
Sample records for dye-labeled dna detects

  1. Preparation of fluorescent-dye-labeled cDNA from RNA for microarray hybridization.

    Ares, Manuel


    This protocol describes how to prepare fluorescently labeled cDNA for hybridization to microarrays. It consists of two steps: first, a mixture of anchored oligo(dT) and random hexamers is used to prime amine-modified cDNA synthesis by reverse transcriptase using a modified deoxynucleotide with a reactive amine group (aminoallyl-dUTP) and an RNA sample as a template. Second, the cDNA is purified and exchanged into bicarbonate buffer so that the amine groups in the cDNA react with the dye N-hydroxysuccinimide (NHS) esters, covalently joining the dye to the cDNA. The dye-coupled cDNA is purified again, and the amount of dye incorporated per microgram of cDNA is determined.

  2. Structures of an Apo and a Binary Complex of an Evolved Archeal B Family DNA Polymerase Capable of Synthesising Highly Cy-Dye Labelled DNA

    Wynne, Samantha A.; Pinheiro, Vitor B.; Holliger, Philipp; Leslie, Andrew G. W.


    Thermophilic DNA polymerases of the polB family are of great importance in biotechnological applications including high-fidelity PCR. Of particular interest is the relative promiscuity of engineered versions of the exo- form of polymerases from the Thermo- and Pyrococcales families towards non-canonical substrates, which enables key advances in Next-generation sequencing. Despite this there is a paucity of structural information to guide further engineering of this group of polymerases. Here we report two structures, of the apo form and of a binary complex of a previously described variant (E10) of Pyrococcus furiosus (Pfu) polymerase with an ability to fully replace dCTP with Cyanine dye-labeled dCTP (Cy3-dCTP or Cy5-dCTP) in PCR and synthesise highly fluorescent “CyDNA” densely decorated with cyanine dye heterocycles. The apo form of Pfu-E10 closely matches reported apo form structures of wild-type Pfu. In contrast, the binary complex (in the replicative state with a duplex DNA oligonucleotide) reveals a closing movement of the thumb domain, increasing the contact surface with the nascent DNA duplex strand. Modelling based on the binary complex suggests how bulky fluorophores may be accommodated during processive synthesis and has aided the identification of residues important for the synthesis of unnatural nucleic acid polymers. PMID:23940661

  3. Single molecule DNA detection with an atomic vapor notch filter

    Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)


    The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)


    A rapid and sensitive fiber optic biosensor assay for radiation-induced DNA damage is reported. For this assay, a biotin-labeled capture oligonucleotide (38 mer) was immobilized to an avidin-coated quartz fiber. Hybridization of a dye-labeled complementary sequence was observed...

  5. The DNA relaxation activity and covalent complex accumulation of Mycobacterium tuberculosis topoisomerase I can be assayed in Escherichia coli: application for identification of potential FRET-dye labeling sites

    Abrenica Maria V


    Full Text Available Abstract Background Mycobacterium tuberculosis topoisomerase I (MtTOP1 and Escherichia coli topoisomerase I have highly homologous transesterification domains, but the two enzymes have distinctly different C-terminal domains. To investigate the structure-function of MtTOP1 and to target its activity for development of new TB therapy, it is desirable to have a rapid genetic assay for its catalytic activity, and potential bactericidal consequence from accumulation of its covalent complex. Results We show that plasmid-encoded recombinant MtTOP1 can complement the temperature sensitive topA function of E. coli strain AS17. Moreover, expression of MtTOP1-G116 S enzyme with the TOPRIM mutation that inhibits DNA religation results in SOS induction and loss of viability in E. coli. The absence of cysteine residues in the MtTOP1 enzyme makes it an attractive system for introduction of potentially informative chemical or spectroscopic probes at specific positions via cysteine mutagenesis. Such probes could be useful for development of high throughput screening (HTS assays. We employed the AS17 complementation system to screen for sites in MtTOP1 that can tolerate cysteine substitution without loss of complementation function. These cysteine substitution mutants were confirmed to have retained the relaxation activity. One such mutant of MtTOP1 was utilized for fluorescence probe incorporation and fluorescence resonance energy transfer measurement with fluorophore-labeled oligonucleotide substrate. Conclusions The DNA relaxation and cleavage complex accumulation of M. tuberculosis topoisomerase I can be measured with genetic assays in E. coli, facilitating rapid analysis of its activities, and discovery of new TB therapy targeting this essential enzyme.

  6. Magnified fluorescence detection of silver(I) ion in aqueous solutions by using nano-graphite-DNA hybrid and DNase I.

    Wei, Yin; Li, Bianmiao; Wang, Xu; Duan, Yixiang


    This paper describes a novel approach utilizing nano-graphite-DNA hybrid and DNase I for the amplified detection of silver(I) ion in aqueous solutions for the first time. Nano-graphite can effectively quench the fluorescence of dye-labeled cytosine-rich single-stranded DNA due to its strong π-π stacking interactions; however, in the presence of Ag(+), C-Ag(+)-C coordination induces the probe to fold into a hairpin structure, which does not adsorb on the surface of nano-graphite and thus retains the dye fluorescence. Meanwhile, the hairpin structure can be cleaved by DNase I, and in such case Ag(+) is delivered from the complex. The released Ag(+) then binds other dye-labeled single-stranded DNA on the nano-graphite surface, and touches off another target recycling, resulting in the successive release of dye-labeled single-stranded DNA from the nano-graphite, which leads to significant amplification of the signal. The present magnification sensing system exhibits high sensitivity toward Ag(+) with a limit of detection of 0.3nM (S/N=3), which is much lower than the standard for Ag(+) in drinking water recommended by the Environmental Protection Agency (EPA). The selectivity of the sensor for Ag(+) against other biologically and environmentally related metal ions is outstanding due to the high specificity of C-Ag(+)-C formation. Moreover, the sensing system is used for the determination of Ag(+) in river water samples with satisfying results. The proposed assay is simple, cost-effective, and might open the door for the development of new assays for other metal ions or biomolecules. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Polyethylenimine-coated Fe3O4 nanoparticles effectively quench fluorescent DNA, which can be developed as a novel platform for protein detection.

    Ma, Long; Sun, Nana; Zhang, Jinyan; Tu, Chunhao; Cao, Xiuqi; Duan, Demin; Diao, Aipo; Man, Shuli


    We report a novel assembly of polyethyleneimine (PEI)-coated Fe 3 O 4 nanoparticles (NPs) with single-stranded DNA (ssDNA), and the fluorescence of the dye labeled in the DNA is remarkably quenched. In the presence of a target protein, the protein-DNA aptamer mutual interaction releases the ssDNA from this assembly and hence restores the fluorescence. This feature could be adopted to develop an aptasensor for protein detection. As a proof-of-concept, for the first time, we have used this proposed sensing strategy to detect thrombin selectively and sensitively. Furthermore, simultaneous multiple detection of thrombin and lysozyme in a complex protein mixture has been proven to be possible.

  8. Rectangular coordination polymer nanoplates: large-scale, rapid synthesis and their application as a fluorescent sensing platform for DNA detection.

    Yingwei Zhang

    Full Text Available In this paper, we report on the large-scale, rapid synthesis of uniform rectangular coordination polymer nanoplates (RCPNs assembled from Cu(II and 4,4'-bipyridine for the first time. We further demonstrate that such RCPNs can be used as a very effective fluorescent sensing platform for multiple DNA detection with a detection limit as low as 30 pM and a high selectivity down to single-base mismatch. The DNA detection is accomplished by the following two steps: (1 RCPN binds dye-labeled single-stranded DNA (ssDNA probe, which brings dye and RCPN into close proximity, leading to fluorescence quenching; (2 Specific hybridization of the probe with its target generates a double-stranded DNA (dsDNA which detaches from RCPN, leading to fluorescence recovery. It suggests that this sensing system can well discriminate complementary and mismatched DNA sequences. The exact mechanism of fluorescence quenching involved is elucidated experimentally and its use in a human blood serum system is also demonstrated successfully.

  9. Detection of Non-Amplified Genomic DNA

    Corradini, Roberto


    This book offers a state-of-the-art overview on non amplified DNA detection methods and provides chemists, biochemists, biotechnologists and material scientists with an introduction to these methods. In fact all these fields have dedicated resources to the problem of nucleic acid detection, each contributing with their own specific methods and concepts. This book will explain the basic principles of the different non amplified DNA detection methods available, highlighting their respective advantages and limitations. The importance of non-amplified DNA sequencing technologies will be also discussed. Non-amplified DNA detection can be achieved by adopting different techniques. Such techniques have allowed the commercialization of innovative platforms for DNA detection that are expected to break into the DNA diagnostics market. The enhanced sensitivity required for the detection of non amplified genomic DNA has prompted new strategies that can achieve ultrasensitivity by combining specific materials with specifi...

  10. Label-free and sensitive detection of T4 polynucleotide kinase activity via coupling DNA strand displacement reaction with enzymatic-aided amplification.

    Cheng, Rui; Tao, Mangjuan; Shi, Zhilu; Zhang, Xiafei; Jin, Yan; Li, Baoxin


    Several fluorescence signal amplification strategies have been developed for sensitive detection of T4 polynucleotide kinase (T4 PNK) activity, but they need fluorescence dye labeled DNA probe. We have addressed the limitation and report here a label-free strategy for sensitive detection of PNK activity by coupling DNA strand displacement reaction with enzymatic-aided amplification. A hairpin oligonucleotide (hpDNA) with blunt ends was used as the substrate for T4 PNK phosphorylation. In the presence of T4 PNK, the stem of hpDNA was phosphorylated and further degraded by lambda exonuclease (λ exo) from 5' to 3' direction to release a single-stranded DNA as a trigger of DNA strand displacement reaction (SDR). The trigger DNA can continuously displace DNA P2 from P1/P2 hybrid with the help of specific cleavage of nicking endonuclease (Nt.BbvCI). Then, DNA P2 can form G-quadruplex in the presence of potassium ions and quadruplex-selective fluorphore, N-methyl mesoporphyrin IX (NMM), resulting in a significant increase in fluorescence intensity of NMM. Thus, the accumulative release of DNA P2 led to fluorescence signal amplification for determining T4 PNK activity with a detection limit of 6.6×10(-4) U/mL, which is superior or comparative with established approaches. By ingeniously utilizing T4 PNK-triggered DNA SDR, T4 PNK activity can be specifically and facilely studied in homogeneous solution containing complex matrix without any external fluorescence labeling. Moreover, the influence of different inhibitors on the T4 PNK activity revealed that it also can be explored to screen T4 PNK inhibitors. Therefore, this label-free amplification strategy presents a facile and cost-effective approach for nucleic acid phosphorylation related research. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Tungsten disulfide nanosheet and exonuclease III co-assisted amplification strategy for highly sensitive fluorescence polarization detection of DNA glycosylase activity

    Zhao, Jingjin; Ma, Yefei; Kong, Rongmei; Zhang, Liangliang; Yang, Wen; Zhao, Shulin


    Herein, we introduced a tungsten disulfide (WS 2 ) nanosheet and exonuclease III (Exo III) co-assisted signal amplification strategy for highly sensitive fluorescent polarization (FP) assay of DNA glycosylase activity. Two DNA glycosylases, uracil-DNA glycosylase (UDG) and human 8-oxoG DNA glycosylase 1 (hOGG1), were tested. A hairpin-structured probe (HP) which contained damaged bases in the stem was used as the substrate. The removal of damaged bases from substrate by DNA glycosylase would lower the melting temperature of HP. The HP was then opened and hybridized with a FAM dye-labeled single strand DNA (DP), generating a duplex with a recessed 3′-terminal of DP. This design facilitated the Exo III-assisted amplification by repeating the hybridization and digestion of DP, liberating numerous FAM fluorophores which could not be adsorbed on WS 2 nanosheet. Thus, the final system exhibited a small FP signal. However, in the absence of DNA glycosylases, no hybridization between DP and HP was occurred, hampering the hydrolysis of DP by Exo III. The intact DP was then adsorbed on the surface of WS 2 nanosheet that greatly amplified the mass of the labeled-FAM fluorophore, resulting in a large FP value. With the co-assisted amplification strategy, the sensitivity was substantially improved. In addition, this method was applied to detect UDG activity in cell extracts. The study of the inhibition of UDG was also performed. Furthermore, this method is simple in design, easy in implementation, and selective, which holds potential applications in the DNA glycosylase related mechanism research and molecular diagnostics. - Highlights: • A fluorescence polarization strategy for DNA glycosylase activity detection was developed. • The present method was based on WS 2 nanosheet and exonuclease III co-assisted signal amplification. • A high sensitivity and desirable selectivity were achieved. • This method provides a promising universal platform for DNA glycosylase

  12. ctDNA DLBCL Detection Lancet Oncology

    Measurement of circulating tumor DNA in blood can be used to detect disease recurrence in patients with a curable form of cancer known as diffuse large B-cell lymphoma (DLBCL). In most patients, measurement of ctDNA enabled detection of microscopic diseas

  13. Detection of HBV Covalently Closed Circular DNA

    Xiaoling Li


    Full Text Available Chronic hepatitis B virus (HBV infection affects approximately 240 million people worldwide and remains a serious public health concern because its complete cure is impossible with current treatments. Covalently closed circular DNA (cccDNA in the nucleus of infected cells cannot be eliminated by present therapeutics and may result in persistence and relapse. Drug development targeting cccDNA formation and maintenance is hindered by the lack of efficient cccDNA models and reliable cccDNA detection methods. Southern blotting is regarded as the gold standard for quantitative cccDNA detection, but it is complicated and not suitable for high-throughput drug screening, so more sensitive and simple methods, including polymerase chain reaction (PCR-based methods, Invader assays, in situ hybridization and surrogates, have been developed for cccDNA detection. However, most methods are not reliable enough, and there are no unified standards for these approaches. This review will summarize available methods for cccDNA detection. It is hoped that more robust methods for cccDNA monitoring will be developed and that standard operation procedures for routine cccDNA detection in scientific research and clinical monitoring will be established.

  14. Biosensors for DNA sequence detection

    Vercoutere, Wenonah; Akeson, Mark


    DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.

  15. DNA Origami-Graphene Hybrid Nanopore for DNA Detection.

    Barati Farimani, Amir; Dibaeinia, Payam; Aluru, Narayana R


    DNA origami nanostructures can be used to functionalize solid-state nanopores for single molecule studies. In this study, we characterized a nanopore in a DNA origami-graphene heterostructure for DNA detection. The DNA origami nanopore is functionalized with a specific nucleotide type at the edge of the pore. Using extensive molecular dynamics (MD) simulations, we computed and analyzed the ionic conductivity of nanopores in heterostructures carpeted with one or two layers of DNA origami on graphene. We demonstrate that a nanopore in DNA origami-graphene gives rise to distinguishable dwell times for the four DNA base types, whereas for a nanopore in bare graphene, the dwell time is almost the same for all types of bases. The specific interactions (hydrogen bonds) between DNA origami and the translocating DNA strand yield different residence times and ionic currents. We also conclude that the speed of DNA translocation decreases due to the friction between the dangling bases at the pore mouth and the sequencing DNA strands.

  16. A NIR-remote controlled upconverting nanoparticle: an improved tool for living cell dye-labeling

    Zheng, Bin; Gong, Xiaoqun; Wang, Hanjie; Wang, Sheng; Chang, Jin; Wang, Huiquan; Li, Wei; Tan, Jian


    In living cells, due to the selective permeability and complicated cellular environment, the uptake efficiency and fluorescence decay of organic dyes during dye-labeling may be influenced, which may eventually result in poor fluorescent imaging. In this work, a protocol of UCNs@mSiO_2-(FA and Azo) core–shell nanocarriers was designed and prepared successfully. The core–shell nanocarriers were assembled from two parts, including a mesoporous silica shell surface modified by folate (FA) and azobenzene (Azo), and an upconverting nanocrystal (UCN) core. The mesoporous silica shell is used for loading organic dyes and conjugating folate which helps to enhance the cellular uptake of nanocarriers. The UCN core works as a transducer to convert near infrared (NIR) light to local UV and visible light to activate a back-and-forth wagging motion of azobenzene molecules on the surface, while the azobenzene acts as a molecular impeller for propelling the release of organic dyes. The nanocarriers of loading organic dyes can maintain the stability of the fluorescent imaging effect better than free organic dyes. The experimental results show that with the help of the nanoparticle, cell uptake efficiency of the model dyes of rhodamine and 4′, 6-diamidino-2-phenylindole (DAPI) was significantly improved. The release of dyes can only be triggered by NIR light exposure and their quantity is highly dependent on the duration of NIR light exposure, thus realizing NIR-regulated dye release spatiotemporally. Our work may open a novel avenue for precisely controlling UCN-based living cell imaging in biotechnology and diagnostics, as well as studying cell dynamics, cell–cell interactions, and tissue morphogenesis. (paper)

  17. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    McCutchen-Maloney, Sandra L.


    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  18. Ultraviolet absorption detection of DNA in gels

    Mahon, A.R.


    A method and apparatus for the detection and quantification of large fragments of unlabelled deoxyribonucleic acid (DNA) in agarose gels is presented. The technique is based on ultra-violet (UV) absorption by nucleotides. A deuterium lamp was used to illuminate regions of an electrophoresis gel. As DNA bands passed through the illuminated region of the gel the amount of UV light transmitted was reduced due to DNA absorption. Two detection systems were investigated. In the first system, synthetic chemical vapour deposition (CVD) diamond strip detectors were used to locate regions of DNA in the gels by detecting the transmitted light. CVD diamond has a high indirect band gap of 5.45 eV and is therefore sensitive to UV photons of wavelengths < 224 nm. A number of CVD diamond samples were characterised to investigate their suitability as detectors for this application. The detectors' quantum efficiency, UV response and time response were measured. DNA bands containing as little as 20 ng were detected by the diamond. In a second system, a deuterium lamp was used to illuminate individual sample lanes of an electrophoresis gel via an array of optical fibres. During electrophoresis the regions of DNA were detected with illumination at 260 nm, using a UV-sensitive charge coupled device (CCD). As the absorption coefficient of a DNA sample is approximately proportional to its mass, the technique is inherently quantitative. This system had a detection limit of 0.25 ng compared with 2-10 ng for the most popular conventional technique, ethidium bromide (EtBr) staining. Using this detection technique, the DNA sample remains in its native state. The removal of carcinogenic dyes from the detection procedure greatly reduces associated biological hazards. (author)

  19. Development of genomic microsatellite multiplex PCR using dye-labeled universal primer and its validation in pedigree analysis of Pacific oyster ( Crassostrea gigas)

    Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong


    There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.

  20. Tungsten disulfide nanosheet and exonuclease III co-assisted amplification strategy for highly sensitive fluorescence polarization detection of DNA glycosylase activity

    Zhao, Jingjin; Ma, Yefei [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China); Kong, Rongmei [The Key Laboratory of Life-Organic Analysis, College of Chemistry and Chemical Engineering, Qufu Normal University, Qufu, Shandong 273165 (China); Zhang, Liangliang, E-mail: [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China); Yang, Wen; Zhao, Shulin [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China)


    Herein, we introduced a tungsten disulfide (WS{sub 2}) nanosheet and exonuclease III (Exo III) co-assisted signal amplification strategy for highly sensitive fluorescent polarization (FP) assay of DNA glycosylase activity. Two DNA glycosylases, uracil-DNA glycosylase (UDG) and human 8-oxoG DNA glycosylase 1 (hOGG1), were tested. A hairpin-structured probe (HP) which contained damaged bases in the stem was used as the substrate. The removal of damaged bases from substrate by DNA glycosylase would lower the melting temperature of HP. The HP was then opened and hybridized with a FAM dye-labeled single strand DNA (DP), generating a duplex with a recessed 3′-terminal of DP. This design facilitated the Exo III-assisted amplification by repeating the hybridization and digestion of DP, liberating numerous FAM fluorophores which could not be adsorbed on WS{sub 2} nanosheet. Thus, the final system exhibited a small FP signal. However, in the absence of DNA glycosylases, no hybridization between DP and HP was occurred, hampering the hydrolysis of DP by Exo III. The intact DP was then adsorbed on the surface of WS{sub 2} nanosheet that greatly amplified the mass of the labeled-FAM fluorophore, resulting in a large FP value. With the co-assisted amplification strategy, the sensitivity was substantially improved. In addition, this method was applied to detect UDG activity in cell extracts. The study of the inhibition of UDG was also performed. Furthermore, this method is simple in design, easy in implementation, and selective, which holds potential applications in the DNA glycosylase related mechanism research and molecular diagnostics. - Highlights: • A fluorescence polarization strategy for DNA glycosylase activity detection was developed. • The present method was based on WS{sub 2} nanosheet and exonuclease III co-assisted signal amplification. • A high sensitivity and desirable selectivity were achieved. • This method provides a promising universal platform for DNA

  1. Detection of environmental carcinogens-DNA

    Pfohl-Leszkowicz, A.; Guillemaut, G.; Rether, B.; Masfaraud, J.F.; Haguenoer, J.M.


    It has been estimated that majority of human cancer is due to environmental factors including pollutants in air, soil, water and food, work places exposure and personal habits such as smoking. After penetration in organism, xenobiotics could be directly excreted or are bio transformed by oxidation or reduction in more hydrophilic compounds which could be conjugate and then eliminated in urine. But in some case, the biotransformation leads to electrophilic compounds which interact with macromolecules such as DNA, forming addition products named adduct. The 32 P post-labelling method, inspired by recent developments in the methodology for sequencing nucleic acids, is an extremely sensitive method for assessing and quantifying DNA adducts and is applicable to structurally diverse classes of chemicals. In the first study, we have analysed hepatic DNA from fish living in the River Rhone downstream and upstream from a polychlorinated biphenyl incineration plant. Our results suggest that fish are exposed to genotoxic chemicals. In another study, leave DNA from healthy and declining hop were analysed. The total adduct level is 3 time higher in declining hop. A comparison between DNA adducts from several vegetal cells cultured in presence of heptachlor and DNA adduct in declining hop, confirmed the implication of heptachlor. In these examples, our data indicate the usefulness of the 32 P-post labelling method to assess the contamination of the environment by genotoxic pollutants. Epidemiological data suggested that increasing exposure to airborne PAH contributes to increase risk cancer in this population. Exposure-dependent adducts were detected in while blood cells in coke oven workers. The adduct levels is function of the level of pollutant. In the last example we have analysed lung tissue from patient with cancer. We observed many adducts in peritumoral tissue, while few adducts could be detected in tumoral tissues. (author)

  2. Ultrasensitive norovirus detection using DNA aptasensor technology.

    Amanda Giamberardino

    Full Text Available DNA aptamers were developed against murine norovirus (MNV using SELEX (Systematic Evolution of Ligands by EXponential enrichment. Nine rounds of SELEX led to the discovery of AG3, a promising aptamer with very high affinity for MNV as well as for lab-synthesized capsids of a common human norovirus (HuNoV outbreak strain (GII.3. Using fluorescence anisotropy, AG3 was found to bind with MNV with affinity in the low picomolar range. The aptamer could cross-react with HuNoV though it was selected against MNV. As compared to a non-specific DNA control sequence, the norovirus-binding affinity of AG3 was about a million-fold higher. In further tests, the aptamer also showed nearly a million-fold higher affinity for the noroviruses than for the feline calicivirus (FCV, a virus similar in size and structure to noroviruses. AG3 was incorporated into a simple electrochemical sensor using a gold nanoparticle-modified screen-printed carbon electrode (GNPs-SPCE. The aptasensor could detect MNV with a limit of detection of approximately 180 virus particles, for possible on-site applications. The lead aptamer candidate and the aptasensor platform show promise for the rapid detection and identification of noroviruses in environmental and clinical samples.

  3. [Single-molecule detection and characterization of DNA replication based on DNA origami].

    Wang, Qi; Fan, Youjie; Li, Bin


    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  4. DNA & Protein detection based on microbead agglutination

    Kodzius, Rimantas


    We report a simple and rapid room temperature assay for point-of-care (POC) testing that is based on specific agglutination. Agglutination tests are based on aggregation of microparticles in the presence of a specific analyte thus enabling the macroscopic observation. Agglutination-based tests are most often used to explore the antibody-antigen reactions. Agglutination has been used for mode protein assays using a biotin/streptavidin two-component system, as well as a hybridization based two-component assay; however, as our work shows, two-component systems are prone to self-termination of the linking analyte and thus have a lower sensitivity. Three component systems have also been used with DNA hybridization, as in our work; however, their assay requires 48 hours for incubation, while our assay is performed in 5 minutes making it a real candidate for POC testing. We demonstrate three assays: a two-component biotin/streptavidin assay, a three-component hybridization assay using single stranded DNA (ssDNA) molecules and a stepped three-component hybridization assay. The comparison of these three assays shows our simple stepped three-component agglutination assay to be rapid at room temperature and more sensitive than the two-component version by an order of magnitude. An agglutination assay was also performed in a PDMS microfluidic chip where agglutinated beads were trapped by filter columns for easy observation. We developed a rapid (5 minute) room temperature assay, which is based on microbead agglutination. Our three-component assay solves the linker self-termination issue allowing an order of magnitude increase in sensitivity over two–component assays. Our stepped version of the three-component assay solves the issue with probe site saturation thus enabling a wider range of detection. Detection of the agglutinated beads with the naked eye by trapping in microfluidic channels has been shown.

  5. Interface Layering Phenomena in Capacitance Detection of DNA with Biochips

    Sandro Carrara


    Full Text Available Reliable DNA detection is of great importance for the development of the Lab-on-chip technology. The effort of the most recent projects on this field is to integrate all necessary operations, such as sample preparation (mixing, PCR amplification together with the sensor user for DNA detection. Among the different ways to sense the DNA hybridization, fluorescence based detection has been favored by the market. However, fluorescence based approaches require that the DNA targets are labeled by means of chromophores. As an alternative label-free DNA detection method, capacitance detection was recently proposed by different authors. While this effect has been successfully demonstrated by several groups, the model used for data analysis is far too simple to describe the real behavior of a DNA sensor. The aim of the present paper is to propose a different electrochemical model to describe DNA capacitance detection.

  6. Tumor‐associated DNA mutation detection in individuals undergoing colonoscopy

    Fleshner, Phillip; Braunstein, Glenn D.; Ovsepyan, Gayane; Tonozzi, Theresa R.; Kammesheidt, Anja


    Abstract The majority of colorectal cancers (CRC) harbor somatic mutations and epigenetic modifications in the tumor tissue, and some of these mutations can be detected in plasma as circulating tumor DNA (ctDNA). Precancerous colorectal lesions also contain many of these same mutations. This study examined plasma for ctDNA from patients undergoing a screening or diagnostic colonoscopy to determine the sensitivity and specificity of the ctDNA panel for detecting CRC and precancerous lesions. T...

  7. Automated DNA electrophoresis, hybridization and detection

    Zapolski, E.J.; Gersten, D.M.; Golab, T.J.; Ledley, R.S.


    A fully automated, computer controlled system for nucleic acid hybridization analysis has been devised and constructed. In practice, DNA is digested with restriction endonuclease enzyme(s) and loaded into the system by pipette; 32 P-labelled nucleic acid probe(s) is loaded into the nine hybridization chambers. Instructions for all the steps in the automated process are specified by answering questions that appear on the computer screen at the start of the experiment. Subsequent steps are performed automatically. The system performs horizontal electrophoresis in agarose gel, fixed the fragments to a solid phase matrix, denatures, neutralizes, prehybridizes, hybridizes, washes, dries and detects the radioactivity according to the specifications given by the operator. The results, printed out at the end, give the positions on the matrix to which radioactivity remains hybridized following stringent washing

  8. C-Terminal Fluorescent Labeling Impairs Functionality of DNA Mismatch Repair Proteins

    Brieger, Angela; Plotz, Guido; Hinrichsen, Inga; Passmann, Sandra; Adam, Ronja; Zeuzem, Stefan


    The human DNA mismatch repair (MMR) process is crucial to maintain the integrity of the genome and requires many different proteins which interact perfectly and coordinated. Germline mutations in MMR genes are responsible for the development of the hereditary form of colorectal cancer called Lynch syndrome. Various mutations mainly in two MMR proteins, MLH1 and MSH2, have been identified so far, whereas 55% are detected within MLH1, the essential component of the heterodimer MutLα (MLH1 and PMS2). Most of those MLH1 variants are pathogenic but the relevance of missense mutations often remains unclear. Many different recombinant systems are applied to filter out disease-associated proteins whereby fluorescent tagged proteins are frequently used. However, dye labeling might have deleterious effects on MutLα's functionality. Therefore, we analyzed the consequences of N- and C-terminal fluorescent labeling on expression level, cellular localization and MMR activity of MutLα. Besides significant influence of GFP- or Red-fusion on protein expression we detected incorrect shuttling of single expressed C-terminal GFP-tagged PMS2 into the nucleus and found that C-terminal dye labeling impaired MMR function of MutLα. In contrast, N-terminal tagged MutLαs retained correct functionality and can be recommended both for the analysis of cellular localization and MMR efficiency. PMID:22348133

  9. C-terminal fluorescent labeling impairs functionality of DNA mismatch repair proteins.

    Angela Brieger

    Full Text Available The human DNA mismatch repair (MMR process is crucial to maintain the integrity of the genome and requires many different proteins which interact perfectly and coordinated. Germline mutations in MMR genes are responsible for the development of the hereditary form of colorectal cancer called Lynch syndrome. Various mutations mainly in two MMR proteins, MLH1 and MSH2, have been identified so far, whereas 55% are detected within MLH1, the essential component of the heterodimer MutLα (MLH1 and PMS2. Most of those MLH1 variants are pathogenic but the relevance of missense mutations often remains unclear. Many different recombinant systems are applied to filter out disease-associated proteins whereby fluorescent tagged proteins are frequently used. However, dye labeling might have deleterious effects on MutLα's functionality. Therefore, we analyzed the consequences of N- and C-terminal fluorescent labeling on expression level, cellular localization and MMR activity of MutLα. Besides significant influence of GFP- or Red-fusion on protein expression we detected incorrect shuttling of single expressed C-terminal GFP-tagged PMS2 into the nucleus and found that C-terminal dye labeling impaired MMR function of MutLα. In contrast, N-terminal tagged MutLαs retained correct functionality and can be recommended both for the analysis of cellular localization and MMR efficiency.

  10. Dendrimer-based biosensor for chemiluminescent detection of DNA hybridization

    Liu, P.; Hun, X.; Qing, H.


    We report on a highly sensitive chemiluminescent (CL) biosensor for the sequence-specific detection of DNA using a novel bio barcode DNA probe modified with gold nanoparticles that were covered with a dendrimer. The modified probe is composed of gold nanoparticles, a dendrimer, the CL reagent, and the DNA. The capture probe DNA was immobilized on magnetic beads covered with gold. It first hybridizes with the target DNA and then with one terminal end of the signal DNA on the barcoded DNA probe. CL was generated by adding H 2 O 2 and Co(II) ions as the catalyst. The immobilization of dendrimer onto the gold nanoparticles can significantly enhance sensitivity and gives a detection limit of 6 fmol L -1 of target DNA. (author)

  11. Environmental DNA (eDNA sampling improves occurrence and detection estimates of invasive burmese pythons.

    Margaret E Hunter

    Full Text Available Environmental DNA (eDNA methods are used to detect DNA that is shed into the aquatic environment by cryptic or low density species. Applied in eDNA studies, occupancy models can be used to estimate occurrence and detection probabilities and thereby account for imperfect detection. However, occupancy terminology has been applied inconsistently in eDNA studies, and many have calculated occurrence probabilities while not considering the effects of imperfect detection. Low detection of invasive giant constrictors using visual surveys and traps has hampered the estimation of occupancy and detection estimates needed for population management in southern Florida, USA. Giant constrictor snakes pose a threat to native species and the ecological restoration of the Florida Everglades. To assist with detection, we developed species-specific eDNA assays using quantitative PCR (qPCR for the Burmese python (Python molurus bivittatus, Northern African python (P. sebae, boa constrictor (Boa constrictor, and the green (Eunectes murinus and yellow anaconda (E. notaeus. Burmese pythons, Northern African pythons, and boa constrictors are established and reproducing, while the green and yellow anaconda have the potential to become established. We validated the python and boa constrictor assays using laboratory trials and tested all species in 21 field locations distributed in eight southern Florida regions. Burmese python eDNA was detected in 37 of 63 field sampling events; however, the other species were not detected. Although eDNA was heterogeneously distributed in the environment, occupancy models were able to provide the first estimates of detection probabilities, which were greater than 91%. Burmese python eDNA was detected along the leading northern edge of the known population boundary. The development of informative detection tools and eDNA occupancy models can improve conservation efforts in southern Florida and support more extensive studies of invasive

  12. Environmental DNA (eDNA) sampling improves occurrence and detection estimates of invasive burmese pythons.

    Hunter, Margaret E; Oyler-McCance, Sara J; Dorazio, Robert M; Fike, Jennifer A; Smith, Brian J; Hunter, Charles T; Reed, Robert N; Hart, Kristen M


    Environmental DNA (eDNA) methods are used to detect DNA that is shed into the aquatic environment by cryptic or low density species. Applied in eDNA studies, occupancy models can be used to estimate occurrence and detection probabilities and thereby account for imperfect detection. However, occupancy terminology has been applied inconsistently in eDNA studies, and many have calculated occurrence probabilities while not considering the effects of imperfect detection. Low detection of invasive giant constrictors using visual surveys and traps has hampered the estimation of occupancy and detection estimates needed for population management in southern Florida, USA. Giant constrictor snakes pose a threat to native species and the ecological restoration of the Florida Everglades. To assist with detection, we developed species-specific eDNA assays using quantitative PCR (qPCR) for the Burmese python (Python molurus bivittatus), Northern African python (P. sebae), boa constrictor (Boa constrictor), and the green (Eunectes murinus) and yellow anaconda (E. notaeus). Burmese pythons, Northern African pythons, and boa constrictors are established and reproducing, while the green and yellow anaconda have the potential to become established. We validated the python and boa constrictor assays using laboratory trials and tested all species in 21 field locations distributed in eight southern Florida regions. Burmese python eDNA was detected in 37 of 63 field sampling events; however, the other species were not detected. Although eDNA was heterogeneously distributed in the environment, occupancy models were able to provide the first estimates of detection probabilities, which were greater than 91%. Burmese python eDNA was detected along the leading northern edge of the known population boundary. The development of informative detection tools and eDNA occupancy models can improve conservation efforts in southern Florida and support more extensive studies of invasive constrictors

  13. Detection of parvovirus B19 DNA in blood: Viruses or DNA remnants?

    Molenaar-de Backer, M W A; Russcher, A; Kroes, A C M; Koppelman, M H G M; Lanfermeijer, M; Zaaijer, H L


    Parvovirus B19 (B19V) DNA can be detected in blood over a long period after acute infection. Several reports associate the presence of B19V DNA with disease, irrespective of timing of the initial B19V infection. This study aims to analyze the properties of B19V DNA in blood, differentiating between bare, non-infectious strands of DNA and B19V DNA in viable virions. Ten blood donors with asymptomatic acute B19V infection were followed and sampled up to 22 months after infection. The samples were treated with and without an endonuclease and tested for B19V DNA, to distinguish between DNA in virions and naked DNA. In the acute phase of infection, high levels of B19V DNA were detected, concurrent with B19V IgM antibodies. B19V DNA apparently was encapsidated, as indicated by resistance to endonuclease degradation. Subsequently, B19V DNA remained detectable for more than one year in all donors at low levels (<10 5 IU/mL). Approximately 150days after infection B19V DNA became degradable by an endonuclease, indicating that this concerned naked DNA. In some donors a second endonuclease-resistant peak occurred. Detection of B19V DNA in blood by PCR does not necessarily imply that B19V replication takes place and that infectious B19V virions are present. We propose that remnant B19V DNA strands can be released from tissues without active replication. This finding urges to reconsider an assumed role of B19V infection mainly based on B19V DNA detection in blood, a much debated subject in clinical syndromes such as myocarditis and arthritis. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin


    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

  15. Electrochemical DNA sandwich assay with a lipase label for attomole detection of DNA

    Ferapontova, Elena; Hansen, Majken Nørgaard; Saunders, Aaron Marc


    A fast and sensitive electrochemical lipase-based sandwich hybridization assay for detection of attomole levels of DNA has been developed. A combination of magnetic beads, used for pre-concentration and bioseparation of the analyte with a lipase catalyst label allowed detection of DNA with a limi...

  16. Assessing environmental DNA detection in controlled lentic systems.

    Moyer, Gregory R; Díaz-Ferguson, Edgardo; Hill, Jeffrey E; Shea, Colin


    Little consideration has been given to environmental DNA (eDNA) sampling strategies for rare species. The certainty of species detection relies on understanding false positive and false negative error rates. We used artificial ponds together with logistic regression models to assess the detection of African jewelfish eDNA at varying fish densities (0, 0.32, 1.75, and 5.25 fish/m3). Our objectives were to determine the most effective water stratum for eDNA detection, estimate true and false positive eDNA detection rates, and assess the number of water samples necessary to minimize the risk of false negatives. There were 28 eDNA detections in 324, 1-L, water samples collected from four experimental ponds. The best-approximating model indicated that the per-L-sample probability of eDNA detection was 4.86 times more likely for every 2.53 fish/m3 (1 SD) increase in fish density and 1.67 times less likely for every 1.02 C (1 SD) increase in water temperature. The best section of the water column to detect eDNA was the surface and to a lesser extent the bottom. Although no false positives were detected, the estimated likely number of false positives in samples from ponds that contained fish averaged 3.62. At high densities of African jewelfish, 3-5 L of water provided a >95% probability for the presence/absence of its eDNA. Conversely, at moderate and low densities, the number of water samples necessary to achieve a >95% probability of eDNA detection approximated 42-73 and >100 L, respectively. Potential biases associated with incomplete detection of eDNA could be alleviated via formal estimation of eDNA detection probabilities under an occupancy modeling framework; alternatively, the filtration of hundreds of liters of water may be required to achieve a high (e.g., 95%) level of certainty that African jewelfish eDNA will be detected at low densities (i.e., <0.32 fish/m3 or 1.75 g/m3).

  17. Sensitive Leptospira DNA detection using tapered optical fiber sensor.

    Zainuddin, Nurul H; Chee, Hui Y; Ahmad, Muhammad Z; Mahdi, Mohd A; Abu Bakar, Muhammad H; Yaacob, Mohd H


    This paper presents the development of tapered optical fiber sensor to detect a specific Leptospira bacteria DNA. The bacteria causes Leptospirosis, a deadly disease but with common early flu-like symptoms. Optical single mode fiber (SMF) of 125 μm diameter is tapered to produce 12 μm waist diameter and 15 cm length. The novel DNA-based optical fiber sensor is functionalized by incubating the tapered region with sodium hydroxide (NaOH), (3-Aminopropyl) triethoxysilane and glutaraldehyde. Probe DNA is immobilized onto the tapered region and subsequently hybridized by its complementary DNA (cDNA). The transmission spectra of the DNA-based optical fiber sensor are measured in the 1500 to 1600 nm wavelength range. It is discovered that the shift of the wavelength in the SMF sensor is linearly proportional with the increase in the cDNA concentrations from 0.1 to 1.0 nM. The sensitivity of the sensor toward DNA is measured to be 1.2862 nm/nM and able to detect as low as 0.1 fM. The sensor indicates high specificity when only minimal shift is detected for non-cDNA testing. The developed sensor is able to distinguish between actual DNA of Leptospira serovars (Canicola and Copenhageni) against Clostridium difficile (control sample) at very low (femtomolar) target concentrations. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Poly(o-phenylenediamine) colloid-quenched fluorescent oligonucleotide as a probe for fluorescence-enhanced nucleic acid detection.

    Tian, Jingqi; Li, Hailong; Luo, Yonglan; Wang, Lei; Zhang, Yingwei; Sun, Xuping


    In this Letter, we demonstrate that chemical oxidation polymerization of o-phenylenediamine (OPD) by potassium bichromate at room temperature results in the formation of submicrometer-scale poly(o-phenylenediamine) (POPD) colloids. Such colloids can absorb and quench dye-labeled single-stranded DNA (ssDNA) very effectively. In the presence of a target, a hybridization event occurs, which produces a double-stranded DNA (dsDNA) that detaches from the POPD surface, leading to recovery of dye fluorescence. With the use of an oligonucleotide (OND) sequence associated with human immunodeficiency virus (HIV) as a model system, we demonstrate the proof of concept that POPD colloid-quenched fluorescent OND can be used as a probe for fluorescence-enhanced nucleic acid detection with selectivity down to single-base mismatch.

  19. A Universal Fast Colorimetric Method for DNA Signal Detection with DNA Strand Displacement and Gold Nanoparticles

    Xin Li


    Full Text Available DNA or gene signal detection is of great significance in many fields including medical examination, intracellular molecular monitoring, and gene disease signal diagnosis, but detection of DNA or gene signals in a low concentration with instant visual results remains a challenge. In this work, a universal fast and visual colorimetric detection method for DNA signals is proposed. Specifically, a DNA signal amplification “circuit” based on DNA strand displacement is firstly designed to amplify the target DNA signals, and then thiol modified hairpin DNA strands and gold nanoparticles are used to make signal detection results visualized in a colorimetric manner. If the target DNA signal exists, the gold nanoparticles aggregate and settle down with color changing from dark red to grey quickly; otherwise, the gold nanoparticles’ colloids remain stable in dark red. The proposed method provides a novel way to detect quickly DNA or gene signals in low concentrations with instant visual results. When applied in real-life, it may provide a universal colorimetric method for gene disease signal diagnosis.

  20. Detection of DNA hybridizations using solid-state nanopores

    Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng


    We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

  1. Detection of DNA hybridizations using solid-state nanopores

    Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng, E-mail: [Department of Physics, Brown University, Providence, RI 02912 (United States)


    We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

  2. Environmental DNA (eDNA) Detection Probability Is Influenced by Seasonal Activity of Organisms.

    de Souza, Lesley S; Godwin, James C; Renshaw, Mark A; Larson, Eric


    Environmental DNA (eDNA) holds great promise for conservation applications like the monitoring of invasive or imperiled species, yet this emerging technique requires ongoing testing in order to determine the contexts over which it is effective. For example, little research to date has evaluated how seasonality of organism behavior or activity may influence detection probability of eDNA. We applied eDNA to survey for two highly imperiled species endemic to the upper Black Warrior River basin in Alabama, US: the Black Warrior Waterdog (Necturus alabamensis) and the Flattened Musk Turtle (Sternotherus depressus). Importantly, these species have contrasting patterns of seasonal activity, with N. alabamensis more active in the cool season (October-April) and S. depressus more active in the warm season (May-September). We surveyed sites historically occupied by these species across cool and warm seasons over two years with replicated eDNA water samples, which were analyzed in the laboratory using species-specific quantitative PCR (qPCR) assays. We then used occupancy estimation with detection probability modeling to evaluate both the effects of landscape attributes on organism presence and season of sampling on detection probability of eDNA. Importantly, we found that season strongly affected eDNA detection probability for both species, with N. alabamensis having higher eDNA detection probabilities during the cool season and S. depressus have higher eDNA detection probabilities during the warm season. These results illustrate the influence of organismal behavior or activity on eDNA detection in the environment and identify an important role for basic natural history in designing eDNA monitoring programs.

  3. Environmental DNA for Detection of Endangered Grouper Species (Epinephelus spp.

    Servet A. Doğdu


    Full Text Available Marine ecosystems nestle species or populations known to be threatened due to human overexploitation. Reliable detection and monitoring of threatened organisms is crucial for data-driven conservation actions. Furthermore, misidentification of species represents a major problem. Here, we investigate the potential of using metabarcoding of environmental DNA (eDNA obtained directly from seawater samples to detect endangered grouper species (Epinephelus spp.. Cytochrome c oxidase subunit I (COI fragment of mtDNA was used to detect groupers species in the Mediterranean Coasts. We conducted eDNA sampling at sites by underwater diving across the range of the Grouper species habitats in Northeastern Mediterranean (Antalya-Kas Region and Iskenderun Bay. eDNA was isolated from 2 liter seawater samples which were vacuum-filtered onto 0.45-mm membrane filters. Filters were then folded inwards, placed in 2 ml tubes and stored at -20 oC until DNA extraction, which took place within 24 hours. DNA was extracted from the water sample filters using the DNeasy Blood and Tissue Kit (Qiagen, USA. Manufacturer’s protocols were used during all steps. PCR amplification of eDNA samples were done using selective primers of COI region of mitochondrial DNA, and next-generation DNA sequencing of PCR application was conducted. For the successfully obtained COI sequences, maximum matching rates were revealed as 80% for Epinephelus marginatus, 78,95% for Epinephelus aeneus, 73,48% for Epinephelus costae, 63,45% for Epinephelus caninus, 60,12% for Mycteroperca rubra and 57,12% for Hyporthodus haifensis. Despite the methodological challenges inherent in eDNA analysis, the results demonstrated that eDNA method may be proved to step towards a new beginning to detect and monitor endangered grouper species.

  4. Allele-Specific DNA Methylation Detection by Pyrosequencing®

    Kristensen, Lasse Sommer; Johansen, Jens Vilstrup; Grønbæk, Kirsten


    DNA methylation is an epigenetic modification that plays important roles in healthy as well as diseased cells, by influencing the transcription of genes. In spite the fact that human somatic cells are diploid, most of the currently available methods for the study of DNA methylation do not provide......-effective protocol for allele-specific DNA methylation detection based on Pyrosequencing(®) of methylation-specific PCR (MSP) products including a single nucleotide polymorphism (SNP) within the amplicon....

  5. DNA-based species detection capabilities using laser transmission spectroscopy.

    Mahon, A R; Barnes, M A; Li, F; Egan, S P; Tanner, C E; Ruggiero, S T; Feder, J L; Lodge, D M


    Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel (Dreissena bugensis) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications.

  6. A universal DNA-based protein detection system.

    Tran, Thua N N; Cui, Jinhui; Hartman, Mark R; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C; Lis, John T; Cui, Haixin; Luo, Dan


    Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability.

  7. DNA microarray technique for detecting food-borne pathogens

    Xing GAO


    Full Text Available Objective To study the application of DNA microarray technique for screening and identifying multiple food-borne pathogens. Methods The oligonucleotide probes were designed by Clustal X and Oligo 6.0 at the conserved regions of specific genes of multiple food-borne pathogens, and then were validated by bioinformatic analyses. The 5' end of each probe was modified by amino-group and 10 Poly-T, and the optimized probes were synthesized and spotted on aldehyde-coated slides. The bacteria DNA template incubated with Klenow enzyme was amplified by arbitrarily primed PCR, and PCR products incorporated into Aminoallyl-dUTP were coupled with fluorescent dye. After hybridization of the purified PCR products with DNA microarray, the hybridization image and fluorescence intensity analysis was acquired by ScanArray and GenePix Pro 5.1 software. A series of detection conditions such as arbitrarily primed PCR and microarray hybridization were optimized. The specificity of this approach was evaluated by 16 different bacteria DNA, and the sensitivity and reproducibility were verified by 4 food-borne pathogens DNA. The samples of multiple bacteria DNA and simulated water samples of Shigella dysenteriae were detected. Results Nine different food-borne bacteria were successfully discriminated under the same condition. The sensitivity of genomic DNA was 102 -103pg/ μl, and the coefficient of variation (CV of the reproducibility of assay was less than 15%. The corresponding specific hybridization maps of the multiple bacteria DNA samples were obtained, and the detection limit of simulated water sample of Shigella dysenteriae was 3.54×105cfu/ml. Conclusions The DNA microarray detection system based on arbitrarily primed PCR can be employed for effective detection of multiple food-borne pathogens, and this assay may offer a new method for high-throughput platform for detecting bacteria.

  8. RADIA: RNA and DNA integrated analysis for somatic mutation detection.

    Amie J Radenbaugh

    Full Text Available The detection of somatic single nucleotide variants is a crucial component to the characterization of the cancer genome. Mutation calling algorithms thus far have focused on comparing the normal and tumor genomes from the same individual. In recent years, it has become routine for projects like The Cancer Genome Atlas (TCGA to also sequence the tumor RNA. Here we present RADIA (RNA and DNA Integrated Analysis, a novel computational method combining the patient-matched normal and tumor DNA with the tumor RNA to detect somatic mutations. The inclusion of the RNA increases the power to detect somatic mutations, especially at low DNA allelic frequencies. By integrating an individual's DNA and RNA, we are able to detect mutations that would otherwise be missed by traditional algorithms that examine only the DNA. We demonstrate high sensitivity (84% and very high precision (98% and 99% for RADIA in patient data from endometrial carcinoma and lung adenocarcinoma from TCGA. Mutations with both high DNA and RNA read support have the highest validation rate of over 99%. We also introduce a simulation package that spikes in artificial mutations to patient data, rather than simulating sequencing data from a reference genome. We evaluate sensitivity on the simulation data and demonstrate our ability to rescue back mutations at low DNA allelic frequencies by including the RNA. Finally, we highlight mutations in important cancer genes that were rescued due to the incorporation of the RNA.

  9. Electrochemical detection of DNA triplet repeat expansion

    Fojta, Miroslav; Havran, Luděk; Vojtíšková, Marie; Paleček, Emil


    Roč. 126, č. 21 (2004), s. 6532-6533 ISSN 0002-7863 R&D Projects: GA AV ČR IAA4004402; GA AV ČR IBS5004355; GA AV ČR KJB4004302; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA triplet repeat expansion * PCR amplification * neurodegenerative diseases Subject RIV: BO - Biophysics Impact factor: 6.903, year: 2004

  10. Immunochemical detection of oxidatively damaged DNA

    Rössner ml., Pavel; Šrám, Radim


    Roč. 46, č. 4 (2012), s. 492-522 ISSN 1071-5762 R&D Projects: GA MŽP(CZ) SP/1B3/50/07; GA MŠk 2B08005; GA ČR GAP503/11/0084 Institutional research plan: CEZ:AV0Z50390703 Institutional support: RVO:68378041 Keywords : oxidative DNA damage * ELISA * immunohistochemistry Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 3.279, year: 2012

  11. High-speed detection of DNA translocation in nanopipettes

    Fraccari, Raquel L.; Ciccarella, Pietro; Bahrami, Azadeh; Carminati, Marco; Ferrari, Giorgio; Albrecht, Tim


    We present a high-speed electrical detection scheme based on a custom-designed CMOS amplifier which allows the analysis of DNA translocation in glass nanopipettes on a microsecond timescale. Translocation of different DNA lengths in KCl electrolyte provides a scaling factor of the DNA translocation time equal to p = 1.22, which is different from values observed previously with nanopipettes in LiCl electrolyte or with nanopores. Based on a theoretical model involving electrophoresis, hydrodynamics and surface friction, we show that the experimentally observed range of p-values may be the result of, or at least be affected by DNA adsorption and friction between the DNA and the substrate surface.We present a high-speed electrical detection scheme based on a custom-designed CMOS amplifier which allows the analysis of DNA translocation in glass nanopipettes on a microsecond timescale. Translocation of different DNA lengths in KCl electrolyte provides a scaling factor of the DNA translocation time equal to p = 1.22, which is different from values observed previously with nanopipettes in LiCl electrolyte or with nanopores. Based on a theoretical model involving electrophoresis, hydrodynamics and surface friction, we show that the experimentally observed range of p-values may be the result of, or at least be affected by DNA adsorption and friction between the DNA and the substrate surface. Electronic supplementary information (ESI) available: Gel electrophoresis confirming lengths and purity of DNA samples, comparison between Axopatch 200B and custom-built setup, comprehensive low-noise amplifier characterization, representative I-V curves of nanopipettes used, typical scatter plots of τ vs. peak amplitude for the four LDNA's used, table of most probable τ values, a comparison between different fitting models for the DNA translocation time distribution, further details on the stochastic numerical simulation of the scaling statistics and the derivation of the extended

  12. Novel DNA sequence detection method based on fluorescence energy transfer

    Kobayashi, S.; Tamiya, E.; Karube, I.


    Recently the detection of specific DNA sequence, DNA analysis, has been becoming more important for diagnosis of viral genomes causing infections disease and human sequences related to inherited disorders. These methods typically involve electrophoresis, the immobilization of DNA on a solid support, hybridization to a complementary probe, the detection using labeled with /sup 32/P or nonisotopically with a biotin-avidin-enzyme system, and so on. These techniques are highly effective, but they are very time-consuming and expensive. A principle of fluorescene energy transfer is that the light energy from an excited donor (fluorophore) is transferred to an acceptor (fluorophore), if the acceptor exists in the vicinity of the donor and the excitation spectrum of donor overlaps the emission spectrum of acceptor. In this study, the fluorescence energy transfer was applied to the detection of specific DNA sequence using the hybridization method. The analyte, single-stranded DNA labeled with the donor fluorophore is hybridized to a probe DNA labeled with the acceptor. Because of the complementary DNA duplex formation, two fluorophores became to be closed to each other, and the fluorescence energy transfer was occurred

  13. DNA based methods used for characterization and detection of food ...

    Detection of food borne pathogen is of outmost importance in the food industries and related agencies. For the last few decades conventional methods were used to detect food borne pathogens based on phenotypic characters. At the advent of complementary base pairing and amplification of DNA, the diagnosis of food ...

  14. Detecting differential DNA methylation from sequencing of bisulfite converted DNA of diverse species.

    Huh, Iksoo; Wu, Xin; Park, Taesung; Yi, Soojin V


    DNA methylation is one of the most extensively studied epigenetic modifications of genomic DNA. In recent years, sequencing of bisulfite-converted DNA, particularly via next-generation sequencing technologies, has become a widely popular method to study DNA methylation. This method can be readily applied to a variety of species, dramatically expanding the scope of DNA methylation studies beyond the traditionally studied human and mouse systems. In parallel to the increasing wealth of genomic methylation profiles, many statistical tools have been developed to detect differentially methylated loci (DMLs) or differentially methylated regions (DMRs) between biological conditions. We discuss and summarize several key properties of currently available tools to detect DMLs and DMRs from sequencing of bisulfite-converted DNA. However, the majority of the statistical tools developed for DML/DMR analyses have been validated using only mammalian data sets, and less priority has been placed on the analyses of invertebrate or plant DNA methylation data. We demonstrate that genomic methylation profiles of non-mammalian species are often highly distinct from those of mammalian species using examples of honey bees and humans. We then discuss how such differences in data properties may affect statistical analyses. Based on these differences, we provide three specific recommendations to improve the power and accuracy of DML and DMR analyses of invertebrate data when using currently available statistical tools. These considerations should facilitate systematic and robust analyses of DNA methylation from diverse species, thus advancing our understanding of DNA methylation. © The Author 2017. Published by Oxford University Press.

  15. Optical Detection of Non-amplified Genomic DNA

    Li, Di; Fan, Chunhai

    Nucleic acid sequences are unique to every living organisms including animals, plants and even bacteria and virus, which provide a practical molecular target for the identification and diagnosis of various diseases. DNA contains heterocyclic rings that has inherent optical absorbance at 260 nm, which is widely used to quantify single and double stranded DNA in biology. However, this simple quantification method could not differentiate sequences; therefore it is not suitable for sequence-specific analyte detection. In addition to a few exceptions such as chiral-related circular dichroism spectra, DNA hybridization does not produce significant changes in optical signals, thus an optical label is generally needed for sequence-specific DNA detection with optical means. During the last two decades, we have witnessed explosive progress in the area of optical DNA detection, especially with the help of simultaneously rapidly developed nanomaterials. In this chapter, we will summarize recent advances in optical DNA detection including colorimetric, fluorescent, luminescent, surface plasmon resonance (SPR) and Raman scattering assays. Challenges and problems remained to be addressed are also discussed.

  16. Detection of an enigmatic plethodontid Salamander using Environmental DNA

    Pierson, Todd W.; Mckee, Anna; Spear, Stephen F.; Maerz, John C.; Camp, Carlos D.; Glenn, Travis C.


    The isolation and identification of environmental DNA (eDNA) offers a non-invasive and efficient method for the detection of rare and secretive aquatic wildlife, and it is being widely integrated into inventory and monitoring efforts. The Patch-Nosed Salamander (Urspelerpes brucei) is a tiny, recently discovered species of plethodontid salamander known only from headwater streams in a small region of Georgia and South Carolina. Here, we present results of a quantitative PCR-based eDNA assay capable of detecting Urspelerpes in more than 75% of 33 samples from five confirmed streams. We deployed the method at 31 additional streams and located three previously undocumented populations of Urspelerpes. We compare the results of our eDNA assay with our attempt to use aquatic leaf litterbags for the rapid detection of Urspelerpes and demonstrate the relative efficacy of the eDNA assay. We suggest that eDNA offers great potential for use in detecting other aquatic and semi-aquatic plethodontid salamanders.

  17. Constructing and detecting a cDNA library for mites.

    Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui


    RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

  18. Performance of mitochondrial DNA mutations detecting early stage cancer

    Jakupciak, John P; Srivastava, Sudhir; Sidransky, David; O'Connell, Catherine D; Maragh, Samantha; Markowitz, Maura E; Greenberg, Alissa K; Hoque, Mohammad O; Maitra, Anirban; Barker, Peter E; Wagner, Paul D; Rom, William N


    Mutations in the mitochondrial genome (mtgenome) have been associated with cancer and many other disorders. These mutations can be point mutations or deletions, or admixtures (heteroplasmy). The detection of mtDNA mutations in body fluids using resequencing microarrays, which are more sensitive than other sequencing methods, could provide a strategy to measure mutation loads in remote anatomical sites. We determined the mtDNA mutation load in the entire mitochondrial genome of 26 individuals with different early stage cancers (lung, bladder, kidney) and 12 heavy smokers without cancer. MtDNA was sequenced from three matched specimens (blood, tumor and body fluid) from each cancer patient and two matched specimens (blood and sputum) from smokers without cancer. The inherited wildtype sequence in the blood was compared to the sequences present in the tumor and body fluid, detected using the Affymetrix Genechip ® Human Mitochondrial Resequencing Array 1.0 and supplemented by capillary sequencing for noncoding region. Using this high-throughput method, 75% of the tumors were found to contain mtDNA mutations, higher than in our previous studies, and 36% of the body fluids from these cancer patients contained mtDNA mutations. Most of the mutations detected were heteroplasmic. A statistically significantly higher heteroplasmy rate occurred in tumor specimens when compared to both body fluid of cancer patients and sputum of controls, and in patient blood compared to blood of controls. Only 2 of the 12 sputum specimens from heavy smokers without cancer (17%) contained mtDNA mutations. Although patient mutations were spread throughout the mtDNA genome in the lung, bladder and kidney series, a statistically significant elevation of tRNA and ND complex mutations was detected in tumors. Our findings indicate comprehensive mtDNA resequencing can be a high-throughput tool for detecting mutations in clinical samples with potential applications for cancer detection, but it is

  19. Facilitating the indirect detection of genomic DNA in an electrochemical DNA biosensor using magnetic nanoparticles and DNA ligase

    Roozbeh Hushiarian


    This technique was found to be reliably repeatable. The indirect detection of genomic DNA using this method is significantly improved and showed high efficiency in small amounts of samples with the detection limit of 5.37 × 10−14 M.

  20. Detection of Adult Green Sturgeon Using Environmental DNA Analysis.

    Paul S Bergman

    Full Text Available Environmental DNA (eDNA is an emerging sampling method that has been used successfully for detection of rare aquatic species. The Identification of sampling tools that are less stressful for target organisms has become increasingly important for rare and endangered species. A decline in abundance of the Southern Distinct Population Segment (DPS of North American Green Sturgeon located in California's Central Valley has led to its listing as Threatened under the Federal Endangered Species Act in 2006. While visual surveys of spawning Green Sturgeon in the Central Valley are effective at monitoring fish densities in concentrated pool habitats, results do not scale well to the watershed level, providing limited spatial and temporal context. Unlike most traditional survey methods, environmental DNA analysis provides a relatively quick, inexpensive tool that could efficiently monitor the presence and distribution of aquatic species. We positively identified Green Sturgeon DNA at two locations of known presence in the Sacramento River, proving that eDNA can be effective for monitoring the presence of adult sturgeon. While further study is needed to understand uncertainties of the sampling method, our study represents the first documented detection of Green Sturgeon eDNA, indicating that eDNA analysis could provide a new tool for monitoring Green Sturgeon distribution in the Central Valley, complimenting traditional on-going survey methods.

  1. Detection of DNA nucleotides on pretreated boron doped diamond electrodes

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko [UNESP, Araraquara, SP (Brazil). Inst. de Quimica


    The individual detection and equimolar mixture of DNA nucleotides guanosine monophosphate (GMP), adenosine monophosphate (AMP), thymidine (TMP) and cytidine (CMP) 5'-monophosphate using square wave voltammetry was performed on boron doped diamond (BDD) electrodes cathodically (Red-DDB) and anodically (Oxi-DDB) pretreated. The oxidation of individual DNA nucleotides was more sensitive on Oxi-BDD electrode. In a simultaneous detection of nucleotides, the responses of GMP, AMP, TMP and CMP were very adequate on both treated electrodes. Particularly, more sensitive and separate peaks for TMP and CMP on Oxi-BDD and Red-BDD electrodes, respectively, were observed after deconvolution procedure. The detection of nucleotides in aqueous solutions will certainly contribute for genotoxic evaluation of substances and hybridization reactions by immobilizing ss or ds-DNA on BDD surface. (author)

  2. A multiplex microplatform for the detection of multiple DNA methylation events using gold-DNA affinity.

    Sina, Abu Ali Ibn; Foster, Matthew Thomas; Korbie, Darren; Carrascosa, Laura G; Shiddiky, Muhammad J A; Gao, Jing; Dey, Shuvashis; Trau, Matt


    We report a new multiplexed strategy for the electrochemical detection of regional DNA methylation across multiple regions. Using the sequence dependent affinity of bisulfite treated DNA towards gold surfaces, the method integrates the high sensitivity of a micro-fabricated multiplex device comprising a microarray of gold electrodes, with the powerful multiplexing capability of multiplex-PCR. The synergy of this combination enables the monitoring of the methylation changes across several genomic regions simultaneously from as low as 500 pg μl -1 of DNA with no sequencing requirement.

  3. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa


    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636

  4. Detection of circular telomeric DNA without 2D gel electrophoresis.

    Dlaska, Margit; Anderl, Conrad; Eisterer, Wolfgang; Bechter, Oliver E


    The end of linear chromosomes forms a lasso-like structure called the t-loop. Such t-loops resemble a DNA recombination intermediate, where the single-stranded 3' overhang is arrested in a stretch of duplex DNA. Presumably, such a t-loop can also be deleted via a recombination process. This would result in the occurrence of circular extrachromosomal telomeric DNA (t-circles), which are known to be abundantly present in immortal cells engaging the recombination-based alternative lengthening of telomeres pathway (ALT pathway). Little is known about the basic mechanism of telomeric recombination in these cells and what ultimately causes the generation of such t-circles. Current standard procedures for detecting these molecules involve 2D gel electrophoresis or electron microscopy. However, both methods are labor intense and sophisticated to perform. Here, we present a simpler, faster, and equally sensitive method for detecting t-circles. Our approach is a telomere restriction fragment assay that involves the enzymatic preservation of circular DNA with Klenow enzyme followed by Bal31 degradation of the remaining linear DNA molecules. We show that with this approach t-circles can be detected in ALT cell lines, whereas no t-circles are present in telomerase-positive cell lines. We consider our approach a valid method in which t-circle generation is the experimental readout.

  5. Development of DNA elution method to detect irradiated foodstuff

    Copin, M.P.; Bourgeois, C.M.


    The aim of the work is to develop a reliable method to detect whether a fresh and frozen foodstuff has been irradiated. The molecule of DNA is one of the targets of ionizing radiation. The induction of three major classes of lesion have been shown. Double strand breaks, single strand breaks and base damage. Among the different techniques used to observe and quantify the strand breaks, techniques of elution are very interesting. The method proposed consisted of a filtration of the DNA at the atmospheric pressure and in non denaturing conditions. The amount of DNA retained on the filter is measured after being suitably labelled by microfluorometry. A difference in the amount of DNA retained on a filter of 2 μm from a lysed muscular tissue sample between a frozen Norway lobster which has been irradiated and one which has not, is observed. 7 refs

  6. A dynamic bead-based microarray for parallel DNA detection

    Sochol, R D; Lin, L; Casavant, B P; Dueck, M E; Lee, L P


    A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm 2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening

  7. Detection of carcinogen-DNA adducts by radioimmunoassay

    Poirier, M.C.; Yuspa, S.H.; Weinstein, I.B.; Blobstein, S.


    Covalent binding of carcinogen to nucleic acids is believed to be an essential component of the carcinogenic process, so it is desirable to have highly sensitive and specific methods for detecting such adducts in cells and tissues exposed to known and suspected carcinogens. A radioimmunoassay is here described capable of detecting nanogram amounts of DNA adducts resulting from the covalent binding of the carcinogen N-2-acetylaminofluorene and its activated N-acetoxy derivative. (author)

  8. Irradiation detection of food by DNA Comet Assay

    Khan, A.A.; Delincee, H.


    Microgel electrophoresis of single cells or nuclei (DNA Comet Assay) has been investigated to detect irradiation treatment of more than 50 food commodities e.g. meats, seafood, cereals, pulses, nuts, fruits and vegetables, and spices. The foodstuffs have been exposed to radiation doses covering the range of potential commercial irradiation for inactivation of pathogenic and spoilage micro-organisms, for insect disinfestation and for shelf-life extension. The Comet Assay is based on detection of DNA fragments presumptive to irradiation. For most of the food items investigated, the assay can be applied successfully for irradiation detection by working out different conditions of the assay. However, with some of the foods difficulties arose due to - lack of discrimination between the irradiated and unirradiated food samples due to the presence of the same kinds of comets in both cases and the total absence of the typical intact cells in unirradiated samples. - Sufficient DNA material was not available from some of the foods. - Insufficient lysis of the cell walls in case of some plant foods. In conclusion, the DNA Comet Assay can help to detect the irradiation treatment of several varieties of foods using low-cost equipment in a short time of analysis. (orig.)

  9. Synthesis of streptavidin-conjugated magnetic nanoparticles for DNA detection

    Gong Peijun; Peng Zheyang; Wang Yao; Qiao Ru; Mao Weixing; Qian Haisheng; Zhang Mengya; Li Congcong; Shi Shenyuan


    In this paper, we report a fabrication of streptavidin-coated magnetic nanoparticles used for DNA detection. Initially, amino-functionalized Fe 3 O 4 nanoparticles with high saturation magnetization are prepared by a photopolymerization method using allylamine as monomer. It is followed by covalent immobilization of streptavidin onto the particle surface via a two-step reaction using glutaraldehyde as coupling agent. Streptavidin-coated magnetic nanoparticles are characterized and further tested for their ability to capture DNA target after binding biotinylated oligonucleotide probes. The results show that the products (∼27.2 nm) have a maximum biotin-binding capacity of 0.71 nmol mg −1 when the immobilization reaction is conducted with a mass ratio of streptavidin to magnetic carriers above 0.2 in phosphate buffered saline (pH 7.4) for 24 h. In addition, highly negative ζ-potential and good magnetic susceptibility of the nanocomposites make them applicable for DNA collection and detection, which is verified by the results from the preliminary application of streptavidin-coated magnetic nanoparticles in DNA detection. Therefore, the magnetic nanoparticles provide a promising approach for rapid collection and detection of gene.

  10. Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes

    Yuji Miyahara


    Full Text Available Peptide nucleic acid (PNA has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry.

  11. Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes

    Goda, Tatsuro; Singi, Ankit Balram; Maeda, Yasuhiro; Matsumoto, Akira; Torimura, Masaki; Aoki, Hiroshi; Miyahara, Yuji


    Peptide nucleic acid (PNA) has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM)-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry. PMID:23435052

  12. Whole genomic DNA probe for detection of Porphyromonas endodontalis.

    Nissan, R; Makkar, S R; Sela, M N; Stevens, R


    The purpose of the present study was to develop a DNA probe for Porphyromonas endodontalis. Pure cultures of P. endodontalis were grown in TYP medium, in an anaerobic chamber. DNA was extracted from the P. endodontalis and labeled using the Genius System by Boehringer Mannheim. The labeled P. endodontalis DNA was used in dot-blot hybridization reactions with homologous (P. endodontalis) and unrelated bacterial samples. To determine specificity, strains of 40 other oral bacterial species (e.g. Porphyromonas gingivalis, Porphyromonas asaccharolytica, and Prevotella intermedia) were spotted and reacted with the P. endodontalis DNA probe. None of the panel of 40 oral bacteria hybridized with the P. endodontalis probe, whereas the blot of the homologous organism showed a strong positive reaction. To determine the sensitivity of the probe, dilutions of a P. endodontalis suspension of known concentration were blotted onto a nylon membrane and reacted with the probe. The results of our investigation indicate that the DNA probe that we have prepared specifically detects only P. endodontalis and can detect at least 3 x 10(4) cells.

  13. Effect of sample storage time on detection of hybridization signals in Checkerboard DNA-DNA hybridization.

    do Nascimento, Cássio; Muller, Katia; Sato, Sandra; Albuquerque Junior, Rubens Ferreira


    Long-term sample storage can affect the intensity of the hybridization signals provided by molecular diagnostic methods that use chemiluminescent detection. The aim of this study was to evaluate the effect of different storage times on the hybridization signals of 13 bacterial species detected by the Checkerboard DNA-DNA hybridization method using whole-genomic DNA probes. Ninety-six subgingival biofilm samples were collected from 36 healthy subjects, and the intensity of hybridization signals was evaluated at 4 different time periods: (1) immediately after collecting (n = 24) and (2) after storage at -20 °C for 6 months (n = 24), (3) for 12 months (n = 24), and (4) for 24 months (n = 24). The intensity of hybridization signals obtained from groups 1 and 2 were significantly higher than in the other groups (p  0.05). The Checkerboard DNA-DNA hybridization method was suitable to detect hybridization signals from all groups evaluated, and the intensity of signals decreased significantly after long periods of sample storage.

  14. DNA biosensor by self-assembly of carbon nanotubes and DNA to detect riboflavin

    Li Jing [College of Chemistry and Chemical Engineering. Chongqing University, ChongQing, 400044 (China); Zhang Yunhuai, E-mail: [College of Chemistry and Chemical Engineering. Chongqing University, ChongQing, 400044 (China); Yang Tongyi [School of Life Science. NanJing University, Nanjing, 210093 (China); Zhang Huai [Liming Research Institute of Chemical Industry, LuoYang, 471001 (China); Yang Yixuan [State Key Laboratory of Chemical Resource Engineering. Beijing University of Chemical Technology, Beijing 100029 (China); Xiao Peng [College of Mathematics and Physics, Chongqing University, Chongqing 400044 (China)


    The fabrication of biosensors via self-assembly of single-walled carbon nanotubes (SWNTs) and DNA on a platinum electrode was presented in this paper. The carboxylic SWNTs were assembled on an amine-modified platinum electrode surface and followed by the assembly of NH{sub 2}-DNA with the carboxyl-amine coupling. The decorated surface was characterized by Field Emission Electron Microscopy (FEG-SEM) and electrochemical experiments, which showed that the reaction of DNA-SWNTs biosensor was quasi-reversible. The mechanism of DNA and riboflavin (VB{sub 2}) was studied by cyclic voltammetry and UV-Vis spectroscopy. The fabricated SWNTs-reinforced biosensor exhibits high sensitivity and low detection limit for the tested VB{sub 2} compared to the reported methods.

  15. Statistical guidelines for detecting past population shifts using ancient DNA

    Mourier, Tobias; Ho, Simon Y. W.; Gilbert, Tom


    Populations carry a genetic signal of their demographic past, providing an opportunity for investigating the processes that shaped their evolution. Our ability to infer population histories can be enhanced by including ancient DNA data. Using serial-coalescent simulations and a range of both...... quantitative and temporal sampling schemes, we test the power of ancient mitochondrial sequences and nuclear single-nucleotide polymorphisms (SNPs) to detect past population bottlenecks. Within our simulated framework, mitochondrial sequences have only limited power to detect subtle bottlenecks and/or fast...... results provide useful guidelines for scaling sampling schemes and for optimizing our ability to infer past population dynamics. In addition, our results suggest that many ancient DNA studies may face power issues in detecting moderate demographic collapses and/or highly dynamic demographic shifts when...

  16. Detection and size analysis of proteins with switchable DNA layers.

    Rant, Ulrich; Pringsheim, Erika; Kaiser, Wolfgang; Arinaga, Kenji; Knezevic, Jelena; Tornow, Marc; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard


    We introduce a chip-compatible scheme for the label-free detection of proteins in real-time that is based on the electrically driven conformation switching of DNA oligonucleotides on metal surfaces. The switching behavior is a sensitive indicator for the specific recognition of IgG antibodies and antibody fragments, which can be detected in quantities of less than 10(-18) mol on the sensor surface. Moreover, we show how the dynamics of the induced molecular motion can be monitored by measuring the high-frequency switching response. When proteins bind to the layer, the increase in hydrodynamic drag slows the switching dynamics, which allows us to determine the size of the captured proteins. We demonstrate the identification of different antibody fragments by means of their kinetic fingerprint. The switchDNA method represents a generic approach to simultaneously detect and size target molecules using a single analytical platform.

  17. Direct immobilization and hybridization of DNA on group III nitride semiconductors

    Xu Xiaobin; Jindal, Vibhu; Shahedipour-Sandvik, Fatemeh; Bergkvist, Magnus [College of Nanoscale Science and Engineering, University at Albany (SUNY), 255 Fuller Road, Albany, NY 12203 (United States); Cady, Nathaniel C. [College of Nanoscale Science and Engineering, University at Albany (SUNY), 255 Fuller Road, Albany, NY 12203 (United States)], E-mail:


    A key concern for group III-nitride high electron mobility transistor (HEMT) biosensors is the anchoring of specific capture molecules onto the gate surface. To this end, a direct immobilization strategy was developed to attach single-stranded DNA (ssDNA) to AlGaN surfaces using simple printing techniques without the need for cross-linking agents or complex surface pre-functionalization procedures. Immobilized DNA molecules were stably attached to the AlGaN surfaces and were able to withstand a range of pH and ionic strength conditions. The biological activity of surface-immobilized probe DNA was also retained, as demonstrated by sequence-specific hybridization experiments. Probe hybridization with target ssDNA could be detected by PicoGreen fluorescent dye labeling with a minimum detection limit of 2 nM. These experiments demonstrate a simple and effective immobilization approach for attaching nucleic acids to AlGaN surfaces which can further be used for the development of HEMT-based DNA biosensors.

  18. Detection of extracellular genomic DNA scaffold in human thrombus

    Oklu, Rahmi; Albadawi, Hassan; Watkins, Michael T


    into thrombus remodeling. MATERIALS AND METHODS: Ten human thrombus samples were collected during cases of thrombectomy and open surgical repair of abdominal aortic aneurysms (five samples 1 y old). Additionally, an acute murine hindlimb ischemia model was created to evaluate...... thrombus samples in mice. Human sections were immunostained for the H2A/H2B/DNA complex, myeloperoxidase, fibrinogen, and von Willebrand factor. Mouse sections were immunostained with the H2A antibody. All samples were further evaluated after hematoxylin and eosin and Masson trichrome staining. RESULTS......: An extensive network of extracellular histone/DNA complex was demonstrated in the matrix of human ex vivo thrombus. This network is present throughout the highly cellular acute thrombus. However, in chronic thrombi, detection of the histone/DNA network was predominantly in regions of low collagen content...

  19. Application of DNA-DNA colony hybridization to the detection of catabolic genotypes in environmental samples

    Sayler, G.S.; Shields, M.S.; Tedford, E.T.; Breen, A.; Hooper, S.W.; Sirotkin, K.M.; Davis, J.W.


    The application of preexisting DNA hybridization techniques was investigated for potential in determining populations of specific gene sequences in environmental samples. Cross-hybridizations among two degradative plasmids, TOL and NAH, and two cloning vehicles, pLAFR1 and RSF1010, were determined. The detection limits for the TOL plasmid against a nonhomologous plasmid-bearing bacterial background was ascertained. The colony hybridization technique allowed detection of one colony containing TOL plasmid among 10(6) Escherichia coli colonies of nonhomologous DNA. Comparisons between population estimates derived from growth on selective substrates and from hybridizations were examined. Findings indicated that standard sole carbon source enumeration procedures for degradative populations lead to overestimations due to nonspecific growth of other bacteria on the microcontaminant carbon sources present in the media. Population estimates based on the selective growth of a microcosm population on two aromatic substrates (toluene and naphthalene) and estimates derived from DNA-DNA colony hybridizations, using the TOL or NAH plasmid as a probe, corresponded with estimates of substrate mineralization rates and past exposure to environmental contaminants. The applications of such techniques are hoped to eventually allow enumeration of any specific gene sequences in the environment, including both anabolic and catabolic genes. In addition, this procedure should prove useful in monitoring recombinant DNA clones released into environmental situations

  20. Environmental DNA (eDNA metabarcoding assays to detect invasive invertebrate species in the Great Lakes.

    Katy E Klymus

    Full Text Available Describing and monitoring biodiversity comprise integral parts of ecosystem management. Recent research coupling metabarcoding and environmental DNA (eDNA demonstrate that these methods can serve as important tools for surveying biodiversity, while significantly decreasing the time, expense and resources spent on traditional survey methods. The literature emphasizes the importance of genetic marker development, as the markers dictate the applicability, sensitivity and resolution ability of an eDNA assay. The present study developed two metabarcoding eDNA assays using the mtDNA 16S RNA gene with Illumina MiSeq platform to detect invertebrate fauna in the Laurentian Great Lakes and surrounding waterways, with a focus for use on invasive bivalve and gastropod species monitoring. We employed careful primer design and in vitro testing with mock communities to assess ability of the markers to amplify and sequence targeted species DNA, while retaining rank abundance information. In our mock communities, read abundances reflected the initial input abundance, with regressions having significant slopes (p<0.05 and high coefficients of determination (R2 for all comparisons. Tests on field environmental samples revealed similar ability of our markers to measure relative abundance. Due to the limited reference sequence data available for these invertebrate species, care must be taken when analyzing results and identifying sequence reads to species level. These markers extend eDNA metabarcoding research for molluscs and appear relevant to other invertebrate taxa, such as rotifers and bryozoans. Furthermore, the sphaeriid mussel assay is group-specific, exclusively amplifying bivalves in the Sphaeridae family and providing species-level identification. Our assays provide useful tools for managers and conservation scientists, facilitating early detection of invasive species as well as improving resolution of mollusc diversity.

  1. DNA Nucleotides Detection via capacitance properties of Graphene

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash


    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  2. Detection of DNA fingerprints of cultivated rice by hybridization with a human minisatellite DNA probe

    Dallas, J.F.


    A human minisatellite DNA probe detects several restriction fragment length polymorphisms in cultivars of Asian and African rice. Certain fragments appear to be inherited in a Mendelian fashion and may represent unlinked loci. The hybridization patterns appear to be cultivar-specific and largely unchanged after the regeneration of plants from tissue culture. The results suggest that these regions of the rice genome may be used to generate cultivar-specific DNA fingerprints. The demonstration of similarity between a human minisatellite sequence and polymorphic regions in the rice genome suggests that such regions also occur in the genomes of many other plant species

  3. The strategies of DNA immobilization and hybridization detection mechanism in the construction of electrochemical DNA sensor: A review

    Jahwarhar Izuan Abdul Rashid


    Full Text Available In recent years, electrochemical deoxyribonucleic acid (DNA sensor has recently emerged as promising alternative clinical diagnostic devices especially for infectious disease by exploiting DNA recognition events and converting them into an electrochemical signal. This is because the existing DNA diagnostic method possesses certain drawbacks such as time-consuming, expensive, laborious, low selectivity and sensitivity. DNA immobilization strategies and mechanism of electrochemical detection are two the most important aspects that should be considered before developing highly selective and sensitive electrochemical DNA sensor. Here, we focus on some recent strategies for DNA probes immobilization on the surface of electrochemical transducer such as adsorption, covalent bonding and Avidin/Streptavidin-Biotin interaction on the electrode surface for specific interaction with its complementary DNA target. A numerous approach for DNA hybridization detection based electrochemical technique that frequently used including direct DNA electrochemical detection and label based electrochemical (redox-active indicator, enzyme label and nanoparticles were also discussed in aiming to provide general guide for the design of electrochemical DNA sensor. We also discussed the challenges and suggestions to improve the application of electrochemical DNA sensor at point-care setting. Keywords: Electrochemical DNA sensor, DNA immobilization, DNA hybridization, Electrochemical mechanism

  4. Understanding environmental DNA detection probabilities: A case study using a stream-dwelling char Salvelinus fontinalis

    Taylor M. Wilcox; Kevin S. McKelvey; Michael K. Young; Adam J. Sepulveda; Bradley B. Shepard; Stephen F. Jane; Andrew R. Whiteley; Winsor H. Lowe; Michael K. Schwartz


    Environmental DNA sampling (eDNA) has emerged as a powerful tool for detecting aquatic animals. Previous research suggests that eDNA methods are substantially more sensitive than traditional sampling. However, the factors influencing eDNA detection and the resulting sampling costs are still not well understood. Here we use multiple experiments to derive...

  5. Multicolor fluorescent biosensor for multiplexed detection of DNA.

    Hu, Rong; Liu, Tao; Zhang, Xiao-Bing; Huan, Shuang-Yan; Wu, Cuichen; Fu, Ting; Tan, Weihong


    Development of efficient methods for highly sensitive and rapid screening of specific oligonucleotide sequences is essential to the early diagnosis of serious diseases. In this work, an aggregated cationic perylene diimide (PDI) derivative was found to efficiently quench the fluorescence emission of a variety of anionic oligonucleotide-labeled fluorophores that emit at wavelengths from the visible to NIR region. This broad-spectrum quencher was then adopted to develop a multicolor biosensor via a label-free approach for multiplexed fluorescent detection of DNA. The aggregated perylene derivative exhibits a very high quenching efficiency on all ssDNA-labeled dyes associated with biosensor detection, having efficiency values of 98.3 ± 0.9%, 97 ± 1.1%, and 98.2 ± 0.6% for FAM, TAMRA, and Cy5, respectively. An exonuclease-assisted autocatalytic target recycling amplification was also integrated into the sensing system. High quenching efficiency combined with autocatalytic target recycling amplification afforded the biosensor with high sensitivity toward target DNA, resulting in a detection limit of 20 pM, which is about 50-fold lower than that of traditional unamplified homogeneous fluorescent assay methods. The quencher did not interfere with the catalytic activity of nuclease, and the biosensor could be manipulated in either preaddition or postaddition manner with similar sensitivity. Moreover, the proposed sensing system allows for simultaneous and multicolor analysis of several oligonucleotides in homogeneous solution, demonstrating its potential application in the rapid screening of multiple biotargets.




    The measurement of anti-dsDNA antibodies is important for the diagnosis and the follow-up of patients with systemic lupus erythematosus (SLE). For routine detection of anti-dsDNA, the Farr assay and the immunofluorescence technique (IFT) on Crithidia luciliae proved to be very useful. The anti-dsDNA

  7. Direct detection of chicken genomic DNA for gender determination by thymine-DNA glycosylase.

    Porat, N; Bogdanov, K; Danielli, A; Arie, A; Samina, I; Hadani, A


    1. Birds, especially nestlings, are generally difficult to sex by morphology and early detection of chick gender in ovo in the hatchery would facilitate removal of unwanted chicks and diminish welfare objections regarding culling after hatch. 2. We describe a method to determine chicken gender without the need for PCR via use of Thymine-DNA Glycosylase (TDG). TDG restores thymine (T)/guanine (G) mismatches to cytosine (C)/G. We show here, that like DNA Polymerase, TDG can recognise, bind and function on a primer hybridised to chicken genomic DNA. 3. The primer contained a T to mismatch a G in a chicken genomic template and the T/G was cleaved with high fidelity by TDG. Thus, the chicken genomic DNA can be identified without PCR amplification via direct and linear detection. Sensitivity was increased using gender specific sequences from the chicken genome. 4. Currently, these are laboratory results, but we anticipate that further development will allow this method to be used in non-laboratory settings, where PCR cannot be employed.

  8. Colorimetric DNA detection of transgenic plants using gold nanoparticles functionalized with L-shaped DNA probes

    Nourisaeid, Elham; Mousavi, Amir; Arpanaei, Ayyoob


    In this study, a DNA colorimetric detection system based on gold nanoparticles functionalized with L-shaped DNA probes was prepared and evaluated. We investigated the hybridization efficiency of the L-shaped probes and studied the effect of nanoparticle size and the L-shaped DNA probe length on the performance of the as-prepared system. Probes were attached to the surface of gold nanoparticles using an adenine sequence. An optimal sequence of 35S rRNA gene promoter from the cauliflower mosaic virus, which is frequently used in the development of transgenic plants, and the two complementary ends of this gene were employed as model target strands and probe molecules, respectively. The spectrophotometric properties of the as-prepared systems indicated that the large NPs show better changes in the absorption spectrum and consequently present a better performance. The results of this study revealed that the probe/Au-NPs prepared using a vertical spacer containing 5 thymine oligonucleotides exhibited a stronger spectrophotometric response in comparison to that of larger probes. These results in general indicate the suitable performance of the L-shaped DNA probe-functionalized Au-NPs, and in particular emphasize the important role of the gold nanoparticle size and length of the DNA probes in enhancing the performance of such a system.

  9. Modeling the Sensitivity of Field Surveys for Detection of Environmental DNA (eDNA.

    Martin T Schultz

    Full Text Available The environmental DNA (eDNA method is the practice of collecting environmental samples and analyzing them for the presence of a genetic marker specific to a target species. Little is known about the sensitivity of the eDNA method. Sensitivity is the probability that the target marker will be detected if it is present in the water body. Methods and tools are needed to assess the sensitivity of sampling protocols, design eDNA surveys, and interpret survey results. In this study, the sensitivity of the eDNA method is modeled as a function of ambient target marker concentration. The model accounts for five steps of sample collection and analysis, including: 1 collection of a filtered water sample from the source; 2 extraction of DNA from the filter and isolation in a purified elution; 3 removal of aliquots from the elution for use in the polymerase chain reaction (PCR assay; 4 PCR; and 5 genetic sequencing. The model is applicable to any target species. For demonstration purposes, the model is parameterized for bighead carp (Hypophthalmichthys nobilis and silver carp (H. molitrix assuming sampling protocols used in the Chicago Area Waterway System (CAWS. Simulation results show that eDNA surveys have a high false negative rate at low concentrations of the genetic marker. This is attributed to processing of water samples and division of the extraction elution in preparation for the PCR assay. Increases in field survey sensitivity can be achieved by increasing sample volume, sample number, and PCR replicates. Increasing sample volume yields the greatest increase in sensitivity. It is recommended that investigators estimate and communicate the sensitivity of eDNA surveys to help facilitate interpretation of eDNA survey results. In the absence of such information, it is difficult to evaluate the results of surveys in which no water samples test positive for the target marker. It is also recommended that invasive species managers articulate concentration

  10. 21 CFR 864.7280 - Factor V Leiden DNA mutation detection systems.


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Factor V Leiden DNA mutation detection systems....7280 Factor V Leiden DNA mutation detection systems. (a) Identification. Factor V Leiden deoxyribonucleic acid (DNA) mutation detection systems are devices that consist of different reagents and...

  11. Polypyrrole–gold nanoparticle composites for highly sensitive DNA detection

    Spain, Elaine; Keyes, Tia E.; Forster, Robert J.


    DNA capture surfaces represent a powerful approach to developing highly sensitive sensors for identifying the cause of infection. Electrochemically deposited polypyrrole, PPy, films have been functionalized with electrodeposited gold nanoparticles to give a nanocomposite material, PPy–AuNP. Thiolated capture strand DNA, that is complementary to the sequence from the pathogen Staphylococcus aureus that causes mammary gland inflammation, was then immobilized onto the gold nanoparticles and any of the underlying gold electrode that is exposed. A probe strand, labelled with horse radish peroxidase, HRP, was then hybridized to the target. The concentration of the target was determined by measuring the current generated by reducing benzoquinone produced by the HRP label. Semi-log plots of the pathogen DNA concentration vs. faradaic current are linear from 150 pM to 1 μM and pM concentrations can be detected without the need for molecular, e.g., PCR or NASBA, amplification. The nanocomposite also exhibits excellent selectivity and single base mismatches in a 30 mer sequence can be detected

  12. Immunological detection of O6-methylguanine in alkylated DNA

    Briscoe, W.T.; Spizizen, J.; Tan, E.M.


    Antibodies to O 6 -methyldeoxyguanosine were produced in rabbits and utilized in a radioimmunoassay to detect this nucleoside at picomole levels. The specificity of the antibodies was demonstrated by the use of nucleoside analogues as inhibitors in the radioimmunoassay. The antibodies cross-reacted with O 6 -methylguanosine, O 6 -methylguanine, and O 6 -ethylguanosine. There was 10 4 to 10 6 times less sensitivity to inhibition by deoxyadenosine, deoxyguanosine, and guanosine than by O 6 -methyldeoxyguanosine. The radioimmunoassay also detected O 6 -methylguanine in DNA alkylated by agents known to produce O 6 -methylguanine, such as N'-methyl-N-nitrosourea. DNA alkylated with dimethyl sulfate, which does not produce O 6 -methylguanine in DNA, cross-reacted with the antibodies to a very limited extent. Such an assay system for modified nucleic acid components would be very useful in following the production, persistence, and repair of these lesions in a variety of cells and tissues treated with a broad spectrum of carcinogens and suspected carcinogens

  13. Detection of irradiation treatment of foods using DNA 'comet assay'

    Khan, Hasan M.; Delincee, Henry


    Microgel electrophoresis of single cells (DNA comet assay) has been investigated to detect irradiation treatment of some food samples. These samples of fresh and frozen rainbow trout, red lentil, gram and sliced almonds were irradiated to 1 or 2 kGy using 10 MeV electron beam from a linear accelerator. Rainbow trout samples yielded good results with samples irradiated to 1 or 2 kGy showing fragmentation of DNA and, therefore, longer comets with no intact cells. Unirradiated samples showed shorter comets with a significant number of intact cells. For rainbow trout stored in a freezer for 11 days the irradiated samples can still be discerned by electrophoresis from unirradiated samples, however, the unirradiated trouts also showed some longer comets besides some intact cells. Radiation treatment of red lentils can also be detected by this method, i.e. no intact cells in 1 or 2 kGy irradiated samples and shorter comets and some intact cells in unirradiated samples. However, the results for gram and sliced almond samples were not satisfactory since some intact DNA cells were observed in irradiated samples as well. Probably, incomplete lysis has led to these deviating results

  14. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard


    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.

  15. Electrochemical DNA probe for Hg(2+) detection based on a triple-helix DNA and Multistage Signal Amplification Strategy.

    Wang, Huan; Zhang, Yihe; Ma, Hongmin; Ren, Xiang; Wang, Yaoguang; Zhang, Yong; Wei, Qin


    In this work, an ultrasensitive electrochemical sensor was developed for detection of Hg(2+). Gold nanoparticles decorated bovine serum albumin reduction of graphene oxide (AuNP-BSA-rGO) were used as subsurface material for the immobilization of triple-helix DNA. The triple-helix DNA containing a thiol labelled single-stranded DNA (sDNA) and a thymine-rich DNA (T-rich DNA), which could be unwinded in the present of Hg(2+) to form more stable thymine-Hg(2+)-thymine (T-Hg(2+)-T) complex. T-Hg(2+)-T complex was then removed and the sDNA was left on the electrode. At this time, gold nanoparticle carrying thiol labelled cytosine-rich complementary DNA (cDNA-AuNP) could bind with the free sDNA. Meanwhile, the other free cDNA on AuNP could bind with each other in the present of Ag(+) to form the stable cytosine-Ag(+)-cytosine (C-Ag(+)-C) complex and circle amplification. Plenty of C-Ag(+)-C could form silver nanoclusters by electrochemical reduction and the striping signal of Ag could be measured for purpose of the final electrochemical detection of Hg(2+). This sensor could detect Hg(2+) over a wide concentration range from 0.1 to 130nM with a detection limit of 0.03nM. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Failure to detect circulating DNA-anti-DNA complexes by four radioimmunological methods in patients with systemic lupus erythematosus

    Izui, S.; Lambert, P.H.; Miescher, P.A.


    The presence of DNA-anti-DNA complexes in sera from patients with systemic lupus erythematosus (SLE) was investigated by two new radioimmunoassays (RIA) developed for this purpose and by measuring the CLq and DNA binding activity of serum before and after treatment with DNAse. Two direct RIA developed in this study were based on the reactivity of [ 3 H]actinomycin D ([ 3 H]ACT-D) or solid-phase methylated bovine serum albumin (mBSA) with DNA-anti-DNA complexes. DNA-anti-DNA complexes prepared in vitro could be efficiently detected at various antigen-antibody ratios by these two RIA. Increased levels of circulating immune complexes as indicated by the CLq binding test were found in 52% of SLE sera. However, the frequency of specific DNA-anti-DNA complexes detected in SLE sera was very low. Only 6% of sera exhibited an increased value deviating by more than three s.d. from the normal mean when tested with the [ 3 H]ACT-D binding RIA or the solid-phase mBSA RIA. On the other hand, there was no significant difference in the serum CLq or DNA binding activity after treatment with DNAse. These results suggest that DNA-anti-DNA complexes do not occur frequently in circulating blood and represent only a very small portion of the immune complexes detected in serum from patients with SLE. (author)

  17. Failure to detect circulating DNA-anti-DNA complexes by four radioimmunological methods in patients with systemic lupus erythematosus

    Izui, S; Lambert, P H; Miescher, P A [Hopital Cantonal Geneve (Switzerland)


    The presence of The DNA-anti-DNA complexes in sera from patients with systemic lupus erythematosus (SLE) was investigated by two new radioimmunoassays (RIA) developed for this purpose and by measuring the CLq and DNA binding activity of serum before and after treatment with DNAse. Two direct RIA developed in this study were based on the reactivity of (/sup 3/H)actinomycin D ((/sup 3/H)ACT-D) or solid-phase methylated bovine serum albumin (mBSA) with DNA-anti-DNA complexes. DNA-anti-DNA complexes prepared in vitro could be efficiently detected at various antigen-antibody ratios by these two RIA. Increased levels of circulating immune complexes as indicated by the CLq binding test were found in 52% of the SLE sera. However, the frequency of specific DNA-anti-DNA complexes detected in the SLE sera was very low. Only 6% of the sera exhibited an increased value deviating by more than three s.d. from the normal mean when tested with the (/sup 3/H)ACT-D binding RIA or the solid-phase mBSA RIA. On the other hand, there was no significant difference in the serum CLq or DNA binding activity after treatment with DNAse. These results suggest that DNA-anti-DNA complexes do not occur frequently in circulating blood and represent only a very small portion of the immune complexes detected in serum from patients with SLE.

  18. Detection of DNA polymorphisms in Dendrobium Sonia White mutant lines

    Affrida Abu Hassan; Putri Noor Faizah Megat Mohd Tahir; Zaiton Ahmad; Mohd Nazir Basiran


    Dendrobium Sonia white mutant lines were obtained through gamma ray induced mutation of purple flower Dendrobium Sonia at dosage 35 Gy. Amplified Fragment Length Polymorphism (AFLP) technique was used to compare genomic variations in these mutant lines with the control. Our objectives were to detect polymorphic fragments from these mutants to provide useful information on genes involving in flower colour expression. AFLP is a PCR based DNA fingerprinting technique. It involves digestion of DNA with restriction enzymes, ligation of adapter and selective amplification using primer with one (pre-amplification) and three (selective amplification) arbitrary nucleotides. A total number of 20 primer combinations have been tested and 7 produced clear fingerprint patterns. Of these, 13 polymorphic bands have been successfully isolate and cloned. (Author)

  19. Detection of alpha particles using DNA/Al Schottky junctions

    Al-Ta' ii, Hassan Maktuff Jaber, E-mail:, E-mail: [Low Dimensional Materials Research Centre (LDMRC), 50603 Kuala Lumpur (Malaysia); Department of Physics, Faculty of Science, University of Al-Muthana, Al-Muthana 66001 (Iraq); Periasamy, Vengadesh, E-mail:, E-mail: [Low Dimensional Materials Research Centre (LDMRC), 50603 Kuala Lumpur (Malaysia); Amin, Yusoff Mohd [Department of Physics, Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia)


    Deoxyribonucleic acid or DNA can be utilized in an organic-metallic rectifying structure to detect radiation, especially alpha particles. This has become much more important in recent years due to crucial environmental detection needs in both peace and war. In this work, we fabricated an aluminum (Al)/DNA/Al structure and generated current–voltage characteristics upon exposure to alpha radiation. Two models were utilized to investigate these current profiles; the standard conventional thermionic emission model and Cheung and Cheung's method. Using these models, the barrier height, Richardson constant, ideality factor and series resistance of the metal-DNA-metal structure were analyzed in real time. The barrier height, Φ value calculated using the conventional method for non-radiated structure was 0.7149 eV, increasing to 0.7367 eV after 4 min of radiation. Barrier height values were observed to increase after 20, 30 and 40 min of radiation, except for 6, 8, and 10 min, which registered a decrease of about 0.67 eV. This was in comparison using Cheung and Cheung's method, which registered 0.6983 eV and 0.7528 eV for the non-radiated and 2 min of radiation, respectively. The barrier height values, meanwhile, were observed to decrease after 4 (0.61 eV) to 40 min (0.6945 eV). The study shows that conventional thermionic emission model could be practically utilized for estimating the diode parameters including the effect of series resistance. These changes in the electronic properties of the Al/DNA/Al junctions could therefore be utilized in the manufacture of sensitive alpha particle sensors.

  20. Detection of human DNA polymorphisms with a simplified denaturing gradient gel electrophoresis technique.

    Noll, W W; Collins, M


    Single base pair differences between otherwise identical DNA molecules can result in altered melting behavior detectable by denaturing gradient gel electrophoresis. We have developed a simplified procedure for using denaturing gradient gel electrophoresis to detect base pair changes in genomic DNA. Genomic DNA is digested with restriction enzymes and hybridized in solution to labeled single-stranded probe DNA. The excess probe is then hybridized to complementary phage M13 template DNA, and th...

  1. A novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori.

    Liu, Ziping; Su, Xingguang


    In this work, a novel fluorescent DNA sensor for ultrasensitive detection of Helicobacter pylori (H. pylori) DNA was developed. This strategy took advantage of DNA hybridization between single-stranded DNA (ssDNA, which had been designed as an aptamer specific for H. pylori DNA) and the complementary target H. pylori DNA, and the feature that ssDNA bound to graphene oxide (GO) with significantly higher affinity than double-stranded DNA (dsDNA). ssDNA were firstly covalent conjugated with CuInS 2 quantum dots (QDs) by reaction between the carboxy group of QDs and amino group modified ssDNA, forming ssDNA-QDs genosensor. In the absence of the complementary target H. pylori DNA, GO could adsorb ssDNA-QDs DNA sensor and efficiently quench the fluorescence of ssDNA-QDs. While the complementary target H. pylori DNA was introduced, the ssDNA-QDs preferentially bound with the H. pylori DNA. The formation of dsDNA would alter the conformation of ssDNA and disturb the interaction between ssDNA and GO. Thus, the dsDNA-QDs/GO system exhibited a stronger fluorescence emission than that of the ssDNA-QDs/GO system. Under the optimized conditions, a linear correlation was established between the fluorescence intensity ratio I/I 0 and the concentration of H. pylori DNA in the range of 1.25-875pmolL -1 with a detection limit of 0.46pmolL -1 . The proposed method was applied to the determination of H. pylori DNA sequence in milk samples with satisfactory results. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Detection of Herpes Simplex Virus DNA in Pseudoexfoliation Syndrome

    Masoomeh Eghtedari


    Full Text Available Background: Pseudoexfoliation syndrome is one of the mostcommon identifiable causes of open angle glaucoma. It hasunknown etiology and pathogenesis. Infection, possibly viral,is one of the proposed pathogenic mechanisms in this condition.In the present study the presence of herpes simplex virus(HSV in specimens of anterior lens capsule of patients withpseudoexfoliation syndrome has been assessed.Methods: The presence of HSV- DNA was searched by usingpolymerase chain reaction method in specimens of anteriorlens capsule (5 mm diameter of 50 patients with pseudoexfoliationsyndrome (study group and 50 age-matchedpatients without the disease (control group who underwentcataract or combined cataract and glaucoma surgery duringa one-year (2006-2007 period in Khalili Hospital, Shiraz,Iran. The results were compared statistically with Chisquaretest and independent samples t test using SPSS software(version 11.5.Results: HSV type I DNA was detected in 18% of the patientsin the study group compared with 2% in the control group (Chisquare test, P = 0.008. The difference between the ranges ofintraocular pressure in the two groups was not statistically significant.Conclusion: The presence of HSV type I DNA suggests thepossible relationship between the virus and pseudoexfoliationsyndrome. It may be a treatable etiology in this multi-factorialdisorder and may help to future management of patients; especiallyto prevent some of the complications in this syndrome.

  3. Detecting multiple DNA human profile from a mosquito blood meal.

    Rabêlo, K C N; Albuquerque, C M R; Tavares, V B; Santos, S M; Souza, C A; Oliveira, T C; Moura, R R; Brandão, L A C; Crovella, S


    Criminal traces commonly found at crime scenes may present mixtures from two or more individuals. The scene of the crime is important for the collection of various types of traces in order to find the perpetrator of the crime. Thus, we propose that hematophagous mosquitoes found at crime scenes can be used to perform genetic testing of human blood and aid in suspect investigation. The aim of the study was to obtain a single Aedes aegypti mosquito profile from a human DNA mixture containing genetic materials of four individuals. We also determined the effect of blood acquisition time by setting time intervals of 24, 48, and 72 h after the blood meal. STR loci and amelogenin were analyzed, and the results showed that human DNA profiles could be obtained from hematophagous mosquitos at 24 h following the blood meal. It is possible that hematophagous mosquitoes can be used as biological remains at the scene of the crime, and can be used to detect human DNA profiles of up to four individuals.

  4. Complexes of DNA with fluorescent dyes are effective reagents for detection of autoimmune antibodies

    Domljanovic, Ivana; Carstens, Annika; Okholm, Anders


    as targets for these antibodies. This is done in a simple, rapid and specific immunofluorescence assay. Specifically, employing 3D nanostructures (DNA origami), we present a new approach in the detection and study of human antibodies to DNA. We demonstrate the detection of anti-DNA antibodies...

  5. Multicolour probes for sequence-specific DNA detection based on graphene oxide.

    Zhu, Qing; Xiang, Dongshan; Zhang, Cuiling; Ji, Xinghu; He, Zhike


    The bifunctionality of graphene oxide (GO) which can highly adsorb single-stranded DNA (ssDNA) and effectively quench the emission of organic dyes is reasonably utilized in a multiplexed DNA detection system, achieving sensitive and selective detection of HIV, VV and EV, respectively.

  6. Fluorescent carbon nanoparticle-based lateral flow biosensor for ultrasensitive detection of DNA.

    Takalkar, Sunitha; Baryeh, Kwaku; Liu, Guodong


    We report a fluorescent carbon nanoparticle (FCN)-based lateral flow biosensor for ultrasensitive detection of DNA. Fluorescent carbon nanoparticle with a diameter of around 15nm was used as a tag to label a detection DNA probe, which was complementary with the part of target DNA. A capture DNA probe was immobilized on the test zone of the lateral flow biosensor. Sandwich-type hybridization reactions among the FCN-labeled DNA probe, target DNA and capture DNA probe were performed on the lateral flow biosensor. In the presence of target DNA, FCNs were captured on the test zone of the biosensor and the fluorescent intensity of the captured FCNs was measured with a portable fluorescent reader. After systematic optimizations of experimental parameters (the components of running buffers, the concentration of detection DNA probe used in the preparation of FCN-DNA conjugates, the amount of FCN-DNA dispensed on the conjugate pad and the dispensing cycles of the capture DNA probes on the test-zone), the biosensor could detect a minimum concentration of 0.4 fM DNA. This study provides a rapid and low-cost approach for DNA detection with high sensitivity, showing great promise for clinical application and biomedical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Sensitive detection of mercury and copper ions by fluorescent DNA/Ag nanoclusters in guanine-rich DNA hybridization.

    Peng, Jun; Ling, Jian; Zhang, Xiu-Qing; Bai, Hui-Ping; Zheng, Liyan; Cao, Qiu-E; Ding, Zhong-Tao


    In this work, we designed a new fluorescent oligonucleotides-stabilized silver nanoclusters (DNA/AgNCs) probe for sensitive detection of mercury and copper ions. This probe contains two tailored DNA sequence. One is a signal probe contains a cytosine-rich sequence template for AgNCs synthesis and link sequence at both ends. The other is a guanine-rich sequence for signal enhancement and link sequence complementary to the link sequence of the signal probe. After hybridization, the fluorescence of hybridized double-strand DNA/AgNCs is 200-fold enhanced based on the fluorescence enhancement effect of DNA/AgNCs in proximity of guanine-rich DNA sequence. The double-strand DNA/AgNCs probe is brighter and stable than that of single-strand DNA/AgNCs, and more importantly, can be used as novel fluorescent probes for detecting mercury and copper ions. Mercury and copper ions in the range of 6.0-160.0 and 6-240 nM, can be linearly detected with the detection limits of 2.1 and 3.4 nM, respectively. Our results indicated that the analytical parameters of the method for mercury and copper ions detection are much better than which using a single-strand DNA/AgNCs. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Optical Fiber Nanotips Coated with Molecular Beacons for DNA Detection

    Ambra Giannetti


    Full Text Available Optical fiber sensors, thanks to their compactness, fast response and real-time measurements, have a large impact in the fields of life science research, drug discovery and medical diagnostics. In recent years, advances in nanotechnology have resulted in the development of nanotools, capable of entering the single cell, resulting in new nanobiosensors useful for the detection of biomolecules inside living cells. In this paper, we provide an application of a nanotip coupled with molecular beacons (MBs for the detection of DNA. The MBs were characterized by hybridization studies with a complementary target to prove their functionality both free in solution and immobilized onto a solid support. The solid support chosen as substrate for the immobilization of the MBs was a 30 nm tapered tip of an optical fiber, fabricated by chemical etching. With this set-up promising results were obtained and a limit of detection (LOD of 0.57 nM was reached, opening up the possibility of using the proposed nanotip to detect mRNAs inside the cytoplasm of living cells.

  9. Estimating HPV DNA Deposition Between Sexual Partners Using HPV Concordance, Y Chromosome DNA Detection, and Self-reported Sexual Behaviors.

    Malagón, Talía; Burchell, Ann N; El-Zein, Mariam; Guénoun, Julie; Tellier, Pierre-Paul; Coutlée, François; Franco, Eduardo L


    Detection of human papillomavirus (HPV) DNA in genital samples may not always represent true infections but may be depositions from infected sexual partners. We examined whether sexual risk factors and a biomarker (Y chromosome DNA) were associated with genital HPV partner concordance and estimated the fraction of HPV detections potentially attributable to partner deposition. The HITCH study enrolled young women attending a university or college in Montréal, Canada, and their male partners, from 2005 to 2010. We tested baseline genital samples for Y chromosome DNA and HPV DNA using polymerase chain reaction. Type-specific HPV concordance was 42.4% in partnerships where at least one partner was HPV DNA positive. Y chromosome DNA predicted type-specific HPV concordance in univariate analyses, but in multivariable models the independent predictors of concordance were days since last vaginal sex (26.5% higher concordance 0-1 vs 8-14 days after last vaginal sex) and condom use (22.6% higher concordance in never vs always users). We estimated that 14.1% (95% confidence interval [CI], 6.3-21.9%) of HPV DNA detections in genital samples were attributable to vaginal sex in the past week. A substantial proportion of HPV DNA detections may be depositions due to recent unprotected vaginal sex. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail:

  10. An evaluation of the efficacy of using environmental DNA (eDNA) to detect giant gartersnakes (Thamnophis gigas)

    Halstead, Brian J.; Wood, Dustin A.; Bowen, Lizabeth; Waters, Shannon C.; Vandergast, Amy G.; Ersan, Julia S.; Skalos, Shannon M.; Casazza, Michael L.


    Detecting populations of rare or cryptic species is essential for their conservation. For species like giant gartersnakes (Thamnophis gigas), conventional survey methods can be expensive and inefficient. These sampling difficulties might be overcome by modern techniques that detect deoxyribonucleic acid (DNA) shed by organisms into the environment (eDNA). We evaluated the efficacy of detecting giant gartersnake eDNA in water samples from the laboratory and at locations with known giant gartersnake populations in the Sacramento Valley of California, and failed to detect giant gartersnake DNA in most laboratory and all field samples. Aspects of giant gartersnake biology—such as highly keratinized skin and spending extensive time in the terrestrial environment, as well as hot, sunny, and turbid conditions in wetlands and canals of the Sacramento Valley—likely contributed to low detection probabilities. Although detection of eDNA shows promise under many conditions, further development is needed before sampling for eDNA is a viable option for detecting giant gartersnake populations.

  11. A Smart DNA Tweezer for Detection of Human Telomerase Activity.

    Xu, Xiaowen; Wang, Lei; Li, Kan; Huang, Qihong; Jiang, Wei


    Reliable and accurate detection of telomerase activity is crucial to better understand its role in cancer cells and to further explore its function in cancer diagnosis and treatment. Here, we construct a smart DNA tweezer (DT) for detection of telomerase activity. The DT is assembled by three specially designed single-stranded oligonucleotides: a central strand dually labeled with donor/acceptor fluorophores and two arm strands containing overhangs complementary to telomerase reaction products (TRPs). It can get closed through hybridization with TRPs and get reopen through strand displacement reaction by TRPs' complementary sequences. First, under the action of telomerase, telomerase binding substrates (TS) are elongated to generate TRPs ended with telomeric repeats (TTAGGG) n . TRPs hybridize with the two arm overhangs cooperatively and strain DT to closed state, inducing an increased fluorescence resonance energy transfer (FRET) efficiency, which is utilized for telomerase activity detection. Second, upon introduction of a removal strand (RS) complementary to TRPs, the closed DT is relaxed to open state via the toehold-mediated strand displacement, inducing a decreased FRET efficiency, which is utilized for determination of TRP length distribution. The detection limit of telomerase activity is equivalent to 141 cells/μL for HeLa cells, and telomerase-active cellular extracts can be differentiated from telomerase-inactive cellular extracts. Furthermore, TRPs owning 1, 2, 3, 4, and ≥5 telomeric repeats are identified to account for 25.6%, 20.5%, 15.7%, 12.5%, and 25.7%, respectively. The proposed strategy will offer a new approach for reliable, accurate detection of telomerase activity and product length distribution for deeper studying its role and function in cancer.

  12. The detection of large deletions or duplications in genomic DNA.

    Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R


    While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

  13. Electrochemical DNA biosensor based on avidin-biotin conjugation for influenza virus (type A) detection

    Chung, Da-Jung; Kim, Ki-Chul; Choi, Seong-Ho


    An electrochemical DNA biosensor (E-DNA biosensor) was fabricated by avidin-biotin conjugation of a biotinylated probe DNA, 5'-biotin-ATG AGT CTT CTA ACC GAG GTC GAA-3', and an avidin-modified glassy carbon electrode (GCE) to detect the influenza virus (type A). An avidin-modified GCE was prepared by the reaction of avidin and a carboxylic acid-modified GCE, which was synthesized by the electrochemical reduction of 4-carboxyphenyl diazonium salt. The current value of the E-DNA biosensor was evaluated after hybridization of the probe DNA and target DNA using cyclic voltammetry (CV). The current value decreased after the hybridization of the probe DNA and target DNA. The DNA that was used follows: complementary target DNA, 5'-TTC GAC CTC GGT TAG AAG ACT CAT-3' and two-base mismatched DNA, 5'-TTC GAC AGC GGT TAT AAG ACT CAT-3'.

  14. Rapid, highly sensitive and highly specific gene detection by combining enzymatic amplification and DNA chip detection simultaneously

    Koji Hashimoto


    Full Text Available We have developed a novel gene detection method based on the loop-mediated isothermal amplification (LAMP reaction and the DNA dissociation reaction on the same DNA chip surface to achieve a lower detection limit, broader dynamic range and faster detection time than are attainable with a conventional DNA chip. Both FAM- and thiol-labeled DNA probe bound to the complementary sequence accompanying Dabcyl was immobilized on the gold surface via Au/thiol bond. The LAMP reaction was carried out on the DNA probe fixed gold surface. At first, Dabcyl molecules quenched the FAM fluorescence. According to the LAMP reaction, the complementary sequence with Dabcyl was competitively reacted with the amplified targeted sequence. As a result, the FAM fluorescence increased owing to dissociation of the complementary sequence from the DNA probe. The simultaneous reaction of LAMP and DNA chip detection was achieved, and 103 copies of the targeted gene were detected within an hour by measuring fluorescence intensity of the DNA probe. Keywords: Biosensor, DNA chip, Loop-mediated isothermal amplification (LAMP, Fluorescence detection, Gold substrate, Au/thiol bond

  15. Detection of influenza A virus using carbon nanotubes field effect transistor based DNA sensor

    Tran, Thi Luyen; Nguyen, Thi Thuy; Huyen Tran, Thi Thu; Chu, Van Tuan; Thinh Tran, Quang; Tuan Mai, Anh


    The carbon nanotubes field effect transistor (CNTFET) based DNA sensor was developed, in this paper, for detection of influenza A virus DNA. Number of factors that influence the output signal and analytical results were investigated. The initial probe DNA, decides the available DNA strands on CNTs, was 10 μM. The hybridization time for defined single helix was 120 min. The hybridization temperature was set at 30 °C to get a net change in drain current of the DNA sensor without altering properties of any biological compounds. The response time of the DNA sensor was less than one minute with a high reproducibility. In addition, the DNA sensor has a wide linear detection range from 1 pM to 10 nM, and a very low detection limit of 1 pM. Finally, after 7-month storage in 7.4 pH buffer, the output signal of DNA sensor recovered 97%.

  16. Quantitative detection of DNA by autocatalytic enlargement of hybridized gold nanoprobes

    Zhan, Zongrui; Cao, Cuong; Sim, Sang Jun


    Quantitative detection of specific viral DNA has become a pressing issue for the earlier clinical diagnosis of viral infectious diseases. Therefore, in this paper, we report a simple, sensitive, and inexpensive quantitative approach for DNA detection based on the autocatalytic Au deposition of go...... to the concentration of the target DNA, could easily be confirmed by a UV–vis scanning spectrophotometer. Limit of detection could be obtained as low as 1.0 fM by this simple method....

  17. Optimization of HPV DNA detection in urine by improving collection, storage, and extraction.

    Vorsters, A; Van den Bergh, J; Micalessi, I; Biesmans, S; Bogers, J; Hens, A; De Coster, I; Ieven, M; Van Damme, P


    The benefits of using urine for the detection of human papillomavirus (HPV) DNA have been evaluated in disease surveillance, epidemiological studies, and screening for cervical cancers in specific subgroups. HPV DNA testing in urine is being considered for important purposes, notably the monitoring of HPV vaccination in adolescent girls and young women who do not wish to have a vaginal examination. The need to optimize and standardize sampling, storage, and processing has been reported.In this paper, we examined the impact of a DNA-conservation buffer, the extraction method, and urine sampling on the detection of HPV DNA and human DNA in urine provided by 44 women with a cytologically normal but HPV DNA-positive cervical sample. Ten women provided first-void and midstream urine samples. DNA analysis was performed using real-time PCR to allow quantification of HPV and human DNA.The results showed that an optimized method for HPV DNA detection in urine should (a) prevent DNA degradation during extraction and storage, (b) recover cell-free HPV DNA in addition to cell-associated DNA, (c) process a sufficient volume of urine, and (d) use a first-void sample.In addition, we found that detectable human DNA in urine may not be a good internal control for sample validity. HPV prevalence data that are based on urine samples collected, stored, and/or processed under suboptimal conditions may underestimate infection rates.

  18. Detection of human papillomavirus DNA in urine. A review of the literature.

    Vorsters, A; Micalessi, I; Bilcke, J; Ieven, M; Bogers, J; Van Damme, P


    The detection of human papillomavirus (HPV) DNA in urine, a specimen easily obtained by a non-invasive self-sampling method, has been the subject of a considerable number of studies. This review provides an overview of 41 published studies; assesses how different methods and settings may contribute to the sometimes contradictory outcomes; and discusses the potential relevance of using urine samples in vaccine trials, disease surveillance, epidemiological studies, and specific settings of cervical cancer screening. Urine sampling, storage conditions, sample preparation, DNA extraction, and DNA amplification may all have an important impact on HPV DNA detection and the form of viral DNA that is detected. Possible trends in HPV DNA prevalence in urine could be inferred from the presence of risk factors or the diagnosis of cervical lesions. HPV DNA detection in urine is feasible and may become a useful tool but necessitates further improvement and standardization.

  19. Detecting the movement and spawning activity of bigheaded carps with environmental DNA

    Erickson, Richard A.; Rees, Christopher B.; Coulter, Alison A.; Merkes, Christopher; McCalla, S. Grace; Touzinsky, Katherine F; Walleser, Liza R.; Goforth, Reuben R.; Amberg, Jon J.


    Bigheaded carps are invasive fishes threatening to invade the Great Lakes basin and establish spawning populations, and have been monitored using environmental DNA (eDNA). Not only does eDNA hold potential for detecting the presence of species, but may also allow for quantitative comparisons like relative abundance of species across time or space. We examined the relationships among bigheaded carp movement, hydrography, spawning and eDNA on the Wabash River, IN, USA. We found positive relationships between eDNA and movement and eDNA and hydrography. We did not find a relationship between eDNA and spawning activity in the form of drifting eggs. Our first finding demonstrates how eDNA may be used to monitor species abundance, whereas our second finding illustrates the need for additional research into eDNA methodologies. Current applications of eDNA are widespread, but the relatively new technology requires further refinement.

  20. Detection of TTV-DNA in PBMC using digoxigenin labelled probe by in situ hybridization

    Liu Yang; Qi Qige


    To determine TTV-DNA in PBMC in patients with viral hepatitis, a study of in situ hybridization using digoxigenin labelled probe by PCR method to the TTV ORF1 region was performed on PBMC. Results showed that the detection rate of TTV-DNA using double-stranded probe in TTV-DNA positive group in sera was 58.06 (18/31), and the detection rate of TTV-DNA using double-stranded probe in TTV-DNA negative group in sera was 27.59 (8/29). For TTV-DNA positive group detected by double- stranded probe, then we use negative- stranded probe to detect their replication. The detection rate was 22.2%(4/18). Conclusions: TTV can infect PBMC and replicate in PBMC

  1. Critical considerations for the application of environmental DNA methods to detect aquatic species

    Goldberg, Caren S.; Turner, Cameron R.; Deiner, Kristy; Klymus, Katy E.; Thomsen, Philip Francis; Murphy, Melanie A.; Spear, Stephen F.; McKee, Anna; Oyler-McCance, Sara J.; Cornman, Robert S.; Laramie, Matthew B.; Mahon, Andrew R.; Lance, Richard F.; Pilliod, David S.; Strickler, Katherine M.; Waits, Lisette P.; Fremier, Alexander K.; Takahara, Teruhiko; Herder, Jelger E.; Taberlet, Pierre


    Species detection using environmental DNA (eDNA) has tremendous potential for contributing to the understanding of the ecology and conservation of aquatic species. Detecting species using eDNA methods, rather than directly sampling the organisms, can reduce impacts on sensitive species and increase the power of field surveys for rare and elusive species. The sensitivity of eDNA methods, however, requires a heightened awareness and attention to quality assurance and quality control protocols. Additionally, the interpretation of eDNA data demands careful consideration of multiple factors. As eDNA methods have grown in application, diverse approaches have been implemented to address these issues. With interest in eDNA continuing to expand, supportive guidelines for undertaking eDNA studies are greatly needed.Environmental DNA researchers from around the world have collaborated to produce this set of guidelines and considerations for implementing eDNA methods to detect aquatic macroorganisms.Critical considerations for study design include preventing contamination in the field and the laboratory, choosing appropriate sample analysis methods, validating assays, testing for sample inhibition and following minimum reporting guidelines. Critical considerations for inference include temporal and spatial processes, limits of correlation of eDNA with abundance, uncertainty of positive and negative results, and potential sources of allochthonous DNA.We present a synthesis of knowledge at this stage for application of this new and powerful detection method.

  2. PCR-based detection of a rare linear DNA in cell culture

    Saveliev Sergei V.


    Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  3. PCR-based detection of a rare linear DNA in cell culture.

    Saveliev, Sergei V.


    The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  4. Detection of human DNA polymorphisms with a simplified denaturing gradient gel electrophoresis technique

    Noll, W.W.; Collins, M.


    Single base pair differences between otherwise identical DNA molecules can result in altered melting behavior detectable by denaturing gradient gel electrophoresis. The authors have developed a simplified procedure for using denaturing gradient gel electrophoresis to detect base pair changes in genomic DNA. Genomic DNA is digested with restriction enzymes and hybridized in solution to labeled single-stranded probe DNA. The excess probe is then hybridized to complementary phage M13 template DNA, and the reaction mixture is electrophoresed on a denaturing gradient gel. Only the genomic DNA probe hybrids migrate into the gel. Differences in hybrid mobility on the gel indicate base pair changes in the genomic DNA. They have used this technique to identify two polymorphic sites within a 1.2-kilobase region of human chromosome 20. This approach should greatly facilitate the identification of DNA polymorphisms useful for gene linkage studies and the diagnosis of genetic diseases

  5. Detection of DNA damage by using hairpin molecular beacon probes and graphene oxide.

    Zhou, Jie; Lu, Qian; Tong, Ying; Wei, Wei; Liu, Songqin


    A hairpin molecular beacon tagged with carboxyfluorescein in combination with graphene oxide as a quencher reagent was used to detect the DNA damage by chemical reagents. The fluorescence of molecular beacon was quenched sharply by graphene oxide; while in the presence of its complementary DNA the quenching efficiency decreased because their hybridization prevented the strong adsorbability of molecular beacon on graphene oxide. If the complementary DNA was damaged by a chemical reagent and could not form intact duplex structure with molecular beacon, more molecular beacon would adsorb on graphene oxide increasing the quenching efficiency. Thus, damaged DNA could be detected based on different quenching efficiencies afforded by damaged and intact complementary DNA. The damage effects of chlorpyrifos-methyl and three metabolites of styrene such as mandelieaeids, phenylglyoxylieaeids and epoxystyrene on DNA were studied as models. The method for detection of DNA damage was reliable, rapid and simple compared to the biological methods. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Label-free detection of DNA hybridization using carbon nanotube network field-effect transistors

    Star, Alexander; Tu, Eugene; Niemann, Joseph; Gabriel, Jean-Christophe P.; Joiner, C. Steve; Valcke, Christian


    We report carbon nanotube network field-effect transistors (NTNFETs) that function as selective detectors of DNA immobilization and hybridization. NTNFETs with immobilized synthetic oligonucleotides have been shown to specifically recognize target DNA sequences, including H63D single-nucleotide polymorphism (SNP) discrimination in the HFE gene, responsible for hereditary hemochromatosis. The electronic responses of NTNFETs upon single-stranded DNA immobilization and subsequent DNA hybridization events were confirmed by using fluorescence-labeled oligonucleotides and then were further explored for label-free DNA detection at picomolar to micromolar concentrations. We have also observed a strong effect of DNA counterions on the electronic response, thus suggesting a charge-based mechanism of DNA detection using NTNFET devices. Implementation of label-free electronic detection assays using NTNFETs constitutes an important step toward low-cost, low-complexity, highly sensitive and accurate molecular diagnostics. hemochromatosis | SNP | biosensor

  7. Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

    Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory


    The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

  8. NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs.

    Morisset, Dany; Dobnik, David; Hamels, Sandrine; Zel, Jana; Gruden, Kristina


    We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1-25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification.

  9. Detection of DNA hybridization using graphene-coated black phosphorus surface plasmon resonance sensor

    Pal, Sarika; Verma, Alka; Raikwar, S.; Prajapati, Y. K.; Saini, J. P.


    In this paper, graphene-coated black phosphorus at the metal surface for the detection of DNA hybridization event is numerically demonstrated. The strategy consists of placing the sensing medium on top of black phosphorus-graphene-coated SPR which interfaces with phosphate-buffered saline solution carrying single-stranded DNA. Upon hybridization with its complementary DNA, desorption of the nanostructures takes place and thus enables the sensitive detection of the DNA hybridization event. The proposed sensor exhibits a sensitivity (125 ο/RIU), detection accuracy (0.95) and quality factor (13.62 RIU-1) for complementary DNA. In comparison with other reported papers, our suggested sensor provides much better performance. Thus, this label-free DNA detection platform should spur off new interest towards the use of black phosphorus-graphene-coated SPR interfaces.

  10. Detection of irradiation induced modifications in foodstuff DNA using 32p post-labelling

    Hoey, B.M.; Swallow, A.J.; Margison, G.P.


    DNA post-labelling has been used successfully to detect damage to DNA caused by a range of damaging agents. The assay results in a fingerprint of changes induced in DNA which might, in principle, be useful as a test for the detection of the irradiation of foods. The authors present their DNA extraction and 32 p post-labelling methods from chicken or cooked prawn samples and their analysis method (High Performance liquid chromatography). It's hoped that these results could form the basis of a test to detect if foods have been irradiated

  11. Detection of a diverse marine fish fauna using environmental DNA from seawater samples

    Thomsen, Philip Francis; Kielgast, Jos; Iversen, Lars Lønsmann


    eDNA from 15 different fish species, including both important consumption species, as well as species rarely or never recorded by conventional monitoring. We also detect eDNA from a rare vagrant species in the area; European pilchard (Sardina pilchardus). Additionally, we detect four bird species....... Records in national databases confirmed the occurrence of all detected species. To investigate the efficiency of the eDNA approach, we compared its performance with 9 methods conventionally used in marine fish surveys. Promisingly, eDNA covered the fish diversity better than or equal to any of the applied...

  12. Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection.

    Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao


    An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.

  13. DNA barcode detects high genetic structure within neotropical bird species.

    Erika Sendra Tavares

    Full Text Available BACKGROUND: Towards lower latitudes the number of recognized species is not only higher, but also phylogeographic subdivision within species is more pronounced. Moreover, new genetically isolated populations are often described in recent phylogenies of Neotropical birds suggesting that the number of species in the region is underestimated. Previous COI barcoding of Argentinean bird species showed more complex patterns of regional divergence in the Neotropical than in the North American avifauna. METHODS AND FINDINGS: Here we analyzed 1,431 samples from 561 different species to extend the Neotropical bird barcode survey to lower latitudes, and detected even higher geographic structure within species than reported previously. About 93% (520 of the species were identified correctly from their DNA barcodes. The remaining 41 species were not monophyletic in their COI sequences because they shared barcode sequences with closely related species (N = 21 or contained very divergent clusters suggestive of putative new species embedded within the gene tree (N = 20. Deep intraspecific divergences overlapping with among-species differences were detected in 48 species, often with samples from large geographic areas and several including multiple subspecies. This strong population genetic structure often coincided with breaks between different ecoregions or areas of endemism. CONCLUSIONS: The taxonomic uncertainty associated with the high incidence of non-monophyletic species and discovery of putative species obscures studies of historical patterns of species diversification in the Neotropical region. We showed that COI barcodes are a valuable tool to indicate which taxa would benefit from more extensive taxonomic revisions with multilocus approaches. Moreover, our results support hypotheses that the megadiversity of birds in the region is associated with multiple geographic processes starting well before the Quaternary and extending to more recent

  14. A simple colorimetric assay for detection of amplified Mycobacterium leprae DNA

    van der Vliet, G. M.; de Wit, M. Y.; Klatser, P. R.


    A colorimetric assay for the detection of PCR-products is described. The assay is based on amplification of DNA in the presence of digoxigenin-dUTP. After immobilization of the PCR products to a microtitre plate, amplified DNA could be detected colorimetrically. The sensitivity of this colorimetric



    CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of

  16. Understanding environmental DNA detection probabilities: A case study using a stream-dwelling char Salvelinus fontinalis

    Wilcox, Taylor M; Mckelvey, Kevin S.; Young, Michael K.; Sepulveda, Adam; Shepard, Bradley B.; Jane, Stephen F; Whiteley, Andrew R.; Lowe, Winsor H.; Schwartz, Michael K.


    Environmental DNA sampling (eDNA) has emerged as a powerful tool for detecting aquatic animals. Previous research suggests that eDNA methods are substantially more sensitive than traditional sampling. However, the factors influencing eDNA detection and the resulting sampling costs are still not well understood. Here we use multiple experiments to derive independent estimates of eDNA production rates and downstream persistence from brook trout (Salvelinus fontinalis) in streams. We use these estimates to parameterize models comparing the false negative detection rates of eDNA sampling and traditional backpack electrofishing. We find that using the protocols in this study eDNA had reasonable detection probabilities at extremely low animal densities (e.g., probability of detection 0.18 at densities of one fish per stream kilometer) and very high detection probabilities at population-level densities (e.g., probability of detection > 0.99 at densities of ≥ 3 fish per 100 m). This is substantially more sensitive than traditional electrofishing for determining the presence of brook trout and may translate into important cost savings when animals are rare. Our findings are consistent with a growing body of literature showing that eDNA sampling is a powerful tool for the detection of aquatic species, particularly those that are rare and difficult to sample using traditional methods.

  17. An alkaline separation method for detection of small amount of DNA damage

    Sakai, Kazuo; Okada, Shigefumi


    An alkaline separation technique originally established by Ahnstroem is modified to detect small amount of DNA damage in X-irradiated mouse leukemic L5178Y cells. It is made quantitative by calibration with an alkaline sucrose gradient centrifugation. The present method would make it possible to study DNA damage and its repair within a dose range of X-rays where cell survival and mutation are usually investigated. It is also useful for detecting DNA damage caused by chemicals. (author)

  18. Immunological detection of modified DNA bases in irradiated food

    Williams, J.H.H.; Tyreman, A.L.; Deeble, D.J.; Jones, M.; Smith, C.J.; Christiansen, J.F.; Beaumont, P.C.


    Ionising radiation is fatal to all known life forms given sufficient exposure in terms of dose and duration. This property has been used beneficially to sterilise a range of materials, particularly medical products where the removal of all contaminating organisms is deemed essential. Irradiation has long been used to sterilise food for consumption by certain categories of patients. The method is attractive because all potentially contaminating organisms can be removed by one simple treatment. Irradiation also slows down or stops certain processes such as sprouting. There are, however, disadvantages to irradiating food. It is not only DNA that is affected as alterations in lipid and protein components of the food may lead to a loss of quality. Although irradiation will kill bacteria it will probably not affect any toxin produced by those bacteria prior to treatment. Irradiation achieves its effects by damaging molecules, particularly nucleic acids. Consequently, if any of the damage to nucleic acids could be shown to by by a process unique to irradiation, and the products of this unique process could be measured, then there is the basis for a detection system. Furthermore, if the damage could be shown to be proportional to the dose of radiation received then the dose could also be quantified. Legislation, therefore, requires that assays be developed for use in different countries, those which totally ban irradiated food, those which require irradiated food to be labelled and those which have selective laws relating to specific foods and specific levels of irradiation. (author)

  19. Spot detection and image segmentation in DNA microarray data.

    Qin, Li; Rueda, Luis; Ali, Adnan; Ngom, Alioune


    Following the invention of microarrays in 1994, the development and applications of this technology have grown exponentially. The numerous applications of microarray technology include clinical diagnosis and treatment, drug design and discovery, tumour detection, and environmental health research. One of the key issues in the experimental approaches utilising microarrays is to extract quantitative information from the spots, which represent genes in a given experiment. For this process, the initial stages are important and they influence future steps in the analysis. Identifying the spots and separating the background from the foreground is a fundamental problem in DNA microarray data analysis. In this review, we present an overview of state-of-the-art methods for microarray image segmentation. We discuss the foundations of the circle-shaped approach, adaptive shape segmentation, histogram-based methods and the recently introduced clustering-based techniques. We analytically show that clustering-based techniques are equivalent to the one-dimensional, standard k-means clustering algorithm that utilises the Euclidean distance.

  20. Application of environmental DNA to detect an endangered marine skate species in the wild.

    Weltz, Kay; Lyle, Jeremy M; Ovenden, Jennifer; Morgan, Jessica A T; Moreno, David A; Semmens, Jayson M


    Environmental DNA (eDNA) techniques have only recently been applied in the marine environment to detect the presence of marine species. Species-specific primers and probes were designed to detect the eDNA of the endangered Maugean skate (Zearaja maugeana) from as little as 1 L of water collected at depth (10-15 m) in Macquarie Harbour (MH), Tasmania. The identity of the eDNA was confirmed as Z. maugeana by sequencing the qPCR products and aligning these with the target sequence for a 100% match. This result has validated the use of this eDNA technique for detecting a rare species, Z. maugeana, in the wild. Being able to investigate the presence, and possibly the abundance, of Z. maugeana in MH and Bathurst harbour (BH), would be addressing a conservation imperative for the endangered Z. maugeana. For future application of this technique in the field, the rate of decay was determined for Z. maugeana eDNA under ambient dissolved oxygen (DO) levels (55% saturation) and lower DO (20% saturation) levels, revealing that the eDNA can be detected for 4 and 16 hours respectively, after which eDNA concentration drops below the detection threshold of the assay. With the rate of decay being influenced by starting eDNA concentrations, it is recommended that samples be filtered as soon as possible after collection to minimize further loss of eDNA prior to and during sample processing.

  1. Application of environmental DNA to detect an endangered marine skate species in the wild.

    Kay Weltz

    Full Text Available Environmental DNA (eDNA techniques have only recently been applied in the marine environment to detect the presence of marine species. Species-specific primers and probes were designed to detect the eDNA of the endangered Maugean skate (Zearaja maugeana from as little as 1 L of water collected at depth (10-15 m in Macquarie Harbour (MH, Tasmania. The identity of the eDNA was confirmed as Z. maugeana by sequencing the qPCR products and aligning these with the target sequence for a 100% match. This result has validated the use of this eDNA technique for detecting a rare species, Z. maugeana, in the wild. Being able to investigate the presence, and possibly the abundance, of Z. maugeana in MH and Bathurst harbour (BH, would be addressing a conservation imperative for the endangered Z. maugeana. For future application of this technique in the field, the rate of decay was determined for Z. maugeana eDNA under ambient dissolved oxygen (DO levels (55% saturation and lower DO (20% saturation levels, revealing that the eDNA can be detected for 4 and 16 hours respectively, after which eDNA concentration drops below the detection threshold of the assay. With the rate of decay being influenced by starting eDNA concentrations, it is recommended that samples be filtered as soon as possible after collection to minimize further loss of eDNA prior to and during sample processing.

  2. Patient-Specific Circulating Tumor DNA Detection during Neoadjuvant Chemotherapy in Triple-Negative Breast Cancer.

    Riva, Francesca; Bidard, Francois-Clement; Houy, Alexandre; Saliou, Adrien; Madic, Jordan; Rampanou, Aurore; Hego, Caroline; Milder, Maud; Cottu, Paul; Sablin, Marie-Paule; Vincent-Salomon, Anne; Lantz, Olivier; Stern, Marc-Henri; Proudhon, Charlotte; Pierga, Jean-Yves


    In nonmetastatic triple-negative breast cancer (TNBC) patients, we investigated whether circulating tumor DNA (ctDNA) detection can reflect the tumor response to neoadjuvant chemotherapy (NCT) and detect minimal residual disease after surgery. Ten milliliters of plasma were collected at 4 time points: before NCT; after 1 cycle; before surgery; after surgery. Customized droplet digital PCR (ddPCR) assays were used to track tumor protein p53 ( TP53 ) mutations previously characterized in tumor tissue by massively parallel sequencing (MPS). Forty-six patients with nonmetastatic TNBC were enrolled. TP53 mutations were identified in 40 of them. Customized ddPCR probes were validated for 38 patients, with excellent correlation with MPS ( r = 0.99), specificity (≥2 droplets/assay), and sensitivity (at least 0.1%). At baseline, ctDNA was detected in 27/36 patients (75%). Its detection was associated with mitotic index ( P = 0.003), tumor grade ( P = 0.003), and stage ( P = 0.03). During treatment, we observed a drop of ctDNA levels in all patients but 1. No patient had detectable ctDNA after surgery. The patient with rising ctDNA levels experienced tumor progression during NCT. Pathological complete response (16/38 patients) was not correlated with ctDNA detection at any time point. ctDNA positivity after 1 cycle of NCT was correlated with shorter disease-free ( P < 0.001) and overall ( P = 0.006) survival. Customized ctDNA detection by ddPCR achieved a 75% detection rate at baseline. During NCT, ctDNA levels decreased quickly and minimal residual disease was not detected after surgery. However, a slow decrease of ctDNA level during NCT was strongly associated with shorter survival. © 2016 American Association for Clinical Chemistry.

  3. A novel SERRS sandwich-hybridization assay to detect specific DNA target.

    Cécile Feuillie

    Full Text Available In this study, we have applied Surface Enhanced Resonance Raman Scattering (SERRS technology to the specific detection of DNA. We present an innovative SERRS sandwich-hybridization assay that allows specific DNA detection without any enzymatic amplification, such as is the case with Polymerase Chain Reaction (PCR. In some substrates, such as ancient or processed remains, enzymatic amplification fails due to DNA alteration (degradation, chemical modification or to the presence of inhibitors. Consequently, the development of a non-enzymatic method, allowing specific DNA detection, could avoid long, expensive and inconclusive amplification trials. Here, we report the proof of concept of a SERRS sandwich-hybridization assay that leads to the detection of a specific chamois DNA. This SERRS assay reveals its potential as a non-enzymatic alternative technology to DNA amplification methods (particularly the PCR method with several applications for species detection. As the amount and type of damage highly depend on the preservation conditions, the present SERRS assay would enlarge the range of samples suitable for DNA analysis and ultimately would provide exciting new opportunities for the investigation of ancient DNA in the fields of evolutionary biology and molecular ecology, and of altered DNA in food frauds detection and forensics.

  4. Detection of dopamine in dopaminergic cell using nanoparticles-based barcode DNA analysis.

    An, Jeung Hee; Kim, Tae-Hyung; Oh, Byung-Keun; Choi, Jeong Woo


    Nanotechnology-based bio-barcode-amplification analysis may be an innovative approach to dopamine detection. In this study, we evaluated the efficacy of this bio-barcode DNA method in detecting dopamine from dopaminergic cells. Herein, a combination DNA barcode and bead-based immunoassay for neurotransmitter detection with PCR-like sensitivity is described. This method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA, and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated in order to remove the conjugated barcode DNA. The DNA barcodes were then identified via PCR analysis. The dopamine concentration in dopaminergic cells can be readily and rapidly detected via the bio-barcode assay method. The bio-barcode assay method is, therefore, a rapid and high-throughput screening tool for the detection of neurotransmitters such as dopamine.

  5. Detection of Toxoplasma gondii DNA in sera samples of mice experimentally infected

    H. Langoni


    Full Text Available Detection of Toxoplasma gondii (T. gondii DNA in blood can help to diagnose the disease in its acute phase; however, it must be considered that hemoglobin, present in blood, can inhibit polymerase activity, making impracticable the detection of DNA in samples. Mice were experimentally infected via oral route with ME49 and BTU2 strains cysts and RH strain tachyzoites; polymerase chain reaction was used to detect T. gondii DNA in mice sera 18, 24, 48, 96, and 192 hours post infection (PI. Toxoplama gondii DNA was detected in only one animal infected with BTU2 strain, genotype III (isolated from a dog with neurological signs 18 hours PI. The agent's DNA was not detected in any sample of the other experimental groups. New studies must be carried out to verify the technique sensitivity in researches on this agent's genetic material using sera samples of acute-phase toxoplasmosis patients, especially in cases of immunosuppression.

  6. Automation and integration of multiplexed on-line sample preparation with capillary electrophoresis for DNA sequencing

    Tan, H.


    The purpose of this research is to develop a multiplexed sample processing system in conjunction with multiplexed capillary electrophoresis for high-throughput DNA sequencing. The concept from DNA template to called bases was first demonstrated with a manually operated single capillary system. Later, an automated microfluidic system with 8 channels based on the same principle was successfully constructed. The instrument automatically processes 8 templates through reaction, purification, denaturation, pre-concentration, injection, separation and detection in a parallel fashion. A multiplexed freeze/thaw switching principle and a distribution network were implemented to manage flow direction and sample transportation. Dye-labeled terminator cycle-sequencing reactions are performed in an 8-capillary array in a hot air thermal cycler. Subsequently, the sequencing ladders are directly loaded into a corresponding size-exclusion chromatographic column operated at {approximately} 60 C for purification. On-line denaturation and stacking injection for capillary electrophoresis is simultaneously accomplished at a cross assembly set at {approximately} 70 C. Not only the separation capillary array but also the reaction capillary array and purification columns can be regenerated after every run. DNA sequencing data from this system allow base calling up to 460 bases with accuracy of 98%.

  7. Facile preparation of a DNA sensor for rapid herpes virus detection

    Tam, Phuong Dinh, E-mail: [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Tuan, Mai Anh, E-mail: [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam); Huy, Tran Quang [National Institute of Hygiene and Epidemiology (NIHE), 01 Yersin, Hai Ba Trung District, Hanoi (Viet Nam); Le, Anh-Tuan [Hanoi Advanced School of Science and Technology, Hanoi University of Technology (Viet Nam); Hieu, Nguyen Van, E-mail: [International Training Institute for Materials Science, Hanoi University of Technology (Viet Nam)


    In this paper, a simple DNA sensor platform was developed for rapid herpes virus detection in real samples. The deoxyribonucleic acid (DNA) sequences of the herpes simplex virus (DNA probe) were directly immobilized on the surface of interdigitated electrodes by electrochemical polymerization along with pyrrole monomers. The potential was scanned from - 0.7 to + 0.6 V, and the scanning rate was 100 mV/s. Fourier transform infrared spectroscopy was employed to verify specific DNA sequence binding and the conducting polymer. The morphology of the conducting polymer doped with DNA strands was characterized using a field emission scanning electron microscope. As-obtained DNA sensor was used to detect the herpes virus DNA in the real samples. The results show that the current DNA sensors detected the lowest DNA concentration of 2 nM. This sensitivity appears to be better than that of the DNA sensors prepared by immobilization of the DNA probe on the 3-aminopropyl-triethoxy-silance (APTS) membrane.

  8. Facile preparation of a DNA sensor for rapid herpes virus detection

    Tam, Phuong Dinh; Tuan, Mai Anh; Huy, Tran Quang; Le, Anh-Tuan; Hieu, Nguyen Van


    In this paper, a simple DNA sensor platform was developed for rapid herpes virus detection in real samples. The deoxyribonucleic acid (DNA) sequences of the herpes simplex virus (DNA probe) were directly immobilized on the surface of interdigitated electrodes by electrochemical polymerization along with pyrrole monomers. The potential was scanned from - 0.7 to + 0.6 V, and the scanning rate was 100 mV/s. Fourier transform infrared spectroscopy was employed to verify specific DNA sequence binding and the conducting polymer. The morphology of the conducting polymer doped with DNA strands was characterized using a field emission scanning electron microscope. As-obtained DNA sensor was used to detect the herpes virus DNA in the real samples. The results show that the current DNA sensors detected the lowest DNA concentration of 2 nM. This sensitivity appears to be better than that of the DNA sensors prepared by immobilization of the DNA probe on the 3-aminopropyl-triethoxy-silance (APTS) membrane.

  9. Detection of DNA of genetically modified maize by a silicon nanowire field-effect transistor

    Pham, Van Binh; Tung Pham, Xuan Thanh; Duong Dang, Ngoc Thuy; Tuyen Le, Thi Thanh; Tran, Phu Duy; Nguyen, Thanh Chien; Nguyen, Van Quoc; Dang, Mau Chien; Tong, Duy Hien; Van Rijn, Cees J M


    A silicon nanowire field-effect transistor based sensor (SiNW-FET) has been proved to be the most sensitive and powerful device for bio-detection applications. In this paper, SiNWs were first fabricated by using our recently developed deposition and etching under angle technique (DEA), then used to build up the complete SiNW device based biosensor. The fabricated SiNW biosensor was used to detect DNA of genetically modified maize. As the DNA of the genetically modified maize has particular DNA sequences of 35S promoter, we therefore designed 21 mer DNA oligonucleotides, which are used as a receptor to capture the transferred DNA of maize. In our work, the SiNW biosensor could detect DNA of genetically modified maize with concentrations down to about 200 pM

  10. Environmental DNA (eDNA From the Wake of the Whales: Droplet Digital PCR for Detection and Species Identification

    C. Scott Baker


    Full Text Available Genetic sampling for identification of species, subspecies or stock of whales, dolphins and porpoises at sea remains challenging. Most samples have been collected with some form of a biopsy dart requiring a close approach of a vessel while the individual is at the surface. Here we have adopted droplet digital (ddPCR technology for detection and species identification of cetaceans using environmental (eDNA collected from seawater. We conducted a series of eDNA sampling experiments during 25 encounters with killer whales, Orcinus orca, in Puget Sound (the Salish Sea. The regular habits of killer whales in these inshore waters allowed us to locate pods and collect seawater, at an initial distance of 200 m and at 15-min intervals, for up to 2 h after the passage of the whales. To optimize detection, we designed a set of oligonucleotide primers and probes to target short fragments of the mitochondrial (mtDNA control region, with a focus on identification of known killer whale ecotypes. We confirmed the potential to detect eDNA in the wake of the whales for up to 2 h, despite movement of the water mass by several kilometers due to tidal currents. Re-amplification and sequencing of the eDNA barcode confirmed that the ddPCR detection included the “southern resident community” of killer whales, consistent with the calls from hydrophone recordings and visual observations.

  11. Factors influencing detection of eDNA from a stream-dwelling amphibian

    Pilliod, David S.; Goldberg, Caren S.; Arkle, Robert S.; Waits, Lisette P.


    Environmental DNA (eDNA) methods for detecting and estimating abundance of aquatic species are emerging rapidly, but little is known about how processes such as secretion rate, environmental degradation, and time since colonization or extirpation from a given site affect eDNA measurements. Using stream-dwelling salamanders and quantitative PCR (qPCR) analysis, we conducted three experiments to assess eDNA: (i) production rate; (ii) persistence time under different temperature and light conditions; and (iii) detectability and concentration through time following experimental introduction and removal of salamanders into previously unoccupied streams. We found that 44–50 g individuals held in aquaria produced 77 ng eDNA/h for 2 h, after which production either slowed considerably or began to equilibrate with degradation. eDNA in both full-sun and shaded treatments degraded exponentially to 2) and when samples were collected within 5 m of the animals. Concentrations of eDNA detected were very low and increased steadily from 6–24 h after introduction, reaching 0.0022 ng/L. Within 1 h of removing salamanders from the stream, eDNA was no longer detectable. These results suggest that eDNA detectability and concentration depend on production rates of individuals, environmental conditions, density of animals, and their residence time.

  12. Assessment of environmental DNA for detecting presence of imperiled aquatic amphibian species in isolated wetlands

    Mckee, Anna; Calhoun, Daniel L.; Barichivich, William J.; Spear, Stephen F.; Goldberg, Caren S.; Glenn, Travis C


    Environmental DNA (eDNA) is an emerging tool that allows low-impact sampling for aquatic species by isolating DNA from water samples and screening for DNA sequences specific to species of interest. However, researchers have not tested this method in naturally acidic wetlands that provide breeding habitat for a number of imperiled species, including the frosted salamander (Ambystoma cingulatum), reticulated flatwoods salamanders (Ambystoma bishopi), striped newt (Notophthalmus perstriatus), and gopher frog (Lithobates capito). Our objectives for this study were to develop and optimize eDNA survey protocols and assays to complement and enhance capture-based survey methods for these amphibian species. We collected three or more water samples, dipnetted or trapped larval and adult amphibians, and conducted visual encounter surveys for egg masses for target species at 40 sites on 12 different longleaf pine (Pinus palustris) tracts. We used quantitative PCRs to screen eDNA from each site for target species presence. We detected flatwoods salamanders at three sites with eDNA but did not detect them during physical surveys. Based on the sample location we assumed these eDNA detections to indicate the presence of frosted flatwoods salamanders. We did not detect reticulated flatwoods salamanders. We detected striped newts with physical and eDNA surveys at two wetlands. We detected gopher frogs at 12 sites total, three with eDNA alone, two with physical surveys alone, and seven with physical and eDNA surveys. We detected our target species with eDNA at 9 of 11 sites where they were present as indicated from traditional surveys and at six sites where they were not detected with traditional surveys. It was, however, critical to use at least three water samples per site for eDNA. Our results demonstrate eDNA surveys can be a useful complement to traditional survey methods for detecting imperiled pond-breeding amphibians. Environmental DNA may be particularly useful in situations

  13. Detection of genetically modified organisms (GMOs) using isothermal amplification of target DNA sequences.

    Lee, David; La Mura, Maurizio; Allnutt, Theo R; Powell, Wayne


    The most common method of GMO detection is based upon the amplification of GMO-specific DNA amplicons using the polymerase chain reaction (PCR). Here we have applied the loop-mediated isothermal amplification (LAMP) method to amplify GMO-related DNA sequences, 'internal' commonly-used motifs for controlling transgene expression and event-specific (plant-transgene) junctions. We have tested the specificity and sensitivity of the technique for use in GMO studies. Results show that detection of 0.01% GMO in equivalent background DNA was possible and dilutions of template suggest that detection from single copies of the template may be possible using LAMP. This work shows that GMO detection can be carried out using LAMP for routine screening as well as for specific events detection. Moreover, the sensitivity and ability to amplify targets, even with a high background of DNA, here demonstrated, highlights the advantages of this isothermal amplification when applied for GMO detection.

  14. A new method to extract dental pulp DNA: application to universal detection of bacteria.

    Lam Tran-Hung

    Full Text Available BACKGROUND: Dental pulp is used for PCR-based detection of DNA derived from host and bacteremic microorganims. Current protocols require odontology expertise for proper recovery of the dental pulp. Dental pulp specimen exposed to laboratory environment yields contaminants detected using universal 16S rDNA-based detection of bacteria. METHODOLOGY/PRINCIPAL FINDINGS: We developed a new protocol by encasing decontaminated tooth into sterile resin, extracting DNA into the dental pulp chamber itself and decontaminating PCR reagents by filtration and double restriction enzyme digestion. Application to 16S rDNA-based detection of bacteria in 144 teeth collected in 86 healthy people yielded a unique sequence in only 14 teeth (9.7% from 12 individuals (14%. Each individual yielded a unique 16S rDNA sequence in 1-2 teeth per individual. Negative controls remained negative. Bacterial identifications were all confirmed by amplification and sequencing of specific rpoB sequence. CONCLUSIONS/SIGNIFICANCE: The new protocol prevented laboratory contamination of the dental pulp. It allowed the detection of bacteria responsible for dental pulp colonization from blood and periodontal tissue. Only 10% such samples contained 16S rDNA. It provides a new tool for the retrospective diagnostic of bacteremia by allowing the universal detection of bacterial DNA in animal and human, contemporary or ancient tooth. It could be further applied to identification of host DNA in forensic medicine and anthropology.

  15. RNA detection in situ with FISH-STICs.

    Sinnamon, John R; Czaplinski, Kevin


    The ability to detect RNA molecules in situ has long had important applications for molecular biological studies. Enzyme or dye-labeled antisense in vitro runoff transcripts and synthetic oligodeoxynucleotides (ODN) both have a proven track record of success, but each of these also has scientific and practical drawbacks and limitations to its use. We devised a means to use commercially synthesized oligonucleotides as RNA-FISH probes without further modification and show that such probes work well for detection of RNA in cultured cells. This approach can bind a high concentration of fluorescent ODN to a short stretch of an RNA using commercial DNA synthesis outlets available to any laboratory. We call this approach for creating in situ hybridization probes Fluorescence In Situ Hybridization with Sequential Tethered and Intertwined ODN Complexes (FISH-STICs). We demonstrate that one FISH-STIC probe can detect mRNA molecules in culture, and that probe detection can be improved by the addition of multiple probes that can be easily adapted for robust mRNA quantification. Using FISH-STICs, we demonstrate a nonoverlapping distribution for β-actin and γ-actin mRNA in cultured fibroblasts, and the detection of neuron-specific transcripts within cultured primary hippocampal neurons.

  16. Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

    Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.


    The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

  17. The use of gold nanoparticle aggregation for DNA computing and logic-based biomolecular detection

    Lee, In-Hee; Yang, Kyung-Ae; Zhang, Byoung-Tak; Lee, Ji-Hoon; Park, Ji-Yoon; Chai, Young Gyu; Lee, Jae-Hoon


    The use of DNA molecules as a physical computational material has attracted much interest, especially in the area of DNA computing. DNAs are also useful for logical control and analysis of biological systems if efficient visualization methods are available. Here we present a quick and simple visualization technique that displays the results of the DNA computing process based on a colorimetric change induced by gold nanoparticle aggregation, and we apply it to the logic-based detection of biomolecules. Our results demonstrate its effectiveness in both DNA-based logical computation and logic-based biomolecular detection

  18. DNA-modified electrodes fabricated using copper-free click chemistry for enhanced protein detection.

    Furst, Ariel L; Hill, Michael G; Barton, Jacqueline K


    A method of DNA monolayer formation has been developed using copper-free click chemistry that yields enhanced surface homogeneity and enables variation in the amount of DNA assembled; extremely low-density DNA monolayers, with as little as 5% of the monolayer being DNA, have been formed. These DNA-modified electrodes (DMEs) were characterized visually, with AFM, and electrochemically, and were found to facilitate DNA-mediated reduction of a distally bound redox probe. These low-density monolayers were found to be more homogeneous than traditional thiol-modified DNA monolayers, with greater helix accessibility through an increased surface area-to-volume ratio. Protein binding efficiency of the transcriptional activator TATA-binding protein (TBP) was also investigated on these surfaces and compared to that on DNA monolayers formed with standard thiol-modified DNA. Our low-density monolayers were found to be extremely sensitive to TBP binding, with a signal decrease in excess of 75% for 150 nM protein. This protein was detectable at 4 nM, on the order of its dissociation constant, with our low-density monolayers. The improved DNA helix accessibility and sensitivity of our low-density DNA monolayers to TBP binding reflects the general utility of this method of DNA monolayer formation for DNA-based electrochemical sensor development.

  19. Detecting single DNA copy number variations in complex genomes using one nanogram of starting DNA and BAC-array CGH.

    Guillaud-Bataille, Marine; Valent, Alexander; Soularue, Pascal; Perot, Christine; Inda, Maria Mar; Receveur, Aline; Smaïli, Sadek; Roest Crollius, Hugues; Bénard, Jean; Bernheim, Alain; Gidrol, Xavier; Danglot, Gisèle


    Comparative genomic hybridization to bacterial artificial chromosome (BAC)-arrays (array-CGH) is a highly efficient technique, allowing the simultaneous measurement of genomic DNA copy number at hundreds or thousands of loci, and the reliable detection of local one-copy-level variations. We report a genome-wide amplification method allowing the same measurement sensitivity, using 1 ng of starting genomic DNA, instead of the classical 1 microg usually necessary. Using a discrete series of DNA fragments, we defined the parameters adapted to the most faithful ligation-mediated PCR amplification and the limits of the technique. The optimized protocol allows a 3000-fold DNA amplification, retaining the quantitative characteristics of the initial genome. Validation of the amplification procedure, using DNA from 10 tumour cell lines hybridized to BAC-arrays of 1500 spots, showed almost perfectly superimposed ratios for the non-amplified and amplified DNAs. Correlation coefficients of 0.96 and 0.99 were observed for regions of low-copy-level variations and all regions, respectively (including in vivo amplified oncogenes). Finally, labelling DNA using two nucleotides bearing the same fluorophore led to a significant increase in reproducibility and to the correct detection of one-copy gain or loss in >90% of the analysed data, even for pseudotriploid tumour genomes.

  20. Optimised Pre-Analytical Methods Improve KRAS Mutation Detection in Circulating Tumour DNA (ctDNA) from Patients with Non-Small Cell Lung Cancer (NSCLC)

    Sherwood, James L.; Corcoran, Claire; Brown, Helen; Sharpe, Alan D.; Musilova, Milena; Kohlmann, Alexander


    Introduction Non-invasive mutation testing using circulating tumour DNA (ctDNA) is an attractive premise. This could enable patients without available tumour sample to access more treatment options. Materials & Methods Peripheral blood and matched tumours were analysed from 45 NSCLC patients. We investigated the impact of pre-analytical variables on DNA yield and/or KRAS mutation detection: sample collection tube type, incubation time, centrifugation steps, plasma input volume and DNA extraction kits. Results 2 hr incubation time and double plasma centrifugation (2000 x g) reduced overall DNA yield resulting in lowered levels of contaminating genomic DNA (gDNA). Reduced “contamination” and increased KRAS mutation detection was observed using cell-free DNA Blood Collection Tubes (cfDNA BCT) (Streck), after 72 hrs following blood draw compared to EDTA tubes. Plasma input volume and use of different DNA extraction kits impacted DNA yield. Conclusion This study demonstrated that successful ctDNA recovery for mutation detection in NSCLC is dependent on pre-analytical steps. Development of standardised methods for the detection of KRAS mutations from ctDNA specimens is recommended to minimise the impact of pre-analytical steps on mutation detection rates. Where rapid sample processing is not possible the use of cfDNA BCT tubes would be advantageous. PMID:26918901

  1. Optimised Pre-Analytical Methods Improve KRAS Mutation Detection in Circulating Tumour DNA (ctDNA from Patients with Non-Small Cell Lung Cancer (NSCLC.

    James L Sherwood

    Full Text Available Non-invasive mutation testing using circulating tumour DNA (ctDNA is an attractive premise. This could enable patients without available tumour sample to access more treatment options.Peripheral blood and matched tumours were analysed from 45 NSCLC patients. We investigated the impact of pre-analytical variables on DNA yield and/or KRAS mutation detection: sample collection tube type, incubation time, centrifugation steps, plasma input volume and DNA extraction kits.2 hr incubation time and double plasma centrifugation (2000 x g reduced overall DNA yield resulting in lowered levels of contaminating genomic DNA (gDNA. Reduced "contamination" and increased KRAS mutation detection was observed using cell-free DNA Blood Collection Tubes (cfDNA BCT (Streck, after 72 hrs following blood draw compared to EDTA tubes. Plasma input volume and use of different DNA extraction kits impacted DNA yield.This study demonstrated that successful ctDNA recovery for mutation detection in NSCLC is dependent on pre-analytical steps. Development of standardised methods for the detection of KRAS mutations from ctDNA specimens is recommended to minimise the impact of pre-analytical steps on mutation detection rates. Where rapid sample processing is not possible the use of cfDNA BCT tubes would be advantageous.

  2. Direct colorimetric detection of unamplified pathogen DNA by dextrin-capped gold nanoparticles.

    Baetsen-Young, Amy M; Vasher, Matthew; Matta, Leann L; Colgan, Phil; Alocilja, Evangelyn C; Day, Brad


    The interaction between gold nanoparticles (AuNPs) and nucleic acids has facilitated a variety of diagnostic applications, with further diversification of synthesis match bio-applications while reducing biotoxicity. However, DNA interactions with unique surface capping agents have not been fully defined. Using dextrin-capped AuNPs (d-AuNPs), we have developed a novel unamplified genomic DNA (gDNA) nanosensor, exploiting dispersion and aggregation characteristics of d-AuNPs, in the presence of gDNA, for sequence-specific detection. We demonstrate that d-AuNPs are stable in a five-fold greater salt concentration than citrate-capped AuNPs and the d-AuNPs were stabilized by single stranded DNA probe (ssDNAp). However, in the elevated salt concentrations of the DNA detection assay, the target reactions were surprisingly further stabilized by the formation of a ssDNAp-target gDNA complex. The results presented herein lead us to propose a mechanism whereby genomic ssDNA secondary structure formation during ssDNAp-to-target gDNA binding enables d-AuNP stabilization in elevated ionic environments. Using the assay described herein, we were successful in detecting as little as 2.94 fM of pathogen DNA, and using crude extractions of a pathogen matrix, as few as 18 spores/µL. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Detection of Adriamycin-DNA adducts by accelerator mass spectrometry at clinically relevant Adriamycin concentrations.

    Coldwell, Kate E; Cutts, Suzanne M; Ognibene, Ted J; Henderson, Paul T; Phillips, Don R


    Limited sensitivity of existing assays has prevented investigation of whether Adriamycin-DNA adducts are involved in the anti-tumour potential of Adriamycin. Previous detection has achieved a sensitivity of a few Adriamycin-DNA adducts/10(4) bp DNA, but has required the use of supra-clinical drug concentrations. This work sought to measure Adriamycin-DNA adducts at sub-micromolar doses using accelerator mass spectrometry (AMS), a technique with origins in geochemistry for radiocarbon dating. We have used conditions previously validated (by less sensitive decay counting) to extract [(14)C]Adriamycin-DNA adducts from cells and adapted the methodology to AMS detection. Here we show the first direct evidence of Adriamycin-DNA adducts at clinically-relevant Adriamycin concentrations. [(14)C]Adriamycin treatment (25 nM) resulted in 4.4 +/- 1.0 adducts/10(7) bp ( approximately 1300 adducts/cell) in MCF-7 breast cancer cells, representing the best sensitivity and precision reported to date for the covalent binding of Adriamycin to DNA. The exceedingly sensitive nature of AMS has enabled over three orders of magnitude increased sensitivity of Adriamycin-DNA adduct detection and revealed adduct formation within an hour of drug treatment. This method has been shown to be highly reproducible for the measurement of Adriamycin-DNA adducts in tumour cells in culture and can now be applied to the detection of these adducts in human tissues.

  4. Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

    Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam


    This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

  5. Fluorescence quantitative PCR in detection of HBV DNA

    Shen Zheng; Li Ming; Shen Xia


    Objective: To study the relationship between the serum content of HBV-DNA and expression of serological markers with HBV infection patients. Methods: Serum samples from 375 hepatitis B patients with different clinical status and 70 normal persons were quantitated for HBV-DNA by FQ-PCR. Results: The average of HBV-DNA contents in the patient in the groups of HBsAg (+) and of HBeAg(+) were significantly higher than those in the group of HBsAg(-) and of HBeAg(-). Even in the group of HBeAg negative, high HBV-DNA contents might still be present in both the HBeAg(+) and HBeAg(-) groups. Conclusion: FQ-PCR can be used to monitor the real state of HBV infection, replication and the course of disease

  6. Detection of Different DNA Animal Species in Commercial Candy Products.

    Muñoz-Colmenero, Marta; Martínez, Jose Luis; Roca, Agustín; Garcia-Vazquez, Eva


    Candy products are consumed all across the world, but there is not much information about their composition. In this study we have used a DNA-based approach for determining the animal species occurring in 40 commercial candies of different types. We extracted DNA and performed PCR amplification, cloning and sequencing for obtaining species-informative DNA sequences. Eight species were identified including fish (hake and anchovy) in 22% of the products analyzed. Bovine and porcine were the most abundant appearing in 27 samples each one. Most products contained a mixture of species. Marshmallows (7), jelly-types, and gummies (20) contained a significantly higher number of species than hard candies (9). We demonstrated the presence of DNA animal species in candy product which allow consumers to make choices and prevent allergic reaction. © 2016 Institute of Food Technologists®

  7. Detection of human papillomavirus DNA with in situ hybridisation in ...

    present study was undertaken to determine the prevalence of human papillomavirus (HPV) DNA in oral squamous carcinoma in the west of the Northern ... Immunocytochemistry for viral antigen was negative in all the specimens. HPV-18 was ...

  8. New applications of CRISPR/Cas9 system on mutant DNA detection.

    Jia, Chenqiang; Huai, Cong; Ding, Jiaqi; Hu, Lingna; Su, Bo; Chen, Hongyan; Lu, Daru


    The detection of mutant DNA is critical for precision medicine, but low-frequency DNA mutation is very hard to be determined. CRISPR/Cas9 is a robust tool for in vivo gene editing, and shows the potential for precise in vitro DNA cleavage. Here we developed a DNA mutation detection system based on CRISPR/Cas9 that can detect gene mutation efficiently even in a low-frequency condition. The system of CRISPR/Cas9 cleavage in vitro showed a high accuracy similar to traditional T7 endonuclease I (T7E1) assay in estimating mutant DNA proportion in the condition of normal frequency. The technology was further used for low-frequency mutant DNA detection of EGFR and HBB somatic mutations. To the end, Cas9 was employed to cleave the wild-type (WT) DNA and to enrich the mutant DNA. Using amplified fragment length polymorphism analysis (AFLPA) and Sanger sequencing, we assessed the sensitivity of CRISPR/Cas9 cleavage-based PCR, in which mutations at 1%-10% could be enriched and detected. When combined with blocker PCR, its sensitivity reached up to 0.1%. Our results suggested that this new application of CRISPR/Cas9 system is a robust and potential method for heterogeneous specimens in the clinical diagnosis and treatment management. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Hall effect biosensors with ultraclean graphene film for improved sensitivity of label-free DNA detection

    Loan, Phan Thi Kim


    The quality of graphene strongly affects the performance of graphene-based biosensors which are highly demanded for the sensitive and selective detection of biomolecules, such as DNA. This work reported a novel transfer process for preparing a residue-free graphene film using a thin gold supporting layer. A Hall effect device made of this gold-transferred graphene was demonstrated to significantly enhance the sensitivity (≈ 5 times) for hybridization detection, with a linear detection range of 1 pM – 100nM for DNA target. Our findings provide an efficient method to boost the sensitivity of graphene-based biosensors for DNA recognition.

  10. Loop-mediated isothermal amplification (LAMP) shield for Arduino DNA detection.

    Velders, Aldrik H; Schoen, Cor; Saggiomo, Vittorio


    Loop-mediated isothermal amplification (LAMP) of DNA is gaining relevance as a method to detect nucleic acids, as it is easier, faster, and more powerful than conventional Polymerase Chain Reaction. However, LAMP is still mostly used in laboratory settings, because of the lack of a cheap and easy, one-button device that can perform LAMP experiments. Here we show how to build and program an Arduino shield for a LAMP and detection of DNA. The here described Arduino Shield is cheap, easy to assemble, to program and use, it is battery operated and the detection of DNA is done by naked-eye so that it can be used in field.

  11. Detection of herpes simplex virus-specific DNA sequences in latently infected mice and in humans.

    Efstathiou, S; Minson, A C; Field, H J; Anderson, J R; Wildy, P


    Herpes simplex virus-specific DNA sequences have been detected by Southern hybridization analysis in both central and peripheral nervous system tissues of latently infected mice. We have detected virus-specific sequences corresponding to the junction fragment but not the genomic termini, an observation first made by Rock and Fraser (Nature [London] 302:523-525, 1983). This "endless" herpes simplex virus DNA is both qualitatively and quantitatively stable in mouse neural tissue analyzed over a 4-month period. In addition, examination of DNA extracted from human trigeminal ganglia has shown herpes simplex virus DNA to be present in an "endless" form similar to that found in the mouse model system. Further restriction enzyme analysis of latently infected mouse brainstem and human trigeminal DNA has shown that this "endless" herpes simplex virus DNA is present in all four isomeric configurations.

  12. Plant DNA Detection from Grasshopper Guts: A Step-by-Step Protocol, from Tissue Preparation to Obtaining Plant DNA Sequences

    Alina Avanesyan


    Full Text Available Premise of the study: A PCR-based method of identifying ingested plant DNA in gut contents of Melanoplus grasshoppers was developed. Although previous investigations have focused on a variety of insects, there are no protocols available for plant DNA detection developed for grasshoppers, agricultural pests that significantly influence plant community composition. Methods and Results: The developed protocol successfully used the noncoding region of the chloroplast trnL (UAA gene and was tested in several feeding experiments. Plant DNA was obtained at seven time points post-ingestion from whole guts and separate gut sections, and was detectable up to 12 h post-ingestion in nymphs and 22 h post-ingestion in adult grasshoppers. Conclusions: The proposed protocol is an effective, relatively quick, and low-cost method of detecting plant DNA from the grasshopper gut and its different sections. This has important applications, from exploring plant “movement” during food consumption, to detecting plant–insect interactions.

  13. Amplified Detection of the Aptamer-Vanillin Complex with the Use of Bsm DNA Polymerase.

    Andrianova, Mariia; Komarova, Natalia; Grudtsov, Vitaliy; Kuznetsov, Evgeniy; Kuznetsov, Alexander


    The electrochemical detection of interactions between aptamers and low-molecular-weight targets often lacks sensitivity. Signal amplification improves the detection of the aptamer-analyte complex; Bsm DNA polymerase was used to amplify the signal from the interaction of vanillin and its aptamer named Van_74 on an ion-sensitive field-effect transistor (ISFET)-based biosensor. The aptamer was immobilized on the ISFET sensitive surface. A short DNA probe was hybridized with the aptamer and dissociated from it upon vanillin addition. A free probe interacted with a special DNA molecular beacon initiated the Bsm DNA polymerase reaction that was detected by ISFET. A buffer solution suitable for both aptamer action and Bsm DNA polymerase activity was determined. The ISFET was shown to detect the Bsm DNA polymerase reaction under the selected conditions. Vanillin at different concentrations (1 × 10 -6 -1 × 10 -8 M) was detected using the biosensor with signal amplification. The developed detection system allowed for the determination of vanillin, starting at a 10 -8 M concentration. Application of the Bsm DNA polymerase resulted in a 15.5 times lower LoD when compared to the biosensor without signal amplification (10.1007/s00604-017-2586-4).

  14. Amplified Detection of the Aptamer–Vanillin Complex with the Use of Bsm DNA Polymerase

    Mariia Andrianova


    Full Text Available The electrochemical detection of interactions between aptamers and low-molecular-weight targets often lacks sensitivity. Signal amplification improves the detection of the aptamer-analyte complex; Bsm DNA polymerase was used to amplify the signal from the interaction of vanillin and its aptamer named Van_74 on an ion-sensitive field-effect transistor (ISFET-based biosensor. The aptamer was immobilized on the ISFET sensitive surface. A short DNA probe was hybridized with the aptamer and dissociated from it upon vanillin addition. A free probe interacted with a special DNA molecular beacon initiated the Bsm DNA polymerase reaction that was detected by ISFET. A buffer solution suitable for both aptamer action and Bsm DNA polymerase activity was determined. The ISFET was shown to detect the Bsm DNA polymerase reaction under the selected conditions. Vanillin at different concentrations (1 × 10−6–1 × 10−8 M was detected using the biosensor with signal amplification. The developed detection system allowed for the determination of vanillin, starting at a 10−8 M concentration. Application of the Bsm DNA polymerase resulted in a 15.5 times lower LoD when compared to the biosensor without signal amplification (10.1007/s00604-017-2586-4.

  15. [Research Progress on the Detection Method of DNA Methylation and Its Application in Forensic Science].

    Nie, Y C; Yu, L J; Guan, H; Zhao, Y; Rong, H B; Jiang, B W; Zhang, T


    As an important part of epigenetic marker, DNA methylation involves in the gene regulation and attracts a wide spread attention in biological auxology, geratology and oncology fields. In forensic science, because of the relative stable, heritable, abundant, and age-related characteristics, DNA methylation is considered to be a useful complement to the classic genetic markers for age-prediction, tissue-identification, and monozygotic twins' discrimination. Various methods for DNA methylation detection have been validated based on methylation sensitive restriction endonuclease, bisulfite modification and methylation-CpG binding protein. In recent years, it is reported that the third generation sequencing method can be used to detect DNA methylation. This paper aims to make a review on the detection method of DNA methylation and its applications in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine.

  16. How to evaluate PCR assays for the detection of low-level DNA

    Banch-Clausen, Frederik; Urhammer, Emil; Rieneck, Klaus


    distribution describing parameters for singleplex real-time PCR-based detection of low-level DNA. The model was tested against experimental data of diluted cell-free foetal DNA. Also, the model was compared with a simplified formula to enable easy predictions. The model predicted outcomes that were...... not significantly different from experimental data generated by testing of cell-free foetal DNA. Also, the simplified formula was applicable for fast and accurate assay evaluation. In conclusion, the model can be applied for evaluation of sensitivity of real-time PCR-based detection of low-level DNA, and may also......High sensitivity of PCR-based detection of very low copy number DNA targets is crucial. Much focus has been on design of PCR primers and optimization of the amplification conditions. Very important are also the criteria used for determining the outcome of a PCR assay, e.g. how many replicates...

  17. An improved method for detecting genetic variation in DNA using denaturing gradient gel electrophoresis

    Takahashi, Norio; Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.


    We have examined the feasibility of denaturing gradient gel electrophoresis (DGGE) of RNA:DNA duplexes to detect variations in genomic and cloned DNAs. The result has demonstrated that use of RNA:DNA duplexes makes DGGE much more practical for screening a large number of samples than use of DNA:DNA heteroduplexes, because preparation of RNA probes is easier than that of DNA probes. Three different 32 P-labeled RNA probes were produced. Genomic or cloned DNAs were digested with restriction enzymes and hybridized to labeled RNA probes, and resulting RNA:DNA duplexes were examined by DGGE. The presence of a mismatch(es) was detected as a difference in the mobility of bands on the gel. The experimental conditions were determined using DNA segments from cloned normal and three thalassemic human β-globin genes. The results from experiments on the cloned DNAs suggest that DGGE of RNA:DNA duplexes will detect nucleotide substitutions and deletions in DNA. In the course of these studies, a polymorphism due to a single-base substitution at position 666 of IVS2 (IVS2-666) of the human β-globin gene was directly identified using genomic DNA samples. A study of 59 unrelated Japanese from Hiroshima was undertaken in which the frequency of the allele with C at IVS2-666 was 0.48 and that of the allele with T was 0.52. This approach was found to be very effective for detecting heritable variation and should be a powerful tool for detecting fresh mutations in DNA, which occur outside the known restriction sites. (author)

  18. Detection of irradiated fresh, chilled, and frozen foods by the mitochondrial DNA method

    Machioni, E.; Bergaentzle, M.; Todoriki, S.; Hasselmann, C.; Kuntz, F.


    DNA molecules are very sensitive to ionising radiation, even at low doses. Strand breaks are easy to detect despite the generally low DNA content of foods, but such ruptures are not specific to radiation processing. Preliminary experiments showed that cellular DNA in beef underwent strong enzymatic degradation during storage at +4 o C and thus radiation effects could not be isolated. In order to make DNA strand rupture more specific to radiation (other than by deep freezing) it appears necessary to isolate the irradiated DNA from cell enzymes. This is the case for mitochondrial DNA which is protected from enzymatic degradation by the mitochondrial walls but not from radiation. It can, therefore, be assumed that DNA strand breaks in mitochondria will be specific to ionising radiation. The aim of this work is to develop and validate the proposed test on different food samples (meat and fish products) which are already or may be industrially irradiated in the near future. (author)

  19. Microfabricated electrochemical sensor for the detection of radiation-induced DNA damage

    Wang, J.; Rivas, G.; Ozsoz, M.; Grant, D.H.; Cai, X.; Parrado, C. [New Mexico State Univ., Las Cruces, NM (United States)


    An electrochemical biosensor protocol for the detection of radiation-induced DNA damage is described. The procedure employs a dsDNA-coated screen-printed electrode and relies on changes in the guanine-DNA oxidation signal upon exposure to ultraviolet radiation. The decreased signal is ascribed primarily to conformational changes in the DNA and to the photoconversion of the guanine-DNA moiety to a nonelectroactive monomeric base product. Factors influencing the response of these microfabricated DNA sensors, such as irradiation time, wavelength, and distance, are explored, and future prospects are discussed. Similar results are given for the use of bare strip electrodes in connection with irradiated DNA solutions. 8 refs., 4 figs.

  20. Chemical cleavage reactions of DNA on solid support: application in mutation detection

    Cotton Richard GH


    Full Text Available Abstract Background The conventional solution-phase Chemical Cleavage of Mismatch (CCM method is time-consuming, as the protocol requires purification of DNA after each reaction step. This paper describes a new version of CCM to overcome this problem by immobilizing DNA on silica solid supports. Results DNA test samples were loaded on to silica beads and the DNA bound to the solid supports underwent chemical modification reactions with KMnO4 (potassium permanganate and hydroxylamine in 3M TEAC (tetraethylammonium chloride solution. The resulting modified DNA was then simultaneously cleaved by piperidine and removed from the solid supports to afford DNA fragments without the requirement of DNA purification between reaction steps. Conclusions The new solid-phase version of CCM is a fast, cost-effective and sensitive method for detection of mismatches and mutations.

  1. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y


    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  2. Gold-based optical biosensor for single-mismatched DNA detection using salt-induced hybridization

    Zhan, Zongrui; Ma, Xingyi; Cao, Cuong


    In this study, a gold nanoparticle (Au-NP)-based detection method for sensitive and specific DNA-based diagnostic applications is described. A sandwich format consisting of Au-NPs/DNA/PMP (Streptavidin-coated MagnetSphere Para-Magnetic Particles) was fabricated. PMPs captured and separated target...

  3. Repurposing environmental DNA samples: Detecting the western pearlshell (Margaritifera falcata) as a proof of concept

    Joseph C. Dysthe; Torrey Rodgers; Thomas W. Franklin; Kellie J. Carim; Michael K. Young; Kevin S. McKelvey; Karen E. Mock; Michael K. Schwartz


    Information on the distribution of multiple species in a common landscape is fundamental to effective conservation and management. However, distribution data are expensive to obtain and often limited to high-profile species in a system. A recently developed technique, environmental DNA (eDNA) sampling, has been shown to be more sensitive than traditional detection...

  4. Detection of Alicyclobacillus species in fruit juice using a random genomic DNA microarray chip.

    Jang, Jun Hyeong; Kim, Sun-Joong; Yoon, Bo Hyun; Ryu, Jee-Hoon; Gu, Man Bock; Chang, Hyo-Ihl


    This study describes a method using a DNA microarray chip to rapidly and simultaneously detect Alicyclobacillus species in orange juice based on the hybridization of genomic DNA with random probes. Three food spoilage bacteria were used in this study: Alicyclobacillus acidocaldarius, Alicyclobacillus acidoterrestris, and Alicyclobacillus cycloheptanicus. The three Alicyclobacillus species were adjusted to 2 × 10(3) CFU/ml and inoculated into pasteurized 100% pure orange juice. Cy5-dCTP labeling was used for reference signals, and Cy3-dCTP was labeled for target genomic DNA. The molar ratio of 1:1 of Cy3-dCTP and Cy5-dCTP was used. DNA microarray chips were fabricated using randomly fragmented DNA of Alicyclobacillus spp. and were hybridized with genomic DNA extracted from Bacillus spp. Genomic DNA extracted from Alicyclobacillus spp. showed a significantly higher hybridization rate compared with DNA of Bacillus spp., thereby distinguishing Alicyclobacillus spp. from Bacillus spp. The results showed that the microarray DNA chip containing randomly fragmented genomic DNA was specific and clearly identified specific food spoilage bacteria. This microarray system is a good tool for rapid and specific detection of thermophilic spoilage bacteria, mainly Alicyclobacillus spp., and is useful and applicable to the fruit juice industry.

  5. Strip biosensor for amplified detection of nerve growth factor-beta based on a molecular translator and catalytic DNA circuit.

    Liu, Jun; Lai, Ting; Mu, Kejie; Zhou, Zheng


    We have demonstrated a new visual detection approach based on a molecular translator and a catalytic DNA circuit for the detection of nerve growth factor-beta (NGF-β). In this assay, a molecular translator based on the binding-induced DNA strand-displacement reaction was employed to convert the input protein to an output DNA signal. The molecular translator is composed of a target recognition element and a signal output element. Target recognition is achieved by the binding of the anti-NGF-β antibody to the target protein. Polyclonal anti-NGF-β antibody is conjugated to DNA1 and DNA2. The antibody conjugated DNA1 is initially hybridized to DNA3 to form a stable DNA1/DNA3 duplex. In the presence of NGF-β, the binding of the same target protein brings DNA1 and DNA2 into close proximity, resulting in an increase in their local effective concentration. This process triggers the strand-displacement reaction between DNA2 and DNA3 and releases the output DNA3. The released DNA3 is further amplified by a catalytic DNA circuit. The product of the catalytic DNA circuit is detected by a strip biosensor. This proposed assay has high sensitivity and selectivity with a dynamic response ranging from 10 fM to 10 pM, and its detection limit is 10 fM of NGF-β. This work provides a sensitive, enzyme-free, and universal strategy for the detection of other proteins.

  6. Development of an Automated Microfluidic System for DNA Collection, Amplification, and Detection of Pathogens

    Hagan, Bethany S.; Bruckner-Lea, Cynthia J.


    This project was focused on developing and testing automated routines for a microfluidic Pathogen Detection System. The basic pathogen detection routine has three primary components; cell concentration, DNA amplification, and detection. In cell concentration, magnetic beads are held in a flow cell by an electromagnet. Sample liquid is passed through the flow cell and bacterial cells attach to the beads. These beads are then released into a small volume of fluid and delivered to the peltier device for cell lysis and DNA amplification. The cells are lysed during initial heating in the peltier device, and the released DNA is amplified using polymerase chain reaction (PCR) or strand displacement amplification (SDA). Once amplified, the DNA is then delivered to a laser induced fluorescence detection unit in which the sample is detected. These three components create a flexible platform that can be used for pathogen detection in liquid and sediment samples. Future developments of the system will include on-line DNA detection during DNA amplification and improved capture and release methods for the magnetic beads during cell concentration.

  7. Detection of DNA damage in cells exposed to ionizing radiation by use of antisingle-stranded-DNA monoclonal antibody

    Schans, G.P. van der; Loon, A.A.W.M. van; Groenendijk, R.H.; Baan, R.A.


    An immunochemical method has been developed for quantitative detection of DNA damage in mammalian cells. The method is based on the binding of a monoclonal antibody to single-stranded DNA. The clone producing this antibody, D1B, was obtained as a by-product from fusion of mouse myeloma cells with spleen cells isolated from a mouse immunized with chemically modified DNA. The technique is based upon the determination of the percentage single-strandedness resulting from the partial umwinding of cellular DNA under alkaline conditions, a time-dependent process. Single-strand and double-strand DNA breaks, or lesions converted into such breaks in alkaline medium, form initiation points for the unwinding. The extent of unwinding under controlled conditions is a measure, therefore, of the amount of such sites. The method is rapid, does not require radioactive labelling of DNA or physical separation of single- from double-stranded molecules, is sufficiently sensitive to detect damage induced by 1 Gu of ionizing radiation and needs only small amounts of cells. The usefulness of the technique was demonstrated in a study on the induction of damage and its repair in unlabelled cultured Chinese hamster cells and in DNA-containing cells of human blood, both after exposure to 60 Co-γ-rays, and in white blood cells and bone marrow cells of X-irradiated mice. A dose-related degree of unwinding was observed and repair could be observed up to 60 min after irradiation. (author). 19 refs.; 3 figs.; 1 tab

  8. In situ detection of tandem DNA repeat length

    Yaar, R.; Szafranski, P.; Cantor, C.R.; Smith, C.L. [Boston Univ., MA (United States)


    A simple method for scoring short tandem DNA repeats is presented. An oligonucleotide target, containing tandem repeats embedded in a unique sequence, was hybridized to a set of complementary probes, containing tandem repeats of known lengths. Single-stranded loop structures formed on duplexes containing a mismatched (different) number of tandem repeats. No loop structure formed on duplexes containing a matched (identical) number of tandem repeats. The matched and mismatched loop structures were enzymatically distinguished and differentially labeled by treatment with S1 nuclease and the Klenow fragment of DNA polymerase. 7 refs., 4 figs.

  9. Hall effect biosensors with ultraclean graphene film for improved sensitivity of label-free DNA detection

    Loan, Phan Thi Kim; Wu, Dongqin; Ye, Chen; Li, Xiaoqing; Tra, Vu Thanh; Wei, Qiuping; Fu, Li; Yu, Aimin; Li, Lain-Jong; Lin, Cheng-Te


    The quality of graphene strongly affects the performance of graphene-based biosensors which are highly demanded for the sensitive and selective detection of biomolecules, such as DNA. This work reported a novel transfer process for preparing a

  10. Improving Probe Immobilization for Label-Free Capacitive Detection of DNA Hybridization on Microfabricated Gold Electrodes

    Sandro Carrara


    Full Text Available Alternative approaches to labeled optical detection for DNA arrays are actively investigated for low-cost point-of-care applications. In this domain, label-free capacitive detection is one of the most intensely studied techniques. It is based on the idea to detect the Helmholtz ion layer displacements when molecular recognition occurs at the electrodes/solution interface. The sensing layer is usually prepared by using thiols terminated DNA single-strength oligonucleotide probes on top of the sensor electrodes. However, published data shows evident time drift, which greatly complicates signal conditioning and processing and ultimately increases the uncertainty in DNA recognition sensing. The aim of this work is to show that newly developed ethylene-glycol functionalized alkanethiols greatly reduce time drift, thereby significantly improving capacitance based label-free detection of DNA.

  11. Rapid detection of cancer related DNA nanoparticulate biomarkers and nanoparticles in whole blood

    Heller, Michael J.; Krishnan, Raj; Sonnenberg, Avery


    The ability to rapidly detect cell free circulating (cfc) DNA, cfc-RNA, exosomes and other nanoparticulate disease biomarkers as well as drug delivery nanoparticles directly in blood is a major challenge for nanomedicine. We now show that microarray and new high voltage dielectrophoretic (DEP) devices can be used to rapidly isolate and detect cfc-DNA nanoparticulates and nanoparticles directly from whole blood and other high conductance samples (plasma, serum, urine, etc.). At DEP frequencies of 5kHz-10kHz both fluorescent-stained high molecular weight (hmw) DNA, cfc-DNA and fluorescent nanoparticles separate from the blood and become highly concentrated at specific DEP highfield regions over the microelectrodes, while blood cells move to the DEP low field-regions. The blood cells can then be removed by a simple fluidic wash while the DNA and nanoparticles remain highly concentrated. The hmw-DNA could be detected at a level of <260ng/ml and the nanoparticles at <9.5 x 109 particles/ml, detection levels that are well within the range for viable clinical diagnostics and drug nanoparticle monitoring. Disease specific cfc-DNA materials could also be detected directly in blood from patients with Chronic Lymphocytic Leukemia (CLL) and confirmed by PCR genotyping analysis.

  12. 5-bp Classical Satellite DNA Loci from Chromosome-1 Instability in Cervical Neoplasia Detected by DNA Breakage Detection/Fluorescence in Situ Hybridization (DBD-FISH).

    Cortés-Gutiérrez, Elva I; Ortíz-Hernández, Brenda L; Dávila-Rodríguez, Martha I; Cerda-Flores, Ricardo M; Fernández, José Luis; López-Fernández, Carmen; Gosálvez, Jaime


    We aimed to evaluate the association between the progressive stages of cervical neoplasia and DNA damage in 5-bp classical satellite DNA sequences from chromosome-1 in cervical epithelium and in peripheral blood lymphocytes using DNA breakage detection/fluorescence in situ hybridization (DBD-FISH). A hospital-based unmatched case-control study was conducted in 2011 with a sample of 30 women grouped according to disease stage and selected according to histological diagnosis; 10 with low-grade squamous intraepithelial lesions (LG-SIL), 10 with high-grade SIL (HG-SIL), and 10 with no cervical lesions, from the Unidad Medica de Alta Especialidad of The Mexican Social Security Institute, IMSS, Mexico. Specific chromosome damage levels in 5-bp classical satellite DNA sequences from chromosome-1 were evaluated in cervical epithelium and peripheral blood lymphocytes using the DBD-FISH technique. Whole-genome DNA hybridization was used as a reference for the level of damage. Results of Kruskal-Wallis test showed a significant increase according to neoplastic development in both tissues. The instability of 5-bp classical satellite DNA sequences from chromosome-1 was evidenced using chromosome-orientation FISH. In conclusion, we suggest that the progression to malignant transformation involves an increase in the instability of 5-bp classical satellite DNA sequences from chromosome-1.

  13. 5-bp Classical Satellite DNA Loci from Chromosome-1 Instability in Cervical Neoplasia Detected by DNA Breakage Detection/Fluorescence in Situ Hybridization (DBD-FISH

    Jaime Gosálvez


    Full Text Available We aimed to evaluate the association between the progressive stages of cervical neoplasia and DNA damage in 5-bp classical satellite DNA sequences from chromosome-1 in cervical epithelium and in peripheral blood lymphocytes using DNA breakage detection/fluorescence in situ hybridization (DBD-FISH. A hospital-based unmatched case-control study was conducted in 2011 with a sample of 30 women grouped according to disease stage and selected according to histological diagnosis; 10 with low-grade squamous intraepithelial lesions (LG-SIL, 10 with high-grade SIL (HG-SIL, and 10 with no cervical lesions, from the Unidad Medica de Alta Especialidad of The Mexican Social Security Institute, IMSS, Mexico. Specific chromosome damage levels in 5-bp classical satellite DNA sequences from chromosome-1 were evaluated in cervical epithelium and peripheral blood lymphocytes using the DBD-FISH technique. Whole-genome DNA hybridization was used as a reference for the level of damage. Results of Kruskal-Wallis test showed a significant increase according to neoplastic development in both tissues. The instability of 5-bp classical satellite DNA sequences from chromosome-1 was evidenced using chromosome-orientation FISH. In conclusion, we suggest that the progression to malignant transformation involves an increase in the instability of 5-bp classical satellite DNA sequences from chromosome-1.

  14. Voltammetric Detection of Damage to DNA by Arsenic Compounds at a DNA Biosensor

    R. Wennrich


    Full Text Available DNA biosensor can serve as a powerfull tool for simple in vitro tests of chemicaltoxicity. In this paper, damage to DNA attached to the surface of screen-printed carbonelectrode by arsenic compounds in solution is described. Using the Co(III complex with1,10-phenanthroline, [Co(phen3]3+ , as an electrochemical DNA marker and the Ru(IIcomplex with bipyridyne, [Ru(bipy3]2+ , as a DNA oxidation catalyst, the portion of originaldsDNA which survives an incubation of the biosensor in the cleavage medium was evaluated.The model cleavage mixture was composed of an arsenic compound at 10-3 mol/Lconcentration corresponding to real contaminated water, 2x10-4 mol/L Fe(II or Cu(II ions asthe redox catalyst, and 1.5x10-2 mol/L hydrogen peroxide. DNA damage by arsenite,dimethylarsinic acid as the metabolic product of inorganic arsenic and widely used herbicide,as well as phenylarsonic acid and p-arsanilic acid as the representatives of feed additives wasfound in difference to arsenate.

  15. Branched-DNA signal amplification combined with paper chromatography hybridization assay and used in hepatitis B virus DNA detection

    Fu, F.Z.; Liu, L.X.; Wang, W.Q.; Sun, S. H.; Liu, L.B.


    Nucleic acids detection method is vital to the clinical pathogen diagnosis. The established method can be classified into target direct amplification and signal amplification format according to the target DNA or RNA being directly amplified or not. Those methods have advantages and disadvantages respectively in the clinical application. In the United States of American, branched-DNA as a strong signal amplifier is broadly used in the quantification of the nucleic acids. To gain satisfied sensitivity, some expensive label molecular and instruments should be adopted. Personnel should be special trained to perform. Hence, those can't be widely carried out in the Third World. To avoid those disadvantages, we used the branched-DNA amplifier in the paper chromatography hybridization assay. Methods: Branched DNA signal amplifier and series of probes complementary to the nucleic acid sequence of hepatitis B virus (HBV) have been synthesized. HBV-DNA or it's capture probe were immobilized on the high flow nitrocellulose strip. Having loaded at one end of the strip in turn, probes or HBV-DNA in the hybridization solution migrate to the opposite end of the strip by capillary forces and hybridizes to the immobilized DNA. The branched-DNA signal amplifier and probe labeled with biotin or 32P were then loaded. Through streptavidin-alkaline phosphatase (SA-AP) conjugate and NBT/BCIP ( the specific chromogenic substrate of AP) or autoradiography, the result can be visualized by color reaction or image production on the X-ray film. Results: The sensitivity of this HBV-DNA detection method used probe labeled with biotin and 32P are 1ng and 10pg. The method using the probe labeled with biotin is simple and rapid (2h) without depending on special instruments, it also avoids the pollution of EtBr which can lead to tumor. And the method using the probe labeled with 32P is simple and sensitive, with the exception of long time autoradiography and the inconvenient isotopic disposal

  16. Impact of temperature and time storage on the microbial detection of oral samples by Checkerboard DNA-DNA hybridization method.

    do Nascimento, Cássio; dos Santos, Janine Navarro; Pedrazzi, Vinícius; Pita, Murillo Sucena; Monesi, Nadia; Ribeiro, Ricardo Faria; de Albuquerque, Rubens Ferreira


    Molecular diagnosis methods have been largely used in epidemiological or clinical studies to detect and quantify microbial species that may colonize the oral cavity in healthy or disease. The preservation of genetic material from samples remains the major challenge to ensure the feasibility of these methodologies. Long-term storage may compromise the final result. The aim of this study was to evaluate the effect of temperature and time storage on the microbial detection of oral samples by Checkerboard DNA-DNA hybridization. Saliva and supragingival biofilm were taken from 10 healthy subjects, aliquoted (n=364) and processed according to proposed protocols: immediate processing and processed after 2 or 4 weeks, and 6 or 12 months of storage at 4°C, -20°C and -80°C. Either total or individual microbial counts were recorded in lower values for samples processed after 12 months of storage, irrespective of temperatures tested. Samples stored up to 6 months at cold temperatures showed similar counts to those immediately processed. The microbial incidence was also significantly reduced in samples stored during 12 months in all temperatures. Temperature and time of oral samples storage have relevant impact in the detection and quantification of bacterial and fungal species by Checkerboard DNA-DNA hybridization method. Samples should be processed immediately after collection or up to 6 months if conserved at cold temperatures to avoid false-negative results. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Ratiometric FRET-based detection of DNA and micro-RNA on the surface using TIRF detection

    Matveeva, Evgenia G.; Gryczynski, Zygmunt; Stewart, Donald R.; Gryczynski, Ignacy


    A new FRET-based method for the ratiometric detection of DNA oligomers on a surface using TIRF detection mode is reported. The dual-labeled system consisting of two hybridized oligomers, Cy3oligoY:Cy5oligoX was immobilized on the surface, and the total internal reflection fluorescence (TIRF) was used to detect emission signals from the surface. Two signals, green and red, which originated from the green donor Cy3 and the red acceptor Cy5, have been simultaneously detected. When the target single-stranded complimentary oligomer was present in the solution, this oligomer replaced the Cy3oligoY in the donor:acceptor complex on the surface and the ratio of red-to-green signal was dramatically changed. This detection scheme is generally applicable to the detection of DNA or RNA on a surface.

  18. Development of 19F-NMR chemical shift detection of DNA B-Z equilibrium using 19F-NMR.

    Nakamura, S; Yang, H; Hirata, C; Kersaudy, F; Fujimoto, K


    Various DNA conformational changes are in correlation with biological events. In particular, DNA B-Z equilibrium showed a high correlation with translation and transcription. In this study, we developed a DNA probe containing 5-trifluoromethylcytidine or 5-trifluoromethylthymidine to detect DNA B-Z equilibrium using 19 F-NMR. Its probe enabled the quantitative detection of B-, Z-, and ss-DNA based on 19 F-NMR chemical shift change.

  19. Selective detection of labeled DNA using an air-clad photonic crystal fiber

    Jensen, Jesper Bo Damm; Hoiby, P.E.; Pedersen, L.H.


    Demonstration of selective detection of fluorophore labeled DNA by hybridization inside the air holes of a photonic crystal fiber A laser exposes the fiber from the side and the emitted fluorescence tunnels into the core.......Demonstration of selective detection of fluorophore labeled DNA by hybridization inside the air holes of a photonic crystal fiber A laser exposes the fiber from the side and the emitted fluorescence tunnels into the core....

  20. Detecting DNA damage with a silver solid amalgam electrode

    Kuchaříková, Kateřina; Novotný, Ladislav; Josypčuk, Bohdan; Fojta, Miroslav


    Roč. 16, č. 5 (2004), s. 410-414 ISSN 1040-0397 R&D Projects: GA AV ČR IAA4004108; GA AV ČR IBS5004355 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA damage * silver solid amalgam electrode * HMDE Subject RIV: BO - Biophysics Impact factor: 2.038, year: 2004

  1. Development of an electrochemical DNA biosensor for detection of ...

    2.4 million of deaths.1,2 Southern hybridization tech- niques, radiographic .... Electrochemical DNA sensors can be greatly affected .... 3.5 Diagnostic performance of the biosensor ... Silva M M S, Cavalcanti I T, Barroso M F, Sales M G F.

  2. Novel DNA barcodes for detection, idenfication and tracking of stachybotrys and chaetomium species

    Lewinska, Anna Malgorzata; Hoof, Jakob Blæsbjerg; Peuhkuri, Ruut Hannele


    Detection and identification of indoor fungi in water-damaged buildings is crucial for preventi and control of fungal growth. This study focuses on a molecular method called DNA barcoding. evaluates commonly used sequences in DNA barcoding for fungal species identification Chaetomium...... and Stachybotrys. The existing DNA barcodes: ITS, SSU, LSU, B-TUB, CMD, RP and TEF-1α do not give satisfying species resolution to be considered as DNA barcodes for the two genera. Therefore, novel barcodes for them are needed. Barcode potentials, such as HOG1 a NAHA, were identified using bioinformatics...

  3. Comparison of DNA extraction methods for detection of citrus huanglongbing in Colombia

    Jorge Evelio Ángel


    Full Text Available Four DNA citrus plant tissue extraction protocols and three methods of DNA extraction from vector psyllid Diaphorina citri Kuwayama (Hemiptera: Psyllidae were compared as part of the validation process and standardization for detection of huanglongbing (HLB. The comparison was done using several criterias such as integrity, purity and concentration. The best quality parameters presented in terms of extraction of DNA from plant midribs tissue of citrus, were cited by Murray and Thompson (1980 and Rodríguez et al. (2010, while for the DNA extraction from psyllid vectors of HLB, the best extraction method was suggested by Manjunath et al.(2008.

  4. Evaluation of DNA Extraction Methods Suitable for PCR-based Detection and Genotyping of Clostridium botulinum

    Auricchio, Bruna; Anniballi, Fabrizio; Fiore, Alfonsina


    in terms of cost, time, labor, and supplies. Eleven botulinum toxin–producing clostridia strains and 25 samples (10 food, 13 clinical, and 2 environmental samples) naturally contaminated with botulinum toxin–producing clostridia were used to compare 4 DNA extraction procedures: Chelex® 100 matrix, Phenol......Sufficient quality and quantity of extracted DNA is critical to detecting and performing genotyping of Clostridium botulinum by means of PCR-based methods. An ideal extraction method has to optimize DNA yield, minimize DNA degradation, allow multiple samples to be extracted, and be efficient...

  5. Environmental DNA as a new method for early detection of New Zealand mudsnails (Potamopyrgus antipodarum)

    Goldberg, Caren S.; Sepulveda, Adam; Ray, Andrew; Baumgardt, Jeremy A.; Waits, Lisette P.


    Early detection of aquatic invasive species is a critical task for management of aquatic ecosystems. This task is hindered by the difficulty and cost of surveying aquatic systems thoroughly. The New Zealand mudsnail (Potamopyrgus antipodarum) is a small, invasive parthenogenic mollusk that can reach very high population densities and severely affects ecosystem functioning. To assist in the early detection of this invasive species, we developed and validated a highly sensitive environmental deoxyribonucleic acid (eDNA) assay. We used a dose–response laboratory experiment to investigate the relationship between New Zealand mudsnail density and eDNA detected through time. We documented that as few as 1 individual in 1.5 L of water for 2 d could be detected with this method, and that eDNA from this species may remain detectable for 21 to 44 d after mudsnail removal. We used the eDNA method to confirm the presence of New Zealand mudsnail eDNA at densities as low as 11 to 144 snails/m2 in a eutrophic 5th-order river. Combined, these results demonstrate the high potential for eDNA surveys to assist with early detection of a widely distributed invasive aquatic invertebrate.

  6. Ehrlichia canis morulae and DNA detection in whole blood and spleen aspiration samples.

    Faria, Joice Lara Maia; Dagnone, Ana Sílvia; Munhoz, Thiago Demarchi; João, Carolina Franchi; Pereira, Wanderson Adriano Biscola; Machado, Rosângela Zacarias; Tinucci-Costa, Mirela


    The aim of this study was to compare the detection of Ehrlichia canis morulae and DNA by nPCR in whole blood and spleen aspiration. The sample included 40 dogs showing thrombocytopenia associated to clinical signs suggestive of canine ehrlichiosis. Morulae detection showed that in 35 of the dogs studied, 17 had morulae in spleen tissue, and two in buffy coat smears. E. canis DNA was detected in 29/40 blood samples. We verified that morulae detection is more efficient in cytological preparations from spleen aspiration. On the other hand, nPCR on spleen and blood samples were equally efficient for disease diagnosis.

  7. Methodological considerations for detection of terrestrial small-body salamander eDNA and implications for biodiversity conservation

    Walker, Donald M.; Leys, Jacob E.; Dunham, Kelly E.; Oliver, Joshua C.; Schiller, Emily E.; Stephenson, Kelsey S.; Kimrey, John T.; Wooten, Jessica; Rogers, Mark W.


    Environmental DNA (eDNA) can be used as an assessment tool to detect populations of threatened species and provide fine-scale data required to make management decisions. The objectives of this project were to use quantitative PCR (qPCR) to: (i) detect spiked salamander DNA in soil, (ii) quantify eDNA degradation over time, (iii) determine detectability of salamander eDNA in a terrestrial environment using soil, faeces, and skin swabs, (iv) detect salamander eDNA in a mesocosm experiment. Salamander eDNA was positively detected in 100% of skin swabs and 66% of faecal samples and concentrations did not differ between the two sources. However, eDNA was not detected in soil samples collected from directly underneath wild-caught living salamanders. Salamander genomic DNA (gDNA) was detected in all qPCR reactions when spiked into soil at 10.0, 5.0, and 1.0 ng/g soil and spike concentration had a significant effect on detected concentrations. Only 33% of samples showed recoverable eDNA when spiked with 0.25 ng/g soil, which was the low end of eDNA detection. To determine the rate of eDNA degradation, gDNA (1 ng/g soil) was spiked into soil and quantified over seven days. Salamander eDNA concentrations decreased across days, but eDNA was still amplifiable at day 7. Salamander eDNA was detected in two of 182 mesocosm soil samples over 12 weeks (n = 52 control samples; n = 65 presence samples; n = 65 eviction samples). The discrepancy in detection success between experiments indicates the potential challenges for this method to be used as a monitoring technique for small-bodied wild terrestrial salamander populations.

  8. Surface-enhanced Raman scattering based nonfluorescent probe for multiplex DNA detection.

    Sun, Lan; Yu, Chenxu; Irudayaraj, Joseph


    To provide rapid and accurate detection of DNA markers in a straightforward, inexpensive, and multiplex format, an alternative surface-enhanced Raman scattering based probe was designed and fabricated to covalently attach both DNA probing sequence and nonfluorescent Raman tags to the surface of gold nanoparticles (DNA-AuP-RTag). The intensity of Raman signal of the probes could be controlled through the surface coverage of the nonfluorescent Raman tags (RTags). Detection sensitivity of these probes could be optimized by fine-tuning the amount of DNA molecules and RTags on the probes. Long-term stability of the DNA-AuP-RTag probes was found to be good (over 3 months). Excellent multiplexing capability of the DNA-AuP-RTag scheme was demonstrated by simultaneous identification of up to eight probes in a mixture. Detection of hybridization of single-stranded DNA to its complementary targets was successfully accomplished with a long-term goal to use nonfluorescent RTags in a Raman-based DNA microarray platform.

  9. DNA-hosted copper nanoclusters/graphene oxide based fluorescent biosensor for protein kinase activity detection.

    Wang, Mengke; Lin, Zihan; Liu, Qing; Jiang, Shan; Liu, Hua; Su, Xingguang


    A novel fluorescent biosensor for protein kinase activity (PKA) detection was designed by applying double-strands DNA-hosted copper nanoclusters (dsDNA-CuNCs) and graphene oxide (GO). One DNA strand of the dsDNA consisted of two domains, one domain can hybridize with another complementary DNA strand to stabilize the fluorescent CuNCs and another domain was adenosine 5'-triphosphate (ATP) aptamer. ATP aptamer of the dsDNA-CuNCs would be spontaneously absorbed onto the GO surface through π-π stacking interactions. Thus GO can efficiently quench the fluorescence (FL) of dsDNA-CuNCs through fluorescence resonance energy transfer (FRET). In the present of ATP, ATP specifically combined with ATP aptamer to form ATP-ATP aptamer binding complexes, which had much less affinity to GO, resulting in the fluorescence recovery of the system. Nevertheless, in the presence of PKA, ATP could be translated into ADP and ADP could not combine with ATP aptamer resulting in the fluorescence quenching of dsDNA-CuNCs again. According to the change of the fluorescence signal, PKA activity could be successfully monitored in the range of 0.1-5.0 U mL -1 with a detection limit (LOD) of 0.039 U mL -1 . Besides, the inhibitory effect of H-89 on PKA activity was studied. The sensor was performed for PKA activity detection in cell lysates with satisfactory results. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. Detection of UVR-induced DNA damage in mouse epidermis in vivo using alkaline elution

    Kinley, J.S.; Moan, J.; Brunborg, G.


    Alkaline elution has been used to detect ultraviolet radiation (UVR)-induced DNA damage in the epidermis of C3H/Tif hr/hr mice. This technique detects DNA damage in the form of single-strand breaks and alkali-labile sites (SSB) formed directly by UVA (320-400 nm) or indirectly by UVB (280-320 nm). The latter induces DNA damage such as cyclobutane pyrimidine dimers and pyrimidine-pyrimidone (6-4)-photoproducts, which are then converted into transient SSB by cellular endonucleases, during nucleotide excision repair (NER). (Author)

  11. Colorimetric detection of DNA damage by using hemin-graphene nanocomposites

    Wei, W.; Zhang, D. M.; Yin, L. H.; Pu, Y. P.; Liu, S. Q.


    A colorimetric method for detection of DNA damage was developed by using hemin-graphene nanosheets (H-GNs). H-GNs were skillfully synthesized by adsorping of hemin on graphene through π-π interactions. The as-prepared H-GNs possessed both the ability of graphene to differentiate the damage DNA from intact DNA and the catalytic action of hemin. The damaged DNA made H-GNs coagulated to different degrees from the intact DNA because there were different amount of negative charge exposed on their surface, which made a great impact on the solubility of H-GNs. As a result, the corresponding centrifugal supernatant of H-GNs solution showed different color in the presence of 3,3',5,5'-tetramethylbenzidine (TMB) and H2O2, which could be discriminated by naked eyes or by ultraviolet (UV)-visible spectrometer. Based on this, the damaged effects of styrene oxide (SO), NaAsO2 and UV radiation on DNA were studied. Results showed that SO exerted most serious damage effect on DNA although all of them damaged DNA seriously. The new method for detection of DNA damage showed good prospect in the evaluation of genotoxicity of new compounds, the maximum limit of pesticide residue, food additives, and so on, which is important in the fields of food science, pharmaceutical science and pesticide science.

  12. New approaches to detect 8-hydroxyguanine in γ-irradiated cellular DNA

    Mei, Nan; Tamae, Kazuyoshi; Hirano, Takeshi; Kasai, Hiroshi; Kunugita, Naoki


    This report describes an assay to detect 8-hydroxydeoxyguanosine 5'-monophosphate (8-OH-dGMP) in cellular DNA by modification of enzyme treatment after DNA extraction, using a high-performance liquid chromatography system equipped with an electrochemical detector (HPLC-ECD). This modification greatly reduces the measured background level of 8-hydroxyguanine (8-OH-Gua) in DNA, and improves the HPLC-ECD sensitivity to measure oxidative DNA damage. The 8-OH-Gua value in the DNA was expressed by the ratio of 8-OH-dGMP to deoxycytidine 5'-monophosphate (dCMP). Background level of 8-OH-Gua in DNA under our conditions was several times lower than that by a previous method. The human lung carcinoma cells (A549) were exposed to γ-rays of 20-100 Gy. A dose-dependent increase in oxidative DNA damage of 8-OH-Gua was observed. Furthermore, using commercial FITC-kit of an immunohistochemical type procedure, 8-OH-Gua was clearly detected in A549 cells and the fluorescence intensity of cells with oxidative DNA damage increased with the doses of γ-irradiation. Using an 8-OH-Gua repair activity assay, we also found that γ-rays decreased the repair enzyme activity. We conclude that the 8-OH-Gua level in human cellular DNA increases partly by the generation of reactive oxygen species (ROS) and partly by the inhibition of repair activity for 8-OH-Gua. (author)

  13. Development of a recombinant DNA assay system for the detection of genetic change in astronauts' cells

    Atchley, S.V.; Chen, D.J.C.; Strniste, G.F.; Walters, R.A.; Moyzis, R.K.


    We are developing a new recombinant DNA system for the detection and measurement of genetic change in humans caused by exposure to low level ionizing radiation. A unique feature of the method is the use of cloned repetitive DNA probes to assay human DNA for structural changes during or after irradiation. Repetitive sequences exist in different families. Collectively they constitute over 25% of the DNA in a human cell. Repeat families have between 10 and 500,000 members. We have constructed repetitive DNA sequence libraries using recombinant DNA techniques. From these libraries we have isolated and characterized individual repeats comprising 75 to 90% of the mass of human repetitive DNA. Repeats used in our assay system exist in tandem arrays in the genome. Perturbation of these sequences in a cell, followed by detection with a repeat probe, produces a new, multimeric ''ladder'' pattern on an autoradiogram. The repeat probe used in our initial study is complementary to 1% of human DNA. Therefore, the sensitivity of this method is several orders of magnitude better than existing assays. Preliminary evidence from human skin cells exposed to acute, low-dose x-ray treatments indicates that DNA is affected at a dose as low as 5R. The radiation doses used in this system are well within the range of doses received by astronauts during spaceflight missions. Due to its small material requirements, this technique could easily be adapted for use in space. 16 refs., 1 fig

  14. Detection of DNA methylation changes in micropropagated banana plants using methylation-sensitive amplification polymorphism (MSAP).

    Peraza-Echeverria, S; Herrera-Valencia, V A.; Kay, A -J.


    The extent of DNA methylation polymorphisms was evaluated in micropropagated banana (Musa AAA cv. 'Grand Naine') derived from either the vegetative apex of the sucker or the floral apex of the male inflorescence using the methylation-sensitive amplification polymorphism (MSAP) technique. In all, 465 fragments, each representing a recognition site cleaved by either or both of the isoschizomers were amplified using eight combinations of primers. A total of 107 sites (23%) were found to be methylated at cytosine in the genome of micropropagated banana plants. In plants micropropagated from the male inflorescence explant 14 (3%) DNA methylation events were polymorphic, while plants micropropagated from the sucker explant produced 8 (1.7%) polymorphisms. No DNA methylation polymorphisms were detected in conventionally propagated banana plants. These results demonstrated the usefulness of MSAP to detect DNA methylation events in micropropagated banana plants and indicate that DNA methylation polymorphisms are associated with micropropagation.

  15. Detecting the effects of toxic agents on spermatogenesis using DNA probes

    Hecht, N.B.


    Advances in the molecular biology of spermatogenesis suggest that DNA probes can be used to monitor the effects of toxic agents in male germ cells of mammals. Molecular hybridization analyses with DNA probes can provide a reproducible methodology capable of detecting changes ranging from massive deletions to single base pair substitutions in the genome of exposed individuals. A constantly increasing number of DNA probes that can be used to detect such alterations in human sperm DNA exist for both ubiquitously expressed proteins and for genes solely expressed in the testis. In this chapter, the currently available testicular stage-specific and/or cell type-specific DNA probes and the techniques by which they can be utilized in reproductive toxicology studies are discussed. The advantages, limitations, and future technological advances of this novel biological marker system for the human male reproductive system are also considered

  16. Modifications of alkaline microgel electrophoresis for sensitive detection of DNA damage

    Singh, N.P.; Stephens, R.E.; Schneider, E.L.


    The alkaline microgel electrophoresis technique was modified to achieve a substantial increase in sensitivity for the detection of radiation-induced DNA damage in human lymphocytes. This increased sensitivity was achieved through: (1) the addition of free radical scavengers to the electrophoresis solution to reduce DNA damage generated during alkaline unwinding and electrophoresis; (2) the modification of the electrophoresis unit to achieve a more uniform electric field; (3) the use of YOYO-1, a DNA dye, producing fluorescence 500-fold more intense than ethidium bromide; and (4) the introduction of an image analysis system for the quantitation of DNA migration. In human lymphocytes, these modifications have resulted in an increased sensitivity of several fold, allowing the detection of DNA damage in the range of 50 mGy. (author)

  17. Detection of urea-induced internal denaturation of dsDNA using solid-state nanopores.

    Singer, Alon; Kuhn, Heiko; Frank-Kamenetskii, Maxim; Meller, Amit


    The ability to detect and measure dsDNA thermal fluctuations is of immense importance in understanding the underlying mechanisms responsible for transcription and replication regulation. We describe here the ability of solid-state nanopores to detect sub-nanometer changes in DNA structure as a result of chemically enhanced thermal fluctuations. In this study, we investigate the subtle changes in the mean effective diameter of a dsDNA molecule with 3-5 nm solid-state nanopores as a function of urea concentration and the DNA's AT content. Our studies reveal an increase in the mean effective diameter of a DNA molecule of approximately 0.6 nm at 8.7 M urea. In agreement with the mechanism of DNA local denaturation, we observe a sigmoid dependence of these effects on urea concentration. We find that the translocation times in urea are markedly slower than would be expected if the dynamics were governed primarily by viscous effects. Furthermore, we find that the sensitivity of the nanopore is sufficient to statistically differentiate between DNA molecules of nearly identical lengths differing only in sequence and AT content when placed in 3.5 M urea. Our results demonstrate that nanopores can detect subtle structural changes and are thus a valuable tool for detecting differences in biomolecules' environment.

  18. Detection of urea-induced internal denaturation of dsDNA using solid-state nanopores

    Singer, Alon; Kuhn, Heiko; Frank-Kamenetskii, Maxim; Meller, Amit


    The ability to detect and measure dsDNA thermal fluctuations is of immense importance in understanding the underlying mechanisms responsible for transcription and replication regulation. We describe here the ability of solid-state nanopores to detect sub-nanometer changes in DNA structure as a result of chemically enhanced thermal fluctuations. In this study, we investigate the subtle changes in the mean effective diameter of a dsDNA molecule with 3-5 nm solid-state nanopores as a function of urea concentration and the DNA's AT content. Our studies reveal an increase in the mean effective diameter of a DNA molecule of approximately 0.6 nm at 8.7 M urea. In agreement with the mechanism of DNA local denaturation, we observe a sigmoid dependence of these effects on urea concentration. We find that the translocation times in urea are markedly slower than would be expected if the dynamics were governed primarily by viscous effects. Furthermore, we find that the sensitivity of the nanopore is sufficient to statistically differentiate between DNA molecules of nearly identical lengths differing only in sequence and AT content when placed in 3.5 M urea. Our results demonstrate that nanopores can detect subtle structural changes and are thus a valuable tool for detecting differences in biomolecules' environment.

  19. Separation/extraction, detection, and interpretation of DNA mixtures in forensic science (review).

    Tao, Ruiyang; Wang, Shouyu; Zhang, Jiashuo; Zhang, Jingyi; Yang, Zihao; Sheng, Xiang; Hou, Yiping; Zhang, Suhua; Li, Chengtao


    Interpreting mixed DNA samples containing material from multiple contributors has long been considered a major challenge in forensic casework, especially when encountering low-template DNA (LT-DNA) or high-order mixtures that may involve missing alleles (dropout) and unrelated alleles (drop-in), among others. In the last decades, extraordinary progress has been made in the analysis of mixed DNA samples, which has led to increasing attention to this research field. The advent of new methods for the separation and extraction of DNA from mixtures, novel or jointly applied genetic markers for detection and reliable interpretation approaches for estimating the weight of evidence, as well as the powerful massively parallel sequencing (MPS) technology, has greatly extended the range of mixed samples that can be correctly analyzed. Here, we summarized the investigative approaches and progress in the field of forensic DNA mixture analysis, hoping to provide some assistance to forensic practitioners and to promote further development involving this issue.

  20. Alkaline gel electrophoresis assay to detect DNA strand breaks and repair mechanisms in Escherichia coli

    Mattos, Jose Carlos Pelielo de; Motta, Ellen Serri da; Oliveira, Marcia Betania Nunes de; Dantas, Flavio Jose da Silva; Araujo, Adriano Caldeira de


    Reactive oxygen species (ROS) can induce lesions in different cellular targets, including DNA. Stannous chloride (SnCl 2 ) is a ROS generator, leading to lethality in Escherichia coli (E. coli), with the base excision repair (BER) mechanism playing a role in this process. Many techniques have been developed to detect genotoxicity, as comet assay, in eukaryotic cells, and plasmid DNA agarose gel electrophoresis. In this study, an adaptation of the alkaline gel electrophoresis method was carried out to ascertain the induction of strand breaks by SnCl 2 in bacterial DNA, from E. coli BER mutants, and its repair pathway. Results obtained show that SnCl 2 was able to induce DNA strand breaks in all strains tested. Moreover, endonuclease IV and exonuclease III play a role in DNA repair. On the whole, data has shown that the alkaline gel electrophoresis assay could be used both for studying DNA strand breaks induction and for associated repair mechanisms. (author)

  1. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    Tam, Phuong Dinh; Trung, Tran; Tuan, Mai Anh; Chien, Nguyen Duc


    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when immerged in double distilled water and kept refrigerated.

  2. Nick translation detection in situ of cellular DNA strand break induced by radiation

    Maehara, Y.; Anai, H.; Kusumoto, T.; Sakaguchi, Y.; Sugimachi, K.


    DNA strand break in HeLa cells induced by radiation was detected using the in situ nick translation method. The cells were exposed to radiation of 3, 6, 12, 18, and 24 Gy in Lab-Tek tissue culture chamber/slides and were fixed with ethanol/acetic acid on the slide glass. The break sites in DNA were translated artificially in the presence of Escherichia coli DNA polymerase I and [ 3 H]-labeled dTTP. Autoradiographic observation was made of the level of break sites in the DNA. The DNA strand break appeared even with a 3 Gy exposure, increased 8.6 times at 24 Gy compared with the control cells, and this level correlated reciprocally to change in cell viability. This nick translation method provides a rapid in situ assay for determining radiation-induced DNA damage of cultured cells, in a semi-quantitative manner

  3. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    Phuong Dinh Tam; Mai Anh Tuan; Tran Trung; Nguyen Duc Chien


    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when emerged in double distilled water and kept refrigerated.

  4. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    Phuong Dinh Tam; Mai Anh Tuan [International Training Institute for Materials Science (Viet Nam); Tran Trung [Department of Electrochemistry, Hung-Yen University of Technology and Education (Viet Nam); Nguyen Duc Chien [Institute of Engineering Physics, Hanoi University of Technology, 1 Dai Co Viet Road, Hanoi (Viet Nam)], E-mail:


    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when emerged in double distilled water and kept refrigerated.

  5. A direct detection of Escherichia coli genomic DNA using gold nanoprobes



    Full Text Available Abstract Background In situation like diagnosis of clinical and forensic samples there exists a need for highly sensitive, rapid and specific DNA detection methods. Though conventional DNA amplification using PCR can provide fast results, it is not widely practised in diagnostic laboratories partially because it requires skilled personnel and expensive equipment. To overcome these limitations nanoparticles have been explored as signalling probes for ultrasensitive DNA detection that can be used in field applications. Among the nanomaterials, gold nanoparticles (AuNPs have been extensively used mainly because of its optical property and ability to get functionalized with a variety of biomolecules. Results We report a protocol for the use of gold nanoparticles functionalized with single stranded oligonucleotide (AuNP- oligo probe as visual detection probes for rapid and specific detection of Escherichia coli. The AuNP- oligo probe on hybridization with target DNA containing complementary sequences remains red whereas test samples without complementary DNA sequences to the probe turns purple due to acid induced aggregation of AuNP- oligo probes. The color change of the solution is observed visually by naked eye demonstrating direct and rapid detection of the pathogenic Escherichia coli from its genomic DNA without the need for PCR amplification. The limit of detection was ~54 ng for unamplified genomic DNA. The method requires less than 30 minutes to complete after genomic DNA extraction. However, by using unamplified enzymatic digested genomic DNA, the detection limit of 11.4 ng was attained. Results of UV-Vis spectroscopic measurement and AFM imaging further support the hypothesis of aggregation based visual discrimination. To elucidate its utility in medical diagnostic, the assay was validated on clinical strains of pathogenic Escherichia coli obtained from local hospitals and spiked urine samples. It was found to be 100% sensitive and proves to

  6. cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer

    Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P


    Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis

  7. Gold-silver-alloy nanoprobes for one-pot multiplex DNA detection

    Doria, G; Larguinho, M; Dias, J T; Baptista, P V; Pereira, E; Franco, R


    A specific colorimetric DNA detection method based on oligonucleotide functionalized gold-silver-alloy nanoparticles (AuAg-alloy-nanoprobes) is presented. The AuAg-alloy-nanoprobes were then used for the specific detection of a DNA sequence from TP53-a gene involved in cancer development. The AuAg-alloy-nanoprobes were then used in combination with Au-nanoprobes for a one-pot dual-colour detection strategy that allowed for the simultaneous differential detection of two distinct target sequences. This system poses an unprecedented opportunity to explore the combined use of metal nanoparticles with different composition towards the development of a multiplex one-pot colorimetric assay for DNA detection.

  8. Gold-silver-alloy nanoprobes for one-pot multiplex DNA detection

    Doria, G; Larguinho, M; Dias, J T; Baptista, P V [Centro de Investigacao em Genetica Molecular Humana (CIGMH), Departamento de Ciencias da Vida, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Pereira, E [Rede de Quimica e Tecnologia (REQUIMTE), Departamento de Quimica, Faculdade de Ciencias, Universidade do Porto, 4169-007 Porto (Portugal); Franco, R, E-mail: [Rede de Quimica e Tecnologia (REQUIMTE), Departamento de Quimica, Faculdade de Ciencias e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal)


    A specific colorimetric DNA detection method based on oligonucleotide functionalized gold-silver-alloy nanoparticles (AuAg-alloy-nanoprobes) is presented. The AuAg-alloy-nanoprobes were then used for the specific detection of a DNA sequence from TP53-a gene involved in cancer development. The AuAg-alloy-nanoprobes were then used in combination with Au-nanoprobes for a one-pot dual-colour detection strategy that allowed for the simultaneous differential detection of two distinct target sequences. This system poses an unprecedented opportunity to explore the combined use of metal nanoparticles with different composition towards the development of a multiplex one-pot colorimetric assay for DNA detection.

  9. 2-Aminopurine hairpin probes for the detection of ultraviolet-induced DNA damage

    El-Yazbi, Amira F.; Loppnow, Glen R.


    Highlights: ► Molecular beacon with 2AP bases detects DNA damage in a simple mix-and-read assay. ► Molecular beacons with 2AP bases detect damage at a 17.2 nM limit of detection. ► The 2AP molecular beacon is linear over a 0–3.5 μM concentration range for damage. - Abstract: Nucleic acid exposure to radiation and chemical insults leads to damage and disease. Thus, detection and understanding DNA damage is important for elucidating molecular mechanisms of disease. However, current methods of DNA damage detection are either time-consuming, destroy the sample, or are too specific to be used for generic detection of damage. In this paper, we develop a fluorescence sensor of 2-aminopurine (2AP), a fluorescent analogue of adenine, incorporated in the loop of a hairpin probe for the quantification of ultraviolet (UV) C-induced nucleic acid damage. Our results show that the selectivity of the 2AP hairpin probe to UV-induced nucleic acid damage is comparable to molecular beacon (MB) probes of DNA damage. The calibration curve for the 2AP hairpin probe shows good linearity (R 2 = 0.98) with a limit of detection of 17.2 nM. This probe is a simple, fast and economic fluorescence sensor for the quantification of UV-induced damage in DNA.

  10. Rapid and label-free electrochemical DNA biosensor for detecting hepatitis A virus.

    Manzano, Marisa; Viezzi, Sara; Mazerat, Sandra; Marks, Robert S; Vidic, Jasmina


    Diagnostic systems that can deliver highly specific and sensitive detection of hepatitis A virus (HAV) in food and water are of particular interest in many fields including food safety, biosecurity and control of outbreaks. Our aim was the development of an electrochemical method based on DNA hybridization to detect HAV. A ssDNA probe specific for HAV (capture probe) was designed and tested on DNAs from various viral and bacterial samples using Nested-Reverse Transcription Polymerase Chain Reaction (nRT-PCR). To develop the electrochemical device, a disposable gold electrode was functionalized with the specific capture probe and tested on complementary ssDNA and on HAV cDNA. The DNA hybridization on the electrode was measured through the monitoring of the oxidative peak potential of the indicator tripropylamine by cyclic voltammetry. To prevent non-specific binding the gold surface was treated with 3% BSA before detection. High resolution atomic force microscopy (AFM) confirmed the efficiency of electrode functionalization and on-electrode hybridization. The proposed device showed a limit of detection of 0.65pM for the complementary ssDNA and 6.94fg/µL for viral cDNA. For a comparison, nRT-PCR quantified the target HAV cDNA with a limit of detection of 6.4fg/µL. The DNA-sensor developed can be adapted to a portable format to be adopted as an easy-to- use and low cost method for screening HAV in contaminated food and water. In addition, it can be useful for rapid control of HAV infections as it takes only a few minutes to provide the results. Copyright © 2017. Published by Elsevier B.V.

  11. Social Fingerprinting: detection of spambot groups through DNA-inspired behavioral modeling

    Cresci, Stefano; Di Pietro, Roberto; Petrocchi, Marinella


    Spambot detection in online social networks is a long-lasting challenge involving the study and design of detection techniques capable of efficiently identifying ever-evolving spammers. Recently, a new wave of social spambots has emerged, with advanced human-like characteristics that allow them...... to go undetected even by current state-of-the-art algorithms. In this paper, we show that efficient spambots detection can be achieved via an in-depth analysis of their collective behaviors exploiting the digital DNA technique for modeling the behaviors of social network users. Inspired by its...... biological counterpart, in the digital DNA representation the behavioral lifetime of a digital account is encoded in a sequence of characters. Then, we define a similarity measure for such digital DNA sequences. We build upon digital DNA and the similarity between groups of users to characterize both genuine...

  12. A novel input-parasitic compensation technique for a nanopore-based CMOS DNA detection sensor

    Kim, Jungsuk


    This paper presents a novel input-parasitic compensation (IPC) technique for a nanopore-based complementary metal-oxide-semiconductor (CMOS) DNA detection sensor. A resistive-feedback transimpedance amplifier is typically adopted as the headstage of a DNA detection sensor to amplify the minute ionic currents generated from a nanopore and convert them to a readable voltage range for digitization. But, parasitic capacitances arising from the headstage input and the nanopore often cause headstage saturation during nanopore sensing, thereby resulting in significant DNA data loss. To compensate for the unwanted saturation, in this work, we propose an area-efficient and automated IPC technique, customized for a low-noise DNA detection sensor, fabricated using a 0.35- μm CMOS process; we demonstrated this prototype in a benchtop test using an α-hemolysin ( α-HL) protein nanopore.

  13. Photoelectrochemical Sensors for the Rapid Detection of DNA Damage Induced by Some Nanoparticles

    M. Jamaluddin Ahmed


    Full Text Available Photoelectrochemcal sensors were developed for the rapid detection of oxidative DNA damage induced by titanium dioxide and polystyrene nanoparticles. Each sensor is a multilayer film prepared on a tin oxide nanoparticle electrode using layer- by-layer self assembly and is composed of separate layer of a photoelectrochemical indicator, DNA. The organic compound and heavy metals represent genotoxic chemicals leading two major damaging mechanisms, DNA adduct formation and DNA oxidation. The DNA damage is detected by monitoring the change of photocurrent of the indicator. In one sensor configuration, a DNA intercalator, Ru(bpy2 (dppz2+ [bpy=2, 2′ -bipyridine, dppz=dipyrido( 3, 2-a: 2′ 3′-c phenazine], was employed as the photoelectrochemical indicator. The damaged DNA on the sensor bound lesser Ru(bpy2 (dppz2+ than the intact DNA, resulting in a drop in photocurrent. In another configuration, ruthenium tris(bipyridine was used as the indicator and was immobilized on the electrode underneath the DNA layer. After oxidative damage, the DNA bases became more accessible to photoelectrochemical oxidation than the intact DNA, producing a rise in photocurrent. Both sensors displayed substantial photocurrent change after incubation in titanium dioxide / polystyrene solution in a time – dependent manner. According to the data, damage of the DNA film was completed in 1h in titanium dioxide / polystyrene solution. In addition, the titanium dioxide induced much more sever damage than polysterene. The results were verified independently by gel electrophoresis and UV-Vis absorbance experiments. The photoelectrochemical reaction can be employed as a new and inexpensive screening tool for the rapid assessment of the genotoxicity of existing and new chemicals.

  14. Photoelectrochemical sensors for the rapid detection of DNA damage Induced by some nanoparticles

    Ahmed, M.J.; Zhang, B.T.; Guo, L.H.


    Photoelectrochemical sensors were developed for the rapid detection of oxidative DNA damage induced by titanium dioxide and polystyrene nanoparticles. Each sensor is a multilayer film prepared on a tin oxide nanoparticle electrode using layer- by-layer self assembly and is composed of separate layer of a photoelectrochemical indicator, DNA. The organic compound and heavy metals represent genotoxic chemicals leading two major damaging mechanisms, DNA adduct formation and DNA oxidation. The DNA damage is detected by monitoring the change of photocurrent of the indicator. In one sensor configuration, a DNA intercalator, Ru(bpy)2 (dppz)2+ [bpy=2, 2' -bipyridine, dppz=dipyrido (3, 2-a: 2' 3'-c) phenazine], was employed as the photoelectrochemical indicator. The damaged DNA on the sensor bound lesser Ru(bpy)2 (dppz)2+ than the intact DNA, resulting in a drop in photocurrent. In another configuration, ruthenium tris(bipyridine) was used as the indicator and was immobilized on the electrode underneath the DNA layer. After oxidative damage, the DNA bases became more accessible to photoelectrochemical oxidation than the intact DNA, producing a rise in photocurrent. Both sensors displayed substantial photocurrent change after incubation in titanium dioxide / polystyrene solution in a time . dependent manner. According to the data, damage of the DNA film was completed in 1h in titanium dioxide / polystyrene solution. In addition, the titanium dioxide induced much more sever damage than polystyrene. The results were verified independently by gel electrophoresis and UV-Vis absorbance experiments. The photoelectrochemical reaction can be employed as a new and inexpensive screening tool for the rapid assessment of the genotoxicity of existing and new chemicals. (author)

  15. Inspecting Targeted Deep Sequencing of Whole Genome Amplified DNA Versus Fresh DNA for Somatic Mutation Detection: A Genetic Study in Myelodysplastic Syndrome Patients.

    Palomo, Laura; Fuster-Tormo, Francisco; Alvira, Daniel; Ademà, Vera; Armengol, María Pilar; Gómez-Marzo, Paula; de Haro, Nuri; Mallo, Mar; Xicoy, Blanca; Zamora, Lurdes; Solé, Francesc


    Whole genome amplification (WGA) has become an invaluable method for preserving limited samples of precious stock material and has been used during the past years as an alternative tool to increase the amount of DNA before library preparation for next-generation sequencing. Myelodysplastic syndromes (MDS) are a group of clonal hematopoietic stem cell disorders characterized by presenting somatic mutations in several myeloid-related genes. In this work, targeted deep sequencing has been performed on four paired fresh DNA and WGA DNA samples from bone marrow of MDS patients, to assess the feasibility of using WGA DNA for detecting somatic mutations. The results of this study highlighted that, in general, the sequencing and alignment statistics of fresh DNA and WGA DNA samples were similar. However, after variant calling and when considering variants detected at all frequencies, there was a high level of discordance between fresh DNA and WGA DNA (overall, a higher number of variants was detected in WGA DNA). After proper filtering, a total of three somatic mutations were detected in the cohort. All somatic mutations detected in fresh DNA were also identified in WGA DNA and validated by whole exome sequencing.

  16. Evaluation of DNA extraction methods for the detection of Cytomegalovirus in dried blood spots

    Koontz, D.; Baecher, K.; Amin, M.; Nikolova, S.; Gallagher, M.; Dollard, S.


    Background Dried blood spots (DBS) are collected universally from newborns and may be valuable for the diagnosis of congenital Cytomegalovirus (CMV) infection. The reported analytical sensitivity for DBS testing compared to urine or saliva varies greatly across CMV studies. The purpose of this study was to directly compare the performance of various DNA extraction methods for identification of CMV in DBS including those used most often in CMV studies. Study design Whatman® Grade 903 filter paper cards were spotted with blood samples from 25 organ transplant recipients who had confirmed CMV viremia. Six DNA extraction methods were compared for relative yield of viral and cellular DNA: 2 manual solution-based methods (Gentra Puregene, thermal shock), 2 manual silica column-based methods (QIAamp DNA Mini, QIAamp DNA Investigator), and 2 automated methods (M48 MagAttract Mini, QIAcube Investigator). DBS extractions were performed in triplicate followed by real-time quantitative PCR (qPCR). Results For extraction of both viral and cellular DNA, two methods (QIAamp DNA Investigator and thermal shock) consistently gave the highest yields, and two methods (M48 MagAttract Mini and QIAamp DNA Mini) consistently gave the lowest yields. There was an average 3-fold difference in DNA yield between the highest and lowest yield methods. Conclusion The choice of DNA extraction method is a major factor in the ability to detect low levels of CMV in DBS and can largely account for the wide range of DBS sensitivities reported in studies to date. PMID:25866346

  17. Application of DNA Machineries for the Barcode Patterned Detection of Genes or Proteins.

    Zhou, Zhixin; Luo, Guofeng; Wulf, Verena; Willner, Itamar


    The study introduces an analytical platform for the detection of genes or aptamer-ligand complexes by nucleic acid barcode patterns generated by DNA machineries. The DNA machineries consist of nucleic acid scaffolds that include specific recognition sites for the different genes or aptamer-ligand analytes. The binding of the analytes to the scaffolds initiate, in the presence of the nucleotide mixture, a cyclic polymerization/nicking machinery that yields displaced strands of variable lengths. The electrophoretic separation of the resulting strands provides barcode patterns for the specific detection of the different analytes. Mixtures of DNA machineries that yield, upon sensing of different genes (or aptamer ligands), one-, two-, or three-band barcode patterns are described. The combination of nucleic acid scaffolds acting, in the presence of polymerase/nicking enzyme and nucleotide mixture, as DNA machineries, that generate multiband barcode patterns provide an analytical platform for the detection of an individual gene out of many possible genes. The diversity of genes (or other analytes) that can be analyzed by the DNA machineries and the barcode patterned imaging is given by the Pascal's triangle. As a proof-of-concept, the detection of one of six genes, that is, TP53, Werner syndrome, Tay-Sachs normal gene, BRCA1, Tay-Sachs mutant gene, and cystic fibrosis disorder gene by six two-band barcode patterns is demonstrated. The advantages and limitations of the detection of analytes by polymerase/nicking DNA machineries that yield barcode patterns as imaging readout signals are discussed.

  18. Ultrasensitive DNA sequence detection using nanoscale ZnO sensor arrays

    Kumar, Nitin; Dorfman, Adam; Hahm, Jong-in [Department of Chemical Engineering, Pennsylvania State University, 160 Fenske Laboratory, University Park, PA 16802 (United States)


    We report that engineered nanoscale zinc oxide structures can be effectively used for the identification of the biothreat agent, Bacillus anthracis by successfully discriminating its DNA sequence from other genetically related species. We explore both covalent and non-covalent linking schemes in order to couple probe DNA strands to the zinc oxide nanostructures. Hybridization reactions are performed with various concentrations of target DNA strands whose sequence is unique to Bacillus anthracis. The use of zinc oxide nanomaterials greatly enhances the fluorescence signal collected after carrying out duplex formation reaction. Specifically, the covalent strategy allows detection of the target species at sample concentrations at a level as low as a few femtomolar as compared to the detection sensitivity in the tens of nanomolar range when using the non-covalent scheme. The presence of the underlying zinc oxide nanomaterials is critical in achieving increased fluorescence detection of hybridized DNA and, therefore, accomplishing rapid and extremely sensitive identification of the biothreat agent. We also demonstrate the easy integration potential of nanoscale zinc oxide into high density arrays by using various types of zinc oxide sensor prototypes in the DNA sequence detection. When combined with conventional automatic sample handling apparatus and computerized fluorescence detection equipment, our approach can greatly promote the use of zinc oxide nanomaterials as signal enhancing platforms for rapid, multiplexed, high-throughput, highly sensitive, DNA sensor arrays.

  19. Ultrasensitive DNA sequence detection using nanoscale ZnO sensor arrays

    Kumar, Nitin; Dorfman, Adam; Hahm, Jong-in


    We report that engineered nanoscale zinc oxide structures can be effectively used for the identification of the biothreat agent, Bacillus anthracis by successfully discriminating its DNA sequence from other genetically related species. We explore both covalent and non-covalent linking schemes in order to couple probe DNA strands to the zinc oxide nanostructures. Hybridization reactions are performed with various concentrations of target DNA strands whose sequence is unique to Bacillus anthracis. The use of zinc oxide nanomaterials greatly enhances the fluorescence signal collected after carrying out duplex formation reaction. Specifically, the covalent strategy allows detection of the target species at sample concentrations at a level as low as a few femtomolar as compared to the detection sensitivity in the tens of nanomolar range when using the non-covalent scheme. The presence of the underlying zinc oxide nanomaterials is critical in achieving increased fluorescence detection of hybridized DNA and, therefore, accomplishing rapid and extremely sensitive identification of the biothreat agent. We also demonstrate the easy integration potential of nanoscale zinc oxide into high density arrays by using various types of zinc oxide sensor prototypes in the DNA sequence detection. When combined with conventional automatic sample handling apparatus and computerized fluorescence detection equipment, our approach can greatly promote the use of zinc oxide nanomaterials as signal enhancing platforms for rapid, multiplexed, high-throughput, highly sensitive, DNA sensor arrays

  20. Detection of Target ssDNA Using a Microfabricated Hall Magnetometer with Correlated Optical Readout

    Steven M. Hira


    Full Text Available Sensing biological agents at the genomic level, while enhancing the response time for biodetection over commonly used, optics-based techniques such as nucleic acid microarrays or enzyme-linked immunosorbent assays (ELISAs, is an important criterion for new biosensors. Here, we describe the successful detection of a 35-base, single-strand nucleic acid target by Hall-based magnetic transduction as a mimic for pathogenic DNA target detection. The detection platform has low background, large signal amplification following target binding and can discriminate a single, 350 nm superparamagnetic bead labeled with DNA. Detection of the target sequence was demonstrated at 364 pM (<2 target DNA strands per bead target DNA in the presence of 36 μM nontarget (noncomplementary DNA (<10 ppm target DNA using optical microscopy detection on a GaAs Hall mimic. The use of Hall magnetometers as magnetic transduction biosensors holds promise for multiplexing applications that can greatly improve point-of-care (POC diagnostics and subsequent medical care.

  1. Detection of complex hemoglobinopathies: recommendations on screening and DNA testing

    E. Baysal


    Full Text Available The following recommendations should be taken into account during the evaluation and elucidation of the complex hemoglobinopathies: a in complex hemoglobinopathies performing DNA studies on all family members might be essential; b complex gene-gene interactions offer major diagnostic challenges both at the technical and clinical level; c hematological & DNA analyses must be run in parallel. Some cases may be straight forward but others may require indepth DNA work-up; d co-inheritance of a-thalassemia offers added challenge as it may affect phenotype significantly; e sickle cell anemia (SS, co-inherited with a-thal, can be a phenocopy of Sβ0-thal. The HbA2 increase can be mistaken for Sβ-thal. DNA Sequencing is imperative; f only a selected number of normal MCV, MCH, borderline HbA2 cases must be referred for DNA analysis. However, in certain cases, following hematological and family evaluation, the β and d genes may need to be sequenced; g DNA Sequencing will increasingly become the method of choice for screening and DNA mutation analysis. However, new methods like MLPA-which analyzes gene dosage- must be used more commonly to rule out deletion mutants to avoid false negative sequencing results; h these recommendations should be reviewed every 2-3 years reflecting new methods, new findings and new findings from ethnic groups. 诊断和说明复杂血红蛋白病时,建议考虑以下几点: a)针对复杂的血红蛋白病,有必要对所有家庭成员开展DNA研究;b 复杂的基因-基因交互作用可能使诊断在技术和临床层面上颇受挑战;c 血液和DNA分析须同时进行。 有些病例简单,但另外一些病例可能需要开展深层次的DNA检查;d 由于α型地中海贫血可能严重影响表型,α型地中海贫血的共同继承特征更具挑战;e 共同继承α型地中海贫血的镰状细胞贫血(SS),可以作为Sβ0型地中海贫血的显型。 HbA2增

  2. DNA based methods used for characterization and detection of food ...



    May 4, 2009 ... selective medium followed by plating in differential agar medium ... result. Biochemical and immunological methods for the detection require substantial amount of pure culture whereas .... biotin (chemiluminescent) probes are detected visually. It ..... are also gathering special attention due to their covalent.

  3. Voltammetry of osmium-modified DNA at a mercury film electrode application in detecting DNA hybridization

    Kostečka, Pavel; Havran, Luděk; Pivoňková, Hana; Fojta, Miroslav


    Roč. 63, 1-2 (2004), s. 245-248 ISSN 1567-5394 R&D Projects: GA AV ČR IAA4004108; GA AV ČR KJB4004302 Institutional research plan: CEZ:AV0Z5004920 Keywords : osmium * DNA hybridization * mercury film electrode Subject RIV: BO - Biophysics Impact factor: 2.261, year: 2004

  4. Using CdTe/ZnSe core/shell quantum dots to detect DNA and damage to DNA

    Moulick A


    Full Text Available Amitava Moulick,1,2 Vedran Milosavljevic,1,2 Jana Vlachova,1,2 Robert Podgajny,3 David Hynek,1,2 Pavel Kopel,1,2 Vojtech Adam1,2 1Department of Chemistry and Biochemistry, Mendel University, 2Central European Institute of Technology, Brno University of Technology, Brno, Czech Republic; 3Faculty of Chemistry, Jagiellonian University, Krakow, Poland Abstract: CdTe/ZnSe core/shell quantum dot (QD, one of the strongest and most highly luminescent nanoparticles, was directly synthesized in an aqueous medium to study its individual interactions with important nucleobases (adenine, guanine, cytosine, and thymine in detail. The results obtained from the optical analyses indicated that the interactions of the QDs with different nucleobases were different, which reflected in different fluorescent emission maxima and intensities. The difference in the interaction was found due to the different chemical behavior and different sizes of the formed nanoconjugates. An electrochemical study also confirmed that the purines and pyrimidines show different interactions with the core/shell QDs. Based on these phenomena, a novel QD-based method is developed to detect the presence of the DNA, damage to DNA, and mutation. The QDs were successfully applied very easily to detect any change in the sequence (mutation of DNA. The QDs also showed their ability to detect DNAs directly from the extracts of human cancer (PC3 and normal (PNT1A cells (detection limit of 500 pM of DNA, which indicates the possibilities to use this easy assay technique to confirm the presence of living organisms in extreme environments. Keywords: nanoparticles, nucleobases, biosensor, fluorescence, mutation

  5. Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus

    Honorato Castro, Ana C.; França, Erick G.; de Paula, Lucas F.; Soares, Marcia M. C. N.; Goulart, Luiz R.; Madurro, João M.; Brito-Madurro, Ana G.


    An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L-1. Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy.

  6. A Novel Computational Method for Detecting DNA Methylation Sites with DNA Sequence Information and Physicochemical Properties.

    Pan, Gaofeng; Jiang, Limin; Tang, Jijun; Guo, Fei


    DNA methylation is an important biochemical process, and it has a close connection with many types of cancer. Research about DNA methylation can help us to understand the regulation mechanism and epigenetic reprogramming. Therefore, it becomes very important to recognize the methylation sites in the DNA sequence. In the past several decades, many computational methods-especially machine learning methods-have been developed since the high-throughout sequencing technology became widely used in research and industry. In order to accurately identify whether or not a nucleotide residue is methylated under the specific DNA sequence context, we propose a novel method that overcomes the shortcomings of previous methods for predicting methylation sites. We use k -gram, multivariate mutual information, discrete wavelet transform, and pseudo amino acid composition to extract features, and train a sparse Bayesian learning model to do DNA methylation prediction. Five criteria-area under the receiver operating characteristic curve (AUC), Matthew's correlation coefficient (MCC), accuracy (ACC), sensitivity (SN), and specificity-are used to evaluate the prediction results of our method. On the benchmark dataset, we could reach 0.8632 on AUC, 0.8017 on ACC, 0.5558 on MCC, and 0.7268 on SN. Additionally, the best results on two scBS-seq profiled mouse embryonic stem cells datasets were 0.8896 and 0.9511 by AUC, respectively. When compared with other outstanding methods, our method surpassed them on the accuracy of prediction. The improvement of AUC by our method compared to other methods was at least 0.0399 . For the convenience of other researchers, our code has been uploaded to a file hosting service, and can be downloaded from:

  7. A Novel Computational Method for Detecting DNA Methylation Sites with DNA Sequence Information and Physicochemical Properties

    Gaofeng Pan


    Full Text Available DNA methylation is an important biochemical process, and it has a close connection with many types of cancer. Research about DNA methylation can help us to understand the regulation mechanism and epigenetic reprogramming. Therefore, it becomes very important to recognize the methylation sites in the DNA sequence. In the past several decades, many computational methods—especially machine learning methods—have been developed since the high-throughout sequencing technology became widely used in research and industry. In order to accurately identify whether or not a nucleotide residue is methylated under the specific DNA sequence context, we propose a novel method that overcomes the shortcomings of previous methods for predicting methylation sites. We use k-gram, multivariate mutual information, discrete wavelet transform, and pseudo amino acid composition to extract features, and train a sparse Bayesian learning model to do DNA methylation prediction. Five criteria—area under the receiver operating characteristic curve (AUC, Matthew’s correlation coefficient (MCC, accuracy (ACC, sensitivity (SN, and specificity—are used to evaluate the prediction results of our method. On the benchmark dataset, we could reach 0.8632 on AUC, 0.8017 on ACC, 0.5558 on MCC, and 0.7268 on SN. Additionally, the best results on two scBS-seq profiled mouse embryonic stem cells datasets were 0.8896 and 0.9511 by AUC, respectively. When compared with other outstanding methods, our method surpassed them on the accuracy of prediction. The improvement of AUC by our method compared to other methods was at least 0.0399 . For the convenience of other researchers, our code has been uploaded to a file hosting service, and can be downloaded from:

  8. An eDNA assay for river otter detection: A tool for surveying a semi-aquatic mammal

    Ticha M. Padgett-Stewart; Taylor M. Wilcox; Kellie J. Carim; Kevin S. McKelvey; Michael K. Young; Michael K. Schwartz


    Environmental DNA (eDNA) is an effective tool for the detection of elusive or low-density aquatic organisms. However, it has infrequently been applied to mammalian species. North American river otters (Lontra canadensis) are both broad ranging and semi-aquatic, making them an ideal candidate for examining the uses of eDNA for detection of mammals. We developed...

  9. Label-Free Ag+ Detection by Enhancing DNA Sensitized Tb3+ Luminescence

    Kimberly Kleinke


    Full Text Available In this work, the effect of Ag+ on DNA sensitized Tb3+ luminescence was studied initially using the Ag+-specific RNA-cleaving DNAzyme, Ag10c. While we expected to observe luminescence quenching by Ag+, a significant enhancement was produced. Based on this observation, simple DNA oligonucleotide homopolymers were used with systematically varied sequence and length. We discovered that both poly-G and poly-T DNA have a significant emission enhancement by Ag+, while the absolute intensity is stronger with the poly-G DNA, indicating that a G-quadruplex DNA is not required for this enhancement. Using the optimized length of the G7 DNA (an oligo constituted with seven guanines, Ag+ was measured with a detection limit of 57.6 nM. The signaling kinetics, G7 DNA conformation, and the binding affinity of Tb3+ to the DNA in the presence or absence of Ag+ are also studied to reveal the mechanism of emission enhancement. This observation is useful not only for label-free detection of Ag+, but also interesting for the rational design of new biosensors using Tb3+ luminescence.

  10. Aquatic environmental DNA detects seasonal fish abundance and habitat preference in an urban estuary.

    Mark Y Stoeckle

    Full Text Available The difficulty of censusing marine animal populations hampers effective ocean management. Analyzing water for DNA traces shed by organisms may aid assessment. Here we tested aquatic environmental DNA (eDNA as an indicator of fish presence in the lower Hudson River estuary. A checklist of local marine fish and their relative abundance was prepared by compiling 12 traditional surveys conducted between 1988-2015. To improve eDNA identification success, 31 specimens representing 18 marine fish species were sequenced for two mitochondrial gene regions, boosting coverage of the 12S eDNA target sequence to 80% of local taxa. We collected 76 one-liter shoreline surface water samples at two contrasting estuary locations over six months beginning in January 2016. eDNA was amplified with vertebrate-specific 12S primers. Bioinformatic analysis of amplified DNA, using a reference library of GenBank and our newly generated 12S sequences, detected most (81% locally abundant or common species and relatively few (23% uncommon taxa, and corresponded to seasonal presence and habitat preference as determined by traditional surveys. Approximately 2% of fish reads were commonly consumed species that are rare or absent in local waters, consistent with wastewater input. Freshwater species were rarely detected despite Hudson River inflow. These results support further exploration and suggest eDNA will facilitate fine-scale geographic and temporal mapping of marine fish populations at relatively low cost.

  11. An efficient enzyme-powered micromotor device fabricated by cyclic alternate hybridization assembly for DNA detection.

    Fu, Shizhe; Zhang, Xueqing; Xie, Yuzhe; Wu, Jie; Ju, Huangxian


    An efficient enzyme-powered micromotor device was fabricated by assembling multiple layers of catalase on the inner surface of a poly(3,4-ethylenedioxythiophene and sodium 4-styrenesulfonate)/Au microtube (PEDOT-PSS/Au). The catalase assembly was achieved by programmed DNA hybridization, which was performed by immobilizing a designed sandwich DNA structure as the sensing unit on the PEDOT-PSS/Au, and then alternately hybridizing with two assisting DNA to bind the enzyme for efficient motor motion. The micromotor device showed unique features of good reproducibility, stability and motion performance. Under optimal conditions, it showed a speed of 420 μm s -1 in 2% H 2 O 2 and even 51 μm s -1 in 0.25% H 2 O 2 . In the presence of target DNA, the sensing unit hybridized with target DNA to release the multi-layer DNA as well as the multi-catalase, resulting in a decrease of the motion speed. By using the speed as a signal, the micromotor device could detect DNA from 10 nM to 1 μM. The proposed micromotor device along with the cyclic alternate DNA hybridization assembly technique provided a new path to fabricate efficient and versatile micromotors, which would be an exceptional tool for rapid and simple detection of biomolecules.

  12. [Application of DNA extraction kit, 'GM quicker' for detection of genetically modified soybeans].

    Sato, Noriko; Sugiura, Yoshitsugu; Tanaka, Toshitsugu


    Several DNA extraction methods have been officially introduced to detect genetically modified soybeans, but the choice of DNA extraction kits depend on the nature of the samples, such as grains or processed foods. To overcome this disadvantage, we examined whether the GM quicker kit is available for both grains and processed foods. We compared GM quicker with four approved DNA extraction kits in respect of DNA purity, copy numbers of lectin gene, and working time. We found that the DNA quality of GM quicker was superior to that of the other kits for grains, and the procedure was faster. However, in the case of processed foods, GM quicker was not superior to the other kits. We therefore investigated an unapproved GM quicker 3 kit, which is available for DNA extraction from processed foods, such as tofu and boiled soybeans. The GM quicker 3 kit provided good DNA quality from both grains and processed foods, so we made a minor modification of the GM quicker-based protocol that was suitable for processed foods, using GM quicker and its reagents. The modified method enhanced the performance of GM quicker with processed foods. We believe that GM quicker with the modified protocol is an excellent tool to obtain high-quality DNA from grains and processed foods for detection of genetically modified soybeans.

  13. Detection of hepatitis B virus DNA sequences in infected hepatocytes by in situ cytohybridisation

    Gowans, E.J.; Burrell, C.J.; Jilbert, A.R.; Marmion, B.P.


    Plasmid pHBV 114 DNA, which contains 73% of the genome of hepatitis B virus (HBV), was radiolabelled with tritium to 1-2 X 10(8) dpm/microgram by nick translation and used as a radioactive probe to detect HBV DNA present in sections of infected liver tissue by in situ hybridisation followed by autoradiography. Factors affecting the sensitivity of the reaction were examined, including different methods of fixation, hybridisation time, temperature, and buffers. The specificity of the reaction for detecting viral DNA was carefully established by the use of unrelated DNA probes, pretreatment of sections with DNAase, and comparing the stability of the binding of DNA probe at different temperatures, with the melting curve of double-stranded DNA in solution. In the one liver studied in detail, cells containing large amounts of viral DNA were distributed in foci corresponding to areas containing morphologically damaged hepatocytes. This observation suggested a relationship between active viral replication and cell damage. Viral DNA was found mainly in the cytoplasm, although a minority of nuclei in these foci were also positive

  14. Development of Piezoelectric DNA-Based Biosensor for Direct Detection of Mycobacterium Tuberculosis in Clinical Specimens

    Thongchai KAEWPHINIT


    Full Text Available This study was focused on establishment of piezoelectric biosensor for direct detection of Mycobacterium tuberculosis (MTB in clinical specimens. The quartz crystal immobilized via 3-mercaptopropionic acid (MPA/avidin/DNA biotinylated probe on gold surface and hybridization of the DNA target to DNA biotinylated probe. The optimal concentration of MPA, avidin and 5’-biotinylated DNA probe for immobilization of specific DNA probe on gold surface were 15 mM, 0.1 mg/ml and 1.5 μM, respectively. The detection of genomic DNA digestion in the range from 0.5 to 30 μg/ml. The fabricated biosensor was evaluated through an examination of 200 samples. No cross hybridization were observed against M. avium complex (MAC and other microorganism. This target DNA preparation without amplification will reduce time consuming, costs, and the tedious step of amplification. This study can be extended to develop the new method which is high sensitivity, specificity, cheap, easy to use, and rapid for detection of MTB in many fields.

  15. A combined HM-PCR/SNuPE method for high sensitive detection of rare DNA methylation

    Tierling Sascha


    Full Text Available Abstract Background DNA methylation changes are widely used as early molecular markers in cancer detection. Sensitive detection and classification of rare methylation changes in DNA extracted from circulating body fluids or complex tissue samples is crucial for the understanding of tumor etiology, clinical diagnosis and treatment. In this paper, we describe a combined method to monitor the presence of methylated tumor DNA in an excess of unmethylated background DNA of non-tumorous cells. The method combines heavy methyl-PCR, which favors preferential amplification of methylated marker sequence from bisulfite-treated DNA with a methylation-specific single nucleotide primer extension monitored by ion-pair, reversed-phase, high-performance liquid chromatography separation. Results This combined method allows detection of 14 pg (that is, four to five genomic copies of methylated chromosomal DNA in a 2000-fold excess (that is, 50 ng of unmethylated chromosomal background, with an analytical sensitivity of > 90%. We outline a detailed protocol for the combined assay on two examples of known cancer markers (SEPT9 and TMEFF2 and discuss general aspects of assay design and data interpretation. Finally, we provide an application example for rapid testing on tumor methylation in plasma DNA derived from a small cohort of patients with colorectal cancer. Conclusion The method allows unambiguous detection of rare DNA methylation, for example in body fluid or DNA isolates from cells or tissues, with very high sensitivity and accuracy. The application combines standard technologies and can easily be adapted to any target region of interest. It does not require costly reagents and can be used for routine screening of many samples.

  16. Nucleobase modification as redox DNA labelling for electrochemical detection

    Hocek, Michal; Fojta, Miroslav


    Roč. 40, č. 12 (2011), s. 5802-5814 ISSN 0306-0012 R&D Projects: GA MŠk(CZ) LC06035; GA MŠk LC512; GA AV ČR(CZ) IAA400040901; GA ČR GA203/09/0317 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : nucleotides * oligonucleotides * DNA * electrochemistry * redox labeling Subject RIV: CC - Organic Chemistry Impact factor: 28.760, year: 2011

  17. An environmental DNA marker for detecting nonnative brown trout (Salmo trutta)

    K. J. Carim; T. M. Wilcox; M. Anderson; D. Lawrence; Michael Young; Kevin McKelvey; Michael Schwartz


    Brown trout (Salmo trutta) are widely introduced in western North America where their presence has led to declines of several native species. To assist conservation efforts aimed at early detection and eradication of this species, we developed a quantitative PCR marker to detect the presence of brown trout DNA in environmental samples. The marker strongly...

  18. Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

    Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin


    Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

  19. Multi-scale magnetic nanoparticle based optomagnetic bioassay for sensitive DNA and bacteria detection

    Tian, Bo; Zardán Gómez De La Torre, Teresa; Donolato, Marco


    nanoparticles (binding to the target) and thus the optomagnetic response of the sample, which is measured by an optomagnetic setup including a 405 nm laser and a photodetector. The limit of detection is mainly set by the lowest measurable concentration of magnetic nanoparticles. Herein, as new results compared...... with the target. We show that the optimization and lowering of the 100 nm magnetic nanoparticle concentration result in a limit of detection of 780 fM of DNA coils formed by rolling circle amplification (size of about 1 μm) and 105 CFU per mL Salmonella (for immunoassay). These values are 15 times lower than...... those reported previously for this readout principle. Finally, we show that the 250 nm magnetic nanoparticles can serve as a second detection label for qualitative biplex detection of DNA coils formed by rolling circle amplification from V. cholerae and E. coli DNA coils using 100 nm and 250 nm magnetic...

  20. Enzyme-enhanced fluorescence detection of DNA on etched optical fibers.

    Niu, Shu-yan; Li, Quan-yi; Ren, Rui; Zhang, Shu-sheng


    A novel DNA biosensor based on enzyme-enhanced fluorescence detection on etched optical fibers was developed. The hybridization complex of DNA probe and biotinylated target was formed on the etched optical fiber, and was then bound with streptavidin labeled horseradish peroxidase (streptavidin-HRP). The target DNA was quantified through the fluorescent detection of bi-p,p'-4-hydroxyphenylacetic acid (DBDA) generated from the substrate 4-hydroxyphenylacetic acid (p-HPA) under the catalysis of HRP, with a detection limit of 1 pM and a linear range from 1.69 pM to 169 pM. It is facile to regenerate this sensor through surface treatment with concentrated urea solution. It was discovered that the sensor can retain 70% of its original activity after three detection-regeneration cycles.

  1. Enzyme-Free Detection of Mutations in Cancer DNA Using Synthetic Oligonucleotide Probes and Fluorescence Microscopy

    Miotke, Laura; Maity, Arindam; Ji, Hanlee


    BACKGROUND: Rapid reliable diagnostics of DNA mutations are highly desirable in research and clinical assays. Current development in this field goes simultaneously in two directions: 1) high-throughput methods, and 2) portable assays. Non-enzymatic approaches are attractive for both types...... 1000-fold above the potential detection limit. CONCLUSION: Overall, the novel assay we describe could become a new approach to rapid, reliable and enzyme-free diagnostics of cancer or other associated DNA targets. Importantly, stoichiometry of wild type and mutant targets is conserved in our assay...... of methods since they would allow rapid and relatively inexpensive detection of nucleic acids. Modern fluorescence microscopy is having a huge impact on detection of biomolecules at previously unachievable resolution. However, no straightforward methods to detect DNA in a non-enzymatic way using fluorescence...

  2. Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci

    Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.


    Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis

  3. The detection of great crested newts year round via environmental DNA analysis.

    Rees, Helen C; Baker, Claire A; Gardner, David S; Maddison, Ben C; Gough, Kevin C


    Analysis of environmental DNA (eDNA) is a method that has been used for the detection of various species within water bodies. The great crested newt (Triturus cristatus) has a short eDNA survey season (mid-April to June). Here we investigate whether this season could be extended into other months using the current methodology as stipulated by Natural England. Here we present data to show that in monthly water samples taken from two ponds (March 2014-February 2015) we were able to detect great crested newt DNA in all months in at least one of the ponds. Similar levels of great crested newt eDNA (i.e. highly positive identification) were detected through the months of March-August, suggesting it may be possible to extend the current survey window. In order to determine how applicable these observations are for ponds throughout the rest of the UK, further work in multiple other ponds over multiple seasons is suggested. Nevertheless, the current work clearly demonstrates, in two ponds, the efficacy and reproducibility of eDNA detection for determining the presence of great crested newts.

  4. Microfluidic Arrayed Lab-On-A-Chip for Electrochemical Capacitive Detection of DNA Hybridization Events.

    Ben-Yoav, Hadar; Dykstra, Peter H; Bentley, William E; Ghodssi, Reza


    A microfluidic electrochemical lab-on-a-chip (LOC) device for DNA hybridization detection has been developed. The device comprises a 3 × 3 array of microelectrodes integrated with a dual layer microfluidic valved manipulation system that provides controlled and automated capabilities for high throughput analysis of microliter volume samples. The surface of the microelectrodes is functionalized with single-stranded DNA (ssDNA) probes which enable specific detection of complementary ssDNA targets. These targets are detected by a capacitive technique which measures dielectric variation at the microelectrode-electrolyte interface due to DNA hybridization events. A quantitative analysis of the hybridization events is carried out based on a sensing modeling that includes detailed analysis of energy storage and dissipation components. By calculating these components during hybridization events the device is able to demonstrate specific and dose response sensing characteristics. The developed microfluidic LOC for DNA hybridization detection offers a technology for real-time and label-free assessment of genetic markers outside of laboratory settings, such as at the point-of-care or in-field environmental monitoring.

  5. Detection of bovine mastitis pathogens by loop-mediated isothermal amplification and an electrochemical DNA chip.

    Kawai, Kazuhiro; Inada, Mika; Ito, Keiko; Hashimoto, Koji; Nikaido, Masaru; Hata, Eiji; Katsuda, Ken; Kiku, Yoshio; Tagawa, Yuichi; Hayashi, Tomohito


    Bovine mastitis causes significant economic losses in the dairy industry. Effective prevention of bovine mastitis requires an understanding of the infection status of a pathogenic microorganism in a herd that has not yet shown clinical signs of mastitis and appropriate treatment specific for the pathogenic microorganism. However, bacterial identification by culture has drawbacks in that the sensitivity may be low and the procedure can be complex. In this study, we developed a genetic detection method to identify mastitis pathogens using a simple and highly sensitive electrochemical DNA chip which can specifically detect bacterial DNA in milk specimens. First, we selected microorganisms belonging to 12 families and/or genera associated with mastitis for which testing should be performed. Next, we optimized the conditions for amplifying microorganism DNA by loop-mediated isothermal amplification (LAMP) using 32 primers and the use of a DNA chip capable of measuring all pathogens simultaneously. Sample detection could be completed in just a few hours using this method. Comparison of the results obtained with our DNA chip method and those obtained by bacterial culture verified that when the culture method was set to 100%, the total positive concordance rate of the DNA chip was 85.0% and the total negative concordance rate was 86.9%. Furthermore, the proposed method allows both rapid and highly sensitive detection of mastitis pathogens. We believe that this method will contribute to the development of an effective mastitis control program.

  6. DNA-mediated strand displacement facilitates sensitive electronic detection of antibodies in human serums.

    Dou, Baoting; Yang, Jianmei; Shi, Kai; Yuan, Ruo; Xiang, Yun


    We describe here the development of a sensitive and convenient electronic sensor for the detection of antibodies in human serums. The sensor is constructed by self-assembly formation of a mixed monolayer containing the small molecule epitope conjugated double stranded DNA probes on gold electrode. The target antibody binds the epitope on the dsDNA probe and lowers the melting temperature of the duplex, which facilitates the displacement of the antibody-linked strand of the duplex probe by an invading methylene blue-tagged single stranded DNA (MB-ssDNA) through the strand displacement reaction and leads to the capture of many MB-ssDNA on the sensor surface. Subsequent electrochemical oxidation of the methylene blue labels results in amplified current response for sensitive monitoring of the antibodies. The antibody assay conditions are optimized and the sensor exhibits a linear range between 1.0 and 25.0nM with a detection limit of 0.67nM for the target antibody. The sensor is also selective and can be employed to detect the target antibodies in human serum samples. With the advantages of using small molecule epitope as the antibody recognition element over traditional antigen, the versatile manipulability of the DNA probes and the unique properties of the electrochemical transduction technique, the developed sensor thus hold great potential for simple and sensitive detection of different antibodies and other proteins in real samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. A set of 14 DIP-SNP markers to detect unbalanced DNA mixtures.

    Liu, Zhizhen; Liu, Jinding; Wang, Jiaqi; Chen, Deqing; Liu, Zidong; Shi, Jie; Li, Zeqin; Li, Wenyan; Zhang, Gengqian; Du, Bing


    Unbalanced DNA mixture is still a difficult problem for forensic practice. DIP-STRs are useful markers for detection of minor DNA but they are not widespread in the human genome and having long amplicons. In this study, we proposed a novel type of genetic marker, termed DIP-SNP. DIP-SNP refers to the combination of INDEL and SNP in less than 300bp length of human genome. The multiplex PCR and SNaPshot assay were established for 14 DIP-SNP markers in a Chinese Han population from Shanxi, China. This novel compound marker allows detection of the minor DNA contributor with sensitivity from 1:50 to 1:1000 in a DNA mixture of any gender with 1 ng-10 ng DNA template. Most of the DIP-SNP markers had a relatively high probability of informative alleles with an average I value of 0.33. In all, we proposed DIP-SNP as a novel kind of genetic marker for detection of minor contributor from unbalanced DNA mixture and established the detection method by associating the multiplex PCR and SNaPshot assay. DIP-SNP polymorphisms are promising markers for forensic or clinical mixture examination because they are shorter, widespread and higher sensitive. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R


    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  9. A CCD-based system for the detection of DNA in electrophoresis gels by UV absorption

    Mahon, A.R.; MacDonald, J.H.; Mainwood, A.; Ott, R.J.


    A method and apparatus for the detection and quantification of large fragments of unlabelled nucleic acids in agarose gels is presented. The technique is based on ultraviolet (UV) absorption by nucleotides. A deuterium source illuminates individual sample lanes of an electrophoresis gel via an array of optical fibres. As DNA bands pass through the illuminated region of the gel the amount of UV light transmitted is reduced because of absorption by the DNA. During electrophoresis the regions of DNA are detected on-line using a UV-sensitive charge coupled device (CCD). As the absorption coefficient is proportional to the mass of DNA the technique is inherently quantitative. The mass of DNA in a region of the gel is approximately proportional to the integrated signal in the corresponding section of the CCD image. This system currently has a detection limit of less than 1.25 ng compared with 2-10 ng for the most popular conventional technique, ethidium bromide (EtBr) staining. In addition the DNA sample remains in its native state. The removal of the carcinogenic dye from the detection procedure greatly reduces associated biological hazards. (author)

  10. Enzyme-free and label-free ultrasensitive electrochemical detection of DNA and adenosine triphosphate by dendritic DNA concatamer-based signal amplification.

    Liu, Shufeng; Lin, Ying; Liu, Tao; Cheng, Chuanbin; Wei, Wenji; Wang, Li; Li, Feng


    Hybridization chain reaction (HCR) strategy has been well developed for the fabrication of various biosensing platforms for signal amplification. Herein, a novel enzyme-free and label-free ultrasensitive electrochemical DNA biosensing platform for the detection of target DNA and adenosine triphosphate (ATP) was firstly proposed, in which three auxiliary DNA probes were ingeniously designed to construct the dendritic DNA concatamer via HCR strategy and used as hexaammineruthenium(III) chloride (RuHex) carrier for signal amplification. With the developed dendritic DNA concatamer-based signal amplification strategy, the DNA biosensor could achieve an ultrasensitive electrochemical detection of DNA and ATP with a superior detection limit as low as 5 aM and 20 fM, respectively, and also demonstrate a high selectivity for DNA and ATP detection. The currently proposed dendritic DNA concatamer opens a promising direction to construct ultrasensitive DNA biosensing platform for biomolecular detection in bioanalysis and clinical biomedicine, which offers the distinct advantages of simplicity and cost efficiency owing to no need of any kind of enzyme, chemical modification or labeling. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Cluster analysis for DNA methylation profiles having a detection threshold

    Siegmund Kimberly D


    Full Text Available Abstract Background DNA methylation, a molecular feature used to investigate tumor heterogeneity, can be measured on many genomic regions using the MethyLight technology. Due to the combination of the underlying biology of DNA methylation and the MethyLight technology, the measurements, while being generated on a continuous scale, have a large number of 0 values. This suggests that conventional clustering methodology may not perform well on this data. Results We compare performance of existing methodology (such as k-means with two novel methods that explicitly allow for the preponderance of values at 0. We also consider how the ability to successfully cluster such data depends upon the number of informative genes for which methylation is measured and the correlation structure of the methylation values for those genes. We show that when data is collected for a sufficient number of genes, our models do improve clustering performance compared to methods, such as k-means, that do not explicitly respect the supposed biological realities of the situation. Conclusion The performance of analysis methods depends upon how well the assumptions of those methods reflect the properties of the data being analyzed. Differing technologies will lead to data with differing properties, and should therefore be analyzed differently. Consequently, it is prudent to give thought to what the properties of the data are likely to be, and which analysis method might therefore be likely to best capture those properties.

  12. A novel pathway to detect and cope with exogenous dsDNA.

    Kobayashi, Shouhei; Haraguchi, Tokuko


    How a living cell responds to exogenous materials is one of the fundamental questions in the life sciences. In particular, understanding the mechanisms by which a cell recognizes exogenous double-stranded DNA (dsDNA) is important for immunology research because it will facilitate the control of pathogen infections that entail the presence of exogenous dsDNA in the cytoplasm of host cells. Several cytosolic dsDNA sensor proteins that trigger innate immune responses have been identified and the downstream signaling pathways have been investigated. However, the events that occur at the site of exogenous dsDNA when it is exposed to the cytosol of the host cell remain unknown. Using dsDNA-coated polystyrene beads incorporated into living cells, we recently found that barrier-to-autointegration factor (BAF) binds to the exogenous dsDNA immediately after its appearance in the cytosol and plays a role in DNA avoidance of autophagy. Our findings reveal a novel pathway in which BAF plays a key role in the detection of and response to exogenous dsDNA.

  13. Detection of dietary DNA, protein, and glyphosate in meat, milk, and eggs.

    Van Eenennaam, A L; Young, A E


    Products such as meat, milk, and eggs from animals that have consumed genetically engineered (GE) feed are not currently subject to mandatory GE labeling requirements. Some voluntary "non-genetically modified organism" labeling has been associated with such products, indicating that the animals were not fed GE crops, as there are no commercialized GE food animals. This review summarizes the available scientific literature on the detection of dietary DNA and protein in animal products and briefly discusses the implications of mandatory GE labeling for products from animals that have consumed GE feed. Because glyphosate is used on some GE crops, the available studies on glyphosate residues in animal products are also reviewed. In GE crops, recombinant DNA (rDNA) makes up a small percentage of the plant's total DNA. The final amount of DNA in food/feed depends on many factors including the variable number and density of cells in the edible parts, the DNA-containing matrix, environmental conditions, and the specific transgenic event. Processing treatments and animals' digestive systems degrade DNA into small fragments. Available reports conclude that endogenous DNA and rDNA are processed in exactly the same way in the gastrointestinal tract and that they account for a very small proportion of food intake by weight. Small pieces of high copy number endogenous plant genes have occasionally been detected in meat and milk. Similarly sized pieces of rDNA have also been identified in meat, primarily fish, although detection is inconsistent. Dietary rDNA fragments have not been detected in chicken or quail eggs or in fresh milk from cows or goats. Collectively, studies have failed to identify full-length endogenous or rDNA transcripts or recombinant proteins in meat, milk, or eggs. Similarly, because mammals do not bioaccumulate glyphosate and it is rapidly excreted, negligible levels of glyphosate in cattle, pig and poultry meat, milk, and eggs have been reported. Despite

  14. Detection of Babesia bovis carrier cattle by using polymerase chain reaction amplification of parasite DNA.

    Fahrimal, Y; Goff, W L; Jasmer, D P


    Carrier cattle infected with Babesia bovis are difficult to detect because of the low numbers of parasites that occur in peripheral blood. However, diagnosis of low-level infections with the parasite is important for evaluating the efficacies of vaccines and in transmission and epidemiological studies. We used the polymerase chain reaction (PCR) to amplify a portion of the apocytochrome b gene from the parasite and tested the ability of this method to detect carrier cattle. The target sequence is associated with a 7.4-kb DNA element in undigested B. bovis genomic DNA (as shown previously), and the amplified product was detected by Southern and dot blot hybridization. The assay was specific for B. bovis, since no amplification was detected with Babesia bigemina, Trypanosoma brucei, Anaplasma marginale, or leukocyte DNA. The target sequence was amplified in DNA from B. bovis Mexico, Texas, and Australia S and L strains, demonstrating the applicability of the method to strains from different geographic regions. The sensitivity of the method ranged from 1 to 10 infected erythrocytes extracted from 0.5 ml of blood. This sensitivity was about 1,000 times greater than that from the use of unamplified parasite DNA. By the PCR method, six B. bovis carrier cattle were detected 86% of the time (range, 66 to 100%) when they were tested 11 times, while with microscopic examination of thick blood smears, the same carrier cattle were detected only 36% of the time (range, 17 to 66%). The method provides a useful diagnostic tool for detecting B. bovis carrier cattle, and the sensitivity is significantly improved over that of current methods. The results also suggest that characteristics of the apocytchrome b gene may make this a valuable target DNA for PCR-based detection of other hemoparasites. Images PMID:1624551

  15. DNA-damage foci to detect and characterize DNA repair alterations in children treated for pediatric malignancies.

    Nadine Schuler

    Full Text Available PURPOSE: In children diagnosed with cancer, we evaluated the DNA damage foci approach to identify patients with double-strand break (DSB repair deficiencies, who may overreact to DNA-damaging radio- and chemotherapy. In one patient with Fanconi anemia (FA suffering relapsing squamous cell carcinomas of the oral cavity we also characterized the repair defect in biopsies of skin, mucosa and tumor. METHODS AND MATERIALS: In children with histologically confirmed tumors or leukemias and healthy control-children DSB repair was investigated by counting γH2AX-, 53BP1- and pATM-foci in blood lymphocytes at defined time points after ex-vivo irradiation. This DSB repair capacity was correlated with treatment-related normal-tissue responses. For the FA patient the defective repair was also characterized in tissue biopsies by analyzing DNA damage response proteins by light and electron microscopy. RESULTS: Between tumor-children and healthy control-children we observed significant differences in mean DSB repair capacity, suggesting that childhood cancer is based on genetic alterations affecting DNA repair. Only 1 out of 4 patients with grade-4 normal-tissue toxicities revealed an impaired DSB repair capacity. The defective DNA repair in FA patient was verified in irradiated blood lymphocytes as well as in non-irradiated mucosa and skin biopsies leading to an excessive accumulation of heterochromatin-associated DSBs in rapidly cycling cells. CONCLUSIONS: Analyzing human tissues we show that DSB repair alterations predispose to cancer formation at younger ages and affect the susceptibility to normal-tissue toxicities. DNA damage foci analysis of blood and tissue samples allows one to detect and characterize DSB repair deficiencies and enables identification of patients at risk for high-grade toxicities. However, not all treatment-associated normal-tissue toxicities can be explained by DSB repair deficiencies.

  16. Ultrasensitive Electrochemical Detection of Clostridium perfringens DNA Based Morphology-Dependent DNA Adsorption Properties of CeO2 Nanorods in Dairy Products

    Xingcan Qian


    Full Text Available Foodborne pathogens such as Clostridium perfringens can cause diverse illnesses and seriously threaten to human health, yet far less attention has been given to detecting these pathogenic bacteria. Herein, two morphologies of nanoceria were synthesized via adjusting the concentration of NaOH, and CeO2 nanorod has been utilized as sensing material to achieve sensitive and selective detection of C. perfringens DNA sequence due to its strong adsorption ability towards DNA compared to nanoparticle. The DNA probe was tightly immobilized on CeO2/chitosan modified electrode surface via metal coordination, and the DNA surface density was 2.51 × 10−10 mol/cm2. Under optimal experimental conditions, the electrochemical impedance biosensor displays favorable selectivity toward target DNA in comparison with base-mismatched and non-complementary DNA. The dynamic linear range of the proposed biosensor for detecting oligonucleotide sequence of Clostridium perfringens was from 1.0 × 10−14 to 1.0 × 10−7 mol/L. The detection limit was 7.06 × 10−15 mol/L. In comparison, differential pulse voltammetry (DPV method quantified the target DNA with a detection limit of 1.95 × 10−15 mol/L. Moreover, the DNA biosensor could detect C. perfringens extracted DNA in dairy products and provided a potential application in food quality control.

  17. Non-invasive prenatal detection of achondroplasia using circulating fetal DNA in maternal plasma.

    Lim, Ji Hyae; Kim, Mee Jin; Kim, Shin Young; Kim, Hye Ok; Song, Mee Jin; Kim, Min Hyoung; Park, So Yeon; Yang, Jae Hyug; Ryu, Hyun Mee


    To perform a reliable non-invasive detection of the fetal achondroplasia using maternal plasma. We developed a quantitative fluorescent-polymerase chain reaction (QF-PCR) method suitable for detection of the FGFR3 mutation (G1138A) causing achondroplasia. This method was applied in a non-invasive detection of the fetal achondroplasia using circulating fetal-DNA (cf-DNA) in maternal plasma. Maternal plasmas were obtained at 27 weeks of gestational age from women carrying an achondroplasia fetus or a normal fetus. Two percent or less achondroplasia DNA was reliably detected by QF-PCR. In a woman carrying a normal fetus, analysis of cf-DNA showed only one peak of the wild-type G allele. In a woman expected an achondroplasia fetus, analysis of cf-DNA showed the two peaks of wild-type G allele and mutant-type A allele and accurately detected the fetal achondroplasia. The non-invasive method using maternal plasma and QF-PCR may be useful for diagnosis of the fetal achondroplasia.

  18. Phosphorescent quantum dots/doxorubicin nanohybrids based on photoinduced electron transfer for detection of DNA.

    Miao, Yanming; Zhang, Zhifeng; Gong, Yan; Yan, Guiqin


    MPA-capped Mn-doped ZnS QDs/DXR nanohybrids (MPA: 3-mercaptopropionic acid; QDs: quantum dots; DXR: cetyltrimethyl ammonium bromide) were constructed via photoinduced electron transfer (PIET) and then used as a room-temperature phosphorescence (RTP) probe for detection of DNA. DXR as a quencher will quench the RTP of Mn-doped ZnS QDs via PIET, thereby forming Mn-doped ZnS QDs/DXR nanohybrids and storing RTP. With the addition of DNA, it will be inserted into DXR and thus DXR will be competitively desorbed from the surface of Mn-doped ZnS QDs, thereby releasing the RTP of Mn-doped ZnS QDs. Based on this, a new method for DNA detection was built. The sensor for DNA has a detection limit of 0.039 mg L(-1) and a linear range from 0.1 to 14 mg L(-1). The present QDs-based RTP method does not need deoxidants or other inducers as required by conventional RTP detection methods, and avoids interference from autofluorescence and the scattering light of the matrix that are encountered in spectrofluorometry. Therefore, this method can be used to detect the DNA content in body fluid. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Gold nanoparticle-based probes for the colorimetric detection of Mycobacterium avium subspecies paratuberculosis DNA.

    Ganareal, Thenor Aristotile Charles S; Balbin, Michelle M; Monserate, Juvy J; Salazar, Joel R; Mingala, Claro N


    Gold nanoparticle (AuNP) is considered to be the most stable metal nanoparticle having the ability to be functionalized with biomolecules. Recently, AuNP-based DNA detection methods captured the interest of researchers worldwide. Paratuberculosis or Johne's disease, a chronic gastroenteritis in ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP), was found to have negative effect in the livestock industry. In this study, AuNP-based probes were evaluated for the specific and sensitive detection of MAP DNA. AuNP-based probe was produced by functionalization of AuNPs with thiol-modified oligonucleotide and was confirmed by Fourier-Transform Infrared (FTIR) spectroscopy. UV-Vis spectroscopy and Scanning Electron Microscopy (SEM) were used to characterize AuNPs. DNA detection was done by hybridization of 10 μL of DNA with 5 μL of probe at 63 °C for 10 min and addition of 3 μL salt solution. The method was specific to MAP with detection limit of 103 ng. UV-Vis and SEM showed dispersion and aggregation of the AuNPs for the positive and negative results, respectively, with no observed particle growth. This study therefore reports an AuNP-based probes which can be used for the specific and sensitive detection of MAP DNA. Copyright © 2018 Elsevier Inc. All rights reserved.

  20. Detection of Methylated Circulating DNA as Noninvasive Biomarkers for Breast Cancer Diagnosis

    Cheuk, Isabella Wai Yin; Shin, Vivian Yvonne


    Internationally, breast cancer is the most common female cancer, and is induced by a combination of environmental, genetic, and epigenetic risk factors. Despite the advancement of imaging techniques, invasive sampling of breast epithelial cells is the only definitive diagnostic procedure for patients with breast cancer. To date, molecular biomarkers with high sensitivity and specificity for the screening and early detection of breast cancer are lacking. Recent evidence suggests that the detection of methylated circulating cell-free DNA in the peripheral blood of patients with cancer may be a promising quantitative and noninvasive method for cancer diagnosis. Methylation detection based on a multi-gene panel, rather than on the methylation status of a single gene, may be used to increase the sensitivity and specificity of breast cancer screening. In this review, the results of 14 relevant studies, investigating the efficacy of cell-free DNA methylation screening for breast cancer diagnosis, have been summarized. The genetic risk factors for breast cancer, the methods used for breast cancer detection, and the techniques and limitations related to the detection of cell-free DNA methylation status, have also been reviewed and discussed. From this review, we conclude that the analysis of peripheral blood or other samples to detect differentially methylated cell-free DNA is a promising technique for use in clinical settings, and may improve the sensitivity of screening for both, early detection and disease relapse, and thus improve the future prognosis of patients with breast cancer. PMID:28382090

  1. Detection of DNA strand breaks in mammalian cells using the radioresistant bacterium PprA protein

    Satoh, Katsuya; Wada, Seiichi; Narumi, Issay; Kikuchi, Masahiro; Funayama, Tomoo; Kobayashi, Yasuhiko


    We have previously found that the PprA protein from Deinococcus radiodurans possesses ability to recognize DNA carrying strand breaks. In the present study, we attempted to visualize radiation-induced DNA strand breaks with PprA protein using immunofluorescence technique to elucidate the DNA damage response mechanism in mammalian cultured cells. As a result, colocalization of Cy2 and DAPI fluorescent signals was observed. This observation suggests that DNA strand breaks in the nucleus of CHO-K1 cells were effectively detected using the PprA protein. The amount of DNA strand breaks (integrated density of Cy2 fluorescent signals) was increased with the increase in the radiation dose. (author)

  2. Potential utility of environmental DNA for early detection of Eurasian watermilfoil (Myriophyllum spicatum)

    Newton, Jeremy; Sepulveda, Adam; Sylvester, K; Thum, Ryan


    Considering the harmful and irreversible consequences of many biological invasions, early detection of an invasive species is an important step toward protecting ecosystems (Sepulveda et al. 2012). Early detection increases the probability that suppression or eradication efforts will be successful because invasive populations are small and localized (Vander Zanden et al. 2010). However, most invasive species are not detected early because current tools have low detection probabilities when target species are rare and the sampling effort required to achieve acceptable detection capabilities with current tools is seldom tractable (Jerde et al. 2011). As a result, many invasive species go undetected until they are abundant and suppression efforts become costly. Novel DNA-based surveillance tools have recently revolutionized early detection abilities using environmental DNA (eDNA) present in the water (Darling and Mahon 2011, Bohmann et al. 2014). In brief, eDNA monitoring enables the identification of organisms from DNA present and collected in water samples. Aquatic and semiaquatic organisms release DNA contained in sloughed, damaged, or partially decomposed tissue and waste products into the water and molecular techniques allow this eDNA in the water column to be identified from simple and easy-tocollect water samples (Darling and Mahon 2011). Despite limited understanding of the production, persistence, and spread of DNA in water (Barnes et al. 2014), eDNA monitoring has been applied not only to invasive species (Jerde et al. 2011), but also to species that are rare, endangered, or highly elusive (Spear et al. 2014). However, most eDNA research and monitoring has focused on detection of invertebrates and vertebrates and less attentionhas been given to developing eDNA techniques for detecting aquatic invasive plants. Eurasian watermilfoil (EWM; Myriophyllum spicatum L.) is an invasive species for which improved early detection would be particularly helpful. Advanced

  3. A probe-based quantitative PCR assay for detecting Tetracapsuloides bryosalmonae in fish tissue and environmental DNA water samples

    Hutchins, Patrick; Sepulveda, Adam; Martin, Renee; Hopper, Lacey


    A probe-based quantitative real-time PCR assay was developed to detect Tetracapsuloides bryosalmonae, which causes proliferative kidney disease in salmonid fish, in kidney tissue and environmental DNA (eDNA) water samples. The limits of detection and quantification were 7 and 100 DNA copies for calibration standards and T. bryosalmonae was reliably detected down to 100 copies in tissue and eDNA samples. The assay presented here is a highly sensitive and quantitative tool for detecting T. bryosalmonae with potential applications for tissue diagnostics and environmental detection.

  4. Selective detection of Mg2+ ions via enhanced fluorescence emission using Au–DNA nanocomposites

    Tanushree Basu


    Full Text Available The biophysical properties of DNA-modified Au nanoparticles (AuNPs have attracted a great deal of research interest for various applications in biosensing. AuNPs have strong binding capability to the phosphate and sugar groups in DNA, rendering unique physicochemical properties for detection of metal ions. The formation of Au–DNA nanocomposites is evident from the observed changes in the optical absorption, plasmon band, zeta potential, DLS particle size distribution, as well as TEM and AFM surface morphology analysis. Circular dichroism studies also revealed that DNA-functionalized AuNP binding caused a conformational change in the DNA structure. Due to the size and shape dependent plasmonic interactions of AuNPs (33–78 nm with DNA, the resultant Au–DNA nanocomposites (NCs exhibit superior fluorescence emission due to chemical binding with Ca2+, Fe2+ and Mg2+ ions. A significant increase in fluorescence emission (λex = 260 nm of Au–DNA NCs was observed after selectively binding with Mg2+ ions (20–800 ppm in an aqueous solution where a minimum of 100 ppm Mg2+ ions was detected based on the linearity of concentration versus fluorescence intensity curve (λem = 400 nm. The effectiveness of Au–DNA nanocomposites was further verified by comparing the known concentration (50–120 ppm of Mg2+ ions in synthetic tap water and a real life sample of Gelusil (300–360 ppm Mg2+, a widely used antacid medicine. Therefore, this method could be a sensitive tool for the estimation of water hardness after careful preparation of a suitably designed Au–DNA nanostructure.

  5. Detection of Hepatocyte Clones Containing Integrated Hepatitis B Virus DNA Using Inverse Nested PCR.

    Tu, Thomas; Jilbert, Allison R


    Chronic hepatitis B virus (HBV) infection is a major cause of liver cirrhosis and hepatocellular carcinoma (HCC), leading to ~600,000 deaths per year worldwide. Many of the steps that occur during progression from the normal liver to cirrhosis and/or HCC are unknown. Integration of HBV DNA into random sites in the host cell genome occurs as a by-product of the HBV replication cycle and forms a unique junction between virus and cellular DNA. Analyses of integrated HBV DNA have revealed that HCCs are clonal and imply that they develop from the transformation of hepatocytes, the only liver cell known to be infected by HBV. Integrated HBV DNA has also been shown, at least in some tumors, to cause insertional mutagenesis in cancer driver genes, which may facilitate the development of HCC. Studies of HBV DNA integration in the histologically normal liver have provided additional insight into HBV-associated liver disease, suggesting that hepatocytes with a survival or growth advantage undergo high levels of clonal expansion even in the absence of oncogenic transformation. Here we describe inverse nested PCR (invPCR), a highly sensitive method that allows detection, sequencing, and enumeration of virus-cell DNA junctions formed by the integration of HBV DNA. The invPCR protocol is composed of two major steps: inversion of the virus-cell DNA junction and single-molecule nested PCR. The invPCR method is highly specific and inexpensive and can be tailored to DNA extracted from large or small amounts of liver. This procedure also allows detection of genome-wide random integration of any known DNA sequence and is therefore a useful technique for molecular biology, virology, and genetic research.

  6. Rapid on-site detection of Acidovorax avenae subsp. citrulli by gold-labeled DNA strip sensor.

    Zhao, Wenjun; Lu, Jie; Ma, Wenwei; Xu, Chuanlai; Kuang, Hua; Zhu, Shuifang


    Acidovorax avenae subsp. citrulli (AAC) is one of the most harmful diseases in cucurbit production. A rapid and sensitive DNA strip sensor was constructed based on gold nanoparticle-labeled oligonucleotide probes for the detection of AAC. Both the qualitative and semi-quantitative detections of target DNA were successfully achieved using the developed DNA strip sensor. The qualitative limit of detection (LOD) of the strip sensor was determined as 4 nM. The LOD for the semi-quantitative detection was calculated to be 0.48 nM in the range of 0-10 nM. The genomic DNA was detected directly using the DNA strip sensor without any further treatment. This DNA strip sensor is a potentially useful tool for rapid on-site DNA screening. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Label-free, electrochemical detection of methicillin-resistant staphylococcus aureus DNA with reduced graphene oxide-modified electrodes

    Wang, Zhijuan


    Reduced graphene oxide (rGO)-modified glassy carbon electrode is used to detect the methicillin-resistant Staphylococcus aureus (MRSA) DNA by using electrochemical impedance spectroscopy. Our experiments confirm that ssDNA, before and after hybridization with target DNA, are successfully anchored on the rGO surface. After the probe DNA, pre-adsorbed on rGO electrode, hybridizes with target DNA, the measured impedance increases dramatically. It provides a new method to detect DNA with high sensitivity (10-13M, i.e., 100 fM) and selectivity. © 2011 Elsevier B.V.

  8. Detection of Toxoplasma gondii DNA in Brazilian oysters (Crassostrea rhizophorae).

    Ribeiro, L A; Santos, L K N S S; Brito, P A; Maciel, B M; Da Silva, A V; Albuquerque, G R


    The aim of this study was to detect evidence of Toxoplasma gondii using polymerase chain reaction (PCR)-based techniques in oysters (Crassostrea rhizophorae) obtained from the southern coastal region of Bahia, Brazil. A total of 624 oysters were collected, and the gills and digestive glands were dissected. Each tissue sample was separated into pools containing tissues (of the same type) from three animals, leading to a total of 416 experimental samples for analysis (208 samples each from the gills and digestive glands). Molecular analysis using PCR-based detection of the T. gondii AF 146527 repetitive fragment yielded negative results for all samples. However, when nested-PCR was used for detection of the T. gondii SAG-1 gene, 17 samples were positive, with the gills being the tissue with maximal detection of the parasite. These positive results were confirmed by sample sequencing. It is therefore suggested that C. rhizophorae oysters are capable of filtering and retaining T. gondii oocysts in their tissue. This represents a risk to public health because they are traditionally ingested in natura.

  9. cDNA cloning, structural analysis, SNP detection and tissue ...


    detection and tissue expression profile of the IGF1 gene in Malabari and Attappady Black goats of India. J. Genet. ... Keywords. gene cloning; gene expression; goat; insulin-like growth factor 1; mRNA; single-nucleotide ..... cle tenderness (Koohmaraie et al. .... growth factor (IGF) system in the bovine oviduct at oestrus and.

  10. Isothermal Recombinase Polymerase amplification (RPA) of Schistosoma haematobium DNA and oligochromatographic lateral flow detection.

    Rosser, A; Rollinson, D; Forrest, M; Webster, B L


    Accurate diagnosis of urogenital schistosomiasis is vital for surveillance/control programs. Amplification of schistosome DNA in urine by PCR is sensitive and specific but requires infrastructure, financial resources and skilled personnel, often not available in endemic areas. Recombinase Polymerase Amplification (RPA) is an isothermal DNA amplification/detection technology that is simple, rapid, portable and needs few resources. Here a Schistosoma haematobium RPA assay was developed and adapted so that DNA amplicons could be detected using oligochromatographic Lateral Flow (LF) strips. The assay successfully amplified S. haematobium DNA at 30-45 °C in 10 mins and was sensitive to a lower limit of 100 fg of DNA. The assay was also successful with the addition of crude urine, up to 5% of the total reaction volume. Cross amplification occurred with other schistosome species but not with other common urine microorganisms. The LF-RPA assay developed here can amplify and detect low levels of S. haematobium DNA. Reactions are rapid, require low temperatures and positive reactions are interpreted using lateral flow strips, reducing the need for infrastructure and resources. This together with an ability to withstand inhibitors within urine makes RPA a promising technology for further development as a molecular diagnostic tool for urogenital schistosomiasis.

  11. Potential use of DNA adducts to detect mutagenic compounds in soil

    Hua Guoxiong; Lyons, Brett; Killham, Ken; Singleton, Ian


    In this study, three different soils with contrasting features, spiked with 300 mg benzo[a]pyrene (BaP)/kg dry soil, were incubated at 20 deg. C and 60% water holding capacity for 540 days. At different time points, BaP and DNA were extracted and quantified, and DNA adducts were quantified by 32 P-postlabelling. After 540 days incubation, 69.3, 81.6 and 83.2% of initial BaP added remained in Cruden Bay, Boyndie and Insch soils, respectively. Meanwhile, a significantly different amount of DNA-BaP adducts were found in the three soils exposed to BaP over time. The work demonstrates the concept that DNA adducts can be detected on DNA extracted from soil. Results suggest the technique is not able to directly reflect bioavailability of BaP transformation products. However, this new method provides a potential way to detect mutagenic compounds in contaminated soil and to assess the outcomes of soil remediation. - A novel DNA adduct assay may provide a potential technique to detect mutagenic compounds in contaminated soil

  12. Detection of DNA hybridization based on SnO2 nanomaterial enhanced fluorescence

    Gu Cuiping; Huang Jiarui; Ni Ning; Li Minqiang; Liu Jinhuai


    In this paper, enhanced fluorescence emissions were firstly investigated based on SnO 2 nanomaterial, and its application in the detection of DNA hybridization was also demonstrated. The microarray of SnO 2 nanomaterial was fabricated by the vapour phase transport method catalyzed by patterned Au nanoparticles on a silicon substrate. A probe DNA was immobilized on the substrate with patterned SnO 2 nanomaterial, respectively, by covalent and non-covalent linking schemes. When a fluorophore labelled target DNA was hybridized with a probe DNA on the substrate, fluorescence emissions were only observed on the surface of SnO 2 nanomaterial, which indicated the property of enhancing fluorescence signals from the SnO 2 nanomaterial. By comparing the different fluorescence images from covalent and non-covalent linking schemes, the covalent method was confirmed to be more effective for immobilizing a probe DNA. With the combined use of SnO 2 nanomaterial and the covalent linking scheme, the target DNA could be detected at a very low concentration of 10 fM. And the stability of SnO 2 nanomaterial under the experimental conditions was also compared with silicon nanowires. The findings strongly suggested that SnO 2 nanomaterial could be extensively applied in detections of biological samples with enhancing fluorescence property and high stability

  13. Eggshell membrane: A natural substrate for immobilization and detection of DNA

    Ray, Preetam Guha; Roy, Somenath, E-mail:


    Chemically modified eggshell membranes (ESM) have been explored as potentially novel platforms for immobilization of oligonucleotides and subsequent detection of target DNA. The fibrous network of the native ESM as well those functionalized with acetic acid or n-butyl acetate has been examined by field-emission scanning electron microscopy (FESEM). The formation of surface functional moieties has been confirmed by Fourier-transform infrared spectroscopy (FTIR). DNA molecules, with an end terminal − NH{sub 2} group (at 5′ end) have been immobilized on the chemically modified ESM surface. The effect of surface modification on the DNA immobilization efficiency has been investigated using fluorescence microscopy and atomic force microscopy (AFM). The above studies concurrently suggest that functionalization of ESM with n-butyl acetate causes a better homogeneity of the DNA probes on the membrane surface. On-chip hybridization of the target DNA with the surface bound capture probes has been performed on the functionalized membranes. It is observed that n-butyl acetate modification of ESM pushes the limit of detection (LOD) of the DNA sensors by at least an order of magnitude compared to the other modification method. - Graphical abstract: Eggshell membranes (ESM) have been chemically modified with acetic acid or n-butyl acetate for immobilization of aminated capture probes and subsequent detection of fluorophore-tagged target DNA molecules. n-Butyl acetate modified ESM exhibits superior homogeneity of capture probe immobilization and lower limit of detection for the target DNA molecules. - Highlights: • Eggshell membranes (ESM) have been explored as potentially novel platforms for immobilization of oligonucleotides. • Compared to native ESM, those modified with acetic acid or n-butyl acetate have shown more efficient loading of DNA probes. • ESM modified with n-butyl acetate pushed the lower limit of detection (LOD) of the sensor down to 10 nM of target DNA

  14. Hall effect biosensors with ultraclean graphene film for improved sensitivity of label-free DNA detection.

    Loan, Phan Thi Kim; Wu, Dongqin; Ye, Chen; Li, Xiaoqing; Tra, Vu Thanh; Wei, Qiuping; Fu, Li; Yu, Aimin; Li, Lain-Jong; Lin, Cheng-Te


    The quality of graphene strongly affects the performance of graphene-based biosensors which are highly demanded for the sensitive and selective detection of biomolecules, such as DNA. This work reported a novel transfer process for preparing a residue-free graphene film using a thin gold supporting layer. A Hall effect device made of this gold-transferred graphene was demonstrated to significantly enhance the sensitivity (≈ 5 times) for hybridization detection, with a linear detection range of 1pM to 100nM for DNA target. Our findings provide an efficient method to boost the sensitivity of graphene-based biosensors for DNA recognition. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Development of laser-induced fluorescence detection to assay DNA damage

    Sharma, M.; Freund, H.G.


    A precolumn derivation method has been developed for high performance liquid chromatographic (HPLC) analysis of DNA damage using fluorescence detection. The modified nucleotide, having excised enzymatically from the exposed DNA, is enriched from the normal nucleotides and labeled with a fluorescent reagent. The labeling procedure involves phosphoramidation of the nucleotide with ethylenediamine (EDA) followed by conjugation of the free amino end of the phosphoramidate with 5-dimethylaminonaphthalene 1-sulfonyl chloride, commonly known as Dansyl chloride. The dansylated nucleotide can be analyzed with a sub-picomole limit of detection (LOD) by conventional HPLC using a conventional fluorescence detector. By combining microbore HPLC with laser-induced fluorescence (LIF) detection, the authors present the development of an analytical system that has sub-femtomole LOD for real-time analysis of the dansylated nucleotide. In this paper the application of the developed system in fluorescence postlabeling assay of a small alkyl-modified nucleotide (5-methyl CMP) in calf-thymus DNA is discussed

  16. DNA detection and single nucleotide mutation identification using SERS for molecular diagnostics and global health

    Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan


    Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.

  17. Detection of genetically modified organisms (GMOs using isothermal amplification of target DNA sequences

    La Mura Maurizio


    Full Text Available Abstract Background The most common method of GMO detection is based upon the amplification of GMO-specific DNA amplicons using the polymerase chain reaction (PCR. Here we have applied the loop-mediated isothermal amplification (LAMP method to amplify GMO-related DNA sequences, 'internal' commonly-used motifs for controlling transgene expression and event-specific (plant-transgene junctions. Results We have tested the specificity and sensitivity of the technique for use in GMO studies. Results show that detection of 0.01% GMO in equivalent background DNA was possible and dilutions of template suggest that detection from single copies of the template may be possible using LAMP. Conclusion This work shows that GMO detection can be carried out using LAMP for routine screening as well as for specific events detection. Moreover, the sensitivity and ability to amplify targets, even with a high background of DNA, here demonstrated, highlights the advantages of this isothermal amplification when applied for GMO detection.

  18. An ultrasensitive hollow-silica-based biosensor for pathogenic Escherichia coli DNA detection.

    Ariffin, Eda Yuhana; Lee, Yook Heng; Futra, Dedi; Tan, Ling Ling; Karim, Nurul Huda Abd; Ibrahim, Nik Nuraznida Nik; Ahmad, Asmat


    A novel electrochemical DNA biosensor for ultrasensitive and selective quantitation of Escherichia coli DNA based on aminated hollow silica spheres (HSiSs) has been successfully developed. The HSiSs were synthesized with facile sonication and heating techniques. The HSiSs have an inner and an outer surface for DNA immobilization sites after they have been functionalized with 3-aminopropyltriethoxysilane. From field emission scanning electron microscopy images, the presence of pores was confirmed in the functionalized HSiSs. Furthermore, Brunauer-Emmett-Teller (BET) analysis indicated that the HSiSs have four times more surface area than silica spheres that have no pores. These aminated HSiSs were deposited onto a screen-printed carbon paste electrode containing a layer of gold nanoparticles (AuNPs) to form a AuNP/HSiS hybrid sensor membrane matrix. Aminated DNA probes were grafted onto the AuNP/HSiS-modified screen-printed electrode via imine covalent bonds with use of glutaraldehyde cross-linker. The DNA hybridization reaction was studied by differential pulse voltammetry using an anthraquinone redox intercalator as the electroactive DNA hybridization label. The DNA biosensor demonstrated a linear response over a wide target sequence concentration range of 1.0×10 -12 -1.0×10 -2 μM, with a low detection limit of 8.17×10 -14 μM (R 2 = 0.99). The improved performance of the DNA biosensor appeared to be due to the hollow structure and rough surface morphology of the hollow silica particles, which greatly increased the total binding surface area for high DNA loading capacity. The HSiSs also facilitated molecule diffusion through the silica hollow structure, and substantially improved the overall DNA hybridization assay. Graphical abstract Step-by-step DNA biosensor fabrication based on aminated hollow silica spheres.

  19. Hybridization chain reaction amplification for highly sensitive fluorescence detection of DNA with dextran coated microarrays.

    Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua


    Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Detection of mitochondrial DNA with the compact bead array sensor system (cBASS)

    Mulvaney, Shawn P.; Ibe, Carol N.; Caldwell, Jane M.; Levine, Jay F.; Whitman, Lloyd J.; Tamanaha, Cy R.


    Enteric pathogens are a significant contaminant in surface waters used for recreation, fish and shellfish harvesting, crop irrigation, and human consumption. The need for water monitoring becomes more pronounced when industrial, agricultural, and residential lands are found in close proximity. Fecal contamination is particularly problematic and identification of the pollution source essential to remediation efforts. Standard monitoring for fecal contamination relies on indicator organisms, but the technique is too broad to identify the source of contamination. Instead, real-time PCR of mitochondrial DNA (mtDNA) is an emerging method for identification of the contamination source. Presented herein, we evaluate an alternative technology, the compact Bead Array Sensor System (cBASS®) and its assay approach Fluidic Force Discrimination (FFD), for the detection of mtDNA. Previously, we achieved multiplexed, attomolar detection of toxins and femtomolar detection of nucleic acids in minutes with FFD assays. More importantly, FFD assays are compatible with a variety of complex matrices and therefore potentially applicable for samples where the matrix would interfere with PCR amplification. We have designed a triplex assay for the NADH gene found in human, swine, and bovine mtDNA and demonstrated the specific detection of human mtDNA spiked into a waste water sample.

  1. Fluorescence turn-on detection of target sequence DNA based on silicon nanodot-mediated quenching.

    Zhang, Yanan; Ning, Xinping; Mao, Guobin; Ji, Xinghu; He, Zhike


    We have developed a new enzyme-free method for target sequence DNA detection based on the dynamic quenching of fluorescent silicon nanodots (SiNDs) toward Cy5-tagged DNA probe. Fascinatingly, the water-soluble SiNDs can quench the fluorescence of cyanine (Cy5) in Cy5-tagged DNA probe in homogeneous solution, and the fluorescence of Cy5-tagged DNA probe can be restored in the presence of target sequence DNA (the synthetic target miRNA-27a). Based on this phenomenon, a SiND-featured fluorescent sensor has been constructed for "turn-on" detection of the synthetic target miRNA-27a for the first time. This newly developed approach possesses the merits of low cost, simple design, and convenient operation since no enzymatic reaction, toxic reagents, or separation procedures are involved. The established method achieves a detection limit of 0.16 nM, and the relative standard deviation of this method is 9% (1 nM, n = 5). The linear range is 0.5-20 nM, and the recoveries in spiked human fluids are in the range of 90-122%. This protocol provides a new tactic in the development of the nonenzymic miRNA biosensors and opens a promising avenue for early diagnosis of miRNA-associated disease. Graphical abstract The SiND-based fluorescent sensor for detection of S-miR-27a.


    Bambang Kuswandi


    Full Text Available An electrochemical method for the detection of the genotoxic compounds using a DNA-modified electrode was developed. This electrode was successfully used for the electrochemical detection of genotoxic compounds in water samples. The electrochemical results clearly demonstrated that, the development is related to the molecular interaction between the surface-linked DNA obtained from calf thymus and the target compounds, such as pollutants, in order to develop a simple device for rapid screening of genotoxic compounds in environmental samples. The detection of such compounds was measured by their effect on the oxidation signal of the guanine peak of the DNA immobilised on the surface of carbon based Screen-Printed Electrode (SPE in disposable mode, and monitored by square-wave voltametric analysis. The DNA biosensor is able to detect known intercalating and groove-binding genotoxic compounds such as Dioxin, Bisphenol A, PCBs, and Phtalates. Application to real water samples is discussed and reported.   Keywords: electrochemical, screen-printed electrode, DNA biosensor, genotoxic compounds

  3. Detection and analysis of human papillomavirus 16 and 18 homologous DNA sequences in oral lesions.

    Wen, S; Tsuji, T; Li, X; Mizugaki, Y; Hayatsu, Y; Shinozaki, F


    The prevalence of human papillomavirus (HPV) 16 and 18 was investigated in oral lesions of the population of northeast China including squamous cell carcinomas (SCCs), candida leukoplakias, lichen planuses and papillomas, by southern blot hybridization with polymerase chain reaction (PCR). Amplified HPV16 and 18 E6 DNA was analyzed by cycle sequence. HPV DNA was detected in 14 of 45 SCCs (31.1%). HPV18 E6 DNA and HPV16 E6. DNA were detected in 24.4% and 20.0% of SCCs. respectively. Dual infection of both HPV 16 and HPV 18 was detected in 6 of 45 SCCs (13.3%), but not in other oral lesions. HPV 18 E6 DNA was also detected in 2 of 3 oral candida leukoplakias, but in none of the 5 papillomas. Our study indicated that HPV 18 infection might be more frequent than HPV 16 infection in oral SCCs in northeast Chinese, dual infection of high risk HPV types was restricted in oral SCCs, and that HPV infection might be involved in the pathogenesis of oral candida leukoplakia.

  4. DNA extraction methods for panbacterial and panfungal PCR detection in intraocular fluids.

    Mazoteras, Paloma; Bispo, Paulo José Martins; Höfling-Lima, Ana Luisa; Casaroli-Marano, Ricardo P


    Three different methods of DNA extraction from intraocular fluids were compared with subsequent detection for bacterial and fungal DNA by universal PCR amplification. Three DNA extraction methods, from aqueous and vitreous humors, were evaluated to compare their relative efficiency. Bacterial (Gram positive and negative) and fungal strains were used in this study: Escherichia coli, Staphylococcus epidermidis and Candida albicans. The quality, quantification, and detection limit for DNA extraction and PCR amplification were analyzed. Validation procedures for 13 aqueous humor and 14 vitreous samples, from 20 patients with clinically suspected endophthalmitis were carried out. The column-based extraction method was the most time-effective, achieving DNA detection limits ≥10(2) and 10(3 )CFU/100 µL for bacteria and fungi, respectively. PCR amplification detected 100 fg, 1 pg and 10 pg of genomic DNA of E. coli, S. epidermidis and C. albicans respectively. PCR detected 90.0% of the causative agents from 27 intraocular samples collected from 20 patients with clinically suspected endophthalmitis, while standard microbiological techniques could detect only 60.0%. The most frequently found organisms were Streptococcus spp. in 38.9% (n = 7) of patients and Staphylococcus spp. found in 22.2% (n = 4). The column-based extraction method for very small inocula in small volume samples (50-100 µL) of aqueous and/or vitreous humors allowed PCR amplification in all samples with sufficient quality for subsequent sequencing and identification of the microorganism in the majority of them.

  5. Thermodynamic framework to assess low abundance DNA mutation detection by hybridization

    Willems, Hanny; Jacobs, An; Hadiwikarta, Wahyu Wijaya; Venken, Tom; Valkenborg, Dirk; Van Roy, Nadine; Vandesompele, Jo; Hooyberghs, Jef


    The knowledge of genomic DNA variations in patient samples has a high and increasing value for human diagnostics in its broadest sense. Although many methods and sensors to detect or quantify these variations are available or under development, the number of underlying physico-chemical detection principles is limited. One of these principles is the hybridization of sample target DNA versus nucleic acid probes. We introduce a novel thermodynamics approach and develop a framework to exploit the specific detection capabilities of nucleic acid hybridization, using generic principles applicable to any platform. As a case study, we detect point mutations in the KRAS oncogene on a microarray platform. For the given platform and hybridization conditions, we demonstrate the multiplex detection capability of hybridization and assess the detection limit using thermodynamic considerations; DNA containing point mutations in a background of wild type sequences can be identified down to at least 1% relative concentration. In order to show the clinical relevance, the detection capabilities are confirmed on challenging formalin-fixed paraffin-embedded clinical tumor samples. This enzyme-free detection framework contains the accuracy and efficiency to screen for hundreds of mutations in a single run with many potential applications in molecular diagnostics and the field of personalised medicine. PMID:28542229

  6. DNA extraction methods for detecting genetically modified foods: A comparative study.

    Elsanhoty, Rafaat M; Ramadan, Mohamed Fawzy; Jany, Klaus Dieter


    The work presented in this manuscript was achieved to compare six different methods for extracting DNA from raw maize and its derived products. The methods that gave higher yield and quality of DNA were chosen to detect the genetic modification in the samples collected from the Egyptian market. The different methods used were evaluated for extracting DNA from maize kernels (without treatment), maize flour (mechanical treatment), canned maize (sweet corn), frozen maize (sweet corn), maize starch, extruded maize, popcorn, corn flacks, maize snacks, and bread made from corn flour (mechanical and thermal treatments). The quality and quantity of the DNA extracted from the standards, containing known percentages of GMO material and from the different food products were evaluated. For qualitative detection of the GMO varieties in foods, the GMOScreen 35S/NOS test kit was used, to screen the genetic modification in the samples. The positive samples for the 35S promoter and/or the NOS terminator were identified by the standard methods adopted by EU. All of the used methods extracted yielded good DNA quality. However, we noted that the purest DNA extract were obtained using the DNA extraction kit (Roche) and this generally was the best method for extracting DNA from most of the maize-derived foods. We have noted that the yield of DNA extracted from maize-derived foods was generally lower in the processed products. The results indicated that 17 samples were positive for the presence of 35S promoter, while 34% from the samples were positive for the genetically modified maize line Bt-176. Copyright © 2010 Elsevier Ltd. All rights reserved.

  7. Computational optimisation of targeted DNA sequencing for cancer detection

    Martinez, Pierre; McGranahan, Nicholas; Birkbak, Nicolai Juul


    Despite recent progress thanks to next-generation sequencing technologies, personalised cancer medicine is still hampered by intra-tumour heterogeneity and drug resistance. As most patients with advanced metastatic disease face poor survival, there is need to improve early diagnosis. Analysing...... detection. Dividing 4,467 samples into one discovery and two independent validation cohorts, we show that up to 76% of 10 cancer types harbour at least one mutation in a panel of only 25 genes, with high sensitivity across most tumour types. Our analyses demonstrate that targeting "hotspot" regions would...

  8. Detection of DNA via the fluorescence quenching of Mn-doped ZnSe D-dots/doxorubicin/DNA ternary complexes system.

    Gao, Xue; Niu, Lu; Su, Xingguang


    This manuscript reports a method for the detection of double-stranded DNA, based on Mn:ZnSe d-dots and intercalating agent doxorubicin (DOX). DOX can quench the photoluminescence (PL) of Mn:ZnSe d-dots through photoinduced electron transfer process, after binding with Mn:ZnSe d-dots. The addition of DNA can result in the formation of the Mn:ZnSe d-dots-DOX-DNA ternary complexes, the fluorescence of the Mn:ZnSe d-dots-DOX complexes would be further quenched by the addition of DNA, thus allowing the detection of DNA. The formation mechanism of the Mn:ZnSe d-dots-DOX-DNA ternary complexes was studied in detail in this paper. Under optimal conditions, the quenched fluorescence intensity of Mn:ZnSe d-dots-DOX system are perfectly described by Stern-Volmer equation with the concentration of hsDNA ranging from 0.006 μg mL(-1) to 6.4 μg mL(-1). The detection limit (S/N = 3) for hsDNA is 0.5 ng mL(-1). The proposed method was successfully applied to the detection of DNA in synthetic samples and the results were satisfactory.

  9. Detection of tyrosine hydroxylase in dopaminergic neuron cell using gold nanoparticles-based barcode DNA.

    An, Jeung Hee; Oh, Byung-Keun; Choi, Jeong Woo


    Tyrosine hydroxylase, the rate-limiting enzyme of catecholamine biosysthesis, is predominantly expressed in several cell groups within the brain, including the dopaminergic neurons of the substantia nigra and ventral tegmental area. We evaluated the efficacy of this protein-detection method in detecting tyrosine hydroxylase in normal and oxidative stress damaged dopaminergic cells. In this study, a coupling of DNA barcode and bead-based immnunoassay for detecting tyrosine hydroxylaser with PCR-like sensitivity is reported. The method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated to remove the conjugated barcode DNA. The DNA barcodes were identified by PCR analysis. The concentration of tyrosine hydroxylase in dopaminergic cell can be easily and rapidly detected using bio-barcode assay. The bio-barcode assay is a rapid and high-throughput screening tool to detect of neurotransmitter such as dopamine.

  10. Fluorescence bio-barcode DNA assay based on gold and magnetic nanoparticles for detection of Exotoxin A gene sequence.

    Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh


    Bio-barcode DNA based on gold nanoparticle (bDNA-GNPs) as a new generation of biosensor based detection tools, holds promise for biological science studies. They are of enormous importance in the emergence of rapid and sensitive procedures for detecting toxins of microorganisms. Exotoxin A (ETA) is the most toxic virulence factor of Pseudomonas aeruginosa. ETA has ADP-ribosylation activity and decisively affects the protein synthesis of the host cells. In the present study, we developed a fluorescence bio-barcode technology to trace P. aeruginosa ETA. The GNPs were coated with the first target-specific DNA probe 1 (1pDNA) and bio-barcode DNA, which acted as a signal reporter. The magnetic nanoparticles (MNPs) were coated with the second target-specific DNA probe 2 (2pDNA) that was able to recognize the other end of the target DNA. After binding the nanoparticles with the target DNA, the following sandwich structure was formed: MNP 2pDNA/tDNA/1pDNA-GNP-bDNA. After isolating the sandwiches by a magnetic field, the DNAs of the probes which have been hybridized to their complementary DNA, GNPs and MNPs, via the hydrogen, electrostatic and covalently bonds, were released from the sandwiches after dissolving in dithiothreitol solution (DTT 0.8M). This bio-barcode DNA with known DNA sequence was then detected by fluorescence spectrophotometry. The findings showed that the new method has the advantages of fast, high sensitivity (the detection limit was 1.2ng/ml), good selectivity, and wide linear range of 5-200ng/ml. The regression analysis also showed that there was a good linear relationship (∆F=0.57 [target DNA]+21.31, R 2 =0.9984) between the fluorescent intensity and the target DNA concentration in the samples. Copyright © 2016. Published by Elsevier B.V.

  11. One-pot synthesis of strongly fluorescent DNA-CuInS2 quantum dots for label-free and ultrasensitive detection of anthrax lethal factor DNA

    Liu, Ziping; Su, Xingguang


    Herein, high quality DNA-CuInS 2 QDs are facilely synthesized through a one-pot hydrothermal method with fluorescence quantum yield as high as 23.4%, and the strongly fluorescent DNA-CuInS 2 QDs have been utilized as a novel fluorescent biosensor for label-free and ultrasensitive detection of anthrax lethal factor DNA. L-Cysteine (L-Cys) and a specific-sequence DNA are used as co-ligands to stabilize the CuInS 2 QDs. The specific-sequence DNA consists of two domains: phosphorothiolates domain (sulfur-containing variants of the usual phosphodiester backbone) controls the nanocrystal passivation and serves as a ligand, and the functional domain (non-phosphorothioates) controls the biorecognition. The as-prepared DNA-CuInS 2 QDs have high stability, good water-solubility and low toxicity. Under the optimized conditions, a linear correlation was established between the fluorescence intensity ratio I/I 0 (I 0 is the original fluorescence intensity of DNA-CuInS 2 QDs, and I is the fluorescence intensity of DNA-CuInS 2 QDs/GO with the addition of various concentrations of anthrax lethal factor DNA) and the concentration of anthrax lethal factor DNA in the range of 0.029–0.733 nmol L −1 with a detection limit of 0.013 nmol L −1 . The proposed method has been successfully applied to the determination of anthrax lethal factor DNA sequence in human serum samples with satisfactory results. Because of low toxicity and fine biocompatibility, DNA-CuInS 2 QDs also hold potential applications in bioimaging. - Highlights: • Strongly fluorescent DNA-QDs were successfully prepared by a one-pot hydrothermal method with quantum yield up to 23.4%. • A biosensor for label-free detection of anthrax lethal factor DNA was established based on the as-prepared DNA-QDs. • The DNA sensor took advantage of the feature that ssDNA binds to GO with significantly higher affinity than dsDNA. • Good sensitivity and selectivity were obtained. • This method was utilized to detect

  12. One-pot synthesis of strongly fluorescent DNA-CuInS{sub 2} quantum dots for label-free and ultrasensitive detection of anthrax lethal factor DNA

    Liu, Ziping; Su, Xingguang, E-mail:


    Herein, high quality DNA-CuInS{sub 2} QDs are facilely synthesized through a one-pot hydrothermal method with fluorescence quantum yield as high as 23.4%, and the strongly fluorescent DNA-CuInS{sub 2} QDs have been utilized as a novel fluorescent biosensor for label-free and ultrasensitive detection of anthrax lethal factor DNA. L-Cysteine (L-Cys) and a specific-sequence DNA are used as co-ligands to stabilize the CuInS{sub 2} QDs. The specific-sequence DNA consists of two domains: phosphorothiolates domain (sulfur-containing variants of the usual phosphodiester backbone) controls the nanocrystal passivation and serves as a ligand, and the functional domain (non-phosphorothioates) controls the biorecognition. The as-prepared DNA-CuInS{sub 2} QDs have high stability, good water-solubility and low toxicity. Under the optimized conditions, a linear correlation was established between the fluorescence intensity ratio I/I{sub 0} (I{sub 0} is the original fluorescence intensity of DNA-CuInS{sub 2} QDs, and I is the fluorescence intensity of DNA-CuInS{sub 2} QDs/GO with the addition of various concentrations of anthrax lethal factor DNA) and the concentration of anthrax lethal factor DNA in the range of 0.029–0.733 nmol L{sup −1} with a detection limit of 0.013 nmol L{sup −1}. The proposed method has been successfully applied to the determination of anthrax lethal factor DNA sequence in human serum samples with satisfactory results. Because of low toxicity and fine biocompatibility, DNA-CuInS{sub 2} QDs also hold potential applications in bioimaging. - Highlights: • Strongly fluorescent DNA-QDs were successfully prepared by a one-pot hydrothermal method with quantum yield up to 23.4%. • A biosensor for label-free detection of anthrax lethal factor DNA was established based on the as-prepared DNA-QDs. • The DNA sensor took advantage of the feature that ssDNA binds to GO with significantly higher affinity than dsDNA. • Good sensitivity and selectivity were

  13. DNA detection in tooth exposed to different temperatures: An in vitro study

    Rama Raju Devaraju


    Full Text Available Introduction: Human identification is an important field of study and research in forensic science and aims at establishing human identity. Several biological materials such as bone, hair, a biopsy sample, saliva and blood have been employed in isolation of DNA for human identification. It is possible to obtain DNA from virtually all human body tissues with variations in the quantity and quality of the DNA extracted from each tissue. Aims and Objectives: A study was carried out in our department to detect the presence of DNA from burnt teeth samples at various temperatures and to highlight the importance of DNA obtained from tooth in identifying a deceased in fire accidents. Materials and Methods: The work included 13 extracted teeth of patients who were indicated for therapeutic extraction and those who were diagnosed clinically and radiographically with caries and periodontitis who were indicated for extraction. Out of the 13 extracted teeth, two were decayed (One had class I dental caries C 1 and the other was grossly decayed C 2 , four were periodontally compromised teeth and the other seven were therapeutically extracted. The freshly extracted teeth were immediately subjected to varying temperatures, from 100°C to 800°C using a Delta burnout furnace for 15-20 minutes. They were cryogenically crushed using a mortar and pestle to make samples of the tooth, which were analysed for DNA. Results: When teeth were incinerated from 100°C-800°C, genomic DNA was obtained only between 100°C and 300°C whereas it was not obtained above this temperature. When the teeth were incinerated from 300°C to 800°C mtDNA was extracted from 300°C to 700°C, but no DNA was obtained above 700°C. Conclusion: Teeth are good sources for DNA, even in cases where the specimens are highly decomposed.

  14. Detection of Merkel Cell Polyomavirus DNA in Serum Samples of Healthy Blood Donors

    Mazzoni, Elisa; Rotondo, John C.; Marracino, Luisa; Selvatici, Rita; Bononi, Ilaria; Torreggiani, Elena; Touzé, Antoine; Martini, Fernanda; Tognon, Mauro G.


    Merkel cell polyomavirus (MCPyV) has been detected in 80% of Merkel cell carcinomas (MCC). In the host, the MCPyV reservoir remains elusive. MCPyV DNA sequences were revealed in blood donor buffy coats. In this study, MCPyV DNA sequences were investigated in the sera (n = 190) of healthy blood donors. Two MCPyV DNA sequences, coding for the viral oncoprotein large T antigen (LT), were investigated using polymerase chain reaction (PCR) methods and DNA sequencing. Circulating MCPyV sequences were detected in sera with a prevalence of 2.6% (5/190), at low-DNA viral load, which is in the range of 1–4 and 1–5 copies/μl by real-time PCR and droplet digital PCR, respectively. DNA sequencing carried out in the five MCPyV-positive samples indicated that the two MCPyV LT sequences which were analyzed belong to the MKL-1 strain. Circulating MCPyV LT sequences are present in blood donor sera. MCPyV-positive samples from blood donors could represent a potential vehicle for MCPyV infection in receivers, whereas an increase in viral load may occur with multiple blood transfusions. In certain patient conditions, such as immune-depression/suppression, additional disease or old age, transfusion of MCPyV-positive samples could be an additional risk factor for MCC onset. PMID:29238698

  15. Evaluation of Global Genomic DNA Methylation in Human Whole Blood by Capillary Electrophoresis UV Detection

    Angelo Zinellu


    Full Text Available Alterations in global DNA methylation are implicated in various pathophysiological processes. The development of simple and quick, yet robust, methods to assess DNA methylation is required to facilitate its measurement and interpretation in clinical practice. We describe a highly sensitive and reproducible capillary electrophoresis method with UV detection for the separation and detection of cytosine and methylcytosine, after formic acid hydrolysis of DNA extracted from human whole blood. Hydrolysed samples were dried and resuspended with water and directly injected into the capillary without sample derivatization procedures. The use of a run buffer containing 50 mmol/L BIS-TRIS propane (BTP phosphate buffer at pH 3.25 and 60 mmol/L sodium acetate buffer at pH 3.60 (4 : 1, v/v allowed full analyte identification within 11 min. Precision tests indicated an elevated reproducibility with an interassay CV of 1.98% when starting from 2 μg of the extracted DNA. The method was successfully tested by measuring the DNA methylation degree both in healthy volunteers and in reference calf thymus DNA.

  16. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay

    Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen


    Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility. PMID:26544710

  17. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

    Yong Huang

    Full Text Available Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus and PCV2 (DNA virus from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29% and TGEV (11.7% preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

  18. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

    Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen


    Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

  19. New Concepts of Fluorescent Probes for Specific Detection of DNA Sequences: Bis-Modified Oligonucleotides in Excimer and Exciplex Detection

    Gbaj A


    Full Text Available The detection of single base mismatches in DNA is important for diagnostics, treatment of genetic diseases, and identification of single nucleotide polymorphisms. Highly sensitive, specific assays are needed to investigate genetic samples from patients. The use of a simple fluorescent nucleoside analogue in detection of DNA sequence and point mutations by hybridisation in solution is described in this study. The 5’-bispyrene and 3’-naphthalene oligonucleotide probes form an exciplex on hybridisation to target in water and the 5’-bispyrene oligonucleotide alone is an adequate probe to determine concentration of target present. It was also indicated that this system has a potential to identify mismatches and insertions. The aim of this work was to investigate experimental structures and conditions that permit strong exciplex emission for nucleic acid detectors, and show how such exciplexes can register the presence of mismatches as required in SNP analysis. This study revealed that the hybridisation of 5'-bispyrenyl fluorophore to a DNA target results in formation of a fluorescent probe with high signal intensity change and specificity for detecting a complementary target in a homogeneous system. Detection of SNP mutations using this split-probe system is a highly specific, simple, and accessible method to meet the rigorous requirements of pharmacogenomic studies. Thus, it is possible for the system to act as SNP detectors and it shows promise for future applications in genetic testing.

  20. New concepts of fluorescent probes for specific detection of DNA sequences: bis-modified oligonucleotides in excimer and exciplex detection.

    Gbaj, A; Bichenkova, Ev; Walsh, L; Savage, He; Sardarian, Ar; Etchells, Ll; Gulati, A; Hawisa, S; Douglas, Kt


    The detection of single base mismatches in DNA is important for diagnostics, treatment of genetic diseases, and identification of single nucleotide polymorphisms. Highly sensitive, specific assays are needed to investigate genetic samples from patients. The use of a simple fluorescent nucleoside analogue in detection of DNA sequence and point mutations by hybridisation in solution is described in this study. The 5'-bispyrene and 3'-naphthalene oligonucleotide probes form an exciplex on hybridisation to target in water and the 5'-bispyrene oligonucleotide alone is an adequate probe to determine concentration of target present. It was also indicated that this system has a potential to identify mismatches and insertions. The aim of this work was to investigate experimental structures and conditions that permit strong exciplex emission for nucleic acid detectors, and show how such exciplexes can register the presence of mismatches as required in SNP analysis. This study revealed that the hybridisation of 5'-bispyrenyl fluorophore to a DNA target results in formation of a fluorescent probe with high signal intensity change and specificity for detecting a complementary target in a homogeneous system. Detection of SNP mutations using this split-probe system is a highly specific, simple, and accessible method to meet the rigorous requirements of pharmacogenomic studies. Thus, it is possible for the system to act as SNP detectors and it shows promise for future applications in genetic testing.

  1. Attomolar detection of proteins via cascade strand-displacement amplification and polystyrene nanoparticle enhancement in fluorescence polarization aptasensors.

    Huang, Yong; Liu, Xiaoqian; Huang, Huakui; Qin, Jian; Zhang, Liangliang; Zhao, Shulin; Chen, Zhen-Feng; Liang, Hong


    Extremely sensitive and accurate measurements of protein markers for early detection and monitoring of diseases pose a formidable challenge. Herein, we develop a new type of amplified fluorescence polarization (FP) aptasensor based on allostery-triggered cascade strand-displacement amplification (CSDA) and polystyrene nanoparticle (PS NP) enhancement for ultrasensitive detection of proteins. The assay system consists of a fluorescent dye-labeled aptamer hairpin probe and a PS NP-modified DNA duplex (assistant DNA/trigger DNA duplex) probe with a single-stranded part and DNA polymerase. Two probes coexist stably in the absence of target, and the dye exhibits relatively low FP background. Upon recognition and binding with a target protein, the stem of the aptamer hairpin probe is opened, after which the opened hairpin probe hybridizes with the single-stranded part in the PS NP-modified DNA duplex probe and triggers the CSDA reaction through the polymerase-catalyzed recycling of both target protein and trigger DNA. Throughout this CSDA process, numerous massive dyes are assembled onto PS NPs, which results in a substantial FP increase that provides a readout signal for the amplified sensing process. Our newly proposed amplified FP aptasensor enables the quantitative measurement of proteins with the detection limit in attomolar range, which is about 6 orders of magnitude lower than that of traditional homogeneous aptasensors. Moreover, this sensing method also exhibits high specificity for target proteins and can be performed in homogeneous solutions. In addition, the suitability of this method for the quantification of target protein in biological samples has also been shown. Considering these distinct advantages, the proposed sensing method can be expected to provide an ultrasensitive platform for the analysis of various types of target molecules.

  2. Detection of anthrax lef with DNA-based photonic crystal sensors

    Zhang, Bailin; Dallo, Shatha; Peterson, Ralph; Hussain, Syed; Weitao, Tao; Ye, Jing Yong


    Bacillus anthracis has posed a threat of becoming biological weapons of mass destruction due to its virulence factors encoded by the plasmid-borne genes, such as lef for lethal factor. We report the development of a fast and sensitive anthrax DNA biosensor based on a photonic crystal structure used in a total-internal-reflection configuration. For the detection of the lef gene, a single-stranded DNA lef probe was biotinylated and immobilized onto the sensor via biotin-streptavidin interactions. A positive control, lef-com, was the complementary strand of the probe, while a negative control was an unrelated single-stranded DNA fragment from the 16S rRNA gene of Acinetobacter baumannii. After addition of the biotinylated lef probe onto the sensor, significant changes in the resonance wavelength of the sensor were observed, resulting from binding of the probe to streptavidin on the sensor. The addition of lef-com led to another significant increase as a result of hybridization between the two DNA strands. The detection sensitivity for the target DNA reached as low as 0.1 nM. In contrast, adding the unrelated DNAs did not cause an obvious shift in the resonant wavelength. These results demonstrate that detection of the anthrax lef by the photonic crystal structure in a total-internal-reflection sensor is highly specific and sensitive.

  3. Phosphorescent quantum dots/ethidium bromide nanohybrids based on photoinduced electron transfer for DNA detection.

    Bi, Lin; Yu, Yuan-Hua


    Mercaptopropionic acid-capped Mn-doped ZnS quantum dots/ethidium bromide (EB) nanohybrids were constructed for photoinduced electron transfer (PIET) and then used as a room-temperature phosphorescence (RTP) probe for DNA detection. EB could quench the RTP of Mn-doped ZnS QDs by PIET, thereby forming Mn-doped ZnS QDs/EB nanohybrids and storing RTP. Meanwhile, EB could be inserted into DNA and EB could be competitively desorbed from the surface of Mn-doped ZnS QDs by DNA, thereby releasing the RTP of Mn-doped ZnS QDs. Based on this mechanism, a RTP sensor for DNA detection was developed. Under optimal conditions, the detection limit for DNA was 0.045 mg L(-1), the relative standard deviation was 1.7%, and the method linear ranged from 0.2 to 20 mg L(-1). The proposed method was applied to biological fluids, in which satisfactory results were obtained. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Detection of DNA and poly-l-lysine using CVD graphene-channel FET biosensors

    Kakatkar, Aniket; Craighead, H G; Abhilash, T S; Alba, R De; Parpia, J M


    A graphene channel field-effect biosensor is demonstrated for detecting the binding of double-stranded DNA and poly-l-lysine. Sensors consist of chemical vapor deposition graphene transferred using a clean, etchant-free transfer method. The presence of DNA and poly-l-lysine are detected by the conductance change of the graphene transistor. A readily measured shift in the Dirac voltage (the voltage at which the graphene’s resistance peaks) is observed after the graphene channel is exposed to solutions containing DNA or poly-l-lysine. The ‘Dirac voltage shift’ is attributed to the binding/unbinding of charged molecules on the graphene surface. The polarity of the response changes to positive direction with poly-l-lysine and negative direction with DNA. This response results in detection limits of 8 pM for 48.5 kbp DNA and 11 pM for poly-l-lysine. The biosensors are easy to fabricate, reusable and are promising as sensors of a wide variety of charged biomolecules. (paper)

  5. Graphene electrode modified with electrochemically reduced graphene oxide for label-free DNA detection.

    Li, Bing; Pan, Genhua; Avent, Neil D; Lowry, Roy B; Madgett, Tracey E; Waines, Paul L


    A novel printed graphene electrode modified with electrochemically reduced graphene oxide was developed for the detection of a specific oligonucleotide sequence. The graphene oxide was immobilized onto the surface of a graphene electrode via π-π bonds and electrochemical reduction of graphene oxide was achieved by cyclic voltammetry. A much higher redox current was observed from the reduced graphene oxide-graphene double-layer electrode, a 42% and 36.7% increase, respectively, in comparison with that of a bare printed graphene or reduced graphene oxide electrode. The good electron transfer activity is attributed to a combination of the large number of electroactive sites in reduced graphene oxide and the high conductivity nature of graphene. The probe ssDNA was further immobilized onto the surface of the reduced graphene oxide-graphene double-layer electrode via π-π bonds and then hybridized with its target cDNA. The change of peak current due to the hybridized dsDNA could be used for quantitative sensing of DNA concentration. It has been demonstrated that a linear range from 10(-7)M to 10(-12)M is achievable for the detection of human immunodeficiency virus 1 gene with a detection limit of 1.58 × 10(-13)M as determined by three times standard deviation of zero DNA concentration. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. DNA of Dientamoeba fragilis detected within surface-sterilized eggs of Enterobius vermicularis.

    Röser, Dennis; Nejsum, Peter; Carlsgart, Anne Josefine; Nielsen, Henrik Vedel; Stensvold, Christen Rune


    With no evidence of a cyst stage, the mode of transmission of Dientamoeba fragilis, an intestinal protozoon of common occurrence and suggested pathogenicity, is incompletely known. Numerous studies have suggested that eggs of intestinal nematodes, primarily Enterobius vermicularis (pinworm), can serve as vectors for D. fragilis, although attempts to culture D. fragilis from pinworm eggs have been unsuccessful and data from epidemiological studies on D. fragilis/pinworm co-infection have been conflicting. The aim of this study was to investigate whether we could detect D. fragilis DNA from pinworm eggs collected from routine diagnostic samples (cellophane tape) and surface-sterilised by hypochlorite. DNA was extracted from individual eggs and tested by PCR using D. fragilis- and E. vermicularis-specific primers; amplicons were sequenced for confirmation. In cellophane tape samples from 64 patients with unknown D. fragilis status we detected D. fragilis DNA in 12/238 (5%) eggs, and in a patient known to harbour D. fragilis we detected D. fragilis DNA in 39/99 (39%) eggs. The finding of D. fragilis DNA within eggs of E. vermicularis strongly supports the hypothesis of D. fragilis-transmission by pinworm and has implications for antimicrobial intervention as well as control and public health measures. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Integrating prior knowledge in multiple testing under dependence with applications to detecting differential DNA methylation.

    Kuan, Pei Fen; Chiang, Derek Y


    DNA methylation has emerged as an important hallmark of epigenetics. Numerous platforms including tiling arrays and next generation sequencing, and experimental protocols are available for profiling DNA methylation. Similar to other tiling array data, DNA methylation data shares the characteristics of inherent correlation structure among nearby probes. However, unlike gene expression or protein DNA binding data, the varying CpG density which gives rise to CpG island, shore and shelf definition provides exogenous information in detecting differential methylation. This article aims to introduce a robust testing and probe ranking procedure based on a nonhomogeneous hidden Markov model that incorporates the above-mentioned features for detecting differential methylation. We revisit the seminal work of Sun and Cai (2009, Journal of the Royal Statistical Society: Series B (Statistical Methodology)71, 393-424) and propose modeling the nonnull using a nonparametric symmetric distribution in two-sided hypothesis testing. We show that this model improves probe ranking and is robust to model misspecification based on extensive simulation studies. We further illustrate that our proposed framework achieves good operating characteristics as compared to commonly used methods in real DNA methylation data that aims to detect differential methylation sites. © 2012, The International Biometric Society.

  8. Templated Chemistry for Sequence-Specific Fluorogenic Detection of Duplex DNA

    Li, Hao; Franzini, Raphael M.; Bruner, Christopher; Kool, Eric T.


    We describe the development of templated fluorogenic chemistry for detection of specific sequences of duplex DNA in solution. In this approach, two modified homopyrimidine oligodeoxynucleotide probes are designed to bind by triple helix formation at adjacent positions on a specific purine-rich target sequence of duplex DNA. One fluorescein-labeled probe contains an α-azidoether linker to a fluorescence quencher; the second (trigger) probe carries a triarylphosphine, designed to reduce the azide and cleave the linker. The data showed that at pH 5.6 these probes yielded a strong fluorescence signal within minutes on addition to a complementary homopurine duplex DNA target. The signal increased by a factor of ca. 60, and was completely dependent on the presence of the target DNA. Replacement of cytosine in the probes with pseudoisocytosine allowed the templated chemistry to proceed readily at pH 7. Single nucleotide mismatches in the target oligonucleotide slowed the templated reaction considerably, demonstrating high sequence selectivity. The use of templated fluorogenic chemistry for detection of duplex DNAs has not been previously reported and may allow detection of double stranded DNA, at least for homopurine-homopyrimidine target sites, under native, non-disturbing conditions. PMID:20859985

  9. Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus

    Honorato Castro, Ana C.; França, Erick G.; Paula, Lucas F. de; Soares, Marcia M.C.N.; Goulart, Luiz R.; Madurro, João M.; Brito-Madurro, Ana G.


    Graphical abstract: - Highlights: • Specific oligonucleotide detection for hepatitis B based on poly-4-aminophenol matrix. • Electrochemical detection of the gene specific using ethidium bromide as indicator. • The detection limit was 2.61 nmol L −1 , with a correlation coefficient of 0.998 (n = 3). • The system discriminates three-base mismatches and non-complementary target. - Abstract: An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L −1 . Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy

  10. Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus

    Honorato Castro, Ana C.; França, Erick G. [Institute of Genetics and Biochemistry, Federal University of Uberlândia, Uberlândia (Brazil); Paula, Lucas F. de [Institute of Chemistry, Federal University of Uberlândia, Uberlândia (Brazil); Soares, Marcia M.C.N. [Adolfo Lutz Institute, Regional Laboratory in São José do Rio Preto (Brazil); Goulart, Luiz R. [Institute of Genetics and Biochemistry, Federal University of Uberlândia, Uberlândia (Brazil); Madurro, João M. [Institute of Chemistry, Federal University of Uberlândia, Uberlândia (Brazil); Brito-Madurro, Ana G., E-mail: [Institute of Genetics and Biochemistry, Federal University of Uberlândia, Uberlândia (Brazil)


    Graphical abstract: - Highlights: • Specific oligonucleotide detection for hepatitis B based on poly-4-aminophenol matrix. • Electrochemical detection of the gene specific using ethidium bromide as indicator. • The detection limit was 2.61 nmol L{sup −1}, with a correlation coefficient of 0.998 (n = 3). • The system discriminates three-base mismatches and non-complementary target. - Abstract: An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L{sup −1}. Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy.

  11. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction.

    Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid


    Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  12. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

    Samira Mohammadi


    Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  13. Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

    Zhang, Zhao; Birkedal, Victoria; Gothelf, Kurt Vesterager


    The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, w...... G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection......., which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split...

  14. Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

    Zhang, Z.; Birkedal, V.; Gothelf, K. V.


    The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection.

  15. Ratiometric FRET-based detection of DNA and micro-RNA in solution

    Matveeva, Evgenia G.; Gryczynski, Zygmunt; Stewart, Donald R.; Gryczynski, Ignacy


    A ratiometric method for detecting DNA oligomers in bulk solution based on Foerster resonance energy transfer (FRET) is described. The two fluorescence signals (green and red), originating from Cy3 (donor, green) and Cy5 (acceptor, red) labels, are simultaneously detected from the pre-hybridized Cy3oligomerY:Cy5oligomerX system. The ratio of red to green intensities is sensitive to the presence of the single-stranded complimentary oligomer, which replaces single-stranded Cy3oligomerY in the donor:acceptor complex and perturbs the FRET. The detection scheme is generally applicable to the detection of DNA and RNA, and particularly micro-RNA. The proposed method is applicable to various double-stranded various lengths targets (manipulation of the sample preparation conditions, such as temperature, incubation time, denaturizing agent, may be needed).

  16. Immunological detection and quantification of DNA components structurally modified by alkylating carcinogens, mutagens and chemotherapeutic agents

    Rajewsky, M.F.


    The detection and quantification of defined reaction products of chemical mutagens and carcinogens (and of many cancer chemotherapeutic agents) with DNA require highly sensitive analytical techniques. The exceptional capability of immunoglobulins to recognize subtle alterations of molecular structure (especially when monoclonal antibodies are used to maximize specificity), outstanding sensitivity of immunoanalysis by high-affinity antibodies, and the fact that radioactively-labelled agents are not required suggest the utility of a radioimmunoassay to recognize and quantitate alkylated DNA products. We have recently developed a set of high-affinity monoclonal antibodies (secreted by mouse x mouse as well as by rat x rat hybridomas; antibody affinity constants, 10 9 to > 10 10 lmol) specifically directed against several DNA alkylation products with possible relevance in relation to both mutagenesis and malignant transformation of mammalian cells. These alkylation products include 0 6 -N-butyldeoxyguanosine, and 0 4 -ethyldeoxythymidine. When used in a radioimmunassay, an antibody specific for 0 6 -ethyldeoxyguanosine, for example, will detect this product at an 0 6 -ethyldeoxyguanosine/deoxyguanosine molar ratio of approx. 3 x 10 -7 in a hydrolysate of 100 ug of DNA. The limit of detection can be lowered further if the respective alkyldeoxynucleosides are separated by HPLC from the DNA hydrolysate prior to the RIA. The anti-alkyldeoxynucleoside monoclonal antibodies can also be used to visualize, by immunostaining and fluorescence microscopy combined with electronic image intensification, specific alkylation products in the nuclear DNA of individual cells, and to localize structurally modified bases in double-stranded DNA molecules by transmission electron microscopy

  17. Non-invasive aneuploidy detection using free fetal DNA and RNA in maternal plasma: recent progress and future possibilities.

    Go, A.T.; Vugt, J.M.G. van; Oudejans, C.B.


    BACKGROUND: Cell-free fetal DNA (cff DNA) and RNA can be detected in maternal plasma and used for non-invasive prenatal diagnostics. Recent technical advances have led to a drastic change in the clinical applicability and potential uses of free fetal DNA and RNA. This review summarizes the latest

  18. One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

    Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu


    A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

  19. Advanced DNA-Based Point-of-Care Diagnostic Methods for Plant Diseases Detection

    Lau, Han Yih; Botella, Jose R.


    Diagnostic technologies for the detection of plant pathogens with point-of-care capability and high multiplexing ability are an essential tool in the fight to reduce the large agricultural production losses caused by plant diseases. The main desirable characteristics for such diagnostic assays are high specificity, sensitivity, reproducibility, quickness, cost efficiency and high-throughput multiplex detection capability. This article describes and discusses various DNA-based point-of care di...

  20. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

    Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir


    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10(-9) M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  1. Development of a Fluorescence Resonance Energy Transfer (FRET-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense

    Noremylia Mohd Bakhori


    Full Text Available An optical DNA biosensor based on fluorescence resonance energy transfer (FRET utilizing synthesized quantum dot (QD has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  2. An environmental DNA assay for detecting Arctic grayling in the upper Missouri River basin, North America

    K. J. Carim; J. C. S. Dysthe; Michael Young; Kevin McKelvey; Michael Schwartz


    The upper Missouri River basin in the northwestern US contains disjunct Arctic grayling (Thymallus arcticus) populations of conservation concern. To assist efforts aimed at understanding Artic grayling distribution, we developed a quantitative PCR assay to detect the presence of Arctic grayling DNA in environmental samples. The assay amplified low...

  3. DNA, Drugs, and Detectives: An Interdisciplinary Special Topics Course for Undergraduate Students in Forensic Science

    Coticone, Sulekha Rao; Van Houten, Lora Bailey


    A special topics course combining two relevant and contemporary themes (forensic DNA analysis and illicit drug detection) was developed to stimulate student enthusiasm and enhance understanding of forensic science. Building on the interest of popular television shows such as "CSI" and "Breaking Bad," this course connects…

  4. Detection of Orientia sp. DNA in rodents from Asia, West Africa and Europe.

    Cosson, Jean François; Galan, Maxime; Bard, Emilie; Razzauti, Maria; Bernard, Maria; Morand, Serge; Brouat, Carine; Dalecky, Ambroise; Bâ, Khalilou; Charbonnel, Nathalie; Vayssier-Taussat, Muriel


    Orientia bacterium is the agent of the scrub typhus, a seriously neglected life-threatening disease in Asia. Here, we report the detection of DNA of Orientia in rodents from Europe and Africa. These findings have important implications for public health. Surveillance outside Asia, where the disease is not expected by sanitary services, needs to be improved.

  5. Ternary monolayers as DNA recognition interfaces for direct and sensitive electrochemical detection in untreated clinical samples

    Campuzano, S.; Kuralay, F.; Lobo-Castanón, M.J.; Bartošík, Martin; Vyavahare, K.; Paleček, Emil; Haake, D.A.; Wang, J.


    Roč. 26, č. 8 (2011), s. 3577-3583 ISSN 0956-5663 R&D Projects: GA MŠk(CZ) ME09038 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : electrochemical detection * DNA hybridization * self-assembled monolayer Subject RIV: BO - Biophysics Impact factor: 5.602, year: 2011

  6. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    Lee, Seong-Hun


    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  7. Loop-mediated isothermal amplification (LAMP) shield for Arduino DNA detection

    Velders, Aldrik H.; Schoen, Cor; Saggiomo, Vittorio


    Objective: Loop-mediated isothermal amplification (LAMP) of DNA is gaining relevance as a method to detect nucleic acids, as it is easier, faster, and more powerful than conventional Polymerase Chain Reaction. However, LAMP is still mostly used in laboratory settings, because of the lack of a cheap

  8. Rapid detection of DNA-interstrand and DNA-protein cross-links in mammalian cells by gravity-flow alkaline elution

    Hincks, J.R.; Coulombe, R.A. Jr.


    Alkaline elution is a sensitive and commonly used technique to detect cellular DNA damage in the form of DNA strand breaks and DNA cross-links. Conventional alkaline elution procedures have extensive equipment requirements and are tedious to perform. Our laboratory recently presented a rapid, simplified, and sensitive modification of the alkaline elution technique to detect carcinogen-induced DNA strand breaks. In the present study, we have further modified this technique to enable the rapid characterization of chemically induced DNA-interstrand and DNA-protein associated cross-links in cultured epithelial cells. Cells were exposed to three known DNA cross-linking agents, nitrogen mustard (HN 2 ), mitomycin C (MMC), or ultraviolet irradiation (UV). One hour exposures of HN 2 at 0.25, 1.0, and 4.0 microM or of MMC at 20, 40, and 60 microM produced a dose-dependent induction of total DNA cross-links by these agents. Digestion with proteinase K revealed that HN 2 and MMC induced both DNA-protein cross-links and DNA-interstrand cross-links. Ultraviolet irradiation induced both DNA cross-links and DNA strand breaks, the latter of which were either protein and nonprotein associated. The results demonstrate that gravity-flow alkaline elution is a sensitive and accurate method to characterize the molecular events of DNA cross-linking. Using this procedure, elution of DNA from treated cells is completed in 1 hr, and only three fractions per sample are analyzed. This method may be useful as a rapid screening assay for genotoxicity and/or as an adjunct to other predictive assays for potential mutagenic or carcinogenic agents

  9. Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

    Vojkovska, H; Kubikova, I; Kralik, P


    Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

  10. c-DNA of HIV-1 detection on spot of Buffy-Coat of leukocytes (DBCS

    Marco Rossi de Gasperis


    Full Text Available Introduction:The elective way for the diagnosis of HIV-1-infection in the window period and in children under the age of 16-18 months is to search virus integrated in leukocytes. Aim of the study was to assess the sensitivity and specificity of extraction from Buffy-Dried Coat Spot (DBCS in leukocyte to detect c-DNA with nested-PCR in HIV-1-infected individuals compared to Dried Blood Spot (DBS both extracted by automated instrument EZ1 (QIAGEN, Hilden, Germany. Both DBCS and both DBS were compared with those tests from whole blood by conventional DNA-extraction Methods: Five ml of whole blood from 50 HIV-infected individuals were collected. 40 μl of each sample were spotted on “FTA ELUTE Micro Card” (Whatman, Inc., Clifton, NJ, 200 μl were extracted according to the manual procedure (QIAGEN “QIAamp DNA minikit and the remaining sample was incubated at 37 °C for 120 minutes. Plasma was centrifuged at 1000 rcf/1g for 10 minutes at room temperature. Forty μl of the obtained buffy-coat was spotted. Both DBCS and both DBS were dried at room temperature for 24 hours.Two of 5 punch from each spot were extracted with TISSUE DNA kit (Biorobot EZ1 DSP “Qiagen” and eluted in 50 μl of buffer.The recovery of genomic DNA was measured amplifying the ß-globin gene by Real-Time “SybrGreen I”.The DNA was amplified for the “pol” gene of HIV-1 by nested PCR and revealed in “SYBR-green I”. Eight HIV-antibody-negative samples were used as internal control. Results:The experimental protocol adopted for the DBCS showed high sensitivity and specificity.The extracted DNA from DBS and DBCS was characterized by excellent quality and without any inhibitory agents. The amount of proviral DNA extracted from DBCS is similar to that obtained by conventional extraction, while the DBS test was significantly less sensitive. Conclusion:These preliminary data suggest that the amount of c-DNA obtained with DBS technique is often not enough for the

  11. Depletion of Human DNA in Spiked Clinical Specimens for Improvement of Sensitivity of Pathogen Detection by Next-Generation Sequencing

    Hasan, Mohammad R.; Rawat, Arun; Tang, Patrick; Jithesh, Puthen V.; Thomas, Eva; Tan, Rusung; Tilley, Peter


    Next-generation sequencing (NGS) technology has shown promise for the detection of human pathogens from clinical samples. However, one of the major obstacles to the use of NGS in diagnostic microbiology is the low ratio of pathogen DNA to human DNA in most clinical specimens. In this study, we aimed to develop a specimen-processing protocol to remove human DNA and enrich specimens for bacterial and viral DNA for shotgun metagenomic sequencing. Cerebrospinal fluid (CSF) and nasopharyngeal aspi...

  12. Comparison of DNA extraction kits for detection of Burkholderia pseudomallei in spiked human whole blood using real-time PCR.

    Nicole L Podnecky

    Full Text Available Burkholderia pseudomallei, the etiologic agent of melioidosis, is endemic in northern Australia and Southeast Asia and can cause severe septicemia that may lead to death in 20% to 50% of cases. Rapid detection of B. pseudomallei infection is crucial for timely treatment of septic patients. This study evaluated seven commercially available DNA extraction kits to determine the relative recovery of B. pseudomallei DNA from spiked EDTA-containing human whole blood. The evaluation included three manual kits: the QIAamp DNA Mini kit, the QIAamp DNA Blood Mini kit, and the High Pure PCR Template Preparation kit; and four automated systems: the MagNAPure LC using the DNA Isolation Kit I, the MagNAPure Compact using the Nucleic Acid Isolation Kit I, and the QIAcube using the QIAamp DNA Mini kit and the QIAamp DNA Blood Mini kit. Detection of B. pseudomallei DNA extracted by each kit was performed using the B. pseudomallei specific type III secretion real-time PCR (TTS1 assay. Crossing threshold (C T values were used to compare the limit of detection and reproducibility of each kit. This study also compared the DNA concentrations and DNA purity yielded for each kit. The following kits consistently yielded DNA that produced a detectable signal from blood spiked with 5.5×10(4 colony forming units per mL: the High Pure PCR Template Preparation, QIAamp DNA Mini, MagNA Pure Compact, and the QIAcube running the QIAamp DNA Mini and QIAamp DNA Blood Mini kits. The High Pure PCR Template Preparation kit yielded the lowest limit of detection with spiked blood, but when this kit was used with blood from patients with confirmed cases of melioidosis, the bacteria was not reliably detected indicating blood may not be an optimal specimen.

  13. The detection of HBV DNA with gold-coated iron oxide nanoparticle gene probes

    Xi Dong; Luo Xiaoping; Lu Qianghua; Yao Kailun; Liu Zuli; Ning Qin


    Gold-coated iron oxide nanoparticle Hepatitis B virus (HBV) DNA probes were prepared, and their application for HBV DNA measurement was studied. Gold-coated iron oxide nanoparticles were prepared by the citrate reduction of tetra-chloroauric acid in the presence of iron oxide nanoparticles which were added as seeds. With a fluorescence-based method, the maximal surface coverage of hexaethiol 30-mer oligonucleotides and the maximal percentage of hybridization strands on gold-coated iron oxide nanoparticles were (120 ± 8) oligonucleotides per nanoparticle, and (14 ± 2%), respectively, which were comparable with those of (132 ± 10) and (22 ± 3%) in Au nanoparticle groups. Large network aggregates were formed when gold-coated iron oxide nanoparticle HBV DNA gene probe was applied to detect HBV DNA molecules as evidenced by transmission electron microscopy and the high specificity was verified by blot hybridization. Our results further suggested that detecting DNA with iron oxide nanoparticles and magnetic separator was feasible and might be an alternative effective method

  14. Ionizing radiation-induced DNA injury and damage detection in patients with breast cancer

    Borrego-Soto, Gissela; Ortiz-Lopez, Rocio; Rojas-Martinez, Augusto, E-mail:, E-mail: [Departamento de Bioquímica y Medicina Molecular, Facultad de Medicina, Universidad Autónoma de Nuevo León, Monterrey, Nuevo León (Mexico)


    Breast cancer is the most common malignancy in women. Radiotherapy is frequently used in patients with breast cancer, but some patients may be more susceptible to ionizing radiation, and increased exposure to radiation sources may be associated to radiation adverse events. This susceptibility may be related to deficiencies in DNA repair mechanisms that are activated after cell-radiation, which causes DNA damage, particularly DNA double strand breaks. Some of these genetic susceptibilities in DNA-repair mechanisms are implicated in the etiology of hereditary breast/ovarian cancer (pathologic mutations in the BRCA 1 and 2 genes), but other less penetrant variants in genes involved in sporadic breast cancer have been described. These same genetic susceptibilities may be involved in negative radiotherapeutic outcomes. For these reasons, it is necessary to implement methods for detecting patients who are susceptible to radiotherapy-related adverse events. This review discusses mechanisms of DNA damage and repair, genes related to these functions, and the diagnosis methods designed and under research for detection of breast cancer patients with increased radiosensitivity. (author)

  15. Evaluation of a manual DNA extraction protocol and an isothermal amplification assay for detecting HIV-1 DNA from dried blood spots for use in resource-limited settings.

    Jordan, Jeanne A; Ibe, Christine O; Moore, Miranda S; Host, Christel; Simon, Gary L


    In resource-limited settings (RLS) dried blood spots (DBS) are collected on infants and transported through provincial laboratories to a central facility where HIV-1 DNA PCR testing is performed using specialized equipment. Implementing a simpler approach not requiring such equipment or skilled personnel could allow the more numerous provincial laboratories to offer testing, improving turn-around-time to identify and treat infected infants sooner. Assess performances of a manual DNA extraction method and helicase-dependent amplification (HDA) assay for detecting HIV-1 DNA from DBS. 60 HIV-1 infected adults were enrolled, blood samples taken and DBS made. DBS extracts were assessed for DNA concentration and beta globin amplification using PCR and melt-curve analysis. These same extracts were then tested for HIV-1 DNA using HDA and compared to results generated by PCR and pyrosequencing. Finally, HDA limit of detection (LOD) studies were performed using DBS extracts prepared with known numbers of 8E5 cells. The manual extraction protocol consistently yielded high concentrations of amplifiable DNA from DBS. LOD assessment demonstrated HDA detected ∼470 copies/ml of HIV-1 DNA extracts in 4/4 replicates. No statistical difference was found using the McNemar's test when comparing HDA to PCR for detecting HIV-1 DNA from DBS. Using just a magnet, heat block and pipettes, the manual extraction protocol and HDA assay detected HIV-1 DNA from DBS at levels that would be useful for early infant diagnosis. Next steps will include assessing HDA for non-B HIV-1 subtypes recognition and comparison to Roche HIV-1 DNA v1.5 PCR assay. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. A magnetic bead-based method for concentrating DNA from human urine for downstream detection.

    Bordelon, Hali; Russ, Patricia K; Wright, David W; Haselton, Frederick R


    Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3) to 5×10(8) copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6), 14×10(6), and 8×10(6) copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.

  17. A magnetic bead-based method for concentrating DNA from human urine for downstream detection.

    Hali Bordelon

    Full Text Available Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3 to 5×10(8 copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6, 14×10(6, and 8×10(6 copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.

  18. An automated microfluidic DNA microarray platform for genetic variant detection in inherited arrhythmic diseases.

    Huang, Shu-Hong; Chang, Yu-Shin; Juang, Jyh-Ming Jimmy; Chang, Kai-Wei; Tsai, Mong-Hsun; Lu, Tzu-Pin; Lai, Liang-Chuan; Chuang, Eric Y; Huang, Nien-Tsu


    In this study, we developed an automated microfluidic DNA microarray (AMDM) platform for point mutation detection of genetic variants in inherited arrhythmic diseases. The platform allows for automated and programmable reagent sequencing under precise conditions of hybridization flow and temperature control. It is composed of a commercial microfluidic control system, a microfluidic microarray device, and a temperature control unit. The automated and rapid hybridization process can be performed in the AMDM platform using Cy3 labeled oligonucleotide exons of SCN5A genetic DNA, which produces proteins associated with sodium channels abundant in the heart (cardiac) muscle cells. We then introduce a graphene oxide (GO)-assisted DNA microarray hybridization protocol to enable point mutation detection. In this protocol, a GO solution is added after the staining step to quench dyes bound to single-stranded DNA or non-perfectly matched DNA, which can improve point mutation specificity. As proof-of-concept we extracted the wild-type and mutant of exon 12 and exon 17 of SCN5A genetic DNA from patients with long QT syndrome or Brugada syndrome by touchdown PCR and performed a successful point mutation discrimination in the AMDM platform. Overall, the AMDM platform can greatly reduce laborious and time-consuming hybridization steps and prevent potential contamination. Furthermore, by introducing the reciprocating flow into the microchannel during the hybridization process, the total assay time can be reduced to 3 hours, which is 6 times faster than the conventional DNA microarray. Given the automatic assay operation, shorter assay time, and high point mutation discrimination, we believe that the AMDM platform has potential for low-cost, rapid and sensitive genetic testing in a simple and user-friendly manner, which may benefit gene screening in medical practice.

  19. Different Levels of DNA Methylation Detected in Human Sperms after Morphological Selection Using High Magnification Microscopy

    Nino Guy Cassuto


    Full Text Available Objective. To analyze DNA methylation levels between two groups of spermatozoa taken from the same sample, following morphological selection by high magnification (HM at 6100x microscopy. A prospective study was conducted and studied 876 spermatozoa from 10 randomly selected men. Sperm morphology was characterized at HM according to criteria previously established. High-scoring Score 6 and low-scoring Score 0 sperm were selected. Sperm DNA methylation level was assessed using an immunoassay method targeting 5-methylcytosine residues by fluorescence microscopy with imaging analysis system to detect DNA methylation in single spermatozoon. Results. In total, 448 S6 spermatozoa and 428 S0 spermatozoa were analyzed. A strong relationship was found between sperm DNA methylation levels and sperm morphology observed at HM. Sperm DNA methylation level in the S6 group was significantly lower compared with that in the S0 group (p<10-6, OR = 2.4; and p<0.001, as determined using the Wilcoxon test. Conclusion. Differences in DNA methylation levels are associated with sperm morphology variations as observed at HM, which allows spermatozoa with abnormal levels to be discarded and ultimately decrease birth defects, malformations, and epigenetic diseases that may be transmitted from sperm to offspring in ICSI.

  20. Detection of Colorectal Cancer by a Quantitative Fluorescence Determination of DNA Amplification in Stool

    Daniele Calistri


    Full Text Available DNA amplification of exfoliated cells in stool repre sents an inexpensive and rapid test, but has only 50% to 60% sensitivity. A new quantitative method, calle( fluorescence long DNA, was developed and validate( in our laboratory on stool obtained from 86 patient., with primary colorectal cancer and from 62 health individuals. It consists of the amplification of stoo DNA with fluorescence primers and the quantification of the amplification using a standard curve. Results are arbitrarily expressed in nanograms. The potential of thi new method compared to the conventional approact was analyzed in a subgroup of 94 individuals (51 patients and 38 healthy volunteers. In the presen series, DNA amplification analysis showed a specific ity of 97% and a sensitivity of only 50%. Conversely fluorescence DNA evaluation, using the best cutoff o 25 ng, showed a sensitivity of about 76% and a spec ificity of 93%. Similar sensitivity was observed regard less of Dukes stage, tumor location, and size, thu., also permitting the detection of early-stage tumors The present study seems to indicate that quantitative fluorescence DNA determination in stool successfully identifies colorectal cancer patients with a sensitivity comparable, if not superior, to that of multiple gene analysis but at a lower cost and in a shorter time.

  1. Molecular detection of Anaplasma phagocytophilum DNA in the lesser horseshoe bat (Rhinolophus hipposideros) guano.

    Afonso, E; Goydadin, A-C


    Although bats are increasingly recognised as potential reservoir hosts of human zoonotic pathogens, bacteria in bats are still poorly studied. To investigate the DNA faecal prevalence of the bacterium Anaplasma phagocytophilum, we sampled 23 lesser horseshoe bat (Rhinolophus hipposideros) maternity colonies located in buildings (churches, barns) in rural villages of eastern France. A total of 552 faecal samples were collected from 278 individuals. Anaplasma phagocytophilum DNA was detected in the faeces of 63 individuals (22.7%). Such high prevalence might suggest persistent infection in bats and/or a frequent consumption of insect preys carrying bacteria. Faecal DNA prevalence varied highly among colonies but was not related to the colony size. Faecal DNA prevalence was the highest in the Jura Department, where the density of ticks is known to be the highest across the study area. Because the sampled bats live in close proximity to humans, we discuss how concerning the presence of A. phagocytophilum DNA in bat guano is for humans frequenting places of worship that shelter bats. We also advocate future research to understand what a high faecal DNA prevalence in bat guano really implicates in terms of bacteria transmission.

  2. Alkaline gel electrophoresis assay to detect DNA strand breaks and repair mechanisms in Escherichia coli

    Mattos, Jose Carlos Pelielo de; Motta, Ellen Serri da; Oliveira, Marcia Betania Nunes de; Dantas, Flavio Jose da Silva; Araujo, Adriano Caldeira de [Universidade do Estado do Rio de Janeiro (UERJ), RJ (Brazil). Dept. de Biofisica e Biometria. Lab. de Radio e Fotobiologia]. E-mail:


    Reactive oxygen species (ROS) can induce lesions in different cellular targets, including DNA. Stannous chloride (SnCl{sub 2}) is a ROS generator, leading to lethality in Escherichia coli (E. coli), with the base excision repair (BER) mechanism playing a role in this process. Many techniques have been developed to detect genotoxicity, as comet assay, in eukaryotic cells, and plasmid DNA agarose gel electrophoresis. In this study, an adaptation of the alkaline gel electrophoresis method was carried out to ascertain the induction of strand breaks by SnCl{sub 2} in bacterial DNA, from E. coli BER mutants, and its repair pathway. Results obtained show that SnCl{sub 2} was able to induce DNA strand breaks in all strains tested. Moreover, endonuclease IV and exonuclease III play a role in DNA repair. On the whole, data has shown that the alkaline gel electrophoresis assay could be used both for studying DNA strand breaks induction and for associated repair mechanisms. (author)

  3. Detection of Cryptosporidium parvum Oocysts on Fresh Produce Using DNA Aptamers.

    Asma Iqbal

    Full Text Available There are currently no standard methods for the detection of Cryptosporidium spp., or other protozoan parasites, in foods, and existing methods are often inadequate, with low and variable recovery efficiencies. Food testing is difficult due to the low concentrations of parasites, the difficulty in eluting parasites from some foods, the lack of enrichment methods, and the presence of PCR inhibitors. The main objectives of the present study were to obtain DNA aptamers binding to the oocyst wall of C. parvum, and to use the aptamers to detect the presence of this parasite in foods. DNA aptamers were selected against C. parvum oocysts using SELEX (Systematic Evolution of Ligands by EXponential enrichment. Ten rounds of selection led to the discovery of 14 aptamer clones with high affinities for C. parvum oocysts. For detecting parasite-bound aptamers, a simple electrochemical sensor was employed, which used a gold nanoparticle-modified screen-printed carbon electrode. This aptasensor was fabricated by self-assembling a hybrid of a thiolated ssDNA primer and the anti- C. parvum aptamer. Square wave voltammetry was employed to quantitate C. parvum in the range of 150 to 800 oocysts, with a detection limit of approximately 100 oocysts. The high sensitivity and specificity of the developed aptasensor suggests that this novel method is very promising for the detection and identification of C. parvum oocysts on spiked fresh fruits, as compared to conventional methods such as microscopy and PCR.

  4. Simultaneous Detection of Ricin and Abrin DNA by Real-Time PCR (qPCR

    Roman Wölfel


    Full Text Available Ricin and abrin are two of the most potent plant toxins known and may be easily obtained in high yield from the seeds using rather simple technology. As a result, both toxins are potent and available toxins for criminal or terrorist acts. However, as the production of highly purified ricin or abrin requires sophisticated equipment and knowledge, it may be more likely that crude extracts would be used by non-governmental perpetrators. Remaining plant-specific nucleic acids in these extracts allow the application of a real-time PCR (qPCR assay for the detection and identification of abrin or ricin genomic material. Therefore, we have developed a duplex real-time PCR assays for simultaneous detection of ricin and abrin DNA based on the OmniMix HS bead PCR reagent mixture. Novel primers and hybridization probes were designed for detection on a SmartCycler instrument by using 5′-nuclease technology. The assay was thoroughly optimized and validated in terms of analytical sensitivity. Evaluation of the assay sensitivity by probit analysis demonstrated a 95% probability of detection at 3 genomes per reaction for ricin DNA and 1.2 genomes per reaction for abrin DNA. The suitability of the assays was exemplified by detection of ricin and abrin contaminations in a food matrix.

  5. Highly sensitive "signal-on" electrochemiluminescent biosensor for the detection of DNA based on dual quenching and strand displacement reaction.

    Lou, Jing; Wang, Zhaoyin; Wang, Xiao; Bao, Jianchun; Tu, Wenwen; Dai, Zhihui


    A "signal-on" electrochemiluminescent DNA biosensing platform was proposed based on the dual quenching and strand displacement reaction. This novel "signal-on" detection strategy revealed its sensitivity in achieving a detection limit of 2.4 aM and its selectivity in distinguishing single nucleotide polymorphism of target DNA.

  6. Detection of bovine herpesvirus 4 glycoprotein B and thymidine kinase DNA by PCR assays in bovine milk

    Wellenberg, G.J.; Verstraten, E.; Belak, S.; Verschuren, S.B.E.; Rijsewijk, F.A.M.; Peshev, R.; Oirschot, van J.T.


    A polymerase chain reaction (PCR) assay was developed to detect bovine herpesvirus 4 (BHV4) glycoprotein B (gB) DNA, and a nested-PCR assay was modified for the detection of BHV4 thymidine kinase (TK) DNA in bovine milk samples. To identify false-negative PCR results, internal control templates were

  7. Detection, characterization and measure of a new radiation-induced damage in isolated and cellular DNA

    Regulus, P.


    Deoxyribonucleic acid (DNA) contains the genetic information and chemical injury to this macromolecule may have severe biological consequences. We report here the detection of 4 new radiation-induced DNA lesions by using a high-performance liquid chromatography coupled to tandem mass spectrometry (HPLC-MS/MS) approach. For that purpose, the characteristic fragmentation of most 2'-deoxy-ribo nucleosides, the loss of 116 Da corresponding to the loss of the 2-deoxyribose moiety, was used in the so-called neutral loss mode of the HPLC-MS/MS. One of the newly detected lesions, named dCyd341 because it is a 2'-deoxycytidine modification exhibiting a molecular weight of 341 Da, was also detected in cellular DNA. Characterization of this modified nucleoside was performed using NMR and exact mass determination of the product obtained by chemical synthesis. A mechanism of formation was then proposed, in which the first event is the H-abstraction at the C4 position of a 2-deoxyribose moiety. Then, the sugar modification produced exhibits a reactive aldehyde that, through reaction with a vicinal cytosine base, gives rise to dCyd341. dCyd341 could be considered as a complex damage since its formation involves a DNA strand break and a cross-link between a damaged sugar residue and a vicinal cytosine base located most probably on the complementary DNA strand. In addition to its characterization, preliminary biological studies revealed that cells are able to remove the lesion from DNA. Repair studies have revealed the ability of cells to excise the lesion. Identification of the repair systems involved could represent an interesting challenge. (author)

  8. Detection and quantification of 4-ABP adducts in DNA from bladder cancer patients.

    Zayas, Beatriz; Stillwell, Sara W; Wishnok, John S; Trudel, Laura J; Skipper, Paul; Yu, Mimi C; Tannenbaum, Steven R; Wogan, Gerald N


    We analyzed bladder DNA from 27 cancer patients for dG-C8-4-aminobiphenyl (dG-C8-ABP) adducts using the liquid chromatography tandem mass spectrometry method with a 700 attomol (1 adduct in 10(9) bases) detection limit. Hemoglobin (Hb) 4-aminobiphenyl (4-ABP) adduct levels were measured by gas chromatography-mass spectrometry. After isolation of dG-C8-ABP by immunoaffinity chromatography and further purification, deuterated (d9) dG-C8-ABP (MW=443 Da) was added to each sample. Structural evidence and adduct quantification were determined by selected reaction monitoring, based on the expected adduct ion [M+H+]+1, at m/z 435 with fragmentation to the product ion at m/z 319, and monitoring of the transition for the internal standard, m/z 444-->328. The method was validated by analysis of DNA (100 microg each) from calf thymus; livers from ABP-treated and untreated rats; human placentas; and TK6 lymphoblastoid cells. Adduct was detected at femtomol levels in DNA from livers of ABP-treated rats and calf thymus, but not in other controls. The method was applied to 41 DNA samples (200 microg each) from 27 human bladders; 28 from tumor and 14 from surrounding non-tumor tissue. Of 27 tissues analyzed, 44% (12) contained 5-80 dG-C8-ABP adducts per 10(9) bases; only 1 out of 27 (4%) contained adduct in both tumor and surrounding tissues. The Hb adduct was detected in samples from all patients, at levels of 12-1960 pg per gram Hb. There was no correlation between levels of DNA and Hb adducts. The presence of DNA adducts in 44% of the subjects and high levels of Hb adducts in these non-smokers indicate environmental sources of exposure to 4-ABP.

  9. Rapid Detection of Cell-Free Mycobacterium tuberculosis DNA in Tuberculous Pleural Effusion.

    Che, Nanying; Yang, Xinting; Liu, Zichen; Li, Kun; Chen, Xiaoyou


    Tuberculous pleurisy is one of the most common types of extrapulmonary tuberculosis, but its diagnosis remains difficult. In this study, we report for the first time on the detection of cell-free Mycobacterium tuberculosis DNA in pleural effusion and an evaluation of a newly developed molecular assay for the detection of cell-free Mycobacterium tuberculosis DNA. A total of 78 patients with pleural effusion, 60 patients with tuberculous pleurisy, and 18 patients with alternative diseases were included in this study. Mycobacterial culture, the Xpert MTB/RIF assay, the adenosine deaminase assay, the T-SPOT.TB assay, and the cell-free Mycobacterium tuberculosis DNA assay were performed on all the pleural effusion samples. The cell-free Mycobacterium tuberculosis DNA assay and adenosine deaminase assay showed significantly higher sensitivities of 75.0% and 68.3%, respectively, than mycobacterial culture and the Xpert MTB/RIF assay, which had sensitivities of 26.7% and 20.0%, respectively ( P pleural effusion showed the highest sensitivity of 95.0% but the lowest specificity of 38.9%. The cell-free Mycobacterium tuberculosis DNA assay detected as few as 1.25 copies of IS 6110 per ml of pleural effusion and showed good accordance of the results between repeated tests ( r = 0.978, P = 2.84 × 10 -10 ). These data suggest that the cell-free Mycobacterium tuberculosis DNA assay is a rapid and accurate molecular test which provides direct evidence of Mycobacterium tuberculosis etiology. Copyright © 2017 American Society for Microbiology.

  10. DNA detection on ultrahigh-density optical fiber-based nanoarrays.

    Tam, Jenny M; Song, Linan; Walt, David R


    Nanoarrays for DNA detection were fabricated on etched nanofiber bundles based on recently developed techniques for microscale arrays. Two different-sized nanoarrays were created: one with 700 nm feature sizes and a 1 microm center-to-center pitch (approximately 1x10(6) array elements/mm(2)) and one with 300 nm feature sizes and a 500 nm center-to-center pitch (4.6x10(6) array elements/mm(2)). A random, multiplexed array composed of oligonucleotide-functionalized nanospheres was constructed and used for parallel detection and analysis of fluorescently labeled DNA targets. We have used these arrays to detect a variety of target sequences including Bacillus thuringiensis kurstaki and vaccina virus sequences, two potential biowarfare agents, as well as interleukin-2 sequences, an immune system modulator that has been used for the diagnosis of HIV.

  11. Detection of mitochondrial DNA deletions in human cells induced by ionizing radiation

    Liu, Qing-Jie; Feng, Jiang-Bin; Lu, Xue; Li, Yu-Wen; Chen, De-Qing


    Full text: Purpose: To screen the novel mitochondrial DNA (mt DNA) deletions induced by ionizing radiation, and analyze the several kinds of mt DNA deletions, known as 3895 bp, 889 bp, 7436 bp or 4934 bp deletions. Methods: Long-range PCR with two pairs of primers, which could amplify the whole human mitochondrial genome, was used to analyze the lymphoblastoid cell line before and after exposed to 10 Gy 60 Co γ-rays. The limited condition PCR was used to certify the possible mt DNA deletion showed by long-range PCR. The PCR products were purified, cloned, sequenced and the sequence result were BLASTed. Regular PCR or nest-PCR were used to analyze the 3895 bp, 889 bp, 7436 bp or 4934 bp deletions before and after radiation exposure. The final PCR products were purified, sequenced and BALSTed on standard human mitochondrial genome sequence database. Results: (1) The predicted bands of mt DNA were observed on the control cell lines, and the possible mt DNA deletions were also detected on the irradiated cell lines. The deletions were certified by the limited condition PCR. The sequence BLAST results of the cloned PCR products showed that two kinds of deletions, 7455 bp deletion (nt 475-7929 in heavy strand) and 9225 bp deletion (nt 7714-369 in heavy strand), which were between two 8 bp direct repeats. Further bioinformatics analysis showed that the two deletions were novel deletions. (2) The 889 bp and 3895 bp deletion were not detected for the cell line samples not exposed to 60 Co γ-rays. The 889 bp and 3895 bp deletions were detected on samples exposed to 10 Gy 60 Co γ-rays. The BALST results showed that the 889 bp and 3895 deletions flanked nt 11688 bp-12576, nt 548 bp-4443, respectively. The 7436 bp deletion levels were not changed much before and after irradiation. (3) The 4934 bp deletions had the same pattern as 7436 bp deletion, but it could induced by radiation. Conclusions: Ionizing radiation could induce the human lymphoblastoid two novel mt DNA

  12. The detection of melamine base on a turn-on fluorescence of DNA-Ag nanoclusters

    Xie, Peisi [Ministry of Education Key Laboratory of Analysis and Detection Technology for Food Safety, Fuzhou University, Fuzhou 350002 (China); State Key Laboratory of Environmental and Biological Analysis, Department of Chemistry, Hong Kong Baptist University, Hong Kong (China); Zhan, Yuanjin; Wu, Mei; Guo, Longhua; Lin, Zhenyu [Ministry of Education Key Laboratory of Analysis and Detection Technology for Food Safety, Fuzhou University, Fuzhou 350002 (China); Qiu, Bin, E-mail: [Ministry of Education Key Laboratory of Analysis and Detection Technology for Food Safety, Fuzhou University, Fuzhou 350002 (China); Chen, Guonan [Ministry of Education Key Laboratory of Analysis and Detection Technology for Food Safety, Fuzhou University, Fuzhou 350002 (China); Cai, Zongwei [State Key Laboratory of Environmental and Biological Analysis, Department of Chemistry, Hong Kong Baptist University, Hong Kong (China)


    A label-free, ultra-sensitive and turn-on fluorescence method to detect melamine has been developed. The strategy uses the DNA-Ag nanoclusters (DNA-AgNCs) as the fluorescence probe. The fluorescence of DNA-AgNCs can be quenched in presence of Hg{sup 2+}. However, When Hg{sup 2+} and melamine were reacted for 15 min at 1000 rmp then introduced into DNA-AgNCs solution, a strong fluorescence recovery could be found. Based on this methodology, the changing fluorescent intensity has a linear relationship with melamine in the range of 0.2 μM to 4 μM (R{sup 2}=0.997). The detection limit down to 0.1 μM was obtained, which is 200 times lower than the melamine safety limit of 20 μM estimated by the US Food and Drug Administration. In addition, we had been successfully applied this method to detect melamine in milk powder and raw milk.

  13. Femtomolar detection of single mismatches by discriminant analysis of DNA hybridization events using gold nanoparticles.

    Ma, Xingyi; Sim, Sang Jun


    Even though DNA-based nanosensors have been demonstrated for quantitative detection of analytes and diseases, hybridization events have never been numerically investigated for further understanding of DNA mediated interactions. Here, we developed a nanoscale platform with well-designed capture and detection gold nanoprobes to precisely evaluate the hybridization events. The capture gold nanoprobes were mono-laid on glass and the detection probes were fabricated via a novel competitive conjugation method. The two kinds of probes combined in a suitable orientation following the hybridization with the target. We found that hybridization efficiency was markedly dependent on electrostatic interactions between DNA strands, which can be tailored by adjusting the salt concentration of the incubation solution. Due to the much lower stability of the double helix formed by mismatches, the hybridization efficiencies of single mismatched (MMT) and perfectly matched DNA (PMT) were different. Therefore, we obtained an optimized salt concentration that allowed for discrimination of MMT from PMT without stringent control of temperature or pH. The results indicated this to be an ultrasensitive and precise nanosensor for the diagnosis of genetic diseases.

  14. DNA polymorphism sensitive impedimetric detection on gold-nanoislands modified electrodes.

    Bonanni, Alessandra; Pividori, Maria Isabel; del Valle, Manel


    Nanocomposite materials are being increasingly used in biosensing applications as they can significantly improve biosensor performance. Here we report the use of a novel impedimetric genosensor based on gold nanoparticles graphite-epoxy nanocomposite (nanoAu-GEC) for the detection of triple base mutation deletion in a cystic-fibrosis (CF) related human DNA sequence. The developed platform consists of chemisorbing gold nano-islands surrounded by rigid, non-chemisorbing, and conducting graphite-epoxy composite. The ratio of the gold nanoparticles in the composite was carefully optimized by electrochemical and microscopy studies. Such platform allows the very fast and stable thiol immobilization of DNA probes on the gold islands, thus minimizing the steric and electrostatic repulsion among the DNA probes and improving the detection of DNA polymorphism down to 2.25fmol by using electrochemical impedance spectroscopy. These findings are very important in order to develop new and renewable platforms to be used in point-of-care devices for the detection of biomolecules. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Detection of Balamuthia mandrillaris DNA by real-time PCR targeting the RNase P gene

    Lewin Astrid


    Full Text Available Abstract Background The free-living amoeba Balamuthia mandrillaris may cause fatal encephalitis both in immunocompromised and in – apparently – immunocompetent humans and other mammalian species. Rapid, specific, sensitive, and reliable detection requiring little pathogen-specific expertise is an absolute prerequisite for a successful therapy and a welcome tool for both experimental and epidemiological research. Results A real-time polymerase chain reaction assay using TaqMan® probes (real-time PCR was established specifically targeting the RNase P gene of B. mandrillaris amoebae. The assay detected at least 2 (down to 0.5 genomes of B. mandrillaris grown in axenic culture. It did not react with DNA from closely related Acanthamoeba (3 species, nor with DNA from Toxoplasma gondii, Leishmania major, Pneumocystis murina, Mycobacterium bovis (BCG, human brain, various mouse organs, or from human and murine cell lines. The assay efficiently detected B. mandrillaris DNA in spiked cell cultures, spiked murine organ homogenates, B. mandrillaris-infected mice, and CNS tissue-DNA preparations from 2 patients with proven cerebral balamuthiasis. This novel primer set was successfully combined with a published set that targets the B. mandrillaris 18S rRNA gene in a duplex real-time PCR assay to ensure maximum specificity and as a precaution against false negative results. Conclusion A real-time PCR assay for B. mandrillaris amoebae is presented, that is highly specific, sensitive, and reliable and thus suited both for diagnosis and for research.

  16. Validation study of HPV DNA detection from stained FNA smears by polymerase chain reaction

    Channir, Hani Ibrahim; Larsen, Christian Grønhøj; Ahlborn, Lise Barlebo


    and corresponding surgical specimens were collected from 71 patients with known HPV-positive OPSCC, 12 patients with oral squamous cell carcinoma (OSCC), 20 patients with branchial cleft cysts, and 20 patients with Warthin tumors. Thirty-eight patients with OPSCC and 7 patients with OSCC had FNA smears available...... was detected in 68 of the 71 FNA smears from OPSCC metastases. All corresponding surgical specimens from primary tumors (n = 71) and metastases (n = 38) were p16- and HPV DNA-positive. All the surgical specimens and corresponding FNA smears from OSCCs, Warthin tumors, and branchial cleft cysts were HPV DNA...

  17. Detection of plant DNA in the bronchoalveolar lavage of patients with ventilator-associated pneumonia.

    Sabri Bousbia

    Full Text Available BACKGROUND: Hospital-acquired infections such as nosocomial pneumonia are a serious cause of mortality for hospitalized patients, especially for those admitted to intensive care units (ICUs. Despite the number of the studies reported to date, the causative agents of pneumonia are not completely known. Herein, we found by molecular technique that vegetable and tobacco DNA may be detected in the bronchoalveolar lavage from patients with ventilator-associated pneumonia (VAP. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, we studied bronchoalveolar lavage (BAL from patients admitted to ICUs with ventilator-associated pneumonia. BAL fluids were assessed with molecular tests, culture and blood culture. We successfully identified plant DNA in six patients out of 106 (6% with ventilator-associated pneumonia. Inhalation was confirmed in four cases and suspected in the other two cases. Inhalation was significantly frequent in patients with plant DNA (four out of six patients than those without plant DNA (three out of 100 patients (P<0.001. Nicotiana tabacum chloroplast DNA was identified in three patients who were smokers (cases 2, 3 and 6. Cucurbita pepo, Morus bombycis and Triticum aestivum DNA were identified in cases 1, 4 and 5 respectively. Twenty-three different bacterial species, two viruses and five fungal species were identified from among these six patients by using molecular and culture techniques. Several of the pathogenic microorganisms identified are reported to be food-borne or tobacco plant-associated pathogens. CONCLUSIONS/SIGNIFICANCE: Our study shows that plants DNA may be identified in the BAL fluid of pneumonia patients, especially when exploring aspiration pneumonia, but the significance of the presence of plant DNA and its role in the pathogenesis of pneumonia is unknown and remains to be investigated. However, the identification of these plants may be a potential marker of aspiration in patients with pneumonia.

  18. Radiosensitivity evaluation of Human tumor cell lines by detecting 4977bp deletion in mitochondrial DNA

    Zhang Yipei


    Objective: To explore the feasibility of determining radiosensitivity of human tumor cell lines in vitro using the assay of mtDNA4977bp deletion. Methods: Three human tumor cell lines were selected in this study, HepG 2 , EC-9706 and MCF-7. The surviving fraction(SF), the ratio of mtDNA4977bp deletion and DNA damage were detected by MTT assay and nested PCR technique respectively. Results: MTT assay: The SF of HepG 2 and EC-9706 after irradiated by 2, 4and 8Gy was lower significantly than that of MCF-7, which showed that the radiosensitivity of HepG 2 and EC-9706 was higher than that of MCF-7. But there was no statistical difference of SF between HepG 2 and EC-9706. PCR method:The differences on mtDNA 4977bp deletion in mitochondrial DNA among HepG 2 , EC-9706 and MCF-7 were not significant after 1Gy and 4Gy γ-ray irradiation. The ratio of 4977bp deletion in mitochondrial DNA of HepG 2 and EC-9706 increased while that of MCF-7 decreased after 8Gy irradiation. The ratio of mtDNA 4977bp deletion of HepG 2 and EC-9706 was higher significantly than that of MCF-7, which implies that the radiosensitivity of HepG 2 and EC-9706 was higher than that of MCF -7. Conclusion: As a new biological marker, mtDNA4977bp deletion may be hopeful to evaluate the radiosensitivity of tumor cells more objectively and exactly. (authors)

  19. Identifying DNA Methylation Biomarkers for Non-Endoscopic Detection of Barrett’s Esophagus

    Moinova, Helen R.; LaFramboise, Thomas; Lutterbaugh, James D.; Chandar, Apoorva Krishna; Dumot, John; Faulx, Ashley; Brock, Wendy; De la Cruz Cabrera, Omar; Guda, Kishore; Barnholtz-Sloan, Jill S.; Iyer, Prasad G.; Canto, Marcia I.; Wang, Jean S.; Shaheen, Nicholas J.; Thota, Prashanti N.; Willis, Joseph E.; Chak, Amitabh; Markowitz, Sanford D.


    We report a biomarker-based non-endoscopic method for detecting Barrett’s esophagus (BE), based on detecting methylated DNAs retrieved via a swallowable balloon-based esophageal sampling device. BE is the precursor of, and a major recognized risk factor for, developing esophageal adenocarcinoma (EAC). Endoscopy, the current standard for BE detection, is not cost-effective for population screening. We performed genome-wide screening to ascertain regions targeted for recurrent aberrant cytosine methylation in BE, identifying high-frequency methylation within the CCNA1 locus. We tested CCNA1 DNA methylation as a BE biomarker in cytology brushings of the distal esophagus from 173 individuals with or without BE. CCNA1 DNA methylation demonstrated an area under the curve (AUC)=0.95 for discriminating BE-related metaplasia and neoplasia cases versus normal individuals, performing identically to methylation of VIM DNA, an established BE biomarker. When combined, the resulting two biomarker panel was 95% sensitive and 91% specific. These results were replicated in an independent validation cohort of 149 individuals, who were assayed using the same cutoff values for test positivity established in the training population. To progress toward non-endoscopic esophageal screening, we engineered a well-tolerated, swallowable, encapsulated balloon device able to selectively sample the distal esophagus within 5 minutes. In balloon samples from 86 individuals, tests of CCNA1 plus VIM DNA methylation detected BE metaplasia with 90.3% sensitivity and 91.7% specificity. Combining the balloon sampling device with molecular assays of CCNA1 plus VIM DNA methylation enables an efficient, well-tolerated, sensitive, and specific method of screening at-risk populations for BE. PMID:29343623

  20. Profiling the miRNAs for Early Cancer Detection using DNA-based Logic Gates

    Tahereh Yahya


    Full Text Available Abstract Background: DNA-based computing is an emerging research aspect that enables the in-vivo computation and decision making with significant correctness. Recent papers show that the expression level of miRNAs are related to the progress status of some diseases such as cancers and DNA computing is introduced as a low cost and concise technique for detection of these biomarkers. In this paper, DNA-based logic gates are implemented in the laboratory to detect the level of miR-21 as the biomarker of cancer. Materials and Methods: At the first, required strands for designing DNA gates are synthesized. Then, double stranded gate is generated in laboratory using a temperature gradient that followed by electrophoresis process. This double strand is the computation engine for detecting the miR-21 biomarker. miR-21 is as input in designed gate. At the end, the expression level of miR-21 is identified by measuring the generated fluorescent. Results: at the first stage, the proposed DNA-based logic gate is evaluated by using the synthesized input strands and then it is experimented on a tumor tissue. Experimental results on synthesized strands show that its detection quality/correctness is 2.5x better than conventional methods. Conclusion: Experimental results on the tumor tissues are successful and are matched with those are extracted from real time PCR results. Also, the results show that this method is significantly more suitable than real time PCR in view of time and cost.

  1. Detecting an elusive invasive species: a diagnostic PCR to detect Burmese python in Florida waters and an assessment of persistence of environmental DNA.

    Piaggio, Antoinette J; Engeman, Richard M; Hopken, Matthew W; Humphrey, John S; Keacher, Kandy L; Bruce, William E; Avery, Michael L


    Recent studies have demonstrated that detection of environmental DNA (eDNA) from aquatic vertebrates in water bodies is possible. The Burmese python, Python bivittatus, is a semi-aquatic, invasive species in Florida where its elusive nature and cryptic coloration make its detection difficult. Our goal was to develop a diagnostic PCR to detect P. bivittatus from water-borne eDNA, which could assist managers in monitoring this invasive species. First, we used captive P. bivittatus to determine whether reptilian DNA could be isolated and amplified from water samples. We also evaluated the efficacy of two DNA isolation methods and two DNA extraction kits commonly used in eDNA preparation. A fragment of the mitochondrial cytochrome b gene from P. bivittatus was detected in all water samples isolated with the sodium acetate precipitate and the QIAamp DNA Micro Kit. Next, we designed P. bivittatus-specific primers and assessed the degradation rate of eDNA in water. Our primers did not amplify DNA from closely related species, and we found that P. bivittatus DNA was consistently detectable up to 96 h. Finally, we sampled water from six field sites in south Florida. Samples from five sites, where P. bivittatus has been observed, tested positive for eDNA. The final site was negative and had no prior documented evidence of P. bivittatus. This study shows P. bivittatus eDNA can be isolated from water samples; thus, this method is a new and promising technique for the management of invasive reptiles. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  2. Detection of multidrug-resistant tuberculosis from stored DNA Samples: A multicenter study

    Marie Sylvianne Rabodoarivelo


    Full Text Available Background: In low-income countries, rapid detection of tuberculosis (TB drug resistance is often restricted by the difficulties of transporting and storing sputum samples from remote health centers to the reference laboratories where molecular tests are available. The aim of this study was to evaluate the performance of four transport and storage systems for molecular detection of rifampicin (RIF and isoniazid (INH resistance. Methods: This was a multicenter study. Molecular detection of RIF and INH resistance was performed directly from smear-positive TB sputa spotted on a slide, FTA card, GenoCard, and ethanol using the Genotype MTBDRplus assay. The performance of the DNA extraction method from each storage support to detect drug resistance was assessed by calculating their sensitivity and specificity compared to the phenotypic method. Results: From all sites, the overall sensitivity and specificity for RIF-resistance detection was 88% and 85%, respectively, for slides, 86% and 92%, respectively, for GenoCard, 87% and 89%, respectively, for FTA card, and 88% and 92%, respectively, for ethanol. For INH-resistance detection, the overall sensitivity and specificity was 82% and 90%, respectively, for slides, 85% and 96%, respectively, for GenoCard, 86% and 92%, respectively, for FTA card, and 86% and 94%, respectively, for ethanol. Conclusion: Smear slides and filter cards showed to be very useful tools to facilitate DNA extraction from sputum samples with the potential to accelerate the detection of drug resistance in remote areas.

  3. Detection of multidrug-resistant tuberculosis from stored DNA Samples: A multicenter study.

    Rabodoarivelo, Marie Sylvianne; Brandao, A; Cergole Novella, M C; C Bombonatte, A G; Imperiale, B; Rakotosamimanana, N; Morcillo, N; Rasolofo, V; Palomino, J C; Martin, A


    In low-income countries, rapid detection of tuberculosis (TB) drug resistance is often restricted by the difficulties of transporting and storing sputum samples from remote health centers to the reference laboratories where molecular tests are available. The aim of this study was to evaluate the performance of four transport and storage systems for molecular detection of rifampicin (RIF) and isoniazid (INH) resistance. This was a multicenter study. Molecular detection of RIF and INH resistance was performed directly from smear-positive TB sputa spotted on a slide, FTA card, GenoCard, and ethanol using the Genotype MTBDRplus assay. The performance of the DNA extraction method from each storage support to detect drug resistance was assessed by calculating their sensitivity and specificity compared to the phenotypic method. From all sites, the overall sensitivity and specificity for RIF-resistance detection was 88% and 85%, respectively, for slides, 86% and 92%, respectively, for GenoCard, 87% and 89%, respectively, for FTA card, and 88% and 92%, respectively, for ethanol. For INH-resistance detection, the overall sensitivity and specificity was 82% and 90%, respectively, for slides, 85% and 96%, respectively, for GenoCard, 86% and 92%, respectively, for FTA card, and 86% and 94%, respectively, for ethanol. Smear slides and filter cards showed to be very useful tools to facilitate DNA extraction from sputum samples with the potential to accelerate the detection of drug resistance in remote areas.

  4. Alkaline gel electrophoresis assay to detect DNA strand breaks and repair mechanisms in Escherichia coli

    José Carlos Pelielo de Mattos


    Full Text Available Reactive oxygen species (ROS can induce lesions in different cellular targets, including DNA. Stannous chloride (SnCl2 is a ROS generator, leading to lethality in Escherichia coli (E. coli, with the base excision repair (BER mechanism playing a role in this process. Many techniques have been developed to detect genotoxicity, as comet assay, in eukaryotic cells, and plasmid DNA agarose gel electrophoresis. In this study, an adaptation of the alkaline gel electrophoresis method was carried out to ascertain the induction of strand breaks by SnCl2 in bacterial DNA, from E. coli BER mutants, and its repair pathway. Results obtained show that SnCl2 was able to induce DNA strand breaks in all strains tested. Moreover, endonuclease IV and exonuclease III play a role in DNA repair. On the whole, data has shown that the alkaline gel electrophoresis assay could be used both for studying DNA strand breaks induction and for associated repair mechanisms.Espécies reativas de oxigênio (ERO podem induzir lesões em diferentes alvos celulares, incluindo o DNA. O cloreto estanoso (SnCl2 é um gerador de ERO que induz letalidade em E. coli, sendo o reparo por excisão de bases (BER um mecanismo importante neste processo. Técnicas como o ensaio cometa (em eucariotos e a eletroforese de DNA plasmidial em gel de agarose têm sido utilizadas para detectar genotoxicidade. No presente estudo, uma adaptação do método de eletroforese em gel alcalino de agarose foi usada para verificar a indução de quebras, pelo SnCl2, no DNA de E. coli, bem como a participação de enzimas do BER na restauração das lesões. Os resultados mostraram que o SnCl2 induziu quebras no DNA de todas as cepas testadas. Além disso, endonuclease IV e exonuclease III estão envolvidas na reparação dos danos. Em resumo, os dados obtidos indicam que a metodologia de eletroforese em gel alcalino de agarose pode ser empregada tanto para o estudo de quebras no DNA, quanto para avaliação dos

  5. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

    Dimitrov, Valentin V.


    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  6. A facile, sensitive, and highly specific trinitrophenol assay based on target-induced synergetic effects of acid induction and electron transfer towards DNA-templated copper nanoclusters.

    Li, Haiyin; Chang, Jiafu; Hou, Ting; Ge, Lei; Li, Feng


    Reliable, selective and sensitive approaches for trinitrophenol (TNP) detection are highly desirable with respect to national security and environmental protection. Herein, a simple and novel fluorescent strategy for highly sensitive and specific TNP assay has been successfully developed, which is based on the quenching of the fluorescent poly(thymine)-templated copper nanoclusters (DNA-CuNCs), through the synergetic effects of acid induction and electron transfer. Upon the addition of TNP, donor-acceptor complexes between the electron-deficient nitro-groups in TNP and the electron-donating DNA templates are formed, resulting in the close proximity between TNP and CuNCs. Moreover, the acidity of TNP contributes to the pH decrease of the system. These factors combine to dramatically quench the fluorescence of DNA-CuNCs, providing a "signal-off" strategy for TNP sensing. The as-proposed strategy demonstrates high sensitivity for TNP assay, and a detection limit of 0.03μM is obtained, which is lower than those reported by using organic fluorescent materials. More significantly, this approach shows outstanding selectivity over a number of TNP analogues, such as 2,4,6-trinitrotoluene (TNT), 2,4-dinitrotoluene (DNT), 2,4-dinitrophenol (DNP), 3-nitrophenol (NP), nitrobenzene (NB), phenol (BP), and toluene (BT). Compared with previous studies, this method does not need complex DNA sequence design, fluorescent dye labeling, or sophisticated organic reactions, rendering the strategy with additional advantages of simplicity and cost-effectiveness. In addition, the as-proposed strategy has been adopted for the detection of TNP in natural water samples, indicating its great potential to be applied in the fields of public safety and environmental monitoring. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. New Detection Modality for Label-Free Quantification of DNA in Biological Samples via Superparamagnetic Bead Aggregation

    Leslie, Daniel C.; Li, Jingyi; Strachan, Briony C.; Begley, Matthew R.; Finkler, David; Bazydlo, Lindsay L.; Barker, N. Scott; Haverstick, Doris; Utz, Marcel; Landers, James P.


    Combining DNA and superparamagnetic beads in a rotating magnetic field produces multiparticle aggregates that are visually striking, and enables label-free optical detection and quantification of DNA at levels in the picogram per microliter range. DNA in biological samples can be quantified directly by simple analysis of optical images of microfluidic wells placed on a magnetic stirrer without DNA purification. Aggregation results from DNA/bead interactions driven either by the presence of a chaotrope (a nonspecific trigger for aggregation) or by hybridization with oligonucleotides on functionalized beads (sequence-specific). This paper demonstrates quantification of DNA with sensitivity comparable to that of the best currently available fluorometric assays. The robustness and sensitivity of the method enable a wide range of applications, illustrated here by counting eukaryotic cells. Using widely available and inexpensive benchtop hardware, the approach provides a highly accessible low-tech microscale alternative to more expensive DNA detection and cell counting techniques. PMID:22423674

  8. Detection of adenovirus in nasopharyngeal specimens by radioactive and nonradioactive DNA probes

    Hyypiae, T.


    The presence of adenovirus DNA in clinical specimens was analyzed by nucleic acid hybridization assays by both radioactive and enzymatic detection systems. The sensitivity of the hybridization tests was in the range of 10 to 100 pg of homologous adenovirus DNA. Minimal background was noticed with unrelated viral and nonviral DNA. Twenty-four nasopharyngeal mucus aspirate specimens, collected from children with acute respiratory infection, were assayed in the hybridization tests and also by an enzyme immunoassay for adenovirus hexon antigen which was used as a reference test. Sixteen specimens positive by the enzyme immunoassay also were positive in the two nucleic acid hybridization tests, and the remaining eight specimens were negative in all of the tests. The results indicate that nucleid acid hybridization tests with both radioactive and nonradioactive probes can be used for diagnosis of microbial infections

  9. Metal Nanoparticles/Porous Silicon Microcavity Enhanced Surface Plasmon Resonance Fluorescence for the Detection of DNA

    Jiajia Wang


    Full Text Available A porous silicon microcavity (PSiMC with resonant peak wavelength of 635 nm was fabricated by electrochemical etching. Metal nanoparticles (NPs/PSiMC enhanced fluorescence substrates were prepared by the electrostatic adherence of Au NPs that were distributed in PSiMC. The Au NPs/PSiMC device was used to characterize the target DNA immobilization and hybridization with its complementary DNA sequences marked with Rhodamine red (RRA. Fluorescence enhancement was observed on the Au NPs/PSiMC device substrate; and the minimum detection concentration of DNA ran up to 10 pM. The surface plasmon resonance (SPR of the MC substrate; which is so well-positioned to improve fluorescence enhancement rather the fluorescence enhancement of the high reflection band of the Bragg reflector; would welcome such a highly sensitive in biosensor.

  10. Metal Nanoparticles/Porous Silicon Microcavity Enhanced Surface Plasmon Resonance Fluorescence for the Detection of DNA.

    Wang, Jiajia; Jia, Zhenhong


    A porous silicon microcavity (PSiMC) with resonant peak wavelength of 635 nm was fabricated by electrochemical etching. Metal nanoparticles (NPs)/PSiMC enhanced fluorescence substrates were prepared by the electrostatic adherence of Au NPs that were distributed in PSiMC. The Au NPs/PSiMC device was used to characterize the target DNA immobilization and hybridization with its complementary DNA sequences marked with Rhodamine red (RRA). Fluorescence enhancement was observed on the Au NPs/PSiMC device substrate; and the minimum detection concentration of DNA ran up to 10 pM. The surface plasmon resonance (SPR) of the MC substrate; which is so well-positioned to improve fluorescence enhancement rather the fluorescence enhancement of the high reflection band of the Bragg reflector; would welcome such a highly sensitive in biosensor.

  11. Detection of Cytomegalovirus DNA in Serum Correlates with Clinical Cytomegalovirus Retinitis in AIDS

    Hansen, K.K.; Ricksten, A.; Hofmann, B.


    The high sensitivity of nested polymerase chain reaction (PCR) offers the possibility of rapid detection of cytomegalovirus (CMV) DNA in serum. Five consecutive serum samples were examined from 52 human immunodeficiency virus (HIV)-seropositive patients (19 of whom had clinically presumed diagnosis...... became positive with the onset of clinical retinitis. In contrast, 29 of 33 HIV-seropositive subjects without clinical CMV chorioretinitis and matched with respect to age and CD4 T cell numbers were negative for CMV DNA in all 5 serum samples. Thus, the presence of CMV DNA in serum analyzed by PCR...... is a good predictive marker of CMV retinitis in HIV-seropositive subjects. A positive PCR results supports the clinical diagnosis and may be useful for monitoring response to antiviral treatment....

  12. Detection of experimental pancreas necrosis by DNA-ase labelled with radioiodine

    Tihanyi, Tibor; Duffek, Laszlo; Balint, Istvan; Flautner, Lajos


    Detection of pancreas necrosis was attempted in dog experiments. Strong association between pancreatic DNA-ase and actin molecules in vitro provided the theoretical basis for the procedure. Pancreatic DNA-ase labelled with 125 I was administered intravenously to dogs in which experimental pancreas necrosis was elicited. Accumulation ratio of radioactivity was above 20 in the necrotic pancreas whereas it varied between 1.6 and 5.6 in other tissues. After administration of 37 MBq 131 I labelled DNA-ase, accumulation of radioactivity could be clearly visualized in the necrotic portions of the removed pancreas by a gamma camera. The investigations will be extended in order to develop a clinically utilizable test. (L.E.)

  13. Detection of DNA specific sequences of Spongospora subterranea in soil and potato tubers

    Cristian Oswaldo Saavedra Rodríguez


    Full Text Available A test has been developed for early identification of the casual agent for potato powdery scab (Spongospora subterranea fs subterranea. Identification was carried out in seeds and soil where this tuber is grown. A polymerase chain reaction (PCR was set up for detecting 372, 390 and 391 bp ribosomal DNA internal transcribed spacer sequences (ITS in the S. subterraneagenome. A method for extracting and purifying DNA from infected plant material (potato root nodes and pustules on the potato was standardised. Plant tissue was obtained by potato tuber propagation using an inoculum from the pathogen in greenhouse conditions. After the PCR had been optimised and its sensitivity determined, a molecular methodology was validated by examining plant material infected with S. subterranea and soil samples infested with the pathogen obtained from the departments of Cundinamarca and Nariño. The PCR detected S. subterranea DNA from infected material and soil samples (all thirty samples from the experimental area analysed proved PCR positive. These results show that this molecular method was not just useful for the early detection of the pathogen in soil samples but as a tool for detecting or determining the possible presence of this micro-organism in places that have been declared f ree of S. subterranea and an effective form of quality control in producing the certif ied potato seed. Key words: Powdery scab, cystosori, internal transcribed spacer, PCR, plasmodiophorid.

  14. Nanoparticle sensor for label free detection of swine DNA in mixed biological samples

    Ali, M E; Hashim, U [Institute of Nano Electronic Engineering (INNE), Universiti Malaysia Perlis, Lot 104-108, Tingkat 1, Block A, Taman Pertiwi Indah, Jalan Kangar-Alor Star, Seriab, 01000 Kangar, Perlis (Malaysia); Mustafa, S; Che Man, Y B; Yusop, M H M [Halal Products Research Institute, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor (Malaysia); Bari, M F [School of Materials Engineering, University Malaysia Perlis, Seriab 01000, Kangar, Perlis (Malaysia); Islam, Kh N [Department of Preclinical Sciences, Faculty of Veterinary Medicine, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor (Malaysia); Hasan, M F, E-mail: [Department of Crop Science, Faculty of Agriculture, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor (Malaysia)


    We used 40 {+-} 5 nm gold nanoparticles (GNPs) as colorimetric sensor to visually detect swine-specific conserved sequence and nucleotide mismatch in PCR-amplified and non-amplified mitochondrial DNA mixtures to authenticate species. Colloidal GNPs changed color from pinkish-red to gray-purple in 2 mM PBS. Visually observed results were clearly reflected by the dramatic reduction of surface plasmon resonance peak at 530 nm and the appearance of new features in the 620-800 nm regions in their absorption spectra. The particles were stabilized against salt-induced aggregation upon the adsorption of single-stranded DNA. The PCR products, without any additional processing, were hybridized with a 17-base probe prior to exposure to GNPs. At a critical annealing temperature (55 {sup 0}C) that differentiated matched and mismatched base pairing, the probe was hybridized to pig PCR product and dehybridized from the deer product. The dehybridized probe stuck to GNPs to prevent them from salt-induced aggregation and retained their characteristic red color. Hybridization of a 27-nucleotide probe to swine mitochondrial DNA identified them in pork-venison, pork-shad and venison-shad binary admixtures, eliminating the need of PCR amplification. Thus the assay was applied to authenticate species both in PCR-amplified and non-amplified heterogeneous biological samples. The results were determined visually and validated by absorption spectroscopy. The entire assay (hybridization plus visual detection) was performed in less than 10 min. The LOD (for genomic DNA) of the assay was 6 {mu}g ml{sup -1} swine DNA in mixed meat samples. We believe the assay can be applied for species assignment in food analysis, mismatch detection in genetic screening and homology studies between closely related species.

  15. Human papillomavirus DNA detection in menstrual blood from patients with cervical intraepithelial neoplasia and condyloma acuminatum.

    Wong, Sze Chuen Cesar; Au, Thomas Chi Chuen; Chan, Sammy Chung Sum; Chan, Charles Ming Lok; Lam, Money Yan Yee; Zee, Benny Chung Ying; Pong, Wei Mei; Chan, Anthony Tak Cheung


    The Papanicolaou test generates pain and embarrassment, and cytology screening has limited sensitivity for detection of cervical neoplasia. These factors urge the use of another screening test that can overcome these limitations. We explore a completely noninvasive method using detection of human papillomavirus (HPV) DNA in women's menstrual blood (MB). The participants were divided into 3 cohorts: (i) 235 patients with cervical intraepithelial neoplasia 3 (CIN 3) (n = 48), CIN 2 (n = 60), CIN 1 (n = 58), or condyloma acuminatum (CAC) (n = 69) before treatment or remission; (ii) from the first cohort of patients, 108 CIN 3 or CIN 2 patients after treatment and 62 CIN 1 or CAC patients after remission; and (iii) 323 apparently normal subjects (ANS) without any cervical disease. The HPV genotypes of the infected patients were confirmed by direct sequencing. Quantitative real-time PCR (QRT-PCR) was used to measure the MB HPV16 load for 15 infected patients. Results showed that the sensitivity, specificity, and positive and negative predictive values for detection of MB HPV DNA in samples from patients with CIN or CAC were 82.8%, 93.1%, 90.0%, and 87.9%, respectively. Moreover, MB HPV DNA was found in samples from 22.2% of CIN 3 or CIN 2 patients after treatment, 0.0% of CIN 1 or CAC patients after remission, and 8.1% of ANS, 4 of whom were found to have CIN 1 or CAC. Furthermore, QRT-PCR showed that the normalized MB HPV16 DNA copy numbers in samples from patients with CIN 1 to CIN 3 were significantly increased. These preliminary results suggested that MB HPV DNA is a potential noninvasive marker for these premalignant cervical diseases.

  16. Nanoparticle sensor for label free detection of swine DNA in mixed biological samples

    Ali, M E; Hashim, U; Mustafa, S; Che Man, Y B; Yusop, M H M; Bari, M F; Islam, Kh N; Hasan, M F


    We used 40 ± 5 nm gold nanoparticles (GNPs) as colorimetric sensor to visually detect swine-specific conserved sequence and nucleotide mismatch in PCR-amplified and non-amplified mitochondrial DNA mixtures to authenticate species. Colloidal GNPs changed color from pinkish-red to gray-purple in 2 mM PBS. Visually observed results were clearly reflected by the dramatic reduction of surface plasmon resonance peak at 530 nm and the appearance of new features in the 620-800 nm regions in their absorption spectra. The particles were stabilized against salt-induced aggregation upon the adsorption of single-stranded DNA. The PCR products, without any additional processing, were hybridized with a 17-base probe prior to exposure to GNPs. At a critical annealing temperature (55 0 C) that differentiated matched and mismatched base pairing, the probe was hybridized to pig PCR product and dehybridized from the deer product. The dehybridized probe stuck to GNPs to prevent them from salt-induced aggregation and retained their characteristic red color. Hybridization of a 27-nucleotide probe to swine mitochondrial DNA identified them in pork-venison, pork-shad and venison-shad binary admixtures, eliminating the need of PCR amplification. Thus the assay was applied to authenticate species both in PCR-amplified and non-amplified heterogeneous biological samples. The results were determined visually and validated by absorption spectroscopy. The entire assay (hybridization plus visual detection) was performed in less than 10 min. The LOD (for genomic DNA) of the assay was 6 μg ml -1 swine DNA in mixed meat samples. We believe the assay can be applied for species assignment in food analysis, mismatch detection in genetic screening and homology studies between closely related species.

  17. Detection of Hepatitis B Virus M204I Mutation by Quantum Dot-Labeled DNA Probe

    Cheng Zhang


    Full Text Available Quantum dots (QDs are semiconductor nanoparticles with a diameter of less than 10 nm, which have been widely used as fluorescent probes in biochemical analysis and vivo imaging because of their excellent optical properties. Sensitive and convenient detection of hepatitis B virus (HBV gene mutations is important in clinical diagnosis. Therefore, we developed a sensitive, low-cost and convenient QDs-mediated fluorescent method for the detection of HBV gene mutations in real serum samples from chronic hepatitis B (CHB patients who had received lamivudine or telbivudine antiviral therapy. We also evaluated the efficiency of this method for the detection of drug-resistant mutations compared with direct sequencing. In CHB, HBV DNA from the serum samples of patients with poor response or virological breakthrough can be hybridized to probes containing the M204I mutation to visualize fluorescence under fluorescence microscopy, where fluorescence intensity is related to the virus load, in our method. At present, the limits of the method used to detect HBV genetic variations by fluorescence quantum dots is 103 IU/mL. These results show that QDs can be used as fluorescent probes to detect viral HBV DNA polymerase gene variation, and is a simple readout system without complex and expensive instruments, which provides an attractive platform for the detection of HBV M204I mutation.

  18. Advanced DNA-Based Point-of-Care Diagnostic Methods for Plant Diseases Detection

    Han Yih Lau


    Full Text Available Diagnostic technologies for the detection of plant pathogens with point-of-care capability and high multiplexing ability are an essential tool in the fight to reduce the large agricultural production losses caused by plant diseases. The main desirable characteristics for such diagnostic assays are high specificity, sensitivity, reproducibility, quickness, cost efficiency and high-throughput multiplex detection capability. This article describes and discusses various DNA-based point-of care diagnostic methods for applications in plant disease detection. Polymerase chain reaction (PCR is the most common DNA amplification technology used for detecting various plant and animal pathogens. However, subsequent to PCR based assays, several types of nucleic acid amplification technologies have been developed to achieve higher sensitivity, rapid detection as well as suitable for field applications such as loop-mediated isothermal amplification, helicase-dependent amplification, rolling circle amplification, recombinase polymerase amplification, and molecular inversion probe. The principle behind these technologies has been thoroughly discussed in several review papers; herein we emphasize the application of these technologies to detect plant pathogens by outlining the advantages and disadvantages of each technology in detail.

  19. Trails of river monsters: Detecting critically endangered Mekong giant catfish Pangasianodon gigas using environmental DNA

    Bellemain Eva


    Full Text Available Pressures on freshwater biodiversity in Southeast Asia are accelerating, yet the status and conservation needs of many of the region’s iconic fish species are poorly known. The Mekong is highly species diverse and supports four of the six largest freshwater fish globally, three of which, including Mekong giant catfish (Pangasianodon gigas, are Critically Endangered. Emerging environmental DNA (eDNA techniques have potential for monitoring threatened freshwater biodiversity, yet have not been applied in complex and biodiverse tropical ecosystems such as the Mekong. We developed species-specific primers for amplifying Mekong giant catfish DNA. In situ validation demonstrated that the DNA amplification was successful for all samples taken in reservoirs with known presence of Mekong giant catfish independent of fish density. We collected water samples from six deep pools on the Mekong, identified through Local Ecological Knowledge, in Cambodia, Lao PDR, and Thailand. DNA was extracted and amplified from these samples using the designed primers and probes. Mekong giant catfish DNA was detected from one sample from the species’ presumed spawning grounds on the Mekong mainstream, near the border between northern Thailand and Lao PDR. eDNA sampling using species-specific primers has potential for surveying and monitoring poorly known species from complex tropical aquatic environments. However accounting for false absences is likely to be required for the method to function with precision when applied to extremely rare species that are highly dispersed within a large river system. We recommend that such approach be utilised more widely by freshwater conservation practitioners for specific applications. The method is best suited for baseline biodiversity assessments or to identify and prioritise locations for more rigorous sampling. Our methods are particularly relevant for systems or species with limited baseline data or with physical characteristics

  20. Techniques of DNA hybridization detect small numbers of mycobacteria with no cross-hybridization with non-mycobacterial respiratory organisms

    Shoemaker, S.A.; Fisher, J.H.; Scoggin, C.H.


    The traditional methods used in identifying mycobacteria, such as acid-fast bacillus stains and culture, are often time-consuming, insensitive, and nonspecific. As part of an ongoing program to improve diagnosis and characterization of mycobacteria, the authors have found that deoxyribonucleic acid (DNA) hybridization techniques using isotopically labeled, single-stranded, total DNA can be used to detect as little as 10(-4) micrograms of Mycobacterium tuberculosis (MTb) DNA. This amount of DNA represents approximately 2 X 10(4) genomes. They have also shown the MTb DNA is sufficiently different from the DNA of non-mycobacterial microorganisms such that cross-hybridization with MTb DNA does not occur under the hybridization conditions employed. The authors speculate that DNA hybridization techniques may allow the rapid, sensitive, and specific identification of mycobacteria

  1. A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

    Jones, J.L.; Bulford, B.B.


    The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

  2. SYBR green-based detection of Leishmania infantum DNA using peripheral blood samples.

    Ghasemian, Mehrdad; Gharavi, Mohammad Javad; Akhlaghi, Lame; Mohebali, Mehdi; Meamar, Ahmad Reza; Aryan, Ehsan; Oormazdi, Hormozd; Ghayour, Zahra


    Parasitological methods for the diagnosis of visceral leishmaniasis (VL) require invasive sampling procedures. The aim of this study was to detect Leishmania infantum (L. infantum) DNA by real time-PCR method in peripheral blood of symptomatic VL patient and compared its performance with nested PCR, an established molecular method with very high diagnostic indices. 47 parasitologically confirmed VL patients diagnosed by direct agglutination test (DAT > 3200), bone marrow aspiration and presented characteristic clinical features (fever, hepatosplenomegaly, and anemia) and 40 controls (non-endemic healthy control-30, Malaria-2, Toxoplasma gondii-2, Mycobacterium tuberculosis-2, HBV-1, HCV-1, HSV-1 and CMV-1) were enrolled in this study. SYBR-green based real time-PCR and nested PCR was performed to amplify the Kinetoplast DNA minicircle gene using the DNA extracted from Buffy coat. From among 47 patients, 45 (95.7 %) were positive by both nested-PCR and real time-PCR. These results indicate that real time-PCR was not only as sensitive as a nested-PCR assay for detection of Leishmania kDNA in clinical sample, but also more rapid. The advantage of real time-PCR based methods over nested-PCR is simple to perform, more faster in which nested-PCR requires post-PCR processing and reducing contamination risk.

  3. Detection of radiation treatment of meat by novel techniques of DNA comet assay

    Khan, A.A.; Khan, H.M.


    Treatment of food to ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests and to extend shelf life; thereby contributing to safer and more plentiful food supply. Food control agencies throughout the world need some reliable, simple and rapid methods for detection of irradiated foods to ensure free choice of consumer and to enforce labeling. The DNA comet assay offers great potential as a rapid tool to screen irradiated and unirradiated samples of several kinds of foods. In the present study, frozen beef has been investigated for detection of irradiation treatment. The samples were subjected to radiation doses of 0,4,5 and 7.0 kGy and were stored in freezer before analysis. The cells were extracted into cold PBS solutions, embedded into the agarose gel on microscope slides, lysed and electrophoressed at a voltage of 2v/cm for 2 min. The fragmented DNA as a result of irradiation treatment was stretched in the gel producing the dose dependent comets. These comets were visible using a simple transmission microscope after silver staining. The controlled and irradiated samples of meat were clearly distinguishable on the basis of the stained patterns of DNA in form of round or conical intact cells for unirradiated samples or in form of comets for irradiated samples. It is therefore, concluded that 'DNA Comet Assay' offers a potential to screen unirradiated and irradiated meat samples. (author)

  4. Simultaneous detection of transgenic DNA by surface plasmon resonance imaging with potential application to gene doping detection.

    Scarano, Simona; Ermini, Maria Laura; Spiriti, Maria Michela; Mascini, Marco; Bogani, Patrizia; Minunni, Maria


    Surface plasmon resonance imaging (SPRi) was used as the transduction principle for the development of optical-based sensing for transgenes detection in human cell lines. The objective was to develop a multianalyte, label-free, and real-time approach for DNA sequences that are identified as markers of transgenosis events. The strategy exploits SPRi sensing to detect the transgenic event by targeting selected marker sequences, which are present on shuttle vector backbone used to carry out the transfection of human embryonic kidney (HEK) cell lines. Here, we identified DNA sequences belonging to the Cytomegalovirus promoter and the Enhanced Green Fluorescent Protein gene. System development is discussed in terms of probe efficiency and influence of secondary structures on biorecognition reaction on sensor; moreover, optimization of PCR samples pretreatment was carried out to allow hybridization on biosensor, together with an approach to increase SPRi signals by in situ mass enhancement. Real-time PCR was also employed as reference technique for marker sequences detection on human HEK cells. We can foresee that the developed system may have potential applications in the field of antidoping research focused on the so-called gene doping.

  5. A DNA Microarray-Based Assay to Detect Dual Infection with Two Dengue Virus Serotypes

    Alvaro Díaz-Badillo


    Full Text Available Here; we have described and tested a microarray based-method for the screening of dengue virus (DENV serotypes. This DNA microarray assay is specific and sensitive and can detect dual infections with two dengue virus serotypes and single-serotype infections. Other methodologies may underestimate samples containing more than one serotype. This technology can be used to discriminate between the four DENV serotypes. Single-stranded DNA targets were covalently attached to glass slides and hybridised with specific labelled probes. DENV isolates and dengue samples were used to evaluate microarray performance. Our results demonstrate that the probes hybridized specifically to DENV serotypes; with no detection of unspecific signals. This finding provides evidence that specific probes can effectively identify single and double infections in DENV samples.

  6. Mapping yeast origins of replication via single-stranded DNA detection.

    Feng, Wenyi; Raghuraman, M K; Brewer, Bonita J


    Studies in th Saccharomyces cerevisiae have provided a framework for understanding how eukaryotic cells replicate their chromosomal DNA to ensure faithful transmission of genetic information to their daughter cells. In particular, S. cerevisiae is the first eukaryote to have its origins of replication mapped on a genomic scale, by three independent groups using three different microarray-based approaches. Here we describe a new technique of origin mapping via detection of single-stranded DNA in yeast. This method not only identified the majority of previously discovered origins, but also detected new ones. We have also shown that this technique can identify origins in Schizosaccharomyces pombe, illustrating the utility of this method for origin mapping in other eukaryotes.

  7. Label-free detection of DNA hybridization using transistors based on CVD grown graphene.

    Chen, Tzu-Yin; Loan, Phan Thi Kim; Hsu, Chang-Lung; Lee, Yi-Hsien; Tse-Wei Wang, Jacob; Wei, Kung-Hwa; Lin, Cheng-Te; Li, Lain-Jong


    The high transconductance and low noise of graphene-based field-effect transistors based on large-area monolayer graphene produced by chemical vapor deposition are used for label-free electrical detection of DNA hybridization. The gate materials, buffer concentration and surface condition of graphene have been optimized to achieve the DNA detection sensitivity as low as 1 pM (10(-12) M), which is more sensitive than the existing report based on few-layer graphene. The graphene films obtained using conventional PMMA-assisted transfer technique exhibits PMMA residues, which degrade the sensing performance of graphene. We have demonstrated that the sensing performance of the graphene samples prepared by gold-transfer is largely enhanced (by 125%). Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Detection and identification of phytoplasma DNA in symptomatic mushrooms of the genus Ramaria (O. Gomphales

    Martín, María P.


    Full Text Available Using polymerase chain reaction assays with specific primers for amplifying phytoplasma 16S rDNA, the presence of phytoplasmas in Ramaria basidiomes with abnormal development has been detected for the first time in fungi. Phytoplasmas have not been detected in asymptomatic basidiomes. Sequence analyses based on parsimony and maximum likelihood place the phytoplasma in the Stolbur group.Mediante la reacci6n en cadena de la polimerasa y el uso de iniciadores específicos para la regidn 16S rDNA de fitoplasmas, se ha detectado por primera vez en hongos la presencia de estos organismos en basidiomas de Ramaria que presentaban un desarrollo anormal. El analisis filogen&ico de las secuencias por los criterios de parsimonia y de maxima verosimilitud confirman a este fitoplasma como del grupo "Stolbur".

  9. Use of SCGE method for detection of DNA comet in irradiated samples of poultry and shrimp

    Rajaei, R.; Hosseini, S.L.


    DNA in food may sustain damage by gamma irradiation.This damage can be detected by a sensitive technique, called single cell gel electrophoresis. This is a simple and low-cost technique for rapid screening of the cells of irradiated foodstuffs. For this purpose, poultry and shrimp samples were irradiated by the 60 Co gamma radiation. The radiation doses for poultry were 2,5 and 7 kGy and for shrimp were 3 and 7kGy, respectively. The irradiation samples were compared with those of unirradiated types (control). In addition, the effects of shelf-life and temperature were considered on the poultry samples only. We have found that this technique is easily applicable for identification of irradiated from unirradiated samples and it is found to be irrespective of the applied dose. It is worth mentioning that any DNA change arising from any source, for example temperature fluctuation, may be detected by the single cell gel electrophoresis technique

  10. Detection of DNA oligonucleotides with base mutations by terahertz spectroscopy and microstructures.

    Mingjie Tang

    Full Text Available DNA oligonucleotides with a 5-base mutation at the 3'-terminus were investigated by terahertz (THz spectroscopy in a marker-free manner. The four single-stranded oligonucleotides with 17nt have been detected with specificity on a microfluidic chip, and corroborated by spectral measurements with split-ring resonators. The number of hydrogen bonds formed between the oligonucleotide and its surrounding water molecules, deemed a key contribution to the THz absorption of biological solutions, was explored by molecular dynamics simulations to explain the experimental findings. Our work underlies the feasibility of THz spectroscopy combined with microstructures for marker-free detection of DNA, which may form the basis of a prospective diagnostic tool for studying genic mutation.

  11. An integrated strategy combining DNA walking and NGS to detect GMOs.

    Fraiture, Marie-Alice; Herman, Philippe; Papazova, Nina; De Loose, Marc; Deforce, Dieter; Ruttink, Tom; Roosens, Nancy H


    Recently, we developed a DNA walking system for the detection and characterization of a broad spectrum of GMOs in routine analysis of food/feed matrices. Here, we present a new version with improved throughput and sensitivity by coupling the DNA walking system to Pacific Bioscience® Next-generation sequencing technology. The performance of the new strategy was thoroughly assessed through several assays. First, we tested its detection and identification capability on grains with high or low GMO content. Second, the potential impacts of food processing were investigated using rice noodle samples. Finally, GMO mixtures and a real-life sample were analyzed to illustrate the applicability of the proposed strategy in routine GMO analysis. In all tested samples, the presence of multiple GMOs was unambiguously proven by the characterization of transgene flanking regions and the combinations of elements that are typical for transgene constructs. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  12. Clinical patterns associated with the concurrent detection of anti-HBs and HBV DNA.

    Anastasiou, Olympia E; Widera, Marek; Korth, Johannes; Kefalakes, Helenie; Katsounas, Antonios; Hilgard, Gudrun; Gerken, Guido; Canbay, Ali; Ciesek, Sandra; Verheyen, Jens


    Simultaneous detection of anti-HBs and HBV DNA is a rare serological combination and has been described in acute and chronic HBV infection. To scrutinize viral and clinical patterns associated with concurrent detection of anti-HBs and HBV DNA. Simultaneous detection of anti-HBs and HBV DNA was observed in 64/1444 (4.4%) patients treated for HBV infection at the University Hospital of Essen from 2006 to 2016 (8 with acute, 20 with reactivated, and 36 chronic HBV infection). Clinical data and laboratory parameters were analyzed. Regions of the small hepatitis B surface antigen (SHB) and the reverse transcriptase (RT) were sequenced using next generation sequencing (NGS). Among the 64 patients with detectable HBV DNA and anti-HBs, 17 were HBsAg negative (HBsAg[-]), and two had acute liver failure. Patients with acute HBV infection had fewer genotype specific amino acid substitutions in the SHB region than patients with reactivated HBV infection (4 [4.5] vs 9 [16.25], P = 0.043). However, we could observe a significantly higher number of mutations in the a-determinant region when comparing chronically infected patients to patients with acute infection (0 [1] vs 1 [1], P = 0.044). The ratio of nonsynonymous to synonymous mutations (Ka/Ks) was on average >1 for the SHB region and 1) in the SHB region indicates that anti-HBs might have exerted selection pressure on the HBsAg. In three cases the diagnosis of acute HBV infection would have been at least delayed by only focusing on HBsAg testing. © 2017 Wiley Periodicals, Inc.

  13. GANN: Genetic algorithm neural networks for the detection of conserved combinations of features in DNA

    Beiko Robert G


    Full Text Available Abstract Background The multitude of motif detection algorithms developed to date have largely focused on the detection of patterns in primary sequence. Since sequence-dependent DNA structure and flexibility may also play a role in protein-DNA interactions, the simultaneous exploration of sequence- and structure-based hypotheses about the composition of binding sites and the ordering of features in a regulatory region should be considered as well. The consideration of structural features requires the development of new detection tools that can deal with data types other than primary sequence. Results GANN (available at is a machine learning tool for the detection of conserved features in DNA. The software suite contains programs to extract different regions of genomic DNA from flat files and convert these sequences to indices that reflect sequence and structural composition or the presence of specific protein binding sites. The machine learning component allows the classification of different types of sequences based on subsamples of these indices, and can identify the best combinations of indices and machine learning architecture for sequence discrimination. Another key feature of GANN is the replicated splitting of data into training and test sets, and the implementation of negative controls. In validation experiments, GANN successfully merged important sequence and structural features to yield good predictive models for synthetic and real regulatory regions. Conclusion GANN is a flexible tool that can search through large sets of sequence and structural feature combinations to identify those that best characterize a set of sequences.

  14. Rapid detection of fungal keratitis with DNA-stabilizing FTA filter paper.

    Menassa, Nardine; Bosshard, Philipp P; Kaufmann, Claude; Grimm, Christian; Auffarth, Gerd U; Thiel, Michael A


    Purpose. Polymerase chain reaction (PCR) is increasingly important for the rapid detection of fungal keratitis. However, techniques of specimen collection and DNA extraction before PCR may interfere with test sensitivity. The purpose of this study was to investigate the use of DNA-stabilizing FTA filter paper (Indicating FTA filter paper; Whatman International, Ltd., Maidstone, UK) for specimen collection without DNA extraction in a single-step, nonnested PCR for fungal keratitis. Methods. Specimens were collected from ocular surfaces with FTA filter discs, which automatically lyse collected cells and stabilize nucleic acids. Filter discs were directly used in single-step PCR reactions to detect fungal DNA. Test sensitivity was evaluated with serial dilutions of Candida albicans, Fusarium oxysporum, and Aspergillus fumigatus cultures. Test specificity was analyzed by comparing 196 and 155 healthy individuals from Switzerland and Egypt, respectively, with 15 patients with a diagnosis of microbial keratitis. Results. PCR with filter discs detected 3 C. albicans, 25 F. oxysporum, and 125 A. fumigatus organisms. In healthy volunteers, fungal PCR was positive in 1.0% and 8.4% of eyes from Switzerland and Egypt, respectively. Fungal PCR remained negative in 10 cases of culture-proven bacterial keratitis, became positive in 4 cases of fungal keratitis, but missed 1 case of culture-proven A. fumigatus keratitis. Conclusions. FTA filter paper for specimen collection together with direct PCR is a promising method of detecting fungal keratitis. The analytical sensitivity is high without the need for a semi-nested or nested second PCR, the clinical specificity is 91.7% to 99.0%, and the method is rapid and inexpensive.

  15. Comparison of DNA extraction protocols to detect Mycobacterium bovis in bovine tissue by PCR

    Cássia Yumi Ikuta


    Full Text Available The current scenario of international beef trading has increased the pressure for better and faster diagnosis of bovine tuberculosis. Although traditional culture remains the gold standard method to confirm Mycobacterium bovis infection, it is exceedingly time consuming, and demands viable mycobacteria. Molecular methods overcome the flaws of the bacteriological methods with faster detection and identification. However, mycobacterial features like a complex cell wall and pathogen–host interaction make the molecular detection a challenge. Three protocols for DNA extraction (A, B and C from bovine tissues were tested to verify the most suitable technique for routine diagnostic assessment of their specificity and sensitivity. Thirty culture-positive and thirty culture-negative granulomatous lesions were included in the trial. From each sample, three tissue suspensions at different dilutions (10-1, 10-2 and 10-3 were prepared and submitted to DNA extraction. PCR procedures targeting IS6110 were performed, employing two volumes of DNA: 5 µL of all three dilutions, and 2.5 µL of the 10-1 dilution. Protocol A was able to detect members of the M. tuberculosis complex in most samples. The sensitivity of the test decreased with increase in tissue-suspension dilution. Although Protocol A presented the highest sensitivity followed by C and B, it showed the lowest specificity, which can be due to a failure in primary isolation caused by the lack of viable organisms or incubation time. Regardless classical bacteriological methods are still recommended by OIE, after evaluating the sensitivity of DNA extraction protocols and PCR procedures, we conclude that the best strategy for M. bovis detection is to follow Protocol A on concentrated tissue suspensions.

  16. The objective of this program is to develop innovative DNA detection technologies to achieve fast microbial community assessment. The specific approaches are (1) to develop inexpensive and reliable sequence-proof hybridization DNA detection technology (2) to develop quantitative DNA hybridization technology for microbial community assessment and (3) to study the microbes which have demonstrated the potential to have nuclear waste bioremediation

    Chen, Chung H.


    The objective of this program is to develop innovative DNA detection technologies to achieve fast microbial community assessment. The specific approaches are (1) to develop inexpensive and reliable sequence-proof hybridization DNA detection technology (2) to develop quantitative DNA hybridization technology for microbial community assessment and (3) to study the microbes which have demonstrated the potential to have nuclear waste bioremediation

  17. Gold Nanoparticles for the Detection of DNA Adducts as Biomarkers of Exposure to Acrylamide

    Larguinho, Miguel Angelo Rodrigues

    The main objective of this thesis was the development of a gold nanoparticle-based methodology for detection of DNA adducts as biomarkers, to try and overcome existing drawbacks in currently employed techniques. For this objective to be achieved, the experimental work was divided in three components: sample preparation, method of detection and development of a model for exposure to acrylamide. Different techniques were employed and combined for de-complexation and purification of DNA samples (including ultrasonic energy, nuclease digestion and chromatography), resulting in a complete protocol for sample treatment, prior to detection. The detection of alkylated nucleotides using gold nanoparticles was performed by two distinct methodologies: mass spectrometry and colorimetric detection. In mass spectrometry, gold nanoparticles were employed for laser desorption/ionisation instead of the organic matrix. Identification of nucleotides was possible by fingerprint, however no specific mass signals were denoted when using gold nanoparticles to analyse biological samples. An alternate method using the colorimetric properties of gold nanoparticles was employed for detection. This method inspired in the non-cross-linking assay allowed the identification of glycidamide-guanine adducts and DNA adducts generated in vitro. For the development of a model of exposure, two different aquatic organisms were studies: a goldfish and a mussel. Organisms were exposed to waterborne acrylamide, after which mortality was recorded and effect concentrations were estimated. In goldfish, both genotoxicity and metabolic alterations were assessed and revealed dose-effect relationships of acrylamide. Histopathological alterations were verified primarily in pancreatic cells, but also in hepatocytes. Mussels showed higher effect concentrations than goldfish. Biomarkers of oxidative stress, biotransformation and neurotoxicity were analysed after prolonged exposure, showing mild oxidative stress in

  18. Comparison of commercial DNA preparation kits for the detection of Brucellae in tissue using quantitative real-time PCR

    Straube Eberhard


    Full Text Available Abstract Background The detection of Brucellae in tissue specimens using PCR assays is difficult because the amount of bacteria is usually low. Therefore, optimised DNA extraction methods are critical. The aim of this study was to assess the performance of commercial kits for the extraction of Brucella DNA. Methods Five kits were evaluated using clinical specimens: QIAamp™ DNA Mini Kit (QIAGEN, peqGold™ Tissue DNA Mini Kit (PeqLab, UltraClean™ Tissue and Cells DNA Isolation Kit (MoBio, DNA Isolation Kit for Cells and Tissues (Roche, and NucleoSpin™ Tissue (Macherey-Nagel. DNA yield was determined using a quantitative real-time PCR assay targeting IS711 that included an internal amplification control. Results Kits of QIAGEN and Roche provided the highest amount of DNA, Macherey-Nagel and Peqlab products were intermediate whereas MoBio yielded the lowest amount of DNA. Differences were significant (p Conclusions We observed differences in DNA yield as high as two orders of magnitude for some samples between the best and the worst DNA extraction kits and inhibition was observed occasionally. This indicates that DNA purification may be more relevant than expected when the amount of DNA in tissue is very low.

  19. [Endonuclease modified comet assay for oxidative DNA damage induced by detection of genetic toxicants].

    Zhao, Jian; Li, Hongli; Zhai, Qingfeng; Qiu, Yugang; Niu, Yong; Dai, Yufei; Zheng, Yuxin; Duan, Huawei


    The aim of this study was to investigate the use of the lesion-specific endonucleases-modified comet assay for analysis of DNA oxidation in cell lines. DNA breaks and oxidative damage were evaluated by normal alkaline and formamidopyrimidine-DNA-glycosylase (FPG) modified comet assays. Cytotoxicity were assessed by MTT method. The human bronchial epithelial cell (16HBE) were treated with benzo (a) pyrene (B(a)P), methyl methanesulfonate (MMS), colchicine (COL) and vincristine (VCR) respectively, and the dose is 20 µmol/L, 25 mg/ml, 5 mg/L and 0.5 mg/L for 24 h, respectively. Oxidative damage was also detected by levels of reactive oxygen species in treated cells. Four genotoxicants give higher cytotoxicity and no significant changes on parameters of comet assay treated by enzyme buffer. Cell survival rate were (59.69 ± 2.60) %, (54.33 ± 2.81) %, (53.11 ± 4.00) %, (51.43 ± 3.92) % in four groups, respectively. There was the direct DNA damage induced by test genotoxicants presented by tail length, Olive tail moment (TM) and tail DNA (%) in the comet assay. The presence of FPG in the assays increased DNA migration in treated groups when compared to those without it, and the difference was statistically significant which indicated that the clastogen and aneugen could induce oxidative damage in DNA strand. In the three parameters, the Olive TM was changed most obviously after genotoxicants treatment. In the contrast group, the Olive TM of B(a) P,MMS, COL,VCR in the contrast groups were 22.99 ± 17.33, 31.65 ± 18.86, 19.86 ± 9.56 and 17.02 ± 9.39, respectively, after dealing with the FPG, the Olive TM were 34.50 ± 17.29, 43.80 ± 10.06, 33.10 ± 12.38, 28.60 ± 10.53, increased by 58.94%, 38.48%, 66.86% and 68.21%, respectively (t value was 3.91, 3.89, 6.66 and 3.87, respectively, and all P comet assay appears more specific for detecting oxidative DNA damage induced by genotoxicants exposure, and the application of comet assay will be expanded. The endonuclease

  20. Nanobiosensor for Detection and Quantification of DNA Sequences in Degraded Mixed Meats

    M. E. Ali


    Full Text Available A novel class of nanobiosensor was developed by integrating a 27-nucleotide AluI fragment of swine cytochrome b (cytb gene to a 3-nm diameter citrate-tannate coated gold nanoparticle (GNP. The biosensor detected 0.5% and 1% pork in raw and 2.5-h autoclaved pork-beef binary admixtures in a single step without any separation or washing. The hybridization kinetics of the hybrid sensor was studied with synthetic and AluI digested real pork targets from moderate to extreme target concentrations and a sigmoidal relationship was found. Using the kinetic curve, a convenient method for quantifying and counting target DNA copy number was developed. The accuracy of the method was over 90% and 80% for raw and autoclaved pork-beef binary admixtures in the range of 5–100% pork adulteration. The biosensor probe identified a target DNA sequence that was several-folds shorter than a typical PCR-template. This offered the detection and quantitation of potential targets in highly processed or degraded samples where PCR amplification was not possible due to template crisis. The assay was a viable alternative approach of qPCR for detecting, quantifying and counting copy number of shorter size DNA sequences to address a wide ranging biological problem in food industry, diagnostic laboratories and forensic medicine.

  1. DNA-Based Nanobiosensors as an Emerging Platform for Detection of Disease

    Khalid M. Abu-Salah


    Full Text Available Detection of disease at an early stage is one of the biggest challenges in medicine. Different disciplines of science are working together in this regard. The goal of nanodiagnostics is to provide more accurate tools for earlier diagnosis, to reduce cost and to simplify healthcare delivery of effective and personalized medicine, especially with regard to chronic diseases (e.g., diabetes and cardiovascular diseases that have high healthcare costs. Up-to-date results suggest that DNA-based nanobiosensors could be used effectively to provide simple, fast, cost-effective, sensitive and specific detection of some genetic, cancer, and infectious diseases. In addition, they could potentially be used as a platform to detect immunodeficiency, and neurological and other diseases. This review examines different types of DNA-based nanobiosensors, the basic principles upon which they are based and their advantages and potential in diagnosis of acute and chronic diseases. We discuss recent trends and applications of new strategies for DNA-based nanobiosensors, and emphasize the challenges in translating basic research to the clinical laboratory.

  2. Development of a real-time PCR to detect Demodex canis DNA in different tissue samples.

    Ravera, Ivan; Altet, Laura; Francino, Olga; Bardagí, Mar; Sánchez, Armand; Ferrer, Lluís


    The present study reports the development of a real-time polymerase chain reaction (PCR) to detect Demodex canis DNA on different tissue samples. The technique amplifies a 166 bp of D. canis chitin synthase gene (AB 080667) and it has been successfully tested on hairs extracted with their roots and on formalin-fixed paraffin embedded skin biopsies. The real-time PCR amplified on the hairs of all 14 dogs with a firm diagnosis of demodicosis and consistently failed to amplify on negative controls. Eleven of 12 skin biopsies with a morphologic diagnosis of canine demodicosis were also positive. Sampling hairs on two skin points (lateral face and interdigital skin), D. canis DNA was detected on nine of 51 healthy dogs (17.6%) a much higher percentage than previously reported with microscopic studies. Furthermore, it is foreseen that if the number of samples were increased, the percentage of positive dogs would probably also grow. Moreover, in four of the six dogs with demodicosis, the samples taken from non-lesioned skin were positive. This finding, if confirmed in further studies, suggests that demodicosis is a generalized phenomenon in canine skin, due to proliferation of local mite populations, even though macroscopic lesions only appear in certain areas. The real-time PCR technique to detect D. canis DNA described in this work is a useful tool to advance our understanding of canine demodicosis.

  3. Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage

    Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M.; Savva, D.; Walker, C.


    The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)

  4. Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage

    Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M. [University of Plymouth (United Kingdom). Environmental Research Centre; Child, P. [ADAS Boxworth (United Kingdom); Savva, D.; Walker, C. [University of Reading (United Kingdom). School of Animal and Microbial Sciences


    The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)

  5. An effective method for detection and analysis of DNA damage induced by heavy-ion beams

    Kazama, Y.; Saito, H.; Fujiwara, M.; Matsuyama, T.; Hayashi, Y.; Ryuto, H.; Fukunishi, N.; Abe, T.


    We have developed an efficient system to detect and analyze DNA mutations induced by heavy-ion beams in Arabidopsis thaliana. In this system, a stable transgenic Arabidopsis line that constitutively expresses a yellow fluorescent protein (YFP) by a single-copy gene at a genomic locus was constructed and irradiated with heavy-ion beams. The YFP gene is a target of mutagenesis, and its loss of function or expression can easily be detected by the disappearance of YFP signals in planta under microscopy. With this system, a sup(12)Csup(6+)- induced mutant with single deletion and multiple base changes was isolated

  6. Lanthanide mixed ligand chelates for DNA profiling and latent fingerprint detection

    Menzel, E. R.; Allred, Clay


    It is our aim to develop a universally applicable latent fingerprint detection method using lanthanide (rare-earth) complexes as a source of luminescence. Use of these lanthanide complexes offers advantages on several fronts, including benefits from large Stokes shifts, long luminescence lifetimes, narrow emissions, ability of sequential assembly of complexes, and chemical variability of the ligands. Proper exploitation of these advantages would lead to a latent fingerprint detection method superior to any currently available. These same characteristics also lend themselves to many of the problems associated with DNA processing in the forensic science context.

  7. Functionalization of optical nanotip arrays with an electrochemical microcantilever for multiplexed DNA detection.

    Descamps, Emeline; Duroure, Nathalie; Deiss, Frédérique; Leichlé, Thierry; Adam, Catherine; Mailley, Pascal; Aït-Ikhlef, Ali; Livache, Thierry; Nicu, Liviu; Sojic, Neso


    Optical nanotip arrays fabricated on etched fiber bundles were functionalized with DNA spots. Such unconventional substrates (3D and non-planar) are difficult to pattern with standard microfabrication techniques but, using an electrochemical cantilever, up to 400 spots were electrodeposited on the nanostructured optical surface in 5 min. This approach allows each spot to be addressed individually and multiplexed fluorescence detection is demonstrated. Finally, remote fluorescence detection was performed by imaging through the optical fiber bundle itself after hybridisation with the complementary sequence.

  8. Sensitive detection of point mutation by electrochemiluminescence and DNA ligase-based assay

    Zhou, Huijuan; Wu, Baoyan


    The technology of single-base mutation detection plays an increasingly important role in diagnosis and prognosis of genetic-based diseases. Here we reported a new method for the analysis of point mutations in genomic DNA through the integration of allele-specific oligonucleotide ligation assay (OLA) with magnetic beads-based electrochemiluminescence (ECL) detection scheme. In this assay the tris(bipyridine) ruthenium (TBR) labeled probe and the biotinylated probe are designed to perfectly complementary to the mutant target, thus a ligation can be generated between those two probes by Taq DNA Ligase in the presence of mutant target. If there is an allele mismatch, the ligation does not take place. The ligation products are then captured onto streptavidin-coated paramagnetic beads, and detected by measuring the ECL signal of the TBR label. Results showed that the new method held a low detection limit down to 10 fmol and was successfully applied in the identification of point mutations from ASTC-α-1, PANC-1 and normal cell lines in codon 273 of TP53 oncogene. In summary, this method provides a sensitive, cost-effective and easy operation approach for point mutation detection.

  9. The first detection of Babesia species DNA from Japanese black bears (Ursus thibetanus japonicus) in Japan.

    Ikawa, Kazuhito; Aoki, Mikiko; Ichikawa, Madoka; Itagaki, Tadashi


    In this study, we tried to detect protozoan blood parasites from the liver or blood of 156 Japanese black bears (Ursus thibetanus japonicus) in Iwate Prefecture of Japan by polymerase chain reaction. Two amplicons (approximately 540 bp and 480 bp) were detected by amplification for V4 hyper-variable regions of the 18S rRNA gene. Approximately 540-bp products were obtained in 119 samples (76.3%) and were considered to be DNA of Hepatozoon ursi. Approximately 480-bp products were obtained in 22 samples (14.1%) and were considered to be DNA of Babesia species. The nucleotide sequences (1635 bp) of the 18S rRNA gene of Babesia sp. were very similar (99.3%) to those (AY190123, AY190124) of Babesia sp. detected previously from Ixodes ovatus. Phylogenetic analysis showed that Babesia sp. detected in this study closely related to Babesia sp. derived from raccoons in Japan and the U.S.A. This is the first report of Babesia species detected from Japanese black bears. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  10. Graphene oxide and DNA aptamer based sub-nanomolar potassium detecting optical nanosensor

    Datta, Debopam; Sarkar, Ketaki; Mukherjee, Souvik; Meshik, Xenia; Stroscio, Michael A.; Dutta, Mitra


    Quantum-dot (QD) based nanosensors are frequently used by researchers to detect small molecules, ions and different biomolecules. In this article, we present a sensor complex/system comprised of deoxyribonucleic acid (DNA) aptamer, gold nanoparticle and semiconductor QD, attached to a graphene oxide (GO) flake for detection of potassium. As reported herein, it is demonstrated that QD-aptamer-quencher nanosensor functions even when tethered to GO, opening the way to future applications where sensing can be accomplished simultaneously with other previously demonstrated applications of GO such as serving as a nanocarrier for drug delivery. Herein, it is demonstrated that the DNA based thrombin binding aptamer used in this study undergoes the conformational change needed for sensing even when the nanosensor complex is anchored to the GO. Analysis with the Hill equation indicates the interaction between aptamer and potassium follows sigmoidal Hill kinetics. It is found that the quenching efficiency of the optical sensor is linear with the logarithm of concentration from 1 pM to 100 nM and decreases for higher concentration due to unavailability of aptamer binding sites. Such a simple and sensitive optical aptasensor with minimum detection capability of 1.96 pM for potassium ion can also be employed in-vitro detection of different physiological ions, pathogens and disease detection methods.

  11. Multiplexed colorimetric detection of Kaposi's sarcoma associated herpesvirus and Bartonella DNA using gold and silver nanoparticles

    Mancuso, Matthew; Jiang, Li; Cesarman, Ethel; Erickson, David


    Kaposi's sarcoma (KS) is an infectious cancer occurring most commonly in human immunodeficiency virus (HIV) positive patients and in endemic regions, such as Sub-Saharan Africa, where KS is among the top four most prevalent cancers. The cause of KS is the Kaposi's sarcoma-associated herpesvirus (KSHV, also called HHV-8), an oncogenic herpesvirus that while routinely diagnosed in developed nations, provides challenges to developing world medical providers and point-of-care detection. A major challenge in the diagnosis of KS is the existence of a number of other diseases with similar clinical presentation and histopathological features, requiring the detection of KSHV in a biopsy sample. In this work we develop an answer to this challenge by creating a multiplexed one-pot detection system for KSHV DNA and DNA from a frequently confounding disease, bacillary angiomatosis. Gold and silver nanoparticle aggregation reactions are tuned for each target and a multi-color change system is developed capable of detecting both targets down to levels between 1 nM and 2 nM. The system developed here could later be integrated with microfluidic sample processing to create a final device capable of solving the two major challenges in point-of-care KS detection.

  12. Design of a DNA chip for detection of unknown genetically modified organisms (GMOs).

    Nesvold, Håvard; Kristoffersen, Anja Bråthen; Holst-Jensen, Arne; Berdal, Knut G


    Unknown genetically modified organisms (GMOs) have not undergone a risk evaluation, and hence might pose a danger to health and environment. There are, today, no methods for detecting unknown GMOs. In this paper we propose a novel method intended as a first step in an approach for detecting unknown genetically modified (GM) material in a single plant. A model is designed where biological and combinatorial reduction rules are applied to a set of DNA chip probes containing all possible sequences of uniform length n, creating probes capable of detecting unknown GMOs. The model is theoretically tested for Arabidopsis thaliana Columbia, and the probabilities for detecting inserts and receiving false positives are assessed for various parameters for this organism. From a theoretical standpoint, the model looks very promising but should be tested further in the laboratory. The model and algorithms will be available upon request to the corresponding author.

  13. An optimized pentaplex PCR for detecting DNA mismatch repair-deficient colorectal cancers.

    Ajay Goel


    Full Text Available Microsatellite instability (MSI is used to screen colorectal cancers (CRC for Lynch Syndrome, and to predict outcome and response to treatment. The current technique for measuring MSI requires DNA from normal and neoplastic tissues, and fails to identify tumors with specific DNA mismatch repair (MMR defects. We tested a panel of five quasi-monomorphic mononucleotide repeat markers amplified in a single multiplex PCR reaction (pentaplex PCR to detect MSI.We investigated a cohort of 213 CRC patients, comprised of 114 MMR-deficient and 99 MMR-proficient tumors. Immunohistochemical (IHC analysis evaluated the expression of MLH1, MSH2, PMS2 and MSH6. MSI status was defined by differences in the quasi-monomorphic variation range (QMVR from a pool of normal DNA samples, and measuring differences in allele lengths in tumor DNA.Amplification of 426 normal alleles allowed optimization of the QMVR at each marker, and eliminated the requirement for matched reference DNA to define MSI in each sample. Using > or = 2/5 unstable markers as the criteria for MSI resulted in a sensitivity of 95.6% (95% CI = 90.1-98.1% and a positive predictive value of 100% (95% CI = 96.6%-100%. Detection of MSH6-deficiency was limited using all techniques. Data analysis with a three-marker panel (BAT26, NR21 and NR27 was comparable in sensitivity (97.4% and positive predictive value (96.5% to the five marker panel. Both approaches were superior to the standard approach to measuring MSI.An optimized pentaplex (or triplex PCR offers a facile, robust, very inexpensive, highly sensitive, and specific assay for the identification of MSI in CRC.

  14. Adenovirus Detection by the cGAS/STING/TBK1 DNA Sensing Cascade

    Lam, Eric; Stein, Saskia


    Adenovirus (Ad) infection triggers a cell-specific antiviral response following exposure of viral DNA to the intracellular compartment. A variety of DNA sensors (DAI, AIM2, DDx41, RNA polymerase [Pol] III, and IFI16 [p204]) have been identified in recent years; however, the DNA sensor involved in detection of adenovirus has not been established. Cyclic GMP-AMP synthase (cGAS), a DNA sensor that produces a cyclic guanine-adenine dinucleotide (cGAMP) inducer of STING, has been examined to determine its role in generating an antiadenoviral response. Short hairpin RNA (shRNA) lentiviral vectors targeting TBK1, STING, and cGAS were established in murine MS1 endothelial and RAW 264.7 macrophage cell lines. Knockdown of TBK1, STING, and cGAS results in a dramatic reduction in the activation of the primary antiviral response marker phosphorylated interferon (IFN) response factor 3 (IRF3) following exposure to adenovirus. Furthermore, activation of secondary type I IFN signaling targets (ptyrSTAT1 and ptyrSTAT2 [ptyrSTAT1/2]) was also compromised. Consistent with compromised activation of primary and secondary response markers, transcriptional activation of IRF3-responsive genes (beta IFN [IFN-β], ISG15, ISG54) and secondary response transcripts were diminished in cells knocked down in cGAS, STING, or TBK1. These data establish cGAS as the dominant cytosolic DNA sensor responsible for detection of internalized adenovirus leading to induction of the type I interferon antiviral cascade. PMID:24198409

  15. Rapid colorimetric assay for detection of Listeria monocytogenes in food samples using LAMP formation of DNA concatemers and gold nanoparticle-DNA probe complex

    Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum


    ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.

  16. Molecular beacon-based real-time PCR method for detection of porcine DNA in gelatin and gelatin capsules.

    Mohamad, Nurhidayatul Asma; Mustafa, Shuhaimi; Khairil Mokhtar, Nur Fadhilah; El Sheikha, Aly Farag


    The pharmaceutical industry has boosted gelatin consumption worldwide. This is supported by the availability of cost-effective gelatin production from porcine by-products. However, cross-contamination of gelatin materials, where porcine gelatin was unintentionally included in the other animal sources of gelatin, has caused significant concerns about halal authenticity. The real-time polymerase chain reaction (PCR) has enabled a highly specific and sensitive animal species detection method in various food products. Hence, such a technique was employed in the present study to detect and quantify porcine DNA in gelatin using a molecular beacon probe, with differences in performance between mitochondrial (cytochrome b gene) and chromosomal DNA-(MPRE42 repetitive element) based porcine-specific PCR assays being compared. A higher sensitivity was observed in chromosomal DNA (MPRE-PCR assay), where this assay allows the detection of gelatin DNA at amounts as as low as 1 pg, whereas mitochondrial DNA (CBH-PCR assay) can only detect at levels down to 10 pg of gelatin DNA. When an analysis with commercial gelatin and gelatin capsule samples was conducted, the same result was observed, with a significantly more sensitive detection being provided by the repetitive element of chromosomal DNA. The present study has established highly sensitive DNA-based porcine detection systems derived from chromosomal DNA that are feasible for highly processed products such as gelatin and gelatin capsules containing a minute amount of DNA. This sensitive detection method can also be implemented to assist the halal authentication process of various food products available on the market. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  17. Typical xeroderma pigmentosum complementation group A fibroblasts have detectable ultraviolet light-induced unscheduled DNA synthesis

    Petinga, R.A.; Andrews, A.D.; Robbins, J.H.; Tarone, R.E.


    Ultraviolet-induced nuclear uptake of tritiated thymidine [ 3 H]dThd demonstrable by autoradiography in non-synthesis phases of the cell cycle is known as unscheduled DNA synthesis and reflects repair replication of ultraviolet-damaged DNA. We have reported that the rate of any such unscheduled DNA synthesis in typical group A xeroderma pigmentosum fibroblasts, if present, is less than 2% of the normal rate. We have now performed experiments to determine whether these fibroblasts have any unscheduled DNA synthesis. Fibroblast coverslip cultures of four xeroderma pigmentosum group A strains were prepared. Irradiated (254 nm ultraviolet light) and unirradiated cultures from each strain were incubated with [ 3 H]dThd at 37degC, and autoradiograms were prepared using NTB-3 emulsion. A nuclear grain count was made of 100 consecutive nuclei of non-S-phase irradiated and unirradiated cells. A slide background grain count was simultaneously made from an acellular area adjacent to each cell analyzed. When a strain's irradiated and unirradiated autoradiograms having similar slide background grain count averages were compared, the nuclear grain count average of the irradiated cells was always higher than that of the unirradiated cells. This ultraviolet-induced increase in the mean nuclear grain count ranged from 0.4 to 1.3% of that given by normal non-xeroderma pigmentosum fibroblasts and was not reduced by 10 -2 M hydroxyurea. Planimetric studies showed that the ultraviolet-induced increase in nuclear grain count is not due to an increased nuclear area in irradiated cells. We conclude that these typical group A xeroderma pigmentosum strains perform very low, but detectable, ultraviolet-induced unscheduled DNA synthesis which probably reflects repair replication. We cannot, however, determine if there are significantly different rates of ultraviolet-induced unscheduled DNA synthesis among these ultraviolet strains

  18. Sensitive detection of colorectal cancer in peripheral blood by septin 9 DNA methylation assay.

    Robert Grützmann

    Full Text Available BACKGROUND: Colorectal cancer (CRC is the second leading cause of cancer deaths despite the fact that detection of this cancer in early stages results in over 90% survival rate. Currently less than 45% of at-risk individuals in the US are screened regularly, exposing a need for better screening tests. We performed two case-control studies to validate a blood-based test that identifies methylated DNA in plasma from all stages of CRC. METHODOLOGY/PRINCIPAL FINDINGS: Using a PCR assay for analysis of Septin 9 (SEPT9 hypermethylation in DNA extracted from plasma, clinical performance was optimized on 354 samples (252 CRC, 102 controls and validated in a blinded, independent study of 309 samples (126 CRC, 183 controls. 168 polyps and 411 additional disease controls were also evaluated. Based on the training study SEPT9-based classification detected 120/252 CRCs (48% and 7/102 controls (7%. In the test study 73/126 CRCs (58% and 18/183 control samples (10% were positive for SEPT9 validating the training set results. Inclusion of an additional measurement replicate increased the sensitivity of the assay in the testing set to 72% (90/125 CRCs detected while maintaining 90% specificity (19/183 for controls. Positive rates for plasmas from the other cancers (11/96 and non-cancerous conditions (41/315 were low. The rate of polyp detection (>1 cm was approximately 20%. CONCLUSIONS/SIGNIFICANCE: Analysis of SEPT9 DNA methylation in plasma represents a straightforward, minimally invasive method to detect all stages of CRC with potential to satisfy unmet needs for increased compliance in the screening population. Further clinical testing is warranted.

  19. Usefulness of in-house PCR methods for hepatitis B virus DNA detection.

    Portilho, Moyra Machado; Baptista, Marcia Leite; da Silva, Messias; de Sousa, Paulo Sérgio Fonseca; Lewis-Ximenez, Lia Laura; Lampe, Elisabeth; Villar, Livia Melo


    The aim of the present study was to evaluate the performance of three in-house PCR techniques for HBV DNA detection and compare it with commercial quantitative methods to evaluate the usefulness of in-house methods for HBV diagnosis. Three panels of HBsAg reactive sera samples were evaluated: (i) 50 samples were examined using three methods for in-house qualitative PCR and the Cobas Amplicor HBV Monitor Assay; (ii) 87 samples were assayed using in-house semi-nested PCR and the Cobas TaqMan HBV test; (iii) 11 serial samples obtained from 2 HBV-infected individuals were assayed using the Cobas Amplicor HBV test and semi-nested PCR. In panel I, HBV DNA was detected in 44 samples using the Cobas Amplicor HBV test, 42 samples using semi-nested PCR (90% concordance with Cobas Amplicor), 22 samples using PCR for the core gene (63.6% concordance) and 29 samples using single-round PCR for the pre-S/S gene (75% concordance). In panel II, HBV DNA was quantified in 78 of the 87 HBsAg reactive samples using Cobas TaqMan but 52 samples using semi-nested PCR (67.8% concordance). HBV DNA was detected in serial samples until the 17th and 26th week after first donation using in-house semi-nested PCR and the Cobas Amplicor HBV test, respectively. In-house semi-nested PCR presented adequate concordance with commercial methods as an alternative method for HBV molecular diagnosis in low-resource settings. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Direct Detection of Unnatural DNA Nucleotides dNaM and d5SICS using the MspA Nanopore.

    Jonathan M Craig

    Full Text Available Malyshev et al. showed that the four-letter genetic code within a living organism could be expanded to include the unnatural DNA bases dNaM and d5SICS. However, verification and detection of these unnatural bases in DNA requires new sequencing techniques. Here we provide proof of concept detection of dNaM and d5SICS in DNA oligomers via nanopore sequencing using the nanopore MspA. We find that both phi29 DNA polymerase and Hel308 helicase are capable of controlling the motion of DNA containing dNaM and d5SICS through the pore and that single reads are sufficient to detect the presence and location of dNaM and d5SICS within single molecules.

  1. Gold nanoparticles for the bare-eye based and spectrophotometric detection of proteins, polynucleotides and DNA

    Lepoitevin, Mathilde; Lemouel, Marie; Bechelany, Mikhael; Janot, Jean-Marc; Balme, Sebastien


    We have explored the potential of using gold nanoparticles (Au-NPs) in optical and bare-eye discrimination of (a) proteins (such as bovine serum albumin and lysozyme), (b) homo-polynucleotides (such as poly-adenylic acid, poly-cytidylic acid, poly-uridylic acid and poly-inosinic acid), and (c) long chain DNA (from salmon, herring and thym). Such biomacromolecules can be detected and discriminated due to their ability to prevent the formation of blue aggregates from red (non-aggregated) citrate capped Au-NPs on addition of NaCl. The effect of these biomacromolecules on the aggregation was investigated by colorimetry and UV–vis spectrometry. The results show that the two proteins can be differentiated by colorimetry, and also salmon ssDNA and dsDNA. The Au-NPs can also discriminate the dsDNAs of salmon and herring. We conclude that the use of Au-NPs represent a viable candidate to future methods of DNA analysis on the basis of visual testing, particularly in the area of food analysis. (author)

  2. Barcode DNA length polymorphisms vs fatty acid profiling for adulteration detection in olive oil.

    Uncu, Ali Tevfik; Uncu, Ayse Ozgur; Frary, Anne; Doganlar, Sami


    The aim of this study was to compare the performance of a DNA-barcode assay with fatty acid profile analysis to authenticate the botanical origin of olive oil. To achieve this aim, we performed a PCR-capillary electrophoresis (PCR-CE) approach on olive oil: seed oil blends using the plastid trnL (UAA) intron barcode. In parallel to genomic analysis, we subjected the samples to gas chromatography analysis of fatty acid composition. While the PCR-CE assay proved equally efficient as gas chromatography analysis in detecting adulteration with soybean, palm, rapeseed, sunflower, sesame, cottonseed and peanut oils, it was superior to the widely utilized analytical chemistry approach in revealing the adulterant species and detecting small quantities of corn and safflower oils in olive oil. Moreover, the DNA-based test correctly identified all tested olive oil: hazelnut oil blends whereas it was not feasible to detect hazelnut oil adulteration through fatty acid profile analysis. Thus, the present research has shown the feasibility of a PCR-CE barcode assay to detect adulteration in olive oil. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Simple system for isothermal DNA amplification coupled to lateral flow detection.

    Kristina Roskos

    Full Text Available Infectious disease diagnosis in point-of-care settings can be greatly improved through integrated, automated nucleic acid testing devices. We have developed an early prototype for a low-cost system which executes isothermal DNA amplification coupled to nucleic acid lateral flow (NALF detection in a mesofluidic cartridge attached to a portable instrument. Fluid handling inside the cartridge is facilitated through one-way passive valves, flexible pouches, and electrolysis-driven pumps, which promotes a compact and inexpensive instrument design. The closed-system disposable prevents workspace amplicon contamination. The cartridge design is based on standard scalable manufacturing techniques such as injection molding. Nucleic acid amplification occurs in a two-layer pouch that enables efficient heat transfer. We have demonstrated as proof of principle the amplification and detection of Mycobacterium tuberculosis (M.tb genomic DNA in the cartridge, using either Loop Mediated Amplification (LAMP or the Exponential Amplification Reaction (EXPAR, both coupled to NALF detection. We envision that a refined version of this cartridge, including upstream sample preparation coupled to amplification and detection, will enable fully-automated sample-in to answer-out infectious disease diagnosis in primary care settings of low-resource countries with high disease burden.

  4. [Real-time quantification to analyze historical Colombian samples detecting a short fragment of hypervariable region II of mitochondrial DNA].

    Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena


    Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.

  5. Electrochemical detection of specific DNA and respiratory activity of Escherichia coli

    Yamanaka, Keiichiro; Ikeuchi, Tomohiko; Saito, Masato; Nagatani, Naoki; Tamiya, Eiichi


    We present two rapid and simplified detection methods for Escherichia coli involving the use of a hand-held potentiostat and a disposable screen-printed carbon electrode. E. coli is one of the indicator organisms used to access for food safety. Commonly, microbiological culture techniques take more than one day to yield results and therefore, a simple, cost-effective, in situ detection system is required for testing food safety. This report describes two complementary techniques for high- and low-sensitivity detection of E. coli. High-sensitivity detection relies upon quantification of DNA amplification by using polymerase chain reaction (PCR), while the simplified, low-sensitivity detection can be obtained through measurement of oxygen consumption due to respiration; importantly, both techniques utilize the same type of electrode. The former entails mixing the PCR mixture with Hoechst, an electro-active DNA intercalator, and then, measuring the oxidation current. Binding of Hoechst molecules to the amplified DNA causes the peak current to decrease because of the slow diffusion of the Hoechst-amplified DNA complex to the electrode surface. The results showed that the oxidation peak current of Hoechst decreased depending on the number of E. coli cells added to the PCR mixture as the template for amplification, and the sensitivity of the method was as low as a single bacterium. Oxygen consumption was detected by direct measurement of the cell-containing culture medium. This method required only 10 μL to be applied on the screen-printed electrode, and the reduction in oxygen current was clearly observed within 30 min when a minimum of 1 × 10 5 cells were present. These results were obtained without purifying the culture, and the samples were applied onto the electrode without any surface modifications. The techniques describes in this report are versatile, because they require the same type of electrode, have simplistic nature, use a hand-held potentiostat, and have

  6. PORSCHA: a novel homogeneous assay for detection of DNA/RNA

    Kidwell, David A.


    A novel assay, Pi Overlapping Ring Systems Contained in a Homogeneous Assay (PORSCHA), has been developed which relies upon the change in fluorescent spectral properties that pyrene and its derivatives show as a function of their proximity. When two pyrene rings are sufficiently close such that their pi-systems can overlap during the excited lifetime, an excimer emission centered at 480 nm is observed. When the pi-systems are too far apart for overlap, only monomer emission is observed at 378 nm and 396 nm. Only Angstrom changes in distances are necessary to switch from excimer to monomer emission. Due to its many degrees of freedom, single-stranded DNA adopts a random-coil conformation in solution. When labeled with two pyrene fluorophores and upon binding to its complimentary strand, the excimer intensity changes because the pyrenes may be either closer together or farther apart, corresponding to the reduced degrees of freedom of the double helix. Because the probe does not disturb the system and no separation steps are necessary before detecting the DNA binding, completely reversible, in situ, detection of DNA is possible.

  7. A non-isotopic assay uses bromouridine and RNA synthesis to detect DNA damage responses.

    Hasegawa, Mayu; Iwai, Shigenori; Kuraoka, Isao


    Individuals with inherited xeroderma pigmentosum (XP) disorder and Cockayne syndrome (CS) are deficient in nucleotide excision repair and experience hypersensitivity to sunlight. Although there are several diagnostic assays for these disorders, the recovery of RNA synthesis (RRS) assay that can discriminate between XP cells and CS cells is very laborious. Here, we report on a novel non-radioisotope RRS assay that uses bromouridine (a uridine analog) as an alternative to (3)H-uridine. This assay can easily detect RNA polymerase I transcription in nucleoli and RNA polymerase II transcription in nuclei. The non-RI RSS assay also can rapidly detect normal RRS activity in HeLa cells. Thus, this assay is useful as a novel and easy technique for CS diagnosis. Because RRS is thought to be related to transcription-coupled DNA repair, which is triggered by the blockage of transcriptional machinery by DNA lesions, this assay may be of use for analysis of DNA repair, transcription, and/or genetic toxicity. Copyright 2010 Elsevier B.V. All rights reserved.

  8. Intermolecular G-quadruplex structure-based fluorescent DNA detection system.

    Zhou, Hui; Wu, Zai-Sheng; Shen, Guo-Li; Yu, Ru-Qin


    Adopting multi-donors to pair with one acceptor could improve the performance of fluorogenic detection probes. However, common dyes (e.g., fluorescein) in close proximity to each other would self-quench the fluorescence, and the fluorescence is difficult to restore. In this contribution, we constructed a novel "multi-donors-to-one acceptor" fluorescent DNA detection system by means of the intermolecular G-quadruplex (IGQ) structure-based fluorescence signal enhancement combined with the hairpin oligonucleotide. The novel IGQ-hairpin system was characterized using the p53 gene as the model target DNA. The proposed system showed an improved assay performance due to the introduction of IGQ-structure into fluorescent signaling probes, which could inhibit the background fluorescence and increase fluorescence restoration amplitude of fluoresceins upon target DNA hybridization. The proof-of-concept scheme is expected to provide new insight into the potential of G-quadruplex structure and promote the application of fluorescent oligonucleotide probes in fundamental research, diagnosis, and treatment of genetic diseases. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Electrochemically fabricated polyaniline nanowire-modified electrode for voltammetric detection of DNA hybridization

    Zhu Ningning; Chang Zhu; He Pingang; Fang Yuzhi


    A novel and sensitive electrochemical DNA biosensor based on electrochemically fabricated polyaniline nanowire and methylene blue for DNA hybridization detection is presented. Nanowires of conducting polymers were directly synthesized through a three-step electrochemical deposition procedure in an aniline-containing electrolyte solution, by using the glassy carbon electrode (GCE) as the working electrode. The morphology of the polyaniline films was examined using a field emission scanning electron microscope (SEM). The diameters of the nanowires range from 80 to 100 nm. The polyaniline nanowires-coated electrode exhibited very good electrochemical conductivity. Oligonucleotides with phosphate groups at the 5' end were covalently linked onto the amino groups of polyaniline nanowires on the electrode. The hybridization events were monitored with differential pulse voltammetry (DPV) measurement using methylene blue (MB) as an indicator. The approach described here can effectively discriminate complementary from non-complementary DNA sequence, with a detection limit of 1.0 x 10 -12 mol l -1 of complementary target, suggesting that the polyaniline nanowires hold great promises for sensitive electrochemical biosensor applications

  10. In situ PCR detection of phytoplasma DNA in embryos from coconut palms with lethal yellowing disease.

    Cordova, Ivan; Jones, Phil; Harrison, Nigel A; Oropeza, Carlos


    SUMMARY DNA of the lethal yellowing (LY) phytoplasma was detected in 13 of 72 embryos from fruits of four diseased Atlantic tall coconut palms by polymerase chain reaction (PCR) assays employing phytoplasma universal rRNA primer pair P1/P7, nested LY group-specific rRNA primer pair 503f/LY16Sr or LY phytoplasma-specific nonribosomal primer pair LYF1/R1. Phytoplasma distribution in sectioned tissues from six PCR positive embryos was determined by in situ PCR and digoxigenin-11-deoxy-UTP (Dig) labelling of amplification products. Dig-labeled DNA products detected by colourimetric assay were clearly evident on sections from the same three embryos investigated in detail by in situ PCRs employing primer pairs P1/P7 or LYF1/R1. Deposition of blue-green stain on sections as a result of each assay was restricted to areas of the embryos corresponding to the plumule and cells ensheathing it. By comparison, similarly treated embryo sections derived from fruits of a symptomless Atlantic tall coconut palm were consistently devoid of any stain. Presence of phytoplasma DNA in embryo tissues suggests the possible potential for seed transmission which remains to be demonstrated.

  11. Detection of irradiation treatment of foods using DNA 'comet assay'

    Khan, Hasan M.; Delincee, Henry


    Microgel electrophoresis of single cells (DNA comet assay) has been investigated to detect irradiation treatment of some food samples. These samples of fresh and frozen rainbow trout, red lentil, gram and sliced almonds were irradiated to 1 or 2 kGy using 10 MeV electron beam from a linear accelerator. Rainbow trout samples yielded good results with samples irradiated to 1 or 2 kGy showing fragmentation of DNA and, therefore, longer comets with no intact cells. Unirradiated samples showed shorter comets with a significant number of intact cells. For rainbow trout stored in a freezer for 11 days the irradiated samples can still be discerned by electrophoresis from unirradiated samples, however, the unirradiated trouts also showed some longer comets besides some intact cells. Radiation treatment of red lentils can also be detected by this method, i.e. no intact cells in 1 or 2 kGy irradiated samples and shorter comets and some intact cells in unirradiated samples. However, the results for gram and sliced almond samples were not satisfactory since some intact DNA cells were observed in irradiated samples as well. Probably, incomplete lysis has led to these deviating results.

  12. Enhanced sensing of dengue virus DNA detection using O{sub 2} plasma treated-silicon nanowire based electrical biosensor

    Rahman, S.F.A., E-mail: [Institute of Advanced Technology, Universiti Putra Malaysia, 43400, UPM, Serdang, Selangor (Malaysia); Yusof, N.A., E-mail: [Institute of Advanced Technology, Universiti Putra Malaysia, 43400, UPM, Serdang, Selangor (Malaysia); Chemistry Department, Faculty of Science, Universiti Putra Malaysia, 43400, UPM, Serdang, Selangor (Malaysia); Hashim, U. [Institute of Nano Electronic Engineering, Universiti Malaysia Perlis, 01000, Kangar, Perlis (Malaysia); Hushiarian, R. [La Trobe Institute for Molecular Science, La Trobe University, Victoria, 3086 (Australia); Nuzaihan, M.N.M. [Institute of Nano Electronic Engineering, Universiti Malaysia Perlis, 01000, Kangar, Perlis (Malaysia); Hamidon, M.N. [Institute of Advanced Technology, Universiti Putra Malaysia, 43400, UPM, Serdang, Selangor (Malaysia); Zawawi, R.M. [Chemistry Department, Faculty of Science, Universiti Putra Malaysia, 43400, UPM, Serdang, Selangor (Malaysia); Fathil, M.F.M. [Institute of Nano Electronic Engineering, Universiti Malaysia Perlis, 01000, Kangar, Perlis (Malaysia)


    Dengue Virus (DENV) has become one of the most serious arthropod-borne viral diseases, causing death globally. The existing methods for DENV detection suffer from the late stage treatment due to antibodies-based detection which is feasible only after five days following the onset of the illness. Here, we demonstrated the highly effective molecular electronic based detection utilizing silicon nanowire (SiNW) integrated with standard complementary metal-oxide-semiconductor (CMOS) process as a sensing device for detecting deoxyribonucleic acid (DNA) related to DENV in an early stage diagnosis. To transform the fabricated devices as a functional sensing element, three-step procedure consist of SiNW surface modification, DNA immobilization and DNA hybridization were employed. The detection principle works by detecting the changes in current of SiNW which bridge the source and drain terminal to sense the immobilization of probe DNA and their hybridization with target DNA. The oxygen (O{sub 2}) plasma was proposed as an effective strategy for increasing the binding amounts of target DNA by modified the SiNW surface. It was found that the detection limit of the optimized O{sub 2} plasma treated-SiNW device could be reduced to 1.985 × 10{sup −14} M with a linear detection range of the sequence-specific DNA from 1.0 × 10{sup −9} M to 1.0 × 10{sup −13} M. In addition, the developed biosensor device was able to discriminate between complementary, single mismatch and non-complementary DNA sequences. This highly sensitive assay was then applied to the detection of reverse transcription-polymerase chain reaction (RT-PCR) product of DENV-DNA, making it as a potential method for disease diagnosis through electrical biosensor. - Highlights: • Molecular electronic detection of Dengue Virus (DENV) DNA using SiNW biosensor is presented. • Oxygen plasma surface treatment as an enhancer technique for device sensitivity is highlighted. • The limit of detection (Lo

  13. Enhanced sensing of dengue virus DNA detection using O_2 plasma treated-silicon nanowire based electrical biosensor

    Rahman, S.F.A.; Yusof, N.A.; Hashim, U.; Hushiarian, R.; Nuzaihan, M.N.M.; Hamidon, M.N.; Zawawi, R.M.; Fathil, M.F.M.


    Dengue Virus (DENV) has become one of the most serious arthropod-borne viral diseases, causing death globally. The existing methods for DENV detection suffer from the late stage treatment due to antibodies-based detection which is feasible only after five days following the onset of the illness. Here, we demonstrated the highly effective molecular electronic based detection utilizing silicon nanowire (SiNW) integrated with standard complementary metal-oxide-semiconductor (CMOS) process as a sensing device for detecting deoxyribonucleic acid (DNA) related to DENV in an early stage diagnosis. To transform the fabricated devices as a functional sensing element, three-step procedure consist of SiNW surface modification, DNA immobilization and DNA hybridization were employed. The detection principle works by detecting the changes in current of SiNW which bridge the source and drain terminal to sense the immobilization of probe DNA and their hybridization with target DNA. The oxygen (O_2) plasma was proposed as an effective strategy for increasing the binding amounts of target DNA by modified the SiNW surface. It was found that the detection limit of the optimized O_2 plasma treated-SiNW device could be reduced to 1.985 × 10"−"1"4 M with a linear detection range of the sequence-specific DNA from 1.0 × 10"−"9 M to 1.0 × 10"−"1"3 M. In addition, the developed biosensor device was able to discriminate between complementary, single mismatch and non-complementary DNA sequences. This highly sensitive assay was then applied to the detection of reverse transcription-polymerase chain reaction (RT-PCR) product of DENV-DNA, making it as a potential method for disease diagnosis through electrical biosensor. - Highlights: • Molecular electronic detection of Dengue Virus (DENV) DNA using SiNW biosensor is presented. • Oxygen plasma surface treatment as an enhancer technique for device sensitivity is highlighted. • The limit of detection (LoD) as low as 1.985

  14. DNA isolation protocols affect the detection limit of PCR approaches of bacteria in samples from the human gastrointestinal tract

    Zoetendal, E.G.; Ben-Amor, K.; Akkermans, A.D.L.; Abee, T.; Vos, de W.M.


    A major concern in molecular ecological studies is the lysis efficiency of different bacteria in a complex ecosystem. We used a PCR-based 16S rDNA approach to determine the effect of two DNA isolation protocols (i.e. the bead beating and Triton-X100 method) on the detection limit of seven

  15. A novel gold nanoparticle-DNA aptamer-based plasmonic chip for rapid and sensitive detection of bacterial pathogens

    Sun, Yi; Phuoc Long, Truong; Wolff, Anders


    Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...

  16. Quenching the chemiluminescence of acridinium ester by graphene oxide for label-free and homogeneous DNA detection.

    He, Yi; Huang, Guangming; Cui, Hua


    It was found that graphene oxide (GO) could effectively quench the chemiluminescence (CL) emission from a acridinium ester (AE)-hydrogen peroxide system. By taking advantage of this quenching effect, as a proof of concept, a label-free and homogeneous DNA assay was developed for the detection of Mycobacterium tuberculosis DNA. In the absence of target DNA, both probe DNA and AE were absorbed on the surface of GO, producing a weak CL emission owing to the CL quenching effect of GO. However, in the presence of target DNA, a double-stranded structure of DNA was generated, leading to the release of the oligonucleotide from the GO surface. AE favors binding with double-stranded DNA, which will be released from the GO surface; thus, the quenching effect of GO will be no longer effective and a strong CL signal can be observed. This assay can detect M. tuberculosis DNA with a detection limit of 0.65 nM. This sensitivity is lower than that of previously reported electrochemical detection.

  17. Simultaneous detection of multiple DNA targets by integrating dual-color graphene quantum dot nanoprobes and carbon nanotubes.

    Qian, Zhaosheng; Shan, Xiaoyue; Chai, Lujing; Chen, Jianrong; Feng, Hui


    Simultaneous detection of multiple DNA targets was achieved based on a biocompatible graphene quantum dots (GQDs) and carbon nanotubes (CNTs) platform through spontaneous assembly between dual-color GQD-based probes and CNTs and subsequently self-recognition between DNA probes and targets. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Sensitive detection of cyclophosphamide using DNA-modified carbon paste, pencil graphite and hanging mercury drop electrodes.

    Palaska, P; Aritzoglou, E; Girousi, S


    The interaction of cyclophosphamide (CP) with calf thymus double-stranded DNA (dsDNA) and thermally denatured single-stranded DNA (ssDNA) immobilized at the carbon paste (CPE) and pencil graphite electrodes (PGE), was studied electrochemically based on oxidation signals of guanine and adenine using differential pulse voltammetry (DPV). As a result of the interaction of CP with DNA, the voltammetric signals of guanine and adenine increased in the case of dsDNA while a slight increase was observed in ssDNA. The effect of experimental parameters such as the interaction time between CP and DNA forms and the concentration of CP, were studied using DPV with CPE and PGE. Additionally, reproducibility and detection limits were determined using both electrodes. A comparison of the analytical performance between CPE and PGE was done. Our results showed that these two different DNA biosensors could be used for the sensitive, rapid and cost effective detection of CP itself as well as of CP-DNA interaction. Furthermore, the interaction of CP with dsDNA and ssDNA was studied in solution and at the electrode surface by means of alternating current voltammetry (ACV) in 0.3M NaCl and 50mM sodium phosphate buffer (pH 8.5) supporting electrolyte, using a hanging mercury drop electrode (HMDE) as working electrode. The conclusions of this study were mainly based on tensammetric peaks I (at -1.183V) and II (-1.419V) of DNA. This study involved the interaction of CP with surface-confined and solution phase DNA where experimental parameters, such as the concentration of CP and the interaction time, were studied. By increasing the concentration of CP, an increase of peak II was observed in both ds and ssDNA, while an increase of peak I was observed only in the case of dsDNA. An overall conclusion of the study using HMDE was that the interaction of CP with surface-confined DNA significantly differed from that with solution phase DNA. The increase of peaks I and II was lower in the case of

  19. Prototype Systems Containing Human Cytochrome P450 for High-Throughput Real-Time Detection of DNA Damage by Compounds That Form DNA-Reactive Metabolites.

    Brito Palma, Bernardo; Fisher, Charles W; Rueff, José; Kranendonk, Michel


    The formation of reactive metabolites through biotransformation is the suspected cause of many adverse drug reactions. Testing for the propensity of a drug to form reactive metabolites has increasingly become an integral part of lead-optimization strategy in drug discovery. DNA reactivity is one undesirable facet of a drug or its metabolites and can lead to increased risk of cancer and reproductive toxicity. Many drugs are metabolized by cytochromes P450 in the liver and other tissues, and these reactions can generate hard electrophiles. These hard electrophilic reactive metabolites may react with DNA and may be detected in standard in vitro genotoxicity assays; however, the majority of these assays fall short due to the use of animal-derived organ extracts that inadequately represent human metabolism. The current study describes the development of bacterial systems that efficiently detect DNA-damaging electrophilic reactive metabolites generated by human P450 biotransformation. These assays use a GFP reporter system that detects DNA damage through induction of the SOS response and a GFP reporter to control for cytotoxicity. Two human CYP1A2-competent prototypes presented here have appropriate characteristics for the detection of DNA-damaging reactive metabolites in a high-throughput manner. The advantages of this approach include a short assay time (120-180 min) with real-time measurement, sensitivity to small amounts of compound, and adaptability to a microplate format. These systems are suitable for high-throughput assays and can serve as prototypes for the development of future enhanced versions.

  20. Highly sensitive detection of human IgG using a novel bio-barcode assay combined with DNA chip technology

    Liu, Zhenbao; Zhou, Bo; Wang, Haiqing; Lu, Feng; Liu, Tianjun; Song, Cunxian; Leng, Xigang


    A simple and ultrasensitive detection of human IgG based on signal amplification using a novel bio-barcode assay and DNA chip technology was developed. The sensing platform was a sandwich system made up of antibody-modified magnetic microparticles (Ab-MMPs)/human IgG/Cy3-labeled single-stranded DNA and antibody-modified gold nanoparticles (Cy3-ssDNA-Ab-AuNPs). The MMPs (2.5 μm in diameter) modified with mouse anti-human IgG monoclonal-antibodies could capture human IgG and further be separated and enriched via a magnetic field. The AuNPs (13 nm in diameter) conjugated with goat anti-human IgG polyclonal-antibodies and Cy3-ssDNA could further combine with the human IgG/Ab-MMP complex. The Cy3-ssDNA on AuNPs was then released by TCEP to hybridize with the DNA chip, thus generating a detectable signal by the fluorescence intensity of Cy3. In order to improve detection sensitivity, a three-level cascaded signal amplification was developed: (1) The MMP enrichment as the first-level; (2) Large quantities of Cy3-ssDNA on AuNPs as the second-level; (3) The Cy3-ssDNA conjugate with DNA chip as the third-level. The highly sensitive technique showed an increased response of the fluorescence intensity to the increased concentration of human IgG through a detection range from 1 pg mL −1 to 10 ng mL −1 . This sensing technique could not only improve the detection sensitivity for the low concentration of human IgG but also present a robust and efficient signal amplification model. The detection method has good stability, specificity, and reproducibility and could be applied in the detection of human IgG in the real samples

  1. Highly sensitive detection of human IgG using a novel bio-barcode assay combined with DNA chip technology

    Liu, Zhenbao [Central South University, School of Pharmaceutical Sciences (China); Zhou, Bo, E-mail: [The Affiliated Zhongda Hospital of Southeast University, Department of Gerontology (China); Wang, Haiqing; Lu, Feng; Liu, Tianjun; Song, Cunxian; Leng, Xigang, E-mail: [Institute of Biomedical Engineering, Chinese Academy of Medical Sciences and Peking Union Medical College (China)


    A simple and ultrasensitive detection of human IgG based on signal amplification using a novel bio-barcode assay and DNA chip technology was developed. The sensing platform was a sandwich system made up of antibody-modified magnetic microparticles (Ab-MMPs)/human IgG/Cy3-labeled single-stranded DNA and antibody-modified gold nanoparticles (Cy3-ssDNA-Ab-AuNPs). The MMPs (2.5 {mu}m in diameter) modified with mouse anti-human IgG monoclonal-antibodies could capture human IgG and further be separated and enriched via a magnetic field. The AuNPs (13 nm in diameter) conjugated with goat anti-human IgG polyclonal-antibodies and Cy3-ssDNA could further combine with the human IgG/Ab-MMP complex. The Cy3-ssDNA on AuNPs was then released by TCEP to hybridize with the DNA chip, thus generating a detectable signal by the fluorescence intensity of Cy3. In order to improve detection sensitivity, a three-level cascaded signal amplification was developed: (1) The MMP enrichment as the first-level; (2) Large quantities of Cy3-ssDNA on AuNPs as the second-level; (3) The Cy3-ssDNA conjugate with DNA chip as the third-level. The highly sensitive technique showed an increased response of the fluorescence intensity to the increased concentration of human IgG through a detection range from 1 pg mL{sup -1} to 10 ng mL{sup -1}. This sensing technique could not only improve the detection sensitivity for the low concentration of human IgG but also present a robust and efficient signal amplification model. The detection method has good stability, specificity, and reproducibility and could be applied in the detection of human IgG in the real samples.

  2. Highly sensitive detection of human IgG using a novel bio-barcode assay combined with DNA chip technology

    Liu, Zhenbao; Zhou, Bo; Wang, Haiqing; Lu, Feng; Liu, Tianjun; Song, Cunxian; Leng, Xigang


    A simple and ultrasensitive detection of human IgG based on signal amplification using a novel bio-barcode assay and DNA chip technology was developed. The sensing platform was a sandwich system made up of antibody-modified magnetic microparticles (Ab-MMPs)/human IgG/Cy3-labeled single-stranded DNA and antibody-modified gold nanoparticles (Cy3-ssDNA-Ab-AuNPs). The MMPs (2.5 μm in diameter) modified with mouse anti-human IgG monoclonal-antibodies could capture human IgG and further be separated and enriched via a magnetic field. The AuNPs (13 nm in diameter) conjugated with goat anti-human IgG polyclonal-antibodies and Cy3-ssDNA could further combine with the human IgG/Ab-MMP complex. The Cy3-ssDNA on AuNPs was then released by TCEP to hybridize with the DNA chip, thus generating a detectable signal by the fluorescence intensity of Cy3. In order to improve detection sensitivity, a three-level cascaded signal amplification was developed: (1) The MMP enrichment as the first-level; (2) Large quantities of Cy3-ssDNA on AuNPs as the second-level; (3) The Cy3-ssDNA conjugate with DNA chip as the third-level. The highly sensitive technique showed an increased response of the fluorescence intensity to the increased concentration of human IgG through a detection range from 1 pg mL-1 to 10 ng mL-1. This sensing technique could not only improve the detection sensitivity for the low concentration of human IgG but also present a robust and efficient signal amplification model. The detection method has good stability, specificity, and reproducibility and could be applied in the detection of human IgG in the real samples.

  3. A novel technique with enhanced detection and quantitation of HPV-16 E1- and E2-mediated DNA replication

    Taylor, Ewan R.; Morgan, Iain M.


    Transient DNA replication assays to detect papillomavirus E1/E2-mediated DNA replication have depended upon Southern blotting. This technique is hazardous (radioactive), labour intensive, semiquantitative, and physically limited in the number of samples that can be processed at any one time. We have overcome these problems by developing a real-time PCR protocol for the detection of E1/E2-mediated transient DNA replication. The results demonstrate detection of replication at levels not seen using Southern blotting demonstrating enhanced sensitivity. This technique is also, by definition, highly quantitative. Therefore, the real-time PCR technique is the optimal method for the detection of E1/E2-mediated DNA replication

  4. Optical detection of two-color-fluorophore barcode for nanopore DNA sensing

    Zhang, M.; Sychugov, I.; Schmidt, T.; Linnros, J.


    A simple schematic on parallel optical detection of two-fluorophore barcode for single-molecule nanopore sensing is presented. The chosen two fluorophores, ATTO-532 and DY-521-XL, emitting in well-separated spectrum range can be excited at the same wavelength. A beam splitter was employed to separate signals from the two fluorophores and guide them to the same CCD camera. Based on a conventional microscope, sources of background in the nanopore sensing system, including membranes, compounds in buffer solution, and a detection cell was characterized. By photoluminescence excitation measurements, it turned out that silicon membrane has a negligible photoluminescence under the examined excitation from 440 nm to 560 nm, in comparison with a silicon nitrite membrane. Further, background signals from the detection cell were suppressed. Brownian motion of 450 bps DNA labelled with single ATTO-532 or DY-521-XL was successfully recorded by our optical system.

  5. Large Scale Parallel DNA Detection by Two-Dimensional Solid-State Multipore Systems.

    Athreya, Nagendra Bala Murali; Sarathy, Aditya; Leburton, Jean-Pierre


    We describe a scalable device design of a dense array of multiple nanopores made from nanoscale semiconductor materials to detect and identify translocations of many biomolecules in a massively parallel detection scheme. We use molecular dynamics coupled to nanoscale device simulations to illustrate the ability of this device setup to uniquely identify DNA parallel translocations. We show that the transverse sheet currents along membranes are immune to the crosstalk effects arising from simultaneous translocations of biomolecules through multiple pores, due to their ability to sense only the local potential changes. We also show that electronic sensing across the nanopore membrane offers a higher detection resolution compared to ionic current blocking technique in a multipore setup, irrespective of the irregularities that occur while fabricating the nanopores in a two-dimensional membrane.

  6. Development of a biotinylated DNA probe for detection of infectious hematopoietic necrosis virus

    Deering, R.E.; Arakawa, C.K.; Oshima, K.H.; O'Hara, P.J.; Landolt, M.L.; Winton, J.R.


    A nonrad~oact~ve DNA probe assay was developed to detect and ~dent~fy infect~ous hernatopoiet~c necrosls virus (IHNV) uslng a dot blot format The probe a synthet~c DNA oligonucleot~de labeled enzymatlcally w~th biotln hybnd~zed spec~f~cally w~th nucleocaps~d mRNA extracted from Infected cells early In the vlrus repl~cation cycle A rap~d guan~dln~um th~ocyanate based RNA extraction method uslng RNAzol B and rn~crocentrifuge tubes eff~c~ently pioduced h~gh qual~ty RNA from 3 commonly used f~sh cell llnes, CHSE-214, CHH-1, and EPC The probe reacted with 6 d~verse ~solates of IHNV, but d~d not react \

  7. DNA of Dientamoeba fragilis detected within surface-sterilized eggs of Enterobius vermicularis

    Röser, Dennis; Nejsum, Peter; Carlsgart, Anne Josefine


    With no evidence of a cyst stage, the mode of transmission of Dientamoeba fragilis, an intestinal protozoon of common occurrence and suggested pathogenicity, is incompletely known. Numerous studies have suggested that eggs of intestinal nematodes, primarily Enterobius vermicularis (pinworm), can...... serve as vectors for D. fragilis, although attempts to culture D. fragilis from pinworm eggs have been unsuccessful and data from epidemiological studies on D. fragilis/pinworm co-infection have been conflicting. The aim of this study was to investigate whether we could detect D. fragilis DNA from...... pinworm eggs collected from routine diagnostic samples (cellophane tape) and surface-sterilised by hypochlorite. DNA was extracted from individual eggs and tested by PCR using D. fragilis- and E. vermicularis-specific primers; amplicons were sequenced for confirmation. In cellophane tape samples from 64...

  8. Extraction, amplification and detection of DNA in microfluidic chip-based assays

    Wu, Jinbo


    This review covers three aspects of PCR-based microfluidic chip assays: sample preparation, target amplification, and product detection. We also discuss the challenges related to the miniaturization and integration of each assay and make a comparison between conventional and microfluidic schemes. In order to accomplish these essential assays without human intervention between individual steps, the micro-components for fluid manipulation become critical. We therefore summarize and discuss components such as microvalves (for fluid regulation), pumps (for fluid driving) and mixers (for blending fluids). By combining the above assays and microcomponents, DNA testing of multi-step bio-reactions in microfluidic chips may be achieved with minimal external control. The combination of assay schemes with the use of micro-components also leads to rapid methods for DNA testing via multi-step bioreactions. Contains 259 references.

  9. Use of resonance ionization spectroscopy to detect DNA bands on ultrathin spin-coated gels.

    Doktycz, M J; Gibson, W A; Arlinghaus, H F; Allen, R C; Jacobson, K B


    Development of alternative electrophoresis procedures are necessary for large volume sequencing and mapping studies. The use of stable isotopes as DNA labels and ultrathin gels promises to greatly increase the rate of sequencing. Spin coating is presented as an alternative method for producing ultrathin polyacrylamide gels. The technique has the potential of producing gels of micron to submicron thicknesses by varying the viscosity of the acrylamide solution and the spinning speed. Thirty micron thick 6% (weight %) gels were produced in this manner. Tin-labeled DNA oligomers were electrophoresed and detected using sputter-initiated resonance ionization spectroscopy (SIRIS). The usefulness of SIRIS and laser atomization RIS (LARIS) to sample the surface and deeper layers of 240 microns thick gels was investigated. With LARIS, whole cross-sections of the gel can be atomized, possibly allowing complete sampling of labels.


    Edith Burbano


    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  11. Detection of Pyrrolizidine Alkaloid DNA Adducts in Livers of Cattle Poisoned with Heliotropium europaeum.

    Fu, Peter P; Xia, Qingsu; He, Xiaobo; Barel, Shimon; Edery, Nir; Beland, Frederick A; Shimshoni, Jakob A


    Pyrrolizidine alkaloids are among the most common poisonous plants affecting livestock, wildlife, and humans. Exposure of humans and livestock to toxic pyrrolizidine alkaloids through the intake of contaminated food and feed may result in poisoning, leading to devastating epidemics. During February 2014, 73 mixed breed female beef cows from the Galilee region of Israel were accidently fed pyrrolizidine alkaloid contaminated hay for 42 days, resulting in the sudden death of 24 cows over a period of 63 days. The remaining cows were slaughtered 2.5 months after the last ingestion of the contaminated hay. In this study, we report the histopathological analysis of the livers from five of the slaughtered cows and quantitation of pyrrolizidine alkaloid-derived DNA adducts from their livers and three livers of control cows fed with feed free of weeds producing pyrrolizidine alkaloids. Histopathological examination revealed that the five cows suffered from varying degrees of bile duct proliferation, fibrosis, and megalocytosis. Selected reaction monitoring HPLC-ES-MS/MS analysis indicated that (±)-6,7-dihydro-7-hydroxy-1-hydroxymethyl-5H-pyrrolizine (DHP)-derived DNA adducts were formed in all five livers. The livers from the three control cows did not have any liver damage nor any indication of DHP-DNA adduct formed. These results confirm that the toxicity observed in these cattle was caused by pyrrolizidine alkaloid poisoning and that pyrrolizidine alkaloid-derived DNA adducts could still be detected and quantified in the livers of the chronically poisoned cows 2.5 months after their last exposure to the contaminated feed, suggesting that DHP-derived DNA adducts can serve as biomarkers for pyrrolizidine alkaloid exposure and poisoning.

  12. An Electrochemical DNA Biosensor for the Detection of Salmonella Using Polymeric Films and Electrochemical Labels

    Diaz Serrano, Madeline

    Waterborne and foodborne diseases are one of the principal public health problems worldwide. Microorganisms are the major agents of foodborne illness: pathogens such as Salmonella, Campylobacter jejuni and Escherichia coli, and parasites such as cryptosporidium. The most popular methods to detect Salmonella are based on culture and colony counting methods, ELISA, Gel electrophoresis and the polymerase chain reaction. Conventional detection methods are laborious and time-consuming, allowing for portions of the food to be distributed, marketed, sold and eaten before the analysis is done and the problem even detected. By these reasons, the rapid, easy and portable detection of foodborne organisms will facilitate the disease treatment. Our particular interest is to develop a nucleic acid biosensor (NAB) for the detection of pathogenic microorganisms in food and water samples. In this research, we report on the development of a NAB prototype using a polymer modified electrode surface together with sequences of different lengths for the OmpC gene from Salmonella as probes and Ferrocene-labeled target (Fc-ssDNA), Ferrocene-labeled tri(ethylene glycol) (Fc-PEG) and Ruthenium-Ferrocene (Ru-Fe) bimetallic complex as an electrochemical labels. We have optimized several PS films and anchored nucleic acid sequences with different lengths at gold and carbon surfaces. Non contact mode AFM and XPS were used to monitor each step of the NAB preparation, from polymer modification to oligos hybridization (conventional design). The hybridization reaction was followed electrochemically using a Fc-ssDNA and Fc-PEG in solution taking advantage of the morphological changes generated upon hybridization. We observed a small current at the potential for the Fe oxidation without signal amplification at +296 mV vs. Ag/AgCl for the Fc-ssDNA strategy and a small current at +524 mV for the Fc-PEG strategy. The immobilization, hybridization and signal amplification of Biotin- OmpC Salmonella genes

  13. Establishment and Application of a Visual DNA Microarray for the Detection of Food-borne Pathogens.

    Li, Yongjin


    The accurate detection and identification of food-borne pathogenic microorganisms is critical for food safety nowadays. In the present work, a visual DNA microarray was established and applied to detect pathogens commonly found in food, including Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in food samples. Multiplex PCR (mPCR) was employed to simultaneously amplify specific gene fragments, fimY for Salmonella, ipaH for Shigella, iap for L. monocytogenes and ECs2841 for E. coli O157:H7, respectively. Biotinylated PCR amplicons annealed to the microarray probes were then reacted with a streptavidin-alkaline phosphatase conjugate and nitro blue tetrazolium/5-bromo-4-chloro-3'-indolylphosphate, p-toluidine salt (NBT/BCIP); the positive results were easily visualized as blue dots formatted on the microarray surface. The performance of a DNA microarray was tested against 14 representative collection strains and mock-contamination food samples. The combination of mPCR and a visual micro-plate chip specifically and sensitively detected Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in standard strains and food matrices with a sensitivity of ∼10(2) CFU/mL of bacterial culture. Thus, the developed method is advantageous because of its high throughput, cost-effectiveness and ease of use.

  14. Synthesis of a multi-functional DNA nanosphere barcode system for direct cell detection.

    Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum


    Nucleic acid-based technologies have been applied to numerous biomedical applications. As a novel material for target detection, DNA has been used to construct a barcode system with a range of structures. This paper reports multi-functionalized DNA nanospheres (DNANSs) by rolling circle amplification (RCA) with several functionalized nucleotides. DNANSs with a barcode system were designed to exhibit fluorescence for coding enhanced signals and contain biotin for more functionalities, including targeting through the biotin-streptavidin (biotin-STA) interaction. Functionalized deoxynucleotide triphosphates (dNTPs) were mixed in the RCA process and functional moieties can be expressed on the DNANSs. The anti-epidermal growth factor receptor antibodies (anti-EGFR Abs) can be conjugated on DNANSs for targeting cancer cells specifically. As a proof of concept, the potential of the multi-functional DNANS barcode was demonstrated by direct cell detection as a simple detection method. The DNANS barcode provides a new route for the simple and rapid selective recognition of cancer cells.

  15. Genetic effect of A-bomb radiation- Analysis of minisatellite regions detected by DNA fingerprint probe

    Kodaira, Mieko


    In author's laboratory, screening of mutation in germ cells of A-bomb survivors is under investigation with use of 8 single-locus minisatellite probes and no increase in mutation rate has been detected hitherto. This paper reported results of screening on the minisatellite region, which consisting of short repeated base sequence, using a DNA fingerprint probe for 33.15 core sequence. Subjects were 50 A-bomb survivor families exposed to mean dose of 1.9 Sv (exposed group) or 0 Gy (control), having 64 or 60 children, respectively. DNA was extracted from their B cells established by EB virus and subjected to agarose-gel electrophoresis followed by southern blotting with some improvements for fingerprinting. On the fingerprints, numbers of the band detected in regions of >3.5 kb were 1080 in children of the exposed group (16.9/child) and 1024 (17.1) in the control group, indicating no detectable effect of exposure on the germ cell mutation rate in the region.(K.H.)

  16. Light emitting diode, photodiode-based fluorescence detection system for DNA analysis with microchip electrophoresis.

    Hall, Gordon H; Glerum, D Moira; Backhouse, Christopher J


    Electrophoretic separation of fluorescently end-labeled DNA after a PCR serves as a gold standard in genetic diagnostics. Because of their size and cost, instruments for this type of analysis have had limited market uptake, particularly for point-of-care applications. This might be changed through a higher level of system integration and lower instrument costs that can be realized through the use of LEDs for excitation and photodiodes for detection--if they provide sufficient sensitivity. Here, we demonstrate an optimized microchip electrophoresis instrument using polymeric fluidic chips with fluorescence detection of end-labeled DNA with a LOD of 0.15 nM of Alexa Fluor 532. This represents orders of magnitude improvement over previously reported instruments of this type. We demonstrate the system with an electrophoretic separation of two PCR products and their respective primers. We believe that this is the first LED-induced fluorescence microchip electrophoresis system with photodiode-based detection that could be used for standard applications of PCR and electrophoresis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Detection of excretory Entamoeba histolytica DNA in the urine, and detection of E. histolytica DNA and lectin antigen in the liver abscess pus for the diagnosis of amoebic liver abscess

    Khairnar Krishna


    Full Text Available Abstract Background Amoebic liver abscess (ALA and pyogenic liver abscesses (PLA appear identical by ultrasound and other imaging techniques. Collection of blood or liver abscess pus for diagnosis of liver abscesses is an invasive procedure, and the procedure requires technical expertise and disposable syringes. Collection of urine is a noninvasive procedure. Therefore, there has been much interest shown towards the use of urine as an alternative clinical specimen for the diagnosis of some parasitic infections. Here, we report for the first time the detection of E. histolytica DNA excreted in the urine for diagnosis of the cases of ALA. Results E. histolytica DNA was detected in liver abscess pus specimen of 80.4% of ALA patients by a nested multiplex polymerase chain reaction (PCR targeting 16S-like r RNA gene. The nested PCR detected E. histolytica DNA in all 37 (100% liver abscess pus specimens collected prior to metronidazole treatment, but were detected in only 53 of 75 (70.6% pus specimens collected after therapy with metronidazole. Similarly, the PCR detected E. histolytica DNA in 21 of 53 (39.6% urine specimens of ALA patients. The test detected E. histolytica DNA in only 4 of 23 (17.4% urine specimens collected prior to metronidazole treatment, but were detected in 17 of 30 (56.7% urine specimens collected after treatment with metronidazole. The enzyme-linked immunosorbent assay (ELISA for the detection of lectin E. histolytica antigen in the liver abscess pus showed a sensitivity of 50% and the indirect haemagglutination (IHA test for detection of amoebic antibodies in the serum showed a sensitivity of 76.8% for the diagnosis of the ALA. Conclusion The present study for the first time shows that the kidney barrier in ALA patients is permeable to E. histolytica DNA molecule resulting in excretion of E. histolytica DNA in urine which can be detected by PCR. The study also shows that the PCR for detection of E. histolytica DNA in urine of

  18. Radioactive and enzymatic cloned cDNA probes for bovine enteric coronavirus detection by molecular hybridization

    Collomb, J.; Finance, C.; Alabouch, S.; Laporte, J.


    Genomic RNA of F15 strain bovine enteric coronavirus (BECV) was cloned in E. coli. Three clones (174, 160, PG 78), selected in the cDNA library, including a large portion of the nucleocapsid (N), matrix (M) and peplomeric (S) protein genes , were used as probes for a slot blot hybridization assay. Two probe labelling techniques were compared, radiolabelling with 32 P and enzymatic labelling through covalent linkage to peroxidase and chemiluminescence detection. The radioactive probe 174 detected as little as 1 to 3 pg of viral RNA, while the less sensitive enzymatic probe could not reveal more than 100 pg of RNA. No significant detection amplification was achieved when a mixture of the three probes was used. Probe 174 allowed specific identification for BECV. No hybridization was noticed either with rotaviruses or even with other antigenically unrelated members of the family Coronaviridae such as transmissible gastroenteritis virus. The test proved valid for detection of BECV in the supernatant of infected HRT-18 cells: genomic RNA could be detected after direct spotting of samples, but prior nucleic acid extraction after proteinase K treatment improved virus detection. BECV diagnosis in faecal samples using enzymatic probe was compared with conventional diagnostic methods. (authors)

  19. Radioactive and enzymatic cloned cDNA probes for bovine enteric coronavirus detection by molecular hybridization

    Collomb, J; Finance, C; Alabouch, S [Lab. de Microbiologie Moleculaire, Faculte des Sciences Pharmaceutiques et Biologiques, Univ. de Nancy I, Nancy (France); Laporte, J [Station de Virologie et d' Immunologie Moleculaires, INRA, Jouy-en-Josas (France)


    Genomic RNA of F15 strain bovine enteric coronavirus (BECV) was cloned in E. coli. Three clones (174, 160, PG 78), selected in the cDNA library, including a large portion of the nucleocapsid (N), matrix (M) and peplomeric (S) protein genes , were used as probes for a slot blot hybridization assay. Two probe labelling techniques were compared, radiolabeled with [sup 32]P and enzymatic labeled through covalent linkage to peroxidase for chemiluminescence detection. The radioactive probe 174 detected as little as 1-3 pg of viral RNA, while the less sensitive enzymatic probe could not reveal more than 100 pg of RNA. No significant detection amplification was achieved when a mixture of the three probes was used. Probe 174 allowed specific identification for BECV. No hybridization was noticed either with rotaviruses or even with other antigenically unrelated members of the family Coronaviridae such as transmissible gastroenteritis virus. The test proved valid for detection of BECV in the supernatant of infected HRT-18 cells: genomic RNA could be detected after direct spotting of samples, but prior nucleic acid extraction after proteinase K treatment improved virus detection. BECV diagnosis in fecal samples using enzymatic probe was compared with conventional diagnostic methods. (authors).

  20. Molecular beacon based biosensor for the sequence-specific detection of DNA using DNA-capped gold nanoparticles-streptavidin conjugates for signal amplification

    Fang, Xian; Jiang, Wei; Han, Xiaowei; Zhang, Yuzhong


    We describe a highly sensitive and selective molecular beacon-based electrochemical impedance biosensor for the sequence-specific detection of DNA. DNA-capped conjugates between gold nanoparticles (Au-NPs) and streptavidin are used for signal amplification. The molecular beacon was labeled with a thiol at its 5′ end and with biotin at its 3′ end, and then immobilized on the surface of a bare gold electrode through the formation of Au-S bonds. Initially, the molecular beacon is present in the “closed” state, and this shields the biotin from being approached by streptavidin due to steric hindrance. In the presence of the target DNA, the target DNA molecules hybridize with the loop and cause a conformational change that moves the biotin away from the surface of the electrode. The biotin thereby becomes accessible for the reporter (the DNA-streptavidin capped Au-NPs), and this results in a distinct increase in electron transfer resistance. Under optimal conditions, the increase in resistance is linearly related to the logarithm of the concentration of complementary target DNA in the range from 1.0 fM to 0.1 μM, with a detection limit of 0.35 fM (at an S/N of 3). This biosensor exhibits good selectivity, and acceptable stability and reproducibility. (author)

  1. Ultrasensitive electrochemical detection of DNA based on Zn²⁺ assistant DNA recycling followed with hybridization chain reaction dual amplification.

    Qian, Yong; Wang, Chunyan; Gao, Fenglei


    A new strategy to combine Zn(2+) assistant DNA recycling followed with hybridization chain reaction dual amplification was designed for highly sensitive electrochemical detection of target DNA. A gold electrode was used to immobilize molecular beacon (MB) as the recognition probe and perform the amplification procedure. In the presence of the target DNA, the hairpin probe 1 was opened, and the DNAzyme was liberated from the caged structure. The activated DNAzyme hybridized with the MB and catalyzed its cleavage in the presence of Zn(2+) cofactor and resulting in a free DNAzyme strand. Finally, each target-induced activated DNAzyme underwent many cycles triggering the cleavage of MB, thus forming numerous MB fragments. The MB fragments triggered the HCR and formed a long double-helix DNA structure. Because both H1 and H2 were labeled by biotin, a lot of SA-ALP was captured on the electrode surface, thus catalyzing a silver deposition process for electrochemical stripping analysis. This novel cascade signal amplification strategy can detect target DNA down to the attomolar level with a dynamic range spanning 6 orders of magnitude. This highly sensitive and specific assay has a great potential to become a promising DNA quantification method in biomedical research and clinical diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. DNA comet assay as a rapid detection method of irradiated bovine meat by electron beam

    Marin-Huachaca, Nelida Simona; Villavicencio, Anna Lucia C.H.


    Full text: Introduction: The presence in food of pathogenic microorganisms, such as Salmon