Nd extinct decay scheme (146Sm half-life of 103 My) is a powerful tool to trace early Earth silicate differentiation. Differences in 142Nd abundance measured between different chondrite meteorite groups and the modern Earth challenges the interpretation of the 142Nd isotopic variations found in terrestrial samples because the origin of the Earth and the nature of its building blocks is still an ongoing debate. As bulk meteorites, the enstatite chondrites (EC) have isotope signatures that are the closest to the Earth value with an average small deficit of ∼10 ppm in 142Nd relative to modern terrestrial samples. Here we review all the Nd isotope data measured on EC so far, and present the first measurements on an observed meteorite fall Almahata Sitta containing pristine fragments of an unmetamorphosed enstatite chondrite belonging to the EL3 subgroup. Once 142Nd/144Nd ratios are normalized to a common chondritic evolution, samples from the EC group (both EL and EH) have a deficit in 142Nd but the dispersion is important (μ142 Nd = - 10 ± 12 (2SD) ppm). This scatter reflects their unique mineralogy associated to their formation in reduced conditions (low fO2 or high C/O). Rare-earth elements are mainly carried by the sulfide phase oldhamite (CaS) that is more easily altered than silicates by weathering since most of the EC meteorites are desert finds. The EL6 have fractionated rare-earth element patterns with depletion in the most incompatible elements. Deviations in Nd mass independent stable isotope ratios in enstatite chondrites relative to terrestrial standard are not resolved with the level of analytical precision achieved by modern mass spectrometry techniques. Here we show that enstatite chondrites from the EL3 and EL6 subgroups may come from different parent bodies. Samples from the EL3 subgroup have Nd (μ142 Nd = - 0.8 ± 7.0, 2SD) and Ru isotope ratios undistinguishable from that of the Bulk Silicate Earth. EL3 samples have never been

Paramagnetic metal complexes as potential relaxation agents for NMR imaging

International Nuclear Information System (INIS)

Coroiu, Ilioara; Demco, D. E.; Darabont, Al.; Bogdan, M.

1997-01-01

The development of nuclear magnetic resonance (NMR) imaging technique as a clinical diagnostic modality has prompted the need for a new class of pharmaceuticals. These drugs must be administered to a patient in order to enhance the image contrast between the normal and diseased tissue and/or indicate the status of organ function or blood flow. Paramagnetic compounds are presently undergoing extensive evaluation as contrast agents in magnetic resonance imaging (MRI). These agents increase contrast in MRI by differentially localizing in tissue where they increase the relaxation rates of nearby water protons. The longitudinal R 1 and transverse R 2 relaxivities were measured as a function of molar concentrations for some new paramagnetic complexes like the following: dysprosium, erbium and gadolinium citrates, gadolinium methylene diphosphonate, dysprosium and gadolinium iminodiacetate, manganese para-aminobenzoate and copper nicotinate. The available theoretical approaches for quantitative understanding are presented. (authors)

Dysprosium-free melt-spun permanent magnets

International Nuclear Information System (INIS)

Brown, D N; Wu, Z; He, F; Miller, D J; Herchenroeder, J W

2014-01-01

Melt-spun NdFeB powders can be formed into a number of different types of permanent magnet for a variety of applications in electronics, automotive and clean technology industries. The melt-spinning process produces flake powder with a fine uniform array of nanoscale Nd 2 Fe 14 B grains. These powders can be net-shape formed into isotropic polymer-bonded magnets or hot formed into fully dense magnets. This paper discusses the influence of heavy rare earth elements and microstructure on the magnetic performance, thermal stability and material cost of NdFeB magnets. Evidence indicates that melt-spun nanocrystalline NdFeB magnets are less dependent on heavy rare earth elements for high-temperature performance than the alternative coarser-grained sintered NdFeB magnets. In particular, hot-pressed melt-spun magnets are an attractive low-cost solution for applications that require thermal stability up to 175–200 °C. (paper)

Dysprosium-free melt-spun permanent magnets.

Science.gov (United States)

Brown, D N; Wu, Z; He, F; Miller, D J; Herchenroeder, J W

2014-02-12

Melt-spun NdFeB powders can be formed into a number of different types of permanent magnet for a variety of applications in electronics, automotive and clean technology industries. The melt-spinning process produces flake powder with a fine uniform array of nanoscale Nd2Fe14B grains. These powders can be net-shape formed into isotropic polymer-bonded magnets or hot formed into fully dense magnets. This paper discusses the influence of heavy rare earth elements and microstructure on the magnetic performance, thermal stability and material cost of NdFeB magnets. Evidence indicates that melt-spun nanocrystalline NdFeB magnets are less dependent on heavy rare earth elements for high-temperature performance than the alternative coarser-grained sintered NdFeB magnets. In particular, hot-pressed melt-spun magnets are an attractive low-cost solution for applications that require thermal stability up to 175-200 °C.

The decay of hot dysprosium nuclei

International Nuclear Information System (INIS)

Atac, A.; Rekstad, J.; Guttormsen, M.; Messelt, S.; Ramsoey, T.; Thorsteinsen, T.F.; Loevhoeiden, G.; Roedland, T.

1987-03-01

The γ-decay following the 162,163 Dy( 3 He,αxn) reactions with E 3 He =45 MeV has been studied. Non-statistical γ-radiation with energies of E γ ≅1 MeV and ≅2 MeV is found for various residual nuclei. The properties of these γ-ray bumps depend on the number of emitted neutrons and reveal an odd-even mass dependence. New techniques to extract average neutron energies as a function of excitation energy and of the number of emitted neutrons are employed. The deduced neutron energies are consistent with Fermi-gas model predictions

Accumulation of weak optical signals and spectral memory in InSe single crystals

International Nuclear Information System (INIS)

Abdinov, A.Shj.; Babaeva, R.F.

1995-01-01

Dysprosium alloying effect on the electron and physico-chemical properties of InSe monocrystals is studied. Accumulation of low light signals and spectral or color memory is shown to be observed under certain conditions (temperature, content of admitted impurity, wave length and light intensity)

Analysis of miR-146a and miR-142-3p as Potential Markers of Freshly Isolated or In Vitro-Expanded Human Treg cells

DEFF Research Database (Denmark)

Holmstrøm, K; Pedersen, A E; Gad, M

2017-01-01

Regulatory CD4(+) T cells (Tregs) are pivotal for prevention of autoimmunity. The use of Tregs is therefore of increasing interest in in vitro drug screening assays as well as for a cytotherapy per se against autoimmune disorders. For both purposes, in vitro expansion of peripheral blood Tregs...... in the same markers in activated tTregs as opposed to naïve tTregs. In vitro-expanded Tregs could be identified based on FOXP3 expression, but with loss of a discriminate profile for miRNA candidates and a decline in FOXP3 when activated tTregs were expanded. Our data demonstrate miR-146a and 142-3p...... and cytotherapy as FOXP3 is pivotal for suppressive function....

Radiological re-survey results at 146 West Central Avenue, Maywood, New Jersey (MJ034)

International Nuclear Information System (INIS)

Murray, M.E.; Johnson, C.A.

1994-05-01

Maywood Chemical Works (MCW) of Maywood, New Jersey, generated process wastes and residues associated with the production and refining of thorium and thorium compounds from 1916 to 1959. During the early years of operation, MCW stored wastes and residues in low-lying areas west of the processing facilities and consequently some of the residuals containing radioactive materials migrated offsite to the surrounding area. Subsequently, the U.S. Department of Energy (DOE) designated for remedial action the old MCW property and several vicinity properties. Additionally, in 1984, the property at 146 West Central Ave., Maywood, New Jersey and properties in its vicinity were included as a decontamination research and development project under the DOE Formerly Utilized Sites Remedial Action Program. In 1987 and 1988, at the request of DOE, Oak Ridge National Laboratory (ORNL) conducted a radiological survey on this property. A report describing this survey was published in 1989. A second radiological survey by ORNL was conducted on this property in May 1993 at the request of DOE after an ad hoc radiological survey, requested by the property owner and conducted by Bechtel National, Inc. (BNI), identified some contamination not previously found by ORNL. The purpose of the second ORNL survey was to determine whether radioactive materials from the old MCW were present on the property, and if so, if radioactive materials present were above guidelines. A certified civil survey was requisitioned by ORNL to determine actual property boundaries before beginning the radiological re-survey. The re-survey included a surface gamma scan and the collection of a large number of soil samples for radionuclide analyses. Results of this survey demonstrated that although elevated residual thorium-232 contamination was present in a few isolated spots on the southern end of the backyard, it did not exceed DOE guidelines

Gastrointestinal stromal tumor: analysis of 146 cases of the center of reference of the National Cancer Institute--INCA.

Science.gov (United States)

Linhares, Eduardo; Gonçalves, Rinaldo; Valadão, Marcus; Vilhena, Bruno; Herchenhorn, Daniel; Romano, Sergio; Ferreira, Maria Aparecida; Ferreira, Carlos Gil; Ramos, Cintia de Araujo; de Jesus, José Paulo

2011-01-01

To evaluate the treatment of GIST in INCA. We conducted a retrospective analysis of all cases of GIST treated at INCA in the period from 1997 to 2009. We analyzed 146 patients with a mean age of 44.5 years and female predominance. The main symptom was abdominal pain. We observed the occurrence of a second primary tumor in 22% of cases and 92% of the immunohistochemistry exams were positive for CD117. The most frequent location was in the stomach and the high-risk group was predominant. Surgery was considered R0 (extensive) in 70% of the cases and the main sites of metastases were liver and peritoneum. Overall survival in two and five years was, respectively, 86% and 59%. There was a significant difference between overall survival (p = 0.29) of the high-risk group versus the other. Our patients presented mainly in the form of high-risk disease, with obvious impact on survival. The use of imatinib improved survival of patients with recurrent and metastatic disease. We should study its use in the setting of adjuvant and neoadjuvant therapy to improve results of the high risk group. The creation of reference centers is a need for the study of rare diseases.

The change of the state of an endohedral fullerene by encapsulation into SWCNT: a Raman spectroelectrochemical study of Dy3N@C80 peapods

Czech Academy of Sciences Publication Activity Database

Kalbáč, Martin; Kavan, Ladislav; Zukalová, Markéta; Yang, S.; Čech, J.; Roth, S.; Dunsch, L.

2007-01-01

Roč. 13, - (2007), s. 8811-8817 ISSN 0947-6539 R&D Projects: GA AV ČR KJB400400601; GA MŠk LC510 Institutional research plan: CEZ:AV0Z40400503 Keywords : dysprosium * electrochemistry * fullerenes * nanotubes Subject RIV: CG - Electrochemistry Impact factor: 5.330, year: 2007

Thermal characterization of (U, Dy)O2 pellets

International Nuclear Information System (INIS)

Pelloni, M; Bianchi, L; Pablovich, M.E; Kaufmann, F; Kempf, R

2012-01-01

The thermal diffusivity of (U,Dy)O 2 pellets were determined in the temperature range 250 K to 1600 K measured by the laser flash method. The dependence of thermal with temperature and dysprosium content was studied and found in good agreement with physical models available (author)

Axial segregation in high intensity discharge lamps measured by laser absorption spectroscopy

NARCIS (Netherlands)

Flikweert, A.J.; Nimalasuriya, T.; Groothuis, C.H.J.M.; Kroesen, G.M.W.; Stoffels, W.W.

2005-01-01

High intensity discharge lamps have a high efficiency. These lamps contain rare-earth additives (in our case dysprosium iodide) which radiate very efficiently. A problem is color separation in the lamp because of axial segregation of the rare-earth additives, caused by diffusion and convection. Here

Standard Test Method for Determining Thermal Neutron Reaction Rates and Thermal Neutron Fluence Rates by Radioactivation Techniques

CERN Document Server

American Society for Testing and Materials. Philadelphia

2008-01-01

1.1 The purpose of this test method is to define a general procedure for determining an unknown thermal-neutron fluence rate by neutron activation techniques. It is not practicable to describe completely a technique applicable to the large number of experimental situations that require the measurement of a thermal-neutron fluence rate. Therefore, this method is presented so that the user may adapt to his particular situation the fundamental procedures of the following techniques. 1.1.1 Radiometric counting technique using pure cobalt, pure gold, pure indium, cobalt-aluminum, alloy, gold-aluminum alloy, or indium-aluminum alloy. 1.1.2 Standard comparison technique using pure gold, or gold-aluminum alloy, and 1.1.3 Secondary standard comparison techniques using pure indium, indium-aluminum alloy, pure dysprosium, or dysprosium-aluminum alloy. 1.2 The techniques presented are limited to measurements at room temperatures. However, special problems when making thermal-neutron fluence rate measurements in high-...

Double Solvent for Extracting Rare Earth Concentrate

International Nuclear Information System (INIS)

Bintarti, AN; Bambang EHB

2007-01-01

An extraction process to rare earth concentrate which contain elements were yttrium (Y), lanthanum (La), cerium (Ce), neodymium (Nd), samarium (Sm), gadolinium (Gd) and dysprosium (Dy) which were dissolved in to nitric acid has been done. The experiment of the extraction by double solvent in batch to mix 10 ml of the feed with 10 ml solvent contained the pair of solvent was TBP and TOA, D2EHPA and TOA, TBP and D2EHPA in cyclohexane as tinner. It was selected a right pairs of solvent for doing variation such as the acidity of the feed from 2 - 6 M and the time of stirring from 5 - 25 minutes gave the good relatively extraction condition to Dy element such as using 10 % volume of TOA in D2EHPA and cyclohexane, the acidity of the feed 3 M and the time stirring 15 minutes produced coefficient distribution to dysprosium = 0.586 and separation factor Dy-Ce = ∼ (unlimited); Dy-Nd = 4.651. (author)

Investigations on structural, optical and magnetic properties of Dy-doped zinc ferrite nanoparticles

Science.gov (United States)

Vinosha, P. Annie; Deepapriya, S.; Rodney, John. D.; Das, S. Jerome

2018-04-01

A persuasive and thriftily feasible homogeneous co-precipitation route was adopted to fabricate dysprosium (Dy) doped zinc ferrite (Zn1-xDyxFe2O4)nanoparticles in order to examine their structural, optical and magnetic properties. Theas-synthesized Zn1-xDyxFe2O4 was studied for its momentous applications in photo-degradation of organic Methylene Blue (MB) dye. The paper marksthe connotation of zinc ferrite nanocatalyst in Photo-Fenton degradation. The chemical composition of dysprosium has a decisive feature of this research work. From X-ray diffraction analysis (XRD), spinel phase formation of theas-synthesized Zn1-xDyxFe2O4 nanoparticles was observedand the crystallite size was foundto increase as the doping concentration increased. Theabsorption bands peaked between 600-400 cm-l waspragmatic by Fourier Transform Infrared spectral analysis (FTIR). Transmission Electron Microscopy (TEM) micrograph elucidated the morphology and the speck size of as-synthesized nanoparticles. Surface area and pore size were determined by Brunauer-Emmett-Teller (BET) technique.

Comparative examination of the fresh and spent nuclear TRIGA fuel by neutron radiography

International Nuclear Information System (INIS)

Dinca, M.

2016-01-01

At the Institute for Nuclear Research (INR) there is in operation an underwater (wet) neutron radiography facility (INUM) designed especially for nuclear fuel investigation. INUM was involved in CANDU experimental type and TRIGA type nuclear fuel investigations. In this paper are presented the results after investigation of the nuclear fuel TRIGA-HEU and TRIGA-LEU, fresh and spent, using transfer method with metallic foils of dysprosium and indium and radiographic films (38 cm x 10 cm). This method is the most suitable for spent fuel and offers a high geometrical resolution of the images that subsequently are digitalized with a professional scanner for films. From the images obtained for TRIGA-HEU and TRIGA-LEU with different degree of burn-up there are established the opportunities to use dysprosium or indium converter foils based on their response to thermal or epithermal neutrons to evaluate the degree of burn-up, dimensional measurements, defects etc. (authors)

Negative binomial fits to multiplicity distributions from central collisions of 16O + Cu at 14.6A GeV/c and intermittency

International Nuclear Information System (INIS)

Tannenbaum, M.J.

1994-01-01

An 'intermittency' analysis of charged particle multiplicity data from the target multiplicy array (TMA) in central collisions of 16 O+Cu at 14.6 AxGeV/c has been published by the AGS-E802 collaboration. The centrality cut was made using the Zero degree Calorimeter and requiring that the forward energy be less than one projectile nucleon (i.e. T ZCAL 16 O+Cu collisions is found to exhibit an apparently linear increase with the δη interval, albeit with a much steeper slope than for the other reactions, and a non-zero intercept, k(0)≠0. True intermittency, ξ→0, would occur if the intercept k(0)→0, which is not observed in any experiment. The correlation length for central 16 O+Cu collisions, although smaller than expected, is quite finite and can be measured - which means that a length scale exists in these collisions and therefore there is no intermittency in the multiplicity fluctuations

Chemical ordering around open-volume regions in bulk metallic glass Zr52.5Ti5Al10Cu17.9Ni14.6

International Nuclear Information System (INIS)

Asoka-Kumar, P.; Hartley, J.; Howell, R.; Sterne, P. A.; Nieh, T. G.

2000-01-01

We provide direct experimental evidence for a nonrandom distribution of atomic constituents in Zr 52.5 Ti 5 Al 10 Cu 17.9 Ni 14.6 bulk metallic glass using positron annihilation spectroscopy. The Ti content around the open-volume regions is significantly enhanced at the expense of Ni and Cu. Our results indicate that Ni and Cu atoms closely occupy the volume bounded by their neighboring atoms while Al, Ti, and Zr are less closely packed, and more likely to be associated with the open-volume regions. The overall distribution of elements seen by the positron is not significantly altered by annealing or by crystallization. Theoretical calculations indicate that the observed elemental distribution is not consistent with the known crystalline phases Zr 2 Cu and NiZr 2 , while Al 3 Zr 4 shows some of the characteristics seen in the experiment. (c) 2000 American Institute of Physics

Remaining Sites Verification Package for the 100-F-52, 146-FR Radioecology and Aquatic Biology Laboratory Soil. Attachment to Waste Site Reclassification Form 2008-022

International Nuclear Information System (INIS)

Capron, J.M.

2008-01-01

The 100-F-52 waste site consisted of the soil under and around the former 146-FR Radioecology and Aquatic Biology Laboratory. The laboratory was used for studies of the effects of pre-reactor and post-reactor process water on fish eggs, young fish, and other small river creatures of interest. In accordance with this evaluation, the confirmatory sampling results support a reclassification of this site to No Action. The current site conditions achieve the remedial action objectives and the corresponding remedial action goals established in the Remaining Sites ROD. The results of confirmatory sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River

Material Flow Analysis of NdFeB magnets for Denmark: A comprehensive waste flow sampling and analysis approach

DEFF Research Database (Denmark)

Habib, Komal; Schibye, Peter Klausen; Vestbø, Andreas Peter

2014-01-01

for considerable size and weight reduction in modern applications. This study aims to explore the current and future potential of secondary supply of neodymium and dysprosium from recycling of NdFeB magnets. For this purpose, Material Flow Analysis (MFA) has been carried out to perform the detailed mapping...

Tuning the activity of Pt alloy electrocatalysts by means of the lanthanide contraction

DEFF Research Database (Denmark)

Escribano, Maria Escudero; Malacrida, Paolo; Hansen, Martin Hangaard

2016-01-01

is lanthanum, cerium, samarium, gadolinium, terbium, dysprosium, thulium, or calcium. The materials are among the most active polycrystalline Pt-based catalysts reported, presenting activity enhancement by a factor of 3 to 6 over Pt. The active phase consists of a Pt overlayer formed by acid leaching. The ORR...

Critical resources in clean energy technologies and waste flows

DEFF Research Database (Denmark)

Habib, Komal

is fraught with the risk of shifting the supply security problem from one type of non‐renewable resources (fossil fuels) to another type (metals), in particular the specialty metals such as rare earth elements e.g. neodymium and dysprosium. This PhD work presented an in‐depth analysis of potential resource...

Regulation of the growth and photosynthesis of cherry tomato ...

African Journals Online (AJOL)

The growth and photosynthetic characteristics of cherry tomato seedlings were investigated under seven light irradiations such as dysprosium lamps (white light; control, C), red light emitting diodes (LEDs) (R), blue LEDs (B), orange LEDs (O), green LEDs (G), red and blue LEDs (RB) and red, blue and green LEDs (RBG) ...

A Thermally Actuated Flux Pump for Energizing YBCO Pucks

Science.gov (United States)

2016-05-01

a Hall sensor with an advertised active area of approximately 1.016 mm diameter supplied by Lakeshore was positioned in the centre of the YBCO as...top and the coldhead (green) along the bottom. The brown colour is the light green of the coldhead and the orange of the dysprosium centre

Perovskite catalysts for oxidative coupling

Science.gov (United States)

Campbell, Kenneth D.

1991-01-01

Perovskites of the structure A.sub.2 B.sub.2 C.sub.3 O.sub.10 are useful as catalysts for the oxidative coupling of lower alkane to heavier hydrocarbons. A is alkali metal; B is lanthanide or lanthanum, cerium, neodymium, samarium, praseodymium, gadolinium or dysprosium; and C is titanium.

System, centrality, and transverse mass dependence of two-pion correlation radii in heavy ion collisions at 11.6A and 14.6A GeV/c

International Nuclear Information System (INIS)

Ahle, L.; Baker, M.D.; Cianciolo, V.; Costales, J.B.; Dunlop, J.C.; Heintzelman, G.; Judd, E.; Kehoe, W.L.; Ledoux, R.J.; Morrison, D.P.; Morse, R.J.; Ogilvie, C.A.; Parsons, C.G.; Rothschild, P.; Soltz, R.A.; Steadman, S.G.; Stephans, G.S.F.; Sung, T.W.; Vutsadakis, V.; Woodruff, D.

2002-01-01

Two-pion correlation functions are analyzed at midrapidity for three systems (14.6A GeV/c Si+Al, Si+Au, and 11.6A GeV/c Au+Au), seven distinct centrality conditions, and different k T bins in the range 0.1-0.5 GeV/c. Source reference frames are determined from fits to the Yano-Koonin source parametrization. Bertsch-Pratt radius parameters are shown to scale linearly with both number of projectile and total participants as obtained from a Glauber model calculation. A finite lifetime parameter that increases linearly with system/centrality is also reported. The m T dependences of the Bertsch-Pratt radii for the central Si+Au and central Au+Au systems differ only by an overall normalization factor given by the measured system/centrality dependence

Preparation, Structure Characterization and Thermal Decomposition ...

African Journals Online (AJOL)

NJD

Decomposition Process of the Dysprosium(III) m-Methylbenzoate 1 ... A dinuclear complex [Dy(m-MBA)3phen]2·H2O was prepared by the reaction of DyCl3·6H2O, m-methylbenzoic acid and .... ing rate of 10 °C min–1 are illustrated in Fig. 4.

Influence of organic component on geometry and stability of the Dy(3) complexes with benzoic and aminobenzoic acids in water-80 vol.% DMSO(DMFA) mixtures

International Nuclear Information System (INIS)

Kondrashina, Yu.G.; Mustafina, A.R.; Devyatov, F.V.; Vul'fson, S.G.; Kazanskij Gosudarstvennyj Univ., Kazan

1995-01-01

Data of pH-metric and magnetooptical analyses were used to evaluate stability and structure of benzoate and aminobenzoate dysprosium (3) complexes in water and water - 80 vol.% DMSO (DMFA) mixtures. Factors, dictating change of complex structure and stability when passing from water to organic water solvents, are discussed. 19 refs.; 2 figs.; 1 tab

Field dosimetry on sterilization area of medical-hospitable materials

International Nuclear Information System (INIS)

Mariano, C.S.T.P.; Campos, L.L.

1992-01-01

The calcium sulfate doped with dysprosium, used in high dose dosimetry by electron paramagnetic resonance (EPR), is studied on field dosimetry for medical-hospitable materials sterilization. The calibration curves of EPR signal in function of absorbed dose in air and the thermal decay of EPR signal at room temperature are also presented. (C.G.C)

Excited bands in even-even rare-earth nuclei

International Nuclear Information System (INIS)

Vargas, Carlos E.; Hirsch, Jorge G.

2004-01-01

The energetics of states belonging to normal parity bands in even-even dysprosium isotopes, and their B(E2) transition strengths, are studied using an extended pseudo-SU(3) shell model. States with pseudospin 1 are added to the standard pseudospin 0 space, allowing for a proper description of known excited normal parity bands

Possibility for precise Weinberg-angle measurement in centrosymmetric crystals with axis

Science.gov (United States)

Mukhamedjanov, T. N.; Sushkov, O. P.

2006-03-01

We demonstrate that parity-nonconserving interaction due to the nuclear weak charge QW leads to a nonlinear magnetoelectric effect in centrosymmetric paramagnetic crystals. It is shown that the effect exists only in crystals with special symmetry axis k . Kinematically, the correlation (correction to energy) has the form HPNC∝QWE•[B×k](B•k) , where B and E are external magnetic and electric fields. This gives rise to the magnetic induction MPNC∝QW{k(B•[k×E])+[k×E](B•k)} . To be specific, we consider rare-earth-metal trifluorides and, in particular, dysprosium trifluoride which looks the most suitable for experiment. We estimate the optimal temperature for the experiment to be of a few kelvin. For the magnetic field B=1T and the electric field E=10kV/cm , the expected magnetic induction is 4πMPNC˜0.5×10-11G , six orders of magnitude larger than the best sensitivity currently under discussion. Dysprosium has several stable isotopes, and so comparison of the effects for different isotopes provides the possibility for precise measurement of the Weinberg angle.

Oklo natural reactor. Study of uranium and rare earths migration on a core drilled through a reaction zone. Application to determination of the date of the nuclear reaction by measurement of fission products

International Nuclear Information System (INIS)

Ruffenach, J.C.

1977-01-01

Isotopic and chemical analysis of uranium and five rare earths: neodymium, samarium, europium, gadolinium and dysprosium were effected on fourteen samples taken in the same core drilled through a reaction zone of the Oklo uranium deposit. This study points out the general stability of uranium and fission rare earths; spatial distributions of these elements are quite analogous. Migrations have affected about 5% only of fission neodymium in the core of the reaction zone; corresponding values for samarium and gadolinium are slightly higher. These migration phenomena have carried rare earths to no more than 80 cm out of the core. By study of the europium it is shown that nuclear reactions have stayed in the ground since the time of reactions. On the other hand it is shown by analysis of the dysprosium that rare earths have not undergone an important movement. This study allow also the datation of nuclear reactions from the measurement of the quantity of fission neodymium produced. A value of 1.98x10 9 years is obtained slightly higher than the value obtained by geochronology [fr

Isothermal sections at 500 deg C of the Dy-V-Al and Dy-Cr-Al systems in the aluminium rich regions

International Nuclear Information System (INIS)

Rykhal', R.M.; Zarechnyuk, O.S.; Mats'kiv, O.P.

1979-01-01

X-ray diffraction and microscopic analyses have been used to investigate the ternary system dysprosium-vanadium-aluminium in the aluminium rich region. In the system Dy-V-Al two ternary compounds have been found: DyV 2 Al 20 (cubic structure, CeCr 2 Al 20 type, a=14.54 A and approximately DyVAl 8 (hexagonal crystal system, structure unknown, a=10.86, c=17.71 A, c/a=1.631). In the system dysprosium-chromium-aluminium three ternary compounds have been found: DyCr 2 Al 20 (cubic structure, CeCr 2 Al 20 type, a=14.39), approximately equal to DyCrAl 8 ) hexagonal crystal system, structure type unkown a=10.75, c=17.60 A, c/a=1.637) and DyCr 4 Al 8 (tetragonal structure, CeMn 4 Al 8 type, a=8.87, c=5.04 A, c/a=0.568). Isothermal sections of the systems Dy-V-Al and Dy-Cr-Al have been plotted at 500 deg C

Microscopic study of neutron-rich dysprosium isotopes

International Nuclear Information System (INIS)

Vargas, Carlos E.; Velazquez, Victor; Lerma, Sergio

2013-01-01

Microscopic studies in heavy nuclei are very scarce due to large valence spaces involved. This computational problem can be avoided by means of the use of symmetry-based models. Ground-state, γ and β bands, and their B(E2) transition strengths in 160-168 Dy isotopes, are studied in the framework of the pseudo-SU(3) model which includes the preserving symmetry Q . Q term and the symmetry-breaking Nilsson and pairing terms, systematically parametrized. Additionally, three rotor-like terms are considered, whose free parameters, fixed for all members of the chain, are used to fine tune the moment of inertia of rotational bands and the band head of γ and β bands. The model succesfully describes in a systematic way rotational features in these nuclei and allows to extrapolate toward the midshell nucleus 170 Dy. The results presented show that it is possible to study a full chain of isotopes or isotones in the region with the present model. (orig.)

Microscopic study of neutron-rich dysprosium isotopes

Energy Technology Data Exchange (ETDEWEB)

Vargas, Carlos E. [Universidad Veracruzana, Facultad de Fisica e Inteligencia Artificial, Xalapa (Mexico); Universidad Nacional Autonoma de Mexico, Facultad de Ciencias, Apartado Postal 70-542, Mexico D.F. (Mexico); Velazquez, Victor [Universidad Nacional Autonoma de Mexico, Facultad de Ciencias, Apartado Postal 70-542, Mexico D.F. (Mexico); Lerma, Sergio [Universidad Veracruzana, Facultad de Fisica e Inteligencia Artificial, Xalapa (Mexico)

2013-01-15

Microscopic studies in heavy nuclei are very scarce due to large valence spaces involved. This computational problem can be avoided by means of the use of symmetry-based models. Ground-state, {gamma} and {beta} bands, and their B(E2) transition strengths in {sup 160-168}Dy isotopes, are studied in the framework of the pseudo-SU(3) model which includes the preserving symmetry Q . Q term and the symmetry-breaking Nilsson and pairing terms, systematically parametrized. Additionally, three rotor-like terms are considered, whose free parameters, fixed for all members of the chain, are used to fine tune the moment of inertia of rotational bands and the band head of {gamma} and {beta} bands. The model succesfully describes in a systematic way rotational features in these nuclei and allows to extrapolate toward the midshell nucleus {sup 170}Dy. The results presented show that it is possible to study a full chain of isotopes or isotones in the region with the present model. (orig.)

Nonlinear elastic properties of bulk metallic glasses Zr52.5Ti5Cu17.9Ni14.6Al10 and Pd40Cu30Ni10P20

International Nuclear Information System (INIS)

Kobelev, N.P.; Kolyvanov, E.L.; Khonik, V.A.

2005-01-01

The influence of uniaxial compression on the propagation of ultrasonic vibrations in Zr 52.5 Ti 5 Cu 17.9 Ni 14.6 Al 10 and Pd 40 Cu 30 Ni 10 P 20 bulk metallic glasses produced by melt quenching at a rate of 100 K/s is investigated. Elastic deformation was realized by compression of the samples along their long axis up to strains of about 1 GPa. Deriving of major ratios used during the calculation of the third-order elastic moduli of the glasses is described in brief, the results of the calculations being provided. A qualitative agreement between the calculated results and available data on the influence of the uniform pressure on the sound wave propagation rate was obtained [ru

High Harvest Yield, High Expansion, and Phenotype Stability of CD146 Mesenchymal Stromal Cells from Whole Primitive Human Umbilical Cord Tissue

Directory of Open Access Journals (Sweden)

Rebecca C. Schugar

2009-01-01

Full Text Available Human umbilical cord blood is an excellent primitive source of noncontroversial stem cells for treatment of hematologic disorders; meanwhile, new stem cell candidates in the umbilical cord (UC tissue could provide therapeutic cells for nonhematologic disorders. We show novel in situ characterization to identify and localize a panel of some markers expressed by mesenchymal stromal cells (MSCs; CD44, CD105, CD73, CD90 and CD146 in the UC. We describe enzymatic isolation and purification methods of different UC cell populations that do not require manual separation of the vessels and stroma of the coiled, helical-like UC tissue. Unique quantitation of in situ cell frequency and stromal cell counts upon harvest illustrate the potential to obtain high numerical yields with these methods. UC stromal cells can differentiate to the osteogenic and chondrogenic lineages and, under specific culturing conditions, they exhibit high expandability with unique long-term stability of their phenotype. The remarkable stability of the phenotype represents a novel finding for human MSCs, from any source, and supports the use of these cells as highly accessible stromal cells for both basic studies and potentially therapeutic applications such as allogeneic clinical use for musculoskeletal disorders.

Test plan for air monitoring during the Cryogenic Retrieval Demonstration

International Nuclear Information System (INIS)

Yokuda, E.

1992-06-01

This report presents a test plan for air monitoring during the Cryogenic Retrieval Demonstration (CRD). Air monitors will be used to sample for the tracer elements neodymium, terbium, and ytterbium, and dysprosium. The results from this air monitoring will be used to determine if the CRD is successful in controlling dust and minimizing contamination. Procedures and equipment specifications for the test are included

Thermodynamics of ionic migration of simple and complex rare earth salts in mixed alcohol solvents

International Nuclear Information System (INIS)

Gorodyskij, A.V.; Fialkov, Yu.Ya.; Chernyj, D.B.

1982-01-01

The influence of the composition of double mixed solvents (water-methanol and methanol-propanol) on thermodynamic characteristics of electrolytic dissociation process-enthalpy and entropy, dissociation constants of chlorides and diphenanthroline chlorides of lanthanum, neodymium, europium and dysprosium, is analyzed. It is shown that when passing from water to methanol, that is, with decrease of dielectric permeability, the endothermicity of electrolytic dissociation process increases

Thermodynamics of ionic migration of simple and complex rare earth salts in mixed alcohol solvents

Energy Technology Data Exchange (ETDEWEB)

Gorodyskij, A.V.; Fialkov, Yu.Ya.; Chernyj, D.B. (AN Ukrainskoj SSR, Kiev. Inst. Obshchej i Neorganicheskoj Khimii; Kievskij Politekhnicheskij Inst. (Ukrainian SSR))

1982-04-01

The influence of the composition of double mixed solvents (water-methanol and methanol-propanol) on thermodynamic characteristics of electrolytic dissociation process-enthalpy and entropy, dissociation constants of chlorides and diphenanthroline chlorides of lanthanum, neodymium, europium and dysprosium, is analyzed. It is shown that when passing from water to methanol, that is, with decrease of dielectric permeability, the endothermicity of electrolytic dissociation process increases.

Characterization and Luminescence Properties of Color-Tunable Dy3+-Doped BaY2ZnO5 Nanophosphors

Science.gov (United States)

Sonika; Khatkar, S. P.; Khatkar, Avni; Kumar, Rajesh; Taxak, V. B.

2015-01-01

Dy3+-doped BaY2ZnO5 nanophosphors were successfully synthesized by use of a solution combustion process. The effects of sintering temperature and dysprosium concentration on the structural and luminescence characteristics of the phosphors were investigated. X-ray diffraction (XRD) analysis confirmed the formation of pure orthorhombic BaY2ZnO5 with the space group Pbnm at 1100°C. Morphological investigation revealed spherical nanoparticles with smooth surfaces. The luminescence features of the nanophosphor were studied by use of photoluminescence excitation (PLE) and photoluminescence emission (PL), with luminescence decay curves and color ( x, y) coordinates. On excitation at 355 nm, BaY2ZnO5 nanophosphor doped with trivalent dysprosium ion emits white light as a mixture of blue (4F9/2 → 6H15/2) and yellow (4F9/2 → 6H13/2) emission. Concentration quenching is explained on the basis of cross-relaxation between intermediate Dy3+ states. Thus, BaY2ZnO5:Dy3+ nanophosphor may be suitable for producing efficient white light for ultraviolet-light-emitting diodes (UV-LEDs), fluorescent lamps, and a variety of optical display panels.

Magnesium borate radiothermoluminescent detectors

International Nuclear Information System (INIS)

Kazanskaya, V.A.; Kuzmin, V.V.; Minaeva, E.E.; Sokolov, A.D.

1974-01-01

In the report the technology of obtaining polycrystalline magnesium borate activated by dysprosium is described briefly and the method of preparing the tabletted detectors from it is presented. The dependence of the light sum of the samples on the proportion of the components and on the sintering regime has shown that the most sensitive material is obtained at the proportion of boric anhydride and magnesium oxide 2.2-2.4 and at the dysprosium concentration about 1 milligram-atom per gram molecule of the base. The glow curve of such a material has a simple form with one peak the maximum of which is located at 190-200 0 C. The measurement of the main dosimetric characteristics of the magnesium borate tabletted detectors and the comparison with similar parmaeters of the lithium fluoride tabletted detectors have shown that at practically identical effective number the former detectors have the following substantial advantages: the sensitivity is ten-twenty times as large, they are substantially more technological on synthesis of the radiothermoluminophor and during the production of the tabletted detectors, they have a simple glow curve, they do not require the utilization of the thermocycling during the use. (author)

Effect of NaFeEDTA-fortified soy sauce on zinc absorption in children.

Science.gov (United States)

Li, Min; Wu, Jinghuan; Ren, Tongxiang; Wang, Rui; Li, Weidong; Piao, Jianhua; Wang, Jun; Yang, Xiaoguang

2015-03-01

NaFeEDTA has been applied in many foods as an iron fortificant and is used to prevent iron deficiency in Fe-depleted populations. In China, soy sauce is fortified with NaFeEDTA to control iron deficiency. However, it is unclear whether Fe-fortified soy sauce affects zinc absorption. To investigate whether NaFeEDTA-fortified soy sauce affects zinc absorption in children, sixty children were enrolled in this study and randomly assigned to three groups (10 male children and 10 female children in each group). All children received daily 3 mg of (67)Zn and 1.2 mg of dysprosium orally, while the children in the three groups were supplemented with NaFeEDTA-fortified soy sauce (6 mg Fe, NaFeEDTA group), FeSO₄-fortified soy sauce (6 mg Fe, FeSO₄ group), and no iron-fortified soy sauce (control group), respectively. Fecal samples were collected during the experimental period and analyzed for the Zn content, (67)Zn isotope ratio and dysprosium content. The Fe intake from NaFeEDTA-fortified and FeSO₄-fortified groups was significantly higher than that in the control group (P sauce does not affect Zn bioavailability in children.

Synthesis of NCA 11,17β-dihydroxy-6-methyl-17α-(3-[18F]fluoroprop-1-ynyl)androsta-1,4,6-trien-3-one as a potential glucocorticoid receptor ligand for neuro-PET studies

International Nuclear Information System (INIS)

DaSilva, J.N.; Crouzel, C.

1990-01-01

Glucocorticoids appear to exert physiologic, biochemical and behavioral effects on the central nervous system (1). The presence of glucocorticoid binding sites have been demonstrated in human brain by autoradiographic studies (2). In order to visualize the brain glucocorticoid binding sites by PET, the authors have synthesized n.c.a. 11,17β-dihydroxy-6-methyl-17α-(3-[ 18 F]fluoroprop-1-ynyl)androsta-1,4,6-trien-3-one, a fluorine-18 analog of the selective type II glucocorticoid receptor agonist RU 28362 (3). Biodistribution studies in mature male rats and in vivo distribution of 2 by PET on a baboon are in progress

Cross sections for Discrete γ ray production in interactions of 14.6 MeV neutrons with light and medium heavy nuclei

International Nuclear Information System (INIS)

Hlavac, S.; Benovic, M.; Betak, E.; Dostal, L.; Turzo, I.; Simakov, S.P.

1999-01-01

We measured cross section of prompt discrete γ ray transitions produced in 14.6 MeV neutron interactions with 23 Na, 27 Al, 28 Si, 31 P 39 K, 51 V, 55 Mn and nat Mo. Cross sections were measured relative to reference cross sections with low uncertainties using a dedicated experimental setup with a 244 cm 3 HPGe photon detector and associated α particle timing. In addition to photons from inelastic scattering we observed discrete transitions from (n,p), (n,n'p), (n,α), and (n,2n) reactions. Discrete γ transitions in 28 Si(n,n'p) 27 Al, the majority of transitions in Mn+n, and all transitions in Mo+n reactions were observed for the first time. Where available, our experimental data are compared with existing data. This comparison shows that existing data are in disagreement with present data in many cases, a finding which stresses the necessity of standardization of measurement procedure. For some reactions we compared our results with statistical model predictions, calculated with the advanced code GNASH as well as with a technically simpler code DEGAS, developed in our lab. In several instances, mostly in reactions where only a single nucleon is emitted, the statistical model calculations describe the observed cross sections well. In other cases, where several nucleons are emitted sequentially or in a cluster, the agreement is less satisfactory. (author)

The study of heat conductivity properties of GdS1.48 and DyS1.48

International Nuclear Information System (INIS)

Ahmadov, O.R.

2009-01-01

The heat conductivity properties of sulfides of gadolinium and dysprosium up to 900 K with use of the average speed of ultrasound distribution, a specific thermal capacity and Viderman-Frans law have been investigated. The value of Debay temperature, thermal extension coefficient and the temperature dependence are established. It is shown that the scattering on crystal lattice phonons plays the main role in lattice heat conductivity

An application of neutron radiography to archaeology

International Nuclear Information System (INIS)

Tugrul, B.

1990-01-01

Neutron radiography is more useful for certain materials than are the other radiographic techniques. Some neutrons are attenuated by light materials such as water, hydrocarbons and boron, but penetrate through heavy materials such as steel, lead and uranium. The object must be irradiated by neutrons for neutron radiography. The neutron irradiation can take place in a reactor or with a neutron source. The transfer technique relies on the build-up of radioactivity in a foil due to neutron absorption. In this way an activation image is formed in the foil. For this technique, dysprosium ( 164 Dy) and indium ( 115 In) foils can be used. After this irradiation, foils are transferred to a film in the dark-room, the latent image being formed in the film by decay radiation from the foil. The neutron radiography technique has been applied to a sword together with its sheath (inventory number 83/173) (Tugrul and Erdal 1987); a piece of cloth was visible on the handle of the sword. Sword and sheath had become corroded together. The artefact is from the Ikiztepe excavation near the city of Samsun in north Anatolia and belongs to the Early Bronze Age. First, X-ray radiography showed that the sword had been destroyed in large part and was not suitable for conservation and restoration procedures. Second, neutron radiography was carried out. Dysprosium-164 was used for the transfer method as a foil screen and irradiated in the reactor at 100 kW for half an hour. The dysprosium foil remained against the radiographic (Structurix, D-7) film for approximately three half-lives after the irradiation. The neutron radiograph shows the cloth layer continuing towards the bottom of the sheath. Through the cloth, water would have been introduced to the inside of the sheath and this was the main cause of corrosion to the artefact and so of the sword's destruction. (author)

Calorimetric investigation of an yttrium-dysprosium spin glass

International Nuclear Information System (INIS)

Wenger, L.E.

1978-01-01

In an effort to compare the spin glass characteristics of yttrium--rare earth alloys with those of the noble-metal spin glasses, the susceptibility and heat capacity of Y/sub 0.98/Dy/sub 0.02/ have been measured in the temperature range 2.5--40 K. The low-field ac susceptibility measurement shows the characteristic cusp-like peak at 7.64 K. The magnetic specific heat of the same sample shows a peak at 7.0 K and may be qualitatively described as a semi-cusp. The magnetic entropy change from absolute zero to 7 K is approximately 0.52 of cR ln(2J+1). These results are qualitatively different than previous calorimetric results on the archetypal spin glasses, AuFe and CuMn, where rounded maxima are observed at temperatures above the spin glass transition temperatures

Photodissociation spectroscopy of the dysprosium monochloride molecular ion

Energy Technology Data Exchange (ETDEWEB)

Dunning, Alexander, E-mail: alexander.dunning@gmail.com; Schowalter, Steven J.; Puri, Prateek; Hudson, Eric R. [Department of Physics and Astronomy, University of California, Los Angeles, California 90095 (United States); Petrov, Alexander; Kotochigova, Svetlana [Department of Physics, Temple University, Philadelphia, Pennsylvania 19122 (United States)

2015-09-28

We have performed a combined experimental and theoretical study of the photodissociation cross section of the molecular ion DyCl{sup +}. The photodissociation cross section for the photon energy range 35 500 cm{sup −1} to 47 500 cm{sup −1} is measured using an integrated ion trap and time-of-flight mass spectrometer; we observe a broad, asymmetric profile that is peaked near 43 000 cm{sup −1}. The theoretical cross section is determined from electronic potentials and transition dipole moments calculated using the relativistic configuration-interaction valence-bond and coupled-cluster methods. The electronic structure of DyCl{sup +} is extremely complex due to the presence of multiple open electronic shells, including the 4f{sup 10} configuration. The molecule has nine attractive potentials with ionically bonded electrons and 99 repulsive potentials dissociating to a ground state Dy{sup +} ion and Cl atom. We explain the lack of symmetry in the cross section as due to multiple contributions from one-electron-dominated transitions between the vibrational ground state and several resolved repulsive excited states.

Influence of dysprosium addition on the structural, morphological ...

Indian Academy of Sciences (India)

Microwave absorption properties of hexaferrite (70 wt%)–acrylic resin. (30 wt%) composites ... the RE ions were substituted for Sr (Ba) or Fe, taking into accounts the .... general the RE substitutions weaken the super exchange interactions ...

75 FR 27419 - Airworthiness Directives; BAE Systems (Operations) Limited Model BAe 146 and Avro 146-RJ70A, 146...

Science.gov (United States)

2010-05-17

... visual inspection and a visual inspection; Method 2 is a detailed visual inspection. You may obtain.... registry. We also estimate that it will take about 12 work-hours per product to comply with the basic... inspection methods: Method 1 is a combination of a detailed visual inspection and a visual inspection; Method...

75 FR 1560 - Airworthiness Directives; BAE Systems (Operations) Limited Model BAe 146 and Avro 146-RJ70A, 146...

Science.gov (United States)

2010-01-12

... alternative inspection methods: Method 1 is a combination of a detailed visual inspection and a visual inspection; Method 2 is a detailed visual inspection. You may obtain further information by examining the... would take about 12 work-hours per product to comply with the basic requirements of this proposed AD...

Using T2-Exchange from Ln3+DOTA-Based Chelates for Contrast-Enhanced Molecular Imaging of Prostate Cancer with MRI

Science.gov (United States)

2016-04-01

thereby performing disease staging entirely non-invasively. Also, in contrast to PET/CT or SPECT/CT, disease diagnostics and therapy monitoring would...2011;6.e27370. 11. Zhang SR, Sherry AD. Physical characteristics of lanthanide com- plexes that act as magnetization transfer (MT) contrast agents. J...reper- fused and nonreperfused myocardial infarctions - MR imaging with dysprosium-DTPA-BMA in the pig. Acta Radiol 1996;37:18–26. 28. Nilsson S

Pushing the pseudo-SU(3) model towards its limits: Excited bands in even-even Dy isotopes

International Nuclear Information System (INIS)

Vargas, Carlos E.; Hirsch, Jorge G.

2004-01-01

The energetics of states belonging to normal parity bands in even-even dysprosium isotopes, and their B(E2) transition strengths, are studied using an extended pseudo-SU(3) shell model. States with pseudospin 1 are added to the standard pseudospin 0 space, allowing for a proper description of known excited normal parity bands. A realistic Hamiltonian is employed. Both the success of model and its limitations are discussed

Recycling as a strategy against rare earth element criticality: a systemic evaluation of the potential yield of NdFeB magnet recycling.

Science.gov (United States)

Rademaker, Jelle H; Kleijn, René; Yang, Yongxiang

2013-09-17

End-of-life recycling is promoted by OECD countries as a promising strategy in the current global supply crisis surrounding rare earth elements (REEs) so that dependence on China, the dominant supplier, can be decreased. So far the feasibility and potential yield of REE recycling has not been systematically evaluated. This paper estimates the annual waste flows of neodymium and dysprosium from permanent magnets, the main deployment of these critical REEs, during the 2011-2030 period. The estimates focus on three key permanent magnet waste flows: wind turbines, hybrid and electric vehicles, and hard disk drives (HDDs) in personal computers (PCs). This is a good indication of the end-of-life recycling of neodymium and dysprosium maximum potential yield. Results show that for some time to come, waste flows from permanent magnets will remain small relative to the rapidly growing global REE demand. Policymakers therefore need to be aware that during the next decade recycling is unlikely to substantially contribute to global REE supply security. In the long term, waste flows will increase sharply and will meet a substantial part of the total demand for these metals. Future REE recycling efforts should, therefore, focus on the development of recycling technology and infrastructure.

Charge transport properties in microcrystalline KDyFe(China)6

International Nuclear Information System (INIS)

Aubert, P.H.; Goubard, F.; Chevrot, C.; Tabuteau, A.

2007-01-01

Microcrystalline solid dysprosium(III) hexacyanoferrate(II) was synthesized by co-precipitation in aqueous solution. The resulting solid has been studied by Fourier transform infrared spectroscopy, X-ray analysis and solid state electrochemistry. The use of a cavity microelectrode was necessary to explore a wide range of time scale and minimize the (undesired) capacitive currents. Cyclic voltametric experiments were very helpful to understand the kinetic of charge transfer in such microstructure. A structure-properties relationship has been established from the crystallographic and the electrochemical properties. A square-scheme is presented to explain the unique electrochemical behavior of hexacyanoferrate containing dysprosium since this compound exhibits a second redox system. The solid presents an open channel-like morphology in which the motion of charged species occurs during the redox processes. Precisely, the electronic transfer is accompanied by a cation diffusion inside the microcrystalline structure. The size of these channels strongly suggests that the kinetic of charge transfer is limited by the cation transport into these structures. - Graphical abstract: Dy and Fe polyhedra packing in the cell of KDyFe(China) 6 .3.5H 2 O shows occluded water molecules and potassium ions forming a pseudohexagonal 2D sub-lattice connected to each other by diffusion channels

In vitro, ex vivo and in vivo examination of buccal absorption of metoprolol with varying pH in TR146 cell culture, porcine buccal mucosa and Göttingen minipigs

DEFF Research Database (Denmark)

Holm, René; Meng-Lund, Emil; Andersen, Morten B.

2013-01-01

This work studied the buccal absorption of metoprolol in vitro, ex vivo and in vivo as a function of buffered pH at 7.4, 8.5, 9.0 and 9.5. Permeability studies showed a correlation (r(2)=0.92) between in vitro TR146 cell culture and ex vivo porcine buccal mucosa in a modified Ussing chamber...... was obtained after buccal dosing (58-107%) compared to oral (3%) administration, ranging 58-107% and 3%, respectively. Macroscopically, no local toxic effects were observed by visual inspection of mini-pig cheeks. A very clear level C in vitro in vivo correlation (r(2)=0.98) was obtained between the observed....... A higher apparent permeability was observed at higher pH values, i.e. the more compound that was unionised the higher the permeability. In vivo studies were conducted in anaesthetised Göttingen mini-pigs. A clear influence of pH on the absorption was seen and a significant higher absolute bioavailability...

Factors Contributing to Maternal and Child Mortality Reductions in 146 Low- and Middle-Income Countries between 1990 and 2010.

Science.gov (United States)

Bishai, David M; Cohen, Robert; Alfonso, Y Natalia; Adam, Taghreed; Kuruvilla, Shyama; Schweitzer, Julian

2016-01-01

From 1990-2010, worldwide child mortality declined by 43%, and maternal mortality declined by 40%. This paper compares two sources of progress: improvements in societal coverage of health determinants versus improvements in the impact of health determinants as a result of technical change. This paper decomposes the progress made by 146 low- and middle-income countries (LMICs) in lowering childhood and maternal mortality into one component due to better health determinants like literacy, income, and health coverage and a second component due to changes in the impact of these health determinants. Health determinants were selected from eight distinct health-impacting sectors. Health determinants were selected from eight distinct health-impacting sectors. Regression models are used to estimate impact size in 1990 and again in 2010. Changes in the levels of health determinants were measured using secondary data. The model shows that respectively 100% and 89% of the reductions in maternal and child mortality since 1990 were due to improvements in nationwide coverage of health determinants. The relative share of overall improvement attributable to any single determinant varies by country and by model specification. However, in aggregate, approximately 50% of the mortality reductions were due to improvements in the health sector, and the other 50% of the mortality reductions were due to gains outside the health sector. Overall, countries improved maternal and child health (MCH) from 1990 to 2010 mainly through improvements in the societal coverage of a broad array of health system, social, economic and environmental determinants of child health. These findings vindicate efforts by the global community to obtain such improvements, and align with the post-2015 development agenda that builds on the lessons from the MDGs and highlights the importance of promoting health and sustainable development in a more integrated manner across sectors.

Factors Contributing to Maternal and Child Mortality Reductions in 146 Low- and Middle-Income Countries between 1990 and 2010.

Directory of Open Access Journals (Sweden)

David M Bishai

Full Text Available From 1990-2010, worldwide child mortality declined by 43%, and maternal mortality declined by 40%. This paper compares two sources of progress: improvements in societal coverage of health determinants versus improvements in the impact of health determinants as a result of technical change.This paper decomposes the progress made by 146 low- and middle-income countries (LMICs in lowering childhood and maternal mortality into one component due to better health determinants like literacy, income, and health coverage and a second component due to changes in the impact of these health determinants. Health determinants were selected from eight distinct health-impacting sectors. Health determinants were selected from eight distinct health-impacting sectors. Regression models are used to estimate impact size in 1990 and again in 2010. Changes in the levels of health determinants were measured using secondary data.The model shows that respectively 100% and 89% of the reductions in maternal and child mortality since 1990 were due to improvements in nationwide coverage of health determinants. The relative share of overall improvement attributable to any single determinant varies by country and by model specification. However, in aggregate, approximately 50% of the mortality reductions were due to improvements in the health sector, and the other 50% of the mortality reductions were due to gains outside the health sector.Overall, countries improved maternal and child health (MCH from 1990 to 2010 mainly through improvements in the societal coverage of a broad array of health system, social, economic and environmental determinants of child health. These findings vindicate efforts by the global community to obtain such improvements, and align with the post-2015 development agenda that builds on the lessons from the MDGs and highlights the importance of promoting health and sustainable development in a more integrated manner across sectors.

Segond fracture: an MR evaluation of 146 patients with emphasis on the avulsed bone fragment and what attaches to it

Energy Technology Data Exchange (ETDEWEB)

Flores, Dyan V.; Smitaman, Edward; Huang, Brady K.; Resnick, Donald L. [University of California San Diego Medical Center, Department of Radiology, San Diego, CA (United States)

2016-12-15

To re-evaluate the Segond fragment emphasizing those structures that attach to the fragment in patients with reported acute/subacute anterior cruciate ligament (ACL) injuries, and to clarify the nomenclature used to describe these structures. A search of databases of knee MR examinations over 4.5 years with reported ACL tears yielded 19,726 studies. Using strict exclusion criteria, a total of 146 MR studies with acute/subacute ACL tears were re-assessed with respect to the Segond fragment's size, shape, orientation, location, displacement, attaching soft tissue structures, and associated osseous and/or soft tissue injuries. Segond fractures were present in 1.25 % of reported acute/subacute ACL tears. The fragment measured 11.9 x 7.3 x 3.27 mm, being thin, ovoid, vertically oriented, situated anterolaterally along the proximal tibial epiphysis, posterior to Gerdy's tubercle and inferior to the lateral tibial plateau, and displaced up to 6 mm laterally. The attached structures were the meniscotibial component of the mid-third lateral capsular ligament (mt-MTLCL) in 58.9 %, both the mt-MTLCL and the posterior fibers of the ITB (pf-ITB) in 35.6 %, and the pf-ITB in 5.48 % of cases. In no case was there an additional attaching structure that did not meet criteria for the mt-MTLCL or the pf-ITB. The mt-MTLCL most commonly attaches to the Segond fragment, but the pf-ITB can also attach to this fragment. In no case was there an additional attaching structure that did not meet criteria for the mt-MTLCL or the pf-ITB. (orig.)

146Sm-142Nd systematics measured in enstatite chondrites reveals a heterogeneous distribution of 142Nd in the solar nebula.

Science.gov (United States)

Gannoun, Abdelmouhcine; Boyet, Maud; Rizo, Hanika; El Goresy, Ahmed

2011-05-10

The short-lived (146)Sm-(142)Nd chronometer (T(1/2) = 103 Ma) is used to constrain the early silicate evolution of planetary bodies. The composition of bulk terrestrial planets is then considered to be similar to that of primitive chondrites that represent the building blocks of rocky planets. However for many elements chondrites preserve small isotope differences. In this case it is not always clear to what extent these variations reflect the isotope heterogeneity of the protosolar nebula rather than being produced by the decay of parent isotopes. Here we present Sm-Nd isotopes data measured in a comprehensive suite of enstatite chondrites (EC). The EC preserve (142)Nd/(144)Nd ratios that range from those of ordinary chondrites to values similar to terrestrial samples. The EC having terrestrial (142)Nd/(144)Nd ratios are also characterized by small (144)Sm excesses, which is a pure p-process nuclide. The correlation between (144)Sm and (142)Nd for chondrites may indicate a heterogeneous distribution in the solar nebula of p-process matter synthesized in supernovae. However to explain the difference in (142)Nd/(144)Nd ratios, 20% of the p-process contribution to (142)Nd is required, at odds with the value of 4% currently proposed in stellar models. This study highlights the necessity of obtaining high-precision (144)Sm measurements to interpret properly measured (142)Nd signatures. Another explanation could be that the chondrites sample material formed in different pulses of the lifetime of asymptotic giant branch stars. Then the isotope signature measured in SiC presolar would not represent the unique s-process signature of the material present in the solar nebula during accretion.

THE SLOAN DIGITAL SKY SURVEY REVERBERATION MAPPING PROJECT: BIASES IN z  > 1.46 REDSHIFTS DUE TO QUASAR DIVERSITY

Energy Technology Data Exchange (ETDEWEB)

Denney, K. D.; Peterson, B. M. [Department of Astronomy, The Ohio State University, 140 West 18th Avenue, Columbus, OH 43210 (United States); Horne, Keith [SUPA Physics and Astronomy, University of St. Andrews, St. Andrews KY16 9SS (United Kingdom); Brandt, W. N.; Grier, C. J.; Trump, J. R. [Department of Astronomy and Astrophysics, 525 Davey Lab, The Pennsylvania State University, University Park, PA 16802 (United States); Ho, Luis C. [Kavli Institute for Astronomy and Astrophysics, Peking University, Beijing 100871 (China); Ge, J., E-mail: denney@astronomy.ohio-state.edu [Astronomy Department University of Florida 211 Bryant Space Science Center P.O. Box 112055 Gainesville, FL 32611-2055 (United States)

2016-12-10

We use the coadded spectra of 32 epochs of Sloan Digital Sky Survey (SDSS) Reverberation Mapping Project observations of 482 quasars with z  > 1.46 to highlight systematic biases in the SDSS- and Baryon Oscillation Spectroscopic Survey (BOSS)-pipeline redshifts due to the natural diversity of quasar properties. We investigate the characteristics of this bias by comparing the BOSS-pipeline redshifts to an estimate from the centroid of He ii λ 1640. He ii has a low equivalent width but is often well-defined in high-S/N spectra, does not suffer from self-absorption, and has a narrow component which, when present (the case for about half of our sources), produces a redshift estimate that, on average, is consistent with that determined from [O ii] to within the He ii and [O ii] centroid measurement uncertainties. The large redshift differences of ∼1000 km s{sup −1}, on average, between the BOSS-pipeline and He ii-centroid redshifts, suggest there are significant biases in a portion of BOSS quasar redshift measurements. Adopting the He ii-based redshifts shows that C iv does not exhibit a ubiquitous blueshift for all quasars, given the precision probed by our measurements. Instead, we find a distribution of C iv-centroid blueshifts across our sample, with a dynamic range that (i) is wider than that previously reported for this line, and (ii) spans C iv centroids from those consistent with the systemic redshift to those with significant blueshifts of thousands of kilometers per second. These results have significant implications for measurement and use of high-redshift quasar properties and redshifts, and studies based thereon.

THE SLOAN DIGITAL SKY SURVEY REVERBERATION MAPPING PROJECT: BIASES IN z  > 1.46 REDSHIFTS DUE TO QUASAR DIVERSITY

International Nuclear Information System (INIS)

Denney, K. D.; Peterson, B. M.; Horne, Keith; Brandt, W. N.; Grier, C. J.; Trump, J. R.; Ho, Luis C.; Ge, J.

2016-01-01

We use the coadded spectra of 32 epochs of Sloan Digital Sky Survey (SDSS) Reverberation Mapping Project observations of 482 quasars with z  > 1.46 to highlight systematic biases in the SDSS- and Baryon Oscillation Spectroscopic Survey (BOSS)-pipeline redshifts due to the natural diversity of quasar properties. We investigate the characteristics of this bias by comparing the BOSS-pipeline redshifts to an estimate from the centroid of He ii λ 1640. He ii has a low equivalent width but is often well-defined in high-S/N spectra, does not suffer from self-absorption, and has a narrow component which, when present (the case for about half of our sources), produces a redshift estimate that, on average, is consistent with that determined from [O ii] to within the He ii and [O ii] centroid measurement uncertainties. The large redshift differences of ∼1000 km s −1 , on average, between the BOSS-pipeline and He ii-centroid redshifts, suggest there are significant biases in a portion of BOSS quasar redshift measurements. Adopting the He ii-based redshifts shows that C iv does not exhibit a ubiquitous blueshift for all quasars, given the precision probed by our measurements. Instead, we find a distribution of C iv-centroid blueshifts across our sample, with a dynamic range that (i) is wider than that previously reported for this line, and (ii) spans C iv centroids from those consistent with the systemic redshift to those with significant blueshifts of thousands of kilometers per second. These results have significant implications for measurement and use of high-redshift quasar properties and redshifts, and studies based thereon.

Application of Atomic Fluorescence to Measurement of Combustion Temperature in Solid Propellants.

Science.gov (United States)

1986-12-04

into a cytal (yttrium- aluminum -garnet) is shown to be an ideal seed, the fluoresce. f which is stimulated by the ultra-violet output of a Nd:YAG...been successfully employed in atmospheric flames for making thermometric measurements. However, because of the amorphous nature of energetic materials...be determined. R. 6 A .6 An example of this type of behavior is found in trivalent dysprosium, doped at 3% in yttrium- aluminum -garnet (Dy+3 :YAG

Neutron flux distribution measurement in the elementary cell of the RB reactor

Energy Technology Data Exchange (ETDEWEB)

Takac, S [Boris Kidric Institute of Nuclear Sciences Vinca, Beograd (Yugoslavia)

1963-04-15

The distribution of thermal neutrons was measured in the elementary cell with dysprosium foils for different lattice pitches and the results obtained were given. From the distributions measured average fluxes were determined for every single zone. By using the published data concerning effective absorption cross sections thermal utilization factors were calculated and their changes given as functions of lattice pitches: l = 8.0 cm; 11.3 cm and 17.9 cm. (author)

Tumor estromal gastrointestinal: análise de 146 casos do centro de referência do Instituto Nacional do Câncer - INCA

Directory of Open Access Journals (Sweden)

Eduardo Linhares

Full Text Available OBJETIVO: Avaliar os resultados do tratamento de GIST no INCA. MÉTODOS: Análise retrospectiva de todos os casos de GIST tratados no INCA no período de 1997 a 2009. RESULTADOS: Analisamos 146 pacientes, com média de idade de 44,5 anos e predomínio do sexo feminino. O principal sintoma foi dor abdominal. Tivemos ocorrência de segundo primário em 22% dos casos e na imuno-histoquímica, 92% foram positivos para CD117. A localização mais frequente foi estômago e predominou o grupo de alto risco. A cirurgia foi R0 (extenso em 70% e os principais sítios de metástases foram fígado e peritônio. A sobrevida global foi, respectivamente, em dois e cinco anos de 86% e 59%. Houve significante diferença entre a sobrevida global (p=0,29 do grupo de alto risco versus os demais. CONCLUSÃO: Os nossos pacientes apresentam-se principalmente sob forma de doença de alto risco com repercussão óbvia na sobrevida. O uso de Imatinib melhorou a sobrevida dos pacientes com doença metastática e recidivada. Devemos estudar seu uso no cenário de adjuvância e neoadjuvancia visando melhorar os índices do grupo de alto risco. A criação de centros referenciais é uma necessidade para o estudo de doenças pouco frequentes.

Origin of the p-process radionuclides 92Nb and 146Sm in the early solar system and inferences on the birth of the Sun.

Science.gov (United States)

Lugaro, Maria; Pignatari, Marco; Ott, Ulrich; Zuber, Kai; Travaglio, Claudia; Gyürky, György; Fülöp, Zsolt

2016-01-26

The abundances of (92)Nb and (146)Sm in the early solar system are determined from meteoritic analysis, and their stellar production is attributed to the p process. We investigate if their origin from thermonuclear supernovae deriving from the explosion of white dwarfs with mass above the Chandrasekhar limit is in agreement with the abundance of (53)Mn, another radionuclide present in the early solar system and produced in the same events. A consistent solution for (92)Nb and (53)Mn cannot be found within the current uncertainties and requires the (92)Nb/(92)Mo ratio in the early solar system to be at least 50% lower than the current nominal value, which is outside its present error bars. A different solution is to invoke another production site for (92)Nb, which we find in the α-rich freezeout during core-collapse supernovae from massive stars. Whichever scenario we consider, we find that a relatively long time interval of at least ∼ 10 My must have elapsed from when the star-forming region where the Sun was born was isolated from the interstellar medium and the birth of the Sun. This is in agreement with results obtained from radionuclides heavier than iron produced by neutron captures and lends further support to the idea that the Sun was born in a massive star-forming region together with many thousands of stellar siblings.

Energy dependence of thermoluminescent response of CaSO{sub 4}:Dy, LiF:Mg and micro LiF:Mg,Ti in clinical beams of electrons by using different simulator objects; Dependencia energetica da resposta TL de dosimetros de CaSO{sub 4}:Dy, LiF:Mg e microLiF:Mg,Ti em feixes clinicos de eletrons utilizando diferentes objetos simuladores

Energy Technology Data Exchange (ETDEWEB)

Bravim, Amanda; Campos, Leticia Lucente, E-mail: abravin@ipen.b, E-mail: rsakuraba@einstein.b, E-mail: lcrodri@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Sakuraba, Roberto K.; Cruz, Jose Carlos da, E-mail: rsakuraba@einstein.b, E-mail: josecarlosc@einstein.b [Hospital Israelita Albert Einstein (HIAE), Sao Paulo, SP (Brazil)

2011-10-26

Yet not so widely applied in radiotherapy, the calcium sulfate doped with dysprosium (CaSO{sub 4}:Dy) is used in radioprotection and studies has been demonstrated its great potential for the dosimetry in radiotherapy. This work evaluates the energy dependence of the thermoluminescent answer of the CaSO{sub 4}:D, LiF:Mg,Ti (TLD-100) and micro LiF:Mg,Ti in clinical beams of electrons by using water simulators, PMMA and solid water

Phosphor for thermoluminescent type radiation dosimeter

International Nuclear Information System (INIS)

Nada, N.; Yamashita, T.

1975-01-01

This has the accumulation effect of radiation energy and is mainly used as the element for thermoluminescent type radiation dosimeters. It has as the principal constituent a phosphor consisting of calcium sulfate as the principal constituent and other impurity elements such as dysprosium, thulium and the like. It is more sensitive by the order of 1 to 2 or more figures than the conventional ones and is excellent in the retention of absorbed radiation energy. (U.S.)

Surface Thermometry of Energetic Materials by Laser-Induced Fluorescence

Science.gov (United States)

1989-09-01

at 34 yttrium- aluminum -garnet (Dy:YAG). The simplified energy diagram of Dy:YAG is shown in Fig. 1. Absorbed laser light (at 355 nrm) can 5 excite the...the thermometric technique on a surface similar to that of an energetic material, a thermal-setting plastic supplied by Buehler, Ltd., was employed...temperature over the temperature range of interest. The rare-earth ion dysprosium (Dy) doped into a yttrium- aluminum -garnet (YAG) crystal was I determined

From NdFeB magnets towards the rare-earth oxides: a recycling process consuming only oxalic acid

OpenAIRE

Vander Hoogerstraete, Tom; Blanpain, Bart; Van Gerven, Tom; Binnemans, Koen

2014-01-01

A chemical process which consumes a minimum amount of chemicals to recover rare-earth metals from NdFeB magnets was developed. The recovery of rare-earth elements from end-of-life consumer products has gained increasing interest during the last few years. Examples of valuable rare earths are neodymium and dysprosium because they are important constituents of strong permanent magnets used in several large or growing application fields (e.g. hard disk drives, wind turbines, electric vehicles, m...

A high resolution x-ray fluorescence spectrometer for near edge absorption studies

International Nuclear Information System (INIS)

Stojanoff, V.; Hamalainen, K.; Siddons, D.P.; Hastings, J.B.; Berman, L.E.; Cramer, S.; Smith, G.

1991-01-01

A high resolution fluorescence spectrometer using a Johann geometry in a back scattering arrangement was developed. The spectrometer, with a resolution of 0.3 eV at 6.5 keV, combined with an incident beam, with a resolution of 0.7 eV, form the basis of a high resolution instrument for measuring x-ray absorption spectra. The advantages of the instrument are illustrated with the near edge absorption spectrum of dysprosium nitrate. 10 refs., 4 figs

Concepts for using trapped-flux bulk high-temperature superconductor in motors and generators

International Nuclear Information System (INIS)

Hull, John R; Strasik, Michael

2010-01-01

We review previous concepts for using bulk high-temperature superconductors (HTSs) in motors and generators and discuss methods for using trapped-flux (TF) HTSs in motors and generators that have been recently investigated in our laboratory. We examine the expected performance of a brushless motor/generator that uses TF bulk HTSs to provide magnetomotive force, where the stator windings are used to create the TF. A key feature is the use of dysprosium for the stator and rotor cores.

Scissors Mode of Dipolar Quantum Droplets of Dysprosium Atoms

Science.gov (United States)

Ferrier-Barbut, Igor; Wenzel, Matthias; Böttcher, Fabian; Langen, Tim; Isoard, Mathieu; Stringari, Sandro; Pfau, Tilman

2018-04-01

We report on the observation of the scissors mode of a single dipolar quantum droplet. The existence of this mode is due to the breaking of the rotational symmetry by the dipole-dipole interaction, which is fixed along an external homogeneous magnetic field. By modulating the orientation of this magnetic field, we introduce a new spectroscopic technique for studying dipolar quantum droplets. This provides a precise probe for interactions in the system, allowing us to extract a background scattering length for 164Dy of 69 (4 )a0 . Our results establish an analogy between quantum droplets and atomic nuclei, where the existence of the scissors mode is also only due to internal interactions. They further open the possibility to explore physics beyond the available theoretical models for strongly dipolar quantum gases.

Single molecule magnet behaviour in robust dysprosium-biradical complexes.

Science.gov (United States)

Bernot, Kevin; Pointillart, Fabrice; Rosa, Patrick; Etienne, Mael; Sessoli, Roberta; Gatteschi, Dante

2010-09-21

A Dy-biradical complex was synthesized and characterized down to very low temperature. ac magnetic measurements reveal single molecule magnet behaviour visible without any application of dc field. The transition to the quantum tunneling regime is evidenced. Photophysical and EPR measurements provide evidence of the excellent stability of these complexes in solution.

Crystal and molecular structure of dysprosium (3) n-aminobenzoate

International Nuclear Information System (INIS)

Khiyalov, M.S.; Amiraslanov, I.R.; Mamedov, Kh.S.; Movsumov, Eh.M.

1981-01-01

The X ray diffraction investigation of the Dy(NH 2 C 6 H 4 COO) 3 x3H 2 O complex is carried out. Triclinic crystals have lattice parameters α=11.095(15), b=9.099(17), c=12.780 (15)A, α=108.051(12), β=89.072(10); γ=104.954(12) 0 , space group P anti 1, Z=2. The structure consists of dimer molecules. The third water molecule in the formula is an outer spherical one. The average lengths of Dy-O and Dy-OH 2 are 2.39 and 2.40 A respectively, the average value of Dy-O in bridge carboxylates (2.26A) is remarkably shorter. Hydrogen bonds between amine ligand ends, carboxylic groups oxygen and water molecules bind complex molecules into the three-dimensional frame [ru

Dysprosium Acetylacetonato Single-Molecule Magnet Encapsulated in Carbon Nanotubes

Directory of Open Access Journals (Sweden)

Ryo Nakanishi

2016-12-01

Full Text Available Dy single-molecule magnets (SMMs, which have several potential uses in a variety of applications, such as quantum computing, were encapsulated in multi-walled carbon nanotubes (MWCNTs by using a capillary method. Encapsulation was confirmed by using transmission electron microscopy (TEM. In alternating current magnetic measurements, the magnetic susceptibilities of the Dy acetylacetonato complexes showed clear frequency dependence even inside the MWCNTs, meaning that this hybrid can be used as magnetic materials in devices.

Thermal, optical and structural properties of Dy3+ doped sodium aluminophosphate glasses

Science.gov (United States)

Kaur, Manpreet; Singh, Anupinder; Thakur, Vanita; Singh, Lakhwant

2016-03-01

Trivalent Dysprosium doped sodium aluminophosphate glasses with composition 50P2O5-10Al2O3-(20-x)Na2O-20CaO-xDy2O3 (x varying from 0 to 5 mol%) were prepared by melt quench technique. The density of the prepared samples was measured using Archimedes principle and various physical properties like molar volume, rare earth ion concentration, polaron radius, inter nuclear distance and field strength were calculated using different formulae. The differential scanning calorimetry (DSC) was carried out to study the thermal stability of prepared glasses. The UV Visible absorption spectra of the dysprosium doped glasses were found to be comprised of ten absorption bands which correspond to transitions from ground state 6H15/2 to various excited states. The indirect optical band gap energy of the samples was calculated by Tauc's plot and the optical energy was found to be attenuated with Dy3+ ions. The photoluminescence spectrum revealed that Dy3+ doped aluminophosphate glasses have strong emission bands in the visible region. A blue emission band centred at 486 nm, a bright yellow band centred at 575 nm and a weak red band centred at 668 nm were observed in the emission spectrum due to excitation at 352 nm wavelength. Both FTIR and Raman spectra assert slight structural changes induced in the host glass network with Dy3+ ions.

Levitation in paramagnetic liquids

Energy Technology Data Exchange (ETDEWEB)

Dunne, P.A. [School of Physics and CRANN, Trinity Collge, Dublin 2 (Ireland)]. E-mail: pdunne2@tcd.ie; Hilton, J. [School of Physics and CRANN, Trinity Collge, Dublin 2 (Ireland); Coey, J.M.D. [School of Physics and CRANN, Trinity Collge, Dublin 2 (Ireland)

2007-09-15

Magnetic levitation of diamagnetic and paramagnetic substances in a paramagnetic liquid is explored. Materials ranging from graphite to tin and copper can be made to float at ambient temperature in concentrated solutions of dysprosium nitrate, when an electromagnet or four-block permanent magnet array is used to produce a gradient field. Simulations illustrate the stable regions for levitation above the permanent magnets; and a novel eight-block configuration is proposed, which allows denser materials such as gold or lead to be levitated.

On the specific electrophysical properties of n-InSe single crystals

Energy Technology Data Exchange (ETDEWEB)

Abdinov, A. Sh., E-mail: abdinov-axmed@yahoo.com [Baku State University (Azerbaijan); Babaeva, R. F., E-mail: babaeva-rena@yandex.ru; Rzaev, R. M., E-mail: abdinov-axmed@yandex.ru [Azerbaijan State Economic University (Azerbaijan); Ragimova, N. A.; Amirova, S. I. [Baku State University (Azerbaijan)

2016-01-15

The temperature dependences of physical parameters (the conductivity and the Hall constant) are experimentally investigated for pure indium-selenide (n-InSe) crystals and those lightly doped with rareearth elements (gadolinium, holmium, and dysprosium). It is established that the obtained results depend on the origin of the samples under investigation and prove to be contradictory for different samples. The obtained experimental results are treated taking into account the presence of chaotic large-scale defects and drift barriers caused by them in these samples.