WorldWideScience

Sample records for duplication reveal cis-regulatory

  1. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

    Science.gov (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

    2015-12-01

    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  2. Implications of duplicated cis-regulatory elements in the evolution of metazoans: the DDI model or how simplicity begets novelty.

    Science.gov (United States)

    Jiménez-Delgado, Senda; Pascual-Anaya, Juan; Garcia-Fernàndez, Jordi

    2009-07-01

    The discovery that most regulatory genes were conserved among animals from distant phyla challenged the ideas that gene duplication and divergence of homologous coding sequences were the basis for major morphological changes in metazoan evolution. In recent years, however, the interest for the roles, conservation and changes of non-coding sequences grew-up in parallel with genome sequencing projects. Presently, many independent studies are highlighting the importance that subtle changes in cis-regulatory regions had in the evolution of morphology trough the Animal Kingdom. Here we will show and discuss some of these studies, and underscore the future of cis-Evo-Devo research. Nevertheless, we would also explore how gene duplication, which includes duplication of regulatory regions, may have been critical for spatial or temporal co-option of new regulatory networks, causing the deployment of new transcriptome scenarios, and how these induced morphological changes were critical for the evolution of new forms. Forty years after Susumu Ohno famous sentence 'natural selection merely modifies, while redundancy creates', we suggest the alternative: 'natural selection modifies, while redundancy of cis-regulatory elements innovates', and propose the Duplication-Degeneration-Innovation model to explain the increased evolvability of duplicated cis-regulatory regions. Paradoxically, making regulation simpler by subfunctionalization paved the path for future complexity or, in other words, 'to make it simple to make it complex'.

  3. Validation of Skeletal Muscle cis-Regulatory Module Predictions Reveals Nucleotide Composition Bias in Functional Enhancers

    Science.gov (United States)

    Kwon, Andrew T.; Chou, Alice Yi; Arenillas, David J.; Wasserman, Wyeth W.

    2011-01-01

    We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs) using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions. PMID:22144875

  4. Validation of skeletal muscle cis-regulatory module predictions reveals nucleotide composition bias in functional enhancers.

    Directory of Open Access Journals (Sweden)

    Andrew T Kwon

    2011-12-01

    Full Text Available We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions.

  5. CRX ChIP-seq reveals the cis-regulatory architecture of mouse photoreceptors

    NARCIS (Netherlands)

    J.C. Corbo (Joseph); K.A. Lawrence (Karen); M. Karlstetter (Marcus); C.A. Myers (Connie); M. Abdelaziz (Musa); W. Dirkes (William); K. Weigelt (Karin); M. Seifert (Martin); V. Benes (Vladimir); L.G. Fritsche (Lars); B.H.F. Weber (Bernhard); T. Langmann (Thomas)

    2010-01-01

    textabstractApproximately 98% of mammalian DNA is noncoding, yet we understand relatively little about the function of this enigmatic portion of the genome. The cis-regulatory elements that control gene expression reside in noncoding regions and can be identified by mapping the binding sites of

  6. Functional dissection of the promoter of the pollen-specific gene NTP303 reveals a novel pollen-specific, and conserved cis-regulatory element.

    Science.gov (United States)

    Weterings, K; Schrauwen, J; Wullems, G; Twell, D

    1995-07-01

    Regulatory elements within the promoter of the pollen-specific NTP303 gene from tobacco were analysed by transient and stable expression analyses. Analysis of precisely targeted mutations showed that the NTP303 promoter is not regulated by any of the previously described pollen-specific cis-regulatory elements. However, two adjacent regions from -103 to -86 bp and from -86 to -59 bp were shown to contain sequences which positively regulated the NTP303 promoter. Both of these regions were capable of driving pollen-specific expression from a heterologous promoter, independent of orientation and in an additive manner. The boundaries of the minimal, functional NTP303 promoter were determined to lie within the region -86 to -51 bp. The sequence AAATGA localized from -94 to -89 bp was identified as a novel cis-acting element, of which the TGA triplet was shown to comprise an active part. This element was shown to be completely conserved in the similarly regulated promoter of the Bp 10 gene from Brassica napus encoding a homologue of the NTP303 gene.

  7. Statistical significance of cis-regulatory modules

    Directory of Open Access Journals (Sweden)

    Smith Andrew D

    2007-01-01

    Full Text Available Abstract Background It is becoming increasingly important for researchers to be able to scan through large genomic regions for transcription factor binding sites or clusters of binding sites forming cis-regulatory modules. Correspondingly, there has been a push to develop algorithms for the rapid detection and assessment of cis-regulatory modules. While various algorithms for this purpose have been introduced, most are not well suited for rapid, genome scale scanning. Results We introduce methods designed for the detection and statistical evaluation of cis-regulatory modules, modeled as either clusters of individual binding sites or as combinations of sites with constrained organization. In order to determine the statistical significance of module sites, we first need a method to determine the statistical significance of single transcription factor binding site matches. We introduce a straightforward method of estimating the statistical significance of single site matches using a database of known promoters to produce data structures that can be used to estimate p-values for binding site matches. We next introduce a technique to calculate the statistical significance of the arrangement of binding sites within a module using a max-gap model. If the module scanned for has defined organizational parameters, the probability of the module is corrected to account for organizational constraints. The statistical significance of single site matches and the architecture of sites within the module can be combined to provide an overall estimation of statistical significance of cis-regulatory module sites. Conclusion The methods introduced in this paper allow for the detection and statistical evaluation of single transcription factor binding sites and cis-regulatory modules. The features described are implemented in the Search Tool for Occurrences of Regulatory Motifs (STORM and MODSTORM software.

  8. Barcoded DNA-tag reporters for multiplex cis-regulatory analysis.

    Directory of Open Access Journals (Sweden)

    Jongmin Nam

    Full Text Available Cis-regulatory DNA sequences causally mediate patterns of gene expression, but efficient experimental analysis of these control systems has remained challenging. Here we develop a new version of "barcoded" DNA-tag reporters, "Nanotags" that permit simultaneous quantitative analysis of up to 130 distinct cis-regulatory modules (CRMs. The activities of these reporters are measured in single experiments by the NanoString RNA counting method and other quantitative procedures. We demonstrate the efficiency of the Nanotag method by simultaneously measuring hourly temporal activities of 126 CRMs from 46 genes in the developing sea urchin embryo, otherwise a virtually impossible task. Nanotags are also used in gene perturbation experiments to reveal cis-regulatory responses of many CRMs at once. Nanotag methodology can be applied to many research areas, ranging from gene regulatory networks to functional and evolutionary genomics.

  9. [Colonic duplication revealed by intestinal obstruction due to fecal impaction].

    Science.gov (United States)

    Azahouani, A; Hida, M; Benhaddou, H

    2015-12-01

    Colonic duplications are very rare in children. With rectal duplications, they are the rarest locations of alimentary tract duplications, most often diagnosed in the first years of life. We report an unusual case of colic duplication with fecal impaction in a 9-month-old boy revealed by intestinal obstruction. We discuss the main diagnostic and therapeutic aspects of this malformation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  10. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  11. Identification of a cis-regulatory element by transient analysis of co-ordinately regulated genes

    Directory of Open Access Journals (Sweden)

    Allan Andrew C

    2008-07-01

    Full Text Available Abstract Background Transcription factors (TFs co-ordinately regulate target genes that are dispersed throughout the genome. This co-ordinate regulation is achieved, in part, through the interaction of transcription factors with conserved cis-regulatory motifs that are in close proximity to the target genes. While much is known about the families of transcription factors that regulate gene expression in plants, there are few well characterised cis-regulatory motifs. In Arabidopsis, over-expression of the MYB transcription factor PAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1 leads to transgenic plants with elevated anthocyanin levels due to the co-ordinated up-regulation of genes in the anthocyanin biosynthetic pathway. In addition to the anthocyanin biosynthetic genes, there are a number of un-associated genes that also change in expression level. This may be a direct or indirect consequence of the over-expression of PAP1. Results Oligo array analysis of PAP1 over-expression Arabidopsis plants identified genes co-ordinately up-regulated in response to the elevated expression of this transcription factor. Transient assays on the promoter regions of 33 of these up-regulated genes identified eight promoter fragments that were transactivated by PAP1. Bioinformatic analysis on these promoters revealed a common cis-regulatory motif that we showed is required for PAP1 dependent transactivation. Conclusion Co-ordinated gene regulation by individual transcription factors is a complex collection of both direct and indirect effects. Transient transactivation assays provide a rapid method to identify direct target genes from indirect target genes. Bioinformatic analysis of the promoters of these direct target genes is able to locate motifs that are common to this sub-set of promoters, which is impossible to identify with the larger set of direct and indirect target genes. While this type of analysis does not prove a direct interaction between protein and DNA

  12. Using hexamers to predict cis-regulatory motifs in Drosophila

    Directory of Open Access Journals (Sweden)

    Kibler Dennis

    2005-10-01

    Full Text Available Abstract Background Cis-regulatory modules (CRMs are short stretches of DNA that help regulate gene expression in higher eukaryotes. They have been found up to 1 megabase away from the genes they regulate and can be located upstream, downstream, and even within their target genes. Due to the difficulty of finding CRMs using biological and computational techniques, even well-studied regulatory systems may contain CRMs that have not yet been discovered. Results We present a simple, efficient method (HexDiff based only on hexamer frequencies of known CRMs and non-CRM sequence to predict novel CRMs in regulatory systems. On a data set of 16 gap and pair-rule genes containing 52 known CRMs, predictions made by HexDiff had a higher correlation with the known CRMs than several existing CRM prediction algorithms: Ahab, Cluster Buster, MSCAN, MCAST, and LWF. After combining the results of the different algorithms, 10 putative CRMs were identified and are strong candidates for future study. The hexamers used by HexDiff to distinguish between CRMs and non-CRM sequence were also analyzed and were shown to be enriched in regulatory elements. Conclusion HexDiff provides an efficient and effective means for finding new CRMs based on known CRMs, rather than known binding sites.

  13. Genetic mapping uncovers cis-regulatory landscape of RNA editing.

    Science.gov (United States)

    Ramaswami, Gokul; Deng, Patricia; Zhang, Rui; Anna Carbone, Mary; Mackay, Trudy F C; Li, Jin Billy

    2015-09-16

    Adenosine-to-inosine (A-to-I) RNA editing, catalysed by ADAR enzymes conserved in metazoans, plays an important role in neurological functions. Although the fine-tuning mechanism provided by A-to-I RNA editing is important, the underlying rules governing ADAR substrate recognition are not well understood. We apply a quantitative trait loci (QTL) mapping approach to identify genetic variants associated with variability in RNA editing. With very accurate measurement of RNA editing levels at 789 sites in 131 Drosophila melanogaster strains, here we identify 545 editing QTLs (edQTLs) associated with differences in RNA editing. We demonstrate that many edQTLs can act through changes in the local secondary structure for edited dsRNAs. Furthermore, we find that edQTLs located outside of the edited dsRNA duplex are enriched in secondary structure, suggesting that distal dsRNA structure beyond the editing site duplex affects RNA editing efficiency. Our work will facilitate the understanding of the cis-regulatory code of RNA editing.

  14. Changes in Cis-regulatory Elements during Morphological Evolution

    Directory of Open Access Journals (Sweden)

    Yu-Lee Paul

    2012-10-01

    Full Text Available How have animals evolved new body designs (morphological evolution? This requires explanations both for simple morphological changes, such as differences in pigmentation and hair patterns between different Drosophila populations and species, and also for more complex changes, such as differences in the forelimbs of mice and bats, and the necks of amphibians and reptiles. The genetic changes and pathways involved in these evolutionary steps require identification. Many, though not all, of these events occur by changes in cis-regulatory (enhancer elements within developmental genes. Enhancers are modular, each affecting expression in only one or a few tissues. Therefore it is possible to add, remove or alter an enhancer without producing changes in multiple tissues, and thereby avoid widespread (pleiotropic deleterious effects. Ideally, for a given step in morphological evolution it is necessary to identify (i the change in phenotype, (ii the changes in gene expression, (iii the DNA region, enhancer or otherwise, affected, (iv the mutation involved, (v the nature of the transcription or other factors that bind to this site. In practice these data are incomplete for most of the published studies upon morphological evolution. Here, the investigations are categorized according to how far these analyses have proceeded.

  15. Annelid Distal-less/Dlx duplications reveal varied post-duplication fates

    Directory of Open Access Journals (Sweden)

    Korchagina Natalia

    2011-08-01

    Full Text Available Abstract Background Dlx (Distal-less genes have various developmental roles and are widespread throughout the animal kingdom, usually occurring as single copy genes in non-chordates and as multiple copies in most chordate genomes. While the genomic arrangement and function of these genes is well known in vertebrates and arthropods, information about Dlx genes in other organisms is scarce. We investigate the presence of Dlx genes in several annelid species and examine Dlx gene expression in the polychaete Pomatoceros lamarckii. Results Two Dlx genes are present in P. lamarckii, Capitella teleta and Helobdella robusta. The C. teleta Dlx genes are closely linked in an inverted tail-to-tail orientation, reminiscent of the arrangement of vertebrate Dlx pairs, and gene conversion appears to have had a role in their evolution. The H. robusta Dlx genes, however, are not on the same genomic scaffold and display divergent sequences, while, if the P. lamarckii genes are linked in a tail-to-tail orientation they are a minimum of 41 kilobases apart and show no sign of gene conversion. No expression in P. lamarckii appendage development has been observed, which conflicts with the supposed conserved role of these genes in animal appendage development. These Dlx duplications do not appear to be annelid-wide, as the polychaete Platynereis dumerilii likely possesses only one Dlx gene. Conclusions On the basis of the currently accepted annelid phylogeny, we hypothesise that one Dlx duplication occurred in the annelid lineage after the divergence of P. dumerilii from the other lineages and these duplicates then had varied evolutionary fates in different species. We also propose that the ancestral role of Dlx genes is not related to appendage development.

  16. Identifying Cis-Regulatory Changes Involved in the Evolution of Aerobic Fermentation in Yeasts

    Science.gov (United States)

    Lin, Zhenguo; Wang, Tzi-Yuan; Tsai, Bing-Shi; Wu, Fang-Ting; Yu, Fu-Jung; Tseng, Yu-Jung; Sung, Huang-Mo; Li, Wen-Hsiung

    2013-01-01

    Gene regulation change has long been recognized as an important mechanism for phenotypic evolution. We used the evolution of yeast aerobic fermentation as a model to explore how gene regulation has evolved and how this process has contributed to phenotypic evolution and adaptation. Most eukaryotes fully oxidize glucose to CO2 and H2O in mitochondria to maximize energy yield, whereas some yeasts, such as Saccharomyces cerevisiae and its relatives, predominantly ferment glucose into ethanol even in the presence of oxygen, a phenomenon known as aerobic fermentation. We examined the genome-wide gene expression levels among 12 different yeasts and found that a group of genes involved in the mitochondrial respiration process showed the largest reduction in gene expression level during the evolution of aerobic fermentation. Our analysis revealed that the downregulation of these genes was significantly associated with massive loss of binding motifs of Cbf1p in the fermentative yeasts. Our experimental assays confirmed the binding of Cbf1p to the predicted motif and the activator role of Cbf1p. In summary, our study laid a foundation to unravel the long-time mystery about the genetic basis of evolution of aerobic fermentation, providing new insights into understanding the role of cis-regulatory changes in phenotypic evolution. PMID:23650209

  17. Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.

    Science.gov (United States)

    Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P

    2015-04-23

    With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.

  18. Bioinformatic analysis of cis-regulatory interactions between progesterone and estrogen receptors in breast cancer

    Directory of Open Access Journals (Sweden)

    Matloob Khushi

    2014-11-01

    Full Text Available Chromatin factors interact with each other in a cell and sequence-specific manner in order to regulate transcription and a wealth of publically available datasets exists describing the genomic locations of these interactions. Our recently published BiSA (Binding Sites Analyser database contains transcription factor binding locations and epigenetic modifications collected from published studies and provides tools to analyse stored and imported data. Using BiSA we investigated the overlapping cis-regulatory role of estrogen receptor alpha (ERα and progesterone receptor (PR in the T-47D breast cancer cell line. We found that ERα binding sites overlap with a subset of PR binding sites. To investigate further, we re-analysed raw data to remove any biases introduced by the use of distinct tools in the original publications. We identified 22,152 PR and 18,560 ERα binding sites (<5% false discovery rate with 4,358 overlapping regions among the two datasets. BiSA statistical analysis revealed a non-significant overall overlap correlation between the two factors, suggesting that ERα and PR are not partner factors and do not require each other for binding to occur. However, Monte Carlo simulation by Binary Interval Search (BITS, Relevant Distance, Absolute Distance, Jaccard and Projection tests by Genometricorr revealed a statistically significant spatial correlation of binding regions on chromosome between the two factors. Motif analysis revealed that the shared binding regions were enriched with binding motifs for ERα, PR and a number of other transcription and pioneer factors. Some of these factors are known to co-locate with ERα and PR binding. Therefore spatially close proximity of ERα binding sites with PR binding sites suggests that ERα and PR, in general function independently at the molecular level, but that their activities converge on a specific subset of transcriptional targets.

  19. Multiple cis-regulatory elements are involved in the complex regulation of the sieve element-specific MtSEO-F1 promoter from Medicago truncatula.

    Science.gov (United States)

    Bucsenez, M; Rüping, B; Behrens, S; Twyman, R M; Noll, G A; Prüfer, D

    2012-09-01

    The sieve element occlusion (SEO) gene family includes several members that are expressed specifically in immature sieve elements (SEs) in the developing phloem of dicotyledonous plants. To determine how this restricted expression profile is achieved, we analysed the SE-specific Medicago truncatula SEO-F1 promoter (PMtSEO-F1) by constructing deletion, substitution and hybrid constructs and testing them in transgenic tobacco plants using green fluorescent protein as a reporter. This revealed four promoter regions, each containing cis-regulatory elements that activate transcription in SEs. One of these segments also contained sufficient information to suppress PMtSEO-F1 transcription in the phloem companion cells (CCs). Subsequent in silico analysis revealed several candidate cis-regulatory elements that PMtSEO-F1 shares with other SEO promoters. These putative sieve element boxes (PSE boxes) are promising candidates for cis-regulatory elements controlling the SE-specific expression of PMtSEO-F1. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.

  20. Cis-regulatory elements in the primate brain: from functional specialization to neurodegeneration

    NARCIS (Netherlands)

    Vermunt, Marit W.

    2017-01-01

    Over the last decade, the noncoding part of the genome has been shown to harbour thousands of cis-regulatory elements, such as enhancers, that activate well-defined gene expression programs. Here, we charted active enhancers in a multiplicity of human brain regions to understand the role of

  1. Functional evolution of cis-regulatory modules at a homeotic gene in Drosophila.

    Directory of Open Access Journals (Sweden)

    Margaret C W Ho

    2009-11-01

    Full Text Available It is a long-held belief in evolutionary biology that the rate of molecular evolution for a given DNA sequence is inversely related to the level of functional constraint. This belief holds true for the protein-coding homeotic (Hox genes originally discovered in Drosophila melanogaster. Expression of the Hox genes in Drosophila embryos is essential for body patterning and is controlled by an extensive array of cis-regulatory modules (CRMs. How the regulatory modules functionally evolve in different species is not clear. A comparison of the CRMs for the Abdominal-B gene from different Drosophila species reveals relatively low levels of overall sequence conservation. However, embryonic enhancer CRMs from other Drosophila species direct transgenic reporter gene expression in the same spatial and temporal patterns during development as their D. melanogaster orthologs. Bioinformatic analysis reveals the presence of short conserved sequences within defined CRMs, representing gap and pair-rule transcription factor binding sites. One predicted binding site for the gap transcription factor KRUPPEL in the IAB5 CRM was found to be altered in Superabdominal (Sab mutations. In Sab mutant flies, the third abdominal segment is transformed into a copy of the fifth abdominal segment. A model for KRUPPEL-mediated repression at this binding site is presented. These findings challenge our current understanding of the relationship between sequence evolution at the molecular level and functional activity of a CRM. While the overall sequence conservation at Drosophila CRMs is not distinctive from neighboring genomic regions, functionally critical transcription factor binding sites within embryonic enhancer CRMs are highly conserved. These results have implications for understanding mechanisms of gene expression during embryonic development, enhancer function, and the molecular evolution of eukaryotic regulatory modules.

  2. Genome-wide prediction of cis-regulatory regions using supervised deep learning methods.

    Science.gov (United States)

    Li, Yifeng; Shi, Wenqiang; Wasserman, Wyeth W

    2018-05-31

    In the human genome, 98% of DNA sequences are non-protein-coding regions that were previously disregarded as junk DNA. In fact, non-coding regions host a variety of cis-regulatory regions which precisely control the expression of genes. Thus, Identifying active cis-regulatory regions in the human genome is critical for understanding gene regulation and assessing the impact of genetic variation on phenotype. The developments of high-throughput sequencing and machine learning technologies make it possible to predict cis-regulatory regions genome wide. Based on rich data resources such as the Encyclopedia of DNA Elements (ENCODE) and the Functional Annotation of the Mammalian Genome (FANTOM) projects, we introduce DECRES based on supervised deep learning approaches for the identification of enhancer and promoter regions in the human genome. Due to their ability to discover patterns in large and complex data, the introduction of deep learning methods enables a significant advance in our knowledge of the genomic locations of cis-regulatory regions. Using models for well-characterized cell lines, we identify key experimental features that contribute to the predictive performance. Applying DECRES, we delineate locations of 300,000 candidate enhancers genome wide (6.8% of the genome, of which 40,000 are supported by bidirectional transcription data), and 26,000 candidate promoters (0.6% of the genome). The predicted annotations of cis-regulatory regions will provide broad utility for genome interpretation from functional genomics to clinical applications. The DECRES model demonstrates potentials of deep learning technologies when combined with high-throughput sequencing data, and inspires the development of other advanced neural network models for further improvement of genome annotations.

  3. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong

    2009-11-01

    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  4. Prediction of tissue-specific cis-regulatory modules using Bayesian networks and regression trees

    Directory of Open Access Journals (Sweden)

    Chen Xiaoyu

    2007-12-01

    Full Text Available Abstract Background In vertebrates, a large part of gene transcriptional regulation is operated by cis-regulatory modules. These modules are believed to be regulating much of the tissue-specificity of gene expression. Results We develop a Bayesian network approach for identifying cis-regulatory modules likely to regulate tissue-specific expression. The network integrates predicted transcription factor binding site information, transcription factor expression data, and target gene expression data. At its core is a regression tree modeling the effect of combinations of transcription factors bound to a module. A new unsupervised EM-like algorithm is developed to learn the parameters of the network, including the regression tree structure. Conclusion Our approach is shown to accurately identify known human liver and erythroid-specific modules. When applied to the prediction of tissue-specific modules in 10 different tissues, the network predicts a number of important transcription factor combinations whose concerted binding is associated to specific expression.

  5. Computational and molecular dissection of an X-box cis-Regulatory module

    OpenAIRE

    Warrington, Timothy Burton

    2015-01-01

    Ciliopathies are a class of human diseases marked by dysfunction of the cellular organelle, cilia. While many of the molecular components that make up cilia have been identified and studied, comparatively little is understood about the transcriptional regulation of genes encoding these components. The conserved transcription factor Regulatory Factor X (RFX)/DAF-19, which acts through binding to the cis-regulatory motif known as X-box, has been shown to regulate ciliary genes in many animals f...

  6. Creating and validating cis-regulatory maps of tissue-specific gene expression regulation

    Science.gov (United States)

    O'Connor, Timothy R.; Bailey, Timothy L.

    2014-01-01

    Predicting which genomic regions control the transcription of a given gene is a challenge. We present a novel computational approach for creating and validating maps that associate genomic regions (cis-regulatory modules–CRMs) with genes. The method infers regulatory relationships that explain gene expression observed in a test tissue using widely available genomic data for ‘other’ tissues. To predict the regulatory targets of a CRM, we use cross-tissue correlation between histone modifications present at the CRM and expression at genes within 1 Mbp of it. To validate cis-regulatory maps, we show that they yield more accurate models of gene expression than carefully constructed control maps. These gene expression models predict observed gene expression from transcription factor binding in the CRMs linked to that gene. We show that our maps are able to identify long-range regulatory interactions and improve substantially over maps linking genes and CRMs based on either the control maps or a ‘nearest neighbor’ heuristic. Our results also show that it is essential to include CRMs predicted in multiple tissues during map-building, that H3K27ac is the most informative histone modification, and that CAGE is the most informative measure of gene expression for creating cis-regulatory maps. PMID:25200088

  7. Pathogenic adaptation of intracellular bacteria by rewiring a cis-regulatory input function.

    Science.gov (United States)

    Osborne, Suzanne E; Walthers, Don; Tomljenovic, Ana M; Mulder, David T; Silphaduang, Uma; Duong, Nancy; Lowden, Michael J; Wickham, Mark E; Waller, Ross F; Kenney, Linda J; Coombes, Brian K

    2009-03-10

    The acquisition of DNA by horizontal gene transfer enables bacteria to adapt to previously unexploited ecological niches. Although horizontal gene transfer and mutation of protein-coding sequences are well-recognized forms of pathogen evolution, the evolutionary significance of cis-regulatory mutations in creating phenotypic diversity through altered transcriptional outputs is not known. We show the significance of regulatory mutation for pathogen evolution by mapping and then rewiring a cis-regulatory module controlling a gene required for murine typhoid. Acquisition of a binding site for the Salmonella pathogenicity island-2 regulator, SsrB, enabled the srfN gene, ancestral to the Salmonella genus, to play a role in pathoadaptation of S. typhimurium to a host animal. We identified the evolved cis-regulatory module and quantified the fitness gain that this regulatory output accrues for the bacterium using competitive infections of host animals. Our findings highlight a mechanism of pathogen evolution involving regulatory mutation that is selected because of the fitness advantage the new regulatory output provides the incipient clones.

  8. Dynamic SPR monitoring of yeast nuclear protein binding to a cis-regulatory element

    International Nuclear Information System (INIS)

    Mao, Grace; Brody, James P.

    2007-01-01

    Gene expression is controlled by protein complexes binding to short specific sequences of DNA, called cis-regulatory elements. Expression of most eukaryotic genes is controlled by dozens of these elements. Comprehensive identification and monitoring of these elements is a major goal of genomics. In pursuit of this goal, we are developing a surface plasmon resonance (SPR) based assay to identify and monitor cis-regulatory elements. To test whether we could reliably monitor protein binding to a regulatory element, we immobilized a 16 bp region of Saccharomyces cerevisiae chromosome 5 onto a gold surface. This 16 bp region of DNA is known to bind several proteins and thought to control expression of the gene RNR1, which varies through the cell cycle. We synchronized yeast cell cultures, and then sampled these cultures at a regular interval. These samples were processed to purify nuclear lysate, which was then exposed to the sensor. We found that nuclear protein binds this particular element of DNA at a significantly higher rate (as compared to unsynchronized cells) during G1 phase. Other time points show levels of DNA-nuclear protein binding similar to the unsynchronized control. We also measured the apparent association complex of the binding to be 0.014 s -1 . We conclude that (1) SPR-based assays can monitor DNA-nuclear protein binding and that (2) for this particular cis-regulatory element, maximum DNA-nuclear protein binding occurs during G1 phase

  9. The house spider genome reveals an ancient whole-genome duplication during arachnid evolution.

    Science.gov (United States)

    Schwager, Evelyn E; Sharma, Prashant P; Clarke, Thomas; Leite, Daniel J; Wierschin, Torsten; Pechmann, Matthias; Akiyama-Oda, Yasuko; Esposito, Lauren; Bechsgaard, Jesper; Bilde, Trine; Buffry, Alexandra D; Chao, Hsu; Dinh, Huyen; Doddapaneni, HarshaVardhan; Dugan, Shannon; Eibner, Cornelius; Extavour, Cassandra G; Funch, Peter; Garb, Jessica; Gonzalez, Luis B; Gonzalez, Vanessa L; Griffiths-Jones, Sam; Han, Yi; Hayashi, Cheryl; Hilbrant, Maarten; Hughes, Daniel S T; Janssen, Ralf; Lee, Sandra L; Maeso, Ignacio; Murali, Shwetha C; Muzny, Donna M; Nunes da Fonseca, Rodrigo; Paese, Christian L B; Qu, Jiaxin; Ronshaugen, Matthew; Schomburg, Christoph; Schönauer, Anna; Stollewerk, Angelika; Torres-Oliva, Montserrat; Turetzek, Natascha; Vanthournout, Bram; Werren, John H; Wolff, Carsten; Worley, Kim C; Bucher, Gregor; Gibbs, Richard A; Coddington, Jonathan; Oda, Hiroki; Stanke, Mario; Ayoub, Nadia A; Prpic, Nikola-Michael; Flot, Jean-François; Posnien, Nico; Richards, Stephen; McGregor, Alistair P

    2017-07-31

    The duplication of genes can occur through various mechanisms and is thought to make a major contribution to the evolutionary diversification of organisms. There is increasing evidence for a large-scale duplication of genes in some chelicerate lineages including two rounds of whole genome duplication (WGD) in horseshoe crabs. To investigate this further, we sequenced and analyzed the genome of the common house spider Parasteatoda tepidariorum. We found pervasive duplication of both coding and non-coding genes in this spider, including two clusters of Hox genes. Analysis of synteny conservation across the P. tepidariorum genome suggests that there has been an ancient WGD in spiders. Comparison with the genomes of other chelicerates, including that of the newly sequenced bark scorpion Centruroides sculpturatus, suggests that this event occurred in the common ancestor of spiders and scorpions, and is probably independent of the WGDs in horseshoe crabs. Furthermore, characterization of the sequence and expression of the Hox paralogs in P. tepidariorum suggests that many have been subject to neo-functionalization and/or sub-functionalization since their duplication. Our results reveal that spiders and scorpions are likely the descendants of a polyploid ancestor that lived more than 450 MYA. Given the extensive morphological diversity and ecological adaptations found among these animals, rivaling those of vertebrates, our study of the ancient WGD event in Arachnopulmonata provides a new comparative platform to explore common and divergent evolutionary outcomes of polyploidization events across eukaryotes.

  10. Bounded search for de novo identification of degenerate cis-regulatory elements

    Directory of Open Access Journals (Sweden)

    Khetani Radhika S

    2006-05-01

    Full Text Available Abstract Background The identification of statistically overrepresented sequences in the upstream regions of coregulated genes should theoretically permit the identification of potential cis-regulatory elements. However, in practice many cis-regulatory elements are highly degenerate, precluding the use of an exhaustive word-counting strategy for their identification. While numerous methods exist for inferring base distributions using a position weight matrix, recent studies suggest that the independence assumptions inherent in the model, as well as the inability to reach a global optimum, limit this approach. Results In this paper, we report PRISM, a degenerate motif finder that leverages the relationship between the statistical significance of a set of binding sites and that of the individual binding sites. PRISM first identifies overrepresented, non-degenerate consensus motifs, then iteratively relaxes each one into a high-scoring degenerate motif. This approach requires no tunable parameters, thereby lending itself to unbiased performance comparisons. We therefore compare PRISM's performance against nine popular motif finders on 28 well-characterized S. cerevisiae regulons. PRISM consistently outperforms all other programs. Finally, we use PRISM to predict the binding sites of uncharacterized regulons. Our results support a proposed mechanism of action for the yeast cell-cycle transcription factor Stb1, whose binding site has not been determined experimentally. Conclusion The relationship between statistical measures of the binding sites and the set as a whole leads to a simple means of identifying the diverse range of cis-regulatory elements to which a protein binds. This approach leverages the advantages of word-counting, in that position dependencies are implicitly accounted for and local optima are more easily avoided. While we sacrifice guaranteed optimality to prevent the exponential blowup of exhaustive search, we prove that the error

  11. Comparative genomics of metabolic capacities of regulons controlled by cis-regulatory RNA motifs in bacteria.

    Science.gov (United States)

    Sun, Eric I; Leyn, Semen A; Kazanov, Marat D; Saier, Milton H; Novichkov, Pavel S; Rodionov, Dmitry A

    2013-09-02

    In silico comparative genomics approaches have been efficiently used for functional prediction and reconstruction of metabolic and regulatory networks. Riboswitches are metabolite-sensing structures often found in bacterial mRNA leaders controlling gene expression on transcriptional or translational levels.An increasing number of riboswitches and other cis-regulatory RNAs have been recently classified into numerous RNA families in the Rfam database. High conservation of these RNA motifs provides a unique advantage for their genomic identification and comparative analysis. A comparative genomics approach implemented in the RegPredict tool was used for reconstruction and functional annotation of regulons controlled by RNAs from 43 Rfam families in diverse taxonomic groups of Bacteria. The inferred regulons include ~5200 cis-regulatory RNAs and more than 12000 target genes in 255 microbial genomes. All predicted RNA-regulated genes were classified into specific and overall functional categories. Analysis of taxonomic distribution of these categories allowed us to establish major functional preferences for each analyzed cis-regulatory RNA motif family. Overall, most RNA motif regulons showed predictable functional content in accordance with their experimentally established effector ligands. Our results suggest that some RNA motifs (including thiamin pyrophosphate and cobalamin riboswitches that control the cofactor metabolism) are widespread and likely originated from the last common ancestor of all bacteria. However, many more analyzed RNA motifs are restricted to a narrow taxonomic group of bacteria and likely represent more recent evolutionary innovations. The reconstructed regulatory networks for major known RNA motifs substantially expand the existing knowledge of transcriptional regulation in bacteria. The inferred regulons can be used for genetic experiments, functional annotations of genes, metabolic reconstruction and evolutionary analysis. The obtained genome

  12. On the Concept of Cis-regulatory Information: From Sequence Motifs to Logic Functions

    Science.gov (United States)

    Tarpine, Ryan; Istrail, Sorin

    The regulatory genome is about the “system level organization of the core genomic regulatory apparatus, and how this is the locus of causality underlying the twin phenomena of animal development and animal evolution” (E.H. Davidson. The Regulatory Genome: Gene Regulatory Networks in Development and Evolution, Academic Press, 2006). Information processing in the regulatory genome is done through regulatory states, defined as sets of transcription factors (sequence-specific DNA binding proteins which determine gene expression) that are expressed and active at the same time. The core information processing machinery consists of modular DNA sequence elements, called cis-modules, that interact with transcription factors. The cis-modules “read” the information contained in the regulatory state of the cell through transcription factor binding, “process” it, and directly or indirectly communicate with the basal transcription apparatus to determine gene expression. This endowment of each gene with the information-receiving capacity through their cis-regulatory modules is essential for the response to every possible regulatory state to which it might be exposed during all phases of the life cycle and in all cell types. We present here a set of challenges addressed by our CYRENE research project aimed at studying the cis-regulatory code of the regulatory genome. The CYRENE Project is devoted to (1) the construction of a database, the cis-Lexicon, containing comprehensive information across species about experimentally validated cis-regulatory modules; and (2) the software development of a next-generation genome browser, the cis-Browser, specialized for the regulatory genome. The presentation is anchored on three main computational challenges: the Gene Naming Problem, the Consensus Sequence Bottleneck Problem, and the Logic Function Inference Problem.

  13. Conserved cis-regulatory regions in a large genomic landscape control SHH and BMP-regulated Gremlin1 expression in mouse limb buds

    Directory of Open Access Journals (Sweden)

    Zuniga Aimée

    2012-08-01

    Full Text Available Abstract Background Mouse limb bud is a prime model to study the regulatory interactions that control vertebrate organogenesis. Major aspects of limb bud development are controlled by feedback loops that define a self-regulatory signalling system. The SHH/GREM1/AER-FGF feedback loop forms the core of this signalling system that operates between the posterior mesenchymal organiser and the ectodermal signalling centre. The BMP antagonist Gremlin1 (GREM1 is a critical node in this system, whose dynamic expression is controlled by BMP, SHH, and FGF signalling and key to normal progression of limb bud development. Previous analysis identified a distant cis-regulatory landscape within the neighbouring Formin1 (Fmn1 locus that is required for Grem1 expression, reminiscent of the genomic landscapes controlling HoxD and Shh expression in limb buds. Results Three highly conserved regions (HMCO1-3 were identified within the previously defined critical genomic region and tested for their ability to regulate Grem1 expression in mouse limb buds. Using a combination of BAC and conventional transgenic approaches, a 9 kb region located ~70 kb downstream of the Grem1 transcription unit was identified. This region, termed Grem1 Regulatory Sequence 1 (GRS1, is able to recapitulate major aspects of Grem1 expression, as it drives expression of a LacZ reporter into the posterior and, to a lesser extent, in the distal-anterior mesenchyme. Crossing the GRS1 transgene into embryos with alterations in the SHH and BMP pathways established that GRS1 depends on SHH and is modulated by BMP signalling, i.e. integrates inputs from these pathways. Chromatin immunoprecipitation revealed interaction of endogenous GLI3 proteins with the core cis-regulatory elements in the GRS1 region. As GLI3 is a mediator of SHH signal transduction, these results indicated that SHH directly controls Grem1 expression through the GRS1 region. Finally, all cis-regulatory regions within the Grem1

  14. Plasticity of the cis-regulatory input function of a gene.

    Directory of Open Access Journals (Sweden)

    Avraham E Mayo

    2006-04-01

    Full Text Available The transcription rate of a gene is often controlled by several regulators that bind specific sites in the gene's cis-regulatory region. The combined effect of these regulators is described by a cis-regulatory input function. What determines the form of an input function, and how variable is it with respect to mutations? To address this, we employ the well-characterized lac operon of Escherichia coli, which has an elaborate input function, intermediate between Boolean AND-gate and OR-gate logic. We mapped in detail the input function of 12 variants of the lac promoter, each with different point mutations in the regulator binding sites, by means of accurate expression measurements from living cells. We find that even a few mutations can significantly change the input function, resulting in functions that resemble Pure AND gates, OR gates, or single-input switches. Other types of gates were not found. The variant input functions can be described in a unified manner by a mathematical model. The model also lets us predict which functions cannot be reached by point mutations. The input function that we studied thus appears to be plastic, in the sense that many of the mutations do not ruin the regulation completely but rather result in new ways to integrate the inputs.

  15. Preaxial polydactyly/triphalangeal thumb is associated with changed transcription factor-binding affinity in a family with a novel point mutation in the long-range cis-regulatory element ZRS

    DEFF Research Database (Denmark)

    Farooq, Muhammad; Troelsen, Jesper T; Boyd, Mette

    2010-01-01

    A cis-regulatory sequence also known as zone of polarizing activity (ZPA) regulatory sequence (ZRS) located in intron 5 of LMBR1 is essential for expression of sonic hedgehog (SHH) in the developing posterior limb bud mesenchyme. Even though many point mutations causing preaxial duplication defects...... demonstrated a marked difference between wild-type and the mutant probe, which uniquely bound one or several transcription factors extracted from Caco-2 cells. This finding supports a model in which ectopic anterior SHH expression in the developing limb results from abnormal binding of one or more...

  16. Evolution of New cis-Regulatory Motifs Required for Cell-Specific Gene Expression in Caenorhabditis.

    Directory of Open Access Journals (Sweden)

    Michalis Barkoulas

    2016-09-01

    Full Text Available Patterning of C. elegans vulval cell fates relies on inductive signaling. In this induction event, a single cell, the gonadal anchor cell, secretes LIN-3/EGF and induces three out of six competent precursor cells to acquire a vulval fate. We previously showed that this developmental system is robust to a four-fold variation in lin-3/EGF genetic dose. Here using single-molecule FISH, we find that the mean level of expression of lin-3 in the anchor cell is remarkably conserved. No change in lin-3 expression level could be detected among C. elegans wild isolates and only a low level of change-less than 30%-in the Caenorhabditis genus and in Oscheius tipulae. In C. elegans, lin-3 expression in the anchor cell is known to require three transcription factor binding sites, specifically two E-boxes and a nuclear-hormone-receptor (NHR binding site. Mutation of any of these three elements in C. elegans results in a dramatic decrease in lin-3 expression. Yet only a single E-box is found in the Drosophilae supergroup of Caenorhabditis species, including C. angaria, while the NHR-binding site likely only evolved at the base of the Elegans group. We find that a transgene from C. angaria bearing a single E-box is sufficient for normal expression in C. elegans. Even a short 58 bp cis-regulatory fragment from C. angaria with this single E-box is able to replace the three transcription factor binding sites at the endogenous C. elegans lin-3 locus, resulting in the wild-type expression level. Thus, regulatory evolution occurring in cis within a 58 bp lin-3 fragment, results in a strict requirement for the NHR binding site and a second E-box in C. elegans. This single-cell, single-molecule, quantitative and functional evo-devo study demonstrates that conserved expression levels can hide extensive change in cis-regulatory site requirements and highlights the evolution of new cis-regulatory elements required for cell-specific gene expression.

  17. A New Algorithm for Identifying Cis-Regulatory Modules Based on Hidden Markov Model

    Directory of Open Access Journals (Sweden)

    Haitao Guo

    2017-01-01

    Full Text Available The discovery of cis-regulatory modules (CRMs is the key to understanding mechanisms of transcription regulation. Since CRMs have specific regulatory structures that are the basis for the regulation of gene expression, how to model the regulatory structure of CRMs has a considerable impact on the performance of CRM identification. The paper proposes a CRM discovery algorithm called ComSPS. ComSPS builds a regulatory structure model of CRMs based on HMM by exploring the rules of CRM transcriptional grammar that governs the internal motif site arrangement of CRMs. We test ComSPS on three benchmark datasets and compare it with five existing methods. Experimental results show that ComSPS performs better than them.

  18. A New Algorithm for Identifying Cis-Regulatory Modules Based on Hidden Markov Model

    Science.gov (United States)

    2017-01-01

    The discovery of cis-regulatory modules (CRMs) is the key to understanding mechanisms of transcription regulation. Since CRMs have specific regulatory structures that are the basis for the regulation of gene expression, how to model the regulatory structure of CRMs has a considerable impact on the performance of CRM identification. The paper proposes a CRM discovery algorithm called ComSPS. ComSPS builds a regulatory structure model of CRMs based on HMM by exploring the rules of CRM transcriptional grammar that governs the internal motif site arrangement of CRMs. We test ComSPS on three benchmark datasets and compare it with five existing methods. Experimental results show that ComSPS performs better than them. PMID:28497059

  19. Alignment and prediction of cis-regulatory modules based on a probabilistic model of evolution.

    Directory of Open Access Journals (Sweden)

    Xin He

    2009-03-01

    Full Text Available Cross-species comparison has emerged as a powerful paradigm for predicting cis-regulatory modules (CRMs and understanding their evolution. The comparison requires reliable sequence alignment, which remains a challenging task for less conserved noncoding sequences. Furthermore, the existing models of DNA sequence evolution generally do not explicitly treat the special properties of CRM sequences. To address these limitations, we propose a model of CRM evolution that captures different modes of evolution of functional transcription factor binding sites (TFBSs and the background sequences. A particularly novel aspect of our work is a probabilistic model of gains and losses of TFBSs, a process being recognized as an important part of regulatory sequence evolution. We present a computational framework that uses this model to solve the problems of CRM alignment and prediction. Our alignment method is similar to existing methods of statistical alignment but uses the conserved binding sites to improve alignment. Our CRM prediction method deals with the inherent uncertainties of binding site annotations and sequence alignment in a probabilistic framework. In simulated as well as real data, we demonstrate that our program is able to improve both alignment and prediction of CRM sequences over several state-of-the-art methods. Finally, we used alignments produced by our program to study binding site conservation in genome-wide binding data of key transcription factors in the Drosophila blastoderm, with two intriguing results: (i the factor-bound sequences are under strong evolutionary constraints even if their neighboring genes are not expressed in the blastoderm and (ii binding sites in distal bound sequences (relative to transcription start sites tend to be more conserved than those in proximal regions. Our approach is implemented as software, EMMA (Evolutionary Model-based cis-regulatory Module Analysis, ready to be applied in a broad biological context.

  20. In silico modeling of epigenetic-induced changes in photoreceptor cis-regulatory elements.

    Science.gov (United States)

    Hossain, Reafa A; Dunham, Nicholas R; Enke, Raymond A; Berndsen, Christopher E

    2018-01-01

    DNA methylation is a well-characterized epigenetic repressor of mRNA transcription in many plant and vertebrate systems. However, the mechanism of this repression is not fully understood. The process of transcription is controlled by proteins that regulate recruitment and activity of RNA polymerase by binding to specific cis-regulatory sequences. Cone-rod homeobox (CRX) is a well-characterized mammalian transcription factor that controls photoreceptor cell-specific gene expression. Although much is known about the functions and DNA binding specificity of CRX, little is known about how DNA methylation modulates CRX binding affinity to genomic cis-regulatory elements. We used bisulfite pyrosequencing of human ocular tissues to measure DNA methylation levels of the regulatory regions of RHO , PDE6B, PAX6 , and LINE1 retrotransposon repeats. To describe the molecular mechanism of repression, we used molecular modeling to illustrate the effect of DNA methylation on human RHO regulatory sequences. In this study, we demonstrate an inverse correlation between DNA methylation in regulatory regions adjacent to the human RHO and PDE6B genes and their subsequent transcription in human ocular tissues. Docking of CRX to the DNA models shows that CRX interacts with the grooves of these sequences, suggesting changes in groove structure could regulate binding. Molecular dynamics simulations of the RHO promoter and enhancer regions show changes in the flexibility and groove width upon epigenetic modification. Models also demonstrate changes in the local dynamics of CRX binding sites within RHO regulatory sequences which may account for the repression of CRX-dependent transcription. Collectively, these data demonstrate epigenetic regulation of CRX binding sites in human retinal tissue and provide insight into the mechanism of this mode of epigenetic regulation to be tested in future experiments.

  1. Identification of putative cis-regulatory elements in Cryptosporidium parvum by de novo pattern finding

    Directory of Open Access Journals (Sweden)

    Kissinger Jessica C

    2007-01-01

    Full Text Available Abstract Background Cryptosporidium parvum is a unicellular eukaryote in the phylum Apicomplexa. It is an obligate intracellular parasite that causes diarrhea and is a significant AIDS-related pathogen. Cryptosporidium parvum is not amenable to long-term laboratory cultivation or classical molecular genetic analysis. The parasite exhibits a complex life cycle, a broad host range, and fundamental mechanisms of gene regulation remain unknown. We have used data from the recently sequenced genome of this organism to uncover clues about gene regulation in C. parvum. We have applied two pattern finding algorithms MEME and AlignACE to identify conserved, over-represented motifs in the 5' upstream regions of genes in C. parvum. To support our findings, we have established comparative real-time -PCR expression profiles for the groups of genes examined computationally. Results We find that groups of genes that share a function or belong to a common pathway share upstream motifs. Different motifs are conserved upstream of different groups of genes. Comparative real-time PCR studies show co-expression of genes within each group (in sub-sets during the life cycle of the parasite, suggesting co-regulation of these genes may be driven by the use of conserved upstream motifs. Conclusion This is one of the first attempts to characterize cis-regulatory elements in the absence of any previously characterized elements and with very limited expression data (seven genes only. Using de novo pattern finding algorithms, we have identified specific DNA motifs that are conserved upstream of genes belonging to the same metabolic pathway or gene family. We have demonstrated the co-expression of these genes (often in subsets using comparative real-time-PCR experiments thus establishing evidence for these conserved motifs as putative cis-regulatory elements. Given the lack of prior information concerning expression patterns and organization of promoters in C. parvum we

  2. Brachyury, Foxa2 and the cis-Regulatory Origins of the Notochord.

    Directory of Open Access Journals (Sweden)

    Diana S José-Edwards

    2015-12-01

    Full Text Available A main challenge of modern biology is to understand how specific constellations of genes are activated to differentiate cells and give rise to distinct tissues. This study focuses on elucidating how gene expression is initiated in the notochord, an axial structure that provides support and patterning signals to embryos of humans and all other chordates. Although numerous notochord genes have been identified, the regulatory DNAs that orchestrate development and propel evolution of this structure by eliciting notochord gene expression remain mostly uncharted, and the information on their configuration and recurrence is still quite fragmentary. Here we used the simple chordate Ciona for a systematic analysis of notochord cis-regulatory modules (CRMs, and investigated their composition, architectural constraints, predictive ability and evolutionary conservation. We found that most Ciona notochord CRMs relied upon variable combinations of binding sites for the transcription factors Brachyury and/or Foxa2, which can act either synergistically or independently from one another. Notably, one of these CRMs contains a Brachyury binding site juxtaposed to an (AC microsatellite, an unusual arrangement also found in Brachyury-bound regulatory regions in mouse. In contrast, different subsets of CRMs relied upon binding sites for transcription factors of widely diverse families. Surprisingly, we found that neither intra-genomic nor interspecific conservation of binding sites were reliably predictive hallmarks of notochord CRMs. We propose that rather than obeying a rigid sequence-based cis-regulatory code, most notochord CRMs are rather unique. Yet, this study uncovered essential elements recurrently used by divergent chordates as basic building blocks for notochord CRMs.

  3. Brachyury, Foxa2 and the cis-Regulatory Origins of the Notochord.

    Science.gov (United States)

    José-Edwards, Diana S; Oda-Ishii, Izumi; Kugler, Jamie E; Passamaneck, Yale J; Katikala, Lavanya; Nibu, Yutaka; Di Gregorio, Anna

    2015-12-01

    A main challenge of modern biology is to understand how specific constellations of genes are activated to differentiate cells and give rise to distinct tissues. This study focuses on elucidating how gene expression is initiated in the notochord, an axial structure that provides support and patterning signals to embryos of humans and all other chordates. Although numerous notochord genes have been identified, the regulatory DNAs that orchestrate development and propel evolution of this structure by eliciting notochord gene expression remain mostly uncharted, and the information on their configuration and recurrence is still quite fragmentary. Here we used the simple chordate Ciona for a systematic analysis of notochord cis-regulatory modules (CRMs), and investigated their composition, architectural constraints, predictive ability and evolutionary conservation. We found that most Ciona notochord CRMs relied upon variable combinations of binding sites for the transcription factors Brachyury and/or Foxa2, which can act either synergistically or independently from one another. Notably, one of these CRMs contains a Brachyury binding site juxtaposed to an (AC) microsatellite, an unusual arrangement also found in Brachyury-bound regulatory regions in mouse. In contrast, different subsets of CRMs relied upon binding sites for transcription factors of widely diverse families. Surprisingly, we found that neither intra-genomic nor interspecific conservation of binding sites were reliably predictive hallmarks of notochord CRMs. We propose that rather than obeying a rigid sequence-based cis-regulatory code, most notochord CRMs are rather unique. Yet, this study uncovered essential elements recurrently used by divergent chordates as basic building blocks for notochord CRMs.

  4. Nomadic enhancers: tissue-specific cis-regulatory elements of yellow have divergent genomic positions among Drosophila species.

    Directory of Open Access Journals (Sweden)

    Gizem Kalay

    2010-11-01

    Full Text Available cis-regulatory DNA sequences known as enhancers control gene expression in space and time. They are central to metazoan development and are often responsible for changes in gene regulation that contribute to phenotypic evolution. Here, we examine the sequence, function, and genomic location of enhancers controlling tissue- and cell-type specific expression of the yellow gene in six Drosophila species. yellow is required for the production of dark pigment, and its expression has evolved largely in concert with divergent pigment patterns. Using Drosophila melanogaster as a transgenic host, we examined the expression of reporter genes in which either 5' intergenic or intronic sequences of yellow from each species controlled the expression of Green Fluorescent Protein. Surprisingly, we found that sequences controlling expression in the wing veins, as well as sequences controlling expression in epidermal cells of the abdomen, thorax, and wing, were located in different genomic regions in different species. By contrast, sequences controlling expression in bristle-associated cells were located in the intron of all species. Differences in the precise pattern of spatial expression within the developing epidermis of D. melanogaster transformants usually correlated with adult pigmentation in the species from which the cis-regulatory sequences were derived, which is consistent with cis-regulatory evolution affecting yellow expression playing a central role in Drosophila pigmentation divergence. Sequence comparisons among species favored a model in which sequential nucleotide substitutions were responsible for the observed changes in cis-regulatory architecture. Taken together, these data demonstrate frequent changes in yellow cis-regulatory architecture among Drosophila species. Similar analyses of other genes, combining in vivo functional tests of enhancer activity with in silico comparative genomics, are needed to determine whether the pattern of

  5. Cis-regulatory signatures of orthologous stress-associated bZIP transcription factors from rice, sorghum and Arabidopsis based on phylogenetic footprints

    Directory of Open Access Journals (Sweden)

    Xu Fuyu

    2012-09-01

    Full Text Available Abstract Background The potential contribution of upstream sequence variation to the unique features of orthologous genes is just beginning to be unraveled. A core subset of stress-associated bZIP transcription factors from rice (Oryza sativa formed ten clusters of orthologous groups (COG with genes from the monocot sorghum (Sorghum bicolor and dicot Arabidopsis (Arabidopsis thaliana. The total cis-regulatory information content of each stress-associated COG was examined by phylogenetic footprinting to reveal ortholog-specific, lineage-specific and species-specific conservation patterns. Results The most apparent pattern observed was the occurrence of spatially conserved ‘core modules’ among the COGs but not among paralogs. These core modules are comprised of various combinations of two to four putative transcription factor binding site (TFBS classes associated with either developmental or stress-related functions. Outside the core modules are specific stress (ABA, oxidative, abiotic, biotic or organ-associated signals, which may be functioning as ‘regulatory fine-tuners’ and further define lineage-specific and species-specific cis-regulatory signatures. Orthologous monocot and dicot promoters have distinct TFBS classes involved in disease and oxidative-regulated expression, while the orthologous rice and sorghum promoters have distinct combinations of root-specific signals, a pattern that is not particularly conserved in Arabidopsis. Conclusions Patterns of cis-regulatory conservation imply that each ortholog has distinct signatures, further suggesting that they are potentially unique in a regulatory context despite the presumed conservation of broad biological function during speciation. Based on the observed patterns of conservation, we postulate that core modules are likely primary determinants of basal developmental programming, which may be integrated with and further elaborated by additional intrinsic or extrinsic signals in

  6. [Analysis of cis-regulatory element distribution in gene promoters of Gossypium raimondii and Arabidopsis thaliana].

    Science.gov (United States)

    Sun, Gao-Fei; He, Shou-Pu; Du, Xiong-Ming

    2013-10-01

    Cotton genomic studies have boomed since the release of Gossypium raimondii draft genome. In this study, cis-regulatory element (CRE) in 1 kb length sequence upstream 5' UTR of annotated genes were selected and scanned in the Arabidopsis thaliana (At) and Gossypium raimondii (Gr) genomes, based on the database of PLACE (Plant cis-acting Regulatory DNA Elements). According to the definition of this study, 44 (12.3%) and 57 (15.5%) CREs presented "peak-like" distribution in the 1 kb selected sequences of both genomes, respectively. Thirty-four of them were peak-like distributed in both genomes, which could be further categorized into 4 types based on their core sequences. The coincidence of TATABOX peak position and their actual position ((-) -30 bp) indicated that the position of a common CRE was conservative in different genes, which suggested that the peak position of these CREs was their possible actual position of transcription factors. The position of a common CRE was also different between the two genomes due to stronger length variation of 5' UTR in Gr than At. Furthermore, most of the peak-like CREs were located in the region of -110 bp-0 bp, which suggested that concentrated distribution might be conductive to the interaction of transcription factors, and then regulate the gene expression in downstream.

  7. Characterization of Putative cis-Regulatory Elements in Genes Preferentially Expressed in Arabidopsis Male Meiocytes

    Directory of Open Access Journals (Sweden)

    Junhua Li

    2014-01-01

    Full Text Available Meiosis is essential for plant reproduction because it is the process during which homologous chromosome pairing, synapsis, and meiotic recombination occur. The meiotic transcriptome is difficult to investigate because of the size of meiocytes and the confines of anther lobes. The recent development of isolation techniques has enabled the characterization of transcriptional profiles in male meiocytes of Arabidopsis. Gene expression in male meiocytes shows unique features. The direct interaction of transcription factors (TFs with DNA regulatory sequences forms the basis for the specificity of transcriptional regulation. Here, we identified putative cis-regulatory elements (CREs associated with male meiocyte-expressed genes using in silico tools. The upstream regions (1 kb of the top 50 genes preferentially expressed in Arabidopsis meiocytes possessed conserved motifs. These motifs are putative binding sites of TFs, some of which share common functions, such as roles in cell division. In combination with cell-type-specific analysis, our findings could be a substantial aid for the identification and experimental verification of the protein-DNA interactions for the specific TFs that drive gene expression in meiocytes.

  8. Identifying cis-regulatory modules by combining comparative and compositional analysis of DNA.

    Science.gov (United States)

    Pierstorff, Nora; Bergman, Casey M; Wiehe, Thomas

    2006-12-01

    Predicting cis-regulatory modules (CRMs) in higher eukaryotes is a challenging computational task. Commonly used methods to predict CRMs based on the signal of transcription factor binding sites (TFBS) are limited by prior information about transcription factor specificity. More general methods that bypass the reliance on TFBS models are needed for comprehensive CRM prediction. We have developed a method to predict CRMs called CisPlusFinder that identifies high density regions of perfect local ungapped sequences (PLUSs) based on multiple species conservation. By assuming that PLUSs contain core TFBS motifs that are locally overrepresented, the method attempts to capture the expected features of CRM structure and evolution. Applied to a benchmark dataset of CRMs involved in early Drosophila development, CisPlusFinder predicts more annotated CRMs than all other methods tested. Using the REDfly database, we find that some 'false positive' predictions in the benchmark dataset correspond to recently annotated CRMs. Our work demonstrates that CRM prediction methods that combine comparative genomic data with statistical properties of DNA may achieve reasonable performance when applied genome-wide in the absence of an a priori set of known TFBS motifs. The program CisPlusFinder can be downloaded at http://jakob.genetik.uni-koeln.de/bioinformatik/people/nora/nora.html. All software is licensed under the Lesser GNU Public License (LGPL).

  9. Using reporter gene assays to identify cis regulatory differences between humans and chimpanzees.

    Science.gov (United States)

    Chabot, Adrien; Shrit, Ralla A; Blekhman, Ran; Gilad, Yoav

    2007-08-01

    Most phenotypic differences between human and chimpanzee are likely to result from differences in gene regulation, rather than changes to protein-coding regions. To date, however, only a handful of human-chimpanzee nucleotide differences leading to changes in gene regulation have been identified. To hone in on differences in regulatory elements between human and chimpanzee, we focused on 10 genes that were previously found to be differentially expressed between the two species. We then designed reporter gene assays for the putative human and chimpanzee promoters of the 10 genes. Of seven promoters that we found to be active in human liver cell lines, human and chimpanzee promoters had significantly different activity in four cases, three of which recapitulated the gene expression difference seen in the microarray experiment. For these three genes, we were therefore able to demonstrate that a change in cis influences expression differences between humans and chimpanzees. Moreover, using site-directed mutagenesis on one construct, the promoter for the DDA3 gene, we were able to identify three nucleotides that together lead to a cis regulatory difference between the species. High-throughput application of this approach can provide a map of regulatory element differences between humans and our close evolutionary relatives.

  10. Characterization of Cer-1 cis-regulatory region during early Xenopus development.

    Science.gov (United States)

    Silva, Ana Cristina; Filipe, Mário; Steinbeisser, Herbert; Belo, José António

    2011-05-01

    Cerberus-related molecules are well-known Wnt, Nodal, and BMP inhibitors that have been implicated in different processes including anterior–posterior patterning and left–right asymmetry. In both mouse and frog, two Cerberus-related genes have been isolated, mCer-1 and mCer-2, and Xcer and Xcoco, respectively. Until now, little is known about the mechanisms involved in their transcriptional regulation. Here, we report a heterologous analysis of the mouse Cerberus-1 gene upstream regulatory regions, responsible for its expression in the visceral endodermal cells. Our analysis showed that the consensus sequences for a TATA, CAAT, or GC boxes were absent but a TGTGG sequence was present at position -172 to -168 bp, relative to the ATG. Using a series of deletion constructs and transient expression in Xenopus embryos, we found that a fragment of 1.4 kb of Cer-1 promoter sequence could reproduce the endogenous expression pattern of Xenopus cerberus. A 0.7-kb mcer-1 upstream region was able to drive reporter expression to the involuting mesendodermal cells, while further deletions abolished reporter gene expression. Our results suggest that although no sequence similarity was found between mouse and Xenopus cerberus cis-regulatory regions, the signaling cascades regulating cerberus expression, during gastrulation, is conserved.

  11. PReMod: a database of genome-wide mammalian cis-regulatory module predictions.

    Science.gov (United States)

    Ferretti, Vincent; Poitras, Christian; Bergeron, Dominique; Coulombe, Benoit; Robert, François; Blanchette, Mathieu

    2007-01-01

    We describe PReMod, a new database of genome-wide cis-regulatory module (CRM) predictions for both the human and the mouse genomes. The prediction algorithm, described previously in Blanchette et al. (2006) Genome Res., 16, 656-668, exploits the fact that many known CRMs are made of clusters of phylogenetically conserved and repeated transcription factors (TF) binding sites. Contrary to other existing databases, PReMod is not restricted to modules located proximal to genes, but in fact mostly contains distal predicted CRMs (pCRMs). Through its web interface, PReMod allows users to (i) identify pCRMs around a gene of interest; (ii) identify pCRMs that have binding sites for a given TF (or a set of TFs) or (iii) download the entire dataset for local analyses. Queries can also be refined by filtering for specific chromosomal regions, for specific regions relative to genes or for the presence of CpG islands. The output includes information about the binding sites predicted within the selected pCRMs, and a graphical display of their distribution within the pCRMs. It also provides a visual depiction of the chromosomal context of the selected pCRMs in terms of neighboring pCRMs and genes, all of which are linked to the UCSC Genome Browser and the NCBI. PReMod: http://genomequebec.mcgill.ca/PReMod.

  12. BET Bromodomain Inhibition Releases the Mediator Complex from Select cis-Regulatory Elements.

    Science.gov (United States)

    Bhagwat, Anand S; Roe, Jae-Seok; Mok, Beverly Y L; Hohmann, Anja F; Shi, Junwei; Vakoc, Christopher R

    2016-04-19

    The bromodomain and extraterminal (BET) protein BRD4 can physically interact with the Mediator complex, but the relevance of this association to the therapeutic effects of BET inhibitors in cancer is unclear. Here, we show that BET inhibition causes a rapid release of Mediator from a subset of cis-regulatory elements in the genome of acute myeloid leukemia (AML) cells. These sites of Mediator eviction were highly correlated with transcriptional suppression of neighboring genes, which are enriched for targets of the transcription factor MYB and for functions related to leukemogenesis. A shRNA screen of Mediator in AML cells identified the MED12, MED13, MED23, and MED24 subunits as performing a similar regulatory function to BRD4 in this context, including a shared role in sustaining a block in myeloid maturation. These findings suggest that the interaction between BRD4 and Mediator has functional importance for gene-specific transcriptional activation and for AML maintenance. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Lmx1b-targeted cis-regulatory modules involved in limb dorsalization.

    Science.gov (United States)

    Haro, Endika; Watson, Billy A; Feenstra, Jennifer M; Tegeler, Luke; Pira, Charmaine U; Mohan, Subburaman; Oberg, Kerby C

    2017-06-01

    Lmx1b is a homeodomain transcription factor responsible for limb dorsalization. Despite striking double-ventral (loss-of-function) and double-dorsal (gain-of-function) limb phenotypes, no direct gene targets in the limb have been confirmed. To determine direct targets, we performed a chromatin immunoprecipitation against Lmx1b in mouse limbs at embryonic day 12.5 followed by next-generation sequencing (ChIP-seq). Nearly 84% ( n =617) of the Lmx1b-bound genomic intervals (LBIs) identified overlap with chromatin regulatory marks indicative of potential cis -regulatory modules (PCRMs). In addition, 73 LBIs mapped to CRMs that are known to be active during limb development. We compared Lmx1b-bound PCRMs with genes regulated by Lmx1b and found 292 PCRMs within 1 Mb of 254 Lmx1b-regulated genes. Gene ontological analysis suggests that Lmx1b targets extracellular matrix production, bone/joint formation, axonal guidance, vascular development, cell proliferation and cell movement. We validated the functional activity of a PCRM associated with joint-related Gdf5 that provides a mechanism for Lmx1b-mediated joint modification and a PCRM associated with Lmx1b that suggests a role in autoregulation. This is the first report to describe genome-wide Lmx1b binding during limb development, directly linking Lmx1b to targets that accomplish limb dorsalization. © 2017. Published by The Company of Biologists Ltd.

  14. Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis.

    Science.gov (United States)

    Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R

    2005-09-01

    We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.

  15. An integrative and applicable phylogenetic footprinting framework for cis-regulatory motifs identification in prokaryotic genomes.

    Science.gov (United States)

    Liu, Bingqiang; Zhang, Hanyuan; Zhou, Chuan; Li, Guojun; Fennell, Anne; Wang, Guanghui; Kang, Yu; Liu, Qi; Ma, Qin

    2016-08-09

    Phylogenetic footprinting is an important computational technique for identifying cis-regulatory motifs in orthologous regulatory regions from multiple genomes, as motifs tend to evolve slower than their surrounding non-functional sequences. Its application, however, has several difficulties for optimizing the selection of orthologous data and reducing the false positives in motif prediction. Here we present an integrative phylogenetic footprinting framework for accurate motif predictions in prokaryotic genomes (MP(3)). The framework includes a new orthologous data preparation procedure, an additional promoter scoring and pruning method and an integration of six existing motif finding algorithms as basic motif search engines. Specifically, we collected orthologous genes from available prokaryotic genomes and built the orthologous regulatory regions based on sequence similarity of promoter regions. This procedure made full use of the large-scale genomic data and taxonomy information and filtered out the promoters with limited contribution to produce a high quality orthologous promoter set. The promoter scoring and pruning is implemented through motif voting by a set of complementary predicting tools that mine as many motif candidates as possible and simultaneously eliminate the effect of random noise. We have applied the framework to Escherichia coli k12 genome and evaluated the prediction performance through comparison with seven existing programs. This evaluation was systematically carried out at the nucleotide and binding site level, and the results showed that MP(3) consistently outperformed other popular motif finding tools. We have integrated MP(3) into our motif identification and analysis server DMINDA, allowing users to efficiently identify and analyze motifs in 2,072 completely sequenced prokaryotic genomes. The performance evaluation indicated that MP(3) is effective for predicting regulatory motifs in prokaryotic genomes. Its application may enhance

  16. A HLA class I cis-regulatory element whose activity can be modulated by hormones.

    Science.gov (United States)

    Sim, B C; Hui, K M

    1994-12-01

    To elucidate the basis of the down-regulation in major histocompatibility complex (MHC) class I gene expression and to identify possible DNA-binding regulatory elements that have the potential to interact with class I MHC genes, we have studied the transcriptional regulation of class I HLA genes in human breast carcinoma cells. A 9 base pair (bp) negative cis-regulatory element (NRE) has been identified using band-shift assays employing DNA sequences derived from the 5'-flanking region of HLA class I genes. This 9-bp element, GTCATGGCG, located within exon I of the HLA class I gene, can potently inhibit the expression of a heterologous thymidine kinase (TK) gene promoter and the HLA enhancer element. Furthermore, this regulatory element can exert its suppressive function in either the sense or anti-sense orientation. More interestingly, NRE can suppress dexamethasone-mediated gene activation in the context of the reported glucocorticoid-responsive element (GRE) in MCF-7 cells but has no influence on the estrogen-mediated transcriptional activation of MCF-7 cells in the context of the reported estrogen-responsive element (ERE). Furthermore, the presence of such a regulatory element within the HLA class I gene whose activity can be modulated by hormones correlates well with our observation that the level of HLA class I gene expression can be down-regulated by hormones in human breast carcinoma cells. Such interactions between negative regulatory elements and specific hormone trans-activators are novel and suggest a versatile form of transcriptional control.

  17. Deciphering Cis-Regulatory Element Mediated Combinatorial Regulation in Rice under Blast Infected Condition.

    Directory of Open Access Journals (Sweden)

    Arindam Deb

    Full Text Available Combinations of cis-regulatory elements (CREs present at the promoters facilitate the binding of several transcription factors (TFs, thereby altering the consequent gene expressions. Due to the eminent complexity of the regulatory mechanism, the combinatorics of CRE-mediated transcriptional regulation has been elusive. In this work, we have developed a new methodology that quantifies the co-occurrence tendencies of CREs present in a set of promoter sequences; these co-occurrence scores are filtered in three consecutive steps to test their statistical significance; and the significantly co-occurring CRE pairs are presented as networks. These networks of co-occurring CREs are further transformed to derive higher order of regulatory combinatorics. We have further applied this methodology on the differentially up-regulated gene-sets of rice tissues under fungal (Magnaporthe infected conditions to demonstrate how it helps to understand the CRE-mediated combinatorial gene regulation. Our analysis includes a wide spectrum of biologically important results. The CRE pairs having a strong tendency to co-occur often exhibit very similar joint distribution patterns at the promoters of rice. We couple the network approach with experimental results of plant gene regulation and defense mechanisms and find evidences of auto and cross regulation among TF families, cross-talk among multiple hormone signaling pathways, similarities and dissimilarities in regulatory combinatorics between different tissues, etc. Our analyses have pointed a highly distributed nature of the combinatorial gene regulation facilitating an efficient alteration in response to fungal attack. All together, our proposed methodology could be an important approach in understanding the combinatorial gene regulation. It can be further applied to unravel the tissue and/or condition specific combinatorial gene regulation in other eukaryotic systems with the availability of annotated genomic

  18. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures.

    Science.gov (United States)

    Kusters, Elske; Della Pina, Serena; Castel, Rob; Souer, Erik; Koes, Ronald

    2015-08-15

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter constructs in petunia and Arabidopsis, as well as complementation experiments, showed that the divergent expression of leafy (LFY) and the petunia homolog aberrant leaf and flower (ALF) results from alterations in the upstream regulatory network rather than cis-regulatory changes. The divergent expression of unusual floral organs (UFO) from Arabidopsis, and the petunia homolog double top (DOT), however, is caused by the loss or gain of cis-regulatory promoter elements, which respond to trans-acting factors that are expressed in similar patterns in both species. Introduction of pUFO:UFO causes no obvious defects in Arabidopsis, but in petunia it causes the precocious and ectopic formation of flowers. This provides an example of how a change in a cis-regulatory region can account for a change in the plant body plan. © 2015. Published by The Company of Biologists Ltd.

  19. Transcriptome analysis reveals the time of the fourth round of genome duplication in common carp (Cyprinus carpio)

    Science.gov (United States)

    2012-01-01

    Background Common carp (Cyprinus carpio) is thought to have undergone one extra round of genome duplication compared to zebrafish. Transcriptome analysis has been used to study the existence and timing of genome duplication in species for which genome sequences are incomplete. Large-scale transcriptome data for the common carp genome should help reveal the timing of the additional duplication event. Results We have sequenced the transcriptome of common carp using 454 pyrosequencing. After assembling the 454 contigs and the published common carp sequences together, we obtained 49,669 contigs and identified genes using homology searches and an ab initio method. We identified 4,651 orthologous pairs between common carp and zebrafish and found 129,984 paralogous pairs within the common carp. An estimation of the synonymous substitution rate in the orthologous pairs indicated that common carp and zebrafish diverged 120 million years ago (MYA). We identified one round of genome duplication in common carp and estimated that it had occurred 5.6 to 11.3 MYA. In zebrafish, no genome duplication event after speciation was observed, suggesting that, compared to zebrafish, common carp had undergone an additional genome duplication event. We annotated the common carp contigs with Gene Ontology terms and KEGG pathways. Compared with zebrafish gene annotations, we found that a set of biological processes and pathways were enriched in common carp. Conclusions The assembled contigs helped us to estimate the time of the fourth-round of genome duplication in common carp. The resource that we have built as part of this study will help advance functional genomics and genome annotation studies in the future. PMID:22424280

  20. Direct activation of a notochord cis-regulatory module by Brachyury and FoxA in the ascidian Ciona intestinalis.

    Science.gov (United States)

    Passamaneck, Yale J; Katikala, Lavanya; Perrone, Lorena; Dunn, Matthew P; Oda-Ishii, Izumi; Di Gregorio, Anna

    2009-11-01

    The notochord is a defining feature of the chordate body plan. Experiments in ascidian, frog and mouse embryos have shown that co-expression of Brachyury and FoxA class transcription factors is required for notochord development. However, studies on the cis-regulatory sequences mediating the synergistic effects of these transcription factors are complicated by the limited knowledge of notochord genes and cis-regulatory modules (CRMs) that are directly targeted by both. We have identified an easily testable model for such investigations in a 155-bp notochord-specific CRM from the ascidian Ciona intestinalis. This CRM contains functional binding sites for both Ciona Brachyury (Ci-Bra) and FoxA (Ci-FoxA-a). By combining point mutation analysis and misexpression experiments, we demonstrate that binding of both transcription factors to this CRM is necessary and sufficient to activate transcription. To gain insights into the cis-regulatory criteria controlling its activity, we investigated the organization of the transcription factor binding sites within the 155-bp CRM. The 155-bp sequence contains two Ci-Bra binding sites with identical core sequences but opposite orientations, only one of which is required for enhancer activity. Changes in both orientation and spacing of these sites substantially affect the activity of the CRM, as clusters of identical sites found in the Ciona genome with different arrangements are unable to activate transcription in notochord cells. This work presents the first evidence of a synergistic interaction between Brachyury and FoxA in the activation of an individual notochord CRM, and highlights the importance of transcription factor binding site arrangement for its function.

  1. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    International Nuclear Information System (INIS)

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-01-01

    Highlights: → The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. → The core promoter was located in the 5F-1. → Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. → These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  2. ChIP-Seq-Annotated Heliconius erato Genome Highlights Patterns of cis-Regulatory Evolution in Lepidoptera

    Directory of Open Access Journals (Sweden)

    James J. Lewis

    2016-09-01

    Full Text Available Uncovering phylogenetic patterns of cis-regulatory evolution remains a fundamental goal for evolutionary and developmental biology. Here, we characterize the evolution of regulatory loci in butterflies and moths using chromatin immunoprecipitation sequencing (ChIP-seq annotation of regulatory elements across three stages of head development. In the process we provide a high-quality, functionally annotated genome assembly for the butterfly, Heliconius erato. Comparing cis-regulatory element conservation across six lepidopteran genomes, we find that regulatory sequences evolve at a pace similar to that of protein-coding regions. We also observe that elements active at multiple developmental stages are markedly more conserved than elements with stage-specific activity. Surprisingly, we also find that stage-specific proximal and distal regulatory elements evolve at nearly identical rates. Our study provides a benchmark for genome-wide patterns of regulatory element evolution in insects, and it shows that developmental timing of activity strongly predicts patterns of regulatory sequence evolution.

  3. Domain duplication, divergence, and loss events in vertebrate Msx paralogs reveal phylogenomically informed disease markers.

    Science.gov (United States)

    Finnerty, John R; Mazza, Maureen E; Jezewski, Peter A

    2009-01-20

    Msx originated early in animal evolution and is implicated in human genetic disorders. To reconstruct the functional evolution of Msx and inform the study of human mutations, we analyzed the phylogeny and synteny of 46 metazoan Msx proteins and tracked the duplication, diversification and loss of conserved motifs. Vertebrate Msx sequences sort into distinct Msx1, Msx2 and Msx3 clades. The sister-group relationship between MSX1 and MSX2 reflects their derivation from the 4p/5q chromosomal paralogon, a derivative of the original "MetaHox" cluster. We demonstrate physical linkage between Msx and other MetaHox genes (Hmx, NK1, Emx) in a cnidarian. Seven conserved domains, including two Groucho repression domains (N- and C-terminal), were present in the ancestral Msx. In cnidarians, the Groucho domains are highly similar. In vertebrate Msx1, the N-terminal Groucho domain is conserved, while the C-terminal domain diverged substantially, implying a novel function. In vertebrate Msx2 and Msx3, the C-terminal domain was lost. MSX1 mutations associated with ectodermal dysplasia or orofacial clefting disorders map to conserved domains in a non-random fashion. Msx originated from a MetaHox ancestor that also gave rise to Tlx, Demox, NK, and possibly EHGbox, Hox and ParaHox genes. Duplication, divergence or loss of domains played a central role in the functional evolution of Msx. Duplicated domains allow pleiotropically expressed proteins to evolve new functions without disrupting existing interaction networks. Human missense sequence variants reside within evolutionarily conserved domains, likely disrupting protein function. This phylogenomic evaluation of candidate disease markers will inform clinical and functional studies.

  4. Domain duplication, divergence, and loss events in vertebrate Msx paralogs reveal phylogenomically informed disease markers

    Directory of Open Access Journals (Sweden)

    Finnerty John R

    2009-01-01

    Full Text Available Abstract Background Msx originated early in animal evolution and is implicated in human genetic disorders. To reconstruct the functional evolution of Msx and inform the study of human mutations, we analyzed the phylogeny and synteny of 46 metazoan Msx proteins and tracked the duplication, diversification and loss of conserved motifs. Results Vertebrate Msx sequences sort into distinct Msx1, Msx2 and Msx3 clades. The sister-group relationship between MSX1 and MSX2 reflects their derivation from the 4p/5q chromosomal paralogon, a derivative of the original "MetaHox" cluster. We demonstrate physical linkage between Msx and other MetaHox genes (Hmx, NK1, Emx in a cnidarian. Seven conserved domains, including two Groucho repression domains (N- and C-terminal, were present in the ancestral Msx. In cnidarians, the Groucho domains are highly similar. In vertebrate Msx1, the N-terminal Groucho domain is conserved, while the C-terminal domain diverged substantially, implying a novel function. In vertebrate Msx2 and Msx3, the C-terminal domain was lost. MSX1 mutations associated with ectodermal dysplasia or orofacial clefting disorders map to conserved domains in a non-random fashion. Conclusion Msx originated from a MetaHox ancestor that also gave rise to Tlx, Demox, NK, and possibly EHGbox, Hox and ParaHox genes. Duplication, divergence or loss of domains played a central role in the functional evolution of Msx. Duplicated domains allow pleiotropically expressed proteins to evolve new functions without disrupting existing interaction networks. Human missense sequence variants reside within evolutionarily conserved domains, likely disrupting protein function. This phylogenomic evaluation of candidate disease markers will inform clinical and functional studies.

  5. cisMEP: an integrated repository of genomic epigenetic profiles and cis-regulatory modules in Drosophila.

    Science.gov (United States)

    Yang, Tzu-Hsien; Wang, Chung-Ching; Hung, Po-Cheng; Wu, Wei-Sheng

    2014-01-01

    Cis-regulatory modules (CRMs), or the DNA sequences required for regulating gene expression, play the central role in biological researches on transcriptional regulation in metazoan species. Nowadays, the systematic understanding of CRMs still mainly resorts to computational methods due to the time-consuming and small-scale nature of experimental methods. But the accuracy and reliability of different CRM prediction tools are still unclear. Without comparative cross-analysis of the results and combinatorial consideration with extra experimental information, there is no easy way to assess the confidence of the predicted CRMs. This limits the genome-wide understanding of CRMs. It is known that transcription factor binding and epigenetic profiles tend to determine functions of CRMs in gene transcriptional regulation. Thus integration of the genome-wide epigenetic profiles with systematically predicted CRMs can greatly help researchers evaluate and decipher the prediction confidence and possible transcriptional regulatory functions of these potential CRMs. However, these data are still fragmentary in the literatures. Here we performed the computational genome-wide screening for potential CRMs using different prediction tools and constructed the pioneer database, cisMEP (cis-regulatory module epigenetic profile database), to integrate these computationally identified CRMs with genomic epigenetic profile data. cisMEP collects the literature-curated TFBS location data and nine genres of epigenetic data for assessing the confidence of these potential CRMs and deciphering the possible CRM functionality. cisMEP aims to provide a user-friendly interface for researchers to assess the confidence of different potential CRMs and to understand the functions of CRMs through experimentally-identified epigenetic profiles. The deposited potential CRMs and experimental epigenetic profiles for confidence assessment provide experimentally testable hypotheses for the molecular mechanisms

  6. Molecular genetic features of polyploidization and aneuploidization reveal unique patterns for genome duplication in diploid Malus.

    Directory of Open Access Journals (Sweden)

    Michael J Considine

    Full Text Available Polyploidization results in genome duplication and is an important step in evolution and speciation. The Malus genome confirmed that this genus was derived through auto-polyploidization, yet the genetic and meiotic mechanisms for polyploidization, particularly for aneuploidization, are unclear in this genus or other woody perennials. In fact the contribution of aneuploidization remains poorly understood throughout Plantae. We add to this knowledge by characterization of eupolyploidization and aneuploidization in 27,542 F₁ seedlings from seven diploid Malus populations using cytology and microsatellite markers. We provide the first evidence that aneuploidy exceeds eupolyploidy in the diploid crosses, suggesting aneuploidization is a leading cause of genome duplication. Gametes from diploid Malus had a unique combinational pattern; ova preserved euploidy exclusively, while spermatozoa presented both euploidy and aneuploidy. All non-reduced gametes were genetically heterozygous, indicating first-division restitution was the exclusive mode for Malus eupolyploidization and aneuploidization. Chromosome segregation pattern among aneuploids was non-uniform, however, certain chromosomes were associated for aneuploidization. This study is the first to provide molecular evidence for the contribution of heterozygous non-reduced gametes to fitness in polyploids and aneuploids. Aneuploidization can increase, while eupolyploidization may decrease genetic diversity in their newly established populations. Auto-triploidization is important for speciation in the extant Malus. The features of Malus polyploidization confer genetic stability and diversity, and present heterozygosity, heterosis and adaptability for evolutionary selection. A protocol using co-dominant markers was proposed for accelerating apple triploid breeding program. A path was postulated for evolution of numerically odd basic chromosomes. The model for Malus derivation was considerably revised

  7. Molecular genetic features of polyploidization and aneuploidization reveal unique patterns for genome duplication in diploid Malus.

    Science.gov (United States)

    Considine, Michael J; Wan, Yizhen; D'Antuono, Mario F; Zhou, Qian; Han, Mingyu; Gao, Hua; Wang, Man

    2012-01-01

    Polyploidization results in genome duplication and is an important step in evolution and speciation. The Malus genome confirmed that this genus was derived through auto-polyploidization, yet the genetic and meiotic mechanisms for polyploidization, particularly for aneuploidization, are unclear in this genus or other woody perennials. In fact the contribution of aneuploidization remains poorly understood throughout Plantae. We add to this knowledge by characterization of eupolyploidization and aneuploidization in 27,542 F₁ seedlings from seven diploid Malus populations using cytology and microsatellite markers. We provide the first evidence that aneuploidy exceeds eupolyploidy in the diploid crosses, suggesting aneuploidization is a leading cause of genome duplication. Gametes from diploid Malus had a unique combinational pattern; ova preserved euploidy exclusively, while spermatozoa presented both euploidy and aneuploidy. All non-reduced gametes were genetically heterozygous, indicating first-division restitution was the exclusive mode for Malus eupolyploidization and aneuploidization. Chromosome segregation pattern among aneuploids was non-uniform, however, certain chromosomes were associated for aneuploidization. This study is the first to provide molecular evidence for the contribution of heterozygous non-reduced gametes to fitness in polyploids and aneuploids. Aneuploidization can increase, while eupolyploidization may decrease genetic diversity in their newly established populations. Auto-triploidization is important for speciation in the extant Malus. The features of Malus polyploidization confer genetic stability and diversity, and present heterozygosity, heterosis and adaptability for evolutionary selection. A protocol using co-dominant markers was proposed for accelerating apple triploid breeding program. A path was postulated for evolution of numerically odd basic chromosomes. The model for Malus derivation was considerably revised. Impacts of

  8. Dynamic in vivo binding of transcription factors to cis-regulatory modules of cer and gsc in the stepwise formation of the Spemann–Mangold organizer

    Science.gov (United States)

    Sudou, Norihiro; Yamamoto, Shinji; Ogino, Hajime; Taira, Masanori

    2012-01-01

    How multiple developmental cues are integrated on cis-regulatory modules (CRMs) for cell fate decisions remains uncertain. The Spemann–Mangold organizer in Xenopus embryos expresses the transcription factors Lim1/Lhx1, Otx2, Mix1, Siamois (Sia) and VegT. Reporter analyses using sperm nuclear transplantation and DNA injection showed that cerberus (cer) and goosecoid (gsc) are activated by the aforementioned transcription factors through CRMs conserved between X. laevis and X. tropicalis. ChIP-qPCR analysis for the five transcription factors revealed that cer and gsc CRMs are initially bound by both Sia and VegT at the late blastula stage, and subsequently bound by all five factors at the gastrula stage. At the neurula stage, only binding of Lim1 and Otx2 to the gsc CRM, among others, persists, which corresponds to their co-expression in the prechordal plate. Based on these data, together with detailed expression pattern analysis, we propose a new model of stepwise formation of the organizer, in which (1) maternal VegT and Wnt-induced Sia first bind to CRMs at the blastula stage; then (2) Nodal-inducible Lim1, Otx2, Mix1 and zygotic VegT are bound to CRMs in the dorsal endodermal and mesodermal regions where all these genes are co-expressed; and (3) these two regions are combined at the gastrula stage to form the organizer. Thus, the in vivo dynamics of multiple transcription factors highlight their roles in the initiation and maintenance of gene expression, and also reveal the stepwise integration of maternal, Nodal and Wnt signaling on CRMs of organizer genes to generate the organizer. PMID:22492356

  9. Dynamic in vivo binding of transcription factors to cis-regulatory modules of cer and gsc in the stepwise formation of the Spemann-Mangold organizer.

    Science.gov (United States)

    Sudou, Norihiro; Yamamoto, Shinji; Ogino, Hajime; Taira, Masanori

    2012-05-01

    How multiple developmental cues are integrated on cis-regulatory modules (CRMs) for cell fate decisions remains uncertain. The Spemann-Mangold organizer in Xenopus embryos expresses the transcription factors Lim1/Lhx1, Otx2, Mix1, Siamois (Sia) and VegT. Reporter analyses using sperm nuclear transplantation and DNA injection showed that cerberus (cer) and goosecoid (gsc) are activated by the aforementioned transcription factors through CRMs conserved between X. laevis and X. tropicalis. ChIP-qPCR analysis for the five transcription factors revealed that cer and gsc CRMs are initially bound by both Sia and VegT at the late blastula stage, and subsequently bound by all five factors at the gastrula stage. At the neurula stage, only binding of Lim1 and Otx2 to the gsc CRM, among others, persists, which corresponds to their co-expression in the prechordal plate. Based on these data, together with detailed expression pattern analysis, we propose a new model of stepwise formation of the organizer, in which (1) maternal VegT and Wnt-induced Sia first bind to CRMs at the blastula stage; then (2) Nodal-inducible Lim1, Otx2, Mix1 and zygotic VegT are bound to CRMs in the dorsal endodermal and mesodermal regions where all these genes are co-expressed; and (3) these two regions are combined at the gastrula stage to form the organizer. Thus, the in vivo dynamics of multiple transcription factors highlight their roles in the initiation and maintenance of gene expression, and also reveal the stepwise integration of maternal, Nodal and Wnt signaling on CRMs of organizer genes to generate the organizer.

  10. Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.

    Science.gov (United States)

    Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J

    2016-11-04

    Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types

  11. Unveiling combinatorial regulation through the combination of ChIP information and in silico cis-regulatory module detection

    Science.gov (United States)

    Sun, Hong; Guns, Tias; Fierro, Ana Carolina; Thorrez, Lieven; Nijssen, Siegfried; Marchal, Kathleen

    2012-01-01

    Computationally retrieving biologically relevant cis-regulatory modules (CRMs) is not straightforward. Because of the large number of candidates and the imperfection of the screening methods, many spurious CRMs are detected that are as high scoring as the biologically true ones. Using ChIP-information allows not only to reduce the regions in which the binding sites of the assayed transcription factor (TF) should be located, but also allows restricting the valid CRMs to those that contain the assayed TF (here referred to as applying CRM detection in a query-based mode). In this study, we show that exploiting ChIP-information in a query-based way makes in silico CRM detection a much more feasible endeavor. To be able to handle the large datasets, the query-based setting and other specificities proper to CRM detection on ChIP-Seq based data, we developed a novel powerful CRM detection method ‘CPModule’. By applying it on a well-studied ChIP-Seq data set involved in self-renewal of mouse embryonic stem cells, we demonstrate how our tool can recover combinatorial regulation of five known TFs that are key in the self-renewal of mouse embryonic stem cells. Additionally, we make a number of new predictions on combinatorial regulation of these five key TFs with other TFs documented in TRANSFAC. PMID:22422841

  12. Does positive selection drive transcription factor binding site turnover? A test with Drosophila cis-regulatory modules.

    Directory of Open Access Journals (Sweden)

    Bin Z He

    2011-04-01

    Full Text Available Transcription factor binding site(s (TFBS gain and loss (i.e., turnover is a well-documented feature of cis-regulatory module (CRM evolution, yet little attention has been paid to the evolutionary force(s driving this turnover process. The predominant view, motivated by its widespread occurrence, emphasizes the importance of compensatory mutation and genetic drift. Positive selection, in contrast, although it has been invoked in specific instances of adaptive gene expression evolution, has not been considered as a general alternative to neutral compensatory evolution. In this study we evaluate the two hypotheses by analyzing patterns of single nucleotide polymorphism in the TFBS of well-characterized CRM in two closely related Drosophila species, Drosophila melanogaster and Drosophila simulans. An important feature of the analysis is classification of TFBS mutations according to the direction of their predicted effect on binding affinity, which allows gains and losses to be evaluated independently along the two phylogenetic lineages. The observed patterns of polymorphism and divergence are not compatible with neutral evolution for either class of mutations. Instead, multiple lines of evidence are consistent with contributions of positive selection to TFBS gain and loss as well as purifying selection in its maintenance. In discussion, we propose a model to reconcile the finding of selection driving TFBS turnover with constrained CRM function over long evolutionary time.

  13. Mapping of cis-regulatory sites in the promoter of testis-specific stellate genes of Drosophila melanogaster.

    Science.gov (United States)

    Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V

    2012-11-01

    Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.

  14. Retinal Expression of the Drosophila eyes absent Gene Is Controlled by Several Cooperatively Acting Cis-regulatory Elements

    Science.gov (United States)

    Neuman, Sarah D.; Bashirullah, Arash; Kumar, Justin P.

    2016-01-01

    The eyes absent (eya) gene of the fruit fly, Drosophila melanogaster, is a member of an evolutionarily conserved gene regulatory network that controls eye formation in all seeing animals. The loss of eya leads to the complete elimination of the compound eye while forced expression of eya in non-retinal tissues is sufficient to induce ectopic eye formation. Within the developing retina eya is expressed in a dynamic pattern and is involved in tissue specification/determination, cell proliferation, apoptosis, and cell fate choice. In this report we explore the mechanisms by which eya expression is spatially and temporally governed in the developing eye. We demonstrate that multiple cis-regulatory elements function cooperatively to control eya transcription and that spacing between a pair of enhancer elements is important for maintaining correct gene expression. Lastly, we show that the loss of eya expression in sine oculis (so) mutants is the result of massive cell death and a progressive homeotic transformation of retinal progenitor cells into head epidermis. PMID:27930646

  15. Piecing together cis-regulatory networks: insights from epigenomics studies in plants.

    Science.gov (United States)

    Huang, Shao-Shan C; Ecker, Joseph R

    2018-05-01

    5-Methylcytosine, a chemical modification of DNA, is a covalent modification found in the genomes of both plants and animals. Epigenetic inheritance of phenotypes mediated by DNA methylation is well established in plants. Most of the known mechanisms of establishing, maintaining and modifying DNA methylation have been worked out in the reference plant Arabidopsis thaliana. Major functions of DNA methylation in plants include regulation of gene expression and silencing of transposable elements (TEs) and repetitive sequences, both of which have parallels in mammalian biology, involve interaction with the transcriptional machinery, and may have profound effects on the regulatory networks in the cell. Methylome and transcriptome dynamics have been investigated in development and environmental responses in Arabidopsis and agriculturally and ecologically important plants, revealing the interdependent relationship among genomic context, methylation patterns, and expression of TE and protein coding genes. Analyses of methylome variation among plant natural populations and species have begun to quantify the extent of genetic control of methylome variation vs. true epimutation, and model the evolutionary forces driving methylome evolution in both short and long time scales. The ability of DNA methylation to positively or negatively modulate binding affinity of transcription factors (TFs) provides a natural link from genome sequence and methylation changes to transcription. Technologies that allow systematic determination of methylation sensitivities of TFs, in native genomic and methylation context without confounding factors such as histone modifications, will provide baseline datasets for building cell-type- and individual-specific regulatory networks that underlie the establishment and inheritance of complex traits. This article is categorized under: Laboratory Methods and Technologies > Genetic/Genomic Methods Biological Mechanisms > Regulatory Biology. © 2017 Wiley

  16. Independent Evolution of Winner Traits without Whole Genome Duplication in Dekkera Yeasts.

    Directory of Open Access Journals (Sweden)

    Yi-Cheng Guo

    Full Text Available Dekkera yeasts have often been considered as alternative sources of ethanol production that could compete with S. cerevisiae. The two lineages of yeasts independently evolved traits that include high glucose and ethanol tolerance, aerobic fermentation, and a rapid ethanol fermentation rate. The Saccharomyces yeasts attained these traits mainly through whole genome duplication approximately 100 million years ago (Mya. However, the Dekkera yeasts, which were separated from S. cerevisiae approximately 200 Mya, did not undergo whole genome duplication (WGD but still occupy a niche similar to S. cerevisiae. Upon analysis of two Dekkera yeasts and five closely related non-WGD yeasts, we found that a massive loss of cis-regulatory elements occurred in an ancestor of the Dekkera yeasts, which led to improved mitochondrial functions similar to the S. cerevisiae yeasts. The evolutionary analysis indicated that genes involved in the transcription and translation process exhibited faster evolution in the Dekkera yeasts. We detected 90 positively selected genes, suggesting that the Dekkera yeasts evolved an efficient translation system to facilitate adaptive evolution. Moreover, we identified that 12 vacuolar H+-ATPase (V-ATPase function genes that were under positive selection, which assists in developing tolerance to high alcohol and high sugar stress. We also revealed that the enzyme PGK1 is responsible for the increased rate of glycolysis in the Dekkera yeasts. These results provide important insights to understand the independent adaptive evolution of the Dekkera yeasts and provide tools for genetic modification promoting industrial usage.

  17. A novel method for predicting activity of cis-regulatory modules, based on a diverse training set.

    Science.gov (United States)

    Yang, Wei; Sinha, Saurabh

    2017-01-01

    With the rapid emergence of technologies for locating cis-regulatory modules (CRMs) genome-wide, the next pressing challenge is to assign precise functions to each CRM, i.e. to determine the spatiotemporal domains or cell-types where it drives expression. A popular approach to this task is to model the typical k-mer composition of a set of CRMs known to drive a common expression pattern, and assign that pattern to other CRMs exhibiting a similar k-mer composition. This approach does not rely on prior knowledge of transcription factors relevant to the CRM or their binding motifs, and is thus more widely applicable than motif-based methods for predicting CRM activity, but is also prone to false positive predictions. We present a novel strategy to improve the above-mentioned approach: to predict if a CRM drives a specific gene expression pattern, assess not only how similar the CRM is to other CRMs with similar activity but also to CRMs with distinct activities. We use a state-of-the-art statistical method to quantify a CRM's sequence similarity to many different training sets of CRMs, and employ a classification algorithm to integrate these similarity scores into a single prediction of the CRM's activity. This strategy is shown to significantly improve CRM activity prediction over current approaches. Our implementation of the new method, called IMMBoost, is freely available as source code, at https://github.com/weiyangedward/IMMBoost CONTACT: sinhas@illinois.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  18. Nutritional control of gene expression in Drosophila larvae via TOR, Myc and a novel cis-regulatory element

    Directory of Open Access Journals (Sweden)

    Grewal Savraj S

    2010-01-01

    Full Text Available Abstract Background Nutrient availability is a key determinant of eukaryotic cell growth. In unicellular organisms many signaling and transcriptional networks link nutrient availability to the expression of metabolic genes required for growth. However, less is known about the corresponding mechanisms that operate in metazoans. We used gene expression profiling to explore this issue in developing Drosophila larvae. Results We found that starvation for dietary amino acids (AA's leads to dynamic changes in transcript levels of many metabolic genes. The conserved insulin/PI3K and TOR signaling pathways mediate nutrition-dependent growth in Drosophila and other animals. We found that many AA starvation-responsive transcripts were also altered in TOR mutants. In contrast, although PI3K overexpression induced robust changes in the expression of many metabolic genes, these changes showed limited overlap with the AA starvation expression profile. We did however identify a strong overlap between genes regulated by the transcription factor, Myc, and AA starvation-responsive genes, particularly those involved in ribosome biogenesis, protein synthesis and mitochondrial function. The consensus Myc DNA binding site is enriched in promoters of these AA starvation genes, and we found that Myc overexpression could bypass dietary AA to induce expression of these genes. We also identified another sequence motif (Motif 1 enriched in the promoters of AA starvation-responsive genes. We showed that Motif 1 was both necessary and sufficient to mediate transcriptional responses to dietary AA in larvae. Conclusions Our data suggest that many of the transcriptional effects of amino acids are mediated via signaling through the TOR pathway in Drosophila larvae. We also find that these transcriptional effects are mediated through at least two mechanisms: via the transcription factor Myc, and via the Motif 1 cis-regulatory element. These studies begin to elucidate a nutrient

  19. Identification of choriogenin cis-regulatory elements and production of estrogen-inducible, liver-specific transgenic Medaka.

    Science.gov (United States)

    Ueno, Tetsuro; Yasumasu, Shigeki; Hayashi, Shinji; Iuchi, Ichiro

    2004-07-01

    Choriogenins (chg-H, chg-L) are precursor proteins of egg envelope of medaka and synthesized in the spawning female liver in response to estrogen. We linked a gene construct chg-L1.5 kb/GFP (a 1.5 kb 5'-upstream region of the chg-L gene fused with a green fluorescence protein (GFP) gene) to another construct emgb/RFP (a cis-regulatory region of embryonic globin gene fused with an RFP gene), injected the double fusion gene construct into 1- or 2-cell-stage embryos, and selected embryos expressing the RFP in erythroid cells. From the embryos, we established two lines of chg-L1.5 kb/GFP-emgb/RFP-transgenic medaka. The 3-month-old spawning females and estradiol-17beta (E2)-exposed males displayed the liver-specific GFP expression. The E2-dependent GFP expression was detected in the differentiating liver of the stage 37-38 embryos. In addition, RT-PCR and whole-mount in situ hybridization showed that the E2-dependent chg expression was found in the liver of the stage 34 embryos of wild medaka, suggesting that such E2-dependency is achieved shortly after differentiation of the liver. Analysis using serial deletion mutants fused with GFP showed that the region -426 to -284 of the chg-L gene or the region -364 to -265 of the chg-H gene had the ability to promote the E2-dependent liver-specific GFP expression of its downstream gene. Further analyses suggested that an estrogen response element (ERE) at -309, an ERE half-site at -330 and a binding site for C/EBP at -363 of the chg-L gene played important roles in its downstream chg-L gene expression. In addition, this transgenic medaka may be useful as one of the test animals for detecting environmental estrogenic steroids.

  20. Clinical and molecular characterization of duplications encompassing the human SHOX gene reveal a variable effect on stature.

    Science.gov (United States)

    Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert

    2009-07-01

    Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.

  1. A minimal murine Msx-1 gene promoter. Organization of its cis-regulatory motifs and their role in transcriptional activation in cells in culture and in transgenic mice.

    Science.gov (United States)

    Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R

    1997-09-05

    To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient

  2. Yeast Interspecies Comparative Proteomics Reveals Divergence in Expression Profiles and Provides Insights into Proteome Resource Allocation and Evolutionary Roles of Gene Duplication*

    Science.gov (United States)

    Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke

    2016-01-01

    Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under

  3. LDsplit: screening for cis-regulatory motifs stimulating meiotic recombination hotspots by analysis of DNA sequence polymorphisms.

    Science.gov (United States)

    Yang, Peng; Wu, Min; Guo, Jing; Kwoh, Chee Keong; Przytycka, Teresa M; Zheng, Jie

    2014-02-17

    As a fundamental genomic element, meiotic recombination hotspot plays important roles in life sciences. Thus uncovering its regulatory mechanisms has broad impact on biomedical research. Despite the recent identification of the zinc finger protein PRDM9 and its 13-mer binding motif as major regulators for meiotic recombination hotspots, other regulators remain to be discovered. Existing methods for finding DNA sequence motifs of recombination hotspots often rely on the enrichment of co-localizations between hotspots and short DNA patterns, which ignore the cross-individual variation of recombination rates and sequence polymorphisms in the population. Our objective in this paper is to capture signals encoded in genetic variations for the discovery of recombination-associated DNA motifs. Recently, an algorithm called "LDsplit" has been designed to detect the association between single nucleotide polymorphisms (SNPs) and proximal meiotic recombination hotspots. The association is measured by the difference of population recombination rates at a hotspot between two alleles of a candidate SNP. Here we present an open source software tool of LDsplit, with integrative data visualization for recombination hotspots and their proximal SNPs. Applying LDsplit on SNPs inside an established 7-mer motif bound by PRDM9 we observed that SNP alleles preserving the original motif tend to have higher recombination rates than the opposite alleles that disrupt the motif. Running on SNP windows around hotspots each containing an occurrence of the 7-mer motif, LDsplit is able to guide the established motif finding algorithm of MEME to recover the 7-mer motif. In contrast, without LDsplit the 7-mer motif could not be identified. LDsplit is a software tool for the discovery of cis-regulatory DNA sequence motifs stimulating meiotic recombination hotspots by screening and narrowing down to hotspot associated SNPs. It is the first computational method that utilizes the genetic variation of

  4. Predicting tissue specific cis-regulatory modules in the human genome using pairs of co-occurring motifs

    Directory of Open Access Journals (Sweden)

    Girgis Hani Z

    2012-02-01

    Full Text Available Abstract Background Researchers seeking to unlock the genetic basis of human physiology and diseases have been studying gene transcription regulation. The temporal and spatial patterns of gene expression are controlled by mainly non-coding elements known as cis-regulatory modules (CRMs and epigenetic factors. CRMs modulating related genes share the regulatory signature which consists of transcription factor (TF binding sites (TFBSs. Identifying such CRMs is a challenging problem due to the prohibitive number of sequence sets that need to be analyzed. Results We formulated the challenge as a supervised classification problem even though experimentally validated CRMs were not required. Our efforts resulted in a software system named CrmMiner. The system mines for CRMs in the vicinity of related genes. CrmMiner requires two sets of sequences: a mixed set and a control set. Sequences in the vicinity of the related genes comprise the mixed set, whereas the control set includes random genomic sequences. CrmMiner assumes that a large percentage of the mixed set is made of background sequences that do not include CRMs. The system identifies pairs of closely located motifs representing vertebrate TFBSs that are enriched in the training mixed set consisting of 50% of the gene loci. In addition, CrmMiner selects a group of the enriched pairs to represent the tissue-specific regulatory signature. The mixed and the control sets are searched for candidate sequences that include any of the selected pairs. Next, an optimal Bayesian classifier is used to distinguish candidates found in the mixed set from their control counterparts. Our study proposes 62 tissue-specific regulatory signatures and putative CRMs for different human tissues and cell types. These signatures consist of assortments of ubiquitously expressed TFs and tissue-specific TFs. Under controlled settings, CrmMiner identified known CRMs in noisy sets up to 1:25 signal-to-noise ratio. CrmMiner was

  5. A cis-regulatory sequence driving metabolic insecticide resistance in mosquitoes: functional characterisation and signatures of selection.

    Science.gov (United States)

    Wilding, Craig S; Smith, Ian; Lynd, Amy; Yawson, Alexander Egyir; Weetman, David; Paine, Mark J I; Donnelly, Martin J

    2012-09-01

    Although cytochrome P450 (CYP450) enzymes are frequently up-regulated in mosquitoes resistant to insecticides, no regulatory motifs driving these expression differences with relevance to wild populations have been identified. Transposable elements (TEs) are often enriched upstream of those CYP450s involved in insecticide resistance, leading to the assumption that they contribute regulatory motifs that directly underlie the resistance phenotype. A partial CuRE1 (Culex Repetitive Element 1) transposable element is found directly upstream of CYP9M10, a cytochrome P450 implicated previously in larval resistance to permethrin in the ISOP450 strain of Culex quinquefasciatus, but is absent from the equivalent genomic region of a susceptible strain. Via expression of CYP9M10 in Escherichia coli we have now demonstrated time- and NADPH-dependant permethrin metabolism, prerequisites for confirmation of a role in metabolic resistance, and through qPCR shown that CYP9M10 is >20-fold over-expressed in ISOP450 compared to a susceptible strain. In a fluorescent reporter assay the region upstream of CYP9M10 from ISOP450 drove 10× expression compared to the equivalent region (lacking CuRE1) from the susceptible strain. Close correspondence with the gene expression fold-change implicates the upstream region including CuRE1 as a cis-regulatory element involved in resistance. Only a single CuRE1 bearing allele, identical to the CuRE1 bearing allele in the resistant strain, is found throughout Sub-Saharan Africa, in contrast to the diversity encountered in non-CuRE1 alleles. This suggests a single origin and subsequent spread due to selective advantage. CuRE1 is detectable using a simple diagnostic. When applied to C. quinquefasciatus larvae from Ghana we have demonstrated a significant association with permethrin resistance in multiple field sites (mean Odds Ratio = 3.86) suggesting this marker has relevance to natural populations of vector mosquitoes. However, when CuRE1 was excised

  6. Computational exploration of cis-regulatory modules in rhythmic expression data using the "Exploration of Distinctive CREs and CRMs" (EDCC) and "CRM Network Generator" (CNG) programs.

    Science.gov (United States)

    Bekiaris, Pavlos Stephanos; Tekath, Tobias; Staiger, Dorothee; Danisman, Selahattin

    2018-01-01

    Understanding the effect of cis-regulatory elements (CRE) and clusters of CREs, which are called cis-regulatory modules (CRM), in eukaryotic gene expression is a challenge of computational biology. We developed two programs that allow simple, fast and reliable analysis of candidate CREs and CRMs that may affect specific gene expression and that determine positional features between individual CREs within a CRM. The first program, "Exploration of Distinctive CREs and CRMs" (EDCC), correlates candidate CREs and CRMs with specific gene expression patterns. For pairs of CREs, EDCC also determines positional preferences of the single CREs in relation to each other and to the transcriptional start site. The second program, "CRM Network Generator" (CNG), prioritizes these positional preferences using a neural network and thus allows unbiased rating of the positional preferences that were determined by EDCC. We tested these programs with data from a microarray study of circadian gene expression in Arabidopsis thaliana. Analyzing more than 1.5 million pairwise CRE combinations, we found 22 candidate combinations, of which several contained known clock promoter elements together with elements that had not been identified as relevant to circadian gene expression before. CNG analysis further identified positional preferences of these CRE pairs, hinting at positional information that may be relevant for circadian gene expression. Future wet lab experiments will have to determine which of these combinations confer daytime specific circadian gene expression.

  7. RNA-ID, a highly sensitive and robust method to identify cis-regulatory sequences using superfolder GFP and a fluorescence-based assay.

    Science.gov (United States)

    Dean, Kimberly M; Grayhack, Elizabeth J

    2012-12-01

    We have developed a robust and sensitive method, called RNA-ID, to screen for cis-regulatory sequences in RNA using fluorescence-activated cell sorting (FACS) of yeast cells bearing a reporter in which expression of both superfolder green fluorescent protein (GFP) and yeast codon-optimized mCherry red fluorescent protein (RFP) is driven by the bidirectional GAL1,10 promoter. This method recapitulates previously reported progressive inhibition of translation mediated by increasing numbers of CGA codon pairs, and restoration of expression by introduction of a tRNA with an anticodon that base pairs exactly with the CGA codon. This method also reproduces effects of paromomycin and context on stop codon read-through. Five key features of this method contribute to its effectiveness as a selection for regulatory sequences: The system exhibits greater than a 250-fold dynamic range, a quantitative and dose-dependent response to known inhibitory sequences, exquisite resolution that allows nearly complete physical separation of distinct populations, and a reproducible signal between different cells transformed with the identical reporter, all of which are coupled with simple methods involving ligation-independent cloning, to create large libraries. Moreover, we provide evidence that there are sequences within a 9-nt library that cause reduced GFP fluorescence, suggesting that there are novel cis-regulatory sequences to be found even in this short sequence space. This method is widely applicable to the study of both RNA-mediated and codon-mediated effects on expression.

  8. An in vivo cis-regulatory screen at the type 2 diabetes associated TCF7L2 locus identifies multiple tissue-specific enhancers.

    Directory of Open Access Journals (Sweden)

    Daniel Savic

    Full Text Available Genome-wide association studies (GWAS have repeatedly shown an association between non-coding variants in the TCF7L2 locus and risk for type 2 diabetes (T2D, implicating a role for cis-regulatory variation within this locus in disease etiology. Supporting this hypothesis, we previously localized complex regulatory activity to the TCF7L2 T2D-associated interval using an in vivo bacterial artificial chromosome (BAC enhancer-trapping reporter strategy. To follow-up on this broad initial survey of the TCF7L2 regulatory landscape, we performed a fine-mapping enhancer scan using in vivo mouse transgenic reporter assays. We functionally interrogated approximately 50% of the sequences within the T2D-associated interval, utilizing sequence conservation within this 92-kb interval to determine the regulatory potential of all evolutionary conserved sequences that exhibited conservation to the non-eutherian mammal opossum. Included in this study was a detailed functional interrogation of sequences spanning both protective and risk alleles of single nucleotide polymorphism (SNP rs7903146, which has exhibited allele-specific enhancer function in pancreatic beta cells. Using these assays, we identified nine segments regulating various aspects of the TCF7L2 expression profile and that constitute nearly 70% of the sequences tested. These results highlight the regulatory complexity of this interval and support the notion that a TCF7L2 cis-regulatory disruption leads to T2D predisposition.

  9. Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

    2005-07-15

    A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

  10. Enteric Duplication.

    Science.gov (United States)

    Jeziorczak, Paul M; Warner, Brad W

    2018-03-01

    Enteric duplications have been described throughout the entire gastrointestinal tract. The usual perinatal presentation is an abdominal mass. Duplications associated with the foregut have associated respiratory symptoms, whereas duplications in the midgut and hindgut can present with obstructive symptoms, perforation, nausea, emesis, hemorrhage, or be asymptomatic, and identified as an incidental finding. These are differentiated from other cystic lesions by the presence of a normal gastrointestinal mucosal epithelium. Enteric duplications are located on the mesenteric side of the native structures and are often singular with tubular or cystic characteristics. Management of enteric duplications often requires operative intervention with preservation of the native blood supply and intestine. These procedures are usually very well tolerated with low morbidity.

  11. Microarray Analysis of Copy Number Variants on the Human Y Chromosome Reveals Novel and Frequent Duplications Overrepresented in Specific Haplogroups.

    Directory of Open Access Journals (Sweden)

    Martin M Johansson

    Full Text Available The human Y chromosome is almost always excluded from genome-wide investigations of copy number variants (CNVs due to its highly repetitive structure. This chromosome should not be forgotten, not only for its well-known relevance in male fertility, but also for its involvement in clinical phenotypes such as cancers, heart failure and sex specific effects on brain and behaviour.We analysed Y chromosome data from Affymetrix 6.0 SNP arrays and found that the signal intensities for most of 8179 SNP/CN probes in the male specific region (MSY discriminated between a male, background signals in a female and an isodicentric male containing a large deletion of the q-arm and a duplication of the p-arm of the Y chromosome. Therefore, this SNP/CN platform is suitable for identification of gain and loss of Y chromosome sequences. In a set of 1718 males, we found 25 different CNV patterns, many of which are novel. We confirmed some of these variants by PCR or qPCR. The total frequency of individuals with CNVs was 14.7%, including 9.5% with duplications, 4.5% with deletions and 0.7% exhibiting both. Hence, a novel observation is that the frequency of duplications was more than twice the frequency of deletions. Another striking result was that 10 of the 25 detected variants were significantly overrepresented in one or more haplogroups, demonstrating the importance to control for haplogroups in genome-wide investigations to avoid stratification. NO-M214(xM175 individuals presented the highest percentage (95% of CNVs. If they were not counted, 12.4% of the rest included CNVs, and the difference between duplications (8.9% and deletions (2.8% was even larger.Our results demonstrate that currently available genome-wide SNP platforms can be used to identify duplications and deletions in the human Y chromosome. Future association studies of the full spectrum of Y chromosome variants will demonstrate the potential involvement of gain or loss of Y chromosome sequence in

  12. Analysis of the 9p21.3 sequence associated with coronary artery disease reveals a tendency for duplication in a CAD patient

    Science.gov (United States)

    Kouprina, Natalay; Noskov, Vladimir N.; Waterfall, Joshua J.; Walker, Robert L.; Meltzer, Paul S.; Topol, Eric J.; Larionov, Vladimir

    2018-01-01

    Tandem segmental duplications (SDs) greater than 10 kb are widespread in complex genomes. They provide material for gene divergence and evolutionary adaptation, while formation of specific de novo SDs is a hallmark of cancer and some human diseases. Most SDs map to distinct genomic regions termed ‘duplication blocks’. SDs organization within these blocks is often poorly characterized as they are mosaics of ancestral duplicons juxtaposed with younger duplicons arising from more recent duplication events. Structural and functional analysis of SDs is further hampered as long repetitive DNA structures are underrepresented in existing BAC and YAC libraries. We applied Transformation-Associated Recombination (TAR) cloning, a versatile technique for large DNA manipulation, to selectively isolate the coronary artery disease (CAD) interval sequence within the 9p21.3 chromosome locus from a patient with coronary artery disease and normal individuals. Four tandem head-to-tail duplicons, each ∼50 kb long, were recovered in the patient but not in normal individuals. Sequence analysis revealed that the repeats varied by 10-15 SNPs between each other and by 82 SNPs between the human genome sequence (version hg19). SNPs polymorphism within the junctions between repeats allowed two junction types to be distinguished, Type 1 and Type 2, which were found at a 2:1 ratio. The junction sequences contained an Alu element, a sequence previously shown to play a role in duplication. Knowledge of structural variation in the CAD interval from more patients could help link this locus to cardiovascular diseases susceptibility, and maybe relevant to other cases of regional amplification, including cancer. PMID:29632643

  13. Duplicate editorial on duplicate publication.

    Science.gov (United States)

    Corson, Stephen L; Decherney, Alan H

    2005-04-01

    The authors define and discuss the various forms taken by duplicate publications, and provide suggested remedies to help authors, editors, reviewers, and readers avoid this form of internal plagiarism.

  14. Microevolution of cis-regulatory elements: an example from the pair-rule segmentation gene fushi tarazu in the Drosophila melanogaster subgroup.

    Directory of Open Access Journals (Sweden)

    Mohammed Bakkali

    Full Text Available The importance of non-coding DNAs that control transcription is ever noticeable, but the characterization and analysis of the evolution of such DNAs presents challenges not found in the analysis of coding sequences. In this study of the cis-regulatory elements of the pair rule segmentation gene fushi tarazu (ftz I report the DNA sequences of ftz's zebra element (promoter and a region containing the proximal enhancer from a total of 45 fly lines belonging to several populations of the species Drosophila melanogaster, D. simulans, D. sechellia, D. mauritiana, D. yakuba, D. teissieri, D. orena and D. erecta. Both elements evolve at slower rate than ftz synonymous sites, thus reflecting their functional importance. The promoter evolves more slowly than the average for ftz's coding sequence while, on average, the enhancer evolves more rapidly, suggesting more functional constraint and effective purifying selection on the former. Comparative analysis of the number and nature of base substitutions failed to detect significant evidence for positive/adaptive selection in transcription-factor-binding sites. These seem to evolve at similar rates to regions not known to bind transcription factors. Although this result reflects the evolutionary flexibility of the transcription factor binding sites, it also suggests a complex and still not completely understood nature of even the characterized cis-regulatory sequences. The latter seem to contain more functional parts than those currently identified, some of which probably transcription factor binding. This study illustrates ways in which functional assignments of sequences within cis-acting sequences can be used in the search for adaptive evolution, but also highlights difficulties in how such functional assignment and analysis can be carried out.

  15. Rectal duplication.

    Directory of Open Access Journals (Sweden)

    Kulkarni B

    1995-04-01

    Full Text Available Duplications of the alimentary tract are of a great rarity, particularly so in the rectum. Because of its rarity, the difficulty of making a correct diagnosis and of selection of proper approach for treatment, this entity bears a special significance. The present case report deals with a female newborn who presented with imperforate anus and a rectovestibular fistula and a mass prolapsing at the introitus. Complete excision of the mass was carried out through the perineal approach and the child then underwent, a PSARP for the correction of the rectal anomaly. Histology confirmed the mass to be a rectal duplication.

  16. Gallbladder duplication

    Directory of Open Access Journals (Sweden)

    Yagan Pillay

    2015-01-01

    Conclusion: Duplication of the gallbladder is a rare congenital abnormality, which requires special attention to the biliary ductal and arterial anatomy. Laparoscopic cholecystectomy with intraoperative cholangiography is the appropriate treatment in a symptomatic gallbladder. The removal of an asymptomatic double gallbladder remains controversial.

  17. Integrative modeling of eQTLs and cis-regulatory elements suggests mechanisms underlying cell type specificity of eQTLs.

    Directory of Open Access Journals (Sweden)

    Christopher D Brown

    Full Text Available Genetic variants in cis-regulatory elements or trans-acting regulators frequently influence the quantity and spatiotemporal distribution of gene transcription. Recent interest in expression quantitative trait locus (eQTL mapping has paralleled the adoption of genome-wide association studies (GWAS for the analysis of complex traits and disease in humans. Under the hypothesis that many GWAS associations tag non-coding SNPs with small effects, and that these SNPs exert phenotypic control by modifying gene expression, it has become common to interpret GWAS associations using eQTL data. To fully exploit the mechanistic interpretability of eQTL-GWAS comparisons, an improved understanding of the genetic architecture and causal mechanisms of cell type specificity of eQTLs is required. We address this need by performing an eQTL analysis in three parts: first we identified eQTLs from eleven studies on seven cell types; then we integrated eQTL data with cis-regulatory element (CRE data from the ENCODE project; finally we built a set of classifiers to predict the cell type specificity of eQTLs. The cell type specificity of eQTLs is associated with eQTL SNP overlap with hundreds of cell type specific CRE classes, including enhancer, promoter, and repressive chromatin marks, regions of open chromatin, and many classes of DNA binding proteins. These associations provide insight into the molecular mechanisms generating the cell type specificity of eQTLs and the mode of regulation of corresponding eQTLs. Using a random forest classifier with cell specific CRE-SNP overlap as features, we demonstrate the feasibility of predicting the cell type specificity of eQTLs. We then demonstrate that CREs from a trait-associated cell type can be used to annotate GWAS associations in the absence of eQTL data for that cell type. We anticipate that such integrative, predictive modeling of cell specificity will improve our ability to understand the mechanistic basis of human

  18. Comparative genomic analysis reveals occurrence of genetic recombination in virulent Cryptosporidium hominis subtypes and telomeric gene duplications in Cryptosporidium parvum.

    Science.gov (United States)

    Guo, Yaqiong; Tang, Kevin; Rowe, Lori A; Li, Na; Roellig, Dawn M; Knipe, Kristine; Frace, Michael; Yang, Chunfu; Feng, Yaoyu; Xiao, Lihua

    2015-04-18

    Cryptosporidium hominis is a dominant species for human cryptosporidiosis. Within the species, IbA10G2 is the most virulent subtype responsible for all C. hominis-associated outbreaks in Europe and Australia, and is a dominant outbreak subtype in the United States. In recent yearsIaA28R4 is becoming a major new subtype in the United States. In this study, we sequenced the genomes of two field specimens from each of the two subtypes and conducted a comparative genomic analysis of the obtained sequences with those from the only fully sequenced Cryptosporidium parvum genome. Altogether, 8.59-9.05 Mb of Cryptosporidium sequences in 45-767 assembled contigs were obtained from the four specimens, representing 94.36-99.47% coverage of the expected genome. These genomes had complete synteny in gene organization and 96.86-97.0% and 99.72-99.83% nucleotide sequence similarities to the published genomes of C. parvum and C. hominis, respectively. Several major insertions and deletions were seen between C. hominis and C. parvum genomes, involving mostly members of multicopy gene families near telomeres. The four C. hominis genomes were highly similar to each other and divergent from the reference IaA25R3 genome in some highly polymorphic regions. Major sequence differences among the four specimens sequenced in this study were in the 5' and 3' ends of chromosome 6 and the gp60 region, largely the result of genetic recombination. The sequence similarity among specimens of the two dominant outbreak subtypes and genetic recombination in chromosome 6, especially around the putative virulence determinant gp60 region, suggest that genetic recombination plays a potential role in the emergence of hyper-transmissible C. hominis subtypes. The high sequence conservation between C. parvum and C. hominis genomes and significant differences in copy numbers of MEDLE family secreted proteins and insulinase-like proteases indicate that telomeric gene duplications could potentially contribute to

  19. The lncRNA Malat1 Is Dispensable for Mouse Development but Its Transcription Plays a cis-Regulatory Role in the Adult

    Directory of Open Access Journals (Sweden)

    Bin Zhang

    2012-07-01

    Full Text Available Genome-wide studies have identified thousands of long noncoding RNAs (lncRNAs lacking protein-coding capacity. However, most lncRNAs are expressed at a very low level, and in most cases there is no genetic evidence to support their in vivo function. Malat1 (metastasis associated lung adenocarcinoma transcript 1 is among the most abundant and highly conserved lncRNAs, and it exhibits an uncommon 3′-end processing mechanism. In addition, its specific nuclear localization, developmental regulation, and dysregulation in cancer are suggestive of it having a critical biological function. We have characterized a Malat1 loss-of-function genetic model that indicates that Malat1 is not essential for mouse pre- and postnatal development. Furthermore, depletion of Malat1 does not affect global gene expression, splicing factor level and phosphorylation status, or alternative pre-mRNA splicing. However, among a small number of genes that were dysregulated in adult Malat1 knockout mice, many were Malat1 neighboring genes, thus indicating a potential cis-regulatory role of Malat1 gene transcription.

  20. Identification of a cis-regulatory region of a gene in Arabidopsis thaliana whose induction by dehydration is mediated by abscisic acid and requires protein synthesis.

    Science.gov (United States)

    Iwasaki, T; Yamaguchi-Shinozaki, K; Shinozaki, K

    1995-05-20

    In Arabidopsis thaliana, the induction of a dehydration-responsive gene, rd22, is mediated by abscisic acid (ABA) but the gene does not include any sequence corresponding to the consensus ABA-responsive element (ABRE), RYACGTGGYR, in its promoter region. The cis-regulatory region of the rd22 promoter was identified by monitoring the expression of beta-glucuronidase (GUS) activity in leaves of transgenic tobacco plants transformed with chimeric gene fusions constructed between 5'-deleted promoters of rd22 and the coding region of the GUS reporter gene. A 67-bp nucleotide fragment corresponding to positions -207 to -141 of the rd22 promoter conferred responsiveness to dehydration and ABA on a non-responsive promoter. The 67-bp fragment contains the sequences of the recognition sites for some transcription factors, such as MYC, MYB, and GT-1. The fact that accumulation of rd22 mRNA requires protein synthesis raises the possibility that the expression of rd22 might be regulated by one of these trans-acting protein factors whose de novo synthesis is induced by dehydration or ABA. Although the structure of the RD22 protein is very similar to that of a non-storage seed protein, USP, of Vicia faba, the expression of the GUS gene driven by the rd22 promoter in non-stressed transgenic Arabidopsis plants was found mainly in flowers and bolted stems rather than in seeds.

  1. Distinct cis regulatory elements govern the expression of TAG1 in embryonic sensory ganglia and spinal cord.

    Directory of Open Access Journals (Sweden)

    Yoav Hadas

    Full Text Available Cell fate commitment of spinal progenitor neurons is initiated by long-range, midline-derived, morphogens that regulate an array of transcription factors that, in turn, act sequentially or in parallel to control neuronal differentiation. Included among these are transcription factors that regulate the expression of receptors for guidance cues, thereby determining axonal trajectories. The Ig/FNIII superfamily molecules TAG1/Axonin1/CNTN2 (TAG1 and Neurofascin (Nfasc are co-expressed in numerous neuronal cell types in the CNS and PNS - for example motor, DRG and interneurons - both promote neurite outgrowth and both are required for the architecture and function of nodes of Ranvier. The genes encoding TAG1 and Nfasc are adjacent in the genome, an arrangement which is evolutionarily conserved. To study the transcriptional network that governs TAG1 and Nfasc expression in spinal motor and commissural neurons, we set out to identify cis elements that regulate their expression. Two evolutionarily conserved DNA modules, one located between the Nfasc and TAG1 genes and the second directly 5' to the first exon and encompassing the first intron of TAG1, were identified that direct complementary expression to the CNS and PNS, respectively, of the embryonic hindbrain and spinal cord. Sequential deletions and point mutations of the CNS enhancer element revealed a 130bp element containing three conserved E-boxes required for motor neuron expression. In combination, these two elements appear to recapitulate a major part of the pattern of TAG1 expression in the embryonic nervous system.

  2. Cis-regulatory control of the nuclear receptor Coup-TF gene in the sea urchin Paracentrotus lividus embryo.

    Directory of Open Access Journals (Sweden)

    Lamprini G Kalampoki

    Full Text Available Coup-TF, an orphan member of the nuclear receptor super family, has a fundamental role in the development of metazoan embryos. The study of the gene's regulatory circuit in the sea urchin embryo will facilitate the placement of this transcription factor in the well-studied embryonic Gene Regulatory Network (GRN. The Paracentrotus lividus Coup-TF gene (PlCoup-TF is expressed throughout embryonic development preferentially in the oral ectoderm of the gastrula and the ciliary band of the pluteus stage. Two overlapping λ genomic clones, containing three exons and upstream sequences of PlCoup-TF, were isolated from a genomic library. The transcription initiation site was determined and 5' deletions and individual segments of a 1930 bp upstream region were placed ahead of a GFP reporter cassette and injected into fertilized P.lividus eggs. Module a (-532 to -232, was necessary and sufficient to confer ciliary band expression to the reporter. Comparison of P.lividus and Strongylocentrotus purpuratus upstream Coup-TF sequences, revealed considerable conservation, but none within module a. 5' and internal deletions into module a, defined a smaller region that confers ciliary band specific expression. Putative regulatory cis-acting elements (RE1, RE2 and RE3 within module a, were specifically bound by proteins in sea urchin embryonic nuclear extracts. Site-specific mutagenesis of these elements resulted in loss of reporter activity (RE1 or ectopic expression (RE2, RE3. It is proposed that sea urchin transcription factors, which bind these three regulatory sites, are necessary for spatial and quantitative regulation of the PlCoup-TF gene at pluteus stage sea urchin embryos. These findings lead to the future identification of these factors and to the hierarchical positioning of PlCoup-TF within the embryonic GRN.

  3. Properties of non-coding DNA and identification of putative cis-regulatory elements in Theileria parva

    Directory of Open Access Journals (Sweden)

    Guo Xiang

    2008-12-01

    Full Text Available Abstract Background Parasites in the genus Theileria cause lymphoproliferative diseases in cattle, resulting in enormous socio-economic losses. The availability of the genome sequences and annotation for T. parva and T. annulata has facilitated the study of parasite biology and their relationship with host cell transformation and tropism. However, the mechanism of transcriptional regulation in this genus, which may be key to understanding fundamental aspects of its parasitology, remains poorly understood. In this study, we analyze the evolution of non-coding sequences in the Theileria genome and identify conserved sequence elements that may be involved in gene regulation of these parasitic species. Results Intergenic regions and introns in Theileria are short, and their length distributions are considerably right-skewed. Intergenic regions flanked by genes in 5'-5' orientation tend to be longer and slightly more AT-rich than those flanked by two stop codons; intergenic regions flanked by genes in 3'-5' orientation have intermediate values of length and AT composition. Intron position is negatively correlated with intron length, and positively correlated with GC content. Using stringent criteria, we identified a set of high-quality orthologous non-coding sequences between T. parva and T. annulata, and determined the distribution of selective constraints across regions, which are shown to be higher close to translation start sites. A positive correlation between constraint and length in both intergenic regions and introns suggests a tight control over length expansion of non-coding regions. Genome-wide searches for functional elements revealed several conserved motifs in intergenic regions of Theileria genomes. Two such motifs are preferentially located within the first 60 base pairs upstream of transcription start sites in T. parva, are preferentially associated with specific protein functional categories, and have significant similarity to know

  4. Comprehensive meta-analysis of Signal Transducers and Activators of Transcription (STAT genomic binding patterns discerns cell-specific cis-regulatory modules

    Directory of Open Access Journals (Sweden)

    Kang Keunsoo

    2013-01-01

    Full Text Available Abstract Background Cytokine-activated transcription factors from the STAT (Signal Transducers and Activators of Transcription family control common and context-specific genetic programs. It is not clear to what extent cell-specific features determine the binding capacity of seven STAT members and to what degree they share genetic targets. Molecular insight into the biology of STATs was gained from a meta-analysis of 29 available ChIP-seq data sets covering genome-wide occupancy of STATs 1, 3, 4, 5A, 5B and 6 in several cell types. Results We determined that the genomic binding capacity of STATs is primarily defined by the cell type and to a lesser extent by individual family members. For example, the overlap of shared binding sites between STATs 3 and 5 in T cells is greater than that between STAT5 in T cells and non-T cells. Even for the top 1,000 highly enriched STAT binding sites, ~15% of STAT5 binding sites in mouse female liver are shared by other STATs in different cell types while in T cells ~90% of STAT5 binding sites are co-occupied by STAT3, STAT4 and STAT6. In addition, we identified 116 cis-regulatory modules (CRM, which are recognized by all STAT members across cell types defining a common JAK-STAT signature. Lastly, in liver STAT5 binding significantly coincides with binding of the cell-specific transcription factors HNF4A, FOXA1 and FOXA2 and is associated with cell-type specific gene transcription. Conclusions Our results suggest that genomic binding of STATs is primarily determined by the cell type and further specificity is achieved in part by juxtaposed binding of cell-specific transcription factors.

  5. PlantPAN: Plant promoter analysis navigator, for identifying combinatorial cis-regulatory elements with distance constraint in plant gene groups

    Directory of Open Access Journals (Sweden)

    Huang Hsien-Da

    2008-11-01

    Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.

  6. Rectal duplication cyst presenting as rectal prolapse in an infant

    Directory of Open Access Journals (Sweden)

    Maher Zaiem

    2018-05-01

    Full Text Available Rectal duplication is a rare variety of gastrointestinal duplication. It accounts 4% of the total gastrointestinal duplications.In this paper, we are reporting a case of an 8 months old male who presented with rectal prolapse. Digital rectal examination revealed a soft mass bulging through the posterior wall of rectum. Computed tomography (CT scan showed a cystic mass compressing the posterior wall of the rectum. The mass was excised using a Muscle Complex Saving Posterior Sagittal approach (MCS-PSA. The pathology report confirmed the diagnosis of the rectal duplication cyst. The postoperative recovery was uneventful. Keywords: Intestinal duplication, Cystic rectal duplication, Rectal prolapse

  7. De novo assembly of the zucchini genome reveals a whole-genome duplication associated with the origin of the Cucurbita genus.

    Science.gov (United States)

    Montero-Pau, Javier; Blanca, José; Bombarely, Aureliano; Ziarsolo, Peio; Esteras, Cristina; Martí-Gómez, Carlos; Ferriol, María; Gómez, Pedro; Jamilena, Manuel; Mueller, Lukas; Picó, Belén; Cañizares, Joaquín

    2017-11-07

    The Cucurbita genus (squashes, pumpkins and gourds) includes important domesticated species such as C. pepo, C. maxima and C. moschata. In this study, we present a high-quality draft of the zucchini (C. pepo) genome. The assembly has a size of 263 Mb, a scaffold N50 of 1.8 Mb and 34 240 gene models. It includes 92% of the conserved BUSCO core gene set, and it is estimated to cover 93.0% of the genome. The genome is organized in 20 pseudomolecules that represent 81.4% of the assembly, and it is integrated with a genetic map of 7718 SNPs. Despite the small genome size, three independent lines of evidence support that the C. pepo genome is the result of a whole-genome duplication: the topology of the gene family phylogenies, the karyotype organization and the distribution of 4DTv distances. Additionally, 40 transcriptomes of 12 species of the genus were assembled and analysed together with all the other published genomes of the Cucurbitaceae family. The duplication was detected in all the Cucurbita species analysed, including C. maxima and C. moschata, but not in the more distant cucurbits belonging to the Cucumis and Citrullus genera, and it is likely to have occurred 30 ± 4 Mya in the ancestral species that gave rise to the genus. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  8. Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

    Directory of Open Access Journals (Sweden)

    Gadagkar Sudhindra R

    2010-04-01

    with microtubule-associated proteins. CTT residues overwhelming comprise the co-evolving residues between Drosophila alpha 2 and beta 3 tubulin proteins, indicating CTT specializations can be mediated at the level of the tubulin dimer. Gene duplications post-dating separation of the insect orders are unevenly distributed, most often appearing in major alpha 1 and minor beta 2 clades. More than 40 introns are found in tubulins. Their distribution among tubulins reveals that insertion and deletion events are common, surprising given their potential for disrupting tubulin coding sequence. Compensatory evolution is found in Drosophila beta 2 tubulin cis-regulation, and reveals selective pressures acting to maintain testis expression without the use of previously identified testis cis-regulatory elements. Conclusion Tubulins have stringent structure/function relationships, indicated by strong purifying selection, the loss of many gene duplication products, alpha-beta co-evolution in the tubulin dimer, and compensatory evolution in beta 2 tubulin cis-regulation. They evolve through gene duplication, subfunctionalization in expression domain and divergence of duplication products, largely in CTT residues that mediate interactions with other proteins. This has resulted in the tissue-specific minor insect isoforms, and in particular the highly diverse α3, α4, and β2 reproductive tissue-specific tubulin isoforms, illustrating that even a highly conserved protein family can participate in the adaptive process and respond to sexual selection.

  9. Genome-wide identification and comparative expression analysis reveal a rapid expansion and functional divergence of duplicated genes in the WRKY gene family of cabbage, Brassica oleracea var. capitata.

    Science.gov (United States)

    Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi

    2015-02-15

    WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Duplication of the oesophagus

    International Nuclear Information System (INIS)

    Lingg, G.; Nebel, G.

    1981-01-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined. (orig.) [de

  11. Duplication of the oesophagus

    Energy Technology Data Exchange (ETDEWEB)

    Lingg, G; Nebel, G

    1981-08-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined.

  12. Duplication in DNA Sequences

    Science.gov (United States)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  13. Current incidence of duplicate publication in otolaryngology.

    Science.gov (United States)

    Cheung, Veronique Wan Fook; Lam, Gilbert O A; Wang, Yun Fan; Chadha, Neil K

    2014-03-01

    Duplicate publication--deemed highly unethical--is the reproduction of substantial content in another article by the same authors. In 1999, Rosenthal et al. identified an 8.5% incidence of duplicate articles in two otolaryngology journals. We explored the current incidence in three otolaryngology journals in North America and Europe. Retrospective literature review. Index articles in 2008 in Archives of Otolaryngology-Head and Neck Surgery, Laryngoscope, and Clinical Otolaryngology were searched using MEDLINE. Potential duplicate publications in 2006 through 2010 were identified using the first, second, and last authors' names. Three authors independently investigated suspected duplicate publications--classifying them by degree of duplication. Of 358 index articles screened, 75 (20.9%) had 119 potential duplicates from 2006 to 2010. Full review of these 119 potential duplicates revealed a total of 40 articles with some form of redundancy (33.6% of the potential duplicates) involving 27 index articles (7.5% of 358 index articles); one (0.8%) "dual" publication (identical or nearly identical data and conclusions to the index article); three (2.5%) "suspected" dual publications (less than 50% new data and same conclusions); and 36 (30.3%) publications with "salami-slicing" (portion of the index article data repeated) were obtained. Further analysis compared the likelihood of duplicate publication by study source and subspecialty within otolaryngology. The incidence of duplicate publication has not significantly changed over 10 years. "Salami-slicing" was a concerning practice, with no cross-referencing in 61% of these cases. Detecting and eliminating redundant publications is a laborious task, but it is essential in upholding the journal quality and research integrity. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

  14. Two potential hookworm DAF-16 target genes, SNR-3 and LPP-1: gene structure, expression profile, and implications of a cis-regulatory element in the regulation of gene expression.

    Science.gov (United States)

    Gao, Xin; Goggin, Kevin; Dowling, Camille; Qian, Jason; Hawdon, John M

    2015-01-08

    Hookworms infect nearly 700 million people, causing anemia and developmental stunting in heavy infections. Little is known about the genomic structure or gene regulation in hookworms, although recent publication of draft genome assemblies has allowed the first investigations of these topics to be undertaken. The transcription factor DAF-16 mediates multiple developmental pathways in the free living nematode Caenorhabditis elegans, and is involved in the recovery from the developmentally arrested L3 in hookworms. Identification of downstream targets of DAF-16 will provide a better understanding of the molecular mechanism of hookworm infection. Genomic Fragment 2.23 containing a DAF-16 binding element (DBE) was used to identify overlapping complementary expressed sequence tags (ESTs). These sequences were used to search a draft assembly of the Ancylostoma caninum genome, and identified two neighboring genes, snr-3 and lpp-1, in a tail-to-tail orientation. Expression patterns of both genes during parasitic development were determined by qRT-PCR. DAF-16 dependent cis-regulatory activity of fragment 2.23 was investigated using an in vitro reporter system. The snr-3 gene spans approximately 5.6 kb in the genome and contains 3 exons and 2 introns, and contains the DBE in its 3' untranslated region. Downstream from snr-3 in a tail-to-tail arrangement is the gene lpp-1. The lpp-1 gene spans more than 6 kb and contains 10 exons and 9 introns. The A. caninum genome contains 2 apparent splice variants, but there are 7 splice variants in the A. ceylanicum genome. While the gene order is similar, the gene structures of the hookworm genes differ from their C. elegans orthologs. Both genes show peak expression in the late L4 stage. Using a cell culture based expression system, fragment 2.23 was found to have both DAF-16-dependent promoter and enhancer activity that required an intact DBE. Two putative DAF-16 targets were identified by genome wide screening for DAF-16 binding

  15. Typewriting: Toward Duplicating Success

    Science.gov (United States)

    Orsborn, Karen J.

    1977-01-01

    A description of two projects (secretarial handbook and memo pad and personalized stationery) for use in teaching the duplication process that will capture the interests of students in an advanced typewriting class. (HD)

  16. Dissection of cis-regulatory element architecture of the rice oleosin gene promoters to assess abscisic acid responsiveness in suspension-cultured rice cells.

    Science.gov (United States)

    Kim, Sol; Lee, Soo-Bin; Han, Chae-Seong; Lim, Mi-Na; Lee, Sung-Eun; Yoon, In Sun; Hwang, Yong-Sic

    2017-08-01

    Oleosins are the most abundant proteins in the monolipid layer surrounding neutral storage lipids that form oil bodies in plants. Several lines of evidence indicate that they are physiologically important for the maintenance of oil body structure and for mobilization of the lipids stored inside. Rice has six oleosin genes in its genome, the expression of all of which was found to be responsive to abscisic acid (ABA) in our examination of mature embryo and aleurone tissues. The 5'-flanking region of OsOle5 was initially characterized for its responsiveness to ABA through a transient expression assay system using the protoplasts from suspension-cultured rice cells. A series of successive deletions and site-directed mutations identified five regions critical for the hormonal induction of its promoter activity. A search for cis-acting elements in these regions deposited in a public database revealed that they contain various promoter elements previously reported to be involved in the ABA response of various genes. A gain-of-function experiment indicated that multiple copies of all five regions were sufficient to provide the minimal promoter with a distinct ABA responsiveness. Comparative sequence analysis of the short, but still ABA-responsive, promoters of OsOle genes revealed no common modular architecture shared by them, indicating that various distinct promoter elements and independent trans-acting factors are involved in the ABA responsiveness of rice oleosin multigenes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  17. Enteric and rectal duplications and duplication cysts in the adult.

    Science.gov (United States)

    Simsek, Abdurrahman; Zeybek, Nazif; Yagci, Gokhan; Kaymakcioglu, Nihat; Tas, Huseyin; Saglam, Mutlu; Cetiner, Sadettin

    2005-03-01

    Alimentary tract duplication and duplication cysts are rare congenital malformations. The ileum is the most frequently affected site. However, alimentary tract duplication and duplication cysts can occur at any point along the gastrointestinal tract. Early diagnosis and prompt surgical treatment is the best way to prevent associated morbidity. This article presents the cases of three patients admitted to Gulhane Military Medical Academy with signs of acute abdomen, intra-abdominal mass and chronic abdominal pain. These patients were found to have enteric duplication, duplication cyst and/or retro-rectal cyst. The literature on alimentary tract duplications is reviewed.

  18. The centriole duplication cycle

    Science.gov (United States)

    Fırat-Karalar, Elif Nur; Stearns, Tim

    2014-01-01

    Centrosomes are the main microtubule-organizing centre of animal cells and are important for many critical cellular and developmental processes from cell polarization to cell division. At the core of the centrosome are centrioles, which recruit pericentriolar material to form the centrosome and act as basal bodies to nucleate formation of cilia and flagella. Defects in centriole structure, function and number are associated with a variety of human diseases, including cancer, brain diseases and ciliopathies. In this review, we discuss recent advances in our understanding of how new centrioles are assembled and how centriole number is controlled. We propose a general model for centriole duplication control in which cooperative binding of duplication factors defines a centriole ‘origin of duplication’ that initiates duplication, and passage through mitosis effects changes that license the centriole for a new round of duplication in the next cell cycle. We also focus on variations on the general theme in which many centrioles are created in a single cell cycle, including the specialized structures associated with these variations, the deuterosome in animal cells and the blepharoplast in lower plant cells. PMID:25047614

  19. A case report of Ileal duplication

    Energy Technology Data Exchange (ETDEWEB)

    Oh, K K; Suh, J H; Choi, B S [Yonsei University College of Medicine, Seoul (Korea, Republic of)

    1971-10-15

    Since Frankel reported the congenital anomalous intestinal duplication incidentally during autopsy in 1883, about 228 cases has been reported on the literatures. In our severance hospital, one case of ileal duplication was found, and was confirmed by pathology and surgery. This patient of duplication usually reveals the symptoms of abnormal distension, pain and palpable abdominal mass, and sometimes the symptoms of intestinal obstruction. On x-ray flate abdomen, huge occupying mass displaces intestinal gas pattern to left side. Barium enema study reveals elongation and displacement of ileum by large extrinsic mass. And cecum is also displaced upward. On the IVP, this extrinsic mass is not related to kidneys. Also, the literature was reviewed.

  20. Craniofacial duplication (diprosopus).

    Science.gov (United States)

    Turpin, I M; Furnas, D W; Amlie, R N

    1981-02-01

    No congenital malformation in infants is more profound than anterior craniofacial duplication. The precise term for this rare anomaly is diprosopus, referring to a fetus with a single trunk, normal limbs, and varying degrees of facial duplication. A search of the world literature produced only 16 cases of diprosopus since 1864. Despite the rarity of this anomaly, three such infants were born in the Southern California area during the past year, making this the largest reported series to date. The three infants were born with two distinctly formed faces. Each had four separate eyes, two mouths, two noses, and two ears with a primitive ear or sinus tract at the plane of fusion. In addition, multiple congenital aberrations existed which involved a variety of internal organs. The pathogenesis of diprosopus is not well understood, but environmental stress early in embryologic development has been suggested as a possible factor. The apparent mechanism is a slowing of pregastrulation oxidation with resultant focal developmental arrests.

  1. Centrioles: duplicating precariously.

    Science.gov (United States)

    Pelletier, Laurence

    2007-09-04

    To assemble a mitotic spindle and accurately segregate chromosomes to progeny, a cell needs to precisely regulate its centrosome number, a feat largely accomplished through the tight control of centriole duplication. Recent work showing that the overexpression of centriolar proteins can lead to the formation of multiple centrioles in the absence of pre-existing centrioles challenges the idea that it is a self-replicating organelle.

  2. Rectal duplication: a case report.

    Science.gov (United States)

    Didden, K; Masereel, B; Geyskens, P

    2013-01-01

    Gastrointestinal tract duplications are uncommon congenital abnormalities, that may occur anywhere along the alimentary tract. Most frequently they occur at the level of the small bowel tract and are symptomatic before the age of two. In our case we report the history of a 68-years old women with a colon duplication, especially a rectal duplication. This is very exceptional.

  3. Embryonic duplications in sheep.

    Science.gov (United States)

    Dennis, S M

    1975-02-01

    Twenty-seven embryonic duplications were examined during a 3-year investigation into the causes of perinatal lamb mortality. Twenty of the 27 were anomalous twins with 19 being conjoined (diplopagus 9 and heteropagus 10). The various duplications were: haloacardius acephalus 1, diprosopus 2, dicephalus 2, dipypus 3, diprosopus dipygus 1, syncephalus dipygus 1, pygopagus parasiticus 1, heteropagus dipygus 3, melodidymus 6, polyury 4, penile duplication 2, and bilateral otognathia 1. Four lambs were living and the time of death of the others was: parturient 8, and post-parturient 15. Average dry weight of the lambs was 3.35 kg (range 1.59 to 5.45 kg). Breed distribution was: Merino 77.8%, Crossbred 14.8%, Dorset Horn 3.7%, and Corriedale 3.7%. The caudal region was involved in 10 of the conjoined twins (52.6%), anterior region in 7 (36.9%), and both anterior and caudal regions in 2 (10.5%). Associated defects were present in 70.4% of the 27 lambs, the most common being atresia ani.

  4. Long segment ileal duplication with extensive gastric heterotopia

    Directory of Open Access Journals (Sweden)

    Jacob Sunitha

    2009-07-01

    Full Text Available Duplications of the alimentary tract are rare congenital anomalies which can be found at all levels of the alimentary tract. Majority of the duplications present as spherical cysts and usually range from a few millimeters to less than ten centimeters in size. Duplications produce complications such as intestinal obstruction or hemorrhage. A two-month-old infant presented with recurrent episodes of bleeding per rectum. Laparotomy revealed a giant ileal duplicated bowel segment which exhibited extensive gastric heterotopia with focal ulceration.

  5. Craniofacial duplication: a case report.

    Science.gov (United States)

    Suryawanshi, Pradeep; Deshpande, Mandar; Verma, Nitin; Mahendrakar, Vivek; Mahendrakar, Sandhya

    2013-09-01

    A craniofacial duplication or diprosopus is an unusual variant of conjoined twinning. The reported incidence is one in 180,000-15 million births and 35 cases have been reported till date. The phenotype is wide, with the partial duplication of a few facial structures to complete dicephalus. A complete duplication is associated with a high incidence of anomalies in the central nervous system, cardiovascular system, gastrointestinal system and the respiratory system, whereas no major anomalies are found in the infants with a partial duplication. A term baby with the features of a craniofacial duplication has been described, with the proposed theories on embryogenesis and a brief review of the literature.

  6. Rectal duplication with sciatic hernia.

    Science.gov (United States)

    Nosek, Marzena; Golonka, Anna; Kalińska-Lipert, Anita; Nachulewicz, Paweł

    2015-07-01

    Rectal duplications represent 5% of all duplications in the alimentary tract, and they are very rarely diagnosed during the neonatal period. The authors present the method of investigation and the results of surgical treatment of a full-term neonate with a sciatic hernia containing a rectal duplication. The procedure started with three-port laparoscopy, but excision of the tubular duplication of the rectum was possible only by a transanal endorectal pull-through approach. The sciatic hernia was closed, and plastic sutures on the buttock finished the procedure. The coincidence of sciatic hernia with rectal duplication is extremely rare, and the method of treatment depends exclusively on the anatomical conditions.

  7. Functional requirements driving the gene duplication in 12 Drosophila species.

    Science.gov (United States)

    Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui

    2013-08-15

    Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.

  8. MECP2 Duplication Syndrome

    DEFF Research Database (Denmark)

    Signorini, Cinzia; De Felice, Claudio; Leoncini, Silvia

    2016-01-01

    Rett syndrome (RTT) and MECP2 duplication syndrome (MDS) are neurodevelopmental disorders caused by alterations in the methyl-CpG binding protein 2 (MECP2) gene expression. A relationship between MECP2 loss-of-function mutations and oxidative stress has been previously documented in RTT patients...... and murine models. To date, no data on oxidative stress have been reported for the MECP2 gain-of-function mutations in patients with MDS. In the present work, the pro-oxidant status and oxidative fatty acid damage in MDS was investigated (subjects n = 6) and compared to RTT (subjects n = 24) and healthy...... similar to those observed in RTT patients except for higher plasma F2-isoprostanes levels (P work shows unique data in patients affected by MDS. For the first...

  9. Duplicated middle cerebral artery

    Science.gov (United States)

    Perez, Jesus; Machado, Calixto; Scherle, Claudio; Hierro, Daniel

    2009-01-01

    Duplicated middle cerebral artery (DMCA) is an anomalous vessel arising from the internal carotid artery. The incidence DMCA is relatively law, and an association between this anomaly and cerebral aneurysms has been documented. There is a controversy whether DMCA may have perforating arteries. This is an important fact to consider in aneurysm surgery. We report the case of a 34-year-old black woman who suffered a subarachnoid hemorrhage and the angiography a left DMCA, and an aneurysm in an inferior branch of the main MCA. The DMCA and the MCA had perforating arteries. The aneurysm was clipped without complications. The observation of perforating arteries in our patient confirms that the DMCA may have perforating arteries. This is very important to be considered in cerebral aneurysms surgery. Moreover, the DMCA may potentially serve as a collateral blood supply to the MCA territory in cases of MCA occlusion. PMID:22140405

  10. Rectal duplication cyst in adults treated with transanal endoscopic microsurgery.

    Science.gov (United States)

    Ben-Ishay, O; Person, B; Eran, B; Hershkovitz, D; Duek, D Simon

    2011-12-01

    Rectal duplication cyst is a rare entity that accounts for approximately 4% of all alimentary tract duplications. To the best of our knowledge, the presented cases are the first reports in the English literature of rectal duplication cyst resection by transanal endoscopic microsurgery. We present two patients; both are 41-year-old women with a palpable rectal mass. Workup revealed a submucosal posterior mass that was then resected by transanal endoscopic microsurgery. The pathology report described cystic lesions with squamous and columnar epithelium and segments of smooth muscle. These findings were compatible with rectal duplication cyst. Our limited experience showed good results with minimal morbidity and mortality for resection of rectal duplication cysts of limited size with no evidence of malignancy.

  11. Colonic duplication in an adult

    International Nuclear Information System (INIS)

    Baro, P.; Dario Casas, J.; Sanchez, D.

    1988-01-01

    A case of colonic duplication that was diagnosed radiologically in an adult is reported. A long duplicated segment below the normal transverse colon, with a wide anastomosis at the hepatic flexure level, was observed on barium enema. The rarity of this anomaly unassociated with other malformations is emphasized. (orig.)

  12. Complete colonic duplication in children.

    Science.gov (United States)

    Khaleghnejad Tabari, Ahmad; Mirshemirani, Alireza; Khaleghnejad Tabari, Nasibeh

    2012-01-01

    Complete colonic duplication is a very rare congenital anomaly that may have different presentations according to its location and size. Complete colonic duplication can occur in 15% of gastrointestinal duplication. We report two cases of complete colonic duplications, and their characteristics. We present two patients with complete colonic duplication with different types and presentations. Case 1: A 2- year old boy presented to the clinic with abdominal protrusion, difficulty to defecate, chronic constipation and mucosal prolaps covered bulging (rectocele) since he was 6 months old. The patient had palpable pelvic mass with doughy consistency. Rectal exam confirmed perirectal mass with soft consistency. The patient underwent a surgical operation that had total tubular colorectal duplication with one blind end and was treated with simple fenestration of distal end, and was discharged without complication. After two years follow up, he had normal defecation and good weight gain. Case 2: A 2 -day old infant was referred with imperforate anus and complete duplication of recto-sigmoid colon, diphallus, double bladder, and hypospadiasis. After clinical and paraclinical investigations, he underwent operations in several stages in different periods, and was discharged without complications. After four years follow up, he led a normal life. The patients with complete duplication have to be examined carefully because of the high incidence of other systemic anomalies. Treatment includes simple resection of distal common wall, fenestration, and repair other associated anomalies.

  13. Duplication Cyst of the Sigmoid Colon

    Directory of Open Access Journals (Sweden)

    Bastian Domajnko

    2009-01-01

    Full Text Available A 21-year-old male with developmental delay presented with abdominal pain of two days' duration. He was afebrile and his abdomen was soft with mild diffuse tenderness. There were no peritoneal signs. Plain x-ray demonstrated a large air-filled structure in the right upper quadrant. Computed tomography of the abdomen revealed a 9×8 cm structure adjacent to the hepatic flexure containing an air-fluid level. It did not contain oral contrast and had no apparent communication with the colon. At operation, the cystic lesion was identified as a duplication cyst of the sigmoid colon that was adherent to the right upper quadrant. The cyst was excised with a segment of the sigmoid colon and a stapled colo-colostomy was performed. Recovery was uneventful. Final pathology was consistent with a duplication cyst of the sigmoid colon. The cyst was attached to the colon but did not communicate with the lumen.

  14. MLPA analysis for a panel of syndromes with mental retardation reveals imbalances in 5.8% of patients with mental retardation and dysmorphic features, including duplications of the Sotos syndrome and Williams-Beuren syndrome regions

    DEFF Research Database (Denmark)

    Kirchhoff, Maria; Bisgaard, Anne-Marie; Bryndorf, Thue

    2007-01-01

    MLPA analysis for a panel of syndromes with mental retardation (MRS-MLPA) was used for investigation of 258 mentally retarded and dysmorphic patients with normal conventional karyotypes (P064 probe set, MRC-Holland, for detection of (micro)deletions associated with 1p36-deletion, Sotos, Williams...... referred with a clinical suspicion of a specific syndrome, which was confirmed in 17 patients (21.3%). The remaining 90 patients were referred because of mental retardation and dysmorphism but without suspicion of a specific syndrome. Seven imbalances, including four duplications, were detected in these 90...

  15. Plasticity and innovation of regulatory mechanisms underlying seed oil content mediated by duplicated genes in the palaeopolyploid soybean.

    Science.gov (United States)

    Zhang, Dajian; Zhao, Meixia; Li, Shuai; Sun, Lianjun; Wang, Weidong; Cai, Chunmei; Dierking, Emily C; Ma, Jianxin

    2017-06-01

    Many plants have undergone whole genome duplication (WGD). However, how regulatory networks underlying a particular trait are reshaped in polyploids has not been experimentally investigated. Here we show that the regulatory pathways modulating seed oil content, which involve WRINKLED1 (WRI1), LEAFY COTYLEDON1 (LEC1), and LEC2 in Arabidopsis, have been modified in the palaeopolyploid soybean. Such modifications include functional reduction of GmWRI1b of the GmWRI1a/GmWRI1b homoeologous pair relevant to WRI1, complementary non-allelic dosage effects of the GmLEC1a/GmLEC1b homoeologous pair relevant to LEC1, pseudogenization of the singleton GmLEC2 relevant to LEC2, and the rise of the LEC2-like function of GmABI3b, contrasting to its homoeolog GmABI3a, which maintains the ABSCISIC ACID INSENSITIVE 3 (ABI3)-like function in modulating seed maturation and dormancy. The function of GmABI3b in modulating seed oil biosynthesis was fulfilled by direct binding to a RY (CATGCA) cis-regulatory element in the GmWRI1a promoter, which was absent in the GmWRI1b promoter, resulting in reduction of the GmWRI1b expression. Nevertheless, the three regulators each exhibited similar intensities of purifying selection to their respective duplicates since these pairs were formed by a WGD event that is proposed to have occurred approximately 13 million years ago (mya), suggesting that the differentiation in spatiotemporal expression between the duplicated genes is more likely to be the outcome of neutral variation in regulatory sequences. This study thus exemplifies the plasticity, dynamics, and novelty of regulatory networks mediated by WGD. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  16. Anterior colorectal duplication presenting as rectal prolapse.

    Science.gov (United States)

    Ramirez-Resendiz, Amador; Asz, Jose; Medina-Vega, F Antonio; Ortega-Salgado, J Arturo

    2007-09-01

    Duplications of the gastrointestinal (GI) tract are rare. Only 5% of them are rectal and there are very few reports of rectal prolapse (RP) caused by a duplication. An 11 month-old female presented with a RP caused by a blind-ended anterior tubular colorectal duplication. The duplication was successfully opened and connected to the normal rectum without complications. Although infrequent, a rectal duplication should be considered in the differential diagnosis of RP.

  17. External cystic rectal duplication: an unusual presentation of rectal duplication cyst.

    Science.gov (United States)

    Karaman, I; Karaman, A; Arda, N; Cakmak, O

    2007-11-01

    Duplications of gastrointestinal tract are rare anomalies, and rectal duplications account for five percent of the alimentary tract duplications. We present an unusual case of rectal duplication, which was located externally in a newborn female, and discuss the types of distal hindgut duplications.

  18. Concomitant urethral triplication, bladder, and colon duplication.

    Science.gov (United States)

    Tourchi, Ali; Kajbafzadeh, Abdol-Mohammad; Khakpour, Mahshid; Mohammadi Nejad, Payam; Mousavian, Amir-Abbas; Kalantary, Mahdi

    2012-02-01

    The concomitant presence of urethral triplication and caudal duplication is extremely rare with no previous reported cases. We report a case of urethral triplication associated with bladder, sigmoid, and rectum duplication. The patient was initially referred with a history of fecaluria and recurrent urinary tract infection. Physical examination revealed 2 meatal opening on the glans penis. Further investigation revealed three distinct urinary streams, two terminating on the glans penis, and one in the rectum in voiding cystourethrography and retrograde urethrography. Computed tomography demonstrated the bladder divided into two compartments by a complete sagittal septum. The patient was managed by the excision of the rectal ending urethra and removal of the bladder sagittal septum during which, two sigmoidal and rectal segments (the right one filled with fecal) were revealed. The right sigmoid and rectum was resected. The two ventral urethras were kept intact. The postoperative course was uneventful. At his 4 month readmission for colostomy closure, the patient reported good urethral voiding with no complication and recurrence of urinary tract infection and the colostomy was closed with no major complication.

  19. Radiological findings of male urethral duplication associated with bladder duplication: case report

    International Nuclear Information System (INIS)

    Kim, Hyoung Jung; Lim, Joo Won; Lee, Dong Ho; Ko, Young Tae

    2004-01-01

    Urethral duplication or accessory urethra is a rare congenital anomaly. Even rarer, is its association with bladder duplication. We report a case of urethral duplication associated with bladder duplication in a seven-year-old boy who underwent retrograde urethrography, sonography and magnetic resonance (MR) imaging. WhiIe retrograde urethrography can demonstrate the extent of the duplicated urethra, MR imaging and sonography can provide detailed information on the anatomy of the adjacent tissues as well as urethral duplication

  20. Evaluation of contrast in duplicated radiographs

    International Nuclear Information System (INIS)

    Thunthy, K.H.; Weinberg, R.

    1982-01-01

    This investigation evaluated changes in the contrast of duplicated radiographs made at different ultraviolet light exposures. Increasing ultraviolet light exposure had different effects on the duplicates of originals of different background densities. When correctly exposed, a duplicate radiograph enhanced contrast. When originals had the same contrast but different background densities, their duplicates did not have the same contrast. It was not possible to duplicate accurately all the different contrasts measured on an original. It was possible, however, to produce duplicates with all contrasts greater than those of the original

  1. Facial duplication: case, review, and embryogenesis.

    Science.gov (United States)

    Barr, M

    1982-04-01

    The craniofacial anatomy of an infant with facial duplication is described. There were four eyes, two noses, two maxillae, and one mandible. Anterior to the single pituitary the brain was duplicated and there was bilateral arhinencephaly. Portions of the brain were extruded into a large frontal encephalocele. Cases of symmetrical facial duplication reported in the literature range from two complete faces on a single head (diprosopus) to simple nasal duplication. The variety of patterns of duplication suggests that the doubling of facial components arises in several different ways: Forking of the notochord, duplication of the prosencephalon, duplication of the olfactory placodes, and duplication of maxillary and/or mandibular growth centers around the margins of the stomatodeal plate. Among reported cases, the female:male ratio is 2:1.

  2. Biliary tract duplication cyst with gastric heterotopia

    Energy Technology Data Exchange (ETDEWEB)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.

    1988-05-01

    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst.

  3. Biliary tract duplication cyst with gastric heterotopia

    International Nuclear Information System (INIS)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.

    1988-01-01

    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst. (orig.)

  4. Preliminary experiments of electronic duplication

    International Nuclear Information System (INIS)

    Fay, Bernard

    1974-01-01

    Systems of electron sputtering (at the unit scale) use as master mask a photocathode with localized emitting zones. Emitted electrons are accelerated and focussed on a silicon substrate covered with an electrosensitive resin. The very high definition associated with electron masking is obtained whatever the complexity of the master mask is, for a printing duration of the order of the minute. This is a duplication method without any contact that prevents the master mask from any mechanical erosion. Alignment of the successive masks is obtained from an electric signal directly usable through an automatic alignment system. Experiments using the apparatus for reproducing masks through an electronic image or ''electronic duplicator'' developed in Thomson-CSF Laboratory at Corbeville, are presented [fr

  5. Noncommunicating Isolated Enteric Duplication Cyst in the ...

    African Journals Online (AJOL)

    Noncommunicating isolated enteric duplications in the abdomen are an extremely rare variant of enteric duplications with their own blood supply. We report a case of a noncommunicating isolated ileal duplication in a 10-month-old boy. He was admitted because of severe abdominal distension and developed irritability ...

  6. “Clavicular duplication causing thoracic outlet obstruction”: Unique ...

    African Journals Online (AJOL)

    A 22‑year‑old female student reported with features of neurogenic thoracic outlet syndrome mainly involving C8‑T1 components of the brachial plexus, seemingly originating from involvement in costo‑clavicular space. Radiograph of the shoulder revealed clavicular duplication. Neuro‑physiological studies corroborated the ...

  7. Wide rectal duplication cyst in an adult resected by anterior approach: efficacy and recurrence.

    Science.gov (United States)

    Ceriotti, Michela; Saccomani, Giorgia; Lacelli, Francesca; Saccomani, Giovanni E

    2017-06-01

    Alimentary tract duplications are uncommon congenital abnormalities usually diagnosed and treated in childhood. Rectal involvement is extremely rare. We report the case of a 22-year-old female who presented with chronic abdominal and perianal pain; feeling of rectal fullness. Workup revealed a rectal duplication cyst. The patient underwent a complete transabdominal excision of the cyst: an hybrid laparoscopic and laparotomic technique was adopted. The hybrid isolated anterior abdominal approach is safe and feasible even for the treatment of wide rectal duplication cysts. Real recurrence in rectal duplication cysts is uncommon when the first operation was performed with radical intent.

  8. Urethral duplication with unusual cause of bladder outlet obstruction

    Directory of Open Access Journals (Sweden)

    Vivek Venkatramani

    2016-01-01

    Full Text Available A 12-year-old boy presented with poor flow and recurrent urinary tract infections following hypospadias repair at the age of 3 years. The evaluation revealed urethral duplication with a hypoplastic dorsal urethra and patent ventral urethra. He also had duplication of the bladder neck, and on voiding cystourethrogram the ventral bladder neck appeared hypoplastic and compressed by the dorsal bladder neck during voiding. The possibility of functional obstruction of the ventral urethra by the occluded dorsal urethra was suspected, and he underwent a successful urethro-urethrostomy.

  9. A survey of innovation through duplication in the reduced genomes of twelve parasites.

    Directory of Open Access Journals (Sweden)

    Jeremy D DeBarry

    Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that

  10. Rectal duplication cyst in an adult: the laparoscopic approach.

    Science.gov (United States)

    Salameh, Jihad R; Votanopoulos, Konstantinos I; Hilal, Raouf E; Essien, Francis A; Williams, Michael D; Barroso, Alberto O; Sweeney, John F; Brunicardi, F Charles

    2002-12-01

    Rectal duplication cyst (RDC) is a rare congenital anomaly representing 1% to 8% of all intestinal duplications. The case presented here is the first report of the laparoscopic resection of an RDC. We report the case of a 49-year-old white woman in whom a retrorectal cystic mass measuring 5 x 5.3 x 6 cm was diagnosed. The mass was completely resected by means of laparoscopic techniques. Pathologic findings revealed a cystic structure partially lined with squamous as well as respiratory- and gastrointestinal-type epithelium. Muscularis propria was identified in the outer portions of the wall of the specimen. No atypia or malignancy was identified. The overall findings were consistent with an RDC. Laparoscopic resection constitutes an excellent and patient-friendly approach to the management of large adult cystic duplication of the rectum.

  11. The sequence and analysis of duplication rich human chromosome 16

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-08-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  12. The Sequence and Analysis of Duplication Rich Human Chromosome 16

    Science.gov (United States)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-01-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  13. Diprosopus (partially duplicated head) associated with anencephaly: a case report.

    Science.gov (United States)

    al Muti Zaitoun, A; Chang, J; Booker, M

    1999-01-01

    Craniofacial duplication (diprosopus) is a rare form of conjoined twin. A 16 year old mother with a twin pregnancy delivered one normally formed baby boy and one diprosopus male. The malformed baby was 33 weeks of gestation with a single trunk, normal limbs and various degrees of facial duplication. Of the following structures there were two of each: noses, eyes, ears (and one dimple), mouths, tongues and, with bilateral central cleft lips and cleft palates. This was associated with holoprosencephaly and craniorachischisis. Internal organs showed no duplication. There were multiple congenital anomalies including diaphragmatic hernia, small lungs, two lobes of the right lung, ventricular septal defect, small adrenal gland and small left kidney with short ureter. The body also had a short neck, small chest cavities and kyphosis. X-ray revealed duplication of the vertebral column. The case presented here represents a type II of diprosopia of Rating (1933) and is the least common type reported. We also reviewed 22 recently reported cases of diprosopus. In addition to facial duplication, anencephaly, neural tube defect and cardiac malformations represent the more common congenital abnormalities associated with diprosopus. The pathogenesis of diprosopus is not well understood. Factors that play a role in diprosopus are probably similar to those factors (genetic, environmental and abnormal placental circulation) which affect monozoygotic twins as observed in this case report. Early ultrasonography diagnosis of diprosopus permits one to consider a vaginal therapeutic abortion.

  14. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa

    2010-01-01

    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  15. Narrow, duplicated internal auditory canal

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, T. [Servico de Neurorradiologia, Hospital Garcia de Orta, Avenida Torrado da Silva, 2801-951, Almada (Portugal); Shayestehfar, B. [Department of Radiology, UCLA Oliveview School of Medicine, Los Angeles, California (United States); Lufkin, R. [Department of Radiology, UCLA School of Medicine, Los Angeles, California (United States)

    2003-05-01

    A narrow internal auditory canal (IAC) constitutes a relative contraindication to cochlear implantation because it is associated with aplasia or hypoplasia of the vestibulocochlear nerve or its cochlear branch. We report an unusual case of a narrow, duplicated IAC, divided by a bony septum into a superior relatively large portion and an inferior stenotic portion, in which we could identify only the facial nerve. This case adds support to the association between a narrow IAC and aplasia or hypoplasia of the vestibulocochlear nerve. The normal facial nerve argues against the hypothesis that the narrow IAC is the result of a primary bony defect which inhibits the growth of the vestibulocochlear nerve. (orig.)

  16. Rectal duplication in an adult: unusual cause of a buttock mass. Report of a case.

    Science.gov (United States)

    Monek, O; Martin, L; Heyd, B; Mantion, G

    1999-06-01

    Duplications of the rectum are extremely rare embryologic events, with almost 70 cases reported in the world literature. We report on a 39-year-old female patient with a duplication of the rectum. Physical examination showed a left buttock mass; rectal examination revealed the presence of a painless mass compressing the rectum posterolaterally, confirmed by computerized tomography. The patient was operated on with a abdominal then a sacrococcygeal approach. After a complete excision, the postoperative course was unremarkable. Histology revealed a rectal duplication lined with heterotopic cylindric ciliated epithelium. This case shows that the diagnosis of rectal duplication is difficult and can be confused with other types of anorectal pathology. The presence of heterotopic ciliated epithelium has rarely been described. Complete excision of the duplication should be possible in most cases using a transcoccygeal, transanal, or abdominoperineal approach, depending on anatomic considerations.

  17. Cystic rectal duplication: a rare cause of neonatal intestinal obstruction.

    Science.gov (United States)

    Mboyo, A; Monek, O; Massicot, R; Martin, L; Destuynder, O; Lemouel, A; Aubert, D

    1997-07-01

    A case of cystic rectal duplication revealed on day 2 of life by a low intestinal occluding syndrome is reported. Radiologic imaging (ultrasonography, cystography, rectography) showed a large, retrorectal liquid formation in the pelvis and abdomen, with pelvic compression of the terminal alimentary canal and lower urinary tract. Magnetic resonance imaging demonstrated a liquid formation with clearly defined edges and no medullary involvement, thus ruling out the possibility of a previous meningeal hernia. Biological markers were within normal limits. On day 4, a 9 x 6-cm cystic rectal duplication was removed, followed by a temporary colostomy. Pathologic examination demonstrated typical rectal architecture with ciliated cells. Radiologic and clinical findings at 2-month follow-up were reassuring. This case report is exceptional for the following reasons: (1) As a rule, rectal duplications are relatively rare (70 cases reported in the literature); (2) The means of disclosing a neonatal rectal duplication is unusual (4 cases reported in the literature); (3) The volume of the malformation was considerable; and (4) Heterotopic ciliated epithelium was present.

  18. Penile duplication and two anal openings; report of a very rare case.

    Science.gov (United States)

    Bakheet, Mohamed Abdel Al M; Refaei, Mohammad

    2012-03-01

    Penile duplication (diphallus) is an extremely rare disorder. It is almost always associated with other malformations like double bladder, exstrophy of the cloacae, imperforate anus, duplication of the rectosigmoid and vertebral deformities. Meanwhile anal canal duplication, the most distal and least common duplication of the digestive tube and is a very rare congenital malformation. A 21 days old Egyptian neonate is reported with complete penile duplication and two scrotums with each one carrying two palpable testes. Both penises have normal shaft with normally located meatus. Clear urine voids from both meati spontaneously. The child had also a fold of redundant skin about 4×5 cm at the anal region in which two separate anal openings are present. In rectal examination we found two normal anuses passing stool spontaneously. Ascending (voiding) cystourethrography revealed two penises with two separate meatuses and one bladder from which the two urethras go out separately. Intravenous pyelogram (IVP) revealed two normal kidneys and ureters. Barium study revealed duplication of rectum and colon, otherwise normal GIT. In our review of the literature, we did not come across any other case of this variety of the penile duplication and congenital presence of two anuses. Unfortunately the patient expired before any surgical correction.

  19. Bilateral duplication of the internal auditory canal

    International Nuclear Information System (INIS)

    Weon, Young Cheol; Kim, Jae Hyoung; Choi, Sung Kyu; Koo, Ja-Won

    2007-01-01

    Duplication of the internal auditory canal is an extremely rare temporal bone anomaly that is believed to result from aplasia or hypoplasia of the vestibulocochlear nerve. We report bilateral duplication of the internal auditory canal in a 28-month-old boy with developmental delay and sensorineural hearing loss. (orig.)

  20. Social network analysis of duplicative prescriptions: One-month analysis of medical facilities in Japan.

    Science.gov (United States)

    Takahashi, Yoshimitsu; Ishizaki, Tatsuro; Nakayama, Takeo; Kawachi, Ichiro

    2016-03-01

    Duplicative prescriptions refer to situations in which patients receive medications for the same condition from two or more sources. Health officials in Japan have expressed concern about medical "waste" resulting from this practices. We sought to conduct descriptive analysis of duplicative prescriptions using social network analysis and to report their prevalence across ages. We analyzed a health insurance claims database including 1.24 million people from December 2012. Through social network analysis, we examined the duplicative prescription networks, representing each medical facility as nodes, and individual prescriptions for patients as edges. The prevalence of duplicative prescription for any drug class was strongly correlated with its frequency of prescription (r=0.90). Among patients aged 0-19, cough and colds drugs showed the highest prevalence of duplicative prescriptions (10.8%). Among people aged 65 and over, antihypertensive drugs had the highest frequency of prescriptions, but the prevalence of duplicative prescriptions was low (0.2-0.3%). Social network analysis revealed clusters of facilities connected via duplicative prescriptions, e.g., psychotropic drugs showed clustering due to a few patients receiving drugs from 10 or more facilities. Overall, the prevalence of duplicative prescriptions was quite low - less than 10% - although the extent of the problem varied by drug class and age group. Our approach illustrates the potential utility of using a social network approach to understand these practices. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  1. BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements.

    Science.gov (United States)

    De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan

    2015-12-01

    The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. BLSSpeller was written in Java. Source code and manual are available at http://bioinformatics.intec.ugent.be/blsspeller Klaas.Vandepoele@psb.vib-ugent.be or jan.fostier@intec.ugent.be. Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  2. Computational methods to dissect cis-regulatory transcriptional ...

    Indian Academy of Sciences (India)

    The formation of diverse cell types from an invariant set of genes is governed by biochemical and molecular processes that regulate gene activity. A complete understanding of the regulatory mechanisms of gene expression is the major function of genomics. Computational genomics is a rapidly emerging area for ...

  3. Patterns of cis regulatory variation in diverse human populations.

    Directory of Open Access Journals (Sweden)

    Barbara E Stranger

    Full Text Available The genetic basis of gene expression variation has long been studied with the aim to understand the landscape of regulatory variants, but also more recently to assist in the interpretation and elucidation of disease signals. To date, many studies have looked in specific tissues and population-based samples, but there has been limited assessment of the degree of inter-population variability in regulatory variation. We analyzed genome-wide gene expression in lymphoblastoid cell lines from a total of 726 individuals from 8 global populations from the HapMap3 project and correlated gene expression levels with HapMap3 SNPs located in cis to the genes. We describe the influence of ancestry on gene expression levels within and between these diverse human populations and uncover a non-negligible impact on global patterns of gene expression. We further dissect the specific functional pathways differentiated between populations. We also identify 5,691 expression quantitative trait loci (eQTLs after controlling for both non-genetic factors and population admixture and observe that half of the cis-eQTLs are replicated in one or more of the populations. We highlight patterns of eQTL-sharing between populations, which are partially determined by population genetic relatedness, and discover significant sharing of eQTL effects between Asians, European-admixed, and African subpopulations. Specifically, we observe that both the effect size and the direction of effect for eQTLs are highly conserved across populations. We observe an increasing proximity of eQTLs toward the transcription start site as sharing of eQTLs among populations increases, highlighting that variants close to TSS have stronger effects and therefore are more likely to be detected across a wider panel of populations. Together these results offer a unique picture and resource of the degree of differentiation among human populations in functional regulatory variation and provide an estimate for the transferability of complex trait variants across populations.

  4. Cis-regulatory timers for developmental gene expression.

    Directory of Open Access Journals (Sweden)

    Lionel Christiaen

    2013-10-01

    Full Text Available How does a fertilized egg decode its own genome to eventually develop into a mature animal? Each developing cell must activate a battery of genes in a timely manner and according to the function it will ultimately perform, but how? During development of the notochord--a structure akin to the vertebrate spine--in a simple marine invertebrate, an essential protein called Brachyury binds to specific sites in its target genes. A study just published in PLOS Biology reports that if the target gene contains multiple Brachyury-binding sites it will be activated early in development but if it contains only one site it will be activated later. Genes that contain no binding site can still be activated by Brachyury, but only indirectly by an earlier Brachyury-dependent gene product, so later than the directly activated genes. Thus, this study shows how several genes can interpret the presence of a single factor differently to become active at distinct times in development.

  5. Cis-regulatory RNA elements that regulate specialized ribosome activity.

    Science.gov (United States)

    Xue, Shifeng; Barna, Maria

    2015-01-01

    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  6. Clinical Fact of Rectal Duplication with gastric heterotopy | Atmani ...

    African Journals Online (AJOL)

    Enteric duplication could occur through the entire alimentary tract. A case of rectal duplication cyst with heterotopic gastric mucosa in a chid is described. MRI scan is shown useful in the diagnosis of the duplication. The treatment is the complete local resection of the rectal duplication. Keywords: duplication, rectal, MRI, ...

  7. The duplicated genes database: identification and functional annotation of co-localised duplicated genes across genomes.

    Directory of Open Access Journals (Sweden)

    Marion Ouedraogo

    Full Text Available BACKGROUND: There has been a surge in studies linking genome structure and gene expression, with special focus on duplicated genes. Although initially duplicated from the same sequence, duplicated genes can diverge strongly over evolution and take on different functions or regulated expression. However, information on the function and expression of duplicated genes remains sparse. Identifying groups of duplicated genes in different genomes and characterizing their expression and function would therefore be of great interest to the research community. The 'Duplicated Genes Database' (DGD was developed for this purpose. METHODOLOGY: Nine species were included in the DGD. For each species, BLAST analyses were conducted on peptide sequences corresponding to the genes mapped on a same chromosome. Groups of duplicated genes were defined based on these pairwise BLAST comparisons and the genomic location of the genes. For each group, Pearson correlations between gene expression data and semantic similarities between functional GO annotations were also computed when the relevant information was available. CONCLUSIONS: The Duplicated Gene Database provides a list of co-localised and duplicated genes for several species with the available gene co-expression level and semantic similarity value of functional annotation. Adding these data to the groups of duplicated genes provides biological information that can prove useful to gene expression analyses. The Duplicated Gene Database can be freely accessed through the DGD website at http://dgd.genouest.org.

  8. Duplication of the pituitary gland in a newborn with median cleft face syndrome and nasal teratoma

    Energy Technology Data Exchange (ETDEWEB)

    Hamon-Kerautret, M.; Ares, G.S.; Demondion, X.; Pruvo, J.P. [Service de Neuroradiologie, Hopital Roger Salengro, CHRU Lille (France); Rouland, V. [Service de Neonatologie, Hopital Roger Salengro, CHRU Lille (France); Francke, J.P. [Departement d`Anatomie, Faculte de Medicine, Universite de Lille (France)

    1998-05-01

    A newborn suffered immediate neonatal respiratory distress because of an obstructive, soft-tissue nasal mass. Clinical examination revealed a cleft palate with a protruding polypoid mass. CT and MRI showed a heterogeneous nasopharyngeal mass and associated intracranial abnormalities - duplication of the hypophysis and hypoplasia of the corpus callosum. Duplication of the hypophysis is a very rare malformation, only 13 cases having been previously described. The suggested pathogenesis is duplication of the prechordal plate and anterior end of the notochord during early embryological development. (orig.) With 2 figs., 3 refs.

  9. Duplication of the pituitary gland in a newborn with median cleft face syndrome and nasal teratoma

    International Nuclear Information System (INIS)

    Hamon-Kerautret, M.; Ares, G.S.; Demondion, X.; Pruvo, J.P.; Rouland, V.; Francke, J.P.

    1998-01-01

    A newborn suffered immediate neonatal respiratory distress because of an obstructive, soft-tissue nasal mass. Clinical examination revealed a cleft palate with a protruding polypoid mass. CT and MRI showed a heterogeneous nasopharyngeal mass and associated intracranial abnormalities - duplication of the hypophysis and hypoplasia of the corpus callosum. Duplication of the hypophysis is a very rare malformation, only 13 cases having been previously described. The suggested pathogenesis is duplication of the prechordal plate and anterior end of the notochord during early embryological development. (orig.)

  10. Molecular cytogenetic characterization and origin of two de novo duplication 9p cases.

    Science.gov (United States)

    Tsezou, A; Kitsiou, S; Galla, A; Petersen, M B; Karadima, G; Syrrou, M; Sahlèn, S; Blennow, E

    2000-03-13

    We report on two additional cases with duplication of 9p, minor with facial anomalies and developmental delay. Using fluorescence in situ hybridization and single-copy probes, we showed that the first case was a direct duplication, whereas the second case was inverted. The extent of the direct duplication was defined as 9p12 --> p24 by microdissection and microcloning of the aberrant chromosome and subsequent chromosome-specific comparative genomic hybridization. DNA polymorphism analysis with eight microsatellite markers revealed that the origin of the dup(9p) was maternal in the first case, whereas it was paternal in the second. Copyright 2000 Wiley-Liss, Inc.

  11. Duplicate Record Elimination in Large Data Files.

    Science.gov (United States)

    1981-08-01

    UNCLASSIFIJED CSTR -445 NL LmEE~hhE - I1.0 . 111112----5 1.~4 __112 ___IL25_ 1.4 111111.6 EI24 COMPUTER SCIENCES DEPARTMENT oUniversity of Wisconsin...we propose a combinatorial model for the use in the analysis of algorithms for duplicate elimination. We contend that this model can serve as a...duplicates in a multiset of records, knowing the size of the multiset and the number of distinct records in it. 3. Algorithms for Duplicate Elimination

  12. The prevalence of gene duplications and their ancient origin in Rhodobacter sphaeroides 2.4.1

    Directory of Open Access Journals (Sweden)

    Cho Hyuk

    2010-12-01

    Full Text Available Abstract Background Rhodobacter sphaeroides 2.4.1 is a metabolically versatile organism that belongs to α-3 subdivision of Proteobacteria. The present study was to identify the extent, history, and role of gene duplications in R. sphaeroides 2.4.1, an organism that possesses two chromosomes. Results A protein similarity search (BLASTP identified 1247 orfs (~29.4% of the total protein coding orfs that are present in 2 or more copies, 37.5% (234 gene-pairs of which exist in duplicate copies. The distribution of the duplicate gene-pairs in all Clusters of Orthologous Groups (COGs differed significantly when compared to the COG distribution across the whole genome. Location plots revealed clusters of gene duplications that possessed the same COG classification. Phylogenetic analyses were performed to determine a tree topology predicting either a Type-A or Type-B phylogenetic relationship. A Type-A phylogenetic relationship shows that a copy of the protein-pair matches more with an ortholog from a species closely related to R. sphaeroides while a Type-B relationship predicts the highest match between both copies of the R. sphaeroides protein-pair. The results revealed that ~77% of the proteins exhibited a Type-A phylogenetic relationship demonstrating the ancient origin of these gene duplications. Additional analyses on three other strains of R. sphaeroides revealed varying levels of gene loss and retention in these strains. Also, analyses on common gene pairs among the four strains revealed that these genes experience similar functional constraints and undergo purifying selection. Conclusions Although the results suggest that the level of gene duplication in organisms with complex genome structuring (more than one chromosome seems to be not markedly different from that in organisms with only a single chromosome, these duplications may have aided in genome reorganization in this group of eubacteria prior to the formation of R. sphaeroides as gene

  13. Partial Duplication of Chromosome 8p

    African Journals Online (AJOL)

    rme

    The partial chromosome 8p duplication is a rare syndrome and is ... abnormality of maternal origin that ... second trimester by vaginal bleeding and ... echocardiography, brain CT scan and. MRI. Fig. 1:Conventional karyotype of case 3 showing.

  14. Case Report Duplication Of Gastrointestinal Tract

    African Journals Online (AJOL)

    duplication (Fig 3). A tragic event occurred intra-operatively when ... Brain damage persisted and all modalities of treatment were terminated upon confirmation of brain death. ... compression, epithelial recanalization, and vascular accidents (6) ...

  15. Genetics Home Reference: 17q12 duplication

    Science.gov (United States)

    ... J, Li C, Roeder E, Cox S, Karaviti L, Pearson M, Kang SH, Sahoo T, Lalani SR, Stankiewicz ... genomic disorders from the duplication architecture of the human genome. Nat Genet. 2006 Sep;38(9):1038- ...

  16. Rectal duplication cyst in a cat.

    Science.gov (United States)

    Kook, Peter H; Hagen, Regine; Willi, Barbara; Ruetten, Maja; Venzin, Claudio

    2010-12-01

    Enteric duplication is a rare developmental malformation in people, dogs and cats. The purpose of the present report is to describe the first case of a rectal duplication cyst in a 7-year-old domestic shorthair cat presenting for acute constipation and tenesmus. On rectal palpation a spherical mass compressing the lumen of the rectum could be felt in the dorsal wall of the rectum. A computed tomography (CT) scan confirmed the presence of a well demarcated cystic lesion in the pelvic canal, dorsal to the rectum. The cyst was surgically removed via a perineal approach. No communication with the rectal lumen could be demonstrated. Histopathological examination was consistent with a rectal duplication cyst. Clinical signs resolved completely after excision of this conjoined non-communicating cystic rectal duplicate. Copyright © 2010 ISFM and AAFP. Published by Elsevier Ltd. All rights reserved.

  17. [Rectal duplication cyst--case report].

    Science.gov (United States)

    Turyna, R; Horák, L; Kucera, E; Hejda, V; Krofta, L; Feyereisl, J

    2009-06-01

    The authors demonstrate a rare case of duplication anomaly of the rectum. Case report. Institute for the Care of Mother and Child, Prague. We present a rare case of cystic rectal duplication in adult, completely removed and histologically confirmed. A literature review was summarized. The case was complicated by delay in diagnosis, multiple operations, and by the association with endometriosis, as well. Mentioned anomaly is published in the Czech literature for the very first time.

  18. Williams Syndrome and 15q Duplication: Coincidence versus Association.

    Science.gov (United States)

    Khokhar, Aditi; Agarwal, Swashti; Perez-Colon, Sheila

    2017-01-01

    Williams syndrome is a multisystem disorder caused by contiguous gene deletion in 7q11.23, commonly associated with distinctive facial features, supravalvular aortic stenosis, short stature, idiopathic hypercalcemia, developmental delay, joint laxity, and a friendly personality. The clinical features of 15q11q13 duplication syndrome include autism, mental retardation, ataxia, seizures, developmental delay, and behavioral problems. We report a rare case of a girl with genetically confirmed Williams syndrome and coexisting 15q duplication syndrome. The patient underwent treatment for central precocious puberty and later presented with primary amenorrhea. The karyotype revealed 47,XX,+mar. FISH analysis for the marker chromosome showed partial trisomy/tetrasomy for proximal chromosome 15q (15p13q13). FISH using an ELN -specific probe demonstrated a deletion in the Williams syndrome critical region in 7q11.23. To our knowledge, a coexistence of Williams syndrome and 15q duplication syndrome has not been reported in the literature. Our patient had early pubertal development, which has been described in some patients with Williams syndrome. However, years later after discontinuing gonadotropin-releasing hormone analogue treatment, she developed primary amenorrhea.

  19. A conserved segmental duplication within ELA.

    Science.gov (United States)

    Brinkmeyer-Langford, C L; Murphy, W J; Childers, C P; Skow, L C

    2010-12-01

    The assembled genomic sequence of the horse major histocompatibility complex (MHC) (equine lymphocyte antigen, ELA) is very similar to the homologous human HLA, with the notable exception of a large segmental duplication at the boundary of ELA class I and class III that is absent in HLA. The segmental duplication consists of a ∼ 710 kb region of at least 11 repeated blocks: 10 blocks each contain an MHC class I-like sequence and the helicase domain portion of a BAT1-like sequence, and the remaining unit contains the full-length BAT1 gene. Similar genomic features were found in other Perissodactyls, indicating an ancient origin, which is consistent with phylogenetic analyses. Reverse-transcriptase PCR (RT-PCR) of mRNA from peripheral white blood cells of healthy and chronically or acutely infected horses detected transcription from predicted open reading frames in several of the duplicated blocks. This duplication is not present in the sequenced MHCs of most other mammals, although a similar feature at the same relative position is present in the feline MHC (FLA). Striking sequence conservation throughout Perissodactyl evolution is consistent with a functional role for at least some of the genes included within this segmental duplication. © 2010 The Authors, Journal compilation © 2010 Stichting International Foundation for Animal Genetics.

  20. BILATERAL DUPLICATION OF RENAL ARTERIES

    OpenAIRE

    Prajkta A Thete; Mehera Bhoir; M.V.Ambiye

    2014-01-01

    Routine dissection of a male cadaver revealed the presence of bilateral double renal arteries. On the right side the accessory renal artery originated from the abdominal aorta just above the main renal artery. On the left side the accessory renal artery originated from the abdominal aorta about 1 cm above the main renal artery. Knowledge of the variations of renal vascular anatomy has importance in exploration and treatment of renal trauma, renal transplantation, renal artery embolization, su...

  1. Duplication of Key Frames of Video Streams in Wireless Networks

    OpenAIRE

    Sagatov, Evgeny S.; Sukhov, Andrei M.

    2011-01-01

    In this paper technological solutions for improving the quality of video transfer along wireless networks are investigated. Tools have been developed to allow packets to be duplicated with key frames data. In the paper we tested video streams with duplication of all frames, with duplication of key frames, and without duplication. The experiments showed that the best results are obtained by duplication of packages which contain key frames. The paper also provides an overview of the coefficient...

  2. [Intestinal volvulus due to yeyunal duplication].

    Science.gov (United States)

    Rodríguez Iglesias, P; Carazo Palacios, M E; Lluna González, J; Ibáñez Pradas, V; Rodríguez Caraballo, L

    2014-10-01

    Duplications of the alimentary tract are congenital malformations. The ileum is the most commonly affected organ. A lot of duplications are incidentally diagnosed but most of patients present a combination of pain or complications such as obstructive symptoms, intestinal intussusception, perforation or volvulus. We report the case of a 6-years-old girl, with intermittent abdominal pain and vomits for two months long. Laboratory work was completely normal and in the radiology analysis (abdominal sonography and magnetic resonance) a cystic image with intestinal volvulus was observed. The patient underwent laparotomy, Ladd's procedure was done and the cyst was resected. In conclusion, if a patient is admitted with abdominal pain and obstructive symptoms, it is important to consider duplication of the alimentary tract as a possible diagnosis.

  3. Esophageal carcinoma originating in a duplication cyst: case report

    Directory of Open Access Journals (Sweden)

    Pimenta Amadeu P. A.

    1997-01-01

    Full Text Available The authors present the case report of a 61-year-old man, admitted with middle third squamous cell esophageal carcinoma. He was submitted to a curative gastroesophageal resection via a medium laparotomy and a right thoracotomy. An intrathoracic esophagogastric anastomosis was performed. The pathological analysis of the surgical specimen revealed a squamous cell carcinoma clearly originating from the epithelial lining of an esophageal duplication cyst. Immunohistochemitry showed p 53 staining of the tumor cells. The patient at 11 month follow up was asymptomatic.

  4. Prevalence of lower extremity venous duplication

    Directory of Open Access Journals (Sweden)

    Simpson William

    2010-01-01

    Full Text Available Purpose: This retrospective study was performed to determine the prevalence of lower extremity venous duplication using duplex ultrasound in the patient population of a large urban medical center. Materials and Methods: The reports of all lower extremity venous ultrasound examinations performed at our institution between January 1, 2002 and December 31, 2002 were reviewed. Ultrasound examinations that were performed for purposes other than the detection of lower extremity deep vein thrombosis were excluded. The prevalence of duplication and its specific location were recorded. In addition, the prevalence of thrombus and its specific location were also recorded. Results: A total of 3118 exams were performed in 2664 patients. Of the 2664 patients, 2311 had only one examination performed during the study period; 353 patients had more than one examination performed. We found that 10.1% of patients (270/2664 had at least one venous segment duplicated and 5.4% of patients (143/2664 had a thrombus in at least one venous segment. There was a statistically significant difference in the prevalence of both duplication and thrombus with a change in venous segment. Only 0.4% of patients (11/2664 had thrombus within a duplicated segment. Of those who had more than one examination performed, 15.3% (54/353 had the same venous segment(s seen on one examination but not another. Conclusion: Lower extremity venous duplication is a frequent anatomic variant that is seen in 10.1% of patients, but it may not be as common as is generally believed. It can result in a false negative result for deep vein thrombosis.

  5. A salmonid EST genomic study: genes, duplications, phylogeny and microarrays

    Directory of Open Access Journals (Sweden)

    Brahmbhatt Sonal

    2008-11-01

    Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is

  6. Restriction and Recruitment—Gene Duplication and the Origin and Evolution of Snake Venom Toxins

    Science.gov (United States)

    Hargreaves, Adam D.; Swain, Martin T.; Hegarty, Matthew J.; Logan, Darren W.; Mulley, John F.

    2014-01-01

    Snake venom has been hypothesized to have originated and diversified through a process that involves duplication of genes encoding body proteins with subsequent recruitment of the copy to the venom gland, where natural selection acts to develop or increase toxicity. However, gene duplication is known to be a rare event in vertebrate genomes, and the recruitment of duplicated genes to a novel expression domain (neofunctionalization) is an even rarer process that requires the evolution of novel combinations of transcription factor binding sites in upstream regulatory regions. Therefore, although this hypothesis concerning the evolution of snake venom is very unlikely and should be regarded with caution, it is nonetheless often assumed to be established fact, hindering research into the true origins of snake venom toxins. To critically evaluate this hypothesis, we have generated transcriptomic data for body tissues and salivary and venom glands from five species of venomous and nonvenomous reptiles. Our comparative transcriptomic analysis of these data reveals that snake venom does not evolve through the hypothesized process of duplication and recruitment of genes encoding body proteins. Indeed, our results show that many proposed venom toxins are in fact expressed in a wide variety of body tissues, including the salivary gland of nonvenomous reptiles and that these genes have therefore been restricted to the venom gland following duplication, not recruited. Thus, snake venom evolves through the duplication and subfunctionalization of genes encoding existing salivary proteins. These results highlight the danger of the elegant and intuitive “just-so story” in evolutionary biology. PMID:25079342

  7. Incidence of Data Duplications in a Randomly Selected Pool of Life Science Publications.

    Science.gov (United States)

    Oksvold, Morten P

    2016-04-01

    Since the solution to many public health problems depends on research, it is critical for the progress and well-being for the patients that we can trust the scientific literature. Misconduct and poor laboratory practice in science threatens the scientific progress, leads to loss of productivity and increased healthcare costs, and endangers lives of patients. Data duplication may represent one of challenges related to these problems. In order to estimate the frequency of data duplication in life science literature, a systematic screen through 120 original scientific articles published in three different cancer related journals [journal impact factor (IF) 20] was completed. The study revealed a surprisingly high proportion of articles containing data duplication. For the IF 20 journals, 25% of the articles were found to contain data duplications. The IF 5-10 journal showed a comparable proportion (22.5%). The proportion of articles containing duplicated data was comparable between the three journals and no significant correlation to journal IF was found. The editorial offices representing the journals included in this study and the individual authors of the detected articles were contacted to clarify the individual cases. The editorial offices did not reply and only 1 out of 29 cases were apparently clarified by the authors, although no supporting data was supplied. This study questions the reliability of life science literature, it illustrates that data duplications are widespread and independent of journal impact factor and call for a reform of the current peer review and retraction process of scientific publishing.

  8. Reducing and Sustaining Duplicate Medical Record Creation by Usability Testing and System Redesign.

    Science.gov (United States)

    Khunlertkit, Adjhaporn; Dorissaint, Leonard; Chen, Allen; Paine, Lori; Pronovost, Peter J

    2017-10-25

    Duplicate medical record creation is a common and consequential health care systems error often caused by poor search system usability and inappropriate user training. We conducted two phases of scenario-based usability testing with patient registrars working in areas at risk of generating duplicate medical records. Phase 1 evaluated the existing search system, which led to system redesigns. Phase 2 tested the redesigned system to mitigate potential errors before health system-wide implementation. To evaluate system effectiveness, we compared the monthly potential duplicate medical record rates for preimplementation and postimplementation months. The existing system could not effectively handle a misspelling, which led to failed search and duplicate medical record creation. Using the existing system, 96% of registrars found commonly spelled patient names whereas only 69% successfully found complicated names. Registrars lacked knowledge and usage of a phonetic matching function to assist in misspelling. The new system consistently captured the correct patient regardless of misspelling, but search returned more potential matches, resulting in, on average, 4 seconds longer to select common names. Potential monthly duplicate medical record rate reduced by 38%, from 4% to 2.3% after implementation of the new system, and has sustained at an average of 2.5% for 2 years. Usability testing was an effective method to reveal problems and aid system redesign to deliver a more user friendly system, hence reducing the potential for medical record duplication. Greater standards for usability would ensure that these improvements can be realized before rather than after exposing patients to risks.

  9. Translocations used to generate chromosome segment duplications ...

    Indian Academy of Sciences (India)

    a duplication (Dp) of the translocated segment and four inviable (white, W) ascospores with .... of this work, namely, the definition of breakpoint junction sequences of 12 ..... then our results would place supercontig 10.9 in distal. LG VIR. A third ...

  10. Incomplete urethral duplication in an adult male.

    LENUS (Irish Health Repository)

    Davis, N F

    2012-09-01

    Urethral duplication is a rare congenital anomaly with less than 200 cases reported. It predominantly occurs in males and is nearly always diagnosed in childhood or adolescence. It is defined as a complete second passage from the bladder to the dorsum of the penis or as an accessory pathway that ends blindly on the dorsal or ventral surface.

  11. 20 CFR 410.705 - Duplicate claims.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Duplicate claims. 410.705 Section 410.705 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL COAL MINE HEALTH AND SAFETY ACT OF 1969, TITLE IV-BLACK LUNG BENEFITS (1969- ) Rules for the Review of Denied and Pending Claims Under the Black Lung...

  12. Bladder exstrophy associated with complete urethral duplication ...

    African Journals Online (AJOL)

    J.E. Mensah

    ees.elsevier.com/afju · www.sciencedirect.com. Case report. Bladder exstrophy associated with complete urethral duplication: Bladder can be augmented with dorsal urethral mucosa. J.E. Mensaha,∗. , K.N. Ampadua, M.Y. Kyeia, B. Edusieb.

  13. Our experience with unusual gastrointestinal tract duplications in infants

    Directory of Open Access Journals (Sweden)

    Bilal Mirza

    2014-01-01

    Full Text Available Background: Classical duplications may present along any part of gastrointestinal tract (GIT from mouth to anus. Atypical or unusual rare varieties of GIT duplications may also occur, but with different anatomical features. Materials and Methods: We reviewed our 5-year record (February 2008-January 2013 to describe clinical profile of unusual GIT duplications in neonates and small infants. Results: Three patients with atypical variety of GIT duplications were managed in our department during this tenure. Two were females and one male. Age was ranged between 11 days and 2 months. All patients presented with massive abdominal distension causing respiratory embarrassment in two of them. In all patients, the pre-operative differential diagnoses also included GIT duplication cysts. Computerized tomography (CT scan showed single huge cyst in one and multiple cysts in two patients. In one patient the CT scan also depicted a thoracic cyst in relation to posterior mediastinum. At operation, one patient had colonic tubular duplication cyst along with another isolated duplication cyst, the second case had a tubular duplication cyst of ileum with its segmental dilatation, and in the third case two isolated duplications were found. Duplication cysts were excised along with mucosal stripping in one patient, cyst excision and intestinal resection and anastomosis in one patient, and only cysts excision in one. All patients did well post-operatively. Conclusion: We presented unusual GIT duplications. These duplications are managed on similar lines as classical duplications with good prognosis when dealt early.

  14. Presentation and Surgical Management of Duodenal Duplication in Adults

    Directory of Open Access Journals (Sweden)

    Caroline C. Jadlowiec

    2015-01-01

    Full Text Available Duodenal duplications in adults are exceedingly rare and their diagnosis remains difficult as symptoms are largely nonspecific. Clinical presentations include pancreatitis, biliary obstruction, gastrointestinal bleeding from ectopic gastric mucosa, and malignancy. A case of duodenal duplication in a 59-year-old female is presented, and her treatment course is reviewed with description of combined surgical and endoscopic approach to repair, along with a review of historic and current recommendations for management. Traditionally, gastrointestinal duplications have been treated with surgical resection; however, for duodenal duplications, the anatomic proximity to the biliopancreatic ampulla makes surgical management challenging. Recently, advances in endoscopy have improved the clinical success of cystic intraluminal duodenal duplications. Despite these advances, surgical resection is still recommended for extraluminal tubular duplications although combined techniques may be necessary for long tubular duplications. For duodenal duplications, a combined approach of partial excision combined with mucosal stripping may offer advantage.

  15. Duplication of the Left Vertebral Artery Origin: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Sang Wook; Park, Dong Woo; Park, Choong Ki; Lee, Young Jun [Dept. of Radiology, College of Medicine, Hanyang University, Hanyang University Guri Hospital, Guri (Korea, Republic of)

    2013-01-15

    Duplication of vertebral arteries is a very rare but clinically important condition. A duplicated vertebral artery origin can influence hemodynamics, pathogenesis of vascular lesions and treatment options. In cases of vertebral artery duplication, the vertebral arteries generally enter the transverse foramen higher up than normal. Awareness of these vertebral artery variants before procedures, such as neurointervention or surgery, may be beneficial. Here, we describe a case of a 51-year-old female patient with left vertebral artery duplication which was detected incidentally.

  16. Duplication of the Left Vertebral Artery Origin: A Case Report

    International Nuclear Information System (INIS)

    Shin, Sang Wook; Park, Dong Woo; Park, Choong Ki; Lee, Young Jun

    2013-01-01

    Duplication of vertebral arteries is a very rare but clinically important condition. A duplicated vertebral artery origin can influence hemodynamics, pathogenesis of vascular lesions and treatment options. In cases of vertebral artery duplication, the vertebral arteries generally enter the transverse foramen higher up than normal. Awareness of these vertebral artery variants before procedures, such as neurointervention or surgery, may be beneficial. Here, we describe a case of a 51-year-old female patient with left vertebral artery duplication which was detected incidentally.

  17. Review of the embryologic development of the pituitary gland and report of a case of hypophyseal duplication detected by MRI

    Energy Technology Data Exchange (ETDEWEB)

    Kollias, S.S. [Dept. of Radiology, Section of Pediatric Neuroradiology, and Depts. of Radiology and Pediatrics, Children`s Hospital Medical Center, Cincinnati, OH (United States); Ball, W.S. [Dept. of Radiology, Section of Pediatric Neuroradiology, and Depts. of Radiology and Pediatrics, Children`s Hospital Medical Center, Cincinnati, OH (United States); Prenger, E.C. [Dept. of Radiology, Section of Pediatric Neuroradiology, and Depts. of Radiology and Pediatrics, Children`s Hospital Medical Center, Cincinnati, OH (United States)

    1995-01-01

    We describe the clinical manifestations, associated abnormalities, MRI appearances and pathologic significance of a case of hypophyseal duplication. A 16-year-old girl presented with delayed sexual development and history of midline craniofacial anomalies. MRI revealed paired infundibula extending inferiorly to two small pituitary glands, a midline hypothalamic mass, and a midline cleft in the basisphenoid. Twelve cases of pituitary duplication have previously been described. The suggested pathogenesis is duplication of the prechordal plate and anterior end of the notochord during early embryologic development. (orig.)

  18. Cosmic abundances: The impact of stellar duplicity

    OpenAIRE

    Jorissen, A.; Van Eck, S.

    2004-01-01

    The mass-transfer scenario links chemical peculiarities with stellar duplicity for an increasing number of stellar classes (classical and dwarf barium stars, subgiant and giant CH stars, S stars without technetium, yellow symbiotic stars, WIRRING stars, Abell-35-like nuclei of planetary nebulae...). Despite these successes, the mass-transfer scenario still faces several problems: What is the mass-transfer mode? Why orbital elements of dwarf barium stars do not fully match those of the classic...

  19. Identifying Tracks Duplicates via Neural Network

    CERN Document Server

    Sunjerga, Antonio; CERN. Geneva. EP Department

    2017-01-01

    The goal of the project is to study feasibility of state of the art machine learning techniques in track reconstruction. Machine learning techniques provide promising ways to speed up the pattern recognition of tracks by adding more intelligence in the algorithms. Implementation of neural network to process of track duplicates identifying will be discussed. Different approaches are shown and results are compared to method that is currently in use.

  20. Anterior rectal duplication: a diagnostic challenge.

    Science.gov (United States)

    Amjadi, K; Poenaru, D; Soboleski, D; Hurlbut, D; Kamal, I

    2000-04-01

    The authors present an anterior rectal cyst in a 14-month-old girl. This rare variant of rectal duplications presented with recurrent urinary infections. The diagnosis was challenging in view of the multiple differential diagnoses to be considered. Magnetic resonance imaging appeared to be the most accurate preoperative investigation. The cyst was removed uneventfully by partial excision and mucosal ablation. An awareness of this variant can lead to early diagnosis and curative resection.

  1. Single quadrature duplication and transparent taps

    International Nuclear Information System (INIS)

    Kim, Ajung

    2004-01-01

    The concept of single quadrature duplication, which is the process of producing two outputs with the same homodyne detecting statistics as an input, is addressed. This device has important potential application to optical communications as a transparent optical tap in a local area network environment. The characteristics of the device are examined, and a realization scheme employing a coupler and phase-sensitive amplifiers is proposed

  2. Duplication of the pituitary gland - plus syndrome

    International Nuclear Information System (INIS)

    Sen, Debraj; Arora, Vijinder

    2016-01-01

    Duplication of the pituitary gland (DPG) is a very rare developmental anomaly that is often associated with other anomalies – the DPG-plus syndrome and occurs due to splitting of the rostral notochord and prechordal plate during blastogenesis. DPG with the constellation of associated anomalies as in our patient has not been reported previously. This article illustrates the importance of imaging the brain in all patients with obvious midline facial anomalies and the complementary role of MRI and CT in such cases

  3. Comparing genomes with rearrangements and segmental duplications.

    Science.gov (United States)

    Shao, Mingfu; Moret, Bernard M E

    2015-06-15

    Large-scale evolutionary events such as genomic rearrange.ments and segmental duplications form an important part of the evolution of genomes and are widely studied from both biological and computational perspectives. A basic computational problem is to infer these events in the evolutionary history for given modern genomes, a task for which many algorithms have been proposed under various constraints. Algorithms that can handle both rearrangements and content-modifying events such as duplications and losses remain few and limited in their applicability. We study the comparison of two genomes under a model including general rearrangements (through double-cut-and-join) and segmental duplications. We formulate the comparison as an optimization problem and describe an exact algorithm to solve it by using an integer linear program. We also devise a sufficient condition and an efficient algorithm to identify optimal substructures, which can simplify the problem while preserving optimality. Using the optimal substructures with the integer linear program (ILP) formulation yields a practical and exact algorithm to solve the problem. We then apply our algorithm to assign in-paralogs and orthologs (a necessary step in handling duplications) and compare its performance with that of the state-of-the-art method MSOAR, using both simulations and real data. On simulated datasets, our method outperforms MSOAR by a significant margin, and on five well-annotated species, MSOAR achieves high accuracy, yet our method performs slightly better on each of the 10 pairwise comparisons. http://lcbb.epfl.ch/softwares/coser. © The Author 2015. Published by Oxford University Press.

  4. Exon duplications in the ATP7A gene

    DEFF Research Database (Denmark)

    Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko

    2011-01-01

    the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...

  5. Finding all sorting tandem duplication random loss operations

    DEFF Research Database (Denmark)

    Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang

    2011-01-01

    A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...

  6. Origin of the duplicated regions in the yeast genomes

    DEFF Research Database (Denmark)

    Piskur, Jure

    2001-01-01

    The genome of Saccharomyces cerevisiae contains several duplicated regions. The recent sequencing results of several yeast species suggest that the duplicated regions found in the modern Saccharomyces species are probably the result of a single gross duplication, as well as a series of sporadic...

  7. Effect of Duplicate Genes on Mouse Genetic Robustness: An Update

    Directory of Open Access Journals (Sweden)

    Zhixi Su

    2014-01-01

    Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.

  8. An ace-1 gene duplication resorbs the fitness cost associated with resistance in Anopheles gambiae, the main malaria mosquito.

    Science.gov (United States)

    Assogba, Benoît S; Djogbénou, Luc S; Milesi, Pascal; Berthomieu, Arnaud; Perez, Julie; Ayala, Diego; Chandre, Fabrice; Makoutodé, Michel; Labbé, Pierrick; Weill, Mylène

    2015-10-05

    Widespread resistance to pyrethroids threatens malaria control in Africa. Consequently, several countries switched to carbamates and organophophates insecticides for indoor residual spraying. However, a mutation in the ace-1 gene conferring resistance to these compounds (ace-1(R) allele), is already present. Furthermore, a duplicated allele (ace-1(D)) recently appeared; characterizing its selective advantage is mandatory to evaluate the threat. Our data revealed that a unique duplication event, pairing a susceptible and a resistant copy of the ace-1 gene spread through West Africa. Further investigations revealed that, while ace-1(D) confers less resistance than ace-1(R), the high fitness cost associated with ace-1(R) is almost completely suppressed by the duplication for all traits studied. ace-1 duplication thus represents a permanent heterozygote phenotype, selected, and thus spreading, due to the mosaic nature of mosquito control. It provides malaria mosquito with a new evolutionary path that could hamper resistance management.

  9. Partial facial duplication (diprosopus) in a goat kid.

    Science.gov (United States)

    Mukaratirwa, S; Sayi, S T

    2006-03-01

    The anatomical and clinical features of a live-born diprosopic goat kid are described. The kid had two faces with two eyes each, two complete oral cavities and nostrils and two ears. Caudal to the neck, the kid grossly appeared normal. Both mouths of the kid showed synchronous suckling motions. Elevated respiratory and heart rates were recorded and the temperature was subnormal. Radiological examination showed a single trunk and vertebral column, normal limbs, two sets of jaws, three orbits, and contrast radiography revealed a single patent oesophagus. There was maxillary and mandibular duplication resulting in two faces. There was a cleft palate. The oropharyngeal regions of each face merged to form a single laryngopharynx and oesophagus. There was a single brain with hypoplasia of the cerebellum. The left and right cerebral hemispheres were fused rostrally, and there was duplication of the optic chiasma and the pituitary gland. The olfactory tract was absent and the superficial origins of most of the cranial nerves were not discernible.

  10. Partial facial duplication (diprosopus in a goat kid : clinical communication

    Directory of Open Access Journals (Sweden)

    S. Mukaratirwa

    2006-06-01

    Full Text Available The anatomical and clinical features of a live-born diprosopic goat kid are described. The kid had two faces with two eyes each, two complete oral cavities and nostrils and two ears. Caudal to the neck, the kid grossly appeared normal. Both mouths of the kid showed synchronous suckling motions. Elevated respiratory and heart rates were recorded and the temperature was subnormal. Radiological examination showed a single trunk and vertebral column, normal limbs, two sets of jaws, three orbits, and contrast radiography revealed a single patent oesophagus. There was maxillary and mandibular duplication resulting in two faces. There was a cleft palate. The oropharyngeal regions of each face merged to form a single laryngopharynx and oesophagus. There was a single brain with hypoplasia of the cerebellum. The left and right cerebral hemispheres were fused rostrally, and there was duplication of the optic chiasma and the pituitary gland. The olfactory tract was absent and the superficial origins of most of the cranial nerves were not discernible.

  11. Parallel origins of duplications and the formation of pseudogenes in mitochondrial DNA from parthenogenetic lizards (Heteronotia binoei; Gekkonidae).

    Science.gov (United States)

    Zevering, C E; Moritz, C; Heideman, A; Sturm, R A

    1991-11-01

    Analysis of mitochondrial DNAs (mtDNAs) from parthenogenetic lizards of the Heteronotia binoei complex with restriction enzymes revealed an approximately 5-kb addition present in all 77 individuals. Cleavage site mapping suggested the presence of a direct tandem duplication spanning the 16S and 12S rRNA genes, the control region and most, if not all, of the gene for the subunit 1 of NADH dehydrogenase (ND1). The location of the duplication was confirmed by Southern hybridization. A restriction enzyme survey provided evidence for modifications to each copy of the duplicated sequence, including four large deletions. Each gene affected by a deletion was complemented by an intact version in the other copy of the sequence, although for one gene the functional copy was heteroplasmic for another deletion. Sequencing of a fragment from one copy of the duplication which encompassed the tRNA(leu)(UUR) and parts of the 16S rRNA and ND1 genes, revealed mutations expected to disrupt function. Thus, evolution subsequent to the duplication event has resulted in mitochondrial pseudogenes. The presence of duplications in all of these parthenogens, but not among representatives of their maternal sexual ancestors, suggests that the duplications arose in the parthenogenetic form. This provides the second instance in H. binoei of mtDNA duplication associated with the transition from sexual to parthenogenetic reproduction. The increased incidence of duplications in parthenogenetic lizards may be caused by errors in mtDNA replication due to either polyploidy or hybridity of their nuclear genomes.

  12. Type II A2 duplication of urethra in an 8-month-old male child: A case report

    Directory of Open Access Journals (Sweden)

    Mehmet Hanifi Okur

    2015-01-01

    Full Text Available Urethral duplication is a rare congenital anomaly, usually found with multiple anatomical variants. In this article was presented a case of urethral duplication in an 8-month-old male child. The malformation was characterized by the presence of continent hypospadic and normal apical urethra. Retrograde urethrogram through both urethral tracts simultaneously revealed the malformation as Effmann Type II A-2. The accessory ventral urethra was excised without complication.

  13. Laparoscopic excision of a newborn rectal duplication cyst.

    Science.gov (United States)

    Hartin, Charles W; Lau, Stanley T; Escobar, Mauricio A; Glick, Philip L

    2008-08-01

    Congenital rectal duplication cyst is a rare entity treated with surgical excision. Without treatment, a rectal duplication cyst may cause a variety of complications, most notably, transforming into a malignancy. We report on a 7-week-old girl who was found to have a rectal duplication cyst. The rectal duplication cyst was successfully excised laparoscopically. Rectal duplication cysts are rare alimentary tract anomalies generally discovered during childhood. Complications include symptoms arising from the cyst and the possibility of malignant degeneration. They are typically managed by surgical excision.

  14. Surgical management of complete penile duplication accompanied by multiple anomalies.

    Science.gov (United States)

    Karaca, Irfan; Turk, Erdal; Ucan, A Basak; Yayla, Derya; Itirli, Gulcin; Ercal, Derya

    2014-09-01

    Diphallus (penile duplication) is very rare and seen once every 5.5 million births. It can be isolated, but is usually accompanied by other congenital anomalies. Previous studies have reported many concurrent anomalies, such as bladder extrophy, cloacal extrophy, duplicated bladder, scrotal abnormalities, hypospadias, separated symphysis pubis, intestinal anomalies and imperforate anus; no penile duplication case accompanied by omphalocele has been reported. We present the surgical management of a patient with multiple anomalies, including complete penile duplication, hypo-gastric omphalocele and extrophic rectal duplication.

  15. Perforated ileal duplication cyst with haemorrhagic pseudocyst formation

    International Nuclear Information System (INIS)

    Hwang, Im Kyung; Kim, Bong Soo; Kim, Heung Chul; Lee, In Sun; Hwang, Woo Chul; Namkung, Sook

    2003-01-01

    Duplication cysts of the gastrointestinal tract are rare congenital abnormalities. Ectopic gastric mucosa, which can be found in duplications, may cause peptic ulceration, gastrointestinal bleeding or perforation. We report a 1-year-old boy with a perforated ileal duplication cyst with haemorrhagic pseudocyst formation caused by peptic ulceration of the duplication cyst. It presented a snowman-like appearance consisting of a small, thick-walled, true enteric cyst and a large, thin-walled haemorrhagic pseudocyst on US and CT. It is an unusual manifestation of a duplication cyst, which has not been reported in the English language literature. (orig.)

  16. Y-type urethral duplication with posterior perineal fistula: A new variant

    Directory of Open Access Journals (Sweden)

    Sandesh V Parelkar

    2017-05-01

    Full Text Available 13 months old boy presented with constipation and straining during micturition with poor urinary stream and voiding of urine per rectum. Perineal examination revealed posterior perineal fistula. Voiding cysto-urethrogram showed bilateral vesicoureteral reflux with bladder diverticuli, normal dorsal urethra and dye going from urethra to rectum suggestive of Y type urethral duplication. Under stoma cover, he underwent excision of posterior perineal fistula with accessory ventral urethra and anorectoplasty was done. At present patient is passing urine in good stream without straining. The uniqueness of our case is the presence of Y type of urethral duplication with normal calibre dorsal urethra and presence of posterior perineal fistula. Therefore, we consider our case to be an unusual variant of Y type of urethral duplication that has not been described before.

  17. Promotion and Suppression of Centriole Duplication Are Catalytically Coupled through PLK4 to Ensure Centriole Homeostasis

    Directory of Open Access Journals (Sweden)

    Minhee Kim

    2016-08-01

    Full Text Available PLK4 is the major kinase driving centriole duplication. Duplication occurs only once per cell cycle, forming one new (or daughter centriole that is tightly engaged to the preexisting (or mother centriole. Centriole engagement is known to block the reduplication of mother centrioles, but the molecular identity responsible for the block remains unclear. Here, we show that the centriolar cartwheel, the geometric scaffold for centriole assembly, forms the identity of daughter centrioles essential for the block, ceasing further duplication of the mother centriole to which it is engaged. To ensure a steady block, we found that the cartwheel requires constant maintenance by PLK4 through phosphorylation of the same substrate that drives centriole assembly, revealing a parsimonious control in which “assembly” and “block for new assembly” are linked through the same catalytic reaction to achieve homeostasis. Our results support a recently deduced model that the cartwheel-bound PLK4 directly suppresses centriole reduplication.

  18. Small homologous blocks in phytophthora genomes do not point to an ancient whole-genome duplication.

    Science.gov (United States)

    van Hooff, Jolien J E; Snel, Berend; Seidl, Michael F

    2014-05-01

    Genomes of the plant-pathogenic genus Phytophthora are characterized by small duplicated blocks consisting of two consecutive genes (2HOM blocks) and by an elevated abundance of similarly aged gene duplicates. Both properties, in particular the presence of 2HOM blocks, have been attributed to a whole-genome duplication (WGD) at the last common ancestor of Phytophthora. However, large intraspecies synteny-compelling evidence for a WGD-has not been detected. Here, we revisited the WGD hypothesis by deducing the age of 2HOM blocks. Two independent timing methods reveal that the majority of 2HOM blocks arose after divergence of the Phytophthora lineages. In addition, a large proportion of the 2HOM block copies colocalize on the same scaffold. Therefore, the presence of 2HOM blocks does not support a WGD at the last common ancestor of Phytophthora. Thus, genome evolution of Phytophthora is likely driven by alternative mechanisms, such as bursts of transposon activity.

  19. An unusual, duplicate origin of the anterior choroidal artery with aneurysm: a case report.

    Science.gov (United States)

    Chenin, Louis; Chivot, Cyril; Toussaint, Patrick; Deramond, Hervé; Peltier, Johann

    2015-12-01

    Aneurysms of the anterior choroidal artery (AChoA) are rare and often difficult to treat. Variations may be present and must be identified prior to treatment. We report a unique case of a ruptured aneurysm located at the origin of a duplicate branch of the AChoA. A 56-year-old male was admitted to our university hospital for coma. A brain CT scan showed a subarachnoid hemorrhage, and CT angiography revealed a duplication of the right AChoA, with an aneurysm located at the branch's origin. We decided to embolize this aneurysm. Four weeks later, our patient was able to transfer to the rehabilitation unit. To the best of our knowledge, this is one of the first descriptions of an aneurysm located at the origin of a duplicate branch of the AChoA.

  20. Rectal Duplication Cyst: A Rare Cause of Rectal Prolapse in a Toddler.

    Science.gov (United States)

    Khushbakht, Samreen; ul Haq, Anwar

    2015-12-01

    Rectal duplication cysts are rare congenital anomalies. They constitute only 4% of the total gastrointestinal anomalies. They usually present in childhood. The common presenting symptoms are mass or pressure effects like constipation, tenesmus, urinary retention, local infection or bleeding due to presence of ectopic gastric mucosa. We are reporting a rare presenting symptom of rectal duplication cyst in a 4-year-old boy/toddler who presented with rectal prolapse. He also had bleeding per rectum. Rectal examination revealed a soft mass palpable in the posterior rectal wall. CT scan showed a cystic mass in the posterior wall of the rectum. It was excised trans-anally and the postoperative recovery was uneventful. Biopsy report showed rectal duplication cyst.

  1. A case of de novo duplication of 15q24-q26.3

    Directory of Open Access Journals (Sweden)

    Hye Ran Kim

    2011-06-01

    Full Text Available Distal duplication, or trisomy 15q, is an extremely rare chromosomal disorder characterized by prenatal and postnatal overgrowth, mental retardation, and craniofacial malformations. Additional abnormalities typically include an unusually short neck, malformations of the fingers and toes, scoliosis and skeletal malformations, genital abnormalities, particularly in affected males, and, in some cases, cardiac defects. The range and severity of symptoms and physical findings may vary from case to case, depending upon the length and location of the duplicated portion of chromosome 15q. Most reported cases of duplication of the long arm of chromosome 15 frequently have more than one segmental imbalance resulting from unbalanced translocations involving chromosome 15 and deletions in another chromosome, as well as other structural chromosomal abnormalities. We report a female newborn with a de novo duplication, 15q24- q26.3, showing intrauterine overgrowth, a narrow asymmetric face with down-slanting palpebral fissures, a large, prominent nose, and micrognathia, arachnodactyly, camptodactyly, congenital heart disease, hydronephrosis, and hydroureter. Chromosomal analysis showed a 46,XX,inv(9(p12q13,dup(15(q24q26.3. Array comparative genomic hybridization analysis revealed a gain of 42 clones on 15q24-q26.3. This case represents the only reported patient with a de novo 15q24-q26.3 duplication that did not result from an unbalanced translocation and did not have a concomitant monosomic component in Korea.

  2. The E2F-DP1 Transcription Factor Complex Regulates Centriole Duplication in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Jacqueline G. Miller

    2016-03-01

    Full Text Available Centrioles play critical roles in the organization of microtubule-based structures, from the mitotic spindle to cilia and flagella. In order to properly execute their various functions, centrioles are subjected to stringent copy number control. Central to this control mechanism is a precise duplication event that takes place during S phase of the cell cycle and involves the assembly of a single daughter centriole in association with each mother centriole . Recent studies have revealed that posttranslational control of the master regulator Plk4/ZYG-1 kinase and its downstream effector SAS-6 is key to ensuring production of a single daughter centriole. In contrast, relatively little is known about how centriole duplication is regulated at a transcriptional level. Here we show that the transcription factor complex EFL-1-DPL-1 both positively and negatively controls centriole duplication in the Caenorhabditis elegans embryo. Specifically, we find that down regulation of EFL-1-DPL-1 can restore centriole duplication in a zyg-1 hypomorphic mutant and that suppression of the zyg-1 mutant phenotype is accompanied by an increase in SAS-6 protein levels. Further, we find evidence that EFL-1-DPL-1 promotes the transcription of zyg-1 and other centriole duplication genes. Our results provide evidence that in a single tissue type, EFL-1-DPL-1 sets the balance between positive and negative regulators of centriole assembly and thus may be part of a homeostatic mechanism that governs centriole assembly.

  3. The sea lamprey meiotic map improves resolution of ancient vertebrate genome duplications.

    Science.gov (United States)

    Smith, Jeramiah J; Keinath, Melissa C

    2015-08-01

    It is generally accepted that many genes present in vertebrate genomes owe their origin to two whole-genome duplications that occurred deep in the ancestry of the vertebrate lineage. However, details regarding the timing and outcome of these duplications are not well resolved. We present high-density meiotic and comparative genomic maps for the sea lamprey (Petromyzon marinus), a representative of an ancient lineage that diverged from all other vertebrates ∼550 million years ago. Linkage analyses yielded a total of 95 linkage groups, similar to the estimated number of germline chromosomes (1n ∼ 99), spanning a total of 5570.25 cM. Comparative mapping data yield strong support for the hypothesis that a single whole-genome duplication occurred in the basal vertebrate lineage, but do not strongly support a hypothetical second event. Rather, these comparative maps reveal several evolutionarily independent segmental duplications occurring over the last 600+ million years of chordate evolution. This refined history of vertebrate genome duplication should permit more precise investigations of vertebrate evolution. © 2015 Smith and Keinath; Published by Cold Spring Harbor Laboratory Press.

  4. The odds of duplicate gene persistence after polyploidization

    Directory of Open Access Journals (Sweden)

    Chain Frédéric JJ

    2011-12-01

    Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.

  5. Genome-wide signatures of 'rearrangement hotspots' within segmental duplications in humans.

    Directory of Open Access Journals (Sweden)

    Mohammed Uddin

    Full Text Available The primary objective of this study was to create a genome-wide high resolution map (i.e., >100 bp of 'rearrangement hotspots' which can facilitate the identification of regions capable of mediating de novo deletions or duplications in humans. A hierarchical method was employed to fragment segmental duplications (SDs into multiple smaller SD units. Combining an end space free pairwise alignment algorithm with a 'seed and extend' approach, we have exhaustively searched 409 million alignments to detect complex structural rearrangements within the reference-guided assembly of the NA18507 human genome (18× coverage, including the previously identified novel 4.8 Mb sequence from de novo assembly within this genome. We have identified 1,963 rearrangement hotspots within SDs which encompass 166 genes and display an enrichment of duplicated gene nucleotide variants (DNVs. These regions are correlated with increased non-allelic homologous recombination (NAHR event frequency which presumably represents the origin of copy number variations (CNVs and pathogenic duplications/deletions. Analysis revealed that 20% of the detected hotspots are clustered within the proximal and distal SD breakpoints flanked by the pathogenic deletions/duplications that have been mapped for 24 NAHR-mediated genomic disorders. FISH Validation of selected complex regions revealed 94% concordance with in silico localization of the highly homologous derivatives. Other results from this study indicate that intra-chromosomal recombination is enhanced in genic compared with agenic duplicated regions, and that gene desert regions comprising SDs may represent reservoirs for creation of novel genes. The generation of genome-wide signatures of 'rearrangement hotspots', which likely serve as templates for NAHR, may provide a powerful approach towards understanding the underlying mutational mechanism(s for development of constitutional and acquired diseases.

  6. Treatment of Duodenal Duplication by Trans-umbilical Exploratory Minimal Laparotomy

    Directory of Open Access Journals (Sweden)

    Li-Lan Chiang

    2009-08-01

    Full Text Available Duodenal duplication cysts are rare congenital lesions. Their presentation is often non-specific and physical examination and laboratory studies usually reveal no abnormal findings. The diagnosis of duodenal duplication cysts can thus be challenging and relies on ultrasonography, barium swallow, contrast enhanced computed tomography (CT, magnetic resonance imaging (MRI, and magnetic resonance cholangiopancreatography (MRCP. The management of duodenal duplication cyst is surgical. Laparotomy is usually necessary, and complete resection is the management goal. Subtotal excision with stripping of the mucosa due to close involvement of the pancreatobiliary tree, and endoscopic resection have Duodenal duplication cysts are rare congenital lesions usually diagnosed in infancy, although they may present in adulthood. Prenatal diagnosis is difficult, and postnatal diagnosis relies on ultrasonography, barium swallow, contrast-enhanced computerized tomography, magnetic resonance imaging (MRI, and magnetic resonance cholangiopancreatography. A female newborn was diagnosed with an abdominal cyst (size around 6 ×; 5 × 4 cm at gestational age (GA 24 weeks, by regular prenatal examination. After her birth at GA 37 weeks, we performed abdominal ultrasonography and MRI, but there was no definite diagnosis. The usual management of an abdominal cyst involves resection by laparotomy (requiring a large incision or laparoscopy (requiring several small incisions. We performed an exploratory trans-umbilical minimal laparotomy excision for surgery, and the pathology revealed duodenal duplication. In our case, there was no recurrence of the cyst after 18 months follow-up, and the operation scar was almost undetectable. Trans-umbilical minimal laparotomy excision may be considered as an alternative choice for the management of abdominal and duodenal duplication cysts.

  7. SANCTIONING DUPLICATION IN ADMINISTRATIVE AND PENAL AREAS

    Directory of Open Access Journals (Sweden)

    José Manuel Cabrera Delgado

    2014-12-01

    Full Text Available This article provides a first approach from the point of view of jurisprudence, to the recurring problem of concurrency sanctions in cases where further intervention of the courts has become necessary for administrative action. In this regard, the main judgments of both the Constitutional Court and the Supreme Court is, that have shaped the decisions that must be applied from the administrative level, in particular by educational inspectors, when it is foreseeable that it can produce a duplication of disciplinary procedures in the two areas, penal and administrative.

  8. Rectal duplication presenting as colonic subocclusion.

    Science.gov (United States)

    Vuilleumier, H; Maternini, M

    2006-04-01

    Rectal duplication cyst is a rare congenital lesion which is known to be associated with other congenital defects, especially genitourinary and vertebral anomalies. Infections with fistulization, bleeding, and malignant degeneration are the major complications of developmental cysts. The case of an 83-year-old woman referred for acute constipation associated with abdominal distension is reported. CT and MRI showed a large cystic mass of the pelvis with extrinsic compression of the rectum. Surgical excision would have been the treatment of choice. In this case, the patient was unfortunately not eligible for surgery due to her poor general condition but responded well to conservative treatment.

  9. Duplication of the pituitary gland - plus syndrome

    Directory of Open Access Journals (Sweden)

    Debraj Sen

    2016-01-01

    Full Text Available Duplication of the pituitary gland (DPG is a very rare developmental anomaly that is often associated with other anomalies - the DPG-plus syndrome and occurs due to splitting of the rostral notochord and prechordal plate during blastogenesis. DPG with the constellation of associated anomalies as in our patient has not been reported previously. This article illustrates the importance of imaging the brain in all patients with obvious midline facial anomalies and the complementary role of MRI and CT in such cases.

  10. Dealing with duplicate regulations and conflicting jurisdictions

    International Nuclear Information System (INIS)

    Aamodt, P.L.

    1991-01-01

    There are a number of situations where mixed wastes are regulated by dual regulations and regulators. This presentation attempts to show where such duplication exists and how it evolved historically through legislative actions. The presentation includes a discussion of strategies that have been used to deal with the problems that result from duplicate regulations and jurisdictional conflicts. The RCRA and AEA regulations are really more similar than dissimilar. There are significant issues that must be worked through with the regulators. It is most important to work with your regulators early in process. The following are suggestions for dealing with the regulators. (1) Know the regulations in advance of discussions. (2) Begin dialogue with the regulator(s) as early as possible and get to know the people you will be dealing with -- and let them know you. (3) Explain the technical/regulatory issues/problems that you face at your facility in sufficient detail that they are clearly understood, and work with the regulator(s) to reasonably address them in the language/requirements of the permit. (4) Always attempt to comply with the regulations first before going in with a variance request -- document your efforts, and be honest with your assessment of issues. (5) Don't be adversarial -- remember that the regulator has the same objectives as you do. 1 tab

  11. Chromosome duplication in Lolium multiflorum Lam.

    Directory of Open Access Journals (Sweden)

    Roselaine Cristina Pereira

    2014-11-01

    Full Text Available Artificial chromosome duplication of diploid genotypes of Lolium multiflorum (2n=2x=14 is worthy to breeding, and aims to increase the expression of traits with agronomic interest. The purpose of this study was to obtain polyploid plants of L. multiflorum from local diploid populations in order to exploit adaptation and future verification of the effects of polyploidy in agronomic traits. Seedlings were immersed in different colchicine solutions for an exposure time of 3h and 24h. Ploidy determination was made by the DNA content and certified by chromosomes counts. The plants confirmed as tetraploids were placed in a greenhouse, and, at flowering, pollen viability was evaluated, and seeds were harvested to assess the stability of the progenies. The percentage of polyploids obtained was 20%. Pollen viability of the tetraploids generated ranged from 58% to 69%. The tetraploid plants obtained in the experiment generated 164 progenies, of which 109 presented DNA content compatible with the tetraploid level, showing stability of chromosome duplication in the filial generation.

  12. Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene

    Directory of Open Access Journals (Sweden)

    Shomron Noam

    2007-11-01

    Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.

  13. Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia.

    Science.gov (United States)

    Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C

    2010-02-01

    The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.

  14. Hominoid chromosomal rearrangements on 17q map to complex regions of segmental duplication.

    Science.gov (United States)

    Cardone, Maria Francesca; Jiang, Zhaoshi; D'Addabbo, Pietro; Archidiacono, Nicoletta; Rocchi, Mariano; Eichler, Evan E; Ventura, Mario

    2008-01-01

    Chromosomal rearrangements, such as translocations and inversions, are recurrent phenomena during evolution, and both of them are involved in reproductive isolation and speciation. To better understand the molecular basis of chromosome rearrangements and their part in karyotype evolution, we have investigated the history of human chromosome 17 by comparative fluorescence in situ hybridization (FISH) and sequence analysis. Human bacterial artificial chromosome/p1 artificial chromosome probes spanning the length of chromosome 17 were used in FISH experiments on great apes, Old World monkeys and New World monkeys to study the evolutionary history of this chromosome. We observed that the macaque marker order represents the ancestral organization. Human, chimpanzee and gorilla homologous chromosomes differ by a paracentric inversion that occurred specifically in the Homo sapiens/Pan troglodytes/Gorilla gorilla ancestor. Detailed analyses of the paracentric inversion revealed that the breakpoints mapped to two regions syntenic to human 17q12/21 and 17q23, both rich in segmental duplications. Sequence analyses of the human and macaque organization suggest that the duplication events occurred in the catarrhine ancestor with the duplication blocks continuing to duplicate or undergo gene conversion during evolution of the hominoid lineage. We propose that the presence of these duplicons has mediated the inversion in the H. sapiens/P. troglodytes/G. gorilla ancestor. Recently, the same duplication blocks have been shown to be polymorphic in the human population and to be involved in triggering microdeletion and duplication in human. These results further support a model where genomic architecture has a direct role in both rearrangement involved in karyotype evolution and genomic instability in human.

  15. Cholecystitis of a duplicated gallbladder complicated by a cholecystoenteric fistula

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Brady K. [University of Rochester Medical Center, Department of Imaging Sciences, Rochester, NY (United States); Chess, Mitchell A. [University of Rochester Medical Center, Department of Imaging Sciences, Rochester, NY (United States); Advanced Imaging, Batavia, NY (United States)

    2009-04-15

    Gallbladder duplications are uncommon anatomic variants that are sometimes mistaken for other entities on imaging. We present a surgically confirmed case of cholecystitis in a ductular-type duplicated gallbladder complicated by the formation of an inflammatory fistula to the adjacent duodenum. Both US and magnetic resonance cholangiopancreatography were performed preoperatively, in addition to intraoperative cholangiography, which confirmed the presence of a duplicated gallbladder. (orig.)

  16. Spinal Accessory Nerve Duplication: A Case Report and Literature Review

    OpenAIRE

    Papagianni, Eleni; Kosmidou, Panagiota; Fergadaki, Sotiria; Pallantzas, Athanasios; Skandalakis, Panagiotis; Filippou, Dimitrios

    2018-01-01

    Aim of the present study is to expand our knowledge of the anatomy of the 11th cranial nerve and discuss the clinical importance and literature pertaining to accessory nerve duplication. We present one case of duplicated spinal accessory nerve in a patient undergoing neck dissection for oral cavity cancer. The literature review confirms the extremely rare diagnosis of a duplicated accessory nerve. Its clinical implication is of great importance. From this finding, a further extension to our k...

  17. Duplication of the Portal Vein: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sang Won; Shin, Hyeong Cheol; Jou, Sung Shick; Han, Jong Kyu; Kim, Il Young [Soonchunhyang University Cheonan Hospital, Cheonan (Korea, Republic of)

    2009-12-15

    The duplication of the portal vein is an uncommon congenital anomaly. To date, only four cases have been reported in the medical literature. This anomaly can cause portal hypertension in pediatric patients. In addition, duplication of the portal vein has various patterns of connection with a splenic vein or mesenteric veins, and it can lie anterior or posterior to the duodenum. We report the MDCT findings of an adult patient with duplication of the portal vein that was found incidentally

  18. Chromosomal duplication strains of Aspergillus nidulans and their instability

    International Nuclear Information System (INIS)

    Azevedo, J.L. de; Almeida Okino, L.M. de

    1981-01-01

    Strains of Aspergillus nidulans with chromosomal duplication were obtained after gamma irradiation followed by crossing of the translocated strains with normal strains. From 20 analysed colonies, 12 have shown translocations induced by irradiation. Segregants from four of these translocation strains crossed to normal strains have shown to be unstable although presenting normal morphology. Two segregants were genetically analysed. The first one has shown a duplication of part of linkage groups VIII and the second one presented a duplication of a segment of linkage group V. These new duplication strains in A. nidulans open new perspectives of a more detailed study of the instability phenomenon in this fungus. (Author) [pt

  19. Duodenal duplication cyst extending into the posterior mediastinum

    Directory of Open Access Journals (Sweden)

    Tuzun Sefa

    2015-01-01

    Conclusion: Duodenal and the other intestinal duplication cysts should be considered in the differential diagnosis of oral contrast enhanced intrathoracic lesions in thorocoabdominal computerised tomography imaging.

  20. The Centrosome and Its Duplication Cycle

    Science.gov (United States)

    Fu, Jingyan; Hagan, Iain M.; Glover, David M.

    2015-01-01

    The centrosome was discovered in the late 19th century when mitosis was first described. Long recognized as a key organelle of the spindle pole, its core component, the centriole, was realized more than 50 or so years later also to comprise the basal body of the cilium. Here, we chart the more recent acquisition of a molecular understanding of centrosome structure and function. The strategies for gaining such knowledge were quickly developed in the yeasts to decipher the structure and function of their distinctive spindle pole bodies. Only within the past decade have studies with model eukaryotes and cultured cells brought a similar degree of sophistication to our understanding of the centrosome duplication cycle and the multiple roles of this organelle and its component parts in cell division and signaling. Now as we begin to understand these functions in the context of development, the way is being opened up for studies of the roles of centrosomes in human disease. PMID:25646378

  1. Multimodality characterization of a noncommunicating congenital duodenal duplication cyst causing pyloric outflow obstruction in a young dog.

    Science.gov (United States)

    Mutascio, Liliana; Vilaplana Grosso, Federico; Ramos-Vara, José; Simons, Micha

    2017-05-11

    A 10-month-old German Shepherd Dog presented for evaluation of intermittent vomiting. Abdominal radiographs revealed a marked right cranial mass effect. Initial differentials included abscess/cyst or less likely neoplasia from undetermined origin. On abdominal ultrasound the mass appeared cystic and thin walled. Computed tomography revealed a large cystic lesion originating from the pyloroduodenal junction causing pyloric outflow obstruction. A noncommunicating duodenal duplication cyst was found on exploratory laparotomy and further confirmed with histopathology and immunohistochemistry. Enteric duplication cyst should be considered as a differential in young dogs with gastrointestinal signs and a cystic abdominal mass detected with different imaging modalities. © 2017 American College of Veterinary Radiology.

  2. Recombination and evolution of duplicate control regions in the mitochondrial genome of the Asian big-headed turtle, Platysternon megacephalum.

    Directory of Open Access Journals (Sweden)

    Chenfei Zheng

    Full Text Available Complete mitochondrial (mt genome sequences with duplicate control regions (CRs have been detected in various animal species. In Testudines, duplicate mtCRs have been reported in the mtDNA of the Asian big-headed turtle, Platysternon megacephalum, which has three living subspecies. However, the evolutionary pattern of these CRs remains unclear. In this study, we report the completed sequences of duplicate CRs from 20 individuals belonging to three subspecies of this turtle and discuss the micro-evolutionary analysis of the evolution of duplicate CRs. Genetic distances calculated with MEGA 4.1 using the complete duplicate CR sequences revealed that within turtle subspecies, genetic distances between orthologous copies from different individuals were 0.63% for CR1 and 1.2% for CR2app:addword:respectively, and the average distance between paralogous copies of CR1 and CR2 was 4.8%. Phylogenetic relationships were reconstructed from the CR sequences, excluding the variable number of tandem repeats (VNTRs at the 3' end using three methods: neighbor-joining, maximum likelihood algorithm, and Bayesian inference. These data show that any two CRs within individuals were more genetically distant from orthologous genes in different individuals within the same subspecies. This suggests independent evolution of the two mtCRs within each P. megacephalum subspecies. Reconstruction of separate phylogenetic trees using different CR components (TAS, CD, CSB, and VNTRs suggested the role of recombination in the evolution of duplicate CRs. Consequently, recombination events were detected using RDP software with break points at ≈290 bp and ≈1,080 bp. Based on these results, we hypothesize that duplicate CRs in P. megacephalum originated from heterological ancestral recombination of mtDNA. Subsequent recombination could have resulted in homogenization during independent evolutionary events, thus maintaining the functions of duplicate CRs in the mtDNA of P

  3. Somatic mosaicism of an intragenic FANCB duplication in both fibroblast and peripheral blood cells observed in a Fanconi anemia patient leads to milder phenotype.

    Science.gov (United States)

    Asur, Rajalakshmi S; Kimble, Danielle C; Lach, Francis P; Jung, Moonjung; Donovan, Frank X; Kamat, Aparna; Noonan, Raymond J; Thomas, James W; Park, Morgan; Chines, Peter; Vlachos, Adrianna; Auerbach, Arleen D; Smogorzewska, Agata; Chandrasekharappa, Settara C

    2018-01-01

    Fanconi anemia (FA) is a rare disorder characterized by congenital malformations, progressive bone marrow failure, and predisposition to cancer. Patients harboring X-linked FANCB pathogenic variants usually present with severe congenital malformations resembling VACTERL syndrome with hydrocephalus. We employed the diepoxybutane (DEB) test for FA diagnosis, arrayCGH for detection of duplication, targeted capture and next-gen sequencing for defining the duplication breakpoint, PacBio sequencing of full-length FANCB aberrant transcript, FANCD2 ubiquitination and foci formation assays for the evaluation of FANCB protein function by viral transduction of FANCB-null cells with lentiviral FANCB WT and mutant expression constructs, and droplet digital PCR for quantitation of the duplication in the genomic DNA and cDNA. We describe here an FA-B patient with a mild phenotype. The DEB diagnostic test for FA revealed somatic mosaicism. We identified a 9154 bp intragenic duplication in FANCB, covering the first coding exon 3 and the flanking regions. A four bp homology (GTAG) present at both ends of the breakpoint is consistent with microhomology-mediated duplication mechanism. The duplicated allele gives rise to an aberrant transcript containing exon 3 duplication, predicted to introduce a stop codon in FANCB protein (p.A319*). Duplication levels in the peripheral blood DNA declined from 93% to 7.9% in the span of eleven years. Moreover, the patient fibroblasts have shown 8% of wild-type (WT) allele and his carrier mother showed higher than expected levels of WT allele (79% vs. 50%) in peripheral blood, suggesting that the duplication was highly unstable. Unlike sequence point variants, intragenic duplications are difficult to precisely define, accurately quantify, and may be very unstable, challenging the proper diagnosis. The reversion of genomic duplication to the WT allele results in somatic mosaicism and may explain the relatively milder phenotype displayed by the FA

  4. Submicroscopic duplication of the Wolf-Hirschhorn critical region with a 4p terminal deletion.

    Science.gov (United States)

    Roselló, M; Monfort, S; Orellana, C; Ferrer-Bolufer, I; Quiroga, R; Oltra, S; Martínez, F

    2009-01-01

    Chromosomal rearrangements in the short arm of chromosome 4 can result in 2 different clinical entities: Wolf-Hirschhorn syndrome (WHS), characterized by severe growth delay, mental retardation, microcephaly, 'Greek helmet' facies, and closure defects, or partial 4p trisomy, associated with multiple congenital anomalies, mental retardation, and facial dysmorphisms. We present clinical and laboratory findings in a patient who showed a small duplication in 4p16.3 associated with a subtle terminal deletion in the same chromosomal region. GTG-banding analyses, multiplex ligation-dependent probe amplification analyses, and studies by array-based comparative genomic hybridization were performed. The results of the analyses revealed a de novo 1.3 Mb deletion of the terminal 4p and a 1.1 Mb duplication in our patient, encompassing the WHS critical region. Interestingly, this unusual duplication/deletion rearrangement results in an intermediate phenotype that shares characteristics of the WHS and the 4p trisomy syndrome. The use of novel technologies in the genetic diagnosis leads to the description of new clinical syndromes; there is a growing list of microduplication syndromes. Therefore, we propose that overexpression of candidate genes in WHS (WHSC1, WHSC2 and LETM1) due to a duplication causes a clinical entity different to both the WHS and 4p trisomy syndrome. (c) 2009 S. Karger AG, Basel.

  5. Dynamic Delayed Duplicate Detection for External Memory Model Checking

    DEFF Research Database (Denmark)

    Evangelista, Sami

    2008-01-01

    Duplicate detection is an expensive operation of disk-based model checkers. It consists of comparing some potentially new states, the candidate states, to previous visited states. We propose a new approach to this technique called dynamic delayed duplicate detection. This one exploits some typical...

  6. Double-blind ureteral duplication: report of two cases

    International Nuclear Information System (INIS)

    Choi, Ja-Young; Kim, Seung Hyup; Kim, Sun Ho

    2002-01-01

    Blind ending of ureteral duplication is one of the most rare anomalies of the upper urinary tract. We report two cases of ureteral duplication with a blind ending both superiorly and inferiorly, and with no definite communication with the urinary tract. (orig.)

  7. Female Urethral Duplication: Rare Anomaly with Unusual Presentation

    African Journals Online (AJOL)

    UD is classified according to plane (frontal or sagittal) of duplication into different types: (1) Double urethra and double bladder, (2) double urethra with single bladder,. (3) accessory urethra posterior to the normal channel,. (4) double proximal urethra and single distal urethra, and. (5) single proximal urethra and duplicated ...

  8. A rare case of congenital Y-type urethral duplication

    Directory of Open Access Journals (Sweden)

    Charu Tiwari

    2015-11-01

    Full Text Available Duplication of urethra is a rare congenital anomaly. We report a case of Y-type of urethral duplication with the accessory urethra arising from posterior urethra and opening in the perineum. The orthotopic urethra was normal. The accessory urethral tract was cored, transfixed and divided. At 1 year of follow-up, the patient has no urinary complaints

  9. 10 CFR 7.21 - Cost of duplication of documents.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Cost of duplication of documents. 7.21 Section 7.21 Energy NUCLEAR REGULATORY COMMISSION ADVISORY COMMITTEES § 7.21 Cost of duplication of documents. Copies of the records, reports, transcripts, minutes, appendices, working papers, drafts, studies, agenda, or other...

  10. Ruptured rectal duplication with urogenital abnormality: Unusual presentation

    Directory of Open Access Journals (Sweden)

    Shailesh Solanki

    2015-01-01

    Full Text Available Rectal duplication (RD accounts for 5% of alimentary tract duplication. A varied presentation and associated anomalies have been described in the literature. Antenatal rupture of the RD is very rare. We present an unusual case of a ruptured RD associated with urogenital abnormalities in newborn male. We are discussing diagnosis, embryology, management and literature review of ruptured RD.

  11. Rectal Duplication%直肠重复畸形

    Institute of Scientific and Technical Information of China (English)

    张道荣; 牟弦琴; 李振东; 李恭才; 王修忠; 代蕊霜

    1983-01-01

    @@ 我们两院近10年来共收治先天性直肠重复畸形17例(其中河北医学院11例,西安医学院6例).均经手术及病理证实.现总结如下:临床资料本组男性6例,女性11例,最小年龄4天,最大年龄14岁.%This paper reports 17 cases of rectal duplication. There were 6 males and 11rectal duplications were divided into three bordered by a common wall.9 patients in this series were found to have this condition.a rectovestitubular fistula.B.Pararectal duplication.The duplicated bowel lies near elliptical in shape and filled with fluid.In Complicated rectal duplication.The dupticated bowel is located at the perineum near the abnormal anus and is usually associated with hypospadia.Two cases were of this type.between the duplicated bowel and normal rectum must be partially resected at the distal end.The rectovestitubular fistula should be repaired at the same time.Pararectal duplication can be completely resected.resect the duplicated bowel from perineum but leave the genital anomaly for later treatment.

  12. Rectosigmoid tubular duplication presenting as perineal sepsis in a neonate.

    Science.gov (United States)

    Zhang, Zhibo; Huang, Ying; Wang, Dajia; Su, Pengjun

    2010-03-01

    Tubular rectal duplication is a very rare congenital anomaly. We report a case of tubular rectal duplication in a newborn baby who presented with perianal sepsis. The diagnosis was confirmed by barium enema, magnetic resonance imaging, and at operation. We performed total mucosectomy through a posterior sagittal incision combined with laparotomy. The patient was doing quite well at 17-month follow-up examination.

  13. Rectal duplication cyst: a combined abdominal and endoanal operative approach.

    Science.gov (United States)

    Rees, Clare M; Woodward, Mark; Grier, David; Cusick, Eleri

    2007-04-01

    Rectal duplication cysts are rare, comprising duplications. Early excision is the treatment of choice and a number of surgical approaches have been described. We present a 3-week-old infant with a 3 cm cyst that was excised using a previously unreported combined abdominal and endoanal approach.

  14. Ruptured rectal duplication with urogenital abnormality: Unusual presentation.

    Science.gov (United States)

    Solanki, Shailesh; Babu, M Narendra; Jadhav, Vinay; Shankar, Gowri; Santhanakrishnan, Ramesh

    2015-01-01

    Rectal duplication (RD) accounts for 5% of alimentary tract duplication. A varied presentation and associated anomalies have been described in the literature. Antenatal rupture of the RD is very rare. We present an unusual case of a ruptured RD associated with urogenital abnormalities in newborn male. We are discussing diagnosis, embryology, management and literature review of ruptured RD.

  15. Dynamic Delayed Duplicate Detection for External Memory Model Checking

    DEFF Research Database (Denmark)

    Evangelista, Sami

    2008-01-01

    Duplicate detection is an expensive operation of disk-based model checkers. It consists of comparing some potentially new states, the candidate states, to previous visited states. We propose a new approach to this technique called dynamic delayed duplicate detection. This one exploits some typica...... significantly better than some previously published algorithms....

  16. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Directory of Open Access Journals (Sweden)

    Qingyu Chen

    Full Text Available First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases.We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  17. Hypospadiac Duplication of Anterior Urethra-a Rare Congenital Anomaly.

    Science.gov (United States)

    Goyal, Bhawana; Gupta, Suresh; Goyal, Parag

    2017-02-01

    Duplication of the urethra is a complex and rarely seen congenital anomaly with three anatomic variants: epispadiac (dorsal), hypospadiac (ventral), and Y-type. We report here a case of hypospadiac duplication of anterior urethra with dorsal blind ending urethra in a 9-year-old boy who presented with complaint of passing urine from the ventral aspect of penis.

  18. 40 CFR 25.13 - Coordination and non-duplication.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Coordination and non-duplication. 25.13 Section 25.13 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL PUBLIC PARTICIPATION IN... ACT § 25.13 Coordination and non-duplication. The public participation activities and materials that...

  19. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Science.gov (United States)

    Chen, Qingyu; Zobel, Justin; Zhang, Xiuzhen; Verspoor, Karin

    2016-01-01

    First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases. We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  20. Complete cloacal duplication imaged before and during pregnancy.

    Science.gov (United States)

    Ragab, Omar; Landay, Melanie; Shriki, Jabi

    2009-01-01

    The authors describe a 31 year-old female who presented emergently with abdominal pain and was found at CT to have complete genitourinary duplication including separate urinary bladders, uteri, cervices, and vaginas, and also duplication of the rectum. No etiology for abdominal pain was identified. The patient was referred to urology for further evaluation, and an intravenous urographic study was obtained, which confirmed complete lower urinary tract duplication. The patient presented emergently 9 months later during a subsequent pregnancy for further evaluation of abdominal pain. A second CT scan was ordered to rule out appendicitis. Findings consistent with cloacal duplication were again noted. There was also dilatation of the urinary collecting systems, more prominently on the right side. A Cesarean section was performed and confirmed total genitourinary and rectal duplication.

  1. Endoscopic ultrasonography and rectal duplication cyst in an adult.

    Science.gov (United States)

    Castro-Poças, Fernando M; Araújo, Tarcísio P; Silva, Jorge D; Gonçalves, Vicente S

    2017-01-01

    Rectal duplication cysts account for 4% of all duplications of the alimentary tract. Presentation in adulthood is rare. An asymptomatic 54-year-old man was referred for endoscopic colorectal cancer screening. A bulging mass covered by normal mucosa was identified in the rectum. Endoscopic ultrasonography (EUS) with fine needle aspiration (FNA) was made for a diagnosis of rectal duplication cyst. The patient was operated and the diagnosis was confirmed. The diagnosis of the rectal duplication cyst is a challenge. EUS may have a singular role when identifying a muscular layer, because this is the only absolutely necessary criterion for the diagnosis. FNA by EUS may eventually identify colorectal and/or heterotypic epithelium that are the other diagnostic criteria of the duplication cyst.

  2. Cystic rectal duplication in infants: A case report and review of literature

    Directory of Open Access Journals (Sweden)

    Gupta Vipul

    2006-01-01

    Full Text Available Rectal duplication is described in a 1-month-old male infant who presented with constipation for the last 5 days. A presence of a cystic mass in relation to posterior wall of rectum revealed on clinical and radiological examination provided a clue to diagnosis. The clinical presentations and the management protocol of this rare entity are discussed. Authors review their experience with this rare entity and the pertinent literature.

  3. A Case of Duplicated Right Vertebral Artery.

    Science.gov (United States)

    Motomura, Mayuko; Watanabe, Koichi; Tabira, Yoko; Iwanaga, Joe; Matsuuchi, Wakako; Yoshida, Daichi; Saga, Tsuyoshi; Yamaki, Koh-Ichi

    2018-04-27

    We encountered a case of duplicated right vertebral artery during an anatomical dissection course for medical students in 2015. Two vertebral arteries were found in the right neck of a 91-year-old female cadaver. The proximal leg of the arteries arose from the area between the right subclavian artery and the right common carotid artery that diverged from the brachiocephalic artery. The distal leg arose from the right subclavian artery as expected. The proximal leg entered the transverse foramen of the fourth cervical vertebra and the distal leg entered the transverse foramen of the sixth cervical vertebra. The two right vertebral arteries joined to form one artery just after the origin of the right vertebral artery of the brachiocephalic artery entered the transverse foramen of the fourth cervical vertebra. This artery then traveled up in the transverse foramina and became the basilar artery, joining with the left vertebral artery. We discuss the embryological origin of this case and review previously reported cases.

  4. Early vertebrate chromosome duplications and the evolution of the neuropeptide Y receptor gene regions

    Directory of Open Access Journals (Sweden)

    Brenner Sydney

    2008-06-01

    Full Text Available Abstract Background One of the many gene families that expanded in early vertebrate evolution is the neuropeptide (NPY receptor family of G-protein coupled receptors. Earlier work by our lab suggested that several of the NPY receptor genes found in extant vertebrates resulted from two genome duplications before the origin of jawed vertebrates (gnathostomes and one additional genome duplication in the actinopterygian lineage, based on their location on chromosomes sharing several gene families. In this study we have investigated, in five vertebrate genomes, 45 gene families with members close to the NPY receptor genes in the compact genomes of the teleost fishes Tetraodon nigroviridis and Takifugu rubripes. These correspond to Homo sapiens chromosomes 4, 5, 8 and 10. Results Chromosome regions with conserved synteny were identified and confirmed by phylogenetic analyses in H. sapiens, M. musculus, D. rerio, T. rubripes and T. nigroviridis. 26 gene families, including the NPY receptor genes, (plus 3 described recently by other labs showed a tree topology consistent with duplications in early vertebrate evolution and in the actinopterygian lineage, thereby supporting expansion through block duplications. Eight gene families had complications that precluded analysis (such as short sequence length or variable number of repeated domains and another eight families did not support block duplications (because the paralogs in these families seem to have originated in another time window than the proposed genome duplication events. RT-PCR carried out with several tissues in T. rubripes revealed that all five NPY receptors were expressed in the brain and subtypes Y2, Y4 and Y8 were also expressed in peripheral organs. Conclusion We conclude that the phylogenetic analyses and chromosomal locations of these gene families support duplications of large blocks of genes or even entire chromosomes. Thus, these results are consistent with two early vertebrate

  5. Gastric duplication cyst: A cause of rectal bleeding in a young child.

    Science.gov (United States)

    Surridge, Clare A; Goodier, Matthew D

    2014-01-01

    Gastric duplication cysts are an uncommon congenital anomaly and rectal bleeding is a rare presentation of a complicated gastric duplication cyst. This case report describes the radiological findings in a child with a complicated gastric duplication cyst.

  6. Gastric duplication cyst: A cause of rectal bleeding in a young child

    Directory of Open Access Journals (Sweden)

    Clare A Surridge

    2014-01-01

    Full Text Available Gastric duplication cysts are an uncommon congenital anomaly and rectal bleeding is a rare presentation of a complicated gastric duplication cyst. This case report describes the radiological findings in a child with a complicated gastric duplication cyst.

  7. Colonic duplications: Clinical presentation and radiologic features of five cases

    International Nuclear Information System (INIS)

    Blickman, J.G.; Rieu, P.H.M.; Buonomo, C.; Hoogeveen, Y.L.; Boetes, C.

    2006-01-01

    Diagnosis of colonic duplication can pose a potential problem even for those familiar with gastro-intestinal tract duplications in general but unaware of the condition due to its rarity and its apparently bimodal clinical presentation. In this report of five cases of surgically proven pediatric colonic duplication, we illustrate how the condition manifests clinically and describe the imaging features in an attempt to illustrate this bimodal presentation of the condition. The possible etiology, associated congenital anomalies and modes of clinical presentation are reviewed based on literature review as well as on our own experience

  8. Partial duplication of head--a rare congenital anomaly.

    Science.gov (United States)

    Hemachandran, Manikkapurath; Radotra, Bishan Dass

    2004-10-01

    Duplication of notochord results in rare congenital anomalies like double headed monsters, with or without trunk/limb duplication, depending upon the extent of notochordal abnormality. Here we describe the morphological abnormalities in a case of partial duplication of cranial structures with fusion of the two. Autopsy findings suggest that the bifurcation of the neural tube took place around 4th to 6th week of gestation. There are only few reports in English literature describing the autopsy findings of such an anomaly, which is termed as Diprosopus triophthalmus in the modern literature.

  9. Conjoined twin piglets with duplicated cranial and caudal axes.

    Science.gov (United States)

    McManus, C A; Partlow, G D; Fisher, K R

    1994-06-01

    Twins with doubling of the cranial and caudal poles, yet having a single thorax, are rare. One set of diprosopus, dipygus porcine conjoined twins was studied. In addition to the conjoining anomaly, these twins also exhibited ambiguous internal reproductive features. The twins had two snouts, three eyes, a single thorax, and were duplicated from the umbilicus caudally. Radiography indicated a single vertebral column in the cervical region. The vertebral columns were separate caudally from this point. There was a total of six limbs--one pair of forelimbs and two pairs of hindlimbs. Many medial structures failed to develop in these twins. Medial cranial nerves V-XII were absent or displaced although apparently normal laterally. The medial palates were present but shortened, whereas the medial mandibular rami had folded back on themselves rostrally to form a midline mass between the two chins. Each twin had only one lateral kidney and one lateral testis. Medial scrotal sacs were present but devoid of a testis. There was a midline, "uterine"-like structure which crossed between the twins. However, histological analysis of this structure revealed it to be dysplastic testicular tissue. The relationship between the abnormal reproductive features in these twins and the conjoining is unclear. The anatomy of these twins, in addition to the literature reviewed, illustrates the internal anatomical heterogeneity of grossly similar conjoined twins. A review of the literature also suggests that conjoined twinning may be more common in swine than was previously suspected.

  10. Are duplicated genes responsible for anthracnose resistance in common bean?

    Science.gov (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  11. Detection and analysis of ancient segmental duplications in mammalian genomes.

    Science.gov (United States)

    Pu, Lianrong; Lin, Yu; Pevzner, Pavel A

    2018-05-07

    Although segmental duplications (SDs) represent hotbeds for genomic rearrangements and emergence of new genes, there are still no easy-to-use tools for identifying SDs. Moreover, while most previous studies focused on recently emerged SDs, detection of ancient SDs remains an open problem. We developed an SDquest algorithm for SD finding and applied it to analyzing SDs in human, gorilla, and mouse genomes. Our results demonstrate that previous studies missed many SDs in these genomes and show that SDs account for at least 6.05% of the human genome (version hg19), a 17% increase as compared to the previous estimate. Moreover, SDquest classified 6.42% of the latest GRCh38 version of the human genome as SDs, a large increase as compared to previous studies. We thus propose to re-evaluate evolution of SDs based on their accurate representation across multiple genomes. Toward this goal, we analyzed the complex mosaic structure of SDs and decomposed mosaic SDs into elementary SDs, a prerequisite for follow-up evolutionary analysis. We also introduced the concept of the breakpoint graph of mosaic SDs that revealed SD hotspots and suggested that some SDs may have originated from circular extrachromosomal DNA (ecDNA), not unlike ecDNA that contributes to accelerated evolution in cancer. © 2018 Pu et al.; Published by Cold Spring Harbor Laboratory Press.

  12. Evolutionary patterns of RNA-based duplication in non-mammalian chordates.

    Directory of Open Access Journals (Sweden)

    Ming Chen

    Full Text Available The role of RNA-based duplication, or retroposition, in the evolution of new gene functions in mammals, plants, and Drosophila has been widely reported. However, little is known about RNA-based duplication in non-mammalian chordates. In this study, we screened ten non-mammalian chordate genomes for retrocopies and investigated their evolutionary patterns. We identified numerous retrocopies in these species. Examination of the age distribution of these retrocopies revealed no burst of young retrocopies in ancient chordate species. Upon comparing these non-mammalian chordate species to the mammalian species, we observed that a larger fraction of the non-mammalian retrocopies was under strong evolutionary constraints than mammalian retrocopies are, as evidenced by signals of purifying selection and expression profiles. For the Western clawed frog, Medaka, and Sea squirt, many retrogenes have evolved gonad and brain expression patterns, similar to what was observed in human. Testing of retrogene movement in the Medaka genome, where the nascent sex chrosomes have been well assembled, did not reveal any significant gene movement. Taken together, our analyses demonstrate that RNA-based duplication generates many functional genes and can make a significant contribution to the evolution of non-mammalian genomes.

  13. Assessment of iodine content in Brazilian duplicate portion diets and in table salt

    International Nuclear Information System (INIS)

    Maihara, V.A.; Moura, P.L.C.; Favaro, D.I.T.; Vasconcellos, M.B.A.

    2008-01-01

    Excess dietary intake may increase the risk for the hyperthyroidism in the elderly. This study investigated iodine dietary intake by epithermal neutron activation analysis (ENAA) analyzing duplicate portion diet and fortified table salt samples. Duplicate diet samples were obtained from a group of twenty-five steel mill workers from the city of Sao Paulo, over a 3-day period. The samples were freeze dried, mixed and homogenized. Fortified table salt brands were collected from the market and were analyzed with no pre-treatment. Assays for the iodine concentration in the table salt samples revealed values between 24 to 65 mg/kg. The average iodine daily intake for the worker's diets was 813 μg/day, ranging from 402 to 1363 μg/day. In some cases daily intakes were around 10 times higher than the recommended dietary allowance (RDA) value (150 μg/day). (author)

  14. p53 protects against genome instability following centriole duplication failure

    Science.gov (United States)

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  15. Obstetric significance of fetal craniofacial duplication. A case report.

    Science.gov (United States)

    Chervenak, F A; Pinto, M M; Heller, C I; Norooz, H

    1985-01-01

    Craniofacial duplication (diprosopus) is a rare form of conjoined twins. Whenever fetal hydrocephalus is diagnosed, a careful search for other anomalies, such as diprosopus, is mandatory. The obstetric management depends upon the time of the diagnosis.

  16. Genetics Home Reference: 7q11.23 duplication syndrome

    Science.gov (United States)

    ... Duplication Syndrome. 2015 Nov 25. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Ledbetter N, Mefford HC, Smith RJH, Stephens K, editors. GeneReviews® [Internet]. Seattle (WA): ...

  17. The duplication 17p13.3 phenotype

    DEFF Research Database (Denmark)

    Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica

    2013-01-01

    . Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....

  18. Sorting by Cuts, Joins, and Whole Chromosome Duplications.

    Science.gov (United States)

    Zeira, Ron; Shamir, Ron

    2017-02-01

    Genome rearrangement problems have been extensively studied due to their importance in biology. Most studied models assumed a single copy per gene. However, in reality, duplicated genes are common, most notably in cancer. In this study, we make a step toward handling duplicated genes by considering a model that allows the atomic operations of cut, join, and whole chromosome duplication. Given two linear genomes, [Formula: see text] with one copy per gene and [Formula: see text] with two copies per gene, we give a linear time algorithm for computing a shortest sequence of operations transforming [Formula: see text] into [Formula: see text] such that all intermediate genomes are linear. We also show that computing an optimal sequence with fewest duplications is NP-hard.

  19. Endorectal magnetic resonance imaging of a rectal duplication cyst.

    Science.gov (United States)

    Beattie, C H; Garvey, C J; Hershman, M J

    1999-09-01

    A case of a duplication cyst of the rectum is presented. This case highlights the potential role of endoluminal magnetic resonance imaging in the diagnosis of this uncommon condition. Alternative imaging modalities and differential diagnoses are discussed.

  20. Immunohistochemical findings in rectal duplication mimicking rectal prolapse.

    Science.gov (United States)

    Cortese, M G; Pucci, A; Macchieraldo, R; Sacco Casamassima, M G; Canavese, F

    2008-08-01

    Alimentary tract duplications represent rare anomalies, with only 5 % occurring in the rectum. The variety in clinical presentation may lead to a delay in diagnosis or to incorrect and multiple surgical procedures. We report the clinical, histological and immunohistochemical characteristics of a rectal duplication occurring in a 3-month-old male with an unusual clinical presentation. Using routine histology and immunohistochemistry, the rectal duplication showed the diffuse presence of gastric mucosa with a characteristic immunophenotype (i.e., diffuse cytokeratin 7 positivity and scattered chromogranin immunoreactivity). As far as we know, this is the first report showing an immunohistochemical differentiation pattern of gastric lining in a rectal duplication. Our results, showing the presence of gastric mucosa, are suggestive of a possible origin from the embryonic foregut.

  1. Duplicate laboratory test reduction using a clinical decision support tool.

    Science.gov (United States)

    Procop, Gary W; Yerian, Lisa M; Wyllie, Robert; Harrison, A Marc; Kottke-Marchant, Kandice

    2014-05-01

    Duplicate laboratory tests that are unwarranted increase unnecessary phlebotomy, which contributes to iatrogenic anemia, decreased patient satisfaction, and increased health care costs. We employed a clinical decision support tool (CDST) to block unnecessary duplicate test orders during the computerized physician order entry (CPOE) process. We assessed laboratory cost savings after 2 years and searched for untoward patient events associated with this intervention. This CDST blocked 11,790 unnecessary duplicate test orders in these 2 years, which resulted in a cost savings of $183,586. There were no untoward effects reported associated with this intervention. The movement to CPOE affords real-time interaction between the laboratory and the physician through CDSTs that signal duplicate orders. These interactions save health care dollars and should also increase patient satisfaction and well-being.

  2. Noncommunicating isolated enteric duplication cyst in the abdomen ...

    African Journals Online (AJOL)

    ... Surgery 2013, 9:124–126. Keywords: abdomen, children, duplication, isolated, noncommunicating. Department of Pediatric Surgery, Seoul National University College of Medicine, .... M Abdominal pain, anorexia, fever. Ileum. Respiratory.

  3. Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals.

    Science.gov (United States)

    Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C

    2008-02-12

    The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.

  4. Duplicate Health Insurance Coverage: Determinants of Variation Across States

    OpenAIRE

    Luft, Harold S.; Maerki, Susan C.

    1982-01-01

    Although it is recognized that many people have duplicate private health insurance coverage, either through separate purchase or as health benefits in multi-earner families, there has been little analysis of the factors determining duplicate coverage rates. A new data source, the Survey of Income and Education, offers a comparison with the only previous source of state level data, the estimates from the Health Insurance Association of America. The R2 between the two sets is only .3 and certai...

  5. Familial partial duplication (1)(p21p31)

    Energy Technology Data Exchange (ETDEWEB)

    Hoechstetter, L.; Soukup, S.; Schorry, E.K. [Children`s Hospital Research Foundation, Cincinnati, OH (United States)

    1995-11-20

    A partial duplication (1)(p21p31), resulting from a maternal direct insertion (13,1) (q22p21p31), was found in a 30-year-old woman with mental retardation, cleft palate, and multiple minor anomalies. Two other affected and deceased relatives were presumed to have the same chromosome imbalance. Duplication 1p cases are reviewed. 8 refs., 5 figs., 1 tab.

  6. Malrotation with midgut volvulus associated with perforated ileal duplication

    Directory of Open Access Journals (Sweden)

    Anand Pandey

    2013-01-01

    Full Text Available Duplication of the alimentary tract is an important surgical condition. It may occur anywhere in the gastrointestinal tract. An important complication of this entity is perforation of the normal or abnormal gut. Malrotation with midgut volvulus can be a surgical emergency. We present a patient, who presented as malrotation with midgut volvulus associated with perforated ileal duplication. The patient was successfully managed.

  7. An unusual presentation of a rectal duplication cyst.

    Science.gov (United States)

    Jackson, Katharine L; Peche, William J; Rollins, Michael D

    2012-01-01

    Intestinal duplications are rare developmental anomalies that can occur anywhere along the gastrointestinal tract. Rectal duplication cysts account for approximately 4% of all duplication cysts. They usually present in childhood with symptoms of mass effect, local infection or more rarely with rectal bleeding from ectopic gastric mucosa. A 26year old male presented with a history of bright red blood per rectum. On examination a mucosal defect with an associated cavity adjacent to the rectum was identified. This was confirmed with rigid proctoscopy and CT scan imaging. A complete transanal excision was performed. Rectal duplication cysts are more common in pediatric patients. They more frequently present with symptoms of mass effect or local infection than with rectal bleeding. In adult patients they are a rare cause of rectal bleeding. Definitive treatment is with surgical excision. A transanal, transcoccygeal, posterior sagittal or a combined abdominoperineal approach may be used depending on anatomic characteristics of the duplication cyst. We present a rare case of a rectal duplication cyst presenting in adulthood with rectal bleeding, managed with transanal excision. Published by Elsevier Ltd.

  8. Duplicate retention in signalling proteins and constraints from network dynamics.

    Science.gov (United States)

    Soyer, O S; Creevey, C J

    2010-11-01

    Duplications are a major driving force behind evolution. Most duplicates are believed to fix through genetic drift, but it is not clear whether this process affects all duplications equally or whether there are certain gene families that are expected to show neutral expansions under certain circumstances. Here, we analyse the neutrality of duplications in different functional classes of signalling proteins based on their effects on response dynamics. We find that duplications involving intermediary proteins in a signalling network are neutral more often than those involving receptors. Although the fraction of neutral duplications in all functional classes increase with decreasing population size and selective pressure on dynamics, this effect is most pronounced for receptors, indicating a possible expansion of receptors in species with small population size. In line with such an expectation, we found a statistically significant increase in the number of receptors as a fraction of genome size in eukaryotes compared with prokaryotes. Although not confirmative, these results indicate that neutral processes can be a significant factor in shaping signalling networks and affect proteins from different functional classes differently. © 2010 The Authors. Journal Compilation © 2010 European Society For Evolutionary Biology.

  9. Maintenance and Loss of Duplicated Genes by Dosage Subfunctionalization.

    Science.gov (United States)

    Gout, Jean-Francois; Lynch, Michael

    2015-08-01

    Whole-genome duplications (WGDs) have contributed to gene-repertoire enrichment in many eukaryotic lineages. However, most duplicated genes are eventually lost and it is still unclear why some duplicated genes are evolutionary successful whereas others quickly turn to pseudogenes. Here, we show that dosage constraints are major factors opposing post-WGD gene loss in several Paramecium species that share a common ancestral WGD. We propose a model where a majority of WGD-derived duplicates preserve their ancestral function and are retained to produce enough of the proteins performing this same ancestral function. Under this model, the expression level of individual duplicated genes can evolve neutrally as long as they maintain a roughly constant summed expression, and this allows random genetic drift toward uneven contributions of the two copies to total expression. Our analysis suggests that once a high level of imbalance is reached, which can require substantial lengths of time, the copy with the lowest expression level contributes a small enough fraction of the total expression that selection no longer opposes its loss. Extension of our analysis to yeast species sharing a common ancestral WGD yields similar results, suggesting that duplicated-gene retention for dosage constraints followed by divergence in expression level and eventual deterministic gene loss might be a universal feature of post-WGD evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Endoscopic Decompression and Marsupialization of A Duodenal Duplication Cyst

    Directory of Open Access Journals (Sweden)

    Eliza I-Lin Sin

    2018-06-01

    Full Text Available Introduction: Duodenal duplication cysts are rare congenital foregut anomalies, accounting for 2%–12% of all gastrointestinal tract duplications. Surgical excision entails risk of injury to the pancreaticobiliary structures due to proximity or communication with the cyst. We present a case of duodenal duplication cyst in a 3 year-old boy who successfully underwent endoscopic decompression. Case report: AT is a young boy who first presented at 15 months of age with abdominal pain. There was one subsequent episode of pancreatitis. Ultrasonography showed the typical double wall sign of a duplication cyst and magnetic resonance cholangio-pancreatography showed a large 5 cm cyst postero-medial to the second part of the duodenum, communicating with the pancreaticobiliary system and causing dilatation of the proximal duodenum. He subsequently underwent successful endoscopic ultrasound guided decompression at 3 years of age under general anesthesia, and had an uneventful postoperative recovery. Conclusion: Endoscopic ultrasound guided assessment and treatment of gastrointestinal duplication cysts is increasingly reported in adults. To the best of our knowledge, only one case of endoscopic treatment of duodenal duplication cyst, in an older child, has been reported thus far in the paediatric literature. In this paper, we review the current literature and discuss the therapeutic options of this rare condition.

  11. Identification of approximately duplicate material records in ERP systems

    Science.gov (United States)

    Zong, Wei; Wu, Feng; Chu, Lap-Keung; Sculli, Domenic

    2017-03-01

    The quality of master data is crucial for the accurate functioning of the various modules of an enterprise resource planning (ERP) system. This study addresses specific data problems arising from the generation of approximately duplicate material records in ERP databases. Such problems are mainly due to the firm's lack of unique and global identifiers for the material records, and to the arbitrary assignment of alternative names for the same material by various users. Traditional duplicate detection methods are ineffective in identifying such approximately duplicate material records because these methods typically rely on string comparisons of each field. To address this problem, a machine learning-based framework is developed to recognise semantic similarity between strings and to further identify and reunify approximately duplicate material records - a process referred to as de-duplication in this article. First, the keywords of the material records are extracted to form vectors of discriminating words. Second, a machine learning method using a probabilistic neural network is applied to determine the semantic similarity between these material records. The approach was evaluated using data from a real case study. The test results indicate that the proposed method outperforms traditional algorithms in identifying approximately duplicate material records.

  12. Profiling of gene duplication patterns of sequenced teleost genomes: evidence for rapid lineage-specific genome expansion mediated by recent tandem duplications.

    Science.gov (United States)

    Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang

    2012-06-15

    Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication

  13. Role of computed tomography in oesophageal duplications. Report of two cases; Duplications oesophagiennes: place de la tomodensitometrie

    Energy Technology Data Exchange (ETDEWEB)

    Jouini, S.; Menif, E.; Azaiez, N.; Ben Hajel, H.; Cheikh, I.; Ben Ammar, A.; Sellami, M.; Ben Jaafar, M. [Hopital La Rabta, Tunis (Tunisia)

    1995-12-31

    The authors present two cases of esophageal duplication: tubular in one case and cystic in the other. This rare anomaly was identified in both cases by CT scan. A review of literature is proposed. (authors). 22 refs., 10 figs.

  14. Insights into three whole-genome duplications gleaned from the Paramecium caudatum genome sequence.

    Science.gov (United States)

    McGrath, Casey L; Gout, Jean-Francois; Doak, Thomas G; Yanagi, Akira; Lynch, Michael

    2014-08-01

    Paramecium has long been a model eukaryote. The sequence of the Paramecium tetraurelia genome reveals a history of three successive whole-genome duplications (WGDs), and the sequences of P. biaurelia and P. sexaurelia suggest that these WGDs are shared by all members of the aurelia species complex. Here, we present the genome sequence of P. caudatum, a species closely related to the P. aurelia species group. P. caudatum shares only the most ancient of the three WGDs with the aurelia complex. We found that P. caudatum maintains twice as many paralogs from this early event as the P. aurelia species, suggesting that post-WGD gene retention is influenced by subsequent WGDs and supporting the importance of selection for dosage in gene retention. The availability of P. caudatum as an outgroup allows an expanded analysis of the aurelia intermediate and recent WGD events. Both the Guanine+Cytosine (GC) content and the expression level of preduplication genes are significant predictors of duplicate retention. We find widespread asymmetrical evolution among aurelia paralogs, which is likely caused by gradual pseudogenization rather than by neofunctionalization. Finally, cases of divergent resolution of intermediate WGD duplicates between aurelia species implicate this process acts as an ongoing reinforcement mechanism of reproductive isolation long after a WGD event. Copyright © 2014 by the Genetics Society of America.

  15. A Korean boy with 46,XX testicular disorder of sex development caused by SOX9 duplication.

    Science.gov (United States)

    Lee, Gyung Min; Ko, Jung Min; Shin, Choong Ho; Yang, Sei Won

    2014-06-01

    The 46,XX testicular disorder of sex development (DSD), also known as 46,XX male syndrome, is a rare form of DSD and clinical phenotype shows complete sex reversal from female to male. The sex-determining region Y (SRY) gene can be identified in most 46,XX testicular DSD patients; however, approximately 20% of patients with 46,XX testicular DSD are SRY-negative. The SRY-box 9 (SOX9) gene has several important functions during testis development and differentiation in males, and overexpression of SOX9 leads to the male development of 46,XX gonads in the absence of SRY. In addition, SOX9 duplication has been found to be a rare cause of 46,XX testicular DSD in humans. Here, we report a 4.2-year-old SRY-negative 46,XX boy with complete sex reversal caused by SOX9 duplication for the first time in Korea. He showed normal external and internal male genitalia except for small testes. Fluorescence in situ hybridization and polymerase chain reaction (PCR) analyses failed to detect the presence of SRY, and SOX9 intragenic mutation was not identified by direct sequencing analysis. Therefore, we performed real-time PCR analyses with specific primer pairs, and duplication of the SOX9 gene was revealed. Although SRY-negative 46,XX testicular DSD is a rare condition, an effort to make an accurate diagnosis is important for the provision of proper genetic counseling and for guiding patients in their long-term management.

  16. Rectal duplication cyst presenting as perianal sepsis: report of two cases and review of the literature.

    Science.gov (United States)

    Flint, Richard; Strang, Jane; Bissett, Ian; Clark, Matthew; Neill, Mischel; Parry, Bryan

    2004-12-01

    Recurrent perianal sepsis is a difficult problem to manage in colorectal surgical practice. One cause is rectal duplication cyst, a rare congenital lesion that is easily overlooked. Many cases have associated congenital defects, especially musculoskeletal anomalies, and may provide a clue to the underlying condition. Early diagnosis is important because these cysts do not resolve spontaneously and may undergo malignant change. We present two cases of middle-aged females who presented with perianal sepsis secondary to rectal duplication cyst. The first case had numerous surgical procedures for a perianal fistula during a ten-year period. She had associated sacral anomalies consistent with Currarino syndrome. The second case presented with a perineal mass after a bout of perianal inflammation. Both cases had the entire cyst surgically excised. There were no complications postoperatively and no recurrence at follow-up. Histopathology revealed no malignancy in the cyst. Rectal duplication cyst is a rare cause of recurrent perianal sepsis that should be considered in difficult cases, especially in those with associated musculoskeletal anomalies. Complete surgical excision is the preferred treatment to prevent recurrence and the risk of malignant degeneration.

  17. Caudal duplication syndrome: imaging evaluation of a rare entity in an adult patient

    Directory of Open Access Journals (Sweden)

    Tianshen Hu, BS

    2016-03-01

    Full Text Available Several theories have been put forth to explain the complex yet symmetrical malformations and the myriad of clinical presentations of caudal duplication syndrome. Hereby, reported case is a 28-year-old female, gravida 2 para 2, with congenital caudal malformation who has undergone partial reconstructive surgeries in infancy to connect her 2 colons. She presented with recurrent left lower abdominal pain associated with nausea, vomiting, and subsequent feculent anal discharge. Imaging reveals duplication of the urinary bladder, urethra, and colon with with cloacal malformations and fistulae from the left-sided cloaca, uterus didelphys with separate cervices and vaginal canals, right-sided aortic arch and descending thoracic aorta, and dysraphic midline sacrococcygeal defect. Hydronephrosis of the left kidney with left hydroureter and inflammation of one of the colons were suspected to be the cause of the patient’s acute complaints. She improved symptomatically over the course of her hospitalization stay with conservative treatments. The management for this syndrome is individualized and may include surgical intervention to fuse or excise the duplicated organs.

  18. Case Report Duplication Of Gastrointestinal Tract | Tewolde ...

    African Journals Online (AJOL)

    A 6 Months old male child presented to the Orotta Pediatrics Hospital with recurrent chest infections and respiratory distress since birth. He was treated accordingly at different admissions but with marginal improvement. Investigations revealed the presence of a cystic mass in the right posterior mediastinum. The mass was ...

  19. Intussusception due to a cecal duplication cyst: a rare cause of acute abdomen. Case report.

    Science.gov (United States)

    Corroppolo, M; Zampieri, N; Erculiani, E; Cecchetto, M; Camoglio, F S

    2007-01-01

    Duplications of the alimentary tract are rare congenital anomalies. The ileum is the most common site, whereas rectal, duodenal, gastric and cecal duplications are extremely rare. Duplication cysts of the cecum, in a neonate, are even rarer, with only 19 cases reported in medical literature to date. We report a case of intestinal intussusception due to a cecal duplication cyst.

  20. [Anterior rectal duplication in adult patient: a case report].

    Science.gov (United States)

    Rodríguez-Cabrera, J; Villanueva-Sáenz, E; Bolaños-Badillo, L E

    2009-01-01

    To report a case of rectal duplication in the adult and make a literature review. The intestinal duplications are injuries of congenital origin that can exist from the base of the tongue to the anal verge, being the most frequent site at level of terminal ileum (22%) and at the rectal level in 5% To date approximately exist 80 reports in world-wide Literature generally in the pediatric population being little frequent in the adult age. Its presentation could be tubular or cystic. The recommended treatment is the surgical resection generally in block with coloanal anastomosis. A case review of rectal duplication in the adult and the conducted treatment. The case of a patient appears with diagnose of rectal duplication with tubular type,whose main symptom was constipation and fecal impactation. In the exploration was detect double rectal lumen (anterior and posterior) that it above initiates by of the anorectal ring with fibrous ulcer of fibrinoid aspect of 3 approx cm of length x 1 cm wide, at level of the septum that separates both rectal lumina. The rectal duplication is a rare pathology in the adult nevertheless is due to suspect before the existence of alterations in the mechanics of the defecation, rectal prolapse and rectal bleeding,the election treatment is a protectomy with colonic pouch in "J" and coloanal anastomosis.

  1. Pelvicalyceal system duplication with ectopic ureter – diagnostic difficulties associated with the imaging procedure. Two cases report

    Directory of Open Access Journals (Sweden)

    Agnieszka Pukajło-Marczyk

    2014-09-01

    Full Text Available Urinary tract abnormalities are the most frequently occurring developmental anomaly in children. Pelvicalyceal system duplication is one of them and signifies the existence of two urine diverting separate systems. This anomaly occurs in 10% of population, usually in girls, and is associated with complete or partial ureter duplication. The frequency of total ureter duplication, which in 20–40% of patients is found as bilateral, is 1:125 children (0.8% of the population. The most frequent malformation is asymptomatic, diagnosed coincidentally casually and does not require any treatment. In some patients with pelvicalyceal system duplication, vesicoureteral reflux (VUR and ectopic ureter may coexist. Malposition of ureter’s orifice into the bladder predispose to urinary retention, development of hydronephrosis and urinary tract infection (UTI. Ectopic ureterocele is recognized in 6–20% of children with recurrent UTI. The reason why children are referred to the hospital is UTI or hydronephrosis revealed by ultrasound imaging. When the ultrasound image of pelvicalyceal system duplication is ambiguous, micturating cystourethrography (MCU and scintigraphy become the primary diagnostic procedure, or urography – in more complicated cases. In the case of ectopic ureter, the danger of inappropriate catheterization, i.e. directly into its lumen, may occur. Though very rare, this may cause some diagnostic difficulties and lead to injury of the urinary tract. For this reason, we want to further discuss this complication following a diagnostic procedure on the example of two cases of pelvicalyceal system duplication with ectopic ureter.

  2. Penile Duplication and Two Anal Openings; Report of a Very Rare Case

    OpenAIRE

    Bakheet, Mohamed Abdel Al M.; Refaei, Mohammad

    2012-01-01

    Background Penile duplication (diphallus) is an extremely rare disorder. It is almost always associated with other malformations like double bladder, exstrophy of the cloacae, imperforate anus, duplication of the rectosigmoid and vertebral deformities. Meanwhile anal canal duplication, the most distal and least common duplication of the digestive tube and is a very rare congenital malformation. Case Presentation A 21 days old Egyptian neonate is reported with complete penile duplication and t...

  3. FGFR1 tyrosine kinase domain duplication in pilocytic astrocytoma with anaplasia.

    Science.gov (United States)

    Ballester, Leomar Y; Penas-Prado, Marta; Leeds, Norman E; Huse, Jason T; Fuller, Gregory N

    2018-04-01

    We report the case of a 27-yr-old male with visual field loss who had a 4.9-cm complex cystic mass in the right occipital lobe. Histologic examination showed pilocytic astrocytoma (PA) with anaplasia, and molecular characterization revealed FGFR1 duplication with additional variants of unknown significance in several genes ( ARID1A, ARID1B, CHEK2, EPHA5, and MLL2 ). This is one of only a very few reported cases of anaplastic PA with characterization of molecular alterations. © 2018 Ballester et al.; Published by Cold Spring Harbor Laboratory Press.

  4. Enteric Duplication Cysts in Children: A Clinicopathological Dilemma.

    Science.gov (United States)

    Sharma, Sonam; Yadav, Amit K; Mandal, Ashish K; Zaheer, Sufian; Yadav, Devendra K; Samie, Amat

    2015-08-01

    Enteric duplication cysts are rare and uncommon congenital malformations formed during the embryonic period of the development of human digestive system and are mainly encountered during infancy or early childhood, but seldom in adults. The clinical presentation is extremely variable depending upon its size, location and type. We present six cases of enteric duplication cysts with diverse clinico-pathological features. This study was carried out in the Department of Pathology and Department of Paediatric Surgery, Vardhman Mahavir Medical College and Safdarjung Hospital, New Delhi, India for a period of 2 years (January 2013 - December 2014). We retrospectively analyzed six patients of enteric duplication cysts based on data obtained, which consisted of patient's age, sex, clinical presentation, radiological features, operative findings and histopathology report. The data collected was analyzed by descriptive statistics. Six children between age range of 3 days to 10 years had enteric duplication cysts. Two had ileal and one each were of pyloroduodenal, colonic and rectal duplication cyst. In one patient a presumptive diagnosis of enteric duplication cyst was made. Radiology played an important contributory role in diagnosis of these cysts in all the patients but histopathology proved to be gold standard for its confirmation. All these patients were managed by surgical excision. The postoperative and follow up period in all the cases was uneventful. It is important to be aware and make a definitive diagnosis of this rare congenital anomaly as they can present in various clinical forms and can cause significant morbidity and even mortality if left untreated by causing life threatening complications.

  5. A retroperitoneal foregut duplication cyst: a case report

    International Nuclear Information System (INIS)

    Kim, Yong Woon; Lee, Jin Hee; Byun, Kyung Hwan; Kim, Byung Ki; Sohn, Kyung Sik; Kee, Se Kook; Jeon, Jin Min; Yun, Young Kook

    2006-01-01

    Retroperitoneal foregut duplication cyst is an extremely rare congenital malformation. Pathologically, this lesion contains both gastric mucosa and respiratory type mucosa; radiologically, it is often challenging to differentiate it from the other cystic neoplasms that present a similar appearance. We report on a case of retroperitoneal foregut duplication cyst that was lined by both gastric and pseudostratified ciliated columnar epithelium, and it was also accompanied by a pancreatic pseudocyst. Initially, it presented with peripancreatic and intrapancreatic cystic masses in an asymptomatic 30-year-old man, and this man has since undergone surgical resection

  6. Recurrent duplications of 17q12 associated with variable phenotypes

    DEFF Research Database (Denmark)

    Mitchell, Elyse; Douglas, Andrew; Kjaegaard, Susanne

    2015-01-01

    The ability to identify the clinical nature of the recurrent duplication of chromosome 17q12 has been limited by its rarity and the diverse range of phenotypes associated with this genomic change. In order to further define the clinical features of affected patients, detailed clinical information......, potentially contributory copy number changes in a subset of patients, including one patient each with 16p11.2 deletion and 15q13.3 deletion. Our data further define and expand the clinical spectrum associated with duplications of 17q12 and provide support for the role of genomic modifiers contributing...... to phenotypic variability....

  7. Ruptured rectal duplication cyst with classical bladder exstrophy.

    Science.gov (United States)

    Gupta, Rahul K; Oak, Sanjay; Parelkar, Sandesh V; Sanghvi, Beejal; Kaltari, Deepak K; Prakash, Advait; Patil, Rajashekhar; Bachani, Mitesh

    2010-07-01

    A newborn boy was brought to us, 2 hours after birth, with a mucosal-lined left hemiperineal lesion associated with classical bladder exstrophy and an anterolaterally displaced anus. Perineal anatomy was restored by excising the mucosa lined lesion. The bladder closure for classical bladder exstrophy was done at the same time. Histologically, gastric, respiratory, and small intestinal epithelia were present in the mucosa. A rectal duplication cyst that had ruptured in utero through the hemiperineum could explain the anomaly. The association of classical bladder exstrophy with ruptured rectal duplication cyst has never previously been described in the literature. Copyright 2010 Elsevier Inc. All rights reserved.

  8. Duplication of the Hindgut and Lower Urinary. Tract. Case Report

    International Nuclear Information System (INIS)

    Garcia, Vanessa; Tamayo, Margarita; Montoya, Claudia; Acosta, Federico; Cano, Julian; Mejia, Francisco

    2010-01-01

    A 13 year female consulted to Heatup Pad's surgery department with a history of pelvic malformations since she was born and complaining about a colostomy done five years ago. On clinical examination an anal fistula was seen as well as perineal organs duplicated including: vulva - four labia, clitoris, vaginal canal, urethra, also double gluteal cleft. Several diagnostic modalities were performed (voiding cystourethrography, urodynamic, renal scan, CT and MRI) having a diagnosis of complete duplication of the hindgut and lower urinary tract, a rare congenital anomaly that has fewer than 50 cases reported in the literature. During hospitalization she underwent successful abdominopelvic surgical Correction.

  9. Incomplete urethral duplication with cyst formation in a dog

    International Nuclear Information System (INIS)

    Duffey, M.H.; Barnhart, M.D.; Barthez, P.Y.; Smeak, D.D.

    1998-01-01

    Incomplete urethral duplication with cyst formation was diagnosed in a dog that had soft, fluctuant, subcutaneous swellings in the ventral perineal and penile areas and a history of nocturia and incontinence during recumbency that were unresponsive to treatment with antibiotics. Retrograde urethrocystography, voiding urethrography, double-contrast cystography, radiography after direct administration of contrast medium into cystic structures, and excretory urography were performed to evaluate the urinary tract. Communication between the cysts and the urethra was demonstrated radiographically only after intralesional injection of contrast medium. Nocturia and incontinence resolved after surgical removal of the urethral duplication and cysts. The dog was clinically normal 1 year after surgery

  10. Genome Mutational and Transcriptional Hotspots Are Traps for Duplicated Genes and Sources of Adaptations.

    Science.gov (United States)

    Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina

    2017-05-01

    Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Nasal Duplication Combined with Cleft Lip and Palate: Surgical Correction and Long-Term Follow-Up.

    Science.gov (United States)

    Long, Kanharith; Yamaguchi, Kazuaki; Lonic, Daniel; Long, Vanna; Chhoeurn, Vuthy; Lo, Lun-Jou

    2017-10-01

    Diprosopus dirrhinus, or nasal duplication, is a rare entity of partial craniofacial duplication. The case we present is the first report of diprosopus dirrhinus associated with complete cleft lip and palate. The baby was born in Cambodia at full term by normal vaginal delivery with no significant perinatal and family history. Physical examination revealed significant facial deformity due to the duplicated nose and the left complete cleft lip/palate on the right subset. There were 4 nostrils; both medial apertures including the cleft site were found to be 10-15 mm deep cul-de-sac structures without communication to the nasopharynx. The upper third of the face was notable for hypertelorism with a duplication of the soft-tissue nasion and glabella. Between the 2 nasal dorsums, there was a small cutaneous depression with a lacrimal fistula in the midline. Surgical treatment included the first stage of primary lip and nose repair and the second stage of palatoplasty. The patient was followed up at the age of 10 years showing satisfactory results for both aesthetic and functional aspects. Further management in the future will be required for the hypertelorism and nasal deformity.

  12. Duplication of lower lip and mandible--a rare diprosopus.

    Science.gov (United States)

    Suhaili, D N Pengiran; Somasundaram, S; Lau, S H; Ajura, A J; Roslan, A R; Ramli, R

    2011-01-01

    Diprosopus or duplication of the lower lip and mandible is a very rare congenital anomaly. We report this unusual case occurring in a girl who presented to our hospital at the age of 4 months. Surgery and problems related to this anomaly are discussed. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  13. Exposing region duplication through local geometrical color invariant features

    Science.gov (United States)

    Gong, Jiachang; Guo, Jichang

    2015-05-01

    Many advanced image-processing softwares are available for tampering images. How to determine the authenticity of an image has become an urgent problem. Copy-move is one of the most common image forgery operations. Many methods have been proposed for copy-move forgery detection (CMFD). However, most of these methods are designed for grayscale images without any color information used. They are usually not suitable when the duplicated regions have little structure or have undergone various transforms. We propose a CMFD method using local geometrical color invariant features to detect duplicated regions. The method starts by calculating the color gradient of the inspected image. Then, we directly take the color gradient as the input for scale invariant features transform (SIFT) to extract color-SIFT descriptors. Finally, keypoints are matched and clustered before their geometrical relationship is estimated to expose the duplicated regions. We evaluate the detection performance and computational complexity of the proposed method together with several popular CMFD methods on a public database. Experimental results demonstrate the efficacy of the proposed method in detecting duplicated regions with various transforms and poor structure.

  14. Recombination facilitates neofunctionalization of duplicate genes via originalization

    Directory of Open Access Journals (Sweden)

    Huang Ren

    2010-06-01

    Full Text Available Abstract Background Recently originalization was proposed to be an effective way of duplicate-gene preservation, in which recombination provokes the high frequency of original (or wild-type allele on both duplicated loci. Because the high frequency of wild-type allele might drive the arising and accumulating of advantageous mutation, it is hypothesized that recombination might enlarge the probability of neofunctionalization (Pneo of duplicate genes. In this article this hypothesis has been tested theoretically. Results Results show that through originalization recombination might not only shorten mean time to neofunctionalizaiton, but also enlarge Pneo. Conclusions Therefore, recombination might facilitate neofunctionalization via originalization. Several extensive applications of these results on genomic evolution have been discussed: 1. Time to nonfunctionalization can be much longer than a few million generations expected before; 2. Homogenization on duplicated loci results from not only gene conversion, but also originalization; 3. Although the rate of advantageous mutation is much small compared with that of degenerative mutation, Pneo cannot be expected to be small.

  15. Intragenic duplication: a novel mutational mechanism in hereditary pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, Maiken T; Geisz, Andrea; Brusgaard, Klaus

    2011-01-01

    In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide of cationic...

  16. Antegrade pyelography in ureteric duplications with obstructed upper segments

    International Nuclear Information System (INIS)

    Macpherson, R.I.; Kaufman, J.M.

    1983-01-01

    Percutaneous puncture under fluoroscopic control followed by antegrade pyelography was employed in three children, two of them neonates, suspected of having complete duplication of the ureter with obstructed upper segments on the basis of the excretory pyelographic and ultrasonographic findings. This simple, uncomplicated and definitive method confirmed the diagnosis and demonstrated the course, termination and effects of the dilated ectopic ureter

  17. Cryptorchidism due to chromosome 5q inversion duplication.

    Science.gov (United States)

    Dutta, M K; Gundgurthi, A; Garg, M K; Pakhetr, R

    2013-12-01

    We present a 15 year old boy who was born out of a non consanguineous marriage, and presented with bilateral cryptorchidism, mental retardation, facial dysmorphism, hypergonadotrophic hypogonadism with failure of anatomical and biochemical localisation of testes. Karyotype analysis showed 46 XY with inverted duplication on chromosome 5q22-31.

  18. Verification and characterization of chromosome duplication in haploid maize.

    Science.gov (United States)

    de Oliveira Couto, E G; Resende Von Pinho, E V; Von Pinho, R G; Veiga, A D; de Carvalho, M R; de Oliveira Bustamante, F; Nascimento, M S

    2015-06-26

    Doubled haploid technology has been used by various private companies. However, information regarding chromosome duplication methodologies, particularly those concerning techniques used to identify duplication in cells, is limited. Thus, we analyzed and characterized artificially doubled haploids using microsatellites molecular markers, pollen viability, and flow cytometry techniques. Evaluated material was obtained using two different chromosome duplication protocols in maize seeds considered haploids, resulting from the cross between the haploid inducer line KEMS and 4 hybrids (GNS 3225, GNS 3032, GNS 3264, and DKB 393). Fourteen days after duplication, plant samples were collected and assessed by flow cytometry. Further, the plants were transplanted to a field, and samples were collected for DNA analyses using microsatellite markers. The tassels were collected during anthesis for pollen viability analyses. Haploid, diploid, and mixoploid individuals were detected using flow cytometry, demonstrating that this technique was efficient for identifying doubled haploids. The microsatellites markers were also efficient for confirming the ploidies preselected by flow cytometry and for identifying homozygous individuals. Pollen viability showed a significant difference between the evaluated ploidies when the Alexander and propionic-carmin stains were used. The viability rates between the plodies analyzed show potential for fertilization.

  19. Association of anorectal malformation with anal and rectal duplication

    Directory of Open Access Journals (Sweden)

    Karla A. Santos-Jasso

    2014-08-01

    We present three cases of rectal duplications with anorectal malforma- tion with recto-perineal fistula and colonic duplication. Two of them with delayed diagnosis and bowel obstruction, treated with laparotomy, colostomy and side-to-side anastomosis of the proximal colonic duplica- tion; in the third case the diagnosis of the colonic and rectal duplication was made during a colostomy opening. For definitive correction, the three patients underwent abdomino-perineal approach and side-to-side anastomosis of the rectal duplication, placement of the rectum within the muscle complex, and later on colostomy closure. In a fourth patient with anorectal malformation and colostomy after birth, the perineal electro-stimulation showed two muscle complexes. A posterior sagittal approach in both showed two separate blind rectal pouches; an end- to-side anastomosis of the dilated rectum was made, and the muscle complex with stronger contraction was used for the anoplasty. The posterior sagittal approach is the best surgical option to preserve the muscle complex, with a better prognosis for rectal continence.

  20. Obscure bleeding colonic duplication responds to proton pump inhibitor therapy.

    Science.gov (United States)

    Jacques, Jérémie; Projetti, Fabrice; Legros, Romain; Valgueblasse, Virginie; Sarabi, Matthieu; Carrier, Paul; Fredon, Fabien; Bouvier, Stéphane; Loustaud-Ratti, Véronique; Sautereau, Denis

    2013-09-21

    We report the case of a 17-year-old male admitted to our academic hospital with massive rectal bleeding. Since childhood he had reported recurrent gastrointestinal bleeding and had two exploratory laparotomies 5 and 2 years previously. An emergency abdominal computed tomography scan, gastroscopy and colonoscopy, performed after hemodynamic stabilization, were considered normal. High-dose intravenous proton pump inhibitor (PPI) therapy was initiated and bleeding stopped spontaneously. Two other massive rectal bleeds occurred 8 h after each cessation of PPI which led to a hemostatic laparotomy after negative gastroscopy and small bowel capsule endoscopy. This showed long tubular duplication of the right colon, with fresh blood in the duplicated colon. Obscure lower gastrointestinal bleeding is a difficult medical situation and potentially life-threatening. The presence of ulcerated ectopic gastric mucosa in the colonic duplication explains the partial efficacy of PPI therapy. Obscure gastrointestinal bleeding responding to empiric anti-acid therapy should probably evoke the diagnosis of bleeding ectopic gastric mucosa such as Meckel's diverticulum or gastrointestinal duplication, and gastroenterologists should be aware of this potential medical situation.

  1. Duplication of the urethra with communication to the rectum

    International Nuclear Information System (INIS)

    Bruce, R.; Alton, D.

    1986-01-01

    The posterior channel of duplicated urethrae usually follows a straight course to end in the perineum just inside the anal verge. This unique urethra dipped into the perineum and then turned cephalad to enter the rectum above the anus. Delineation of the course of the urethra simplified management by assisting the urologist to convert the rectal passage to a hypospadiac urethra. (orig.)

  2. Different clinical presentations, diagnostic difficulties, and management of cecal duplication.

    Science.gov (United States)

    Temiz, Abdulkerim; Oğuzkurt, Pelin; Ezer, Semire Serin; İnce, Emine; Gezer, Hasan Özkan; Hiçsönmez, Akgün

    2013-03-01

    Cecal duplications (CDs) are very rare, representing 0.4% of all gastrointestinal duplications. This study evaluates the variable clinical presentations, imaging workup, and surgical management of CDs. The records of 7 patients who underwent surgery between April 2001 and December 2011 for CD were retrospectively reviewed. Sex, age, duration of complaints, diagnostic studies, surgical intervention, and pathologic findings were recorded. The median age was 8 months, and mean age was 1.65 ± 2.88 years. Complaints were abdominal pain, rectal bleeding, vomiting, cough and dyspnea, and a prenatally detected cystic mass. The patients were referred with the diagnosis of appendicular abscess, necrotizing enterocolitis, gastrointestinal lymphoma, and intraabdominal cystic mass. Abdominal distention, signs of peritonitis, substernal retraction, fullness at right lower quadrant, and normal findings were detected on physical examination. Diagnostic imaging included plain abdominal radiography (7), ultrasonography (7), computed tomography (3), and magnetic resonance imaging (2). A cystic mass was reported on radiologic studies in 6 patients and appendicular abscess in 1. Cyst and cecum were resected, ileocolostomy was performed in 6 patients, and cyst excision was performed in 1. The diagnosis of duplication cyst was made by pathologic examination in all patients. Cecal duplications may be detected incidentally; however, they may mimic appendicular abscess, a tumor mass, or necrotizing enterocolitis. Whether cystic lesions are symptomatic, they should be excised when detected because of possible complications. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. Type IIA2 urethral duplication: report of an unusual case

    African Journals Online (AJOL)

    ultrasonography (US) showed left-sided hydroureterone- phrosis with a distended thick-walled bladder. US showed the right testis to be enlarged with increased vascularity suggestive of epididymo-orchitis. A retrograde urethro- gram showed a sagittal duplication of urethra, with the narrow dorsal urethra originating from the ...

  4. 48 CFR 1352.231-71 - Duplication of effort.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Duplication of effort. 1352.231-71 Section 1352.231-71 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE CLAUSES... benefit of the Government, and not incidental to any other work, pursuit, research, or purpose of the...

  5. The functions of word duplication in Indonesian languages

    NARCIS (Netherlands)

    Gonda, J.

    1949-01-01

    Abstract In this paper, which is not intended to give an exhaustive collection of word-types, the author tries to review and to systematize a number of the most characteristic meanings of duplication (and reduplication) in Indonesian languages and to look more closely into some aspects of these

  6. Alimentary tract duplications in children: Report of 16 years′ experience

    Directory of Open Access Journals (Sweden)

    Mohamed Zouari

    2014-01-01

    Full Text Available Background: Alimentary tract duplications (ATDs are a rare condition in children, characterised by a large pathogenic, clinical, and histological polymorphism. Surgical observation and pathologic evaluation of the resected specimens are the only way to confirm the diagnosis. In this study, we want to analyse the anatomical, clinical and therapeutic aspects of this entity. Patients and Methods: A total of 12 cases of ATD were diagnosed over a 16-year period at paediatric surgery department. The diagnosis was evoked on clinical and radiological data. Histological study of the resected specimens confirmed the diagnosis in all cases. Results: The mean age of patients at diagnosis was 41 months with a peak of incidence at the 1 st year of life (42%. Out of a total 12 cases, 10 were girls and 2 were boys. Abdominal pain and vomiting were the most frequent presenting features. Ultrasonography, tomodensitometry and magnetic resonance imaging were useful for diagnosis. ATDs were localised on the oesophagus in one case, the stomach in one case, the duodenum in four cases, the ileum in five cases, and the colon in one case. All these duplications were cystic, with three communicating duplications. All patients underwent surgery, and resection procedure was chosen according to duplication type and site. Histological study confirmed the diagnosis in all cases. Conclusion: ATDs are a rare condition in children. Diagnosis relies on histology, and treatment can only be by means of surgery. The outcome after surgery is generally favourable. Diagnosis and precocious surgery of ATDs can warn serious complications.

  7. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...

  8. A large duplication involving the IHH locus mimics acrocallosal syndrome.

    Science.gov (United States)

    Yuksel-Apak, Memnune; Bögershausen, Nina; Pawlik, Barbara; Li, Yun; Apak, Selcuk; Uyguner, Oya; Milz, Esther; Nürnberg, Gudrun; Karaman, Birsen; Gülgören, Ayan; Grzeschik, Karl-Heinz; Nürnberg, Peter; Kayserili, Hülya; Wollnik, Bernd

    2012-06-01

    Indian hedgehog (Ihh) signaling is a major determinant of various processes during embryonic development and has a pivotal role in embryonic skeletal development. A specific spatial and temporal expression of Ihh within the developing limb buds is essential for accurate digit outgrowth and correct digit number. Although missense mutations in IHH cause brachydactyly type A1, small tandem duplications involving the IHH locus have recently been described in patients with mild syndactyly and craniosynostosis. In contrast, a ∼600-kb deletion 5' of IHH in the doublefoot mouse mutant (Dbf) leads to severe polydactyly without craniosynostosis, but with craniofacial dysmorphism. We now present a patient resembling acrocallosal syndrome (ACS) with extensive polysyndactyly of the hands and feet, craniofacial abnormalities including macrocephaly, agenesis of the corpus callosum, dysplastic and low-set ears, severe hypertelorism and profound psychomotor delay. Single-nucleotide polymorphism (SNP) array copy number analysis identified a ∼900-kb duplication of the IHH locus, which was confirmed by an independent quantitative method. A fetus from a second pregnancy of the mother by a different spouse showed similar craniofacial and limb malformations and the same duplication of the IHH-locus. We defined the exact breakpoints and showed that the duplications are identical tandem duplications in both sibs. No copy number changes were observed in the healthy mother. To our knowledge, this is the first report of a human phenotype similar to the Dbf mutant and strikingly overlapping with ACS that is caused by a copy number variation involving the IHH locus on chromosome 2q35.

  9. FUNCTIONAL SPECIALIZATION OF DUPLICATED FLAVONOID BIOSYNTHESIS GENES IN WHEAT

    Directory of Open Access Journals (Sweden)

    Khlestkina E.

    2012-08-01

    Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.

  10. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  11. Divergent Evolutionary Patterns of NAC Transcription Factors Are Associated with Diversification and Gene Duplications in Angiosperm

    Directory of Open Access Journals (Sweden)

    Xiaoli Jin

    2017-06-01

    Full Text Available NAC (NAM/ATAF/CUC proteins constitute one of the biggest plant-specific transcription factor (TF families and have crucial roles in diverse developmental programs during plant growth. Phylogenetic analyses have revealed both conserved and lineage-specific NAC subfamilies, among which various origins and distinct features were observed. It is reasonable to hypothesize that there should be divergent evolutionary patterns of NAC TFs both between dicots and monocots, and among NAC subfamilies. In this study, we compared the gene duplication and loss, evolutionary rate, and selective pattern among non-lineage specific NAC subfamilies, as well as those between dicots and monocots, through genome-wide analyses of sequence and functional data in six dicot and five grass lineages. The number of genes gained in the dicot lineages was much larger than that in the grass lineages, while fewer gene losses were observed in the grass than that in the dicots. We revealed (1 uneven constitution of Clusters of Orthologous Groups (COGs and contrasting birth/death rates among subfamilies, and (2 two distinct evolutionary scenarios of NAC TFs between dicots and grasses. Our results demonstrated that relaxed selection, resulting from concerted gene duplications, may have permitted substitutions responsible for functional divergence of NAC genes into new lineages. The underlying mechanism of distinct evolutionary fates of NAC TFs shed lights on how evolutionary divergence contributes to differences in establishing NAC gene subfamilies and thus impacts the distinct features between dicots and grasses.

  12. Finding cis-regulatory modules in Drosophila using phylogenetic hidden Markov models

    DEFF Research Database (Denmark)

    Wong, Wendy S W; Nielsen, Rasmus

    2007-01-01

    MOTIVATION: Finding the regulatory modules for transcription factors binding is an important step in elucidating the complex molecular mechanisms underlying regulation of gene expression. There are numerous methods available for solving this problem, however, very few of them take advantage of th...

  13. Confocal quantification of cis-regulatory reporter gene expression in living sea urchin.

    Science.gov (United States)

    Damle, Sagar; Hanser, Bridget; Davidson, Eric H; Fraser, Scott E

    2006-11-15

    Quantification of GFP reporter gene expression at single cell level in living sea urchin embryos can now be accomplished by a new method of confocal laser scanning microscopy (CLSM). Eggs injected with a tissue-specific GFP reporter DNA construct were grown to gastrula stage and their fluorescence recorded as a series of contiguous Z-section slices that spanned the entire embryo. To measure the depth-dependent signal decay seen in the successive slices of an image stack, the eggs were coinjected with a freely diffusible internal fluorescent standard, rhodamine dextran. The measured rhodamine fluorescence was used to generate a computational correction for the depth-dependent loss of GFP fluorescence per slice. The intensity of GFP fluorescence was converted to the number of GFP molecules using a conversion constant derived from CLSM imaging of eggs injected with a measured quantity of GFP protein. The outcome is a validated method for accurately counting GFP molecules in given cells in reporter gene transfer experiments, as we demonstrate by use of an expression construct expressed exclusively in skeletogenic cells.

  14. Mapping cis-Regulatory Domains in the Human Genome UsingMulti-Species Conservation of Synteny

    Energy Technology Data Exchange (ETDEWEB)

    Ahituv, Nadav; Prabhakar, Shyam; Poulin, Francis; Rubin, EdwardM.; Couronne, Olivier

    2005-06-13

    Our inability to associate distant regulatory elements with the genes that they regulate has largely precluded their examination for sequence alterations contributing to human disease. One major obstacle is the large genomic space surrounding targeted genes in which such elements could potentially reside. In order to delineate gene regulatory boundaries we used whole-genome human-mouse-chicken (HMC) and human-mouse-frog (HMF) multiple alignments to compile conserved blocks of synteny (CBS), under the hypothesis that these blocks have been kept intact throughout evolution at least in part by the requirement of regulatory elements to stay linked to the genes that they regulate. A total of 2,116 and 1,942 CBS>200 kb were assembled for HMC and HMF respectively, encompassing 1.53 and 0.86 Gb of human sequence. To support the existence of complex long-range regulatory domains within these CBS we analyzed the prevalence and distribution of chromosomal aberrations leading to position effects (disruption of a genes regulatory environment), observing a clear bias not only for mapping onto CBS but also for longer CBS size. Our results provide a genome wide data set characterizing the regulatory domains of genes and the conserved regulatory elements within them.

  15. Identification of cis-regulatory sequences that activate transcription in the suspensor of plant embryos.

    Science.gov (United States)

    Kawashima, Tomokazu; Wang, Xingjun; Henry, Kelli F; Bi, Yuping; Weterings, Koen; Goldberg, Robert B

    2009-03-03

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the scarlet runner bean (Phaseolus coccineus) G564 gene to understand how genes are activated specifically within the suspensor during early embryo development. Previously, we showed that the G564 upstream region has a block of tandem repeats, which contain a conserved 10-bp motif (GAAAAG(C)/(T)GAA), and that deletion of these repeats results in a loss of suspensor transcription. Here, we use gain-of-function (GOF) experiments with transgenic globular-stage tobacco embryos to show that only 1 of the 5 tandem repeats is required to drive suspensor-specific transcription. Fine-scale deletion and scanning mutagenesis experiments with 1 tandem repeat uncovered a 54-bp region that contains all of the sequences required to activate transcription in the suspensor, including the 10-bp motif (GAAAAGCGAA) and a similar 10-bp-like motif (GAAAAACGAA). Site-directed mutagenesis and GOF experiments indicated that both the 10-bp and 10-bp-like motifs are necessary, but not sufficient to activate transcription in the suspensor, and that a sequence (TTGGT) between the 10-bp and the 10-bp-like motifs is also necessary for suspensor transcription. Together, these data identify sequences that are required to activate transcription in the suspensor of a plant embryo after fertilization.

  16. Systematic identification of cis-regulatory sequences active in mouse and human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Marica Grskovic

    2007-08-01

    Full Text Available Understanding the transcriptional regulation of pluripotent cells is of fundamental interest and will greatly inform efforts aimed at directing differentiation of embryonic stem (ES cells or reprogramming somatic cells. We first analyzed the transcriptional profiles of mouse ES cells and primordial germ cells and identified genes upregulated in pluripotent cells both in vitro and in vivo. These genes are enriched for roles in transcription, chromatin remodeling, cell cycle, and DNA repair. We developed a novel computational algorithm, CompMoby, which combines analyses of sequences both aligned and non-aligned between different genomes with a probabilistic segmentation model to systematically predict short DNA motifs that regulate gene expression. CompMoby was used to identify conserved overrepresented motifs in genes upregulated in pluripotent cells. We show that the motifs are preferentially active in undifferentiated mouse ES and embryonic germ cells in a sequence-specific manner, and that they can act as enhancers in the context of an endogenous promoter. Importantly, the activity of the motifs is conserved in human ES cells. We further show that the transcription factor NF-Y specifically binds to one of the motifs, is differentially expressed during ES cell differentiation, and is required for ES cell proliferation. This study provides novel insights into the transcriptional regulatory networks of pluripotent cells. Our results suggest that this systematic approach can be broadly applied to understanding transcriptional networks in mammalian species.

  17. North Carolina macular dystrophy (MCDR1) caused by a novel tandem duplication of the PRDM13 gene.

    Science.gov (United States)

    Bowne, Sara J; Sullivan, Lori S; Wheaton, Dianna K; Locke, Kirsten G; Jones, Kaylie D; Koboldt, Daniel C; Fulton, Robert S; Wilson, Richard K; Blanton, Susan H; Birch, David G; Daiger, Stephen P

    2016-01-01

    To identify the underlying cause of disease in a large family with North Carolina macular dystrophy (NCMD). A large four-generation family (RFS355) with an autosomal dominant form of NCMD was ascertained. Family members underwent comprehensive visual function evaluations. Blood or saliva from six affected family members and three unaffected spouses was collected and DNA tested for linkage to the MCDR1 locus on chromosome 6q12. Three affected family members and two unaffected spouses underwent whole exome sequencing (WES) and subsequently, custom capture of the linkage region followed by next-generation sequencing (NGS). Standard PCR and dideoxy sequencing were used to further characterize the mutation. Of the 12 eyes examined in six affected individuals, all but two had Gass grade 3 macular degeneration features. Large central excavation of the retinal and choroid layers, referred to as a macular caldera, was seen in an age-independent manner in the grade 3 eyes. The calderas are unique to affected individuals with MCDR1. Genome-wide linkage mapping and haplotype analysis of markers from the chromosome 6q region were consistent with linkage to the MCDR1 locus. Whole exome sequencing and custom-capture NGS failed to reveal any rare coding variants segregating with the phenotype. Analysis of the custom-capture NGS sequencing data for copy number variants uncovered a tandem duplication of approximately 60 kb on chromosome 6q. This region contains two genes, CCNC and PRDM13 . The duplication creates a partial copy of CCNC and a complete copy of PRDM13 . The duplication was found in all affected members of the family and is not present in any unaffected members. The duplication was not seen in 200 ethnically matched normal chromosomes. The cause of disease in the original family with MCDR1 and several others has been recently reported to be dysregulation of the PRDM13 gene, caused by either single base substitutions in a DNase 1 hypersensitive site upstream of the CCNC

  18. Genome specific PPARαB duplicates in salmonids and insights into estrogenic regulation in brown trout.

    Science.gov (United States)

    Madureira, Tânia Vieira; Pinheiro, Ivone; de Paula Freire, Rafaelle; Rocha, Eduardo; Castro, Luis Filipe; Urbatzka, Ralph

    2017-06-01

    Peroxisome proliferator-activated receptors (PPARs) are key regulators of many processes in vertebrates, such as carbohydrate and lipid metabolism. PPARα, a member of the PPAR nuclear receptor gene subfamily (NR1C1), is involved in fatty acid metabolism, namely in peroxisomal β-oxidation. Two gene paralogues, pparαA and pparαB, were described in several teleost species with their origin dating back to the teleost-specific genome duplication (3R). Given the additional salmonid-specific genome duplication (4R), four genes could be theoretically anticipated for this gene subfamily. In this work, we examined the pparα gene repertoire in brown trout, Salmo trutta f. fario. Data disclosed two pparα-like sequences in brown trout. Phylogenetic analyses further revealed that the isolated genes are most likely genome pparαB duplicates, pparαBa and pparαBb, while pparαA is apparently absent in salmonids. Both genes showed a ubiquitous mRNA expression across a panel of 11 different organs. In vitro exposed primary brown trout hepatocytes strongly suggest that pparα gene paralogues are differently regulated by ethinylestradiol (EE2). PparαBb mRNA expression significantly decreased with dosage, reaching significance after exposure to 50μM EE2, while pparαBa mRNA increased, significant at 1μM EE2. The present data enhances the understanding of pparα function and evolution in teleost, and reinforces the evidence of a potential crosstalk between estrogenic and pparα signaling pathways. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Science.gov (United States)

    Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.

  20. Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.

    Directory of Open Access Journals (Sweden)

    Nemanja Vukašinović

    Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.

  1. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Directory of Open Access Journals (Sweden)

    Olga V Popova

    Full Text Available Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida and Pycnophyes kielensis (Allomalorhagida. Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even

  2. Molecular evolution of a Y chromosome to autosome gene duplication in Drosophila.

    Science.gov (United States)

    Dyer, Kelly A; White, Brooke E; Bray, Michael J; Piqué, Daniel G; Betancourt, Andrea J

    2011-03-01

    In contrast to the rest of the genome, the Y chromosome is restricted to males and lacks recombination. As a result, Y chromosomes are unable to respond efficiently to selection, and newly formed Y chromosomes degenerate until few genes remain. The rapid loss of genes from newly formed Y chromosomes has been well studied, but gene loss from highly degenerate Y chromosomes has only recently received attention. Here, we identify and characterize a Y to autosome duplication of the male fertility gene kl-5 that occurred during the evolution of the testacea group species of Drosophila. The duplication was likely DNA based, as other Y-linked genes remain on the Y chromosome, the locations of introns are conserved, and expression analyses suggest that regulatory elements remain linked. Genetic mapping reveals that the autosomal copy of kl-5 resides on the dot chromosome, a tiny autosome with strongly suppressed recombination. Molecular evolutionary analyses show that autosomal copies of kl-5 have reduced polymorphism and little recombination. Importantly, the rate of protein evolution of kl-5 has increased significantly in lineages where it is on the dot versus Y linked. Further analyses suggest this pattern is a consequence of relaxed purifying selection, rather than adaptive evolution. Thus, although the initial fixation of the kl-5 duplication may have been advantageous, slightly deleterious mutations have accumulated in the dot-linked copies of kl-5 faster than in the Y-linked copies. Because the dot chromosome contains seven times more genes than the Y and is exposed to selection in both males and females, these results suggest that the dot suffers the deleterious effects of genetic linkage to more selective targets compared with the Y chromosome. Thus, a highly degenerate Y chromosome may not be the worst environment in the genome, as is generally thought, but may in fact be protected from the accumulation of deleterious mutations relative to other nonrecombining

  3. Discovery of previously unidentified genomic disorders from the duplication architecture of the human genome

    NARCIS (Netherlands)

    Sharp, Andrew J.; Hansen, Sierra; Selzer, Rebecca R.; Cheng, Ze; Regan, Regina; Hurst, Jane A.; Stewart, Helen; Price, Sue M.; Blair, Edward; Hennekam, Raoul C.; Fitzpatrick, Carrie A.; Segraves, Rick; Richmond, Todd A.; Guiver, Cheryl; Albertson, Donna G.; Pinkel, Daniel; Eis, Peggy S.; Schwartz, Stuart; Knight, Samantha J. L.; Eichler, Evan E.

    2006-01-01

    Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic

  4. Efficient Algorithms for Analyzing Segmental Duplications, Deletions, and Inversions in Genomes

    Science.gov (United States)

    Kahn, Crystal L.; Mozes, Shay; Raphael, Benjamin J.

    Segmental duplications, or low-copy repeats, are common in mammalian genomes. In the human genome, most segmental duplications are mosaics consisting of pieces of multiple other segmental duplications. This complex genomic organization complicates analysis of the evolutionary history of these sequences. Earlier, we introduced a genomic distance, called duplication distance, that computes the most parsimonious way to build a target string by repeatedly copying substrings of a source string. We also showed how to use this distance to describe the formation of segmental duplications according to a two-step model that has been proposed to explain human segmental duplications. Here we describe polynomial-time exact algorithms for several extensions of duplication distance including models that allow certain types of substring deletions and inversions. These extensions will permit more biologically realistic analyses of segmental duplications in genomes.

  5. Laparoscopic excision of an ascending colon duplication cyst in an adolescent

    Directory of Open Access Journals (Sweden)

    Heather R. Nolan

    2016-01-01

    Full Text Available Colonic intestinal duplications are infrequent and rarely present past early childhood. We present the case of a large, ascending colon duplication in a 17-year-old boy resected using minimally invasive techniques. This appears to be the first reported case of a laparoscopic en-bloc ascending colon duplication resection in an adolescent. The diagnosis and management of colonic duplications are discussed.

  6. The physical map of wheat chromosome 5DS revealed gene duplications and small rearrangements

    Czech Academy of Sciences Publication Activity Database

    Akpinar, B.A.; Magni, F.; Yuce, M.; Lucas, S. J.; Šimková, Hana; Šafář, Jan; Vautrin, S.; Berges, H.; Cattonaro, F.; Doležel, Jaroslav; Budak, H.

    2015-01-01

    Roč. 16, JUN 13 (2015) ISSN 1471-2164 R&D Projects: GA ČR GBP501/12/G090; GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : Triticum aestivum * 5DS * Hexaploid wheat Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.867, year: 2015

  7. Rectal duplications accompanying rectovestibular fistula: report of two cases.

    Science.gov (United States)

    Pampal, Arzu; Ozbayoglu, Asli; Kaya, Cem; Pehlivan, Yildiz; Poyraz, Aylar; Ozen, I Onur; Percin, Ferda E; Demirogullari, Billur

    2013-08-01

    Rectal duplication (RD) cysts are rare congenital anomalies that can be diagnosed with the presence of another opening in the perineum. They seldom accompany anorectal malformations (ARM). Two cases of RD accompanying ARM at opposite ends of the phenotypic spectrum, are described. A 3-month-old baby and a 2-year-old girl with ARM were scheduled for posterior sagittal anorectoplasty. The infant had an orifice at the anal dimple and the other had an orifice at the vestibulum posterior to the rectovestibular fistula. The infant presented with no other anomalies whereas the older one presented with an unusual coexistence of caudal duplication and caudal regression syndromes. Perioperatively both orifices were found to be related to retrorectal cysts, and were excised. Clinicians should always be alert when dealing with complex malformations. Because these malformations have variable anatomical and clinical presentations, they can represent a diagnostic and therapeutic challenge. © 2013 The Authors. Pediatrics International © 2013 Japan Pediatric Society.

  8. Recurrent rectal prolapse caused by colonic duplication in a dog.

    Science.gov (United States)

    Landon, B P; Abraham, L A; Charles, J A; Edwards, G A

    2007-09-01

    A 9-month-old female Shar Pei cross-bred dog was presented with a history of recurrent rectal prolapse over 7 months. Repeated reduction and anal purse string sutures and subsequent incisional colopexy failed to prevent recurrent rectal prolapse. Digital rectal examination following reduction of the prolapse identified a faeces-filled sac within the ventral wall of the rectum and an orifice in the ventral colonic wall, cranial to the pubic brim. A ventral, communicating tubular colonic duplication was diagnosed by means of a barium enema. Surgical excision of the duplicated colonic tube was performed via a caudal ventral midline laparotomy. At 20 weeks post-operation, there has been no recurrence of rectal prolapse.

  9. Reversion in variants from a duplication strain of Aspergillus nidulans

    International Nuclear Information System (INIS)

    Menezes, E.M.; Azevedo, J.L.

    1978-01-01

    Strains of Aspergillus nidulans with a chromosome segment in duplicate, one in normal position and one translocated to another chromosome, are unstable at mitosis. In addition to variants which result from deletions in either of the duplicate segments, which usually have improved morphology, they produce variants with deteriorated morphology. Three deteriorated variants reverted frequently to parental type morphology, both spontaneously and after ultra-violet treatment. Of six reversions analysed genetically, five were due to suppressors and one was probably due to back mutation. The suppressors segregated as single genes and were not linked to the mutation which they suppress. The instability of these so-called 'deteriorated' variants is discussed in relation to mitotic instability phenomena in A. nidulans. (orig.) [de

  10. Comprehensive review of the duplication 3q syndrome and report of a patient with Currarino syndrome and de novo duplication 3q26.32-q27.2.

    Science.gov (United States)

    Dworschak, G C; Crétolle, C; Hilger, A; Engels, H; Korsch, E; Reutter, H; Ludwig, M

    2017-05-01

    Partial duplications of the long arm of chromosome 3, dup(3q), are a rare but well-described condition, sharing features of Cornelia de Lange syndrome. Around two thirds of cases are derived from unbalanced translocations, whereas pure dup(3q) have rarely been reported. Here, we provide an extensive review of the literature on dup(3q). This search revealed several patients with caudal malformations and anomalies, suggesting that caudal malformations or anomalies represent an inherent phenotypic feature of dup(3q). In this context, we report a patient with a pure de novo duplication 3q26.32-q27.2. The patient had the clinical diagnosis of Currarino syndrome (CS) (characterized by the triad of sacral anomalies, anorectal malformations and a presacral mass) and additional features, frequently detected in patients with a dup(3q). Mutations within the MNX1 gene were found to be causative in CS but no MNX1 mutation could be detected in our patient. Our comprehensive search for candidate genes located in the critical region of the duplication 3q syndrome, 3q26.3-q27, revealed a so far neglected phenotypic overlap of dup(3q) and the Pierpont syndrome, associated with a mutation of the TBL1XR1 gene on 3q26.32. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Duplication of the glans penis manifested at puberty.

    Science.gov (United States)

    Gentileschi, S; Bracaglia, R; Seccia, A; Farallo, E

    2006-01-01

    We report the case of a complete duplication of the glans, with prepuce and a blind end urethra just proximal to the dorsal aspect of the balanopreputial fold. The malformation was not evident at birth and during childhood, and became manifest only at puberty, with the growth of the external genitalia. It was not associated with other urinary malformations. Surgical excision was easy and uneventful.

  12. Delusion of fetal duplication in a Capgras patient.

    Science.gov (United States)

    Silva, J A; Leong, G B; Longhitano, M; Botello, T E

    1991-02-01

    A case of Capgras syndrome in a pregnant patient is described. In addition to perceiving living family members as impostors, she believed that there was a double or twin of her fetus. She conceptualized her "twins" differently than the way she viewed doubles of family members. Her fetus may represent the youngest "person" to have been duplicated. The relationship of Capgras syndrome to misidentification phenomena is discussed.

  13. Grebe syndrome with bilateral fibular hemimelia and thumb duplication

    International Nuclear Information System (INIS)

    Rao, Narasimha; Joseph, Benjamin

    2002-01-01

    Grebe syndrome is a rare recessively inherited form of short-limbed dwarfism. Among the skeletal anomalies reported in the past, complete fibular hemimelia and thumb duplication have not been documented. We report a case of Grebe syndrome with these associated anomalies and review the various skeletal anomalies reported in the literature related to this syndrome. Awareness of the skeletal anomalies that can occur in this syndrome should enable an accurate diagnosis. (orig.)

  14. Grebe syndrome with bilateral fibular hemimelia and thumb duplication

    Energy Technology Data Exchange (ETDEWEB)

    Rao, Narasimha; Joseph, Benjamin [Department of Orthopaedics, Kasturba Medical College, Karnataka State (India)

    2002-03-01

    Grebe syndrome is a rare recessively inherited form of short-limbed dwarfism. Among the skeletal anomalies reported in the past, complete fibular hemimelia and thumb duplication have not been documented. We report a case of Grebe syndrome with these associated anomalies and review the various skeletal anomalies reported in the literature related to this syndrome. Awareness of the skeletal anomalies that can occur in this syndrome should enable an accurate diagnosis. (orig.)

  15. Efficient image duplicated region detection model using sequential block clustering

    Czech Academy of Sciences Publication Activity Database

    Sekeh, M. A.; Maarof, M. A.; Rohani, M. F.; Mahdian, Babak

    2013-01-01

    Roč. 10, č. 1 (2013), s. 73-84 ISSN 1742-2876 Institutional support: RVO:67985556 Keywords : Image forensic * Copy–paste forgery * Local block matching Subject RIV: IN - Informatics, Computer Science Impact factor: 0.986, year: 2013 http://library.utia.cas.cz/separaty/2013/ZOI/mahdian-efficient image duplicated region detection model using sequential block clustering.pdf

  16. Whole Genome and Tandem Duplicate Retention facilitated Glucosinolate Pathway Diversification in the Mustard Family.

    NARCIS (Netherlands)

    Hofberger, J.A.; Lyons, E.; Edger, P.P.; Pires, J.C.; Schranz, M.E.

    2013-01-01

    Plants share a common history of successive whole genome duplication (WGD) events retaining genomic patterns of duplicate gene copies (ohnologs) organized in conserved syntenic blocks. Duplication was often proposed to affect the origin of novel traits during evolution. However, genetic evidence

  17. Partial craniofacial duplication: a review of the literature and case report.

    Science.gov (United States)

    Costa, Melinda A; Borzabadi-Farahani, Ali; Lara-Sanchez, Pedro A; Schweitzer, Daniela; Jacobson, Lia; Clarke, Noreen; Hammoudeh, Jeffery; Urata, Mark M; Magee, William P

    2014-06-01

    Diprosopus (Greek; di-, "two" + prosopon, "face"), or craniofacial duplication, is a rare craniofacial anomaly referring to the complete duplication of facial structures. Partial craniofacial duplication describes a broad spectrum of congenital anomalies, including duplications of the oral cavity. This paper describes a 15 month-old female with a duplicated oral cavity, mandible, and maxilla. A Tessier type 7 cleft, midline meningocele, and duplicated hypophysis were also present. The preoperative evaluation, surgical approach, postoperative results, and a review of the literature are presented. The surgical approach was designed to preserve facial nerve innervation to the reconstructed cheek and mouth. The duplicated mandible and maxilla were excised and the remaining left maxilla was bone grafted. Soft tissue repair included closure of the Tessier type VII cleft. Craniofacial duplication remains a rare entity that is more common in females. The pathophysiology remains incompletely characterized, but is postulated to be due to duplication of the notochord, as well as duplication of mandibular growth centres. While diprosopus is a severe deformity often associated with anencephaly, patients with partial duplication typically benefit from surgical treatment. Managing craniofacial duplication requires a detailed preoperative evaluation as well as a comprehensive, staged treatment plan. Long-term follow up is needed appropriately to address ongoing craniofacial deformity. Published by Elsevier Ltd.

  18. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    NARCIS (Netherlands)

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes.

  19. Adenocarcinoma within a rectal duplication cyst: case report and literature review.

    Science.gov (United States)

    Michael, D; Cohen, C R; Northover, J M

    1999-05-01

    Intestinal duplications are uncommon but recognised developmental anomalies. Duplications of the rectum are the most uncommon of these anomalies. They may present with perianal fistulae, bleeding, a pelvic mass or symptoms produced by a mass, or, rarely, malignant change. We present a case of an adenocarcinoma within a rectal duplication cyst which was initially thought to be inoperable but was treated by radical surgery.

  20. Cep63 and cep152 cooperate to ensure centriole duplication.

    Directory of Open Access Journals (Sweden)

    Nicola J Brown

    Full Text Available Centrosomes consist of two centrioles embedded in pericentriolar material and function as the main microtubule organising centres in dividing animal cells. They ensure proper formation and orientation of the mitotic spindle and are therefore essential for the maintenance of genome stability. Centrosome function is crucial during embryonic development, highlighted by the discovery of mutations in genes encoding centrosome or spindle pole proteins that cause autosomal recessive primary microcephaly, including Cep63 and Cep152. In this study we show that Cep63 functions to ensure that centriole duplication occurs reliably in dividing mammalian cells. We show that the interaction between Cep63 and Cep152 can occur independently of centrosome localisation and that the two proteins are dependent on one another for centrosomal localisation. Further, both mouse and human Cep63 and Cep152 cooperate to ensure efficient centriole duplication by promoting the accumulation of essential centriole duplication factors upstream of SAS-6 recruitment and procentriole formation. These observations describe the requirement for Cep63 in maintaining centriole number in dividing mammalian cells and further establish the order of events in centriole formation.

  1. Operative correction and follow-up of craniofacial duplication.

    Science.gov (United States)

    Kotrikova, Bibiana; Hassfeld, Stefan; Steiner, Hans H; Hähnel, Stefan; Krempien, Robert; Mühling, Joachim

    2007-03-01

    Anterior craniofacial duplication (diprosopus) is an extremely rare form of conjoined twins. The children share a single trunk with normal extremities and varying degrees of facial malformation. Duplication of specific structures, such as the nose (diprosopus dirrhinus), eyes (diprosopus tetraophthalmus), and ears, is possible. The authors present a case of partial facial duplication (diprosopus dirrhinus) in a male infant. The clinical and radiographic findings and the surgical correction and follow-up are described. In a single surgical session, the authors were able to achieve not only a functionally but also an aesthetically acceptable result. In the postoperative course, the child showed nearly normal growth and satisfactory psychosocial and motor development. However, 40 months postoperatively, we noticed a tendency of the orbitae to diverge (i.e., toward hypertelorism). The surgical management of complex craniofacial malformations such as diprosopus needs a precise morphologic analysis of the patient's deformity followed by a clear treatment plan. A staged reconstructive approach is carried out to coincide with facial growth patterns and brain and eye function. If the interorbital distance in our patient increases progressively, a second operation for reduction of the interorbital distance may be necessary.

  2. Using sea urchin gametes and zygotes to investigate centrosome duplication.

    Science.gov (United States)

    Sluder, Greenfield

    2016-01-01

    Centriole structure and function in the sea urchin zygote parallel those in mammalian somatic cells. Here, I briefly introduce the properties and attributes of the sea urchin system that make it an attractive platform for the study of centrosome and centriole duplication. These attributes apply to all echinoderms readily available from commercial suppliers: sea urchins, sand dollars, and starfish. I list some of the practical aspects of the system that make it a cost- and time-effective system for experimental work and then list properties that are a "tool kit" that can be used to conduct studies that would not be practical, or in some cases not possible, with mammalian somatic cells. Since centrioles organize and localize the pericentriolar material that nucleates the astral arrays of microtubules (Bobinnec et al. in J Cell Biol 143(6):1575-1589, 1998), the pattern of aster duplication over several cell cycles can be used as a reliable measure for centriole duplication (Sluder and Rieder in J Cell Biol 100(3):887-896, 1985). Descriptions of the methods my laboratory has used to handle and image echinoderm zygotes are reviewed in Sluder et al. (Methods Cell Biol 61:439-472, 1999). Also included is a bibliography of papers that describe additional methods.

  3. The detection of large deletions or duplications in genomic DNA.

    Science.gov (United States)

    Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

    2002-11-01

    While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

  4. Sox genes in grass carp (Ctenopharyngodon idella with their implications for genome duplication and evolution

    Directory of Open Access Journals (Sweden)

    Tong Jingou

    2006-11-01

    Full Text Available Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella, one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes has two co-orthologs in grass carp, and the duplication of Sox4 and Sox11 occurred before the divergence of grass carp and zebrafish, which support the "fish-specific whole-genome duplication" theory. An estimation for the origin of grass carp based on the molecular clock using Sox1, Sox3 and Sox11 genes as markers indicates that grass carp (subfamily Leuciscinae and zebrafish (subfamily Danioninae diverged approximately 60 million years ago. The potential uses of Sox genes as markers in revealing the evolutionary history of grass carp are discussed.

  5. Duplication of the External Auditory Canal: Two Cases and a Review of the Literature

    Science.gov (United States)

    Goudakos, John K.; Blioskas, Sarantis; Psillas, George; Vital, Victor; Markou, Konstantinos

    2012-01-01

    The objective of the present paper is to describe the clinical presentation, diagnostic process, surgical treatment, and outcome of 2 patients with first branchial cleft anomaly. The first case was an 8-year-old girl presented with an elastic lesion located in the left infra-auricular area, in close relation with the lobule, duplicating the external auditory canal. The magnetic resonance imaging revealed a lesion, appearing as a rather well-circumscribed mass within the left parotid gland and duplicating the ear canal. A superficial parotidectomy was subsequently performed, with total excision of the cyst. The second patient was a 15-year-old girl presented with a congenital fistula of the right lateral neck. At superficial parotidectomy, a total excision of the fistula was performed. During the operation the tract was recorded to lay between the branches of the facial nerve, extending with a blind ending canal parallel to the external acoustic meatus. Conclusively, first branchial cleft anomalies are rare malformations with cervical, parotid, or auricular clinical manifestations. Diagnosis of first branchial cleft lesions is achieved mainly through careful physical examination. Complete surgical excision with wide exposure of the lesion is essential in order to achieve permanent cure and avoid recurrence. PMID:23213587

  6. Duplication of the External Auditory Canal: Two Cases and a Review of the Literature

    Directory of Open Access Journals (Sweden)

    John K. Goudakos

    2012-01-01

    Full Text Available The objective of the present paper is to describe the clinical presentation, diagnostic process, surgical treatment, and outcome of 2 patients with first branchial cleft anomaly. The first case was an 8-year-old girl presented with an elastic lesion located in the left infra-auricular area, in close relation with the lobule, duplicating the external auditory canal. The magnetic resonance imaging revealed a lesion, appearing as a rather well-circumscribed mass within the left parotid gland and duplicating the ear canal. A superficial parotidectomy was subsequently performed, with total excision of the cyst. The second patient was a 15-year-old girl presented with a congenital fistula of the right lateral neck. At superficial parotidectomy, a total excision of the fistula was performed. During the operation the tract was recorded to lay between the branches of the facial nerve, extending with a blind ending canal parallel to the external acoustic meatus. Conclusively, first branchial cleft anomalies are rare malformations with cervical, parotid, or auricular clinical manifestations. Diagnosis of first branchial cleft lesions is achieved mainly through careful physical examination. Complete surgical excision with wide exposure of the lesion is essential in order to achieve permanent cure and avoid recurrence.

  7. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  8. Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

    International Nuclear Information System (INIS)

    Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja; Tan, Qihua; Jochumsen, Kirsten; Fritzner, Niels; Brusgaard, Klaus; Dahlgaard, Jesper; Kruse, Torben A.

    2006-01-01

    The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips was three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation

  9. Duplications involving a conserved regulatory element downstream of BMP2 are associated with brachydactyly type A2

    DEFF Research Database (Denmark)

    Dathe, Katarina; Kjaer, Klaus W; Brehm, Anja

    2009-01-01

    Autosomal-dominant brachydactyly type A2 (BDA2), a limb malformation characterized by hypoplastic middle phalanges of the second and fifth fingers, has been shown to be due to mutations in the Bone morphogenetic protein receptor 1B (BMPR1B) or in its ligand Growth and differentiation factor 5 (GDF5......). A linkage analysis performed in a mutation-negative family identified a novel locus for BDA2 on chromosome 20p12.3 that incorporates the gene for Bone morphogenetic protein 2 (BMP2). No point mutation was identified in BMP2, so a high-density array CGH analysis covering the critical interval...... within the identified duplication. Our results reveal an additional functional mechanism for the pathogenesis of BDA2, which is duplication of a regulatory element that affects the expression of BMP2 in the developing limb....

  10. A de novo 11p12-p15.4 duplication in a patient with pharmacoresistant epilepsy, mental retardation, and dysmorphisms.

    Science.gov (United States)

    Coppola, Antonietta; Striano, Pasquale; Gimelli, Stefania; Ciampa, Clotilde; Santulli, Lia; Caranci, Ferdinando; Zuffardi, Orsetta; Gimelli, Giorgio; Striano, Salvatore; Zara, Federico

    2010-03-01

    We report a 22-year-old male patient with pharmacoresistant epilepsy, mental retardation and dysmorphisms. Standard cytogenetic analysis revealed a de novo interstitial duplication of the short arm of chromosome 11 (11p). High density array-CGH analysis showed that the rearrangement spans about 35Mb on chromosome 11p12-p15.4. Duplications of 11p are rare and usually involve the distal part of the chromosome arm (11p15), being not associated with epilepsy, whereas our patient showed a unique epileptic phenotype associated with mental retardation and dysmorphic features. The role of some rearranged genes in epilepsy pathogenesis in this patient is also discussed.

  11. The large soybean (Glycine max) WRKY TF family expanded by segmental duplication events and subsequent divergent selection among subgroups.

    Science.gov (United States)

    Yin, Guangjun; Xu, Hongliang; Xiao, Shuyang; Qin, Yajuan; Li, Yaxuan; Yan, Yueming; Hu, Yingkao

    2013-10-03

    WRKY genes encode one of the most abundant groups of transcription factors in higher plants, and its members regulate important biological process such as growth, development, and responses to biotic and abiotic stresses. Although the soybean genome sequence has been published, functional studies on soybean genes still lag behind those of other species. We identified a total of 133 WRKY members in the soybean genome. According to structural features of their encoded proteins and to the phylogenetic tree, the soybean WRKY family could be classified into three groups (groups I, II, and III). A majority of WRKY genes (76.7%; 102 of 133) were segmentally duplicated and 13.5% (18 of 133) of the genes were tandemly duplicated. This pattern was not apparent in Arabidopsis or rice. The transcriptome atlas revealed notable differential expression in either transcript abundance or in expression patterns under normal growth conditions, which indicated wide functional divergence in this family. Furthermore, some critical amino acids were detected using DIVERGE v2.0 in specific comparisons, suggesting that these sites have contributed to functional divergence among groups or subgroups. In addition, site model and branch-site model analyses of positive Darwinian selection (PDS) showed that different selection regimes could have affected the evolution of these groups. Sites with high probabilities of having been under PDS were found in groups I, II c, II e, and III. Together, these results contribute to a detailed understanding of the molecular evolution of the WRKY gene family in soybean. In this work, all the WRKY genes, which were generated mainly through segmental duplication, were identified in the soybean genome. Moreover, differential expression and functional divergence of the duplicated WRKY genes were two major features of this family throughout their evolutionary history. Positive selection analysis revealed that the different groups have different evolutionary rates

  12. Adenocarcinoma arising in rectal duplication cyst: case report and review of the literature.

    Science.gov (United States)

    Shivnani, Anand T; Small, William; Benson, Al; Rao, Sambasiva; Talamonti, Mark S

    2004-11-01

    Duplication cyst of the gastrointestinal (GI) tract is a rare congenital anomaly, and rectal duplication cysts comprise a small fraction these cases. Most patients present for the first time in adulthood, and the origin of rectal duplication cysts is unclear. Prior series document malignant transformation in approximately 20 per cent of cases. The following case report describes a carcinoma arising in a rectal duplication cyst. Given the lack of data demonstrating adequate control for patients with adenocarcinoma arising in a rectal duplication cyst and our experience with this patient, we recommend all patients undergo multidisciplinary evaluation prior to any therapy.

  13. Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

    Science.gov (United States)

    Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

    2012-11-02

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

  14. Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

    Science.gov (United States)

    Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

    2012-01-01

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

  15. Android Emotions Revealed

    DEFF Research Database (Denmark)

    Vlachos, Evgenios; Schärfe, Henrik

    2012-01-01

    This work presents a method for designing facial interfaces for sociable android robots with respect to the fundamental rules of human affect expression. Extending the work of Paul Ekman towards a robotic direction, we follow the judgment-based approach for evaluating facial expressions to test...... findings are based on the results derived from a number of judgments, and suggest that before programming the facial expressions of a Geminoid, the Original should pass through the proposed procedure. According to our recommendations, the facial expressions of an android should be tested by judges, even...... in which case an android robot like the Geminoid|DK –a duplicate of an Original person- reveals emotions convincingly; when following an empirical perspective, or when following a theoretical one. The methodology includes the processes of acquiring the empirical data, and gathering feedback on them. Our...

  16. 22q11.2q13 duplication including SOX10 causes sex-reversal and peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, Waardenburg syndrome, and Hirschsprung disease.

    Science.gov (United States)

    Falah, Nadia; Posey, Jennifer E; Thorson, Willa; Benke, Paul; Tekin, Mustafa; Tarshish, Brocha; Lupski, James R; Harel, Tamar

    2017-04-01

    Diagnosis of genetic syndromes may be difficult when specific components of a disorder manifest at a later age. We present a follow up of a previous report [Seeherunvong et al., (2004); AJMGA 127: 149-151], of an individual with 22q duplication and sex-reversal syndrome. The subject's phenotype evolved to include peripheral and central demyelination, Waardenburg syndrome type IV, and Hirschsprung disease (PCWH; MIM 609136). DNA microarray analysis defined the duplication at 22q11.2q13, including SOX10. Sequencing of the coding region of SOX10 did not reveal any mutations. Our data suggest that SOX10 duplication can cause disorders of sex development and PCWH, supporting the hypothesis that SOX10 toxic gain of function rather than dominant negative activity underlies PCWH. © 2017 Wiley Periodicals, Inc.

  17. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu

    2016-09-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.

  18. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes1[OPEN

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu

    2016-01-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883

  19. Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.

    Science.gov (United States)

    Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M

    2017-08-01

    Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

  20. Bias and efficiency loss in regression estimates due to duplicated observations: a Monte Carlo simulation

    Directory of Open Access Journals (Sweden)

    Francesco Sarracino

    2017-04-01

    Full Text Available Recent studies documented that survey data contain duplicate records. We assess how duplicate records affect regression estimates, and we evaluate the effectiveness of solutions to deal with duplicate records. Results show that the chances of obtaining unbiased estimates when data contain 40 doublets (about 5% of the sample range between 3.5% and 11.5% depending on the distribution of duplicates. If 7 quintuplets are present in the data (2% of the sample, then the probability of obtaining biased estimates ranges between 11% and 20%. Weighting the duplicate records by the inverse of their multiplicity, or dropping superfluous duplicates outperform other solutions in all considered scenarios. Our results illustrate the risk of using data in presence of duplicate records and call for further research on strategies to analyze affected data.

  1. Sheep skeletal muscle transcriptome analysis reveals muscle growth regulatory lncRNAs.

    Science.gov (United States)

    Chao, Tianle; Ji, Zhibin; Hou, Lei; Wang, Jin; Zhang, Chunlan; Wang, Guizhi; Wang, Jianmin

    2018-01-01

    As widely distributed domestic animals, sheep are an important species and the source of mutton. In this study, we aimed to evaluate the regulatory lncRNAs associated with muscle growth and development between high production mutton sheep (Dorper sheep and Qianhua Mutton Merino sheep) and low production mutton sheep (Small-tailed Han sheep). In total, 39 lncRNAs were found to be differentially expressed. Using co-expression analysis and functional annotation, 1,206 co-expression interactions were found between 32 lncRNAs and 369 genes, and 29 of these lncRNAs were found to be associated with muscle development, metabolism, cell proliferation and apoptosis. lncRNA-mRNA interactions revealed 6 lncRNAs as hub lncRNAs. Moreover, three lncRNAs and their associated co-expressed genes were demonstrated by cis-regulatory gene analyses, and we also found a potential regulatory relationship between the pseudogene lncRNA LOC101121401 and its parent gene FTH1. This study provides a genome-wide resolution of lncRNA and mRNA regulation in muscles from mutton sheep.

  2. Species-Specific Mechanisms of Neuron Subtype Specification Reveal Evolutionary Plasticity of Amniote Brain Development

    Directory of Open Access Journals (Sweden)

    Tadashi Nomura

    2018-03-01

    Full Text Available Summary: Highly ordered brain architectures in vertebrates consist of multiple neuron subtypes with specific neuronal connections. However, the origin of and evolutionary changes in neuron specification mechanisms remain unclear. Here, we report that regulatory mechanisms of neuron subtype specification are divergent in developing amniote brains. In the mammalian neocortex, the transcription factors (TFs Ctip2 and Satb2 are differentially expressed in layer-specific neurons. In contrast, these TFs are co-localized in reptilian and avian dorsal pallial neurons. Multi-potential progenitors that produce distinct neuronal subtypes commonly exist in the reptilian and avian dorsal pallium, whereas a cis-regulatory element of avian Ctip2 exhibits attenuated transcription suppressive activity. Furthermore, the neuronal subtypes distinguished by these TFs are not tightly associated with conserved neuronal connections among amniotes. Our findings reveal the evolutionary plasticity of regulatory gene functions that contribute to species differences in neuronal heterogeneity and connectivity in developing amniote brains. : Neuronal heterogeneity is essential for assembling intricate neuronal circuits. Nomura et al. find that species-specific transcriptional mechanisms underlie diversities of excitatory neuron subtypes in mammalian and non-mammalian brains. Species differences in neuronal subtypes and connections suggest functional plasticity of regulatory genes for neuronal specification during amniote brain evolution. Keywords: Ctip2, Satb2, multi-potential progenitors, transcriptional regulation, neuronal connectivity

  3. Germline or somatic GPR101 duplication leads to X-linked acrogigantism: a clinico-pathological and genetic study.

    Science.gov (United States)

    Iacovazzo, Donato; Caswell, Richard; Bunce, Benjamin; Jose, Sian; Yuan, Bo; Hernández-Ramírez, Laura C; Kapur, Sonal; Caimari, Francisca; Evanson, Jane; Ferraù, Francesco; Dang, Mary N; Gabrovska, Plamena; Larkin, Sarah J; Ansorge, Olaf; Rodd, Celia; Vance, Mary L; Ramírez-Renteria, Claudia; Mercado, Moisés; Goldstone, Anthony P; Buchfelder, Michael; Burren, Christine P; Gurlek, Alper; Dutta, Pinaki; Choong, Catherine S; Cheetham, Timothy; Trivellin, Giampaolo; Stratakis, Constantine A; Lopes, Maria-Beatriz; Grossman, Ashley B; Trouillas, Jacqueline; Lupski, James R; Ellard, Sian; Sampson, Julian R; Roncaroli, Federico; Korbonits, Márta

    2016-06-01

    Non-syndromic pituitary gigantism can result from AIP mutations or the recently identified Xq26.3 microduplication causing X-linked acrogigantism (XLAG). Within Xq26.3, GPR101 is believed to be the causative gene, and the c.924G > C (p.E308D) variant in this orphan G protein-coupled receptor has been suggested to play a role in the pathogenesis of acromegaly.We studied 153 patients (58 females and 95 males) with pituitary gigantism. AIP mutation-negative cases were screened for GPR101 duplication through copy number variation droplet digital PCR and high-density aCGH. The genetic, clinical and histopathological features of XLAG patients were studied in detail. 395 peripheral blood and 193 pituitary tumor DNA samples from acromegaly patients were tested for GPR101 variants.We identified 12 patients (10 females and 2 males; 7.8 %) with XLAG. In one subject, the duplicated region only contained GPR101, but not the other three genes in found to be duplicated in the previously reported patients, defining a new smallest region of overlap of duplications. While females presented with germline mutations, the two male patients harbored the mutation in a mosaic state. Nine patients had pituitary adenomas, while three had hyperplasia. The comparison of the features of XLAG, AIP-positive and GPR101&AIP-negative patients revealed significant differences in sex distribution, age at onset, height, prolactin co-secretion and histological features. The pathological features of XLAG-related adenomas were remarkably similar. These tumors had a sinusoidal and lobular architecture. Sparsely and densely granulated somatotrophs were admixed with lactotrophs; follicle-like structures and calcifications were commonly observed. Patients with sporadic of familial acromegaly did not have an increased prevalence of the c.924G > C (p.E308D) GPR101 variant compared to public databases.In conclusion, XLAG can result from germline or somatic duplication of GPR101. Duplication of GPR101

  4. On Computing Breakpoint Distances for Genomes with Duplicate Genes.

    Science.gov (United States)

    Shao, Mingfu; Moret, Bernard M E

    2017-06-01

    A fundamental problem in comparative genomics is to compute the distance between two genomes in terms of its higher level organization (given by genes or syntenic blocks). For two genomes without duplicate genes, we can easily define (and almost always efficiently compute) a variety of distance measures, but the problem is NP-hard under most models when genomes contain duplicate genes. To tackle duplicate genes, three formulations (exemplar, maximum matching, and any matching) have been proposed, all of which aim to build a matching between homologous genes so as to minimize some distance measure. Of the many distance measures, the breakpoint distance (the number of nonconserved adjacencies) was the first one to be studied and remains of significant interest because of its simplicity and model-free property. The three breakpoint distance problems corresponding to the three formulations have been widely studied. Although we provided last year a solution for the exemplar problem that runs very fast on full genomes, computing optimal solutions for the other two problems has remained challenging. In this article, we describe very fast, exact algorithms for these two problems. Our algorithms rely on a compact integer-linear program that we further simplify by developing an algorithm to remove variables, based on new results on the structure of adjacencies and matchings. Through extensive experiments using both simulations and biological data sets, we show that our algorithms run very fast (in seconds) on mammalian genomes and scale well beyond. We also apply these algorithms (as well as the classic orthology tool MSOAR) to create orthology assignment, then compare their quality in terms of both accuracy and coverage. We find that our algorithm for the "any matching" formulation significantly outperforms other methods in terms of accuracy while achieving nearly maximum coverage.

  5. Enhancement of RNA synthesis by promoter duplication in tombusviruses

    International Nuclear Information System (INIS)

    Panavas, T.; Panaviene, Z.; Pogany, J.; Nagy, P.D.

    2003-01-01

    Replication of tombusviruses, small plus-strand RNA viruses of plants, is regulated by cis-acting elements present in the viral RNA. The role of cis-acting elements can be studied in vitro by using a partially purified RNA-dependent RNA polymerase (RdRp) preparation obtained from tombusvirus-infected plants , Virology 276, 279- 288). Here, we demonstrate that the minus-strand RNA of tombusviruses contains, in addition to the 3'-terminal minimal plus-strand initiation promoter, a second cis-acting element, termed the promoter proximal enhancer (PPE). The PPE element enhanced RNA synthesis by almost threefold from the adjacent minimal promoter in the in vitro assay. The sequence of the PPE element is 70% similar to the minimal promoter, suggesting that sequence duplication of the minimal promoter may have been the mechanism leading to the generation of the PPE. Consistent with this proposal, replacement of the PPE element with the minimal promoter, which resulted in a perfectly duplicated promoter region, preserved its enhancer-like function. In contrast, mutagenesis of the PPE element or its replacement with an artificial G/C-rich sequence abolished its stimulative effect on initiation of RNA synthesis in vitro. In vivo experiments are also consistent with the role of the PPE element in enhancement of tombusvirus replication. Sequence comparison of several tombusviruses and related carmoviruses further supports the finding that duplication of minimal promoter sequences may have been an important mechanism during the evolution of cis-acting elements in tombusviruses and related RNA viruses

  6. Dietary intakes of pesticides based on community duplicate diet samples.

    Science.gov (United States)

    Melnyk, Lisa Jo; Xue, Jianping; Brown, G Gordon; McCombs, Michelle; Nishioka, Marcia; Michael, Larry C

    2014-01-15

    The calculation of dietary intake of selected pesticides was accomplished using food samples collected from individual representatives of a defined demographic community using a community duplicate diet approach. A community of nine participants was identified in Apopka, FL from which intake assessments of organophosphate (OP) and pyrethroid pesticides were made. From these nine participants, sixty-seven individual samples were collected and subsequently analyzed by gas chromatography/mass spectrometry. Measured concentrations were used to estimate dietary intakes for individuals and for the community. Individual intakes of total OP and pyrethroid pesticides ranged from 6.7 to 996 ng and 1.2 to 16,000 ng, respectively. The community intake was 256 ng for OPs and 3430 ng for pyrethroid pesticides. The most commonly detected pesticide was permethrin, but the highest overall intake was of bifenthrin followed by esfenvalerate. These data indicate that the community in Apopka, FL, as represented by the nine individuals, was potentially exposed to both OP and pyrethroid pesticides at levels consistent with a dietary model and other field studies in which standard duplicate diet samples were collected. Higher levels of pyrethroid pesticides were measured than OPs, which is consistent with decreased usage of OPs. The diversity of pyrethroid pesticides detected in food samples was greater than expected. Continually changing pesticide usage patterns need to be considered when determining analytes of interest for large scale epidemiology studies. The Community Duplicate Diet Methodology is a tool for researchers to meet emerging exposure measurement needs that will lead to more accurate assessments of intake which may enhance decisions for chemical regulation. Successfully determining the intake of pesticides through the dietary route will allow for accurate assessments of pesticide exposures to a community of individuals, thereby significantly enhancing the research benefit

  7. Evolutionary diversification of plant shikimate kinase gene duplicates.

    Directory of Open Access Journals (Sweden)

    Geoffrey Fucile

    2008-12-01

    Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.

  8. Tubular sigmoid duplication in an adult man: an interesting incidental finding.

    Science.gov (United States)

    Asour, Amani; Kim, Hyun-Kyung; Arya, Shobhit; Hepworth, Clive

    2017-11-12

    A 61-year-old man attended an outpatient colorectal clinic for a chronic, non-specific abdominal pain, associated with rectal bleeding. He underwent a number of investigations including a CT pneumocolon, which revealed an incidental finding of 20 cm of additional sigmoid colon. This case is interesting because tubular sigmoid duplication is an extremely unusual condition, rarely diagnosed in adults; only a few cases have been reported of this condition in the adult population. Our team chose to treat this patient conservatively, in order to avoid putting the patient at risk of an unnecessary surgery. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  9. Duplicated facial nerve trunk with a first branchial cleft cyst.

    Science.gov (United States)

    Hinson, Drew; Poteet, Perry; Bower, Charles

    2014-03-01

    First branchial cleft anomalies are rare and their various anatomical relationships to the facial nerve have been described. We encountered a 15-year-old female with a type II first branchial cleft cyst presenting as a right neck mass that we found during surgical excision to transverse two main facial nerve trunks. To our knowledge, this is the first reported case of a first branchial cleft anomaly in conjunction with a duplicated facial nerve trunk. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

  10. 10p Duplication characterized by fluorescence in situ hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Wiktor, A.; Feldman, G.L.; Van Dyke, D.L.; Kratkoczki, P.; Ditmars, D.M. Jr. [Henry Ford Hospital, Detroit, MI (United States)

    1994-09-01

    We describe a patient with severe failure to thrive, mild-moderate developmental delay, cleft lip and palate, and other anomalies. Routine cytogenetic analysis documented a de novo chromosome rearrangement involving chromosome 4, but the origin of the derived material was unknown. Using chromosome specific painting probes, the karyotype was defined as 46,XY,der(4)t(4;10)(q35;p11.23). Characterization of the dup(10p) by fluorescence in situ hybridization (FISH) analysis provides another example of the usefulness of this technology in identifying small deletions, duplications, or supernumerary marker chromosomes. 19 refs., 4 figs.

  11. Intragenic Duplication A Novel Mutational Mechanism in Hereditary Pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, M. T.; Geisz, A.; Brusgaard, K.

    2011-01-01

    OBJECTIVES: In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide...... pancreatitis. The accelerated activation of p.K23_I24insIDK by cathepsin B is a unique biochemical property not found in any other pancreatitis-associated trypsinogen mutant. In contrast, the robust autoactivation of the novel mutant confirms the notion that increased autoactivation is a disease......-relevant mechanism in hereditary pancreatitis....

  12. Urethral Triplication Without Bladder Duplication: Endourologic Diagnosis and Management

    Science.gov (United States)

    Ortiz, Ruben; Burgos, Laura; Angulo, Jose Maria

    2018-01-01

    Abstract Urethral triplication is a rare congenital anomaly of the lower urinary system, with urethra ending in glans. At the beginning of toilet training, urine output was observed along the rectum. Rigid cystoscopy shows a perineal urethra starting in the posterior urethra. Subsequently, flexible cystoscopy showed entry of epispadic urethra in the bladder immediately superior to the bladder neck. It was running parallel to primary urethra. Then, we observed two most frequent types of urethral duplication in the sagittal plane in a single patient. PMID:29675475

  13. Bionic Duplication of Fresh Navodon septentrionalis Fish Surface Structures

    Directory of Open Access Journals (Sweden)

    Bing Qu

    2011-01-01

    Full Text Available Biomimetic superhydrophobic surface was fabricated by replicating topography of the fresh fish skin surface of Navodon septentrionalis with polydimethylsiloxane (PDMS elastomer. A two-step replicating method was developed to make the surface structure of the fresh fish skin be replicated with high fidelity. After duplication, it was found that the static contact angle of the replica was as large as 173°. Theoretic analysis based on Young's and Cassie-Baxter (C-B model was performed to explain the relationship between structure and hydrophobicity.

  14. Tracheal Atresia with Segmental Esophageal Duplication: An Unusual Anatomic Arrangement.

    Science.gov (United States)

    Gaerty, Kirsten; Thomas, Joseph T; Petersen, Scott; Tan, Edwin; Kumar, Sailesh; Gardener, Glenn; Armes, Jane

    2016-01-01

    An unusual anatomic configuration of segmental tracheal agenesis/atresia with esophageal duplication on autopsy in a fetus that demised in utero at 29 weeks is reported. The mother was scanned initially for a cardiac anomaly at 20 weeks and on follow-up scan at 27 weeks had polyhydramnios and underwent amnioreduction. The final autopsy diagnosis was vertebral, ano-rectal, cardiac, tracheoesophageal, renal, and limb malformations (VACTERL). We discuss the autopsy findings along with the embryological mechanisms and compare the configuration with Floyd's classification for tracheal agenesis. The difficulties in prenatal diagnosis are discussed.

  15. Clinical presentation of epignathus teratoma with cleft palate; and duplication of cranial base, tongue, mandible, and pituitary gland.

    Science.gov (United States)

    Maeda, Yujiro; Suenaga, Hideyuki; Sugiyama, Madoka; Saijo, Hideto; Hoshi, Kazuto; Mori, Yoshiyuki; Takato, Tsuyoshi

    2013-07-01

    A 2-day-old girl was diagnosed with an oral epignathus teratoma and an uncommon combination of orofacial malformations including cleft palate; tongue, mandible, cranial base, cervical vertebrae, lower lip, and pituitary gland duplications; and fistula of the glabella and lower lip. Computed tomography revealed that the mass within the nasal cavity had tooth-like calcifications and protruded into the nasopharynx and oral cavity. It was implanted on the anterior wall of the body of the sphenoid bone and was accompanied with mandibular duplication. Magnetic resonance imaging detected duplication of the pituitary gland and confirmed the absence of intracranial communication of the nasopharyngeal mass. The teratoma did not cause respiratory obstruction; however, the patient required continuous nasogastric tube feeding. Usually, an epignathus teratoma is associated with few midline defects and can be corrected with multiple interventions at different time points. The current study describes the surgical procedure comprising excision of the tumor along with reconstructive surgeries of the mandible, tongue, and fistulae undertaken when the infant reached 7 months of age. The cleft palate was repaired at 18 months of age using the Kaplan buccal flap method. Histopathologic examination confirmed a grade 0 teratoma covered with keratinized skin and containing pilosebaceous and sweat glands, adipose tissue, and smooth muscle. The long-term success of this intervention was determined at the follow-up examination conducted at 3 years of age, with no signs of the teratoma recurrence observed.

  16. Biological consequences of ancient gene acquisition and duplication in the large genome soil bacterium, ""solibacter usitatus"" strain Ellin6076

    Energy Technology Data Exchange (ETDEWEB)

    Challacombe, Jean F [Los Alamos National Laboratory; Eichorst, Stephanie A [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Kuske, Cheryl R [Los Alamos National Laboratory; Hauser, Loren [ORNL; Land, Miriam [ORNL

    2009-01-01

    Bacterial genome sizes range from ca. 0.5 to 10Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Sequenced genomes of strains in the phylum Acidobacteria revealed that 'Solibacter usistatus' strain Ellin6076 harbors a 9.9 Mb genome. This large genome appears to have arisen by horizontal gene transfer via ancient bacteriophage and plasmid-mediated transduction, as well as widespread small-scale gene duplications. This has resulted in an increased number of paralogs that are potentially ecologically important (ecoparalogs). Low amino acid sequence identities among functional group members and lack of conserved gene order and orientation in the regions containing similar groups of paralogs suggest that most of the paralogs were not the result of recent duplication events. The genome sizes of cultured subdivision 1 and 3 strains in the phylum Acidobacteria were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 1 were estimated to have smaller genome sizes ranging from ca. 2.0 to 4.8 Mb, whereas members of subdivision 3 had slightly larger genomes, from ca. 5.8 to 9.9 Mb. It is hypothesized that the large genome of strain Ellin6076 encodes traits that provide a selective metabolic, defensive and regulatory advantage in the variable soil environment.

  17. Positive selection of a duplicated UV-sensitive visual pigment coincides with wing pigment evolution in Heliconius butterflies

    Science.gov (United States)

    Briscoe, Adriana D.; Bybee, Seth M.; Bernard, Gary D.; Yuan, Furong; Sison-Mangus, Marilou P.; Reed, Robert D.; Warren, Andrew D.; Llorente-Bousquets, Jorge; Chiao, Chuan-Chin

    2010-01-01

    The butterfly Heliconius erato can see from the UV to the red part of the light spectrum with color vision proven from 440 to 640 nm. Its eye is known to contain three visual pigments, rhodopsins, produced by an 11-cis-3-hydroxyretinal chromophore together with long wavelength (LWRh), blue (BRh) and UV (UVRh1) opsins. We now find that H. erato has a second UV opsin mRNA (UVRh2)—a previously undescribed duplication of this gene among Lepidoptera. To investigate its evolutionary origin, we screened eye cDNAs from 14 butterfly species in the subfamily Heliconiinae and found both copies only among Heliconius. Phylogeny-based tests of selection indicate positive selection of UVRh2 following duplication, and some of the positively selected sites correspond to vertebrate visual pigment spectral tuning residues. Epi-microspectrophotometry reveals two UV-absorbing rhodopsins in the H. erato eye with λmax = 355 nm and 398 nm. Along with the additional UV opsin, Heliconius have also evolved 3-hydroxy-DL-kynurenine (3-OHK)-based yellow wing pigments not found in close relatives. Visual models of how butterflies perceive wing color variation indicate this has resulted in an expansion of the number of distinguishable yellow colors on Heliconius wings. Functional diversification of the UV-sensitive visual pigments may help explain why the yellow wing pigments of Heliconius are so colorful in the UV range compared to the yellow pigments of close relatives lacking the UV opsin duplicate. PMID:20133601

  18. Method of duplicating film using the CR system. Evaluation of detectability in a simulated nodule

    International Nuclear Information System (INIS)

    Fukuyama, Atsushi; Ando, Satoshi; Maeda, Kayoko; Ida, Kazushi; Suzuki, Tomoaki; Fukuyama, Kouichi; Hasegawa, Takeo

    2005-01-01

    Since film processors used for screen-film systems have been decreasing recently, it is becoming difficult to develop duplicating film (Dup film) used conventionally. The purpose of this study was to evaluate the usefulness of the method of duplicating film using a computed radiography (CR) system. The process of duplicating film using CR is to eliminate energy accumulated on the imaging plate (IP) using white light, to accumulate energy on the whole surface, and to place the original film in piles. After an exposure of white light, duplicated films can be obtained by CR system. In order to evaluate the reproducibiliy of our system, duplicated films were read by experienced observers and receiver operating characteristic (ROC) analysis was carried out. Observers read 50 images with a simulated nodule and 50 images without a simulated nodule. The average Az values were 0.94 for the original films, 0.91 for films duplicated using Dup film, and 0.90 for films duplicated using the CR system. When the two-tailed paired-T test was performed for each result, there were no statistically significant differences at p<0.05. The detectability of a simulated nodule for films duplicated using the CR system did not differ from the detectability of films duplicated using Dup film. This method may be a reasonable substitute for the conventional duplication system. (author)

  19. Recurrent Gene Duplication Leads to Diverse Repertoires of Centromeric Histones in Drosophila Species.

    Science.gov (United States)

    Kursel, Lisa E; Malik, Harmit S

    2017-06-01

    Despite their essential role in the process of chromosome segregation in most eukaryotes, centromeric histones show remarkable evolutionary lability. Not only have they been lost in multiple insect lineages, but they have also undergone gene duplication in multiple plant lineages. Based on detailed study of a handful of model organisms including Drosophila melanogaster, centromeric histone duplication is considered to be rare in animals. Using a detailed phylogenomic study, we find that Cid, the centromeric histone gene, has undergone at least four independent gene duplications during Drosophila evolution. We find duplicate Cid genes in D. eugracilis (Cid2), in the montium species subgroup (Cid3, Cid4) and in the entire Drosophila subgenus (Cid5). We show that Cid3, Cid4, and Cid5 all localize to centromeres in their respective species. Some Cid duplicates are primarily expressed in the male germline. With rare exceptions, Cid duplicates have been strictly retained after birth, suggesting that they perform nonredundant centromeric functions, independent from the ancestral Cid. Indeed, each duplicate encodes a distinct N-terminal tail, which may provide the basis for distinct protein-protein interactions. Finally, we show some Cid duplicates evolve under positive selection whereas others do not. Taken together, our results support the hypothesis that Drosophila Cid duplicates have subfunctionalized. Thus, these gene duplications provide an unprecedented opportunity to dissect the multiple roles of centromeric histones. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae.

    Science.gov (United States)

    Takahashi, Tadashi; Sato, Atsushi; Ogawa, Masahiro; Hanya, Yoshiki; Oguma, Tetsuya

    2014-08-01

    We describe here the first successful construction of a targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae. The targeted tandem chromosomal duplication was achieved by using strains that had a 5'-deleted pyrG upstream of the region targeted for tandem chromosomal duplication and a 3'-deleted pyrG downstream of the target region. Consequently,strains bearing a 210-kb targeted tandem chromosomal duplication near the centromeric region of chromosome 8 and strains bearing a targeted tandem chromosomal duplication of a 700-kb region of chromosome 2 were successfully constructed. The strains bearing the tandem chromosomal duplication were efficiently obtained from the regenerated protoplast of the parental strains. However, the generation of the chromosomal duplication did not depend on the introduction of double-stranded breaks(DSBs) by I-SceI. The chromosomal duplications of these strains were stably maintained after five generations of culture under nonselective conditions. The strains bearing the tandem chromosomal duplication in the 700-kb region of chromosome 2 showed highly increased protease activity in solid-state culture, indicating that the duplication of large chromosomal segments could be a useful new breeding technology and gene analysis method.

  1. Drosophila duplication hotspots are associated with late-replicating regions of the genome.

    Directory of Open Access Journals (Sweden)

    Margarida Cardoso-Moreira

    2011-11-01

    Full Text Available Duplications play a significant role in both extremes of the phenotypic spectrum of newly arising mutations: they can have severe deleterious effects (e.g. duplications underlie a variety of diseases but can also be highly advantageous. The phenotypic potential of newly arisen duplications has stimulated wide interest in both the mutational and selective processes shaping these variants in the genome. Here we take advantage of the Drosophila simulans-Drosophila melanogaster genetic system to further our understanding of both processes. Regarding mutational processes, the study of two closely related species allows investigation of the potential existence of shared duplication hotspots, and the similarities and differences between the two genomes can be used to dissect its underlying causes. Regarding selection, the difference in the effective population size between the two species can be leveraged to ask questions about the strength of selection acting on different classes of duplications. In this study, we conducted a survey of duplication polymorphisms in 14 different lines of D. simulans using tiling microarrays and combined it with an analogous survey for the D. melanogaster genome. By integrating the two datasets, we identified duplication hotspots conserved between the two species. However, unlike the duplication hotspots identified in mammalian genomes, Drosophila duplication hotspots are not associated with sequences of high sequence identity capable of mediating non-allelic homologous recombination. Instead, Drosophila duplication hotspots are associated with late-replicating regions of the genome, suggesting a link between DNA replication and duplication rates. We also found evidence supporting a higher effectiveness of selection on duplications in D. simulans than in D. melanogaster. This is also true for duplications segregating at high frequency, where we find evidence in D. simulans that a sizeable fraction of these mutations is

  2. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.

    Science.gov (United States)

    Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet

    2016-02-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.

  3. New insights into the nutritional regulation of gluconeogenesis in carnivorous rainbow trout (Oncorhynchus mykiss): a gene duplication trail.

    Science.gov (United States)

    Marandel, Lucie; Seiliez, Iban; Véron, Vincent; Skiba-Cassy, Sandrine; Panserat, Stéphane

    2015-07-01

    The rainbow trout (Oncorhynchus mykiss) is considered to be a strictly carnivorous fish species that is metabolically adapted for high catabolism of proteins and low utilization of dietary carbohydrates. This species consequently has a "glucose-intolerant" phenotype manifested by persistent hyperglycemia when fed a high-carbohydrate diet. Gluconeogenesis in adult fish is also poorly, if ever, regulated by carbohydrates, suggesting that this metabolic pathway is involved in this specific phenotype. In this study, we hypothesized that the fate of duplicated genes after the salmonid-specific 4th whole genome duplication (Ss4R) may have led to adaptive innovation and that their study might provide new elements to enhance our understanding of gluconeogenesis and poor dietary carbohydrate use in this species. Our evolutionary analysis of gluconeogenic genes revealed that pck1, pck2, fbp1a, and g6pca were retained as singletons after Ss4r, while g6pcb1, g6pcb2, and fbp1b ohnolog pairs were maintained. For all genes, duplication may have led to sub- or neofunctionalization. Expression profiles suggest that the gluconeogenesis pathway remained active in trout fed a no-carbohydrate diet. When trout were fed a high-carbohydrate diet (30%), most of the gluconeogenic genes were non- or downregulated, except for g6pbc2 ohnologs, whose RNA levels were surprisingly increased. This study demonstrates that Ss4R in trout involved adaptive innovation via gene duplication and via the outcome of the resulting ohnologs. Indeed, maintenance of ohnologous g6pcb2 pair may contribute in a significant way to the glucose-intolerant phenotype of trout and may partially explain its poor use of dietary carbohydrates. Copyright © 2015 the American Physiological Society.

  4. P110 and P140 cytadherence-related proteins are negative effectors of terminal organelle duplication in Mycoplasma genitalium.

    Directory of Open Access Journals (Sweden)

    Oscar Q Pich

    Full Text Available BACKGROUND: The terminal organelle is a complex structure involved in many aspects of the biology of mycoplasmas such as cell adherence, motility or cell division. Mycoplasma genitalium cells display a single terminal organelle and duplicate this structure prior to cytokinesis in a coordinated manner with the cell division process. Despite the significance of the terminal organelle in mycoplasma virulence, little is known about the mechanisms governing its duplication. METHODOLOGY/PRINCIPAL FINDINGS: In this study we describe the isolation of a mutant, named T192, with a transposon insertion close to the 3' end of the mg192 gene encoding for P110 adhesin. This mutant shows a truncated P110, low levels of P140 and P110 adhesins, a large number of non-motile cells and a high frequency of new terminal organelle formation. Further analyses revealed that the high rates of new terminal organelle formation in T192 cells are a direct consequence of the reduced levels of P110 and P140 rather than to the expression of a truncated P110. Consistently, the phenotype of the T192 mutant was successfully complemented by the reintroduction of the mg192 WT allele which restored the levels of P110 and P140 to those of the WT strain. Quantification of DAPI-stained DNA also showed that the increase in the number of terminal organelles in T192 cells is not accompanied by a higher DNA content, indicating that terminal organelle duplication does not trigger DNA replication in mycoplasmas. CONCLUSIONS/SIGNIFICANCE: Our results demonstrate the existence of a mechanism regulating terminal organelle duplication in M. genitalium and strongly suggest the implication of P110 and P140 adhesins in this mechanism.

  5. STRIDE: Species Tree Root Inference from Gene Duplication Events.

    Science.gov (United States)

    Emms, David M; Kelly, Steven

    2017-12-01

    The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  6. Rapid diagnosis of aneuploidy using segmental duplication quantitative fluorescent PCR.

    Directory of Open Access Journals (Sweden)

    Xiangdong Kong

    Full Text Available The aim of this study was use a simple and rapid procedure, called segmental duplication quantitative fluorescent polymerase chain reaction (SD-QF-PCR, for the prenatal diagnosis of fetal chromosomal aneuploidies. This method is based on the co-amplification of segmental duplications located on two different chromosomes using a single pair of fluorescent primers. The PCR products of different sizes were subsequently analyzed through capillary electrophoresis, and the aneuploidies were determined based on the relative dosage between the two chromosomes. Each primer set, containing five pairs of primers, was designed to simultaneously detect aneuploidies located on chromosomes 21, 18, 13, X and Y in a single reaction. We applied these two primer sets to DNA samples isolated from individuals with trisomy 21 (n = 36; trisomy 18 (n = 6; trisomy 13 (n = 4; 45, X (n = 5; 47, XXX (n = 3; 48, XXYY (n = 2; and unaffected controls (n = 40. We evaluated the performance of this method using the karyotyping results. A correct and unambiguous diagnosis with 100% sensitivity and 100% specificity, was achieved for clinical samples examined. Thus, the present study demonstrates that SD-QF-PCR is a robust, rapid and sensitive method for the diagnosis of common aneuploidies, and these analyses can be performed in less than 4 hours for a single sample, providing a competitive alternative for routine use.

  7. Enteric duplication in children: clinical presentation and outcome.

    Science.gov (United States)

    Rasool, Naima; Safdar, Chaudhry Aqeel; Ahmad, Asrar; Kanwal, Shehla

    2013-06-01

    Enteric duplication (ED) is an anomaly with varied presentations and possible involvement of the alimentary tract. Once diagnosed, resection of the lesion and the involved part of the gut is usually required. The aim of this study was to evaluate the clinical presentations, diagnostic investigations, management and outcomes of patients with ED. This was a descriptive case study conducted at the Department of Paediatric Surgery, Military Hospital, Rawalpindi, Pakistan, from January 2005 to January 2011. The medical records of all patients diagnosed with ED were retrospectively analysed with respect to age, presentation, investigations, site and type of lesion, surgical procedures, histological findings and complications. A total of nine patients were managed during the study period. The patients' ages ranged from three months to five years. Four out of nine EDs were rectal duplications. Three EDs were of the cystic type, five were of the tubular type and one was a complex mixed anomaly. Patients presented with varied symptoms, with the two most common being the presence of an abdominal mass and bleeding per rectum. Diagnosis was mainly achieved based on magnetic resonance imaging and computed tomography, although Meckel's scan provided accurate diagnosis in three of the nine patients. All the cysts were resected without any major complications, and patients were event-free during the five-year follow-up. EDs should be kept in mind when examining patients with an abdominal mass and bleeding per rectum. Meckel's scan can provide accurate diagnosis of EDs with bleeding. Prompt diagnosis and management results in satisfactory outcomes.

  8. Motion analysis for duplicate frame removal in wireless capsule endoscope

    Science.gov (United States)

    Lee, Hyun-Gyu; Choi, Min-Kook; Lee, Sang-Chul

    2011-03-01

    Wireless capsule endoscopy (WCE) has been intensively researched recently due to its convenience for diagnosis and extended detection coverage of some diseases. Typically, a full recording covering entire human digestive system requires about 8 to 12 hours for a patient carrying a capsule endoscope and a portable image receiver/recorder unit, which produces 120,000 image frames on average. In spite of the benefits of close examination, WCE based test has a barrier for quick diagnosis such that a trained diagnostician must examine a huge amount of images for close investigation, normally over 2 hours. The main purpose of our work is to present a novel machine vision approach to reduce diagnosis time by automatically detecting duplicated recordings caused by backward camera movement, typically containing redundant information, in small intestine. The developed technique could be integrated with a visualization tool which supports intelligent inspection method, such as automatic play speed control. Our experimental result shows high accuracy of the technique by detecting 989 duplicate image frames out of 10,000, equivalently to 9.9% data reduction, in a WCE video from a real human subject. With some selected parameters, we achieved the correct detection ratio of 92.85% and the false detection ratio of 13.57%.

  9. Transparency masters for mathematics revealed

    CERN Document Server

    Berman, Elizabeth

    1980-01-01

    Transparency Masters for Mathematics Revealed focuses on master diagrams that can be used for transparencies for an overhead projector or duplicator masters for worksheets. The book offers information on a compilation of master diagrams prepared by John R. Stafford, Jr., audiovisual supervisor at the University of Missouri at Kansas City. Some of the transparencies are designed to be shown horizontally. The initial three masters are number lines and grids that can be used in a mathematics course, while the others are adaptations of text figures which are slightly altered in some instances. The

  10. Comparative inference of duplicated genes produced by polyploidization in soybean genome.

    Science.gov (United States)

    Yang, Yanmei; Wang, Jinpeng; Di, Jianyong

    2013-01-01

    Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.

  11. Colonic duplication in adults: Report of two cases presenting with rectal bleeding

    Institute of Scientific and Technical Information of China (English)

    C Fotiadis; M Genetzakis; I Papandreou; EP Misiakos; E Agapitos; GC Zografos

    2005-01-01

    Gastrointestinal duplication is an uncommon congenital abnormality in two-thirds of cases manifesting before the age of 2 years. Ileal duplication is common while colonic duplication, either cystic or tubular, is a rather unusual clinical entity that remains asymptomatic and undiagnosed in most cases. Mostly occurring in pediatric patients,colonic duplication is encountered in adults only in a few cases. This study reports two cases of colonic duplication in adults. Both cases presented with rectal bleeding on admission. The study was focused on clinical, imaging,histological, and therapeutical aspects of the presenting cases. Gastrografin enema established the diagnosis in both cases. The cystic structure and the adjacent part of the colon were excised en-block. The study implies that colonic duplication, though uncommon, should be included in the differential diagnosis of rectal bleeding.

  12. Colonic duplication in adults: report of two cases presenting with rectal bleeding.

    Science.gov (United States)

    Fotiadis, C; Genetzakis, M; Papandreou, I; Misiakos, E P; Agapitos, E; Zografos, G C

    2005-08-28

    Gastrointestinal duplication is an uncommon congenital abnormality in two-thirds of cases manifesting before the age of 2 years. Ileal duplication is common while colonic duplication, either cystic or tubular, is a rather unusual clinical entity that remains asymptomatic and undiagnosed in most cases. Mostly occurring in pediatric patients, colonic duplication is encountered in adults only in a few cases. This study reports two cases of colonic duplication in adults. Both cases presented with rectal bleeding on admission. The study was focused on clinical, imaging, histological, and therapeutical aspects of the presenting cases. Gastrografin enema established the diagnosis in both cases. The cystic structure and the adjacent part of the colon were excised en-block. The study implies that colonic duplication, though uncommon, should be included in the differential diagnosis of rectal bleeding.

  13. Duplication of the vertebral artery: report of two cases and review of the literature

    International Nuclear Information System (INIS)

    Goddard, A.J.P.; Annesley-Williams, D.; Guthrie, J.A.; Weston, M.

    2001-01-01

    Duplication of the vertebral artery is rare. We report two cases in which it was an incidental finding. In the first, duplication of the right vertebral artery was demonstrated by magnetic resonance angiography (MRA) and conventional angiography. The second patient had duplication of the right vertebral artery demonstrated by MRA. We discuss the origin of this abnormality, its radiological implications and its potential clinical significance are discussed. (orig.)

  14. Craniofacial duplication (diprosopus): CT, MR imaging, and MR angiography findings case report.

    Science.gov (United States)

    Hähnel, Stefan; Schramm, Peter; Hassfeld, Stefan; Steiner, Hans H; Seitz, Angelika

    2003-01-01

    Diprosopus is one of the rarest malformations in humans. In addition to the facial structures, the cerebral frontal lobes were duplicated in this case. Three pairs of anterior cerebral arteries were detected, and the rostral parts of the superior sagittal sinus were duplicated. Computed tomography, magnetic resonance (MR) imaging, and MR angiography allowed study of the degree of duplicative changes in diprosopus, especially for planning cosmetic correction. Copyright RSNA, 2002

  15. MECP2 duplication phenotype in symptomatic females: report of three further cases

    OpenAIRE

    Novara, Francesca; Simonati, Alessandro; Sicca, Federico; Battini, Roberta; Fiori, Simona; Contaldo, Annarita; Criscuolo, Lucia; Zuffardi, Orsetta; Ciccone, Roberto

    2014-01-01

    Background Xq28 duplications, including MECP2 (methyl CpG-binding protein 2; OMIM 300005), have been identified in approximately 140 male patients presenting with hypotonia, severe developmental delay/intellectual disability, limited or absent speech and ambulation, and recurrent respiratory infections. Female patients with Xq28 duplication have been rarely reported and are usually asymptomatic. Altogether, only fifteen symptomatic females with Xq28 duplications including MECP2 have been repo...

  16. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    OpenAIRE

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  17. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    OpenAIRE

    Thomas D Cuypers; Paulien Hogeweg

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  18. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN

    Science.gov (United States)

    Li, Zhen; Van de Peer, Yves; De Smet, Riet

    2016-01-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215

  19. Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants

    OpenAIRE

    Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong

    2010-01-01

    Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

  20. Detection and correction of false segmental duplications caused by genome mis-assembly

    Science.gov (United States)

    2010-01-01

    Diploid genomes with divergent chromosomes present special problems for assembly software as two copies of especially polymorphic regions may be mistakenly constructed, creating the appearance of a recent segmental duplication. We developed a method for identifying such false duplications and applied it to four vertebrate genomes. For each genome, we corrected mis-assemblies, improved estimates of the amount of duplicated sequence, and recovered polymorphisms between the sequenced chromosomes. PMID:20219098

  1. Gastric Duplication Cyst: A Rare Congenital Disease Often Misdiagnosed in Adults

    Directory of Open Access Journals (Sweden)

    Jessica Falleti

    2013-01-01

    Full Text Available Gastrointestinal duplication is a rare congenital disease which affected more commonly the ileum, while the stomach is rarely involved. Generally diagnosed in paediatric or young age, it could be difficult to suspect a gastrointestinal duplication in adults. Herein, we report a 55-year-old male with a gastric duplication cyst found on routinely checkup for chronic hepatitis and first misdiagnosed as a gastrointestinal stromal tumor (GIST; we also discuss its embryology.

  2. Duodenal duplication cyst (DDC) communicating with the pancreatobiliary duct--a rare cause of recurrent acute pancreatitis in adults.

    Science.gov (United States)

    Bong, Jan Jin; Spalding, Duncan

    2010-01-01

    Duodenal duplication cysts (DDC) are rare congenital anomalies that usually present in infancy and childhood. Acute presentation in adults is even rarer. We report a case of a 34-year-old man who presented with recurrent acute pancreatitis and was found to have a cystic lesion in the second part of his duodenum. Further investigations revealed communication between the cystic lesion and the distal common bile duct. We describe the details of the operative approach taken to resect the DDC. We describe the differential diagnoses and the criteria for diagnosing DDC. Management options for DDC are discussed along with our recommendations.

  3. The ethics of scholarly publishing: exploring differences in plagiarism and duplicate publication across nations*

    Science.gov (United States)

    Amos, Kathleen A.

    2014-01-01

    This study explored national differences in plagiarism and duplicate publication in retracted biomedical literature. The national affiliations of authors and reasons for retraction of papers accessible through PubMed that were published from 2008 to 2012 and subsequently retracted were determined in order to identify countries with the largest numbers and highest rates of retraction due to plagiarism and duplicate publication. Authors from more than fifty countries retracted papers. While the United States retracted the most papers, China retracted the most papers for plagiarism and duplicate publication. Rates of plagiarism and duplicate publication were highest in Italy and Finland, respectively. Unethical publishing practices cut across nations. PMID:24860263

  4. The ethics of scholarly publishing: exploring differences in plagiarism and duplicate publication across nations.

    Science.gov (United States)

    Amos, Kathleen A

    2014-04-01

    This study explored national differences in plagiarism and duplicate publication in retracted biomedical literature. The national affiliations of authors and reasons for retraction of papers accessible through PubMed that were published from 2008 to 2012 and subsequently retracted were determined in order to identify countries with the largest numbers and highest rates of retraction due to plagiarism and duplicate publication. Authors from more than fifty countries retracted papers. While the United States retracted the most papers, China retracted the most papers for plagiarism and duplicate publication. Rates of plagiarism and duplicate publication were highest in Italy and Finland, respectively. Unethical publishing practices cut across nations.

  5. Error analysis of filtering operations in pixel-duplicated images of diabetic retinopathy

    Science.gov (United States)

    Mehrubeoglu, Mehrube; McLauchlan, Lifford

    2010-08-01

    In this paper, diabetic retinopathy is chosen for a sample target image to demonstrate the effectiveness of image enlargement through pixel duplication in identifying regions of interest. Pixel duplication is presented as a simpler alternative to data interpolation techniques for detecting small structures in the images. A comparative analysis is performed on different image processing schemes applied to both original and pixel-duplicated images. Structures of interest are detected and and classification parameters optimized for minimum false positive detection in the original and enlarged retinal pictures. The error analysis demonstrates the advantages as well as shortcomings of pixel duplication in image enhancement when spatial averaging operations (smoothing filters) are also applied.

  6. Network topologies and convergent aetiologies arising from deletions and duplications observed in individuals with autism.

    Science.gov (United States)

    Noh, Hyun Ji; Ponting, Chris P; Boulding, Hannah C; Meader, Stephen; Betancur, Catalina; Buxbaum, Joseph D; Pinto, Dalila; Marshall, Christian R; Lionel, Anath C; Scherer, Stephen W; Webber, Caleb

    2013-06-01

    Autism Spectrum Disorders (ASD) are highly heritable and characterised by impairments in social interaction and communication, and restricted and repetitive behaviours. Considering four sets of de novo copy number variants (CNVs) identified in 181 individuals with autism and exploiting mouse functional genomics and known protein-protein interactions, we identified a large and significantly interconnected interaction network. This network contains 187 genes affected by CNVs drawn from 45% of the patients we considered and 22 genes previously implicated in ASD, of which 192 form a single interconnected cluster. On average, those patients with copy number changed genes from this network possess changes in 3 network genes, suggesting that epistasis mediated through the network is extensive. Correspondingly, genes that are highly connected within the network, and thus whose copy number change is predicted by the network to be more phenotypically consequential, are significantly enriched among patients that possess only a single ASD-associated network copy number changed gene (p = 0.002). Strikingly, deleted or disrupted genes from the network are significantly enriched in GO-annotated positive regulators (2.3-fold enrichment, corrected p = 2×10(-5)), whereas duplicated genes are significantly enriched in GO-annotated negative regulators (2.2-fold enrichment, corrected p = 0.005). The direction of copy change is highly informative in the context of the network, providing the means through which perturbations arising from distinct deletions or duplications can yield a common outcome. These findings reveal an extensive ASD-associated molecular network, whose topology indicates ASD-relevant mutational deleteriousness and that mechanistically details how convergent aetiologies can result extensively from CNVs affecting pathways causally implicated in ASD.

  7. Delusional misidentifications and duplications: right brain lesions, left brain delusions.

    Science.gov (United States)

    Devinsky, Orrin

    2009-01-06

    When the delusional misidentification syndromes reduplicative paramnesia and Capgras syndromes result from neurologic disease, lesions are usually bifrontal and/or right hemispheric. The related disorders of confabulation and anosognosis share overlapping mechanisms and anatomic pathology. A dual mechanism is postulated for the delusional misidentification syndromes: negative effects from right hemisphere and frontal lobe dysfunction as well as positive effects from release (i.e., overactivity) of preserved left hemisphere areas. Negative effects of right hemisphere injury impair self-monitoring, ego boundaries, and attaching emotional valence and familiarity to stimuli. The unchecked left hemisphere unleashes a creative narrator from the monitoring of self, memory, and reality by the frontal and right hemisphere areas, leading to excessive and false explanations. Further, the left hemisphere's cognitive style of categorization, often into dual categories, leads it to invent a duplicate or impostor to resolve conflicting information. Delusions result from right hemisphere lesions. But it is the left hemisphere that is deluded.

  8. On face antimagic labeling of double duplication of graphs

    Science.gov (United States)

    Shobana, L.; Kuppan, R.

    2018-04-01

    A Labeling of a plane graph G is called d-antimagic if every numbers, the set of s-sided face weights is Ws={as,as+d,as+2d,...,as+(fs-1)d} for some integers as and d (as>0,d≥0),where fs is the number of s-sided faces. We allow differentsets ws of different s.In this paper, we proved the existence of face antimagic labeling of types (1,0,0),(1,0,1),(1,1,0),(0,1,1) and (1,1,1) of double duplication of all vertices by edges of a cycle graph Cn: n≥3 and a tree of order n.

  9. Bibliographic review of intestinal duplication in the pediatric patient

    International Nuclear Information System (INIS)

    Molina Campos, Cesar

    2013-01-01

    An exhaustive bibliographical review was carried out on all the clinical, diagnostic and therapeutic aspects related to intestinal duplication, to update the concepts that are exposed in the literature. An observational and descriptive study of the literature found was carried out, using as source the articles found in the National Library of Health and Social Security (BINAS) and on the Internet, in addition to the official textbook of the pediatric surgery graduate in Costa Rica. A study of updating of the clinical findings, approach and therapeutic of the pathology was carried out. A protocolization of all diagnosis, can be considered as a valuable tool to help make this diagnosis as expeditious and accurate as possible, in order to provide adequate and safe treatment to the patient, significantly reducing the risks and morbidity in surgery as definitive treatment [es

  10. Gene duplications in prokaryotes can be associated with environmental adaptation.

    Science.gov (United States)

    Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn

    2010-10-20

    Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate

  11. Gene duplications in prokaryotes can be associated with environmental adaptation

    Directory of Open Access Journals (Sweden)

    Lempicki Richard A

    2010-10-01

    Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive

  12. Oculocutaneous albinism in a patient with 17p13.2-pter duplication - a review on the molecular syndromology of 17p13 duplication.

    Science.gov (United States)

    Kucharczyk, Marzena; Jezela-Stanek, Aleksandra; Gieruszczak-Bialek, Dorota; Kugaudo, Monika; Cieslikowska, Agata; Pelc, Magdalena; Krajewska-Walasek, Malgorzata

    2015-06-01

    Chromosomal duplications involving 17p13.3 have recently been defined as a new distinctive syndrome with several diagnosed patients. Some variation is known to occur in the breakpoints of the duplicated region and, consequently, in the phenotype as well. We report on a patient, the fifth to our knowledge, a 4-year-old girl with a pure de novo subtelomeric 17p13.2-pter duplication. She presents all of the facial features described so far for this duplication and in addition, a unilateral palmar transversal crease and oculocutaneous albinism which has not been reported previously. A detailed molecular description of the reported aberration and correlation with the observed phenotypical features based on a literature review. We discuss the possible molecular etiology of albinism in regard to the mode of inheritance. The new data provided here may be useful for further genotype correlations in syndromes with oculocutaneous albinism, especially of autosomal dominant inheritance.

  13. The presence of two rare genomic syndromes, 1q21 deletion and Xq28 duplication, segregating independently in a family with intellectual disability.

    Science.gov (United States)

    Ha, Kyungsoo; Shen, Yiping; Graves, Tyler; Kim, Cheol-Hee; Kim, Hyung-Goo

    2016-01-01

    1q21 microdeletion syndrome is a rare contiguous gene deletion disorder with de novo or autosomal dominant inheritance patterns and its phenotypic features include intellectual disability, distinctive facial dysmorphism, microcephaly, cardiac abnormalities, and cataracts. MECP2 duplication syndrome is an X-linked recessive neurodevelopmental disorder characterized by intellectual disability, global developmental delay, and other neurological complications including late-onset seizures. Previously, these two different genetic syndromes have not been reported segregating independently in a same family. Here we describe two siblings carrying either a chromosome 1q21 microdeletion or a chromosome Xq28 duplication. Using a comparative genomic hybridization (CGH) array, we identified a 1.24 Mb heterozygous deletion at 1q21 resulting in the loss of 9 genes in a girl with learning disability, hypothyroidism, short stature, sensory integration disorder, and soft dysmorphic features including cupped ears and a unilateral ear pit. We also characterized a 508 kb Xq28 duplication encompassing MECP2 in her younger brother with hypotonia, poor speech, cognitive and motor impairment. The parental CGH and quantitative PCR (qPCR) analyses revealed that the 1q21 deletion in the elder sister is de novo , but the Xq28 duplication in the younger brother was originally inherited from the maternal grandmother through the mother, both of whom are asymptomatic carriers. RT-qPCR assays revealed that the affected brother has almost double the amount of MECP2 mRNA expression compared to other family members of both genders including maternal grandmother and mother who have the same Xq28 duplication with no phenotype. This suggests the X chromosome with an Xq28 duplication in the carrier females is preferentially silenced. From our understanding, this would be the first report showing the independent segregation of two genetically unrelated syndromes, 1q21 microdeletion and Xq28 duplication

  14. Duplication of 17(p11.2p11.2) in a male child with autism and severe language delay.

    Science.gov (United States)

    Nakamine, Alisa; Ouchanov, Leonid; Jiménez, Patricia; Manghi, Elina R; Esquivel, Marcela; Monge, Silvia; Fallas, Marietha; Burton, Barbara K; Szomju, Barbara; Elsea, Sarah H; Marshall, Christian R; Scherer, Stephen W; McInnes, L Alison

    2008-03-01

    Duplications of 17(p11.2p11.2) have been associated with various behavioral manifestations including attention deficits, obsessive-compulsive symptoms, autistic traits, and language delay. We are conducting a genetic study of autism and are screening all cases for submicroscopic chromosomal abnormalities, in addition to standard karyotyping, and fragile X testing. Using array-based comparative genomic hybridization analysis of data from the Affymetrix GeneChip(R) Human Mapping Array set, we detected a duplication of approximately 3.3 Mb on chromosome 17p11.2 in a male child with autism and severe expressive language delay. The duplication was confirmed by measuring the copy number of genomic DNA using quantitative polymerase chain reaction. Gene expression analyses revealed increased expression of three candidate genes for the Smith-Magenis neurobehavioral phenotype, RAI1, DRG2, and RASD1, in transformed lymphocytes from Case 81A, suggesting gene dosage effects. Our results add to a growing body of evidence suggesting that duplications of 17(p11.2p11.2) result in language delay as well as autism and related phenotypes. As Smith-Magenis syndrome is also associated with language delay, a gene involved in acquisition of language may lie within this interval. Whether a parent of origin effect, gender of the case, the presence of allelic variation, or changes in expression of genes outside the breakpoints influence the resultant phenotype remains to be determined. (c) 2007 Wiley-Liss, Inc.

  15. A Rare de novo Interstitial Duplication at 4p15.2 in a Boy with Severe Congenital Heart Defects, Limb Anomalies, Hypogonadism, and Global Developmental Delay.

    Science.gov (United States)

    Liang, Liyang; Xie, Yingjun; Shen, Yiping; Yin, Qibin; Yuan, Haiming

    2016-01-01

    Proximal 4p deletion syndrome is a relatively rare genetic condition characterized by dysmorphic facial features, limb anomalies, minor congenital heart defects, hypogonadism, cafe-au-lait spots, developmental delay, tall and thin habitus, and intellectual disability. At present, over 20 cases of this syndrome have been published. However, duplication of the same region in proximal 4p has never been reported. Here, we describe a 2-year-5-month-old boy with severe congenital heart defects, limb anomalies, hypogonadism, distinctive facial features, pre- and postnatal developmental delay, and mild cognitive impairments. A de novo 4.5-Mb interstitial duplication at 4p15.2p15.1 was detected by chromosomal microarray analysis. Next-generation sequencing was employed and confirmed the duplication, but revealed no additional pathogenic variants. Several candidate genes in this interval responsible for the complex clinical phenotype were identified, such as RBPJ, STIM2, CCKAR, and LGI2. The results suggest a novel contiguous gene duplication syndrome. © 2016 S. Karger AG, Basel.

  16. Prenatal detection of a de novo terminal inverted duplication 4p in a fetus with the Wolf-Hirschhorn syndrome phenotype.

    Science.gov (United States)

    Beaujard, M-P; Jouannic, J-M; Bessières, B; Borie, C; Martin-Luis, I; Fallet-Bianco, C; Portnoï, M-F

    2005-06-01

    To present the prenatal diagnosis of a de novo terminal inversion duplication of the short arm of chromosome 4 and a review of the literature. An amniocentesis for chromosome analysis was performed at 33 weeks' gestation because ultrasound examination showed a female fetus with multiple abnormalities consisting of severe intrauterine growth retardation, microcephaly, a cleft lip and renal hypoplasia. Cytogenetic analysis and FISH studies of the cultured amniocytes revealed a de novo terminal inversion duplication of the short arm of chromosome 4 characterized by a duplication of 4p14-p16.1 chromosome region concomitant with a terminal deletion 4p16.1-pter. The karyotype was thus: 46,XX, inv dup del (4)(:p14-->p16.1::p16.1-->qter). The parents opted to terminate the pregnancy. Fetopathological examination showed dysmorphic features and abnormalities consistent with a Wolf-Hirschhorn syndrome (WHS) diagnosis, clinical manifestations of partial 4p trisomy being mild. Although relatively rare, inverted duplications have been reported repeatedly in an increasing number of chromosomes. Only two previous cases with de novo inv dup del (4p) and one with tandem dup 4p have been reported, all of them associated with a 4pter deletion. We report the first case diagnosed prenatally. Breakpoints are variable, resulting in different abnormal phenotype. In our case, clinical manifestations resulted in a WHS phenotype.

  17. Molecular archaeology of Flaviviridae untranslated regions: duplicated RNA structures in the replication enhancer of flaviviruses and pestiviruses emerged via convergent evolution.

    Directory of Open Access Journals (Sweden)

    Dmitri J Gritsun

    Full Text Available RNA secondary structures in the 3'untranslated regions (3'UTR of the viruses of the family Flaviviridae, previously identified as essential (promoters or beneficial (enhancers for replication, have been analysed. Duplicated enhancer elements are revealed as a global feature in the evolution of the 3'UTR of distantly related viruses within the genera Flavivirus and Pestivirus. For the flaviviruses, duplicated structures occur in the 3'UTR of all four distantly related ecological virus subgroups (tick-borne, mosquito-borne, no known vector and insect-specific flaviviruses (ISFV. RNA structural differences distinguish tick-borne flaviviruses with discrete pathogenetic characteristics. For Aedes- and Culex-associated ISFV, secondary RNA structures with different conformations display numerous short ssRNA direct repeats, exposed as loops and bulges. Long quadruplicate regions comprise almost the entire 3'UTR of Culex-associated ISFV. Extended duplicated sequence and associated RNA structures were also discovered in the 3'UTR of pestiviruses. In both the Flavivirus and Pestivirus genera, duplicated RNA structures were localized to the enhancer regions of the 3'UTR suggesting an adaptive role predominantly in wild-type viruses. We propose sequence reiteration might act as a scaffold for dimerization of proteins involved in assembly of viral replicase complexes. Numerous nucleotide repeats exposed as loops/bulges might also interfere with host immune responses acting as a molecular sponge to sequester key host proteins or microRNAs.

  18. Molecular Archaeology of Flaviviridae Untranslated Regions: Duplicated RNA Structures in the Replication Enhancer of Flaviviruses and Pestiviruses Emerged via Convergent Evolution

    Science.gov (United States)

    Gritsun, Dmitri J.; Jones, Ian M.; Gould, Ernest A.; Gritsun, Tamara S.

    2014-01-01

    RNA secondary structures in the 3′untranslated regions (3′UTR) of the viruses of the family Flaviviridae, previously identified as essential (promoters) or beneficial (enhancers) for replication, have been analysed. Duplicated enhancer elements are revealed as a global feature in the evolution of the 3′UTR of distantly related viruses within the genera Flavivirus and Pestivirus. For the flaviviruses, duplicated structures occur in the 3′UTR of all four distantly related ecological virus subgroups (tick-borne, mosquito-borne, no known vector and insect-specific flaviviruses (ISFV). RNA structural differences distinguish tick-borne flaviviruses with discrete pathogenetic characteristics. For Aedes- and Culex-associated ISFV, secondary RNA structures with different conformations display numerous short ssRNA direct repeats, exposed as loops and bulges. Long quadruplicate regions comprise almost the entire 3′UTR of Culex-associated ISFV. Extended duplicated sequence and associated RNA structures were also discovered in the 3′UTR of pestiviruses. In both the Flavivirus and Pestivirus genera, duplicated RNA structures were localized to the enhancer regions of the 3′UTR suggesting an adaptive role predominantly in wild-type viruses. We propose sequence reiteration might act as a scaffold for dimerization of proteins involved in assembly of viral replicase complexes. Numerous nucleotide repeats exposed as loops/bulges might also interfere with host immune responses acting as a molecular sponge to sequester key host proteins or microRNAs. PMID:24647143

  19. Antenatal diagnosis of complete facial duplication--a case report of a rare craniofacial defect.

    Science.gov (United States)

    Rai, V S; Gaffney, G; Manning, N; Pirrone, P G; Chamberlain, P F

    1998-06-01

    We report a case of the prenatal sonographic detection of facial duplication, the diprosopus abnormality, in a twin pregnancy. The characteristic sonographic features of the condition include duplication of eyes, mouth, nose and both mid- and anterior intracranial structures. A heart-shaped abnormality of the cranial vault should prompt more detailed examination for other supportive features of this rare condition.

  20. Gene duplication, tissue-specific gene expression and sexual conflict in stalk-eyed flies (Diopsidae).

    Science.gov (United States)

    Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S

    2012-08-19

    Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.

  1. Megalourethra with Y-Type Duplication of Urethra Presented as Perianal Fistula: A Rare Case Report

    Directory of Open Access Journals (Sweden)

    Shashi Verma

    2015-01-01

    Full Text Available Megalourethra with Y-type duplication is an extremely rare anomaly. We report here one such case, diagnosed with retrograde urethrogram, which was done from both penile meatus and perianal opening simultaneously. Patient was successfully treated by laser optical internal urethrotomy (OIU, excision of duplicated urethra, and reduction urethroplasty in a single stage.

  2. Evolution of vertebrate central nervous system is accompanied by novel expression changes of duplicate genes.

    Science.gov (United States)

    Chen, Yuan; Ding, Yun; Zhang, Zuming; Wang, Wen; Chen, Jun-Yuan; Ueno, Naoto; Mao, Bingyu

    2011-12-20

    The evolution of the central nervous system (CNS) is one of the most striking changes during the transition from invertebrates to vertebrates. As a major source of genetic novelties, gene duplication might play an important role in the functional innovation of vertebrate CNS. In this study, we focused on a group of CNS-biased genes that duplicated during early vertebrate evolution. We investigated the tempo-spatial expression patterns of 33 duplicate gene families and their orthologs during the embryonic development of the vertebrate Xenopus laevis and the cephalochordate Brachiostoma belcheri. Almost all the identified duplicate genes are differentially expressed in the CNS in Xenopus embryos, and more than 50% and 30% duplicate genes are expressed in the telencephalon and mid-hindbrain boundary, respectively, which are mostly considered as two innovations in the vertebrate CNS. Interestingly, more than 50% of the amphioxus orthologs do not show apparent expression in the CNS in amphioxus embryos as detected by in situ hybridization, indicating that some of the vertebrate CNS-biased duplicate genes might arise from non-CNS genes in invertebrates. Our data accentuate the functional contribution of gene duplication in the CNS evolution of vertebrate and uncover an invertebrate non-CNS history for some vertebrate CNS-biased duplicate genes. Copyright © 2011. Published by Elsevier Ltd.

  3. Incidentally found rectal duplication during surgery for rectovestibular fistula and its management.

    Science.gov (United States)

    Balaji, Dhiraj K; Basavaraju, Mamatha

    2015-01-01

    Association of rectal duplication with rectovestibular fistula is rare. A 3-month-old patient underwent primary posterior sagittal anorectoplasty (PSARP) for rectovestibular fistula. During surgery the patient was found to have a rectal duplication (RD). We managed the case by excising the common wall and fenestrating the two lumens together and completed the PSARP.

  4. A rare association of rectal and genitourinary duplication and anorectal malformation

    Institute of Scientific and Technical Information of China (English)

    王俊; 施诚仁; 余世耀; 吴燕; 徐长辉

    2003-01-01

    @@ It is very rare to see multiple malformations occurring in both the urogenital and digestive systems in a case of congenital anorectal malformation. In this particular care, an imperforated anus occurred with other multiple malformations, including a double kidney, urethral duplication and rectal duplication, etc.

  5. Incidentally found rectal duplication during surgery for rectovestibular fistula and its management

    Directory of Open Access Journals (Sweden)

    Dhiraj K Balaji

    2015-01-01

    Full Text Available Association of rectal duplication with rectovestibular fistula is rare. A 3-month-old patient underwent primary posterior sagittal anorectoplasty (PSARP for rectovestibular fistula. During surgery the patient was found to have a rectal duplication (RD. We managed the case by excising the common wall and fenestrating the two lumens together and completed the PSARP.

  6. Tail-like Congenital Duplication of Lower Extremity (Extra Leg or ...

    African Journals Online (AJOL)

    2018-01-01

    Jan 1, 2018 ... ABSTRACT. BACKGROUND: Congenital duplication of lower extremity, either complete or incomplete is extremely rare. Only 26 cases had been reported till 2010, of which only 5 cases had feature of complete duplication. Theories have been proposed that the cause of this abnormality includes maternal ...

  7. Intestinal Duplication Cyst presenting as Volvulus: A rare case report with Review of Literatures

    Directory of Open Access Journals (Sweden)

    Prasan Kumar Hota

    2015-03-01

    Full Text Available Intestinal duplication cyst is a rare congenital anomaly occurring any where along the alimentary tract, from mouth to anus. They can present with numerous complications like perforation, bleeding or intestinal obstruction. We report a rare case  of intestinal duplication cyst of ileum with acute intestinal obstruction due to volvulus with review of literature.

  8. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Duplication and Diversification of the Hypoxia-Inducible IGFBP-1 Gene in Zebrafish

    DEFF Research Database (Denmark)

    Kamei, Hiroyasu; Lu, Ling; Jiao, Shuang

    2008-01-01

    Background: Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenabilit...

  10. 46 CFR Sec. 5 - Responsibility for duplicating copies of NSA-WORKSMALREP Contract.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Responsibility for duplicating copies of NSA-WORKSMALREP Contract. Sec. 5 Section 5 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION A-NATIONAL... INDIVIDUAL CONTRACT FOR MINOR REPAIRS-NSA-WORKSMALREP Sec. 5 Responsibility for duplicating copies of NSA...

  11. Large tubular colonic duplication in an adult treated with a small midline incision

    Science.gov (United States)

    Yong, Yuen Geng; Jung, Kyung Uk; Cho, Yong Beom; Yun, Seong Hyeon; Kim, Hee Cheol; Lee, Woo Yong

    2012-01-01

    Tubular colonic duplication presenting in adults is rare and difficult to diagnose preoperatively. Only a few cases have been reported in the literature. We report a case of a 29-year-old lady presenting with a long history of chronic constipation, abdominal mass and repeated episodes of abdominal pain. The abdominal-pelvic computed tomography scan showed segmental bowel wall thickening thought to be small bowel, and dilatation with stasis of intraluminal content. The provisional diagnosis was small bowel duplication. She was scheduled for single port laparoscopic resection. However, a T-shaped tubular colonic duplication at sigmoid colon was found intraoperatively. Resection of the large T-shaped tubular colonic duplication containing multiple impacted large fecaloma and primary anastomosis was performed. There was no perioperative complication. We report, herein, the case of a T-shaped tubular colonic duplication at sigmoid colon in an adult who was successfully treated through mini-laparotomy assisted by single port laparoscopic surgery. PMID:22403754

  12. Duplicated collecting system of a kidney complicated with hydronephrosis - diagnostic methods review: A case report

    International Nuclear Information System (INIS)

    Osmanski, P.; Plucinska, I.; Calka, K.; Kedzierski, B.; Jazwiec, P.

    2008-01-01

    Duplicated collecting system of a kidney occurs in 1.7-4.2% of the population. It is a complex, unilateral or bilateral, congenital abnormality of the pyelocalyceal system and the ureter. The 2 ureters fuse to form a single ureteral orifice or empty separately into the bladder (ureter duplex). Duplicated collecting systems with complete ureteric duplication may lead to developing vesicoureteral reflux, hydronephrosis, and urinary infection. This article presents a case of a 49-year-old woman with duplicated collecting system and hydronephrosis in the upper pole. The anomaly was diagnosed using urography, ultrasonography and computed tomography examination.The best method for diagnostics of the duplicated pyelocalyceal system complicated by hydronephrosis is computed tomography examination, especially multislice computed tomography. The authors present also the options for therapy (author)

  13. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

    Science.gov (United States)

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

    2016-10-13

    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  14. Decreased exploratory activity in a mouse model of 15q duplication syndrome; implications for disturbance of serotonin signaling.

    Directory of Open Access Journals (Sweden)

    Kota Tamada

    Full Text Available Autism spectrum disorders (ASDs have garnered significant attention as an important grouping of developmental brain disorders. Recent genomic studies have revealed that inherited or de novo copy number variations (CNVs are significantly involved in the pathophysiology of ASDs. In a previous report from our laboratory, we generated mice with CNVs as a model of ASDs, with a duplicated mouse chromosome 7C that is orthologous to human chromosome 15q11-13. Behavioral analyses revealed paternally duplicated (patDp/+ mice displayed abnormal behaviors resembling the symptoms of ASDs. In the present study, we extended these findings by performing various behavioral tests with C57BL/6J patDp/+ mice, and comprehensively measuring brain monoamine levels with ex vivo high performance liquid chromatography. Compared with wild-type controls, patDp/+ mice exhibited decreased locomotor and exploratory activities in the open field test, Y-maze test, and fear-conditioning test. Furthermore, their decreased activity levels overcame increased appetite induced by 24 hours of food deprivation in the novelty suppressed feeding test. Serotonin levels in several brain regions of adult patDp/+ mice were lower than those of wild-type control, with no concurrent changes in brain levels of dopamine or norepinephrine. Moreover, analysis of monoamines in postnatal developmental stages demonstrated reduced brain levels of serotonin in young patDp/+ mice. These findings suggest that a disrupted brain serotonergic system, especially during postnatal development, may generate the phenotypes of patDp/+ mice.

  15. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  16. Independent Origin and Global Distribution of Distinct Plasmodium vivax Duffy Binding Protein Gene Duplications.

    Directory of Open Access Journals (Sweden)

    Jessica B Hostetler

    2016-10-01

    Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.

  17. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2009-07-01

    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  18. The Prevalence of Inappropriate Image Duplication in Biomedical Research Publications

    Science.gov (United States)

    Casadevall, Arturo; Fang, Ferric C.

    2016-01-01

    ABSTRACT Inaccurate data in scientific papers can result from honest error or intentional falsification. This study attempted to determine the percentage of published papers that contain inappropriate image duplication, a specific type of inaccurate data. The images from a total of 20,621 papers published in 40 scientific journals from 1995 to 2014 were visually screened. Overall, 3.8% of published papers contained problematic figures, with at least half exhibiting features suggestive of deliberate manipulation. The prevalence of papers with problematic images has risen markedly during the past decade. Additional papers written by authors of papers with problematic images had an increased likelihood of containing problematic images as well. As this analysis focused only on one type of data, it is likely that the actual prevalence of inaccurate data in the published literature is higher. The marked variation in the frequency of problematic images among journals suggests that journal practices, such as prepublication image screening, influence the quality of the scientific literature. PMID:27273827

  19. Duplicate Address Detection Table in IPv6 Mobile Networks

    Science.gov (United States)

    Alisherov, Farkhod; Kim, Taihoon

    In IP networks, each computer or communication equipment needs an IP address. To supply enough IP addresses, the new Internet protocol IPv6 is used in next generatoion mobile communication. Although IPv6 improves the existing IPv4 Internet protocol, Duplicate Address Detection (DAD) mechanism may consume resources and suffer from long delay. DAD is used to ensure whether the IP address is unique or not. When a mobile node performs an inter-domain handoff, it will first generate a new IP and perform a DAD procedure. The DAD procedure not only wastes time but also increases the signaling load on Internet. In this paper, the author proposes a new DAD mechanism to speed up the DAD procedure. A DAD table is created in access or mobility routers in IP networks and record all IP addresses of the area. When a new IP address needs to perform DAD, it can just search in the DAD table to confirm the uniqueness of the address.

  20. Gene duplication and divergence affecting drug content in Cannabis sativa.

    Science.gov (United States)

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David

    2015-12-01

    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  1. Differential retention of metabolic genes following whole-genome duplication.

    Science.gov (United States)

    Gout, Jean-François; Duret, Laurent; Kahn, Daniel

    2009-05-01

    Classical studies in Metabolic Control Theory have shown that metabolic fluxes usually exhibit little sensitivity to changes in individual enzyme activity, yet remain sensitive to global changes of all enzymes in a pathway. Therefore, little selective pressure is expected on the dosage or expression of individual metabolic genes, yet entire pathways should still be constrained. However, a direct estimate of this selective pressure had not been evaluated. Whole-genome duplications (WGDs) offer a good opportunity to address this question by analyzing the fates of metabolic genes during the massive gene losses that follow. Here, we take advantage of the successive rounds of WGD that occurred in the Paramecium lineage. We show that metabolic genes exhibit different gene retention patterns than nonmetabolic genes. Contrary to what was expected for individual genes, metabolic genes appeared more retained than other genes after the recent WGD, which was best explained by selection for gene expression operating on entire pathways. Metabolic genes also tend to be less retained when present at high copy number before WGD, contrary to other genes that show a positive correlation between gene retention and preduplication copy number. This is rationalized on the basis of the classical concave relationship relating metabolic fluxes with enzyme expression.

  2. Homozygous 16p13.11 duplication associated with mild intellectual disability and urinary tract malformations in two siblings born from consanguineous parents.

    Science.gov (United States)

    Houcinat, N; Llanas, B; Moutton, S; Toutain, J; Cailley, D; Arveiler, B; Combe, C; Lacombe, D; Rooryck, C

    2015-11-01

    The use of array-comparative genomic hybridization (array-CGH) in routine clinical work has allowed the identification of many new copy number variations (CNV). The 16p13.11 duplication has been implicated in various congenital anomalies and neurodevelopmental disorders, but it has also been identified in healthy individuals. We report a clinical observation of two brothers from related parents each carrying a homozygous 16p13.11 duplication. The propositus had mild intellectual disability and posterior urethral valves with chronic renal disease. His brother was considered a healthy child with only learning disabilities and poor academic performances. However, a routine medical examination at 25-years-old revealed a mild chronic renal disease and ureteropelvic junction obstruction. Furthermore, the father presented with a unilateral renal agenesis, thus it seemed that a "congenital anomalies of kidney and urinary tract" (CAKUT) phenotype segregated in this family. This may be related to the duplication, but we cannot exclude the involvement of additional genetic or non-genetic factors in the urological phenotype. Several cohort studies showed association between this chromosomal imbalance and different clinical manifestations, but rarely with CAKUT. The duplication reported here was similar to the larger one of 3.4 Mb previously described versus the more common of 1.6 Mb. It encompassed at least 11 known genes, including the five ohnologs previously identified. Our observation, in addition to expanding the clinical spectrum of the duplication provides further support to understanding the underlying pathogenic mechanism. © 2015 Wiley Periodicals, Inc.

  3. Quantitative fluorescence-polymerase chain reaction assay for the detection of the duplication of the Charcot Marie Tooth disease type 1A critical region.

    Science.gov (United States)

    De Toffol, Simona; Bellone, Emilia; Dulcetti, Francesca; Ruggeri, Anna Maria; Maggio, Pietro Paolo; Pulimeno, Maria Rosaria; Mandich, Paola; Maggi, Federico; Simoni, Giuseppe; Grati, Francesca Romana

    2010-04-01

    Charcot Marie Tooth (CMT) syndrome is the most common hereditary peripheral neuropathy, with an incidence of about 1 in 2500. The subtype 1A (CMT1A) is caused by a tandem duplication of a 1.5-Mb region encompassing the PMP22 gene. Conventional short tandem repeat (STR) analysis can reveal this imbalance if a triallelic pattern, defining with certainty the presence of duplication, is present. In case of duplication with a biallelic pattern, it can only indicate a semiquantitative dosage of the fluorescence intensity ratio of the two fragments. In this study we developed a quantitative fluorescence-PCR using seven highly informative STRs within the CMT1A critical region that successfully disclosed or excluded the presence of the pathogenic imbalance in a cohort of 60 samples including 40 DNAs from samples with the CMT1A duplication previously characterized with two different molecular approaches, and 20 diagnostic samples from 10 members of a five-generation pedigree segregating CMT1A, 8 unrelated cases and 2 prenatal samples. The application of the quantitative fluorescence-PCR using STRs located in the critical region could be a reliable method to evaluate the presence of the PMP22 duplication for the diagnosis and classification of hereditary neuropathies in asymptomatic subjects with a family history of inherited neuropathy, in prenatal samples in cases with one affected parent, and in unrelated patients with a sporadic demyelinating neuropathy with clinical features resembling CMT (i.e., pes cavus with hammer toes) or with conduction velocities in the range of CMT1A.

  4. Paracentric inversion of chromosome 2 associated with cryptic duplication of 2q14 and deletion of 2q37 in a patient with autism.

    Science.gov (United States)

    Devillard, Françoise; Guinchat, Vincent; Moreno-De-Luca, Daniel; Tabet, Anne-Claude; Gruchy, Nicolas; Guillem, Pascale; Nguyen Morel, Marie-Ange; Leporrier, Nathalie; Leboyer, Marion; Jouk, Pierre-Simon; Lespinasse, James; Betancur, Catalina

    2010-09-01

    We describe a patient with autism and a paracentric inversion of chromosome 2q14.2q37.3, with a concurrent duplication of the proximal breakpoint at 2q14.1q14.2 and a deletion of the distal breakpoint at 2q37.3. The abnormality was derived from his mother with a balanced paracentric inversion. The inversion in the child appeared to be cytogenetically balanced but subtelomere FISH revealed a cryptic deletion at the 2q37.3 breakpoint. High-resolution single nucleotide polymorphism array confirmed the presence of a 3.5 Mb deletion that extended to the telomere, and showed a 4.2 Mb duplication at 2q14.1q14.2. FISH studies using a 2q14.2 probe showed that the duplicated segment was located at the telomeric end of chromosome 2q. This recombinant probably resulted from breakage of a dicentric chromosome. The child had autism, mental retardation, speech and language delay, hyperactivity, growth retardation with growth hormone deficiency, insulin-dependent diabetes, and mild facial dysmorphism. Most of these features have been previously described in individuals with simple terminal deletion of 2q37. Pure duplications of the proximal chromosome 2q are rare and no specific syndrome has been defined yet, so the contribution of the 2q14.1q14.2 duplication to the phenotype of the patient is unknown. These findings underscore the need to explore apparently balanced chromosomal rearrangements inherited from a phenotypically normal parent in subjects with autism and/or developmental delay. In addition, they provide further evidence indicating that chromosome 2q terminal deletions are among the most frequently reported cytogenetic abnormalities in individuals with autism.

  5. Gene Duplication of the zebrafish kit ligand and partitioning of melanocyte development functions to kit ligand a.

    Directory of Open Access Journals (Sweden)

    Keith A Hultman

    2007-01-01

    Full Text Available The retention of particular genes after the whole genome duplication in zebrafish has given insights into how genes may evolve through partitioning of ancestral functions. We examine the partitioning of expression patterns and functions of two zebrafish kit ligands, kit ligand a (kitla and kit ligand b (kitlb, and discuss their possible coevolution with the duplicated zebrafish kit receptors (kita and kitb. In situ hybridizations show that kitla mRNA is expressed in the trunk adjacent to the notochord in the middle of each somite during stages of melanocyte migration and later expressed in the skin, when the receptor is required for melanocyte survival. kitla is also expressed in other regions complementary to kita receptor expression, including the pineal gland, tail bud, and ear. In contrast, kitlb mRNA is expressed in brain ventricles, ear, and cardinal vein plexus, in regions generally not complementary to either zebrafish kit receptor ortholog. However, like kitla, kitlb is expressed in the skin during stages consistent with melanocyte survival. Thus, it appears that kita and kitla have maintained congruent expression patterns, while kitb and kitlb have evolved divergent expression patterns. We demonstrate the interaction of kita and kitla by morpholino knockdown analysis. kitla morphants, but not kitlb morphants, phenocopy the null allele of kita, with defects for both melanocyte migration and survival. Furthermore, kitla morpholino, but not kitlb morpholino, interacts genetically with a sensitized allele of kita, confirming that kitla is the functional ligand to kita. Last, we examine kitla overexpression in embryos, which results in hyperpigmentation caused by an increase in the number and size of melanocytes. This hyperpigmentation is dependent on kita function. We conclude that following genome duplication, kita and kitla have maintained their receptor-ligand relationship, coevolved complementary expression patterns, and that

  6. Gene Duplication and Gene Expression Changes Play a Role in the Evolution of Candidate Pollen Feeding Genes in Heliconius Butterflies.

    Science.gov (United States)

    Smith, Gilbert; Macias-Muñoz, Aide; Briscoe, Adriana D

    2016-09-02

    Heliconius possess a unique ability among butterflies to feed on pollen. Pollen feeding significantly extends their lifespan, and is thought to have been important to the diversification of the genus. We used RNA sequencing to examine feeding-related gene expression in the mouthparts of four species of Heliconius and one nonpollen feeding species, Eueides isabella We hypothesized that genes involved in morphology and protein metabolism might be upregulated in Heliconius because they have longer proboscides than Eueides, and because pollen contains more protein than nectar. Using de novo transcriptome assemblies, we tested these hypotheses by comparing gene expression in mouthparts against antennae and legs. We first looked for genes upregulated in mouthparts across all five species and discovered several hundred genes, many of which had functional annotations involving metabolism of proteins (cocoonase), lipids, and carbohydrates. We then looked specifically within Heliconius where we found eleven common upregulated genes with roles in morphology (CPR cuticle proteins), behavior (takeout-like), and metabolism (luciferase-like). Closer examination of these candidates revealed that cocoonase underwent several duplications along the lineage leading to heliconiine butterflies, including two Heliconius-specific duplications. Luciferase-like genes also underwent duplication within lepidopterans, and upregulation in Heliconius mouthparts. Reverse-transcription PCR confirmed that three cocoonases, a peptidase, and one luciferase-like gene are expressed in the proboscis with little to no expression in labial palps and salivary glands. Our results suggest pollen feeding, like other dietary specializations, was likely facilitated by adaptive expansions of preexisting genes-and that the butterfly proboscis is involved in digestive enzyme production. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. A case report: Becker muscular dystrophy presenting with epilepsy and dysgnosia induced by duplication mutation of Dystrophin gene.

    Science.gov (United States)

    Miao, Jing; Feng, Jia-Chun; Zhu, Dan; Yu, Xue-Fan

    2016-12-12

    Becker muscular dystrophy (BMD), a genetic disorder of X-linked recessive inheritance, typically presents with gradually progressive muscle weakness. The condition is caused by mutations of Dystrophin gene located at Xp21.2. Epilepsy is an infrequent manifestation of BMD, while cases of BMD with dysgnosia are extremely rare. We describe a 9-year-old boy with BMD, who presented with epilepsy and dysgnosia. Serum creatine kinase level was markedly elevated (3665 U/L). Wechsler intelligence tests showed a low intelligence quotient (IQ = 65). Electromyogram showed slight myogenic changes and skeletal muscle biopsy revealed muscular dystrophy. Immunohistochemical staining showed partial positivity of sarcolemma for dystrophin-N. Multiplex ligation-dependent probe amplification revealed a duplication mutation in exons 37-44 in the Dystrophin gene. The present case report helps to better understand the clinical and genetic features of BMD.

  8. Association genetics and transcriptome analysis reveal a gibberellin-responsive pathway involved in regulating photosynthesis.

    Science.gov (United States)

    Xie, Jianbo; Tian, Jiaxing; Du, Qingzhang; Chen, Jinhui; Li, Ying; Yang, Xiaohui; Li, Bailian; Zhang, Deqiang

    2016-05-01

    Gibberellins (GAs) regulate a wide range of important processes in plant growth and development, including photosynthesis. However, the mechanism by which GAs regulate photosynthesis remains to be understood. Here, we used multi-gene association to investigate the effect of genes in the GA-responsive pathway, as constructed by RNA sequencing, on photosynthesis, growth, and wood property traits, in a population of 435 Populus tomentosa By analyzing changes in the transcriptome following GA treatment, we identified many key photosynthetic genes, in agreement with the observed increase in measurements of photosynthesis. Regulatory motif enrichment analysis revealed that 37 differentially expressed genes related to photosynthesis shared two essential GA-related cis-regulatory elements, the GA response element and the pyrimidine box. Thus, we constructed a GA-responsive pathway consisting of 47 genes involved in regulating photosynthesis, including GID1, RGA, GID2, MYBGa, and 37 photosynthetic differentially expressed genes. Single nucleotide polymorphism (SNP)-based association analysis showed that 142 SNPs, representing 40 candidate genes in this pathway, were significantly associated with photosynthesis, growth, and wood property traits. Epistasis analysis uncovered interactions between 310 SNP-SNP pairs from 37 genes in this pathway, revealing possible genetic interactions. Moreover, a structural gene-gene matrix based on a time-course of transcript abundances provided a better understanding of the multi-gene pathway affecting photosynthesis. The results imply a functional role for these genes in mediating photosynthesis, growth, and wood properties, demonstrating the potential of combining transcriptome-based regulatory pathway construction and genetic association approaches to detect the complex genetic networks underlying quantitative traits. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights

  9. Pattern of Duplicate Presentations at National Hematology-Oncology Meetings: Influence of the Pharmaceutical Industry.

    Science.gov (United States)

    Ramchandren, Radhakrishnan; Schiffer, Charles A

    2016-03-01

    The major large US hematology-oncology meetings sponsored by the American Society of Hematology (ASH) and American Society of Clinical Oncology (ASCO) have specific guidelines in place discouraging submission of scientific information presented previously at other meetings. Nonetheless, duplicate submissions are frequent. The incidence and motivations for duplicate hematologic presentations and the influence of the pharmaceutical industry on this process have not been thoroughly analyzed. Therefore, were viewed four consecutive ASH and ASCO meetings to assess the frequency of duplicate abstract presentations. All abstracts presented at ASCO2010 in the area of malignant hematology were compared with abstracts from ASCO and ASH 2009 and ASH 2010, and funding sources were reviewed. More than half (54%) of all abstracts submitted to ASCO 2010 acknowledged pharmaceutical company support. Almost one third (31%) of ASCO 2010 abstracts were resubmitted in the 2-year time period, and it was notable that a high fraction (75%) of these duplicate abstracts had pharmaceutical industry sponsorship, compared with 42% of the abstracts that were submitted only once. Despite current guidelines prohibiting duplicate abstract presentation, a substantial proportion (31%) of abstracts at large international hematology-oncology meetings are duplicative, with potential negative consequences. In addition, a disproportionate percentage of the duplicate abstracts rely on pharmaceutical industry support (75%), suggesting that marketing strategies may be a motivation for some of these repetitive submissions.

  10. [Partial facial duplication (a rare diprosopus): Case report and review of the literature].

    Science.gov (United States)

    Es-Seddiki, A; Rkain, M; Ayyad, A; Nkhili, H; Amrani, R; Benajiba, N

    2015-12-01

    Diprosopus, or partial facial duplication, is a very rare congenital abnormality. It is a rare form of conjoined twins. Partial facial duplication may be symmetric or not and may involve the nose, the maxilla, the mandible, the palate, the tongue and the mouth. A male newborn springing from inbred parents was admitted at his first day of life for facial deformity. He presented with hypertelorism, 2 eyes, a tendency to nose duplication (flatted large nose, 2 columellae, 2 lateral nostrils separated in the midline by a third deformed hole), two mouths and a duplicated maxilla. Laboratory tests were normal. The cranio-facial CT confirmed the maxillary duplication. This type of cranio-facial duplication is a rare entity with about 35 reported cases in the literature. Our patient was similar to a rare case of living diprosopus reported by Stiehm in 1972. Diprosopus is often associated with abnormalities of the gastrointestinal tract, the central nervous system, the cardiovascular and respiratory systems and with a high incidence of cleft lip and palate. Surgical treatment consists in the resection of the duplicated components. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  11. Horizontal transfer, not duplication, drives the expansion of protein families in prokaryotes.

    Directory of Open Access Journals (Sweden)

    Todd J Treangen

    2011-01-01

    Full Text Available Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus, average-sized genomes (Bacillus, Enterobacteriaceae, and large genomes (Pseudomonas, Bradyrhizobiaceae to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes--xenologs--persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes--paralogs--are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein-protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families.

  12. Use of diagnostic imaging in the evaluation of gastrointestinal tract duplications.

    Science.gov (United States)

    Laskowska, Katarzyna; Gałązka, Przemysław; Daniluk-Matraś, Irena; Leszczyński, Waldemar; Serafin, Zbigniew

    2014-01-01

    Gastrointestinal tract duplication is a rare malformation associated with the presence of additional segment of the fetal gut. The aim of this study was to retrospectively review clinical features and imaging findings in intraoperatively confirmed cases of gastrointestinal tract duplication in children. The analysis included own material from the years 2002-2012. The analyzed group included 14 children, among them 8 boys and 6 girls. The youngest patient was diagnosed at the age of three weeks, and the oldest at 12 years of age. The duplication cysts were identified in the esophagus (n=2), stomach (n=5), duodenum (n=1), terminal ileum (n=5), and rectum (n=1). In four cases, the duplication coexisted with other anomalies, such as patent urachus, Meckel's diverticulum, mesenteric cyst, and accessory pancreas. Clinical manifestation of gastrointestinal duplication cysts was variable, and some of them were detected accidently. Thin- or thick-walled cystic structures adjacent to the wall of neighboring gastrointestinal segment were documented on diagnostic imaging. Ultrasound and computed tomography are the methods of choice in the evaluation of gastrointestinal duplication cysts. Apart from the diagnosis of the duplication cyst, an important issue is the detection of concomitant developmental pathologies, including pancreatic heterotopy.

  13. Craniofacial Duplication (Diprosopus) in the Cat — Case Report and Review of the Literature

    International Nuclear Information System (INIS)

    Sekeles, E.; Aharon, D.C.; Fass, U.

    1985-01-01

    A kitten displaying the features of symmetrical partial duplication of the head (diprosopus) is described. The morphological description of this double monster is compared to three previous similar cases. All four cases were similar in that duplication of the orbits and eyes were not completed and fission of the oral and nasal cavities and their contents were partial. Furthermore, the central nervous systems were duplicated as far caudal as the brain stem. Present case displayed cleft palate in the two faces, a feature that was not described earlier. Though diprosopus is a rare anomaly in cats, it is more common than in the dog, pig and sheep. In cattle, anterior duplications are one of the largest groups of congenital anomalies. Based on generally accepted considerations concerning the mechanism behind the formation of monozyous twins, conjoined twins and anterior duplications, integrated with experimental data on induction of duplications in animals, an hypothesis is proposed for early embryonic fission. It suggests a constant cleaving factor active along the median plane with affinity to midline structures. Its temporal relations with the developing embryo, especially in susceptible species, decide the degree and type of duplication

  14. Multidetector row computed tomography and ultrasound characteristics of caudal vena cava duplication in dogs.

    Science.gov (United States)

    Bertolini, Giovanna; Diana, Alessia; Cipone, Mario; Drigo, Michele; Caldin, Marco

    2014-01-01

    Caudal vena cava duplication has been rarely reported in small animals. The purpose of this retrospective study was to describe characteristics of duplicated caudal vena cava in a large group of dogs. Computed tomography (CT) and ultrasound databases from two hospitals were searched for canine reports having the diagnosis "double caudal vena cava." One observer reviewed CT images for 71 dogs and two observers reviewed ultrasound images for 21 dogs. In all CT cases, the duplication comprised two vessels that were bilaterally symmetrical and approximately the same calibre (similar to Type I complete duplication in humans). In all ultrasound cases, the duplicated caudal vena cava appeared as a distinct vessel running on the left side of the abdominal segment of the descending aorta and extending from the left common iliac vein to the left renal vein. The prevalence of caudal vena cava duplication was 0.46% for canine ultrasound studies and 2.08% for canine CT studies performed at these hospitals. Median body weight for affected dogs was significantly lower than that of unaffected dogs (P dogs, caudal vena cava duplication should be differentiated from other vascular anomalies when planning surgeries and for avoiding misdiagnoses. © 2014 American College of Veterinary Radiology.

  15. CRISPR/Cas9 and active genetics-based trans-species replacement of the endogenous Drosophila kni-L2 CRM reveals unexpected complexity.

    Science.gov (United States)

    Xu, Xiang-Ru Shannon; Gantz, Valentino Matteo; Siomava, Natalia; Bier, Ethan

    2017-12-23

    The knirps ( kni ) locus encodes transcription factors required for induction of the L2 wing vein in Drosophila . Here, we employ diverse CRISPR/Cas9 genome editing tools to generate a series of targeted lesions within the endogenous cis-regulatory module (CRM) required for kni expression in the L2 vein primordium. Phenotypic analysis of these ' in locus ' mutations based on both expression of Kni protein and adult wing phenotypes, reveals novel unexpected features of L2-CRM function including evidence for a chromosome pairing-dependent process that promotes transcription. We also demonstrate that self-propagating active genetic elements (CopyCat elements) can efficiently delete and replace the L2-CRM with orthologous sequences from other divergent fly species. Wing vein phenotypes resulting from these trans-species enhancer replacements parallel features of the respective donor fly species. This highly sensitive phenotypic readout of enhancer function in a native genomic context reveals novel features of CRM function undetected by traditional reporter gene analysis. © 2017, Xu et al.

  16. Antisense-induced exon skipping for duplications in Duchenne muscular dystrophy

    Directory of Open Access Journals (Sweden)

    van Ommen Gert-Jan B

    2007-07-01

    Full Text Available Abstract Background Antisense-mediated exon skipping is currently one of the most promising therapeutic approaches for Duchenne muscular dystrophy (DMD. Using antisense oligonucleotides (AONs targeting specific exons the DMD reading frame is restored and partially functional dystrophins are produced. Following proof of concept in cultured muscle cells from patients with various deletions and point mutations, we now focus on single and multiple exon duplications. These mutations are in principle ideal targets for this approach since the specific skipping of duplicated exons would generate original, full-length transcripts. Methods Cultured muscle cells from DMD patients carrying duplications were transfected with AONs targeting the duplicated exons, and the dystrophin RNA and protein were analyzed. Results For two brothers with an exon 44 duplication, skipping was, even at suboptimal transfection conditions, so efficient that both exons 44 were skipped, thus generating, once more, an out-of-frame transcript. In such cases, one may resort to multi-exon skipping to restore the reading frame, as is shown here by inducing skipping of exon 43 and both exons 44. By contrast, in cells from a patient with an exon 45 duplication we were able to induce single exon 45 skipping, which allowed restoration of wild type dystrophin. The correction of a larger duplication (involving exons 52 to 62, by combinations of AONs targeting the outer exons, appeared problematic due to inefficient skipping and mistargeting of original instead of duplicated exons. Conclusion The correction of DMD duplications by exon skipping depends on the specific exons targeted. Its options vary from the ideal one, restoring for the first time the true, wild type dystrophin, to requiring more 'classical' skipping strategies, while the correction of multi-exon deletions may need the design of tailored approaches.

  17. The hidden duplication past of the plant pathogen Phytophthora and its consequences for infection

    Directory of Open Access Journals (Sweden)

    Martens Cindy

    2010-06-01

    Full Text Available Abstract Background Oomycetes of the genus Phytophthora are pathogens that infect a wide range of plant species. For dicot hosts such as tomato, potato and soybean, Phytophthora is even the most important pathogen. Previous analyses of Phytophthora genomes uncovered many genes, large gene families and large genome sizes that can partially be explained by significant repeat expansion patterns. Results Analysis of the complete genomes of three different Phytophthora species, using a newly developed approach, unveiled a large number of small duplicated blocks, mainly consisting of two or three consecutive genes. Further analysis of these duplicated genes and comparison with the known gene and genome duplication history of ten other eukaryotes including parasites, algae, plants, fungi, vertebrates and invertebrates, suggests that the ancestor of P. infestans, P. sojae and P. ramorum most likely underwent a whole genome duplication (WGD. Genes that have survived in duplicate are mainly genes that are known to be preferentially retained following WGDs, but also genes important for pathogenicity and infection of the different hosts seem to have been retained in excess. As a result, the WGD might have contributed to the evolutionary and pathogenic success of Phytophthora. Conclusions The fact that we find many small blocks of duplicated genes indicates that the genomes of Phytophthora species have been heavily rearranged following the WGD. Most likely, the high repeat content in these genomes have played an important role in this rearrangement process. As a consequence, the paucity of retained larger duplicated blocks has greatly complicated previous attempts to detect remnants of a large-scale duplication event in Phytophthora. However, as we show here, our newly developed strategy to identify very small duplicated blocks might be a useful approach to uncover ancient polyploidy events, in particular for heavily rearranged genomes.

  18. Duplication at Xq28 involving IKBKG is associated with progressive macrocephaly, recurrent infections, ectodermal dysplasia, benign tumors, and neuropathy

    NARCIS (Netherlands)

    Asbeck, E. Van; Ramalingam, A.; Dvorak, C.; Chen, T.J.; Morava, E.

    2014-01-01

    Duplications on Xq28 are common, although quite variable in size, but usually include the MECP2 gene. Here, we present a patient with a unique, small, 167-kb duplication at Xq28, not including MECP2. The most important gene in the duplicated region was IKBKG, mutations in which can cause a variety

  19. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  20. Caudal Duplication Syndrome: the Vital Role of a Multidisciplinary Approach and Staged Correction

    Science.gov (United States)

    Samuk, Inbal; Levitt, Marc; Dlugy, Elena; Kravarusic, Dragan; Ben-Meir, David; Rajz, Gustavo; Konen, Osnat; Freud, Enrique

    2015-01-01

    Caudal duplication syndrome is a rare entity that describes the association between congenital anomalies involving caudal structures and may have a wide spectrum of clinical manifestations. A full-term male presented with combination of anomalies including anorectal malformation, duplication of the colon and lower urinary tract, split of the lower spine, and lipomyelomeningocele with tethering of the cord. We report this exceptional case of caudal duplication syndrome with special emphasis on surgical strategy and approach combining all disciplines involved. The purpose of this report is to present the pathology, assessment, and management strategy of this complex case. PMID:28018799

  1. Giant T-shaped duplication of the transverse colon. A case report.

    Science.gov (United States)

    Trotovsek, Blaz; Hribernik, Marija; Gvardijancic, Diana; Jelenc, Franc

    2006-01-01

    A case of long diverticular colonic duplication producing acute abdominal pain in a 6-year-old girl is presented. Physical examination showed no signs of acute abdomen at the initial presentation. After a pain-free interval, there was a sudden onset of severe abdominal pain and a large tumor in the lower abdomen was observed. A plain x-ray showed an enormously dilated colonic pouch filled with gas. Excision of the T-shaped duplication and small part of the transverse colon was successful. Because of extensive fibrotic changes in the colon near the opening of duplication, a resection margin of at least 2 cm is recommended.

  2. Caudal Duplication Syndrome: the Vital Role of a Multidisciplinary Approach and Staged Correction.

    Science.gov (United States)

    Samuk, Inbal; Levitt, Marc; Dlugy, Elena; Kravarusic, Dragan; Ben-Meir, David; Rajz, Gustavo; Konen, Osnat; Freud, Enrique

    2016-12-01

    Caudal duplication syndrome is a rare entity that describes the association between congenital anomalies involving caudal structures and may have a wide spectrum of clinical manifestations. A full-term male presented with combination of anomalies including anorectal malformation, duplication of the colon and lower urinary tract, split of the lower spine, and lipomyelomeningocele with tethering of the cord. We report this exceptional case of caudal duplication syndrome with special emphasis on surgical strategy and approach combining all disciplines involved. The purpose of this report is to present the pathology, assessment, and management strategy of this complex case.

  3. A case of asymptomatic ileal duplication cyst associated with acute appendicitis

    Directory of Open Access Journals (Sweden)

    Hülya İpek

    2017-07-01

    Full Text Available Duplications of the alimentary tract are infrequent anomalies. They are most frequently located in the terminal ileum, and majority of them became symptomatic before the age of 2. Presenting symptoms may include abdominal mass, intestinal obstruction, intussusception, rectal bleeding, and abdominal pain. Preoperative diagnosis is usually difficult, intra-abdominal duplications are usually diagnosed during surgical explorations of above complications. We presented a 12-year-old girl with asymptomatic ileal duplication cyst associated with non-complicated acute appendicitis, whose imaging studies at admission were compatible with complicated perforated appendicitis.

  4. Scintigraphic detection of 'yo-yo' phenomenon in incomplete ureteric duplication

    International Nuclear Information System (INIS)

    Chu, Winnie C.W.; Chan, Kam-wing; Metreweli, Constantine

    2003-01-01

    'Yo-yo' reflux in an incompletely duplicated renal system was demonstrated on 99m Tc-mercaptoacetyltriglycine (MAG3) renal scintigraphy in a 7-year-old girl presenting with low-grade fever and pyelonephritis. Incomplete duplication and a bifid renal pelvis, which may be seen in up to 4% of the North American population, occasionally causes symptoms because of recurrent urinary tract infection or loin pain. 99m Tc-MAG3 renal scintigraphy can demonstrate 'yo-yo' reflux in patients with incomplete renal duplication and should be considered in cases with unexplained loin pain, even if 99m Tc-dimercaptosuccinic acid (DMSA) renal scintigraphy is normal. (orig.)

  5. Anal canal duplication and triplication: a rare entity with different presentations.

    Science.gov (United States)

    Palazon, P; Julia, V; Saura, L; de Haro, I; Bejarano, M; Rovira, C; Tarrado, X

    2017-05-01

    Anal canal duplication (ACD) is the rarest of gastrointestinal duplications. Few cases have been reported. Most cases present as an opening in the midline, posterior to the normal anus. The aim of our revision is to contribute with eight new cases, some of them with unusual presentations: five presented as the typical form, one with a perianal nodule, and two presented as two separate orifices (anal canal triplication). Complete excision was performed in all patients with no complications. ACD is the most distal and the least frequent digestive duplication. Its treatment should be surgical excision, to avoid complications such as abscess, fistulization, or malignization. Anal canal triplication has never been described before.

  6. Can the US shale revolution be duplicated in Europe?

    International Nuclear Information System (INIS)

    Saussay, Aurelien

    2015-04-01

    Over the past decade, the rapid increase in shale gas and shale oil production in the United States has profoundly changed energy markets in North America, and has led to a significant decrease in American natural gas prices. The possible existence of large shale deposits in Europe, mainly in France, Poland and the United Kingdom, has fostered speculation on whether the 'shale revolution', and its accompanying macro-economic impacts, could be duplicated in Europe. However, a number of uncertainties, notably geological, technological and regulatory, make this possibility unclear. We present a techno-economic model, SHERPA (Shale Exploitation and Recovery Projection and Analysis), to analyze the main determinants of the profitability of shale wells and plays. We calibrate our model using production data from the leading American shale plays. We use SHERPA to estimate three shale gas production scenarios exploring different sets of geological and technical hypotheses for the largest potential holder of shale gas deposits in Europe, France. Even considering that the geology of the potential French shale deposits is favorable to commercial extraction, we find that under assumptions calibrated on U.S. production data, natural gas could be produced at a high breakeven price of $8.6 per MMBtu, and over a 45 year time-frame have a net present value of $19.6 billion - less than 1% of 2012 French GDP. However, the specificities of the European context, notably high deposit depth and stricter environmental regulations, could increase drilling costs and further decrease this low profitability. We find that a 40% premium over American drilling costs would make shale gas extraction uneconomical. Absent extreme well productivity, it appears very difficult for shale gas extraction to have an impact on European energy markets comparable to the American shale revolution. (author)

  7. Recurrent internal tandem duplications of BCOR in clear cell sarcoma of the kidney

    Science.gov (United States)

    Roy, Angshumoy; Kumar, Vijetha; Zorman, Barry; Fang, Erica; Haines, Katherine M.; Doddapaneni, HarshaVardhan; Hampton, Oliver A.; White, Simon; Bavle, Abhishek A.; Patel, Nimesh R.; Eldin, Karen W.; John Hicks, M.; Rakheja, Dinesh; Leavey, Patrick J.; Skapek, Stephen X.; Amatruda, James F.; Nuchtern, Jed G.; Chintagumpala, Murali M.; Wheeler, David A.; Plon, Sharon E.; Sumazin, Pavel; Parsons, D. Williams

    2015-01-01

    The X-linked BCL-6 co-repressor (BCOR) gene encodes a key constituent of a variant polycomb repressive complex (PRC) that is mutated or translocated in human cancers. Here we report on the identification of somatic internal tandem duplications (ITDs) clustering in the C terminus of BCOR in 23 of 27 (85%) pediatric clear cell sarcomas of the kidney (CCSK) from two independent cohorts. We profile CCSK tumours using a combination of whole-exome, transcriptome and targeted sequencing. Identical ITD mutations are found in primary and relapsed tumour pairs but not in adjacent normal kidney or blood. Mutant BCOR transcripts and proteins are markedly upregulated in ITD-positive tumours. Transcriptome analysis of ITD-positive CCSKs reveals enrichment for PRC2-regulated genes and similarity to undifferentiated sarcomas harbouring BCOR–CCNB3 fusions. The discovery of recurrent BCOR ITDs defines a major oncogenic event in this childhood sarcoma with significant implications for diagnostic and therapeutic approaches to this tumour. PMID:26573325

  8. Nested radiations and the pulse of angiosperm diversification: increased diversification rates often follow whole genome duplications.

    Science.gov (United States)

    Tank, David C; Eastman, Jonathan M; Pennell, Matthew W; Soltis, Pamela S; Soltis, Douglas E; Hinchliff, Cody E; Brown, Joseph W; Sessa, Emily B; Harmon, Luke J

    2015-07-01

    Our growing understanding of the plant tree of life provides a novel opportunity to uncover the major drivers of angiosperm diversity. Using a time-calibrated phylogeny, we characterized hot and cold spots of lineage diversification across the angiosperm tree of life by modeling evolutionary diversification using stepwise AIC (MEDUSA). We also tested the whole-genome duplication (WGD) radiation lag-time model, which postulates that increases in diversification tend to lag behind established WGD events. Diversification rates have been incredibly heterogeneous throughout the evolutionary history of angiosperms and reveal a pattern of 'nested radiations' - increases in net diversification nested within other radiations. This pattern in turn generates a negative relationship between clade age and diversity across both families and orders. We suggest that stochastically changing diversification rates across the phylogeny explain these patterns. Finally, we demonstrate significant statistical support for the WGD radiation lag-time model. Across angiosperms, nested shifts in diversification led to an overall increasing rate of net diversification and declining relative extinction rates through time. These diversification shifts are only rarely perfectly associated with WGD events, but commonly follow them after a lag period. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  9. Identification of a duplication of Xq28 associated with bilateral periventricular nodular heterotopia.

    Science.gov (United States)

    Fink, J M; Dobyns, W B; Guerrini, R; Hirsch, B A

    1997-01-01

    Bilateral periventricular nodular heterotopia (BPNH) is a malformation of neuronal migration and is characterized by nodules of heterotopic gray matter lining the lateral ventricles of the brain. The majority of BPNH patients are female and have epilepsy as a sole clinical manifestation of their disease. Familial BPNH has been mapped to Xq28 by linkage analysis. A multiple congenital anomaly-mental retardation syndrome (BPNH/MR) was recently delineated in three unrelated boys with BPNH, cerebellar hypoplasia, severe mental retardation, epilepsy, and syndactyly. High-resolution chromosome analysis revealed a subtle abnormality of Xq28 in one of the boys with BPNH/MR syndrome. FISH with cosmids and YACs from Xq28 further characterized this abnormality as a 2.25-3.25-Mb inverted duplication. No abnormality of Xq28 was detected by G-banding or FISH in the other two boys. These data support the linkage assignment of BPNH to band Xq28 and narrow the critical region to the distal 2.25-3.25 Mb of Xq28. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:9311743

  10. Zebrafish IGF genes: gene duplication, conservation and divergence, and novel roles in midline and notochord development.

    Directory of Open Access Journals (Sweden)

    Shuming Zou

    Full Text Available Insulin-like growth factors (IGFs are key regulators of development, growth, and longevity. In most vertebrate species including humans, there is one IGF-1 gene and one IGF-2 gene. Here we report the identification and functional characterization of 4 distinct IGF genes (termed as igf-1a, -1b, -2a, and -2b in zebrafish. These genes encode 4 structurally distinct and functional IGF peptides. IGF-1a and IGF-2a mRNAs were detected in multiple tissues in adult fish. IGF-1b mRNA was detected only in the gonad and IGF-2b mRNA only in the liver. Functional analysis showed that all 4 IGFs caused similar developmental defects but with different potencies. Many of these embryos had fully or partially duplicated notochords, suggesting that an excess of IGF signaling causes defects in the midline formation and an expansion of the notochord. IGF-2a, the most potent IGF, was analyzed in depth. IGF-2a expression caused defects in the midline formation and expansion of the notochord but it did not alter the anterior neural patterning. These results not only provide new insights into the functional conservation and divergence of the multiple igf genes but also reveal a novel role of IGF signaling in midline formation and notochord development in a vertebrate model.

  11. Mimics of Duplication Cysts: Intraperitoneal Nodules in a 14-Year-Old Boy

    Directory of Open Access Journals (Sweden)

    Sara E. Ohanessian

    2015-01-01

    Full Text Available Hemangiomas are the most common primary hepatic tumors, but there are few reports of their occurrence elsewhere in the abdomen. The concurrent existence of multiple fibrous nodules of the omentum, mesentery, and porta hepatis, along with a gastric hemangioma, in a child raises the question of syndromic association. Our search of the English literature revealed only rare mentions of hemangiomas involving the stomach and mesentery or omentum. These lesions have attracted clinical attention by symptoms of obstruction, gastrointestinal bleeding, intussusception, infection, perforation, or vague abdominal pain. Although some tumors exist unnoticed for many decades and are identified only incidentally, others present emergently and require immediate surgical attention. We report the case of a 14-year-old boy who presented with symptoms similar to those for appendicitis or duplication cyst, who was found to have a torsed gastric hemangioma and multiple benign fibrous nodules in the abdomen. The presence of multiple vascular or fibrous lesions is associated with genetic syndromes that can have lifelong and reproductive repercussions; so it is imperative that these tumors be recognized by diagnosticians.

  12. A SEVERE CASE OF ACUTE NECROTIC PANCREATITIS CAUSED BY DUODENAL CYST DUPLICATION

    Directory of Open Access Journals (Sweden)

    Gabriel Constantinescu

    2018-03-01

    Full Text Available Introduction. Duodenal duplication cyst (DDC is a rare congenital malformation that appears in the embryonic development of the digestive tract. It is a benign condition usually diagnosed in infancy and early childhood, being a rare and difficult diagnosis in adult population. DDC is a recognized cause of duodenal obstruction, acute pancreatitis, obstructive jaundice and even digestive hemorrhage. Case presentation. We report the case of a young adult male with abdominal pain history, who presents with recurrent episodes of acute severe necrotic pancreatitis. The abdominal computed tomography scan revealed a Balthazar C necrotic pancreatitis with partial thrombosis of the splenic vein and a cystic mass in the second part of the duodenum. The endoscopic ultrasonography (EUS established that the duodenal cystic lesion came from the second layer, meaning the submucosa. We performed endoscopic cystotomy with complete evacuation of the fluid content into the duodenum, with favorable clinical outcome. Conclusions. The particularity of the case is represented by the low incidence of this pathology and the rare form of presentation, meaning acute pancreatitis probably from pancreatic ductular hypertension caused by the DDC.

  13. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    International Nuclear Information System (INIS)

    Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.

    2009-01-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  14. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    Energy Technology Data Exchange (ETDEWEB)

    Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)

    2009-10-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.

  15. Duplication of the dystroglycan gene in most branches of teleost fish

    Directory of Open Access Journals (Sweden)

    Giardina Bruno

    2007-05-01

    Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details

  16. Posterior Nutcracker Syndrome with Left Renal Vein Duplication: A Rare Cause of Haematuria in a 12-Year-Old Boy

    Directory of Open Access Journals (Sweden)

    J. Preza Fernandes

    2012-01-01

    Full Text Available The nutcracker syndrome (NCS is a rare cause of haematuria. It embraces an extended nonpathognomonic spectrum of symptoms that imply a difficult diagnosis. Ultimately it may be associated with substantial morbidity and even life-threatening events. We report a rare cause if a 12-year-old boy who presented with a history of frequent intermittent episodes of painless constant haematuria. The cystoscopy showed a bloody urine ejaculate from the left ureter meatus. The Doppler ultrasonography showed turbulent pattern of venous blood flow of the posterior renal vein branch behind the aorta. The abdominopelvic computer tomography (apCT revealed left renal vein (LRV duplication with a dilated retroaortic branch, entrapped between the aorta and the vertebral column, promoting the renal nutcracker syndrome. The patient was initially hospitalized and managed with oral iron supplements and continuous saline bladder irrigation, not requiring additional treatment. The child is currently asymptomatic, with haemoglobin value returning to normal and therefore proposed to conservative management with close followup. The authors present a case report of episodic haematuria caused by a rare entity—posterior nutcracker syndrome with renal vein duplication.

  17. Ultrasensitive electrochemical sensing platform based on graphene wrapping SnO2 nanocorals and autonomous cascade DNA duplication strategy.

    Science.gov (United States)

    Chen, Ying-Xu; Huang, Ke-Jing; Lin, Feng; Fang, Lin-Xia

    2017-12-01

    In this work, a sensitive, universal and reusable electrochemical biosensor based on stannic oxide nanocorals-graphene hybrids (SnO 2 NCs-Gr) is developed for target DNA detection by using two kinds of DNA enzymes for signal amplification through an autonomous cascade DNA duplication strategy. A hairpin probe is designed composing of a projecting part at the 3'-end as identification sequence for target, a recognition site for nicking endonuclease, and an 18-carbon shim to stop polymerization process. The designed DNA duplication-incision-replacement process is handled by KF polymerase and endonuclease, then combining with gold nanoparticles as signal carrier for further signal amplification. In the detection system, the electrochemical-chemical-chemical procedure, which uses ferrocene methanol, tris(2-carboxyethyl)phosphine and l-ascorbic acid 2-phosphate as oxidoreduction neurogen, deoxidizer and zymolyte, separately, is applied to amplify detection signal. Benefiting from the multiple signal amplification mechanism, the proposed sensor reveals a good linear connection between the peak current and logarithm of analyte concentration in range of 0.0001-1 × 10 -11 molL -1 with a detection limit of 1.25 × 10 -17 molL -1 (S/N=3). This assay also opens one promising strategy for ultrasensitive determination of other biological molecules for bioanalysis and biomedicine diagnostics. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. A de novo 1.38 Mb duplication of 1q31.1 in a boy with hemifacial microsomia, anophthalmia, anotia, macrostomia, and cleft lip and palate.

    Science.gov (United States)

    Huang, Xue-shuang; Zhu, Bao; Jiang, Hai-ou; Wu, Su-fan; Zhang, Zai-qi; Xiao, Lin; Yi, Li-lan; Zhang, Jian-xiang

    2013-04-01

    We reported a 2-year-old boy with developmental delay, mild mental retardation, and severe craniofacial malformation, including facial asymmetry with hypoplasia of the left zygoma, maxilla, and mandible, and left anophthalmia and anotia. A genome-wide screen revealed a 1.38 Mb duplication on chromosome 1q31.1, which was absent in his parents and 27 healthy controls. The duplication region contains two Refseq genes, PLA2G4A and C1orf99, which have not been reported to be implicated in craniofacial malformation. Functional studies of these genes and additional clinical analysis are necessary to elucidate the pathogenesis of craniofacial malformation. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  19. A Rare Interstitial Duplication of 8q22.1–8q24.3 Associated with Syndromic Bilateral Cleft Lip/Palate

    Directory of Open Access Journals (Sweden)

    Regina Ferreira Rezek

    2014-01-01

    Full Text Available We present a rare case of 8q interstitial duplication derived from maternal balanced translocations in a patient with bilateral cleft lip and palate in syndromic form associated with other congenital malformations. G-banding cytogenetic analysis revealed a chromosomal abnormality in the form of the karyotype 46,XX der(22t(8;22(q22.1;p11.1mat. Chromosome microarray analysis evidenced a 49 Mb duplicated segment of chromosome 8q with no pathogenic imbalances on chromosome 22. Two siblings also carry the balanced translocation. We have compared this case with other “pure” trisomies of 8q patients reported in the literature and with genome wide association studies recently published. This work highlights the involvement of chromosome 8q in orofacial clefts.

  20. Craniofacial duplication (diprosopus): report of a case with a review of the literature.

    Science.gov (United States)

    Amr, S S; Hammouri, M F

    1995-01-01

    A case of craniofacial duplication (diprosopus) is presented. Details on this rare form of conjoined twins are described, and the proposed theories of its embryogenesis are discussed with brief review of the pertinent literature.