WorldWideScience

Sample records for duplicated var2csa gene

  1. Disruption of var2csa gene impairs placental malaria associated adhesion phenotype.

    Directory of Open Access Journals (Sweden)

    Nicola K Viebig

    Full Text Available Infection with Plasmodium falciparum during pregnancy is one of the major causes of malaria related morbidity and mortality in newborn and mothers. The complications of pregnancy-associated malaria result mainly from massive adhesion of Plasmodium falciparum-infected erythrocytes (IE to chondroitin sulfate A (CSA present in the placental intervillous blood spaces. Var2CSA, a member of the P. falciparum erythrocyte membrane protein 1 (PfEMP1 family is the predominant parasite ligand mediating CSA binding. However, experimental evidence suggests that other host receptors, such as hyaluronic acid (HA and the neonatal Fc receptor, may also support placental binding. Here we used parasites in which var2csa was genetically disrupted to evaluate the contribution of these receptors to placental sequestration and to identify additional adhesion receptors that may be involved in pregnancy-associated malaria. By comparison to the wild-type parasites, the FCR3delta var2csa mutants could not be selected for HA adhesion, indicating that var2csa is not only essential for IE cytoadhesion to the placental receptor CSA, but also to HA. However, further studies using different pure sources of HA revealed that the previously observed binding results from CSA contamination in the bovine vitreous humor HA preparation. To identify CSA-independent placental interactions, FCR3delta var2csa mutant parasites were selected for adhesion to the human placental trophoblastic BeWo cell line. BeWo selected parasites revealed a multi-phenotypic adhesion population expressing multiple var genes. However, these parasites did not cytoadhere specifically to the syncytiotrophoblast lining of placental cryosections and were not recognized by sera from malaria-exposed women in a parity dependent manner, indicating that the surface molecules present on the surface of the BeWo selected population are not specifically expressed during the course of pregnancy-associated malaria. Taken

  2. Positive selection of Plasmodium falciparum parasites with multiple var2csa-type PfEMP1 genes during the course of infection in pregnant women

    DEFF Research Database (Denmark)

    Sander, Adam F; Salanti, Ali; Lavstsen, Thomas

    2011-01-01

    multiple genes coding for different VAR2CSA proteins, and parasites with >1 var2csa gene appear to be more common in pregnant women with placental malaria than in nonpregnant individuals. We present evidence that, in pregnant women, parasites containing multiple var2csa-type genes possess a selective...... advantage over parasites with a single var2csa gene. Accumulation of parasites with multiple copies of the var2csa gene during the course of pregnancy was also correlated with the development of antibodies involved in blocking VAR2CSA adhesion. The data suggest that multiplicity of var2csa-type genes...

  3. Multiple var2csa-type PfEMP1 genes located at different chromosomal loci occur in many Plasmodium falciparum isolates

    DEFF Research Database (Denmark)

    Sander, Adam F; Salanti, Ali; Lavstsen, Thomas

    2009-01-01

    in the VAR2CSA protein, sequence variation in the DBL2X region of var2csa genes in 54 P.falciparum samples was analyzed. Chromosome mapping of var2csa loci was carried out and a quantitative PCR assay was developed to estimate the number of var2csa genes in P.falciparum isolates from the placenta of pregnant....... falciparum isolates. One gene is on chromosome 12 but additional var2csa-type genes are on different chromosomes in different isolates. Multiplicity of var2csa genes appears more common in infected placentae than in samples from non-pregnant donors indicating a possible advantage of this genotype...

  4. Positive Selection of Plasmodium falciparum Parasites With Multiple var2csa-Type PfEMP1 Genes During the Course of Infection in Pregnant Women

    Science.gov (United States)

    Salanti, Ali; Lavstsen, Thomas; Nielsen, Morten A.; Theander, Thor G.; Leke, Rose G. F.; Lo, Yeung Y.; Bobbili, Naveen; Arnot, David E.; Taylor, Diane W.

    2011-01-01

    Placental malaria infections are caused by Plasmodium falciparum–infected red blood cells sequestering in the placenta by binding to chondroitin sulfate A, mediated by VAR2CSA, a variant of the PfEMP1 family of adhesion antigens. Recent studies have shown that many P. falciparum genomes have multiple genes coding for different VAR2CSA proteins, and parasites with >1 var2csa gene appear to be more common in pregnant women with placental malaria than in nonpregnant individuals. We present evidence that, in pregnant women, parasites containing multiple var2csa-type genes possess a selective advantage over parasites with a single var2csa gene. Accumulation of parasites with multiple copies of the var2csa gene during the course of pregnancy was also correlated with the development of antibodies involved in blocking VAR2CSA adhesion. The data suggest that multiplicity of var2csa-type genes enables P. falciparum parasites to persist for a longer period of time during placental infections, probably because of their greater capacity for antigenic variation and evasion of variant-specific immune responses. PMID:21592998

  5. Dynamics of anti-VAR2CSA immunoglobulin G response in a cohort of senegalese pregnant women

    DEFF Research Database (Denmark)

    Tuikue Ndam, N G; Salanti, A; Le-Hesran, J-Y

    2006-01-01

    demonstrated that a single P. falciparum infection was able to trigger a VAR2CSA-specific antibody response. Among women with infected placentas, women with high anti-VAR2CSA IgG levels at enrollment were more likely to present with a past infection than with an acute/chronic infection. CONCLUSIONS: Anti-VAR2...... (VSAPAM). Several studies have shown that 1 var gene, var2csa, is transcribed at high levels and expressed in CSA-binding Plasmodium falciparum parasites. METHODS: Plasma levels of anti-VAR2CSA immunoglobulin G (IgG) in Senegalese women were measured during pregnancy by enzyme-linked immunosorbent assay......, using 3 recombinant proteins representing 3 domains of the var2csa gene product. RESULTS: The 3 recombinant proteins were specifically recognized by plasma from pregnant women but not by control plasma. A parity-dependent recognition pattern was observed with 2 of the 3 VAR2CSA antigens. A kinetic study...

  6. An upstream open reading frame controls translation of var2csa, a gene implicated in placental malaria.

    Directory of Open Access Journals (Sweden)

    Borko Amulic

    2009-01-01

    Full Text Available Malaria, caused by the parasite Plasmodium falciparum, is responsible for substantial morbidity, mortality and economic losses in tropical regions of the world. Pregnant women are exceptionally vulnerable to severe consequences of the infection, due to the specific adhesion of parasite-infected erythrocytes in the placenta. This adhesion is mediated by a unique variant of PfEMP1, a parasite encoded, hyper-variable antigen placed on the surface of infected cells. This variant, called VAR2CSA, binds to chondroitin sulfate A on syncytiotrophoblasts in the intervillous space of placentas. VAR2CSA appears to only be expressed in the presence of a placenta, suggesting that its expression is actively repressed in men, children or non-pregnant women; however, the mechanism of repression is not understood. Using cultured parasite lines and reporter gene constructs, we show that the gene encoding VAR2CSA contains a small upstream open reading frame that acts to repress translation of the resulting mRNA, revealing a novel form of gene regulation in malaria parasites. The mechanism underlying this translational repression is reversible, allowing high levels of protein translation upon selection, thus potentially enabling parasites to upregulate expression of this variant antigen in the presence of the appropriate host tissue.

  7. Disruption of Var2csa Gene Impairs Placental Malaria Associated Adhesion Phenotype

    OpenAIRE

    Viebig, Nicola K.; Levin, Emily; Dechavanne, Sébastien; Rogerson, Stephen J.; Gysin, Jürg; Smith, Joseph D.; Scherf, Artur; Gamain, Benoit

    2007-01-01

    Infection with Plasmodium falciparum during pregnancy is one of the major causes of malaria related morbidity and mortality in newborn and mothers. The complications of pregnancy-associated malaria result mainly from massive adhesion of Plasmodium falciparum-infected erythrocytes (IE) to chondroitin sulfate A (CSA) present in the placental intervillous blood spaces. Var2CSA, a member of the P. falciparum erythrocyte membrane protein 1 (PfEMP1) family is the predominant parasite ligand mediati...

  8. Optimizing expression of the pregnancy malaria vaccine candidate, VAR2CSA in Pichia pastoris.

    Science.gov (United States)

    Avril, Marion; Hathaway, Marianne J; Cartwright, Megan M; Gose, Severin O; Narum, David L; Smith, Joseph D

    2009-06-29

    VAR2CSA is the main candidate for a vaccine against pregnancy-associated malaria, but vaccine development is complicated by the large size and complex disulfide bonding pattern of the protein. Recent X-ray crystallographic information suggests that domain boundaries of VAR2CSA Duffy binding-like (DBL) domains may be larger than previously predicted and include two additional cysteine residues. This study investigated whether longer constructs would improve VAR2CSA recombinant protein secretion from Pichia pastoris and if domain boundaries were applicable across different VAR2CSA alleles. VAR2CSA sequences were bioinformatically analysed to identify the predicted C11 and C12 cysteine residues at the C-termini of DBL domains and revised N- and C-termimal domain boundaries were predicted in VAR2CSA. Multiple construct boundaries were systematically evaluated for protein secretion in P. pastoris and secreted proteins were tested as immunogens. From a total of 42 different VAR2CSA constructs, 15 proteins (36%) were secreted. Longer construct boundaries, including the predicted C11 and C12 cysteine residues, generally improved expression of poorly or non-secreted domains and permitted expression of all six VAR2CSA DBL domains. However, protein secretion was still highly empiric and affected by subtle differences in domain boundaries and allelic variation between VAR2CSA sequences. Eleven of the secreted proteins were used to immunize rabbits. Antibodies reacted with CSA-binding infected erythrocytes, indicating that P. pastoris recombinant proteins possessed native protein epitopes. These findings strengthen emerging data for a revision of DBL domain boundaries in var-encoded proteins and may facilitate pregnancy malaria vaccine development.

  9. Optimizing expression of the pregnancy malaria vaccine candidate, VAR2CSA in Pichia pastoris

    Directory of Open Access Journals (Sweden)

    Narum David L

    2009-06-01

    Full Text Available Abstract Background VAR2CSA is the main candidate for a vaccine against pregnancy-associated malaria, but vaccine development is complicated by the large size and complex disulfide bonding pattern of the protein. Recent X-ray crystallographic information suggests that domain boundaries of VAR2CSA Duffy binding-like (DBL domains may be larger than previously predicted and include two additional cysteine residues. This study investigated whether longer constructs would improve VAR2CSA recombinant protein secretion from Pichia pastoris and if domain boundaries were applicable across different VAR2CSA alleles. Methods VAR2CSA sequences were bioinformatically analysed to identify the predicted C11 and C12 cysteine residues at the C-termini of DBL domains and revised N- and C-termimal domain boundaries were predicted in VAR2CSA. Multiple construct boundaries were systematically evaluated for protein secretion in P. pastoris and secreted proteins were tested as immunogens. Results From a total of 42 different VAR2CSA constructs, 15 proteins (36% were secreted. Longer construct boundaries, including the predicted C11 and C12 cysteine residues, generally improved expression of poorly or non-secreted domains and permitted expression of all six VAR2CSA DBL domains. However, protein secretion was still highly empiric and affected by subtle differences in domain boundaries and allelic variation between VAR2CSA sequences. Eleven of the secreted proteins were used to immunize rabbits. Antibodies reacted with CSA-binding infected erythrocytes, indicating that P. pastoris recombinant proteins possessed native protein epitopes. Conclusion These findings strengthen emerging data for a revision of DBL domain boundaries in var-encoded proteins and may facilitate pregnancy malaria vaccine development.

  10. A novel virus-like particle based vaccine platform displaying the placental malaria antigen VAR2CSA

    DEFF Research Database (Denmark)

    Thrane, Susan; Janitzek, Christoph M; Agerbæk, Mette Ø

    2015-01-01

    , this difference was not statistically significant after 3rd immunization. Importantly, the VLP-VAR2CSA induced antibodies were functional in inhibiting the binding of parasites to CSA. This study demonstrates that the described Avi-L1 VLP-platform may serve as a versatile system for facilitating optimal VLP......SA-VAR2CSA vaccines induced higher antibody titers than the soluble naked VAR2CSA vaccine after three immunizations. The VAR2CSA Avi-L1 VLP vaccine induced statistically significantly higher endpoint titres compared to the soluble mSA-VAR2CSA vaccine, after 1st and 2nd immunization; however...

  11. Utilizing nanobody technology to target non-immunodominant domains of VAR2CSA.

    Directory of Open Access Journals (Sweden)

    Sisse B Ditlev

    Full Text Available Placental malaria is a major health problem for both pregnant women and their fetuses in malaria endemic regions. It is triggered by the accumulation of Plasmodium falciparum-infected erythrocytes (IE in the intervillous spaces of the placenta and is associated with foetal growth restriction and maternal anemia. IE accumulation is supported by the binding of the parasite-expressed protein VAR2CSA to placental chondroitin sulfate A (CSA. Defining specific CSA-binding epitopes of VAR2CSA, against which to target the immune response, is essential for the development of a vaccine aimed at blocking IE adhesion. However, the development of a VAR2CSA adhesion-blocking vaccine remains challenging due to (i the large size of VAR2CSA and (ii the extensive immune selection for polymorphisms and thereby non-neutralizing B-cell epitopes. Camelid heavy-chain-only antibodies (HcAbs are known to target epitopes that are less immunogenic to classical IgG and, due to their small size and protruding antigen-binding loop, able to reach and recognize cryptic, conformational epitopes which are inaccessible to conventional antibodies. The variable heavy chain (VHH domain is the antigen-binding site of camelid HcAbs, the so called Nanobody, which represents the smallest known (15 kDa intact, native antigen-binding fragment. In this study, we have used the Nanobody technology, an approach new to malaria research, to generate small and functional antibody fragments recognizing unique epitopes broadly distributed on VAR2CSA.

  12. Clinical development of a VAR2CSA-based placental malaria vaccine PAMVAC

    DEFF Research Database (Denmark)

    Gbédandé, Komi; Fievet, Nadine; Viwami, Firmine

    2017-01-01

    Background  The antigen VAR2CSA plays a pivotal role in the pathophysiology of pregnancy-associated malaria (PAM) caused by Plasmodium falciparum. A VAR2CSA-based vaccine candidate, PAMVAC, is under development by an EU-funded multi-country consortium (PlacMalVac project). As part of PAMVAC...

  13. A Novel Virus-Like Particle Based Vaccine Platform Displaying the Placental Malaria Antigen VAR2CSA.

    Directory of Open Access Journals (Sweden)

    Susan Thrane

    Full Text Available Placental malaria caused by Plasmodium falciparum is a major cause of mortality and severe morbidity. Clinical testing of a soluble protein-based vaccine containing the parasite ligand, VAR2CSA, has been initiated. VAR2CSA binds to the human receptor chondroitin sulphate A (CSA and is responsible for sequestration of Plasmodium falciparum infected erythrocytes in the placenta. It is imperative that a vaccine against malaria in pregnancy, if administered to women before they become pregnant, can induce a strong and long lasting immune response. While most soluble protein-based vaccines have failed during clinical testing, virus-like particle (VLP based vaccines (e.g., the licensed human papillomavirus vaccines have demonstrated high efficacy, suggesting that the spatial assembly of the vaccine antigen is a critical parameter for inducing an optimal long-lasting protective immune response. We have developed a VLP vaccine display platform by identifying regions of the HPV16 L1 coat protein where a biotin acceptor site (AviTagTM can be inserted without compromising VLP-assembly. Subsequent biotinylation of Avi-L1 VLPs allow us to anchor monovalent streptavidin (mSA-fused proteins to the biotin, thereby obtaining a dense and repetitive VLP-display of the vaccine antigen. The mSA-VAR2CSA antigen was delivered on the Avi-L1 VLP platform and tested in C57BL/6 mice in comparison to two soluble protein-based vaccines consisting of naked VAR2CSA and mSA-VAR2CSA. The mSA-VAR2CSA Avi-L1 VLP and soluble mSA-VAR2CSA vaccines induced higher antibody titers than the soluble naked VAR2CSA vaccine after three immunizations. The VAR2CSA Avi-L1 VLP vaccine induced statistically significantly higher endpoint titres compared to the soluble mSA-VAR2CSA vaccine, after 1st and 2nd immunization; however, this difference was not statistically significant after 3rd immunization. Importantly, the VLP-VAR2CSA induced antibodies were functional in inhibiting the binding of

  14. Comparison of the specificity of antibodies to VAR2CSA in Cameroonian multigravidae with and without placental malaria

    DEFF Research Database (Denmark)

    Babakhanyan, Anna; Fang, Rui; Wey, Andrew

    2015-01-01

    BACKGROUND: Antibodies (Ab) to VAR2CSA prevent Plasmodium falciparum-infected erythrocytes from sequestrating in the placenta, i.e., prevent placental malaria (PM). The specificity of Ab to VAR2CSA associated with absence of PM is unknown. Accordingly, differences in the specificity of Ab to VAR2......CSA were compared between multigravidae with and without PM who had Ab to VAR2CSA. METHODS: In a retrospective case-control study, plasma collected from Cameroonian multigravidae with (n = 96) and without (n = 324) PM were screened in 21 assays that measured antibody levels to full length VAR2CSA (FV2......), individual VAR2CSA DBL domains, VAR2CSA domains from different genetic backgrounds (variants), as well as proportion of high avidity Ab to FV2. RESULTS: Multigravidae with and without PM had similar levels of Ab to FV2, the six VAR2CSA DBL domains and different variants, while the proportion of high avidity...

  15. Murine Model for Preclinical Studies of Var2CSA-Mediated Pathology Associated with Malaria in Pregnancy

    Science.gov (United States)

    Dechavanne, Sebastien; Sousa, Patrícia M.; Barateiro, André; Cunha, Sónia F.; Nunes-Silva, Sofia; Lima, Flávia A.; Murillo, Oscar; Marinho, Claudio R. F.; Gangnard, Stephane; Srivastava, Anand; Braks, Joanna A.; Janse, Chris J.; Gamain, Benoit; Penha-Gonçalves, Carlos

    2016-01-01

    Plasmodium falciparum infection during pregnancy leads to abortions, stillbirth, low birth weight, and maternal mortality. Infected erythrocytes (IEs) accumulate in the placenta by adhering to chondroitin sulfate A (CSA) via var2CSA protein exposed on the P. falciparum IE membrane. Plasmodium berghei IE infection in pregnant BALB/c mice is a model for severe placental malaria (PM). Here, we describe a transgenic P. berghei parasite expressing the full-length var2CSA extracellular region (domains DBL1X to DBL6ε) fused to a P. berghei exported protein (EMAP1) and characterize a var2CSA-based mouse model of PM. BALB/c mice were infected at midgestation with different doses of P. berghei-var2CSA (P. berghei-VAR) or P. berghei wild-type IEs. Infection with 104 P. berghei-VAR IEs induced a higher incidence of stillbirth and lower fetal weight than P. berghei. At doses of 105 and 106 IEs, P. berghei-VAR-infected mice showed increased maternal mortality during pregnancy and fetal loss, respectively. Parasite loads in infected placentas were similar between parasite lines despite differences in maternal outcomes. Fetal weight loss normalized for parasitemia was higher in P. berghei-VAR-infected mice than in P. berghei-infected mice. In vitro assays showed that higher numbers of P. berghei-VAR IEs than P. berghei IEs adhered to placental tissue. Immunization of mice with P. berghei-VAR elicited IgG antibodies reactive to DBL1-6 recombinant protein, indicating that the topology of immunogenic epitopes is maintained between DBL1-6–EMAP1 on P. berghei-VAR and recombinant DBL1-6 (recDBL1-6). Our data suggested that impairments in pregnancy caused by P. berghei-VAR infection were attributable to var2CSA expression. This model provides a tool for preclinical evaluation of protection against PM induced by approaches that target var2CSA. PMID:27045035

  16. Induction of adhesion-inhibitory antibodies against placental Plasmodium falciparum parasites by using single domains of VAR2CSA

    DEFF Research Database (Denmark)

    Nielsen, Morten A; Pinto, Vera V; Resende, Mafalda

    2009-01-01

    between a parasite protein expressed on erythrocytes named variant surface antigen 2-chondroitin sulfate A (VAR2CSA) and CSA on syncytiotrophoblasts. VAR2CSA is a large polymorphic protein consisting of six Duffy binding-like (DBL), domains and with current constraints on recombinant protein production...... which induce antibodies that inhibit CSA binding of different parasite strains. In this study, we produced a large panel of VAR2CSA proteins and raised antibodies against these antigens. We show that antibodies against the DBL4 domain effectively inhibit parasite binding. As the inhibition...... was not limited to homologous parasite strains, it seems feasible to base a protective malaria vaccine on a single VAR2CSA DBL domain....

  17. The antibody response of pregnant Cameroonian women to VAR2CSA ID1-ID2a, a small recombinant protein containing the CSA-binding site

    DEFF Research Database (Denmark)

    Babakhanyan, Anna; Leke, Rose G F; Salanti, Ali

    2014-01-01

    In pregnant women, Plasmodium falciparum-infected erythrocytes expressing the VAR2CSA antigen bind to chondroitin sulfate A in the placenta causing placental malaria. The binding site of VAR2CSA is present in the ID1-ID2a region. This study sought to determine if pregnant Cameroonian women natura...

  18. Several domains from VAR2CSA can induce Plasmodium falciparum adhesion-blocking antibodies

    DEFF Research Database (Denmark)

    Salanti, Ali; Resende, Mafalda; Ditlev, Sisse B

    2010-01-01

    . In this study, it is demonstrated that other domains of VAR2CSA also can induce antibodies with inhibitory activity. METHODS: All VAR2CSA domains from the 3D7 and HB3 parasites were produced in Baculovirus-transfected insect cells. Groups of three rats per protein were immunized and anti-sera were tested...

  19. Utilizing nanobody technology to target non-immunodominant domains of VAR2CSA

    DEFF Research Database (Denmark)

    Ditlev, Sisse B; Florea, Raluca; Nielsen, Morten A

    2014-01-01

    adhesion. However, the development of a VAR2CSA adhesion-blocking vaccine remains challenging due to (i) the large size of VAR2CSA and (ii) the extensive immune selection for polymorphisms and thereby non-neutralizing B-cell epitopes. Camelid heavy-chain-only antibodies (HcAbs) are known to target epitopes...... that are less immunogenic to classical IgG and, due to their small size and protruding antigen-binding loop, able to reach and recognize cryptic, conformational epitopes which are inaccessible to conventional antibodies. The variable heavy chain (VHH) domain is the antigen-binding site of camelid HcAbs, the so...

  20. High avidity antibodies to full-length VAR2CSA correlate with absence of placental malaria

    DEFF Research Database (Denmark)

    Tutterrow, Yeung Lo; Salanti, Ali; Avril, Marion

    2012-01-01

    VAR2CSA mediates sequestration of Plasmodium falciparum-infected erythrocytes in the placenta, increasing the risk of poor pregnancy outcomes. Naturally acquired antibodies (Ab) to placental parasites at delivery have been associated with improved pregnancy outcomes, but Ab levels and how early...... in pregnancy Ab must be present in order to eliminate placental parasites before delivery remains unknown. Antibodies to individual Duffy-binding like domains of VAR2CSA have been studied, but the domains lack many of the conformational epitopes present in full-length VAR2CSA (FV2). Thus, the purpose...... of this study was to describe the acquisition of Ab to FV2 in women residing in high and low transmission areas and determine how Ab levels during pregnancy correlate with clearance of placental parasites. Plasma samples collected monthly throughout pregnancy from pregnant women living in high and low...

  1. Differential recognition of terminal extracellular Plasmodium falciparum VAR2CSA domains by sera from multigravid, malaria-exposed Malian women.

    Science.gov (United States)

    Travassos, Mark A; Coulibaly, Drissa; Bailey, Jason A; Niangaly, Amadou; Adams, Matthew; Nyunt, Myaing M; Ouattara, Amed; Lyke, Kirsten E; Laurens, Matthew B; Pablo, Jozelyn; Jasinskas, Algis; Nakajima, Rie; Berry, Andrea A; Takala-Harrison, Shannon; Kone, Abdoulaye K; Kouriba, Bourema; Rowe, J Alexandra; Doumbo, Ogobara K; Thera, Mahamadou A; Laufer, Miriam K; Felgner, Philip L; Plowe, Christopher V

    2015-06-01

    The Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family mediates parasite sequestration in small capillaries through tissue-specific cytoadherence. The best characterized of these proteins is VAR2CSA, which is expressed on the surface of infected erythrocytes that bind to chondroitin sulfate in the placental matrix. Antibodies to VAR2CSA prevent placental cytoadherence and protect against placental malaria. The size and complexity of the VAR2CSA protein pose challenges for vaccine development, but smaller constitutive domains may be suitable for subunit vaccine development. A protein microarray was printed to include five overlapping fragments of the 3D7 VAR2CSA extracellular region. Malian women with a history of at least one pregnancy had antibody recognition of four of these fragments and had stronger reactivity against the two distal fragments than did nulliparous women, children, and men from Mali, suggesting that the C-terminal extracellular VAR2CSA domains are a potential focus of protective immunity. With carefully chosen sera from longitudinal studies of pregnant women, this approach has the potential to identify seroreactive VAR2CSA domains associated with protective immunity against pregnancy-associated malaria. © The American Society of Tropical Medicine and Hygiene.

  2. The Antibody Response of Pregnant Cameroonian Women to VAR2CSA ID1-ID2a, a Small Recombinant Protein Containing the CSA-Binding Site

    Science.gov (United States)

    Babakhanyan, Anna; Leke, Rose G. F.; Salanti, Ali; Bobbili, Naveen; Gwanmesia, Philomina; Leke, Robert J. I.; Quakyi, Isabella A.; Chen, John J.; Taylor, Diane Wallace

    2014-01-01

    In pregnant women, Plasmodium falciparum-infected erythrocytes expressing the VAR2CSA antigen bind to chondroitin sulfate A in the placenta causing placental malaria. The binding site of VAR2CSA is present in the ID1-ID2a region. This study sought to determine if pregnant Cameroonian women naturally acquire antibodies to ID1-ID2a and if antibodies to ID1-ID2a correlate with absence of placental malaria at delivery. Antibody levels to full-length VAR2CSA and ID1-ID2a were measured in plasma samples from 745 pregnant Cameroonian women, 144 Cameroonian men, and 66 US subjects. IgM levels and IgG avidity to ID1-ID2a were also determined. As expected, antibodies to ID1-ID2a were absent in US controls. Although pregnant Cameroonian women developed increasing levels of antibodies to full-length VAR2CSA during pregnancy, no increase in either IgM or IgG to ID1-ID2a was observed. Surprisingly, no differences in antibody levels to ID1-ID2a were detected between Cameroonian men and pregnant women. For example, in rural settings only 8–9% of males had antibodies to full-length VAR2CSA, but 90–96% had antibodies to ID1-ID2a. In addition, no significant difference in the avidity of IgG to ID1-ID2a was found between pregnant women and Cameroonian men, and no correlation between antibody levels at delivery and absence of placental malaria was found. Thus, the response to ID1-ID2a was not pregnancy specific, but predominantly against cross-reactivity epitopes, which may have been induced by other PfEMP1 antigens, malarial antigens, or microbes. Currently, ID1-ID2a is a leading vaccine candidate, since it binds to the CSA with the same affinity as the full-length molecule and elicits binding-inhibitory antibodies in animals. Further studies are needed to determine if the presence of naturally acquired cross-reactive antibodies in women living in malaria endemic countries will alter the response to ID1-ID2a following vaccination with ID1-ID2a. PMID:24505415

  3. The antibody response of pregnant Cameroonian women to VAR2CSA ID1-ID2a, a small recombinant protein containing the CSA-binding site.

    Directory of Open Access Journals (Sweden)

    Anna Babakhanyan

    Full Text Available In pregnant women, Plasmodium falciparum-infected erythrocytes expressing the VAR2CSA antigen bind to chondroitin sulfate A in the placenta causing placental malaria. The binding site of VAR2CSA is present in the ID1-ID2a region. This study sought to determine if pregnant Cameroonian women naturally acquire antibodies to ID1-ID2a and if antibodies to ID1-ID2a correlate with absence of placental malaria at delivery. Antibody levels to full-length VAR2CSA and ID1-ID2a were measured in plasma samples from 745 pregnant Cameroonian women, 144 Cameroonian men, and 66 US subjects. IgM levels and IgG avidity to ID1-ID2a were also determined. As expected, antibodies to ID1-ID2a were absent in US controls. Although pregnant Cameroonian women developed increasing levels of antibodies to full-length VAR2CSA during pregnancy, no increase in either IgM or IgG to ID1-ID2a was observed. Surprisingly, no differences in antibody levels to ID1-ID2a were detected between Cameroonian men and pregnant women. For example, in rural settings only 8-9% of males had antibodies to full-length VAR2CSA, but 90-96% had antibodies to ID1-ID2a. In addition, no significant difference in the avidity of IgG to ID1-ID2a was found between pregnant women and Cameroonian men, and no correlation between antibody levels at delivery and absence of placental malaria was found. Thus, the response to ID1-ID2a was not pregnancy specific, but predominantly against cross-reactivity epitopes, which may have been induced by other PfEMP1 antigens, malarial antigens, or microbes. Currently, ID1-ID2a is a leading vaccine candidate, since it binds to the CSA with the same affinity as the full-length molecule and elicits binding-inhibitory antibodies in animals. Further studies are needed to determine if the presence of naturally acquired cross-reactive antibodies in women living in malaria endemic countries will alter the response to ID1-ID2a following vaccination with ID1-ID2a.

  4. Antibody levels to recombinant VAR2CSA domains vary with Plasmodium falciparum parasitaemia, gestational age, and gravidity, but do not predict pregnancy outcomes.

    Science.gov (United States)

    Fried, Michal; Kurtis, Jonathan D; Swihart, Bruce; Morrison, Robert; Pond-Tor, Sunthorn; Barry, Amadou; Sidibe, Youssoufa; Keita, Sekouba; Mahamar, Almahamoudou; Andemel, Naissem; Attaher, Oumar; Dembele, Adama B; Cisse, Kadidia B; Diarra, Bacary S; Kanoute, Moussa B; Narum, David L; Dicko, Alassane; Duffy, Patrick E

    2018-03-09

    Maternal malaria is a tropical scourge associated with poor pregnancy outcomes. Women become resistant to Plasmodium falciparum pregnancy malaria as they acquire antibodies to the variant surface antigen VAR2CSA, a leading vaccine candidate. Because malaria infection may increase VAR2CSA antibody levels and thereby confound analyses of immune protection, gravidity-dependent changes in antibody levels during and after infection, and the effect of VAR2CSA antibodies on pregnancy outcomes were evaluated. Pregnant women enrolled in a longitudinal cohort study of mother-infant pairs in Ouelessebougou, Mali provided plasma samples at enrollment, gestational week 30-32, and delivery. Antibody levels to VAR2CSA domains were measured using a multiplex bead-based assay. Antibody levels to VAR2CSA were higher in multigravidae than primigravidae. Malaria infection was associated with increased antibody levels to VAR2CSA domains. In primigravidae but not in secundigravidae or multigravidae, antibodies levels sharply declined after an infection. A relationship between any VAR2CSA antibody specificity and protection from adverse pregnancy outcomes was not detected. During malaria infection, primigravidae acquire short-lived antibodies. The lack of an association between VAR2CSA domain antibody reactivity and improved pregnancy outcomes suggests that the recombinant proteins may not present native epitopes targeted by protective antibodies.

  5. Llama immunization with full-length VAR2CSA generates cross-reactive and inhibitory single-domain antibodies against the DBL1X domain.

    Science.gov (United States)

    Nunes-Silva, Sofia; Gangnard, Stéphane; Vidal, Marta; Vuchelen, Anneleen; Dechavanne, Sebastien; Chan, Sherwin; Pardon, Els; Steyaert, Jan; Ramboarina, Stephanie; Chêne, Arnaud; Gamain, Benoît

    2014-12-09

    VAR2CSA stands today as the leading vaccine candidate aiming to protect future pregnant women living in malaria endemic areas against the severe clinical outcomes of pregnancy associated malaria (PAM). The rational design of an efficient VAR2CSA-based vaccine relies on a profound understanding of the molecular interactions associated with P. falciparum infected erythrocyte sequestration in the placenta. Following immunization of a llama with the full-length VAR2CSA recombinant protein, we have expressed and characterized a panel of 19 nanobodies able to recognize the recombinant VAR2CSA as well as the surface of erythrocytes infected with parasites originating from different parts of the world. Domain mapping revealed that a large majority of nanobodies targeted DBL1X whereas a few of them were directed towards DBL4ε, DBL5ε and DBL6ε. One nanobody targeting the DBL1X was able to recognize the native VAR2CSA protein of the three parasite lines tested. Furthermore, four nanobodies targeting DBL1X reproducibly inhibited CSA adhesion of erythrocytes infected with the homologous NF54-CSA parasite strain, providing evidences that DBL1X domain is part or close to the CSA binding site. These nanobodies could serve as useful tools to identify conserved epitopes shared between different variants and to characterize the interactions between VAR2CSA and CSA.

  6. Molecular dissection of placental malaria protein VAR2CSA interaction with a chemo-enzymatically synthesized chondroitin sulfate library.

    Science.gov (United States)

    Sugiura, Nobuo; Clausen, Thomas Mandel; Shioiri, Tatsumasa; Gustavsson, Tobias; Watanabe, Hideto; Salanti, Ali

    2016-12-01

    Placental malaria, a serious infection caused by the parasite Plasmodium falciparum, is characterized by the selective accumulation of infected erythrocytes (IEs) in the placentas of the pregnant women. Placental adherence is mediated by the malarial VAR2CSA protein, which interacts with chondroitin sulfate (CS) proteoglycans present in the placental tissue. CS is a linear acidic polysaccharide composed of repeating disaccharide units of D-glucuronic acid and N-acetyl-D-galactosamine that are modified by sulfate groups at different positions. Previous reports have shown that placental-adhering IEs were associated with an unusually low sulfated form of chondroitin sulfate A (CSA) and that a partially sulfated dodecasaccharide is the minimal motif for the interaction. However, the fine molecular structure of this CS chain remains unclear. In this study, we have characterized the CS chain that interacts with a recombinant minimal CS-binding region of VAR2CSA (rVAR2) using a CS library of various defined lengths and sulfate compositions. The CS library was chemo-enzymatically synthesized with bacterial chondroitin polymerase and recombinant CS sulfotransferases. We found that C-4 sulfation of the N-acetyl-D-galactosamine residue is critical for supporting rVAR2 binding, whereas no other sulfate modifications showed effects. Interaction of rVAR2 with CS is highly correlated with the degree of C-4 sulfation and CS chain length. We confirmed that the minimum structure binding to rVAR2 is a tri-sulfated CSA dodecasaccharide, and found that a highly sulfated CSA eicosasaccharide is a more potent inhibitor of rVAR2 binding than the dodecasaccharides. These results suggest that CSA derivatives may potentially serve as targets in therapeutic strategies against placental malaria.

  7. Identification of a Major Dimorphic Region in the Functionally Critical N-Terminal ID1 Domain of VAR2CSA

    DEFF Research Database (Denmark)

    Doritchamou, Justin; Sabbagh, Audrey; Jespersen, Jakob S

    2015-01-01

    The VAR2CSA protein of Plasmodium falciparum is transported to and expressed on the infected erythrocyte surface where it plays a key role in placental malaria (PM). It is the current leading candidate for a vaccine to prevent PM. However, the antigenic polymorphism integral to VAR2CSA poses...... a challenge for vaccine development. Based on detailed analysis of polymorphisms in the sequence of its ligand-binding N-terminal region, currently the main focus for vaccine development, we assessed var2csa from parasite isolates infecting pregnant women. The results reveal for the first time the presence...

  8. Influence of intermittent preventive treatment on antibodies to VAR2CSA in pregnant Cameroonian women

    DEFF Research Database (Denmark)

    Babakhanyan, Anna; Tutterrow, Yeung L; Bobbili, Naveen

    2016-01-01

    Intermittent preventive treatment (IPT) and insecticide-treated bed nets are the standard of care for preventing malaria in pregnant women. Since these preventive measures reduce exposure to malaria, their influence on the antibody (Ab) response to the parasite antigen VAR2CSA was evaluated...... in pregnant Cameroonian women exposed to holoendemic malaria. Ab levels to full-length VAR2CSA (FV2), variants of the six Duffy binding like (DBL) domains, and proportion of high avidity Ab to FV2 were measured longitudinally in 92 women before and 147 women after IPT. As predicted, reduced exposure...

  9. Novel adenovirus encoded virus-like particles displaying the placental malaria associated VAR2CSA antigen

    DEFF Research Database (Denmark)

    Andersson, Anne-Marie C; dos Santos Marques Resende, Mafalda; Salanti, Ali

    2017-01-01

    The malaria parasite Plasmodium falciparum presents antigens on the infected erythrocyte surface that bind human receptors expressed on the vascular endothelium. The VAR2CSA mediated binding to a distinct chondroitin sulphate A (CSA) is a crucial step in the pathophysiology of placental malaria a...

  10. Infections with Plasmodium falciparum during pregnancy affect VAR2CSA DBL-5 domain-specific T cell cytokine responses

    DEFF Research Database (Denmark)

    Gbédandé, Komi; Cottrell, Gilles; Vianou, Bertin

    2016-01-01

    BACKGROUND: Current knowledge of human immunological responses to pregnancy-associated malaria-specific Plasmodium falciparum protein VAR2CSA concerns almost exclusively B cell-driven antibody-mediated activity. Knowledge of VAR2CSA-specific T cell-mediated activity is minimal by comparison, with...

  11. Baculovirus-expressed constructs induce immunoglobulin G that recognizes VAR2CSA on Plasmodium falciparum-infected erythrocytes

    DEFF Research Database (Denmark)

    Barfod, Lea; Nielsen, Morten A; Turner, Louise

    2006-01-01

    We raised specific antisera against recombinant VAR2CSA domains produced in Escherichia coli and in insect cells. All were reactive in enzyme-linked immunosorbent assay, but only insect cell-derived constructs induced immunoglobulin G (IgG) that was reactive with native VAR2CSA on the surface...

  12. Antibody responses to the full-length VAR2CSA and its DBL domains in Cameroonian children and teenagers

    DEFF Research Database (Denmark)

    Fodjo, Barriere A Y; Atemnkeng, Njika; Esemu, Livo

    2016-01-01

    villages and 160 children with severe malaria from the city.  Results: Low Ab levels to VAR2CSA were detected in children; however, Ab levels to FV2 in teenagers were rare. Children preferentially recognized DBL2 (56-70%) and DBL4 (50-60%), while multigravidae produced high levels of IgG to DBL3, DBL5...... and FV2. Sixty-seven percent of teenage girls (n = 16/24) recognized ID1-ID2a region of VAR2CSA. Children with severe forms of malaria had significantly higher IgG to merozoite antigens (all p 0.05) when compared to the healthy children.  Conclusion: The study...... suggests that children, including teenage girls acquire Ab to VAR2CSA domains and FV2, but Ab levels are much lower than those needed to protect women from placental infections and repertoire of Ab responses to DBL domains is different from those in pregnant women. Interestingly, children with severe...

  13. Structure of the DBL3x domain of pregnancy-associated malaria protein VAR2CSA complexed with chondroitin sulfate A

    Energy Technology Data Exchange (ETDEWEB)

    Singh, K.; Gittis, A.G.; Nguyen, P.; Gowda, D.C.; Miller, L.H.; Garboczi, D.N. (NIH); (Penn)

    2008-09-19

    Plasmodium falciparum-infected erythrocytes bind to chondroitin sulfate A (CSA) in the placenta via the VAR2CSA protein, a member of the P. falciparum erythrocyte membrane protein-1 family, leading to life-threatening malaria in pregnant women with severe effects on their fetuses and newborns. Here we describe the structure of the CSA binding DBL3x domain, a Duffy binding-like (DBL) domain of VAR2CSA. By forming a complex of DBL3x with CSA oligosaccharides and determining its structure, we have identified the CSA binding site to be a cluster of conserved positively charged residues on subdomain 2 and subdomain 3. Mutation or chemical modification of lysine residues at the site markedly diminished CSA binding to DBL3x. The location of the CSA binding site is an important step forward in the molecular understanding of pregnancy-associated malaria and offers a new target for vaccine development.

  14. Structural Insight into Epitopes in the Pregnancy-Associated Malaria Protein VAR2CSA

    DEFF Research Database (Denmark)

    Andersen, P; Nielsen, MA; Resende, M

    2008-01-01

    Pregnancy-associated malaria is caused by Plasmodium falciparum malaria parasites binding specifically to chondroitin sulfate A in the placenta. This sequestration of parasites is a major cause of low birth weight in infants and anemia in the mothers. VAR2CSA, a polymorphic multi-domain protein o...

  15. Evidence for globally shared, cross-reacting polymorphic epitopes in the pregnancy-associated malaria vaccine candidate VAR2CSA

    DEFF Research Database (Denmark)

    Avril, Marion; Kulasekara, Bridget R; Gose, Severin O

    2008-01-01

    Pregnancy-associated malaria (PAM) is characterized by the placental sequestration of Plasmodium falciparum-infected erythrocytes (IEs) with the ability to bind to chondroitin sulfate A (CSA). VAR2CSA is a leading candidate for a pregnancy malaria vaccine, but its large size ( approximately 350 k...

  16. The NTS-DBL2X region of VAR2CSA Induces cross-reactive antibodies that inhibit adhesion of several Plasmodium falciparum isolates to chondroitin sulfate A

    DEFF Research Database (Denmark)

    Bigey, Pascal; Gnidehou, Sédami; Doritchamou, Justin

    2011-01-01

    Background. Binding to chondroitin sulfate A by VAR2CSA, a parasite protein expressed on infected erythrocytes, allows placental sequestration of Plasmodium falciparum-infected erythrocytes. This leads to severe consequences such as maternal anemia, stillbirths, and intrauterine growth retardation....... The latter has been clearly associated to increased morbidity and mortality of the infants. Acquired anti-VAR2CSA antibodies have been associated with improved pregnancy outcomes, suggesting a vaccine could prevent the syndrome. However, identifying functionally important regions in the large VAR2CSA protein...

  17. Insight into Antigenic Diversity of VAR2CSA-DBL5 epsilon Domain from Multiple Plasmodium falciparum Placental Isolates

    DEFF Research Database (Denmark)

    Gnidehou, Sedami; Jessen, Leon Ivar; Gangnard, Stephane

    2010-01-01

    on the surface of placental parasites. Despite high DBL5e sequence homology among parasite isolates, sequence analyses identified motifs in DBL5e that discriminate parasites according to donor's parity. Moreover, recombinant proteins of two VAR2CSA DBL5e variants displayed diverse recognition patterns by plasma...... from malaria-exposed women, and diverse proteoglycan binding abilities. Conclusions/Significance: This study provides insights into conserved and exposed B cell epitopes in DBL5e that might be a focus for cross reactivity. The importance of sequence variation in VAR2CSA as a critical challenge...

  18. High efficacy of anti DBL4e-VAR2CSA antibodies in inhibition of CSA-binding Plasmodium falciparum-infected erythrocytes from pregnant women

    DEFF Research Database (Denmark)

    Magistrado, Pamela A; Minja, Daniel; Doritchamou, Justin

    2011-01-01

    Malaria during pregnancy is a major cause of intra-uterine growth-retardation and infant death in sub-Saharan Africa. Ideally, this could be prevented by a vaccine delivered before the first pregnancy. Antibodies against domain DBL4¿ from VAR2CSA has been shown to inhibit adhesion of laboratory i...

  19. Identification and characterization of B-cell epitopes in the DBL4e domain of VAR2CSA

    DEFF Research Database (Denmark)

    Ditlev, Sisse B; Nielsen, Morten A; Resende, Mafalda

    2012-01-01

    and is the leading candidate for a placental malaria vaccine. Antibodies induced in rats against the recombinant DBL4e domain of VAR2CSA inhibit the binding of a number of laboratory and field parasite isolates to CSA. In this study, we used a DBL4e peptide-array to identify epitopes targeted by DBL4e...... might be involved in the induction of inhibitory antibodies induced by the recombinant DBL4e domain....

  20. Placental Sequestration of Plasmodium falciparum Malaria Parasites Is Mediated by the Interaction Between VAR2CSA and Chondroitin Sulfate A on Syndecan-1

    Science.gov (United States)

    Mao, Yang; Resende, Mafalda; Daugaard, Mads; Riis Kristensen, Anders; Damm, Peter; G. Theander, Thor; R. Hansson, Stefan; Salanti, Ali

    2016-01-01

    During placental malaria, Plasmodium falciparum infected erythrocytes sequester in the placenta, causing health problems for both the mother and fetus. The specific adherence is mediated by the VAR2CSA protein, which binds to placental chondroitin sulfate (CS) on chondroitin sulfate proteoglycans (CSPGs) in the placental syncytium. However, the identity of the CSPG core protein and the cellular impact of the interaction have remain elusive. In this study we identified the specific CSPG core protein to which the CS is attached, and characterized its exact placental location. VAR2CSA pull-down experiments using placental extracts from whole placenta or syncytiotrophoblast microvillous cell membranes showed three distinct CSPGs available for VAR2CSA adherence. Further examination of these three CSPGs by immunofluorescence and proximity ligation assays showed that syndecan-1 is the main receptor for VAR2CSA mediated placental adherence. We further show that the commonly used placental choriocarcinoma cell line, BeWo, express a different set of proteoglycans than those present on placental syncytiotrophoblast and may not be the most biologically relevant model to study placental malaria. Syncytial fusion of the BeWo cells, triggered by forskolin treatment, caused an increased expression of placental CS-modified syndecan-1. In line with this, we show that rVAR2 binding to placental CS impairs syndecan-1-related Src signaling in forskolin treated BeWo cells, but not in untreated cells. PMID:27556547

  1. High avidity antibodies to full-length VAR2CSA correlate with absence of placental malaria.

    Directory of Open Access Journals (Sweden)

    Yeung Lo Tutterrow

    Full Text Available VAR2CSA mediates sequestration of Plasmodium falciparum-infected erythrocytes in the placenta, increasing the risk of poor pregnancy outcomes. Naturally acquired antibodies (Ab to placental parasites at delivery have been associated with improved pregnancy outcomes, but Ab levels and how early in pregnancy Ab must be present in order to eliminate placental parasites before delivery remains unknown. Antibodies to individual Duffy-binding like domains of VAR2CSA have been studied, but the domains lack many of the conformational epitopes present in full-length VAR2CSA (FV2. Thus, the purpose of this study was to describe the acquisition of Ab to FV2 in women residing in high and low transmission areas and determine how Ab levels during pregnancy correlate with clearance of placental parasites. Plasma samples collected monthly throughout pregnancy from pregnant women living in high and low transmission areas in Cameroon were evaluated for Ab to FV2 and the proportion of high avidity Ab (i.e., Ab that remain bound in the presence of 3M NH(4SCN was assessed. Ab levels and proportion of high avidity Ab were compared between women with placental malaria (PM(+ and those without (PM(- at delivery. Results showed that PM(- women had significantly higher Ab levels (p = 0.0047 and proportion of high avidity Ab (p = 0.0009 than PM(+ women throughout pregnancy. Specifically, women with moderate to high Ab levels (>5,000 MFI and those with ≥ 35% high avidity Ab at 5-6 months were found to have 2.3 (95% CI, 1.0-4.9 and 7.6-fold (p = 0.0013, 95% CI: 1.2-50.0 reduced risk of placental malaria, respectively. These data show that high levels of Ab to FV2, particularly those with high avidity for FV2, produced by mid-pregnancy are important in clearing parasites from the placenta. Both high Ab levels and proportion of high avidity Ab to FV2 may serve as correlates of protection for assessing immunity against placental malaria.

  2. Differential induction of functional IgG using the Plasmodium falciparum placental malaria vaccine candidate VAR2CSA

    DEFF Research Database (Denmark)

    Pinto, Vera V; Ditlev, Sisse B; Jensen, Kamilla E

    2011-01-01

    In Plasmodium falciparum malaria endemic areas placental malaria (PM) is an important complication of malaria. The recurrence of malaria in primigravidae women irrespective of acquired protection during childhood is caused by the interaction between the parasite-expressed VAR2CSA antigen and chon...

  3. Placental sequestration of Plasmodium falciparum malaria parasites is mediated by the interaction between VAR2CSA and chondroitin sulfate A on syndecan-1

    DEFF Research Database (Denmark)

    Ayres Pereira, Marina; Mandel Clausen, Thomas; Pehrson, Caroline

    2016-01-01

    During placental malaria, Plasmodium falciparum infected erythrocytes sequester in the placenta, causing health problems for both the mother and fetus. The specific adherence is mediated by the VAR2CSA protein, which binds to placental chondroitin sulfate (CS) on chondroitin sulfate proteoglycans......-down experiments using placental extracts from whole placenta or syncytiotrophoblast microvillous cell membranes showed three distinct CSPGs available for VAR2CSA adherence. Further examination of these three CSPGs by immunofluorescence and proximity ligation assays showed that syndecan-1 is the main receptor...... for VAR2CSA mediated placental adherence. We further show that the commonly used placental choriocarcinoma cell line, BeWo, express a different set of proteoglycans than those present on placental syncytiotrophoblast and may not be the most biologically relevant model to study placental malaria. Syncytial...

  4. Molecular dissection of placental malaria protein VAR2CSA interaction with a chemo-enzymatically synthesized chondroitin sulfate library

    DEFF Research Database (Denmark)

    Sugiura, Nobuo; Clausen, Thomas Mandel; Shioiri, Tatsuasa

    2016-01-01

    with chondroitin sulfate (CS) proteoglycans present in the placental tissue. CS is a linear acidic polysaccharide composed of repeating disaccharide units of d-glucuronic acid and N-acetyl-d-galactosamine that are modified by sulfate groups at different positions. Previous reports have shown that placental......-adhering IEs were associated with an unusually low sulfated form of chondroitin sulfate A (CSA) and that a partially sulfated dodecasaccharide is the minimal motif for the interaction. However, the fine molecular structure of this CS chain remains unclear. In this study, we have characterized the CS chain...... that interacts with a recombinant minimal CS-binding region of VAR2CSA (rVAR2) using a CS library of various defined lengths and sulfate compositions. The CS library was chemo-enzymatically synthesized with bacterial chondroitin polymerase and recombinant CS sulfotransferases. We found that C-4 sulfation...

  5. The Influence of Sub-Unit Composition and Expression System on the Functional Antibody Response in the Development of a VAR2CSA Based Plasmodium falciparum Placental Malaria Vaccine.

    Directory of Open Access Journals (Sweden)

    Morten A Nielsen

    Full Text Available The disease caused by Plasmodium falciparum (Pf involves different clinical manifestations that, cumulatively, kill hundreds of thousands every year. Placental malaria (PM is one such manifestation in which Pf infected erythrocytes (IE bind to chondroitin sulphate A (CSA through expression of VAR2CSA, a parasite-derived antigen. Protection against PM is mediated by antibodies that inhibit binding of IE in the placental intervillous space. VAR2CSA is a large antigen incompatible with large scale recombinant protein expression. Vaccines based on sub-units encompassing the functionally constrained receptor-binding domains may, theoretically, circumvent polymorphisms, reduce the risk of escape-mutants and induce cross-reactive antibodies. However, the sub-unit composition and small differences in the borders, may lead to exposure of novel immuno-dominant antibody epitopes that lead to non-functional antibodies, and furthermore influence the folding, stability and yield of expression. Candidate antigens from the pre-clinical development expressed in High-Five insect cells using the baculovirus expression vector system were transitioned into the Drosophila Schneider-2 cell (S2 expression-system compliant with clinical development. The functional capacity of antibodies against antigens expressed in High-Five cells or in S2 cells was equivalent. This enabled an extensive down-selection of S2 insect cell-expressed antigens primarily encompassing the minimal CSA-binding region of VAR2CSA. In general, we found differential potency of inhibitory antibodies against antigens with the same borders but of different var2csa sequences. Likewise, we found that subtle size differences in antigens of the same sequence gave varying levels of inhibitory antibodies. The study shows that induction of a functional response against recombinant subunits of the VAR2CSA antigen is unpredictable, demonstrating the need for large-scale screening in order to identify antigens

  6. Prospects and Pitfalls of Pregnancy-Associated Malaria Vaccination Based on the Natural Immune Response to Plasmodium falciparum VAR2CSA-Expressing Parasites

    Directory of Open Access Journals (Sweden)

    Elizabeth G. Kane

    2011-01-01

    Full Text Available Pregnancy-associated malaria, a manifestation of severe malaria, is the cause of up to 200,000 infant deaths a year, through the effects of placental insufficiency leading to growth restriction and preterm delivery. Development of a vaccine is one strategy for control. Plasmodium falciparum-infected red blood cells accumulate in the placenta through specific binding of pregnancy-associated parasite variants that express the VAR2CSA antigen to chondroitin sulphate A on the surface of syncytiotrophoblast cells. Parasite accumulation, accompanied by an inflammatory infiltrate, disrupts the cytokine balance of pregnancy with the potential to cause placental damage and compromise foetal growth. Multigravid women develop immunity towards VAR2CSA-expressing parasites in a gravidity-dependent manner which prevents unfavourable pregnancy outcomes. Although current vaccine design, targeting VAR2CSA antigens, has succeeded in inducing antibodies artificially, this candidate may not provide protection during the first trimester and may only protect those women living in areas endemic for malaria. It is concluded that while insufficient information about placental-parasite interactions is presently available to produce an effective vaccine, incremental progress is being made towards achieving this goal.

  7. Characterization of human placental glycosaminoglycans and regional binding to VAR2CSA in malaria infected erythrocytes

    DEFF Research Database (Denmark)

    Beaudet, Julie M; Mansur, Leandra; Joo, Eun Ji

    2014-01-01

    expressing VAR2CSA on the erythrocyte surface. This protein adheres to a low-sulfated chondroitin sulfate-A found in placental tissue causing great harm to both mother and developing fetus. In rare cases, the localization of infected erythrocytes to the placenta can even result in the vertical transmission...... placental tissue accessible to parasites in the bloodstream, suggesting it is the primary receptor for parasite infected red blood cells....

  8. Production, crystallization and X-ray diffraction analysis of two nanobodies against the Duffy binding-like (DBL) domain DBL6∊-FCR3 of the Plasmodium falciparum VAR2CSA protein

    International Nuclear Information System (INIS)

    Vuchelen, Anneleen; Pardon, Els; Steyaert, Jan; Gamain, Benoît; Loris, Remy; Nuland, Nico A. J. van; Ramboarina, Stéphanie

    2013-01-01

    Two nanobodies generated against the VAR2CSA DBL6∊-FCR3 domain involved in pregnancy-associated malaria were selected, expressed, purified and crystallized. The VAR2CSA protein has been closely associated with pregnancy-associated malaria and is recognized as the main adhesin exposed on the surface of Plasmodium falciparum-infected erythrocytes. Chondroitin sulfate A was identified as the main host receptor in the placenta. Single-domain heavy-chain camelid antibodies, more commonly called nanobodies, were selected and produced against the DBL6∊-FCR3 domain of VAR2CSA. Crystals of two specific nanobodies, Nb2907 and Nb2919, identified as strong binders to DBL6∊-FCR3 and the full-length VAR2CSA exposed on the surface of FCR3 P. falciparum-infected erythrocytes, were obtained. Crystals of Nb2907 diffract to 2.45 Å resolution and belong to space group C2 with unit-cell parameters a = 136.1, b = 78.5, c = 103.4 Å, β = 118.8°, whereas Nb2919 crystals diffract to 2.15 Å resolution and belong to space group P4 3 2 1 2 with unit-cell parameters a = b = 62.7, c = 167.2 Å

  9. Structural and functional insight into how the Plasmodium falciparum VAR2CSA protein mediates binding to chondroitin sulfate A in placental malaria

    DEFF Research Database (Denmark)

    Clausen, Thomas M; Christoffersen, Stig; Dahlbäck, Madeleine

    2012-01-01

    Malaria is a major global health problem. Pregnant women are susceptible to infection regardless of previously acquired immunity. Placental malaria is caused by parasites capable of sequestering in the placenta. This is mediated by VAR2CSA, a parasite antigen that interacts with chondroitin sulfa...

  10. Full-length recombinant Plasmodium falciparum VAR2CSA binds specifically to CSPG and induces potent parasite adhesion blocking antibodies

    DEFF Research Database (Denmark)

    Khunrae, Pongsak; Dahlbäck, Madeleine; Nielsen, Morten A

    2010-01-01

    in the pathogenesis of severe P. falciparum infection. In pregnant women the parasites express a single and unique member of the PfEMP1 family named VAR2CSA, which is associated with the ability of the infected erythrocytes to adhere specifically to chondroitin sulphate A (CSA) in the placenta. Several DBL domains......Plasmodium falciparum malaria remains one of the world's leading causes of human suffering and poverty. Each year, the disease takes 1-3 million lives, mainly in sub-Saharan Africa. The adhesion of parasite-infected erythrocytes to the vascular endothelium or the placenta is the key event...

  11. Chondroitin sulphate A (CSA)-binding of single recombinant Duffy-binding-like domains is not restricted to Plasmodium falciparum Erythrocyte Membrane Protein 1 expressed by CSA-binding parasites

    DEFF Research Database (Denmark)

    Resende, Mafalda; Ditlev, Sisse B; Nielsen, Morten A

    2009-01-01

    Individuals living in areas with high Plasmodium falciparum transmission acquire immunity to malaria over time and adults have a markedly reduced risk of contracting severe disease. However, pregnant women constitute an important exception. Pregnancy-associated malaria is a major cause of mother....... In this study, we confirm the CSA-binding of these DBL domains, however, the analysis of a number of DBL domains of a non-VAR2CSA origin shows that CSA-binding is not exclusively restricted to VAR2CSA DBL domains. Furthermore, we show that the VAR2CSA DBL domains as well as other DBL domains also bind heparan...

  12. High Levels of Antibodies to Multiple Domains and Strains of VAR2CSA Correlate with the Absence of Placental Malaria in Cameroonian Women Living in an Area of High Plasmodium falciparum Transmission

    Science.gov (United States)

    Tutterrow, Yeung L.; Avril, Marion; Singh, Kavita; Long, Carole A.; Leke, Robert J.; Sama, Grace; Salanti, Ali; Smith, Joseph D.; Leke, Rose G. F.

    2012-01-01

    Placental malaria, caused by sequestration of Plasmodium falciparum-infected erythrocytes in the placenta, is associated with increased risk of maternal morbidity and poor birth outcomes. The parasite antigen VAR2CSA (variant surface antigen 2-chondroitin sulfate A) is expressed on infected erythrocytes and mediates binding to chondroitin sulfate A, initiating inflammation and disrupting homeostasis at the maternal-fetal interface. Although antibodies can prevent sequestration, it is unclear whether parasite clearance is due to antibodies to a single Duffy binding-like (DBL) domain or to an extensive repertoire of antibodies to multiple DBL domains and allelic variants. Accordingly, plasma samples collected longitudinally from pregnant women were screened for naturally acquired antibodies against an extensive panel of VAR2CSA proteins, including 2 to 3 allelic variants for each of 5 different DBL domains. Analyses were performed on plasma samples collected from 3 to 9 months of pregnancy from women living in areas in Cameroon with high and low malaria transmission. The results demonstrate that high antibody levels to multiple VAR2CSA domains, rather than a single domain, were associated with the absence of placental malaria when antibodies were present from early in the second trimester until term. Absence of placental malaria was associated with increasing antibody breadth to different DBL domains and allelic variants in multigravid women. Furthermore, the antibody responses of women in the lower-transmission site had both lower magnitude and lesser breadth than those in the high-transmission site. These data suggest that immunity to placental malaria results from high antibody levels to multiple VAR2CSA domains and allelic variants and that antibody breadth is influenced by malaria transmission intensity. PMID:22331427

  13. Sporozoite Route of Infection Influences In Vitro var Gene Transcription of Plasmodium falciparum Parasites From Controlled Human Infections.

    Science.gov (United States)

    Dimonte, Sandra; Bruske, Ellen I; Hass, Johanna; Supan, Christian; Salazar, Carmen L; Held, Jana; Tschan, Serena; Esen, Meral; Flötenmeyer, Matthias; Koch, Iris; Berger, Jürgen; Bachmann, Anna; Sim, Betty K L; Hoffman, Stephen L; Kremsner, Peter G; Mordmüller, Benjamin; Frank, Matthias

    2016-09-15

    Antigenic variation in Plasmodium falciparum is mediated by the multicopy var gene family. Each parasite possesses about 60 var genes, and switching between active var loci results in antigenic variation. In the current study, the effect of mosquito and host passage on in vitro var gene transcription was investigated. Thirty malaria-naive individuals were inoculated by intradermal or intravenous injection with cryopreserved, isogenic NF54 P. falciparum sporozoites (PfSPZ) generated from 1 premosquito culture. Microscopic parasitemia developed in 22 individuals, and 21 in vitro cultures were established. The var gene transcript levels were determined in early and late postpatient cultures and in the premosquito culture. At the early time point, all cultures preferentially transcribed 8 subtelomeric var genes. Intradermal infections had higher var gene transcript levels than intravenous infections and a significantly longer intrahost replication time (P = .03). At the late time point, 9 subtelomeric and 8 central var genes were transcribed at the same levels in almost all cultures. Premosquito and late postpatient cultures transcribed the same subtelomeric and central var genes, except for var2csa  The duration of intrahost replication influences in vitro var gene transcript patterns. Differences between premosquito and postpatient cultures decrease with prolonged in vitro growth. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  14. Overproduction, purification and crystallization of a chondroitin sulfate A-binding DBL domain from a Plasmodium falciparum var2csa-encoded PfEMP1 protein

    International Nuclear Information System (INIS)

    Higgins, Matthew K.

    2008-01-01

    A chondroitin sulfate A-binding DBL important in placental malaria has been overproduced, purified and crystallized. Diffraction data were collected to 1.9 Å resolution. The PfEMP1 proteins of the malaria parasite Plasmodium falciparum are inserted into the membrane of infected red blood cells, where they mediate adhesion to a variety of human receptors. The DBL domains of the var2csa-encoded PfEMP1 protein play a critical role in malaria of pregnancy, tethering infected cells to the surface of the placenta through interactions with the glycosaminoglycan carbohydrate chondroitin sulfate A (CSA). A CSA-binding DBL domain has been overproduced in a bacterial expression system, purified and crystallized. Native data sets extending to 1.9 Å resolution have been collected and phasing is under way

  15. Overproduction, purification and crystallization of a chondroitin sulfate A-binding DBL domain from a Plasmodium falciparum var2csa-encoded PfEMP1 protein

    Energy Technology Data Exchange (ETDEWEB)

    Higgins, Matthew K., E-mail: mkh20@cam.ac.uk [Department of Biochemistry, University of Cambridge, 80 Tennis Court Road, Cambridge CB2 1GA (United Kingdom)

    2008-03-01

    A chondroitin sulfate A-binding DBL important in placental malaria has been overproduced, purified and crystallized. Diffraction data were collected to 1.9 Å resolution. The PfEMP1 proteins of the malaria parasite Plasmodium falciparum are inserted into the membrane of infected red blood cells, where they mediate adhesion to a variety of human receptors. The DBL domains of the var2csa-encoded PfEMP1 protein play a critical role in malaria of pregnancy, tethering infected cells to the surface of the placenta through interactions with the glycosaminoglycan carbohydrate chondroitin sulfate A (CSA). A CSA-binding DBL domain has been overproduced in a bacterial expression system, purified and crystallized. Native data sets extending to 1.9 Å resolution have been collected and phasing is under way.

  16. The Influence of Sub-Unit Composition and Expression System on the Functional Antibody Response in the Development of a VAR2CSA Based Plasmodium falciparum Placental Malaria Vaccine

    DEFF Research Database (Denmark)

    Nielsen, Morten A; dos Santos Marques Resende, Mafalda; de Jongh, Willem A

    2015-01-01

    -functional antibodies, and furthermore influence the folding, stability and yield of expression. Candidate antigens from the pre-clinical development expressed in High-Five insect cells using the baculovirus expression vector system were transitioned into the Drosophila Schneider-2 cell (S2) expression-system compliant...... with clinical development. The functional capacity of antibodies against antigens expressed in High-Five cells or in S2 cells was equivalent. This enabled an extensive down-selection of S2 insect cell-expressed antigens primarily encompassing the minimal CSA-binding region of VAR2CSA. In general, we found...

  17. Changes in var gene mRNA levels during erythrocytic development in two phenotypically distinct Plasmodium falciparum parasites

    DEFF Research Database (Denmark)

    Dahlbäck, Madeleine; Lavstsen, Thomas; Salanti, Ali

    2007-01-01

    , consistent with previous studies of other PfEMP1. Transcription of the pseudogene var1csa could not be detected in NF54VAR2CSA cells. CONCLUSION: The optimal sampling point for analysis of var transcripts using quantitative real-time PCR is the ring-stage, which is encouraging for the analysis of fresh...

  18. New var reconstruction algorithm exposes high var sequence diversity in a single geographic location in Mali.

    Science.gov (United States)

    Dara, Antoine; Drábek, Elliott F; Travassos, Mark A; Moser, Kara A; Delcher, Arthur L; Su, Qi; Hostelley, Timothy; Coulibaly, Drissa; Daou, Modibo; Dembele, Ahmadou; Diarra, Issa; Kone, Abdoulaye K; Kouriba, Bourema; Laurens, Matthew B; Niangaly, Amadou; Traore, Karim; Tolo, Youssouf; Fraser, Claire M; Thera, Mahamadou A; Djimde, Abdoulaye A; Doumbo, Ogobara K; Plowe, Christopher V; Silva, Joana C

    2017-03-28

    Encoded by the var gene family, highly variable Plasmodium falciparum erythrocyte membrane protein-1 (PfEMP1) proteins mediate tissue-specific cytoadherence of infected erythrocytes, resulting in immune evasion and severe malaria disease. Sequencing and assembling the 40-60 var gene complement for individual infections has been notoriously difficult, impeding molecular epidemiological studies and the assessment of particular var elements as subunit vaccine candidates. We developed and validated a novel algorithm, Exon-Targeted Hybrid Assembly (ETHA), to perform targeted assembly of var gene sequences, based on a combination of Pacific Biosciences and Illumina data. Using ETHA, we characterized the repertoire of var genes in 12 samples from uncomplicated malaria infections in children from a single Malian village and showed them to be as genetically diverse as vars from isolates from around the globe. The gene var2csa, a member of the var family associated with placental malaria pathogenesis, was present in each genome, as were vars previously associated with severe malaria. ETHA, a tool to discover novel var sequences from clinical samples, will aid the understanding of malaria pathogenesis and inform the design of malaria vaccines based on PfEMP1. ETHA is available at: https://sourceforge.net/projects/etha/ .

  19. High levels of antibodies to multiple domains and strains of VAR2CSA correlate with the absence of placental malaria in Cameroonian women living in an area of high Plasmodium falciparum transmission

    DEFF Research Database (Denmark)

    Tutterrow, Yeung L; Avril, Marion; Singh, Kavita

    2012-01-01

    erythrocytes and mediates binding to chondroitin sulfate A, initiating inflammation and disrupting homeostasis at the maternal-fetal interface. Although antibodies can prevent sequestration, it is unclear whether parasite clearance is due to antibodies to a single Duffy binding-like (DBL) domain...... or to an extensive repertoire of antibodies to multiple DBL domains and allelic variants. Accordingly, plasma samples collected longitudinally from pregnant women were screened for naturally acquired antibodies against an extensive panel of VAR2CSA proteins, including 2 to 3 allelic variants for each of 5 different...... DBL domains. Analyses were performed on plasma samples collected from 3 to 9 months of pregnancy from women living in areas in Cameroon with high and low malaria transmission. The results demonstrate that high antibody levels to multiple VAR2CSA domains, rather than a single domain, were associated...

  20. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

    Science.gov (United States)

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

    2016-10-13

    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  1. Generation of antigenic diversity in Plasmodium falciparum by structured rearrangement of Var genes during mitosis.

    Science.gov (United States)

    Claessens, Antoine; Hamilton, William L; Kekre, Mihir; Otto, Thomas D; Faizullabhoy, Adnan; Rayner, Julian C; Kwiatkowski, Dominic

    2014-12-01

    The most polymorphic gene family in P. falciparum is the ∼60 var genes distributed across parasite chromosomes, both in the subtelomeres and in internal regions. They encode hypervariable surface proteins known as P. falciparum erythrocyte membrane protein 1 (PfEMP1) that are critical for pathogenesis and immune evasion in Plasmodium falciparum. How var gene sequence diversity is generated is not currently completely understood. To address this, we constructed large clone trees and performed whole genome sequence analysis to study the generation of novel var gene sequences in asexually replicating parasites. While single nucleotide polymorphisms (SNPs) were scattered across the genome, structural variants (deletions, duplications, translocations) were focused in and around var genes, with considerable variation in frequency between strains. Analysis of more than 100 recombination events involving var exon 1 revealed that the average nucleotide sequence identity of two recombining exons was only 63% (range: 52.7-72.4%) yet the crossovers were error-free and occurred in such a way that the resulting sequence was in frame and domain architecture was preserved. Var exon 1, which encodes the immunologically exposed part of the protein, recombined in up to 0.2% of infected erythrocytes in vitro per life cycle. The high rate of var exon 1 recombination indicates that millions of new antigenic structures could potentially be generated each day in a single infected individual. We propose a model whereby var gene sequence polymorphism is mainly generated during the asexual part of the life cycle.

  2. Generation of antigenic diversity in Plasmodium falciparum by structured rearrangement of Var genes during mitosis.

    Directory of Open Access Journals (Sweden)

    Antoine Claessens

    2014-12-01

    Full Text Available The most polymorphic gene family in P. falciparum is the ∼60 var genes distributed across parasite chromosomes, both in the subtelomeres and in internal regions. They encode hypervariable surface proteins known as P. falciparum erythrocyte membrane protein 1 (PfEMP1 that are critical for pathogenesis and immune evasion in Plasmodium falciparum. How var gene sequence diversity is generated is not currently completely understood. To address this, we constructed large clone trees and performed whole genome sequence analysis to study the generation of novel var gene sequences in asexually replicating parasites. While single nucleotide polymorphisms (SNPs were scattered across the genome, structural variants (deletions, duplications, translocations were focused in and around var genes, with considerable variation in frequency between strains. Analysis of more than 100 recombination events involving var exon 1 revealed that the average nucleotide sequence identity of two recombining exons was only 63% (range: 52.7-72.4% yet the crossovers were error-free and occurred in such a way that the resulting sequence was in frame and domain architecture was preserved. Var exon 1, which encodes the immunologically exposed part of the protein, recombined in up to 0.2% of infected erythrocytes in vitro per life cycle. The high rate of var exon 1 recombination indicates that millions of new antigenic structures could potentially be generated each day in a single infected individual. We propose a model whereby var gene sequence polymorphism is mainly generated during the asexual part of the life cycle.

  3. Genome-wide identification and comparative expression analysis reveal a rapid expansion and functional divergence of duplicated genes in the WRKY gene family of cabbage, Brassica oleracea var. capitata.

    Science.gov (United States)

    Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi

    2015-02-15

    WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. The duplicated genes database: identification and functional annotation of co-localised duplicated genes across genomes.

    Directory of Open Access Journals (Sweden)

    Marion Ouedraogo

    Full Text Available BACKGROUND: There has been a surge in studies linking genome structure and gene expression, with special focus on duplicated genes. Although initially duplicated from the same sequence, duplicated genes can diverge strongly over evolution and take on different functions or regulated expression. However, information on the function and expression of duplicated genes remains sparse. Identifying groups of duplicated genes in different genomes and characterizing their expression and function would therefore be of great interest to the research community. The 'Duplicated Genes Database' (DGD was developed for this purpose. METHODOLOGY: Nine species were included in the DGD. For each species, BLAST analyses were conducted on peptide sequences corresponding to the genes mapped on a same chromosome. Groups of duplicated genes were defined based on these pairwise BLAST comparisons and the genomic location of the genes. For each group, Pearson correlations between gene expression data and semantic similarities between functional GO annotations were also computed when the relevant information was available. CONCLUSIONS: The Duplicated Gene Database provides a list of co-localised and duplicated genes for several species with the available gene co-expression level and semantic similarity value of functional annotation. Adding these data to the groups of duplicated genes provides biological information that can prove useful to gene expression analyses. The Duplicated Gene Database can be freely accessed through the DGD website at http://dgd.genouest.org.

  5. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa

    2010-01-01

    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  6. Evidence for in vitro and in vivo expression of the conserved VAR3 (type 3) plasmodium falciparum erythrocyte membrane protein 1

    DEFF Research Database (Denmark)

    Wang, Christian W; Lavstsen, Thomas; Bengtsson, Dominique C

    2012-01-01

    ABSTRACT: BACKGROUND: Members of the Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) adhesion antigen family are major contributors to the pathogenesis of P. falciparum malaria infections. The PfEMP1-encoding var genes are among the most diverse sequences in nature, but three genes......, var1, var2csa and var3 are found conserved in most parasite genomes. The most severe forms of malaria disease are caused by parasites expressing a subset of antigenically conserved PfEMP1 variants. Thus the ubiquitous and conserved VAR3 PfEMP1 is of particular interest to the research field. Evidence...... of VAR3 expression on the infected erythrocyte surface has never been presented, and var3 genes have been proposed to be transcribed and expressed differently from the rest of the var gene family members. METHODS: In this study, parasites expressing VAR3 PfEMP1 were generated using anti-VAR3 antibodies...

  7. Expression of P. falciparum var Genes Involves Exchange of the Histone Variant H2A.Z at the Promoter

    Science.gov (United States)

    Petter, Michaela; Lee, Chin Chin; Byrne, Timothy J.; Boysen, Katja E.; Volz, Jennifer; Ralph, Stuart A.; Cowman, Alan F.; Brown, Graham V.; Duffy, Michael F.

    2011-01-01

    Plasmodium falciparum employs antigenic variation to evade the human immune response by switching the expression of different variant surface antigens encoded by the var gene family. Epigenetic mechanisms including histone modifications and sub-nuclear compartmentalization contribute to transcriptional regulation in the malaria parasite, in particular to control antigenic variation. Another mechanism of epigenetic control is the exchange of canonical histones with alternative variants to generate functionally specialized chromatin domains. Here we demonstrate that the alternative histone PfH2A.Z is associated with the epigenetic regulation of var genes. In many eukaryotic organisms the histone variant H2A.Z mediates an open chromatin structure at promoters and facilitates diverse levels of regulation, including transcriptional activation. Throughout the asexual, intraerythrocytic lifecycle of P. falciparum we found that the P. falciparum ortholog of H2A.Z (PfH2A.Z) colocalizes with histone modifications that are characteristic of transcriptionally-permissive euchromatin, but not with markers of heterochromatin. Consistent with this finding, antibodies to PfH2A.Z co-precipitate the permissive modification H3K4me3. By chromatin-immunoprecipitation we show that PfH2A.Z is enriched in nucleosomes around the transcription start site (TSS) in both transcriptionally active and silent stage-specific genes. In var genes, however, PfH2A.Z is enriched at the TSS only during active transcription in ring stage parasites. Thus, in contrast to other genes, temporal var gene regulation involves histone variant exchange at promoter nucleosomes. Sir2 histone deacetylases are important for var gene silencing and their yeast ortholog antagonises H2A.Z function in subtelomeric yeast genes. In immature P. falciparum parasites lacking Sir2A or Sir2B high var transcription levels correlate with enrichment of PfH2A.Z at the TSS. As Sir2A knock out parasites mature the var genes are

  8. The prevalence of gene duplications and their ancient origin in Rhodobacter sphaeroides 2.4.1

    Directory of Open Access Journals (Sweden)

    Cho Hyuk

    2010-12-01

    Full Text Available Abstract Background Rhodobacter sphaeroides 2.4.1 is a metabolically versatile organism that belongs to α-3 subdivision of Proteobacteria. The present study was to identify the extent, history, and role of gene duplications in R. sphaeroides 2.4.1, an organism that possesses two chromosomes. Results A protein similarity search (BLASTP identified 1247 orfs (~29.4% of the total protein coding orfs that are present in 2 or more copies, 37.5% (234 gene-pairs of which exist in duplicate copies. The distribution of the duplicate gene-pairs in all Clusters of Orthologous Groups (COGs differed significantly when compared to the COG distribution across the whole genome. Location plots revealed clusters of gene duplications that possessed the same COG classification. Phylogenetic analyses were performed to determine a tree topology predicting either a Type-A or Type-B phylogenetic relationship. A Type-A phylogenetic relationship shows that a copy of the protein-pair matches more with an ortholog from a species closely related to R. sphaeroides while a Type-B relationship predicts the highest match between both copies of the R. sphaeroides protein-pair. The results revealed that ~77% of the proteins exhibited a Type-A phylogenetic relationship demonstrating the ancient origin of these gene duplications. Additional analyses on three other strains of R. sphaeroides revealed varying levels of gene loss and retention in these strains. Also, analyses on common gene pairs among the four strains revealed that these genes experience similar functional constraints and undergo purifying selection. Conclusions Although the results suggest that the level of gene duplication in organisms with complex genome structuring (more than one chromosome seems to be not markedly different from that in organisms with only a single chromosome, these duplications may have aided in genome reorganization in this group of eubacteria prior to the formation of R. sphaeroides as gene

  9. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.

    Science.gov (United States)

    Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet

    2016-02-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.

  10. Chondroitin sulfate A-adhering Plasmodium falciparum-infected erythrocytes express functionally important antibody epitopes shared by multiple variants

    DEFF Research Database (Denmark)

    Barfod, Lea; Dobrilovic, Tina; Magistrado, Pamela

    2010-01-01

    to chondroitin sulfate A in the intervillous space. Although interclonal variation of the var2csa gene is lower than that among var genes in general, VAR2CSA-specific Abs appear to target mainly polymorphic epitopes. This has raised doubts about the feasibility of VAR2CSA-based vaccines. We used eight human......) and recombinant VAR2CSA and interfered with IE and/or VAR2CSA binding to chondroitin sulfate A. Pair-wise mAb combinations were more inhibitory than single mAbs, and all of the mAbs together was the most efficient combination. Each mAb could opsonize IEs for phagocytosis, and a combination of the eight m...

  11. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN

    Science.gov (United States)

    Li, Zhen; Van de Peer, Yves; De Smet, Riet

    2016-01-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215

  12. Duplication and relocation of the functional DPY19L2 gene within low copy repeats

    Directory of Open Access Journals (Sweden)

    Cheung Joseph

    2006-03-01

    Full Text Available Abstract Background Low copy repeats (LCRs are thought to play an important role in recent gene evolution, especially when they facilitate gene duplications. Duplicate genes are fundamental to adaptive evolution, providing substrates for the development of new or shared gene functions. Moreover, silencing of duplicate genes can have an indirect effect on adaptive evolution by causing genomic relocation of functional genes. These changes are theorized to have been a major factor in speciation. Results Here we present a novel example showing functional gene relocation within a LCR. We characterize the genomic structure and gene content of eight related LCRs on human Chromosomes 7 and 12. Two members of a novel transmembrane gene family, DPY19L, were identified in these regions, along with six transcribed pseudogenes. One of these genes, DPY19L2, is found on Chromosome 12 and is not syntenic with its mouse orthologue. Instead, the human locus syntenic to mouse Dpy19l2 contains a pseudogene, DPY19L2P1. This indicates that the ancestral copy of this gene has been silenced, while the descendant copy has remained active. Thus, the functional copy of this gene has been relocated to a new genomic locus. We then describe the expansion and evolution of the DPY19L gene family from a single gene found in invertebrate animals. Ancient duplications have led to multiple homologues in different lineages, with three in fish, frogs and birds and four in mammals. Conclusion Our results show that the DPY19L family has expanded throughout the vertebrate lineage and has undergone recent primate-specific evolution within LCRs.

  13. The odds of duplicate gene persistence after polyploidization

    Directory of Open Access Journals (Sweden)

    Chain Frédéric JJ

    2011-12-01

    Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.

  14. Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures

    Directory of Open Access Journals (Sweden)

    Kesterson Robert A

    2003-04-01

    Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.

  15. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2009-07-01

    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  16. Preferential transcription of conserved rif genes in two phenotypically distinct Plasmodium falciparum parasite lines

    DEFF Research Database (Denmark)

    Wang, Christian W; Magistrado, Pamela A; Nielsen, Morten A

    2009-01-01

    transcribed in the VAR2CSA-expressing parasite line. In addition, two rif genes were found transcribed at early and late intra-erythrocyte stages independently of var gene transcription. Rif genes are organised in groups and inter-genomic conserved gene families, suggesting that RIFIN sub-groups may have......Plasmodium falciparum variant surface antigens (VSA) are targets of protective immunity to malaria. Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) and repetitive interspersed family (RIFIN) proteins are encoded by the two variable multigene families, var and rif genes, respectively...... novel rif gene groups, rifA1 and rifA2, containing inter-genomic conserved rif genes, were identified. All rifA1 genes were orientated head-to-head with a neighbouring Group A var gene whereas rifA2 was present in all parasite genomes as a single copy gene with a unique 5' untranslated region. Rif...

  17. FUNCTIONAL SPECIALIZATION OF DUPLICATED FLAVONOID BIOSYNTHESIS GENES IN WHEAT

    Directory of Open Access Journals (Sweden)

    Khlestkina E.

    2012-08-01

    Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.

  18. Recombination facilitates neofunctionalization of duplicate genes via originalization

    Directory of Open Access Journals (Sweden)

    Huang Ren

    2010-06-01

    Full Text Available Abstract Background Recently originalization was proposed to be an effective way of duplicate-gene preservation, in which recombination provokes the high frequency of original (or wild-type allele on both duplicated loci. Because the high frequency of wild-type allele might drive the arising and accumulating of advantageous mutation, it is hypothesized that recombination might enlarge the probability of neofunctionalization (Pneo of duplicate genes. In this article this hypothesis has been tested theoretically. Results Results show that through originalization recombination might not only shorten mean time to neofunctionalizaiton, but also enlarge Pneo. Conclusions Therefore, recombination might facilitate neofunctionalization via originalization. Several extensive applications of these results on genomic evolution have been discussed: 1. Time to nonfunctionalization can be much longer than a few million generations expected before; 2. Homogenization on duplicated loci results from not only gene conversion, but also originalization; 3. Although the rate of advantageous mutation is much small compared with that of degenerative mutation, Pneo cannot be expected to be small.

  19. Effect of Duplicate Genes on Mouse Genetic Robustness: An Update

    Directory of Open Access Journals (Sweden)

    Zhixi Su

    2014-01-01

    Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.

  20. Functional requirements driving the gene duplication in 12 Drosophila species.

    Science.gov (United States)

    Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui

    2013-08-15

    Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.

  1. Protective antibodies against placental malaria and poor outcomes during pregnancy, Benin

    DEFF Research Database (Denmark)

    Ndam, Nicaise Tuikue; Denoeud-Ndam, Lise; Doritchamou, Justin

    2015-01-01

    Placental malaria is caused by Plasmodium falciparum-infected erythrocytes that bind to placental tissue. Binding is mediated by VAR2CSA, a parasite antigen coded by the var gene, which interacts with chondroitin sulfate A (CSA). Consequences include maternal anemia and fetal growth retardation....... Antibody-mediated immunity to placental malaria is acquired during successive pregnancies, but the target of VAR2CSA-specific protective antibodies is unclear. We assessed VAR2CSA-specific antibodies in pregnant women and analyzed their relationships with protection against placental infection, preterm...... birth, and low birthweight. Antibody responses to the N-terminal region of VAR2CSA during early pregnancy were associated with reduced risks for infections and low birthweight. Among women infected during pregnancy, an increase in CSA binding inhibition was associated with reduced risks for placental...

  2. Evidence for the involvement of VAR2CSA in pregnancy-associated malaria

    DEFF Research Database (Denmark)

    Salanti, Ali; Dahlbäck, Madeleine; Turner, Louise

    2004-01-01

    In Plasmodium falciparum-endemic areas, pregnancy-associated malaria (PAM) is an important health problem. The condition is precipitated by accumulation of parasite-infected erythrocytes (IEs) in the placenta, and this process is mediated by parasite-encoded variant surface antigens (VSA) binding...... to chondroitin sulfate A (CSA). Parasites causing PAM express unique VSA types, VSAPAM, which can be serologically classified as sex specific and parity dependent. It is sex specific because men from malaria-endemic areas do not develop VSAPAM antibodies; it is parity dependent because women acquire anti...

  3. Profiling of gene duplication patterns of sequenced teleost genomes: evidence for rapid lineage-specific genome expansion mediated by recent tandem duplications.

    Science.gov (United States)

    Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang

    2012-06-15

    Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication

  4. Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion

    Directory of Open Access Journals (Sweden)

    Jeffrey A. Fawcett

    2011-02-01

    Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.

  5. Gene duplication, tissue-specific gene expression and sexual conflict in stalk-eyed flies (Diopsidae).

    Science.gov (United States)

    Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S

    2012-08-19

    Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.

  6. Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.

    Science.gov (United States)

    Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J

    2016-11-04

    Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types

  7. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  8. Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.

    Science.gov (United States)

    Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M

    2017-08-01

    Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

  9. Activation and clustering of a Plasmodium falciparum var gene are affected by subtelomeric sequences.

    Science.gov (United States)

    Duffy, Michael F; Tang, Jingyi; Sumardy, Fransisca; Nguyen, Hanh H T; Selvarajah, Shamista A; Josling, Gabrielle A; Day, Karen P; Petter, Michaela; Brown, Graham V

    2017-01-01

    The Plasmodium falciparum var multigene family encodes the cytoadhesive, variant antigen PfEMP1. P. falciparum antigenic variation and cytoadhesion specificity are controlled by epigenetic switching between the single, or few, simultaneously expressed var genes. Most var genes are maintained in perinuclear clusters of heterochromatic telomeres. The active var gene(s) occupy a single, perinuclear var expression site. It is unresolved whether the var expression site forms in situ at a telomeric cluster or whether it is an extant compartment to which single chromosomes travel, thus controlling var switching. Here we show that transcription of a var gene did not require decreased colocalisation with clusters of telomeres, supporting var expression site formation in situ. However following recombination within adjacent subtelomeric sequences, the same var gene was persistently activated and did colocalise less with telomeric clusters. Thus, participation in stable, heterochromatic, telomere clusters and var switching are independent but are both affected by subtelomeric sequences. The var expression site colocalised with the euchromatic mark H3K27ac to a greater extent than it did with heterochromatic H3K9me3. H3K27ac was enriched within the active var gene promoter even when the var gene was transiently repressed in mature parasites and thus H3K27ac may contribute to var gene epigenetic memory. © 2016 Federation of European Biochemical Societies.

  10. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  11. Evolutionary diversification of plant shikimate kinase gene duplicates.

    Directory of Open Access Journals (Sweden)

    Geoffrey Fucile

    2008-12-01

    Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.

  12. Maintenance and Loss of Duplicated Genes by Dosage Subfunctionalization.

    Science.gov (United States)

    Gout, Jean-Francois; Lynch, Michael

    2015-08-01

    Whole-genome duplications (WGDs) have contributed to gene-repertoire enrichment in many eukaryotic lineages. However, most duplicated genes are eventually lost and it is still unclear why some duplicated genes are evolutionary successful whereas others quickly turn to pseudogenes. Here, we show that dosage constraints are major factors opposing post-WGD gene loss in several Paramecium species that share a common ancestral WGD. We propose a model where a majority of WGD-derived duplicates preserve their ancestral function and are retained to produce enough of the proteins performing this same ancestral function. Under this model, the expression level of individual duplicated genes can evolve neutrally as long as they maintain a roughly constant summed expression, and this allows random genetic drift toward uneven contributions of the two copies to total expression. Our analysis suggests that once a high level of imbalance is reached, which can require substantial lengths of time, the copy with the lowest expression level contributes a small enough fraction of the total expression that selection no longer opposes its loss. Extension of our analysis to yeast species sharing a common ancestral WGD yields similar results, suggesting that duplicated-gene retention for dosage constraints followed by divergence in expression level and eventual deterministic gene loss might be a universal feature of post-WGD evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu

    2016-09-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.

  14. Exon duplications in the ATP7A gene

    DEFF Research Database (Denmark)

    Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko

    2011-01-01

    the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...

  15. Recurrent Gene Duplication Leads to Diverse Repertoires of Centromeric Histones in Drosophila Species.

    Science.gov (United States)

    Kursel, Lisa E; Malik, Harmit S

    2017-06-01

    Despite their essential role in the process of chromosome segregation in most eukaryotes, centromeric histones show remarkable evolutionary lability. Not only have they been lost in multiple insect lineages, but they have also undergone gene duplication in multiple plant lineages. Based on detailed study of a handful of model organisms including Drosophila melanogaster, centromeric histone duplication is considered to be rare in animals. Using a detailed phylogenomic study, we find that Cid, the centromeric histone gene, has undergone at least four independent gene duplications during Drosophila evolution. We find duplicate Cid genes in D. eugracilis (Cid2), in the montium species subgroup (Cid3, Cid4) and in the entire Drosophila subgenus (Cid5). We show that Cid3, Cid4, and Cid5 all localize to centromeres in their respective species. Some Cid duplicates are primarily expressed in the male germline. With rare exceptions, Cid duplicates have been strictly retained after birth, suggesting that they perform nonredundant centromeric functions, independent from the ancestral Cid. Indeed, each duplicate encodes a distinct N-terminal tail, which may provide the basis for distinct protein-protein interactions. Finally, we show some Cid duplicates evolve under positive selection whereas others do not. Taken together, our results support the hypothesis that Drosophila Cid duplicates have subfunctionalized. Thus, these gene duplications provide an unprecedented opportunity to dissect the multiple roles of centromeric histones. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Prevalent Role of Gene Features in Determining Evolutionary Fates of Whole-Genome Duplication Duplicated Genes in Flowering Plants1[W][OA

    Science.gov (United States)

    Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi

    2013-01-01

    The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833

  17. Identification of glycosaminoglycan binding regions in the Plasmodium falciparum encoded placental sequestration ligand, VAR2CSA

    DEFF Research Database (Denmark)

    Resende, Mafalda; Nielsen, Morten A.; Dahlbaeck, Madeleine

    2008-01-01

    Background: Pregnancy malaria is caused by Plasmodium falciparum-infected erythrocytes binding the placental receptor chondroitin sulfate A (CSA). This results in accumulation of parasites in the placenta with severe clinical consequences for the mother and her unborn child. Women become resistan...

  18. Comparative inference of duplicated genes produced by polyploidization in soybean genome.

    Science.gov (United States)

    Yang, Yanmei; Wang, Jinpeng; Di, Jianyong

    2013-01-01

    Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.

  19. Cloning of the Repertoire of Individual Plasmodium falciparum var Genes Using Transformation Associated Recombination (TAR)

    Science.gov (United States)

    Schmid, Christoph D.; Bühlmann, Tobias; Louis, Edward J.; Beck, Hans-Peter

    2011-01-01

    One of the major virulence factors of the malaria causing parasite is the Plasmodium falciparum encoded erythrocyte membrane protein 1 (PfEMP1). It is translocated to It the membrane of infected erythrocytes and expressed from approximately 60 var genes in a mutually exclusive manner. Switching of var genes allows the parasite to alter functional and antigenic properties of infected erythrocytes, to escape the immune defense and to establish chronic infections. We have developed an efficient method for isolating VAR genes from telomeric and other genome locations by adapting transformation-associated recombination (TAR) cloning, which can then be analyzed and sequenced. For this purpose, three plasmids each containing a homologous sequence representing the upstream regions of the group A, B, and C var genes and a sequence homologous to the conserved acidic terminal segment (ATS) of var genes were generated. Co-transfection with P. falciparum strain ITG2F6 genomic DNA in yeast cells yielded 200 TAR clones. The relative frequencies of clones from each group were not biased. Clones were screened by PCR, as well as Southern blotting, which revealed clones missed by PCR due to sequence mismatches with the primers. Selected clones were transformed into E. coli and further analyzed by RFLP and end sequencing. Physical analysis of 36 clones revealed 27 distinct types potentially representing 50% of the var gene repertoire. Three clones were selected for sequencing and assembled into single var gene containing contigs. This study demonstrates that it is possible to rapidly obtain the repertoire of var genes from P. falciparum within a single set of cloning experiments. This technique can be applied to individual isolates which will provide a detailed picture of the diversity of var genes in the field. This is a powerful tool to overcome the obstacles with cloning and assembly of multi-gene families by simultaneously cloning each member. PMID:21408186

  20. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  1. Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization

    Directory of Open Access Journals (Sweden)

    Xi-Yin Wang

    2011-01-01

    Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.

  2. Mosquito Passage Dramatically Changes var Gene Expression in Controlled Human Plasmodium falciparum Infections.

    Science.gov (United States)

    Bachmann, Anna; Petter, Michaela; Krumkamp, Ralf; Esen, Meral; Held, Jana; Scholz, Judith A M; Li, Tao; Sim, B Kim Lee; Hoffman, Stephen L; Kremsner, Peter G; Mordmüller, Benjamin; Duffy, Michael F; Tannich, Egbert

    2016-04-01

    Virulence of the most deadly malaria parasite Plasmodium falciparum is linked to the variant surface antigen PfEMP1, which is encoded by about 60 var genes per parasite genome. Although the expression of particular variants has been associated with different clinical outcomes, little is known about var gene expression at the onset of infection. By analyzing controlled human malaria infections via quantitative real-time PCR, we show that parasite populations from 18 volunteers expressed virtually identical transcript patterns that were dominated by the subtelomeric var gene group B and, to a lesser extent, group A. Furthermore, major changes in composition and frequency of var gene transcripts were detected between the parental parasite culture that was used to infect mosquitoes and Plasmodia recovered from infected volunteers, suggesting that P. falciparum resets its var gene expression during mosquito passage and starts with the broad expression of a specific subset of var genes when entering the human blood phase.

  3. Mutation update for the CSB/ERCC6 and CSA/ERCC8 genes involved in Cockayne syndrome.

    Science.gov (United States)

    Laugel, V; Dalloz, C; Durand, M; Sauvanaud, F; Kristensen, U; Vincent, M C; Pasquier, L; Odent, S; Cormier-Daire, V; Gener, B; Tobias, E S; Tolmie, J L; Martin-Coignard, D; Drouin-Garraud, V; Heron, D; Journel, H; Raffo, E; Vigneron, J; Lyonnet, S; Murday, V; Gubser-Mercati, D; Funalot, B; Brueton, L; Sanchez Del Pozo, J; Muñoz, E; Gennery, A R; Salih, M; Noruzinia, M; Prescott, K; Ramos, L; Stark, Z; Fieggen, K; Chabrol, B; Sarda, P; Edery, P; Bloch-Zupan, A; Fawcett, H; Pham, D; Egly, J M; Lehmann, A R; Sarasin, A; Dollfus, H

    2010-02-01

    Cockayne syndrome is an autosomal recessive multisystem disorder characterized principally by neurological and sensory impairment, cachectic dwarfism, and photosensitivity. This rare disease is linked to mutations in the CSB/ERCC6 and CSA/ERCC8 genes encoding proteins involved in the transcription-coupled DNA repair pathway. The clinical spectrum of Cockayne syndrome encompasses a wide range of severity from severe prenatal forms to mild and late-onset presentations. We have reviewed the 45 published mutations in CSA and CSB to date and we report 43 new mutations in these genes together with the corresponding clinical data. Among the 84 reported kindreds, 52 (62%) have mutations in the CSB gene. Many types of mutations are scattered along the whole coding sequence of both genes, but clusters of missense mutations can be recognized and highlight the role of particular motifs in the proteins. Genotype-phenotype correlation hypotheses are considered with regard to these new molecular and clinical data. Additional cases of molecular prenatal diagnosis are reported and the strategy for prenatal testing is discussed. Two web-based locus-specific databases have been created to list all identified variants and to allow the inclusion of future reports (www.umd.be/CSA/ and www.umd.be/CSB/). (c) 2009 Wiley-Liss, Inc.

  4. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong

    2009-11-01

    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  5. Differential transcriptional modulation of duplicated fatty acid-binding protein genes by dietary fatty acids in zebrafish (Danio rerio: evidence for subfunctionalization or neofunctionalization of duplicated genes

    Directory of Open Access Journals (Sweden)

    Denovan-Wright Eileen M

    2009-09-01

    Full Text Available Abstract Background In the Duplication-Degeneration-Complementation (DDC model, subfunctionalization and neofunctionalization have been proposed as important processes driving the retention of duplicated genes in the genome. These processes are thought to occur by gain or loss of regulatory elements in the promoters of duplicated genes. We tested the DDC model by determining the transcriptional induction of fatty acid-binding proteins (Fabps genes by dietary fatty acids (FAs in zebrafish. We chose zebrafish for this study for two reasons: extensive bioinformatics resources are available for zebrafish at zfin.org and zebrafish contains many duplicated genes owing to a whole genome duplication event that occurred early in the ray-finned fish lineage approximately 230-400 million years ago. Adult zebrafish were fed diets containing either fish oil (12% lipid, rich in highly unsaturated fatty acid, sunflower oil (12% lipid, rich in linoleic acid, linseed oil (12% lipid, rich in linolenic acid, or low fat (4% lipid, low fat diet for 10 weeks. FA profiles and the steady-state levels of fabp mRNA and heterogeneous nuclear RNA in intestine, liver, muscle and brain of zebrafish were determined. Result FA profiles assayed by gas chromatography differed in the intestine, brain, muscle and liver depending on diet. The steady-state level of mRNA for three sets of duplicated genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, and fabp11a/fabp11b, was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. In brain, the steady-state level of fabp7b mRNAs was induced in fish fed the linoleic acid-rich diet; in intestine, the transcript level of fabp1b.1 and fabp7b were elevated in fish fed the linolenic acid-rich diet; in liver, the level of fabp7a mRNAs was elevated in fish fed the low fat diet; and in muscle, the level of fabp7a and fabp11a mRNAs were elevated in fish fed the linolenic acid-rich or the low fat diets. In all cases

  6. Antisense long noncoding RNAs regulate var gene activation in the malaria parasite Plasmodium falciparum.

    Science.gov (United States)

    Amit-Avraham, Inbar; Pozner, Guy; Eshar, Shiri; Fastman, Yair; Kolevzon, Netanel; Yavin, Eylon; Dzikowski, Ron

    2015-03-03

    The virulence of Plasmodium falciparum, the causative agent of the deadliest form of human malaria, is attributed to its ability to evade human immunity through antigenic variation. These parasites alternate between expression of variable antigens, encoded by members of a multicopy gene family named var. Immune evasion through antigenic variation depends on tight regulation of var gene expression, ensuring that only a single var gene is expressed at a time while the rest of the family is maintained transcriptionally silent. Understanding how a single gene is chosen for activation is critical for understanding mutually exclusive expression but remains a mystery. Here, we show that antisense long noncoding RNAs (lncRNAs) initiating from var introns are associated with the single active var gene at the time in the cell cycle when the single var upstream promoter is active. We demonstrate that these antisense transcripts are incorporated into chromatin, and that expression of these antisense lncRNAs in trans triggers activation of a silent var gene in a sequence- and dose-dependent manner. On the other hand, interference with these lncRNAs using complement peptide nucleic acid molecules down-regulated the active var gene, erased the epigenetic memory, and induced expression switching. Altogether, our data provide evidence that these antisense lncRNAs play a key role in regulating var gene activation and mutually exclusive expression.

  7. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes1[OPEN

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu

    2016-01-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883

  8. Efficient transformation and expression of gfp gene in Valsa mali var. mali.

    Science.gov (United States)

    Chen, Liang; Sun, Gengwu; Wu, Shujing; Liu, Huixiang; Wang, Hongkai

    2015-01-01

    Valsa mali var. mali, the causal agent of valsa canker of apple, causes great loss of apple production in apple producing regions. The pathogenic mechanism of the pathogen has not been studied extensively, thus a suitable gene marker for pathogenic invasion analysis and a random insertion of T-DNA for mutants are desirable. In this paper, we reported the construction of a binary vector pKO1-HPH containing a positive selective gene hygromycin phosphotransferase (hph), a reporter gene gfp conferring green fluorescent protein, and an efficient protocol for V. mali var. mali transformation mediated by Agrobacterium tumefaciens. A transformation efficiency up to about 75 transformants per 10(5) conidia was achieved when co-cultivation of V. mali var. mali and A. tumefaciens for 48 h in A. tumefaciens inductive medium agar plates. The insertions of hph gene and gfp gene into V. mali var. mali genome verified by polymerase chain reaction and southern blot analysis showed that 10 randomly-selected transformants exhibited a single, unique hybridization pattern. This is the first report of A. tumefaciens-mediated transformation of V. mali var mali carrying a 'reporter' gfp gene that stably and efficiently expressed in the transformed V. mali var. mali species.

  9. A salmonid EST genomic study: genes, duplications, phylogeny and microarrays

    Directory of Open Access Journals (Sweden)

    Brahmbhatt Sonal

    2008-11-01

    Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is

  10. Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene

    Directory of Open Access Journals (Sweden)

    Shomron Noam

    2007-11-01

    Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.

  11. The chondroitin sulfate A-binding site of the VAR2CSA protein involves multiple N-terminal domains

    DEFF Research Database (Denmark)

    Dahlbäck, Madeleine; Jørgensen, Lars M; Nielsen, Morten A

    2011-01-01

    Malaria during pregnancy is a major health problem for African women. The disease is caused by Plasmodium falciparum malaria parasites, which accumulate in the placenta by adhering to chondroitin sulfate A (CSA). The interaction between infected erythrocytes and the placental receptor is mediated...

  12. Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes

    Science.gov (United States)

    Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.

    2011-01-01

    vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289

  13. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes.

    Science.gov (United States)

    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich

    2004-03-01

    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix-loop-helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks emerging through single-gene duplications, the dominant importance of molecular modularity in the bottom-up construction of complex biological entities, and the convergent evolution of networks.

  14. Genome Mutational and Transcriptional Hotspots Are Traps for Duplicated Genes and Sources of Adaptations.

    Science.gov (United States)

    Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina

    2017-05-01

    Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

    1996-07-01

    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  16. Population genomics of the immune evasion (var genes of Plasmodium falciparum.

    Directory of Open Access Journals (Sweden)

    Alyssa E Barry

    2007-03-01

    Full Text Available Var genes encode the major surface antigen (PfEMP1 of the blood stages of the human malaria parasite Plasmodium falciparum. Differential expression of up to 60 diverse var genes in each parasite genome underlies immune evasion. We compared the diversity of the DBLalpha domain of var genes sampled from 30 parasite isolates from a malaria endemic area of Papua New Guinea (PNG and 59 from widespread geographic origins (global. Overall, we obtained over 8,000 quality-controlled DBLalpha sequences. Within our sampling frame, the global population had a total of 895 distinct DBLalpha "types" and negligible overlap among repertoires. This indicated that var gene diversity on a global scale is so immense that many genomes would need to be sequenced to capture its true extent. In contrast, we found a much lower diversity in PNG of 185 DBLalpha types, with an average of approximately 7% overlap among repertoires. While we identify marked geographic structuring, nearly 40% of types identified in PNG were also found in samples from different countries showing a cosmopolitan distribution for much of the diversity. We also present evidence to suggest that recombination plays a key role in maintaining the unprecedented levels of polymorphism found in these immune evasion genes. This population genomic framework provides a cost effective molecular epidemiological tool to rapidly explore the geographic diversity of var genes.

  17. Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia.

    Science.gov (United States)

    Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C

    2010-02-01

    The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.

  18. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

    Science.gov (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

    2015-12-01

    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  19. Selective Constraints on Coding Sequences of Nervous System Genes Are a Major Determinant of Duplicate Gene Retention in Vertebrates.

    Science.gov (United States)

    Roux, Julien; Liu, Jialin; Robinson-Rechavi, Marc

    2017-11-01

    The evolutionary history of vertebrates is marked by three ancient whole-genome duplications: two successive rounds in the ancestor of vertebrates, and a third one specific to teleost fishes. Biased loss of most duplicates enriched the genome for specific genes, such as slow evolving genes, but this selective retention process is not well understood. To understand what drives the long-term preservation of duplicate genes, we characterized duplicated genes in terms of their expression patterns. We used a new method of expression enrichment analysis, TopAnat, applied to in situ hybridization data from thousands of genes from zebrafish and mouse. We showed that the presence of expression in the nervous system is a good predictor of a higher rate of retention of duplicate genes after whole-genome duplication. Further analyses suggest that purifying selection against the toxic effects of misfolded or misinteracting proteins, which is particularly strong in nonrenewing neural tissues, likely constrains the evolution of coding sequences of nervous system genes, leading indirectly to the preservation of duplicate genes after whole-genome duplication. Whole-genome duplications thus greatly contributed to the expansion of the toolkit of genes available for the evolution of profound novelties of the nervous system at the base of the vertebrate radiation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. MSOAR 2.0: Incorporating tandem duplications into ortholog assignment based on genome rearrangement

    Directory of Open Access Journals (Sweden)

    Zhang Liqing

    2010-01-01

    Full Text Available Abstract Background Ortholog assignment is a critical and fundamental problem in comparative genomics, since orthologs are considered to be functional counterparts in different species and can be used to infer molecular functions of one species from those of other species. MSOAR is a recently developed high-throughput system for assigning one-to-one orthologs between closely related species on a genome scale. It attempts to reconstruct the evolutionary history of input genomes in terms of genome rearrangement and gene duplication events. It assumes that a gene duplication event inserts a duplicated gene into the genome of interest at a random location (i.e., the random duplication model. However, in practice, biologists believe that genes are often duplicated by tandem duplications, where a duplicated gene is located next to the original copy (i.e., the tandem duplication model. Results In this paper, we develop MSOAR 2.0, an improved system for one-to-one ortholog assignment. For a pair of input genomes, the system first focuses on the tandemly duplicated genes of each genome and tries to identify among them those that were duplicated after the speciation (i.e., the so-called inparalogs, using a simple phylogenetic tree reconciliation method. For each such set of tandemly duplicated inparalogs, all but one gene will be deleted from the concerned genome (because they cannot possibly appear in any one-to-one ortholog pairs, and MSOAR is invoked. Using both simulated and real data experiments, we show that MSOAR 2.0 is able to achieve a better sensitivity and specificity than MSOAR. In comparison with the well-known genome-scale ortholog assignment tool InParanoid, Ensembl ortholog database, and the orthology information extracted from the well-known whole-genome multiple alignment program MultiZ, MSOAR 2.0 shows the highest sensitivity. Although the specificity of MSOAR 2.0 is slightly worse than that of InParanoid in the real data experiments

  1. Duplication and Diversification of the Hypoxia-Inducible IGFBP-1 Gene in Zebrafish

    DEFF Research Database (Denmark)

    Kamei, Hiroyasu; Lu, Ling; Jiao, Shuang

    2008-01-01

    Background: Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenabilit...

  2. Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants

    OpenAIRE

    Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong

    2010-01-01

    Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

  3. [Gene cloning and bioinformatics analysis of SABATH methyltransferase in Lonicera japonica var. chinensis].

    Science.gov (United States)

    Yu, Xiao-Dan; Jiang, Chao; Huang, Lu-Qi; Qin, Shuang-Shuang; Zeng, Xiang-Mei; Chen, Ping; Yuan, Yuan

    2013-08-01

    To clone SABATH methyltransferase (rLjSABATHMT) gene in Lonicera japonica var. chinensis, and compare the gene expression and intron sequence of SABATH methyltransferase orthologous in L. japonica with L. japonica var. chinensis. It provide a basis for gene regulate the formation of L. japonica floral scents. The cDNA and genome sequences of LjSABATHMT from L. japonica var. chinensis were cloned according to the gene fragments in cDNA library. The LjSABATHMT protein was characterized by bioinformatics analysis. SABATH family phylogenetic tree were built by MEGA 5.0. The transcripted level of SABATHMT orthologous were analyzed in different organs and different flower periods of L. japonica and L. japonica var. chinensis using RT-PCR analysis. Intron sequences of SABATHMT orthologous were also analyzied. The cDNA of LjSABATHMT was 1 251 bp, had a complete coding frame with 365 amino acids. The protein had the conservative SABATHMT domain, and phylogenetic tree showed that it may be a salicylic acid/benzoic acid methyltransferase. Higher expression of SABATH methyltransferase orthologous was found in flower. The intron sequence of L. japonica and L. japonica var. chinensis had rich polymorphism, and two SNP are unique genotype of L. japonica var. chinensis. The motif elements in two orthologous genes were significant differences. The intron difference of SABATH methyltransferase orthologous could be inducing to difference of gene expression between L. japonica and L. japonica var. chinensis. These results will provide important base on regulating active compounds of L. japonica.

  4. A re-assessment of gene-tag classification approaches for describing var gene expression patterns during human Plasmodium falciparum malaria parasite infections.

    Science.gov (United States)

    Githinji, George; Bull, Peter C

    2017-01-01

    PfEMP1 are variant parasite antigens that are inserted on the surface of Plasmodium falciparum infected erythrocytes (IE). Through interactions with various host molecules, PfEMP1 mediate IE sequestration in tissues and play a key role in the pathology of severe malaria. PfEMP1 is encoded by a diverse multi-gene family called var . Previous studies have shown that that expression of specific subsets of var genes are associated with low levels of host immunity and severe malaria. However, in most clinical studies to date, full-length var gene sequences were unavailable and various approaches have been used to make comparisons between var gene expression profiles in different parasite isolates using limited information. Several studies have relied on the classification of a 300 - 500 base-pair "DBLα tag" region in the DBLα domain located at the 5' end of most var genes. We assessed the relationship between various DBLα tag classification methods, and sequence features that are only fully assessable through full-length var gene sequences. We compared these different sequence features in full-length var gene from six fully sequenced laboratory isolates. These comparisons show that despite a long history of recombination,   DBLα sequence tag classification can provide functional information on important features of full-length var genes. Notably, a specific subset of DBLα tags previously defined as "group A-like" is associated with CIDRα1 domains proposed to bind to endothelial protein C receptor. This analysis helps to bring together different sources of data that have been used to assess var gene expression in clinical parasite isolates.

  5. The natural history of class I primate alcohol dehydrogenases includes gene duplication, gene loss, and gene conversion.

    Directory of Open Access Journals (Sweden)

    Matthew A Carrigan

    Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates

  6. Early vertebrate chromosome duplications and the evolution of the neuropeptide Y receptor gene regions

    Directory of Open Access Journals (Sweden)

    Brenner Sydney

    2008-06-01

    Full Text Available Abstract Background One of the many gene families that expanded in early vertebrate evolution is the neuropeptide (NPY receptor family of G-protein coupled receptors. Earlier work by our lab suggested that several of the NPY receptor genes found in extant vertebrates resulted from two genome duplications before the origin of jawed vertebrates (gnathostomes and one additional genome duplication in the actinopterygian lineage, based on their location on chromosomes sharing several gene families. In this study we have investigated, in five vertebrate genomes, 45 gene families with members close to the NPY receptor genes in the compact genomes of the teleost fishes Tetraodon nigroviridis and Takifugu rubripes. These correspond to Homo sapiens chromosomes 4, 5, 8 and 10. Results Chromosome regions with conserved synteny were identified and confirmed by phylogenetic analyses in H. sapiens, M. musculus, D. rerio, T. rubripes and T. nigroviridis. 26 gene families, including the NPY receptor genes, (plus 3 described recently by other labs showed a tree topology consistent with duplications in early vertebrate evolution and in the actinopterygian lineage, thereby supporting expansion through block duplications. Eight gene families had complications that precluded analysis (such as short sequence length or variable number of repeated domains and another eight families did not support block duplications (because the paralogs in these families seem to have originated in another time window than the proposed genome duplication events. RT-PCR carried out with several tissues in T. rubripes revealed that all five NPY receptors were expressed in the brain and subtypes Y2, Y4 and Y8 were also expressed in peripheral organs. Conclusion We conclude that the phylogenetic analyses and chromosomal locations of these gene families support duplications of large blocks of genes or even entire chromosomes. Thus, these results are consistent with two early vertebrate

  7. RANGER-DTL 2.0: Rigorous Reconstruction of Gene-Family Evolution by Duplication, Transfer, and Loss.

    Science.gov (United States)

    Bansal, Mukul S; Kellis, Manolis; Kordi, Misagh; Kundu, Soumya

    2018-04-24

    RANGER-DTL 2.0 is a software program for inferring gene family evolution using Duplication-Transfer-Loss reconciliation. This new software is highly scalable and easy to use, and offers many new features not currently available in any other reconciliation program. RANGER-DTL 2.0 has a particular focus on reconciliation accuracy and can account for many sources of reconciliation uncertainty including uncertain gene tree rooting, gene tree topological uncertainty, multiple optimal reconciliations, and alternative event cost assignments. RANGER-DTL 2.0 is open-source and written in C ++ and Python. Pre-compiled executables, source code (open-source under GNU GPL), and a detailed manual are freely available from http://compbio.engr.uconn.edu/software/RANGER-DTL/. mukul.bansal@uconn.edu.

  8. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  9. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  10. Trans-acting GC-rich non-coding RNA at var expression site modulates gene counting in malaria parasite.

    Science.gov (United States)

    Guizetti, Julien; Barcons-Simon, Anna; Scherf, Artur

    2016-11-16

    Monoallelic expression of the var multigene family enables immune evasion of the malaria parasite Plasmodium falciparum in its human host. At a given time only a single member of the 60-member var gene family is expressed at a discrete perinuclear region called the 'var expression site'. However, the mechanism of var gene counting remains ill-defined. We hypothesize that activation factors associating specifically with the expression site play a key role in this process. Here, we investigate the role of a GC-rich non-coding RNA (ncRNA) gene family composed of 15 highly homologous members. GC-rich genes are positioned adjacent to var genes in chromosome-central gene clusters but are absent near subtelomeric var genes. Fluorescence in situ hybridization demonstrates that GC-rich ncRNA localizes to the perinuclear expression site of central and subtelomeric var genes in trans. Importantly, overexpression of distinct GC-rich ncRNA members disrupts the gene counting process at the single cell level and results in activation of a specific subset of var genes in distinct clones. We identify the first trans-acting factor targeted to the elusive perinuclear var expression site and open up new avenues to investigate ncRNA function in antigenic variation of malaria and other protozoan pathogens. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Evolution of vertebrate central nervous system is accompanied by novel expression changes of duplicate genes.

    Science.gov (United States)

    Chen, Yuan; Ding, Yun; Zhang, Zuming; Wang, Wen; Chen, Jun-Yuan; Ueno, Naoto; Mao, Bingyu

    2011-12-20

    The evolution of the central nervous system (CNS) is one of the most striking changes during the transition from invertebrates to vertebrates. As a major source of genetic novelties, gene duplication might play an important role in the functional innovation of vertebrate CNS. In this study, we focused on a group of CNS-biased genes that duplicated during early vertebrate evolution. We investigated the tempo-spatial expression patterns of 33 duplicate gene families and their orthologs during the embryonic development of the vertebrate Xenopus laevis and the cephalochordate Brachiostoma belcheri. Almost all the identified duplicate genes are differentially expressed in the CNS in Xenopus embryos, and more than 50% and 30% duplicate genes are expressed in the telencephalon and mid-hindbrain boundary, respectively, which are mostly considered as two innovations in the vertebrate CNS. Interestingly, more than 50% of the amphioxus orthologs do not show apparent expression in the CNS in amphioxus embryos as detected by in situ hybridization, indicating that some of the vertebrate CNS-biased duplicate genes might arise from non-CNS genes in invertebrates. Our data accentuate the functional contribution of gene duplication in the CNS evolution of vertebrate and uncover an invertebrate non-CNS history for some vertebrate CNS-biased duplicate genes. Copyright © 2011. Published by Elsevier Ltd.

  12. The complete chloroplast genome sequence of Taxus chinensis var. mairei (Taxaceae): loss of an inverted repeat region and comparative analysis with related species.

    Science.gov (United States)

    Zhang, Yanzhen; Ma, Ji; Yang, Bingxian; Li, Ruyi; Zhu, Wei; Sun, Lianli; Tian, Jingkui; Zhang, Lin

    2014-05-01

    Taxus chinensis var. mairei (Taxaceae) is a domestic variety of yew species in local China. This plant is one of the sources for paclitaxel, which is a promising antineoplastic chemotherapy drugs during the last decade. We have sequenced the complete nucleotide sequence of the chloroplast (cp) genome of T. chinensis var. mairei. The T. chinensis var. mairei cp genome is 129,513 bp in length, with 113 single copy genes and two duplicated genes (trnI-CAU, trnQ-UUG). Among the 113 single copy genes, 9 are intron-containing. Compared to other land plant cp genomes, the T. chinensis var. mairei cp genome has lost one of the large inverted repeats (IRs) found in angiosperms, fern, liverwort, and gymnosperm such as Cycas revoluta and Ginkgo biloba L. Compared to related species, the gene order of T. chinensis var. mairei has a large inversion of ~110kb including 91 genes (from rps18 to accD) with gene contents unarranged. Repeat analysis identified 48 direct and 2 inverted repeats 30 bp long or longer with a sequence identity greater than 90%. Repeated short segments were found in genes rps18, rps19 and clpP. Analysis also revealed 22 simple sequence repeat (SSR) loci and almost all are composed of A or T. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. The distinct proteome of placental malaria parasites.

    Energy Technology Data Exchange (ETDEWEB)

    Fried, Michal; Hixson, Kim K.; Anderson, Lori; Ogata, Yuko; Mutabingwa, Theonest K.; Duffy, Patrick E.

    2007-09-01

    Malaria proteins expressed on the surface of Plasmodium falciparum infected erythrocytes (IE) mediate adhesion and are targeted by protective immune responses. During pregnancy, IE sequester in the placenta. Placental IE bind to the molecule chondroitin sulfate A (CSA) and preferentially transcribe the gene that encodes VAR2CSA, a member of the PfEMP1 variant surface antigen family. Over successive pregnancies women develop specific immunity to CSA-binding IE and antibodies to VAR2CSA. We used tandem mass spectrometry together with accurate mass and time tag technology to study IE membrane fractions of placental parasites. VAR2CSA peptides were detected in placental IE and in IE from children, but the MC variant of VAR2CSA was specifically associated with placental IE. We identified six conserved hypothetical proteins with putative TM or signal peptides that were exclusively expressed by the placental IE, and 11 such proteins that were significantly more abundant in placental IE. One of these hypothetical proteins, PFI1785w, is a 42kDa molecule detected by Western blot in parasites infecting pregnant women but not those infecting children.

  14. Efficient gene replacements in ku70 disruption strain of Aspergillus chevalieri var. intermedius

    Directory of Open Access Journals (Sweden)

    Qingqing Huang

    2017-01-01

    Full Text Available Aspergillus chevalieri var. intermedius is a dominant filamentous fungal species in Fuzhuan tea and is associated with the quality and health benefits of this tea. The sexual or asexual reproduction of this fungus depends on the osmotic pressure of the tea. Efforts to enhance the beneficial effects of A. chevalieri var. intermedius are hampered by difficulties in disrupting its genes. To address this issue, we identified the A. chevalieri var. intermedius homolog (Acku70 of human Ku70 and generated an Acku70 disruption strain (ΔAcku70, aiming to improve the gene replacement efficiency. ΔAcku70 grew at a slightly lower rate in vitro than the wild-type strain; however, the two strains exhibited similar sensitivity to temperature, osmotic pressure and the effects of ethyl methane sulphonate and H2O2. The replacement efficiency of veA and flbA dramatically increased in ΔAcku70 compared to that in the wild type. The efficiency of flbA replacement increased from 2.6% to 80%, whereas the frequency of veA disruption increased from 15.2% to 83.9% and from 30.8% to 86.8%. Thus, ΔAcku70 is suitable for use as a type strain for large-scale functional genomic analysis of A. chevalieri var. intermedius.

  15. Evolution dynamics of a model for gene duplication under adaptive conflict

    Science.gov (United States)

    Ancliff, Mark; Park, Jeong-Man

    2014-06-01

    We present and solve the dynamics of a model for gene duplication showing escape from adaptive conflict. We use a Crow-Kimura quasispecies model of evolution where the fitness landscape is a function of Hamming distances from two reference sequences, which are assumed to optimize two different gene functions, to describe the dynamics of a mixed population of individuals with single and double copies of a pleiotropic gene. The evolution equations are solved through a spin coherent state path integral, and we find two phases: one is an escape from an adaptive conflict phase, where each copy of a duplicated gene evolves toward subfunctionalization, and the other is a duplication loss of function phase, where one copy maintains its pleiotropic form and the other copy undergoes neutral mutation. The phase is determined by a competition between the fitness benefits of subfunctionalization and the greater mutational load associated with maintaining two gene copies. In the escape phase, we find a dynamics of an initial population of single gene sequences only which escape adaptive conflict through gene duplication and find that there are two time regimes: until a time t* single gene sequences dominate, and after t* double gene sequences outgrow single gene sequences. The time t* is identified as the time necessary for subfunctionalization to evolve and spread throughout the double gene sequences, and we show that there is an optimum mutation rate which minimizes this time scale.

  16. Dual stage synthesis and crucial role of cytoadherence-linked asexual gene 9 in the surface expression of malaria parasite var proteins

    DEFF Research Database (Denmark)

    Goel, Suchi; Valiyaveettil, Manojkumar; Achur, Rajeshwara N

    2010-01-01

    adherence. However, how CLAG9 influences this process remains unknown. In this study, we show that CLAG9 interacts with VAR2CSA, a PfEMP1 that mediates IRBC adherence to chondroitin 4-sulfate in the placenta. Importantly, our results show that the adherent parasites synthesize CLAG9 at two stages--the early......Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family members mediate the adherence of parasite-infected red blood cells (IRBCs) to various host receptors. A previous study has shown that the parasite protein, cytoadherence-linked asexual gene 9 (CLAG9), is also essential for IRBC...... within the parasite. Based on these findings, we propose that CLAG9 plays a critical role in the trafficking of PfEMP1s onto the IRBC surface. These results have important implications for the development of therapeutics for cerebral, placental, and other cytoadherence-associated malaria illnesses....

  17. Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster

    Directory of Open Access Journals (Sweden)

    Jakobek Judy L

    2007-07-01

    Full Text Available Abstract Background The biosynthesis of aflatoxin (AF involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST and O-methylsterigmatocystin (OMST, the respective penultimate and ultimate precursors of AF. Although these precursors are chemically and structurally very similar, their accumulation differs at the species level for Aspergilli. Notable examples are A. nidulans that synthesizes only ST, A. flavus that makes predominantly AF, and A. parasiticus that generally produces either AF or OMST. Whether these differences are important in the evolutionary/ecological processes of species adaptation and diversification is unknown. Equally unknown are the specific genomic mechanisms responsible for ordering and clustering of genes in the AF pathway of Aspergillus. Results To elucidate the mechanisms that have driven formation of these clusters, we performed systematic searches of aflatoxin cluster homologs across five Aspergillus genomes. We found a high level of gene duplication and identified seven modules consisting of highly correlated gene pairs (aflA/aflB, aflR/aflS, aflX/aflY, aflF/aflE, aflT/aflQ, aflC/aflW, and aflG/aflL. With the exception of A. nomius, contrasts of mean Ka/Ks values across all cluster genes showed significant differences in selective pressure between section Flavi and non-section Flavi species. A. nomius mean Ka/Ks values were more similar to partial clusters in A. fumigatus and A. terreus. Overall, mean Ka/Ks values were significantly higher for section Flavi than for non-section Flavi species. Conclusion Our results implicate several genomic mechanisms in the evolution of ST, OMST and AF cluster genes. Gene modules may arise from duplications of a single gene, whereby the function of the pre-duplication gene is retained in the copy (aflF/aflE or the copies may partition the ancestral function (aflA/aflB. In some gene modules, the

  18. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  19. Segmental Duplication, Microinversion, and Gene Loss Associated with a Complex Inversion Breakpoint Region in Drosophila

    Science.gov (United States)

    Calvete, Oriol; González, Josefa; Betrán, Esther; Ruiz, Alfredo

    2012-01-01

    Chromosomal inversions are usually portrayed as simple two-breakpoint rearrangements changing gene order but not gene number or structure. However, increasing evidence suggests that inversion breakpoints may often have a complex structure and entail gene duplications with potential functional consequences. Here, we used a combination of different techniques to investigate the breakpoint structure and the functional consequences of a complex rearrangement fixed in Drosophila buzzatii and comprising two tandemly arranged inversions sharing the middle breakpoint: 2m and 2n. By comparing the sequence in the breakpoint regions between D. buzzatii (inverted chromosome) and D. mojavensis (noninverted chromosome), we corroborate the breakpoint reuse at the molecular level and infer that inversion 2m was associated with a duplication of a ∼13 kb segment and likely generated by staggered breaks plus repair by nonhomologous end joining. The duplicated segment contained the gene CG4673, involved in nuclear transport, and its two nested genes CG5071 and CG5079. Interestingly, we found that other than the inversion and the associated duplication, both breakpoints suffered additional rearrangements, that is, the proximal breakpoint experienced a microinversion event associated at both ends with a 121-bp long duplication that contains a promoter. As a consequence of all these different rearrangements, CG5079 has been lost from the genome, CG5071 is now a single copy nonnested gene, and CG4673 has a transcript ∼9 kb shorter and seems to have acquired a more complex gene regulation. Our results illustrate the complex effects of chromosomal rearrangements and highlight the need of complementing genomic approaches with detailed sequence-level and functional analyses of breakpoint regions if we are to fully understand genome structure, function, and evolutionary dynamics. PMID:22328714

  20. Targeted Exon Skipping to Correct Exon Duplications in the Dystrophin Gene

    Directory of Open Access Journals (Sweden)

    Kane L Greer

    2014-01-01

    Full Text Available Duchenne muscular dystrophy is a severe muscle-wasting disease caused by mutations in the dystrophin gene that ablate functional protein expression. Although exonic deletions are the most common Duchenne muscular dystrophy lesion, duplications account for 10–15% of reported disease-causing mutations, and exon 2 is the most commonly duplicated exon. Here, we describe the in vitro evaluation of phosphorodiamidate morpholino oligomers coupled to a cell-penetrating peptide and 2′-O-methyl phosphorothioate oligonucleotides, using three distinct strategies to reframe the dystrophin transcript in patient cells carrying an exon 2 duplication. Differences in exon-skipping efficiencies in vitro were observed between oligomer analogues of the same sequence, with the phosphorodiamidate morpholino oligomer coupled to a cell-penetrating peptide proving the most effective. Differences in exon 2 excision efficiency between normal and exon 2 duplication cells, were apparent, indicating that exon context influences oligomer-induced splice switching. Skipping of a single copy of exon 2 was induced in the cells carrying an exon 2 duplication, the simplest strategy to restore the reading frame and generate a normal dystrophin transcript. In contrast, multiexon skipping of exons 2–7 to generate a Becker muscular dystrophy-like dystrophin transcript was more challenging and could only be induced efficiently with the phosphorodiamidate morpholino oligomer chemistry.

  1. Plasmodium falciparum var Gene Silencing Is Determined by cis DNA Elements That Form Stable and Heritable Interactions ▿

    Science.gov (United States)

    Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.

    2011-01-01

    Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310

  2. Processes of fungal proteome evolution and gain of function: gene duplication and domain rearrangement

    International Nuclear Information System (INIS)

    Cohen-Gihon, Inbar; Nussinov, Ruth; Sharan, Roded

    2011-01-01

    During evolution, organisms have gained functional complexity mainly by modifying and improving existing functioning systems rather than creating new ones ab initio. Here we explore the interplay between two processes which during evolution have had major roles in the acquisition of new functions: gene duplication and protein domain rearrangements. We consider four possible evolutionary scenarios: gene families that have undergone none of these event types; only gene duplication; only domain rearrangement, or both events. We characterize each of the four evolutionary scenarios by functional attributes. Our analysis of ten fungal genomes indicates that at least for the fungi clade, species significantly appear to gain complexity by gene duplication accompanied by the expansion of existing domain architectures via rearrangements. We show that paralogs gaining new domain architectures via duplication tend to adopt new functions compared to paralogs that preserve their domain architectures. We conclude that evolution of protein families through gene duplication and domain rearrangement is correlated with their functional properties. We suggest that in general, new functions are acquired via the integration of gene duplication and domain rearrangements rather than each process acting independently

  3. Polytomy refinement for the correction of dubious duplications in gene trees.

    Science.gov (United States)

    Lafond, Manuel; Chauve, Cedric; Dondi, Riccardo; El-Mabrouk, Nadia

    2014-09-01

    Large-scale methods for inferring gene trees are error-prone. Correcting gene trees for weakly supported features often results in non-binary trees, i.e. trees with polytomies, thus raising the natural question of refining such polytomies into binary trees. A feature pointing toward potential errors in gene trees are duplications that are not supported by the presence of multiple gene copies. We introduce the problem of refining polytomies in a gene tree while minimizing the number of created non-apparent duplications in the resulting tree. We show that this problem can be described as a graph-theoretical optimization problem. We provide a bounded heuristic with guaranteed optimality for well-characterized instances. We apply our algorithm to a set of ray-finned fish gene trees from the Ensembl database to illustrate its ability to correct dubious duplications. The C++ source code for the algorithms and simulations described in the article are available at http://www-ens.iro.umontreal.ca/~lafonman/software.php. Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press.

  4. Rapid sequence divergence rates in the 5 prime regulatory regions of young Drosophila melanogaster duplicate gene pairs

    Directory of Open Access Journals (Sweden)

    Michael H. Kohn

    2008-01-01

    Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.

  5. Duplication and diversification of the hypoxia-inducible IGFBP-1 gene in zebrafish.

    Directory of Open Access Journals (Sweden)

    Hiroyasu Kamei

    2008-08-01

    Full Text Available Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenability to genetic and experimental manipulation and because it possess a large number of duplicated genes.We report the identification and characterization of two hypoxia-inducible genes in zebrafish that are co-ortholgs of human IGF binding protein-1 (IGFBP-1. IGFBP-1 is a secreted protein that binds to IGF and modulates IGF actions in somatic growth, development, and aging. Like their human and mouse counterparts, in adult zebrafish igfbp-1a and igfbp-1b are exclusively expressed in the liver. During embryogenesis, the two genes are expressed in overlapping spatial domains but with distinct temporal patterns. While zebrafish IGFBP-1a mRNA was easily detected throughout embryogenesis, IGFBP-1b mRNA was detectable only in advanced stages. Hypoxia induces igfbp-1a expression in early embryogenesis, but induces the igfbp-1b expression later in embryogenesis. Both IGFBP-1a and -b are capable of IGF binding, but IGFBP-1b has much lower affinities for IGF-I and -II because of greater dissociation rates. Overexpression of IGFBP-1a and -1b in zebrafish embryos caused significant decreases in growth and developmental rates. When tested in cultured zebrafish embryonic cells, IGFBP-1a and -1b both inhibited IGF-1-induced cell proliferation but the activity of IGFBP-1b was significantly weaker.These results indicate subfunction partitioning of the duplicated IGFBP-1 genes at the levels of gene expression, physiological regulation, protein structure, and biological actions. The duplicated IGFBP-1 may provide additional flexibility in fine-tuning IGF signaling activities under hypoxia and other catabolic conditions.

  6. The evolution of pepsinogen C genes in vertebrates: duplication, loss and functional diversification.

    Directory of Open Access Journals (Sweden)

    Luís Filipe Costa Castro

    Full Text Available BACKGROUND: Aspartic proteases comprise a large group of enzymes involved in peptide proteolysis. This collection includes prominent enzymes globally categorized as pepsins, which are derived from pepsinogen precursors. Pepsins are involved in gastric digestion, a hallmark of vertebrate physiology. An important member among the pepsinogens is pepsinogen C (Pgc. A particular aspect of Pgc is its apparent single copy status, which contrasts with the numerous gene copies found for example in pepsinogen A (Pga. Although gene sequences with similarity to Pgc have been described in some vertebrate groups, no exhaustive evolutionary framework has been considered so far. METHODOLOGY/PRINCIPAL FINDINGS: By combining phylogenetics and genomic analysis, we find an unexpected Pgc diversity in the vertebrate sub-phylum. We were able to reconstruct gene duplication timings relative to the divergence of major vertebrate clades. Before tetrapod divergence, a single Pgc gene tandemly expanded to produce two gene lineages (Pgbc and Pgc2. These have been differentially retained in various classes. Accordingly, we find Pgc2 in sauropsids, amphibians and marsupials, but not in eutherian mammals. Pgbc was retained in amphibians, but duplicated in the ancestor of amniotes giving rise to Pgb and Pgc1. The latter was retained in mammals and probably in reptiles and marsupials but not in birds. Pgb was kept in all of the amniote clade with independent episodes of loss in some mammalian species. Lineage specific expansions of Pgc2 and Pgbc have also occurred in marsupials and amphibians respectively. We find that teleost and tetrapod Pgc genes reside in distinct genomic regions hinting at a possible translocation. CONCLUSIONS: We conclude that the repertoire of Pgc genes is larger than previously reported, and that tandem duplications have modelled the history of Pgc genes. We hypothesize that gene expansion lead to functional divergence in tetrapods, coincident with the

  7. Putative DNA G-quadruplex formation within the promoters of Plasmodium falciparum var genes

    Directory of Open Access Journals (Sweden)

    Rowe J

    2009-08-01

    Full Text Available Abstract Background Guanine-rich nucleic acid sequences are capable of folding into an intramolecular four-stranded structure called a G-quadruplex. When found in gene promoter regions, G-quadruplexes can downregulate gene expression, possibly by blocking the transcriptional machinery. Here we have used a genome-wide bioinformatic approach to identify Putative G-Quadruplex Sequences (PQS in the Plasmodium falciparum genome, along with biophysical techniques to examine the physiological stability of P. falciparum PQS in vitro. Results We identified 63 PQS in the non-telomeric regions of the P. falciparum clone 3D7. Interestingly, 16 of these PQS occurred in the upstream region of a subset of the P. falciparum var genes (group B var genes. The var gene family encodes PfEMP1, the parasite's major variant antigen and adhesin expressed at the surface of infected erythrocytes, that plays a key role in malaria pathogenesis and immune evasion. The ability of the PQS found in the upstream regions of group B var genes (UpsB-Q to form stable G-quadruplex structures in vitro was confirmed using 1H NMR, circular dichroism, UV spectroscopy, and thermal denaturation experiments. Moreover, the synthetic compound BOQ1 that shows a higher affinity for DNA forming quadruplex rather than duplex structures was found to bind with high affinity to the UpsB-Q. Conclusion This is the first demonstration of non-telomeric PQS in the genome of P. falciparum that form stable G-quadruplexes under physiological conditions in vitro. These results allow the generation of a novel hypothesis that the G-quadruplex sequences in the upstream regions of var genes have the potential to play a role in the transcriptional control of this major virulence-associated multi-gene family.

  8. Simulating evolution of protein complexes through gene duplication and co-option.

    Science.gov (United States)

    Haarsma, Loren; Nelesen, Serita; VanAndel, Ethan; Lamine, James; VandeHaar, Peter

    2016-06-21

    We present a model of the evolution of protein complexes with novel functions through gene duplication, mutation, and co-option. Under a wide variety of input parameters, digital organisms evolve complexes of 2-5 bound proteins which have novel functions but whose component proteins are not independently functional. Evolution of complexes with novel functions happens more quickly as gene duplication rates increase, point mutation rates increase, protein complex functional probability increases, protein complex functional strength increases, and protein family size decreases. Evolution of complexity is inhibited when the metabolic costs of making proteins exceeds the fitness gain of having functional proteins, or when point mutation rates get so large the functional proteins undergo deleterious mutations faster than new functional complexes can evolve. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. A single enhancer regulating the differential expression of duplicated red-sensitive opsin genes in zebrafish.

    Directory of Open Access Journals (Sweden)

    Taro Tsujimura

    2010-12-01

    Full Text Available A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC clones encompassing the two genes and identified a 0.6-kb "LWS-activating region" (LAR upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins.

  10. Local synteny and codon usage contribute to asymmetric sequence divergence of Saccharomyces cerevisiae gene duplicates

    Directory of Open Access Journals (Sweden)

    Bergthorsson Ulfar

    2011-09-01

    Full Text Available Abstract Background Duplicated genes frequently experience asymmetric rates of sequence evolution. Relaxed selective constraints and positive selection have both been invoked to explain the observation that one paralog within a gene-duplicate pair exhibits an accelerated rate of sequence evolution. In the majority of studies where asymmetric divergence has been established, there is no indication as to which gene copy, ancestral or derived, is evolving more rapidly. In this study we investigated the effect of local synteny (gene-neighborhood conservation and codon usage on the sequence evolution of gene duplicates in the S. cerevisiae genome. We further distinguish the gene duplicates into those that originated from a whole-genome duplication (WGD event (ohnologs versus small-scale duplications (SSD to determine if there exist any differences in their patterns of sequence evolution. Results For SSD pairs, the derived copy evolves faster than the ancestral copy. However, there is no relationship between rate asymmetry and synteny conservation (ancestral-like versus derived-like in ohnologs. mRNA abundance and optimal codon usage as measured by the CAI is lower in the derived SSD copies relative to ancestral paralogs. Moreover, in the case of ohnologs, the faster-evolving copy has lower CAI and lowered expression. Conclusions Together, these results suggest that relaxation of selection for codon usage and gene expression contribute to rate asymmetry in the evolution of duplicated genes and that in SSD pairs, the relaxation of selection stems from the loss of ancestral regulatory information in the derived copy.

  11. Evolutionary history of glucose-6-phosphatase encoding genes in vertebrate lineages: towards a better understanding of the functions of multiple duplicates.

    Science.gov (United States)

    Marandel, Lucie; Panserat, Stéphane; Plagnes-Juan, Elisabeth; Arbenoits, Eva; Soengas, José Luis; Bobe, Julien

    2017-05-02

    Glucose-6-phosphate (G6pc) is a key enzyme involved in the regulation of the glucose homeostasis. The present study aims at revisiting and clarifying the evolutionary history of g6pc genes in vertebrates. g6pc duplications happened by successive rounds of whole genome duplication that occurred during vertebrate evolution. g6pc duplicated before or around Osteichthyes/Chondrichthyes radiation, giving rise to g6pca and g6pcb as a consequence of the second vertebrate whole genome duplication. g6pca was lost after this duplication in Sarcopterygii whereas both g6pca and g6pcb then duplicated as a consequence of the teleost-specific whole genome duplication. One g6pca duplicate was lost after this duplication in teleosts. Similarly one g6pcb2 duplicate was lost at least in the ancestor of percomorpha. The analysis of the evolution of spatial expression patterns of g6pc genes in vertebrates showed that all g6pc were mainly expressed in intestine and liver whereas teleost-specific g6pcb2 genes were mainly and surprisingly expressed in brain and heart. g6pcb2b, one gene previously hypothesised to be involved in the glucose intolerant phenotype in trout, was unexpectedly up-regulated (as it was in liver) by carbohydrates in trout telencephalon without showing significant changes in other brain regions. This up-regulation is in striking contrast with expected glucosensing mechanisms suggesting that its positive response to glucose relates to specific unknown processes in this brain area. Our results suggested that the fixation and the divergence of g6pc duplicated genes during vertebrates' evolution may lead to adaptive novelty and probably to the emergence of novel phenotypes related to glucose homeostasis.

  12. Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

    Directory of Open Access Journals (Sweden)

    Gadagkar Sudhindra R

    2010-04-01

    Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions

  13. The enrichment of TATA box and the scarcity of depleted proximal nucleosome in the promoters of duplicated yeast genes.

    Science.gov (United States)

    Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A

    2010-01-01

    Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.

  14. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  15. MECP2 Duplication Syndrome

    DEFF Research Database (Denmark)

    Signorini, Cinzia; De Felice, Claudio; Leoncini, Silvia

    2016-01-01

    Rett syndrome (RTT) and MECP2 duplication syndrome (MDS) are neurodevelopmental disorders caused by alterations in the methyl-CpG binding protein 2 (MECP2) gene expression. A relationship between MECP2 loss-of-function mutations and oxidative stress has been previously documented in RTT patients...... and murine models. To date, no data on oxidative stress have been reported for the MECP2 gain-of-function mutations in patients with MDS. In the present work, the pro-oxidant status and oxidative fatty acid damage in MDS was investigated (subjects n = 6) and compared to RTT (subjects n = 24) and healthy...... similar to those observed in RTT patients except for higher plasma F2-isoprostanes levels (P work shows unique data in patients affected by MDS. For the first...

  16. A transposable element insertion in the susceptibility gene CsaMLO8 results in hypocotyl resistance to powdery mildew in cucumber

    NARCIS (Netherlands)

    Berg, J.A.; Appiano, M.; Santillán Martínez, M.I.; Hemans, F.W.K.; Vriezen, W.H.; Visser, R.G.F.; Bai, Y.; Schouten, H.J.

    2015-01-01

    Background - Powdery mildew (PM) is an important disease of cucumber (Cucumis sativus L.). CsaMLO8 was previously identified as a candidate susceptibility gene for PM in cucumber, for two reasons: 1) This gene clusters phylogenetically in clade V, which has previously been shown to harbour all known

  17. The Complete Chloroplast Genome of a Key Ancestor of Modern Roses, Rosa chinensis var. spontanea, and a Comparison with Congeneric Species

    Directory of Open Access Journals (Sweden)

    Hong-Ying Jian

    2018-02-01

    Full Text Available Rosa chinensis var. spontanea, an endemic and endangered plant of China, is one of the key ancestors of modern roses and a source for famous traditional Chinese medicines against female diseases, such as irregular menses and dysmenorrhea. In this study, the complete chloroplast (cp genome of R. chinensis var. spontanea was sequenced, analyzed, and compared to congeneric species. The cp genome of R. chinensis var. spontanea is a typical quadripartite circular molecule of 156,590 bp in length, including one large single copy (LSC region of 85,910 bp and one small single copy (SSC region of 18,762 bp, separated by two inverted repeat (IR regions of 25,959 bp. The GC content of the whole genome is 37.2%, while that of LSC, SSC, and IR is 42.8%, 35.2% and 31.2%, respectively. The genome encodes 129 genes, including 84 protein-coding genes (PCGs, 37 transfer RNA (tRNA genes, and eight ribosomal RNA (rRNA genes. Seventeen genes in the IR regions were found to be duplicated. Thirty-three forward and five inverted repeats were detected in the cp genome of R. chinensis var. spontanea. The genome is rich in SSRs. In total, 85 SSRs were detected. A genome comparison revealed that IR contraction might be the reason for the relatively smaller cp genome size of R. chinensis var. spontanea compared to other congeneric species. Sequence analysis revealed that the LSC and SSC regions were more divergent than the IR regions within the genus Rosa and that a higher divergence occurred in non-coding regions than in coding regions. A phylogenetic analysis showed that the sampled species of the genus Rosa formed a monophyletic clade and that R. chinensis var. spontanea shared a more recent ancestor with R. lichiangensis of the section Synstylae than with R. odorata var. gigantea of the section Chinenses. This information will be useful for the conservation genetics of R. chinensis var. spontanea and for the phylogenetic study of the genus Rosa, and it might also

  18. The Complete Chloroplast Genome of a Key Ancestor of Modern Roses, Rosa chinensis var. spontanea, and a Comparison with Congeneric Species.

    Science.gov (United States)

    Jian, Hong-Ying; Zhang, Yong-Hong; Yan, Hui-Jun; Qiu, Xian-Qin; Wang, Qi-Gang; Li, Shu-Bin; Zhang, Shu-Dong

    2018-02-12

    Rosa chinensis var. spontanea , an endemic and endangered plant of China, is one of the key ancestors of modern roses and a source for famous traditional Chinese medicines against female diseases, such as irregular menses and dysmenorrhea. In this study, the complete chloroplast (cp) genome of R. chinensis var. spontanea was sequenced, analyzed, and compared to congeneric species. The cp genome of R. chinensis var. spontanea is a typical quadripartite circular molecule of 156,590 bp in length, including one large single copy (LSC) region of 85,910 bp and one small single copy (SSC) region of 18,762 bp, separated by two inverted repeat (IR) regions of 25,959 bp. The GC content of the whole genome is 37.2%, while that of LSC, SSC, and IR is 42.8%, 35.2% and 31.2%, respectively. The genome encodes 129 genes, including 84 protein-coding genes (PCGs), 37 transfer RNA (tRNA) genes, and eight ribosomal RNA (rRNA) genes. Seventeen genes in the IR regions were found to be duplicated. Thirty-three forward and five inverted repeats were detected in the cp genome of R. chinensis var. spontanea. The genome is rich in SSRs. In total, 85 SSRs were detected. A genome comparison revealed that IR contraction might be the reason for the relatively smaller cp genome size of R. chinensis var. spontanea compared to other congeneric species. Sequence analysis revealed that the LSC and SSC regions were more divergent than the IR regions within the genus Rosa and that a higher divergence occurred in non-coding regions than in coding regions. A phylogenetic analysis showed that the sampled species of the genus Rosa formed a monophyletic clade and that R. chinensis var. s pontanea shared a more recent ancestor with R. lichiangensis of the section Synstylae than with R. odorata var. gigantea of the section Chinenses . This information will be useful for the conservation genetics of R. chinensis var. spontanea and for the phylogenetic study of the genus Rosa , and it might also facilitate the

  19. Restriction and Recruitment—Gene Duplication and the Origin and Evolution of Snake Venom Toxins

    Science.gov (United States)

    Hargreaves, Adam D.; Swain, Martin T.; Hegarty, Matthew J.; Logan, Darren W.; Mulley, John F.

    2014-01-01

    Snake venom has been hypothesized to have originated and diversified through a process that involves duplication of genes encoding body proteins with subsequent recruitment of the copy to the venom gland, where natural selection acts to develop or increase toxicity. However, gene duplication is known to be a rare event in vertebrate genomes, and the recruitment of duplicated genes to a novel expression domain (neofunctionalization) is an even rarer process that requires the evolution of novel combinations of transcription factor binding sites in upstream regulatory regions. Therefore, although this hypothesis concerning the evolution of snake venom is very unlikely and should be regarded with caution, it is nonetheless often assumed to be established fact, hindering research into the true origins of snake venom toxins. To critically evaluate this hypothesis, we have generated transcriptomic data for body tissues and salivary and venom glands from five species of venomous and nonvenomous reptiles. Our comparative transcriptomic analysis of these data reveals that snake venom does not evolve through the hypothesized process of duplication and recruitment of genes encoding body proteins. Indeed, our results show that many proposed venom toxins are in fact expressed in a wide variety of body tissues, including the salivary gland of nonvenomous reptiles and that these genes have therefore been restricted to the venom gland following duplication, not recruited. Thus, snake venom evolves through the duplication and subfunctionalization of genes encoding existing salivary proteins. These results highlight the danger of the elegant and intuitive “just-so story” in evolutionary biology. PMID:25079342

  20. Neofunctionalization of Duplicated P450 Genes Drives the Evolution of Insecticide Resistance in the Brown Planthopper.

    Science.gov (United States)

    Zimmer, Christoph T; Garrood, William T; Singh, Kumar Saurabh; Randall, Emma; Lueke, Bettina; Gutbrod, Oliver; Matthiesen, Svend; Kohler, Maxie; Nauen, Ralf; Davies, T G Emyr; Bass, Chris

    2018-01-22

    Gene duplication is a major source of genetic variation that has been shown to underpin the evolution of a wide range of adaptive traits [1, 2]. For example, duplication or amplification of genes encoding detoxification enzymes has been shown to play an important role in the evolution of insecticide resistance [3-5]. In this context, gene duplication performs an adaptive function as a result of its effects on gene dosage and not as a source of functional novelty [3, 6-8]. Here, we show that duplication and neofunctionalization of a cytochrome P450, CYP6ER1, led to the evolution of insecticide resistance in the brown planthopper. Considerable genetic variation was observed in the coding sequence of CYP6ER1 in populations of brown planthopper collected from across Asia, but just two sequence variants are highly overexpressed in resistant strains and metabolize imidacloprid. Both variants are characterized by profound amino-acid alterations in substrate recognition sites, and the introduction of these mutations into a susceptible P450 sequence is sufficient to confer resistance. CYP6ER1 is duplicated in resistant strains with individuals carrying paralogs with and without the gain-of-function mutations. Despite numerical parity in the genome, the susceptible and mutant copies exhibit marked asymmetry in their expression with the resistant paralogs overexpressed. In the primary resistance-conferring CYP6ER1 variant, this results from an extended region of novel sequence upstream of the gene that provides enhanced expression. Our findings illustrate the versatility of gene duplication in providing opportunities for functional and regulatory innovation during the evolution of an adaptive trait. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. Transcriptome analysis of Panax vietnamensis var. fuscidicus discovers putative ocotillol-type ginsenosides biosynthesis genes and genetic markers.

    Science.gov (United States)

    Zhang, Guang-Hui; Ma, Chun-Hua; Zhang, Jia-Jin; Chen, Jun-Wen; Tang, Qing-Yan; He, Mu-Han; Xu, Xiang-Zeng; Jiang, Ni-Hao; Yang, Sheng-Chao

    2015-03-08

    P. vietnamensis var. fuscidiscus, called "Yesanqi" in Chinese, is a new variety of P. vietnamensis, which was first found in Jinping County, the southern part of Yunnan Province, China. Compared with other Panax plants, this species contains higher content of ocotillol-type saponin, majonoside R2. Despite the pharmacological importance of ocotillol-type saponins, little is known about their biosynthesis in plants. Hence, P. vietnamensis var. fuscidiscus is a suitable medicinal herbal plant species to study biosynthesis of ocotillol-type saponins. In addition, the available genomic information of this important herbal plant is lacking. To investigate the P. vietnamensis var. fuscidiscus transcriptome, Illumina HiSeq™ 2000 sequencing platform was employed. We produced 114,703,210 clean reads, assembled into 126,758 unigenes, with an average length of 1,304 bp and N50 of 2,108 bp. Among these 126,758 unigenes, 85,214 unigenes (67.23%) were annotated based on the information available from the public databases. The transcripts encoding the known enzymes involved in triterpenoid saponins biosynthesis were identified in our Illumina dataset. A full-length cDNA of three Squalene epoxidase (SE) genes were obtained using reverse transcription PCR (RT-PCR) and the expression patterns of ten unigenes were analyzed by reverse transcription quantitative real-time PCR (RT-qPCR). Furthermore, 15 candidate cytochrome P450 genes and 17 candidate UDP-glycosyltransferase genes most likely to involve in triterpenoid saponins biosynthesis pathway were discovered from transcriptome sequencing of P. vietnamensis var. fuscidiscus. We further analyzed the data and found 21,320 simple sequence repeats (SSRs), 30 primer pairs for SSRs were randomly selected for validation of the amplification and polymorphism in 13 P. vietnamensis var. fuscidiscus accessions. Meanwhile, five major triterpene saponins in roots of P. vietnamensis var. fuscidicus were determined using high performance

  2. Ascorbate peroxidase-related (APx-R) is not a duplicable gene.

    Science.gov (United States)

    Dunand, Christophe; Mathé, Catherine; Lazzarotto, Fernanda; Margis, Rogério; Margis-Pinheiro, Marcia

    2011-12-01

    Phylogenetic, genomic and functional analyses have allowed the identification of a new class of putative heme peroxidases, so called APx-R (APx-Related). These new class, mainly present in the green lineage (including green algae and land plants), can also be detected in other unicellular chloroplastic organisms. Except for recent polyploid organisms, only single-copy of APx-R gene was detected in each genome, suggesting that the majority of the APx-R extra-copies were lost after chromosomal or segmental duplications. In a similar way, most APx-R co-expressed genes in Arabidopsis genome do not have conserved extra-copies after chromosomal duplications and are predicted to be localized in organelles, as are the APx-R. The member of this gene network can be considered as unique gene, well conserved through the evolution due to a strong negative selection pressure and a low evolution rate. © 2011 Landes Bioscience

  3. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...

  4. Age distribution of human gene families shows significant roles of both large- and small-scale duplications in vertebrate evolution.

    Science.gov (United States)

    Gu, Xun; Wang, Yufeng; Gu, Jianying

    2002-06-01

    The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.

  5. Duplication of 17(p11.2p11.2) in a male child with autism and severe language delay.

    Science.gov (United States)

    Nakamine, Alisa; Ouchanov, Leonid; Jiménez, Patricia; Manghi, Elina R; Esquivel, Marcela; Monge, Silvia; Fallas, Marietha; Burton, Barbara K; Szomju, Barbara; Elsea, Sarah H; Marshall, Christian R; Scherer, Stephen W; McInnes, L Alison

    2008-03-01

    Duplications of 17(p11.2p11.2) have been associated with various behavioral manifestations including attention deficits, obsessive-compulsive symptoms, autistic traits, and language delay. We are conducting a genetic study of autism and are screening all cases for submicroscopic chromosomal abnormalities, in addition to standard karyotyping, and fragile X testing. Using array-based comparative genomic hybridization analysis of data from the Affymetrix GeneChip(R) Human Mapping Array set, we detected a duplication of approximately 3.3 Mb on chromosome 17p11.2 in a male child with autism and severe expressive language delay. The duplication was confirmed by measuring the copy number of genomic DNA using quantitative polymerase chain reaction. Gene expression analyses revealed increased expression of three candidate genes for the Smith-Magenis neurobehavioral phenotype, RAI1, DRG2, and RASD1, in transformed lymphocytes from Case 81A, suggesting gene dosage effects. Our results add to a growing body of evidence suggesting that duplications of 17(p11.2p11.2) result in language delay as well as autism and related phenotypes. As Smith-Magenis syndrome is also associated with language delay, a gene involved in acquisition of language may lie within this interval. Whether a parent of origin effect, gender of the case, the presence of allelic variation, or changes in expression of genes outside the breakpoints influence the resultant phenotype remains to be determined. (c) 2007 Wiley-Liss, Inc.

  6. Clinical features of SMARCA2 duplication overlap with Coffin-Siris syndrome.

    Science.gov (United States)

    Miyake, Noriko; Abdel-Salam, Ghada; Yamagata, Takanori; Eid, Maha M; Osaka, Hitoshi; Okamoto, Nobuhiko; Mohamed, Amal M; Ikeda, Takahiro; Afifi, Hanan H; Piard, Juliette; van Maldergem, Lionel; Mizuguchi, Takeshi; Miyatake, Satoko; Tsurusaki, Yoshinori; Matsumoto, Naomichi

    2016-10-01

    Coffin-Siris syndrome is a rare congenital malformation and intellectual disability syndrome. Mutations in at least seven genes have been identified. Here, we performed copy number analysis in 37 patients with features of CSS in whom no causative mutations were identified by exome sequencing. We identified a patient with a 9p24.3-p22.2 duplication and another patient with the chromosome der(6)t(6;9)(p25;p21)mat. Both patients share a duplicated 15.8-Mb region containing 46 protein coding genes, including SMARCA2. Dominant negative effects of SMARCA2 mutations may contribute to Nicolaides-Baraitser syndrome. We conclude that their features better resemble Coffin-Siris syndrome, rather than Nicolaides-Baraitser syndrome and that these features likely arise from SMARCA2 over-dosage. Pure 9p duplications (not caused by unbalanced translocations) are rare. Copy number analysis in patients with features that overlap with Coffin-Siris syndrome is recommended to further determine their genetic aspects. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  7. Erasing the Epigenetic Memory and Beginning to Switch—The Onset of Antigenic Switching of var Genes in Plasmodium falciparum

    Science.gov (United States)

    Fastman, Yair; Noble, Robert; Recker, Mario; Dzikowski, Ron

    2012-01-01

    Antigenic variation in Plasmodium falciparum is regulated by transcriptional switches among members of the var gene family, each expressed in a mutually exclusive manner and encoding a different variant of the surface antigens collectively named PfEMP1. Antigenic switching starts when the first merozoites egress from the liver and begin their asexual proliferation within red blood cells. By erasing the epigenetic memory we created parasites with no var background, similar to merozoites that egress from the liver where no var gene is expressed. Creating a null-var background enabled us to investigate the onset of antigenic switches at the early phase of infection. At the onset of switching, var transcription pattern is heterogeneous with numerous genes transcribed at low levels including upsA vars, a subtype that was implicated in severe malaria, which are rarely activated in growing cultures. Analysis of subsequent in vitro switches shows that the probability of a gene to turn on or off is not associated with its chromosomal position or promoter type per se but on intrinsic properties of each gene. We concluded that var switching is determined by gene specific associated switch rates rather than general promoter type or locus associated switch rates. In addition, we show that fine tuned reduction in var transcription increases their switch rate, indicating that transcriptional perturbation can alter antigenic switching. PMID:22461905

  8. On the Complexity of Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

    Science.gov (United States)

    Kordi, Misagh; Bansal, Mukul S

    2017-01-01

    Duplication-Transfer-Loss (DTL) reconciliation has emerged as a powerful technique for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation takes as input a gene family phylogeny and the corresponding species phylogeny, and reconciles the two by postulating speciation, gene duplication, horizontal gene transfer, and gene loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. However, gene trees are frequently non-binary. With such non-binary gene trees, the reconciliation problem seeks to find a binary resolution of the gene tree that minimizes the reconciliation cost. Given the prevalence of non-binary gene trees, many efficient algorithms have been developed for this problem in the context of the simpler Duplication-Loss (DL) reconciliation model. Yet, no efficient algorithms exist for DTL reconciliation with non-binary gene trees and the complexity of the problem remains unknown. In this work, we resolve this open question by showing that the problem is, in fact, NP-hard. Our reduction applies to both the dated and undated formulations of DTL reconciliation. By resolving this long-standing open problem, this work will spur the development of both exact and heuristic algorithms for this important problem.

  9. VarWalker: personalized mutation network analysis of putative cancer genes from next-generation sequencing data.

    Science.gov (United States)

    Jia, Peilin; Zhao, Zhongming

    2014-02-01

    A major challenge in interpreting the large volume of mutation data identified by next-generation sequencing (NGS) is to distinguish driver mutations from neutral passenger mutations to facilitate the identification of targetable genes and new drugs. Current approaches are primarily based on mutation frequencies of single-genes, which lack the power to detect infrequently mutated driver genes and ignore functional interconnection and regulation among cancer genes. We propose a novel mutation network method, VarWalker, to prioritize driver genes in large scale cancer mutation data. VarWalker fits generalized additive models for each sample based on sample-specific mutation profiles and builds on the joint frequency of both mutation genes and their close interactors. These interactors are selected and optimized using the Random Walk with Restart algorithm in a protein-protein interaction network. We applied the method in >300 tumor genomes in two large-scale NGS benchmark datasets: 183 lung adenocarcinoma samples and 121 melanoma samples. In each cancer, we derived a consensus mutation subnetwork containing significantly enriched consensus cancer genes and cancer-related functional pathways. These cancer-specific mutation networks were then validated using independent datasets for each cancer. Importantly, VarWalker prioritizes well-known, infrequently mutated genes, which are shown to interact with highly recurrently mutated genes yet have been ignored by conventional single-gene-based approaches. Utilizing VarWalker, we demonstrated that network-assisted approaches can be effectively adapted to facilitate the detection of cancer driver genes in NGS data.

  10. Concomitant duplications of opioid peptide and receptor genes before the origin of jawed vertebrates.

    Directory of Open Access Journals (Sweden)

    Görel Sundström

    Full Text Available BACKGROUND: The opioid system is involved in reward and pain mechanisms and consists in mammals of four receptors and several peptides. The peptides are derived from four prepropeptide genes, PENK, PDYN, PNOC and POMC, encoding enkephalins, dynorphins, orphanin/nociceptin and beta-endorphin, respectively. Previously we have described how two rounds of genome doubling (2R before the origin of jawed vertebrates formed the receptor family. METHODOLOGY/PRINCIPAL FINDINGS: Opioid peptide gene family members were investigated using a combination of sequence-based phylogeny and chromosomal locations of the peptide genes in various vertebrates. Several adjacent gene families were investigated similarly. The results show that the ancestral peptide gene gave rise to two additional copies in the genome doublings. The fourth member was generated by a local gene duplication, as the genes encoding POMC and PNOC are located on the same chromosome in the chicken genome and all three teleost genomes that we have studied. A translocation has disrupted this synteny in mammals. The PDYN gene seems to have been lost in chicken, but not in zebra finch. Duplicates of some peptide genes have arisen in the teleost fishes. Within the prepropeptide precursors, peptides have been lost or gained in different lineages. CONCLUSIONS/SIGNIFICANCE: The ancestral peptide and receptor genes were located on the same chromosome and were thus duplicated concomitantly. However, subsequently genetic linkage has been lost. In conclusion, the system of opioid peptides and receptors was largely formed by the genome doublings that took place early in vertebrate evolution.

  11. Cumulative Impact of Polychlorinated Biphenyl and Large Chromosomal Duplications on DNA Methylation, Chromatin, and Expression of Autism Candidate Genes.

    Science.gov (United States)

    Dunaway, Keith W; Islam, M Saharul; Coulson, Rochelle L; Lopez, S Jesse; Vogel Ciernia, Annie; Chu, Roy G; Yasui, Dag H; Pessah, Isaac N; Lott, Paul; Mordaunt, Charles; Meguro-Horike, Makiko; Horike, Shin-Ichi; Korf, Ian; LaSalle, Janine M

    2016-12-13

    Rare variants enriched for functions in chromatin regulation and neuronal synapses have been linked to autism. How chromatin and DNA methylation interact with environmental exposures at synaptic genes in autism etiologies is currently unclear. Using whole-genome bisulfite sequencing in brain tissue and a neuronal cell culture model carrying a 15q11.2-q13.3 maternal duplication, we find that significant global DNA hypomethylation is enriched over autism candidate genes and affects gene expression. The cumulative effect of multiple chromosomal duplications and exposure to the pervasive persistent organic pollutant PCB 95 altered methylation of more than 1,000 genes. Hypomethylated genes were enriched for H2A.Z, increased maternal UBE3A in Dup15q corresponded to reduced levels of RING1B, and bivalently modified H2A.Z was altered by PCB 95 and duplication. These results demonstrate the compounding effects of genetic and environmental insults on the neuronal methylome that converge upon dysregulation of chromatin and synaptic genes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  12. Obervations on the Induction of Position Effect Variegation of Euchromatic Genes in Drosophila Melanogaster

    OpenAIRE

    Pokholkova, G. V.; Makunin, I. V.; Belyaeva, E. S.; Zhimulev, I. F.

    1993-01-01

    In the T(1;2)dor(var7) translocation, the 1A-2B7-8 segment of the X chromosome is brought to the vicinity of 2R-chromosome heterochromatin resulting in position effect variegation of dor, BR-C and more distal genes, as well as compaction of chromatin in this segment. By irradiation of T(1;2)dor(var7), nine reversions (rev) to a normal phenotype were recovered. In two cases (rev27, rev226), the 1A-2B7-8 section is relocated to the 19A region of the X chromosome, forming free duplications (1A-2...

  13. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes

    OpenAIRE

    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich

    2004-01-01

    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix–loop–helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks e...

  14. Burkitt lymphoma express oncofetal Chondroitin Sulfate without being a reservoir for placental malaria sequestration

    Science.gov (United States)

    Agerbæk, Mette Ø.; Pereira, Marina A.; Clausen, Thomas M.; Pehrson, Caroline; Oo, Htoo Zarni; Spliid, Charlotte; Rich, Jamie R.; Fung, Vincent; Nkrumah, Francis; Neequaye, Janet; Biggar, Robert J.; Reynolds, Steven J.; Tosato, Giovanna; Pullarkat, Sheeja T.; Ayers, Leona W.; Theander, Thor G.; Daugaard, Mads; Bhatia, Kishor; Nielsen, Morten A.; Mbulaiteye, Sam M.; Salanti, Ali

    2016-01-01

    Burkitt lymphoma (BL) is a malignant disease, which is frequently found in areas with holoendemic Plasmodium falciparum malaria. We have previously found that the VAR2CSA protein is present on malaria-infected erythrocytes and facilitates a highly specific binding to the placenta. OfCS is absent from other non-malignant tissues and thus VAR2CSA generally facilitates parasite sequestration and accumulation in pregnant women. In this study, we show that the specific receptor for VAR2CSA, the oncofetal chondroitin sulfate (ofCS), is likewise present in BL tissue and cell lines. We therefore explored whether ofCS in BL could act as anchor-site for VAR2CSA-expressing infected erythrocytes. In contrast to the placenta, we found no evidence of in vivo sequestering of infected erythrocytes in the BL tissue. Furthermore, we found VAR2CSA specific antibody titers in children with endemic BL to be lower than in control children from the same malaria endemic region. The abundant presence of ofCS in BL tissue and the absence of ofCS in non-malignant tissue, encouraged us to examine whether recombinant VAR2CSA could be used to target BL. We confirmed the binding of VAR2CSA to BL-derived cells and showed that a VAR2CSA drug conjugate efficiently killed the BL-derived cell lines in vitro. These results identify ofCS as a novel therapeutic BL target and highlight how VAR2CSA could be used as a tool for the discovery of novel approaches for directing BL therapy. PMID:27997697

  15. Burkitt lymphoma expresses oncofetal chondroitin sulfate without being a reservoir for placental malaria sequestration.

    Science.gov (United States)

    Agerbaek, Mette Ø; Pereira, Marina A; Clausen, Thomas M; Pehrson, Caroline; Oo, Htoo Zarni; Spliid, Charlotte; Rich, Jamie R; Fung, Vincent; Nkrumah, Francis; Neequaye, Janet; Biggar, Robert J; Reynolds, Steven J; Tosato, Giovanna; Pullarkat, Sheeja T; Ayers, Leona W; Theander, Thor G; Daugaard, Mads; Bhatia, Kishor; Nielsen, Morten A; Mbulaiteye, Sam M; Salanti, Ali

    2017-04-01

    Burkitt lymphoma (BL) is a malignant disease, which is frequently found in areas with holoendemic Plasmodium falciparum malaria. We have previously found that the VAR2CSA protein is present on malaria-infected erythrocytes and facilitates a highly specific binding to the placenta. ofCS is absent in other non-malignant tissues and thus VAR2CSA generally facilitates parasite sequestration and accumulation in pregnant women. In this study, we show that the specific receptor for VAR2CSA, the oncofetal chondroitin sulfate (ofCS), is likewise present in BL tissue and cell lines. We therefore explored whether ofCS in BL could act as anchor site for VAR2CSA-expressing infected erythrocytes. In contrast to the placenta, we found no evidence of in vivo sequestering of infected erythrocytes in the BL tissue. Furthermore, we found VAR2CSA-specific antibody titers in children with endemic BL to be lower than in control children from the same malaria endemic region. The abundant presence of ofCS in BL tissue and the absence of ofCS in non-malignant tissue encouraged us to examine whether recombinant VAR2CSA could be used to target BL. We confirmed the binding of VAR2CSA to BL-derived cells and showed that a VAR2CSA drug conjugate efficiently killed the BL-derived cell lines in vitro. These results identify ofCS as a novel therapeutic BL target and highlight how VAR2CSA could be used as a tool for the discovery of novel approaches for directing BL therapy. © 2016 UICC.

  16. Bioinformatics analysis of the ς-carotene desaturase gene in cabbage (Brassica oleracea var. capitata)

    Science.gov (United States)

    Sun, Bo; Zheng, Aihong; Jiang, Min; Xue, Shengling; Zhang, Fen; Tang, Haoru

    2018-04-01

    ς-carotene desaturase (ZDS) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata ZDS (BocZDS) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocZDS gene mapped to Scaffold000363, and contains an open reading frame of 1,686 bp that encodes a 561-amino acid protein with a calculated molecular mass of 62.00 kD and an isoelectric point (pI) of 8.2. Subcellular localization predicted the BocZDS gene was in the chloroplast. The conserved domain of the BocZDS protein is PLN02487, indicating that it belongs the member of zeta-carotene desaturase. Homology analysis indicates that the ZDS protein is apparently conserved during plant evolution and is most closely related to B. oleracea var. oleracea, B. napus, and B. rapa. The findings of the present study provide a molecular basis for the elucidation of ZDS gene function in cabbage.

  17. Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

    Science.gov (United States)

    Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

    2012-11-02

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

  18. Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

    Science.gov (United States)

    Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

    2012-01-01

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

  19. On Computing Breakpoint Distances for Genomes with Duplicate Genes.

    Science.gov (United States)

    Shao, Mingfu; Moret, Bernard M E

    2017-06-01

    A fundamental problem in comparative genomics is to compute the distance between two genomes in terms of its higher level organization (given by genes or syntenic blocks). For two genomes without duplicate genes, we can easily define (and almost always efficiently compute) a variety of distance measures, but the problem is NP-hard under most models when genomes contain duplicate genes. To tackle duplicate genes, three formulations (exemplar, maximum matching, and any matching) have been proposed, all of which aim to build a matching between homologous genes so as to minimize some distance measure. Of the many distance measures, the breakpoint distance (the number of nonconserved adjacencies) was the first one to be studied and remains of significant interest because of its simplicity and model-free property. The three breakpoint distance problems corresponding to the three formulations have been widely studied. Although we provided last year a solution for the exemplar problem that runs very fast on full genomes, computing optimal solutions for the other two problems has remained challenging. In this article, we describe very fast, exact algorithms for these two problems. Our algorithms rely on a compact integer-linear program that we further simplify by developing an algorithm to remove variables, based on new results on the structure of adjacencies and matchings. Through extensive experiments using both simulations and biological data sets, we show that our algorithms run very fast (in seconds) on mammalian genomes and scale well beyond. We also apply these algorithms (as well as the classic orthology tool MSOAR) to create orthology assignment, then compare their quality in terms of both accuracy and coverage. We find that our algorithm for the "any matching" formulation significantly outperforms other methods in terms of accuracy while achieving nearly maximum coverage.

  20. Duplications of the neuropeptide receptor gene VIPR2 confer significant risk for schizophrenia.

    LENUS (Irish Health Repository)

    Vacic, Vladimir

    2011-03-24

    Rare copy number variants (CNVs) have a prominent role in the aetiology of schizophrenia and other neuropsychiatric disorders. Substantial risk for schizophrenia is conferred by large (>500-kilobase) CNVs at several loci, including microdeletions at 1q21.1 (ref. 2), 3q29 (ref. 3), 15q13.3 (ref. 2) and 22q11.2 (ref. 4) and microduplication at 16p11.2 (ref. 5). However, these CNVs collectively account for a small fraction (2-4%) of cases, and the relevant genes and neurobiological mechanisms are not well understood. Here we performed a large two-stage genome-wide scan of rare CNVs and report the significant association of copy number gains at chromosome 7q36.3 with schizophrenia. Microduplications with variable breakpoints occurred within a 362-kilobase region and were detected in 29 of 8,290 (0.35%) patients versus 2 of 7,431 (0.03%) controls in the combined sample. All duplications overlapped or were located within 89 kilobases upstream of the vasoactive intestinal peptide receptor gene VIPR2. VIPR2 transcription and cyclic-AMP signalling were significantly increased in cultured lymphocytes from patients with microduplications of 7q36.3. These findings implicate altered vasoactive intestinal peptide signalling in the pathogenesis of schizophrenia and indicate the VPAC2 receptor as a potential target for the development of new antipsychotic drugs.

  1. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. An upstream open reading frame controls translation of var2csa, a gene implicated in placental malaria

    DEFF Research Database (Denmark)

    Amulic, Borko; Salanti, Ali; Lavstsen, Thomas

    2009-01-01

    contains a small upstream open reading frame that acts to repress translation of the resulting mRNA, revealing a novel form of gene regulation in malaria parasites. The mechanism underlying this translational repression is reversible, allowing high levels of protein translation upon selection, thus...

  3. Transcription of the var genes from a freshly-obtained field isolate of Plasmodium falciparum shows more variable switching patterns than long laboratory-adapted isolates.

    Science.gov (United States)

    Ye, Run; Zhang, Dongmei; Chen, Biaobang; Zhu, Yongqiang; Zhang, Yilong; Wang, Shengyue; Pan, Weiqing

    2015-02-07

    Antigenic variation in Plasmodium falciparum involves switching among multicopy var gene family and is responsible for immune evasion and the maintenance of chronic infections. Current understanding of var gene expression and switching patterns comes from experiments conducted on long laboratory-adapted strains, with little known about their wild counterparts. Genome sequencing was used to obtain 50 var genes from a parasite isolated from the China-Myanmar border. Four clones with different dominant var genes were cultured in vitro in replicates for 50 generations. Transcription of the individual var gene was detected by real-time PCR and then the switching process was analysed. The expression of multicopy var genes is mutually exclusive in clones of a wild P. falciparum isolate. The activation of distinct primary dominant var genes leads to different and favoured switching patterns in the four clones. The on/off rates of individual var genes are variable and the choice of subsequent dominant var genes are random, which results in the different switching patterns among replicates of each clonal wild P. falciparum isolate with near identical initial transcription profiles. This study suggests that the switching patterns of var genes are abundant, which consist of both conserved and random parts.

  4. Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals.

    Science.gov (United States)

    Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C

    2008-02-12

    The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.

  5. Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.

    Directory of Open Access Journals (Sweden)

    Nemanja Vukašinović

    Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.

  6. The chimeric gene CHRFAM7A, a partial duplication of the CHRNA7 gene, is a dominant negative regulator of α7*nAChR function.

    Science.gov (United States)

    Araud, Tanguy; Graw, Sharon; Berger, Ralph; Lee, Michael; Neveu, Estele; Bertrand, Daniel; Leonard, Sherry

    2011-10-15

    The human α7 neuronal nicotinic acetylcholine receptor gene (CHRNA7) is a candidate gene for schizophrenia and an important drug target for cognitive deficits in the disorder. Activation of the α7*nAChR, results in opening of the channel and entry of mono- and divalent cations, including Ca(2+), that presynaptically participates to neurotransmitter release and postsynaptically to down-stream changes in gene expression. Schizophrenic patients have low levels of α7*nAChR, as measured by binding of the ligand [(125)I]-α-bungarotoxin (I-BTX). The structure of the gene, CHRNA7, is complex. During evolution, CHRNA7 was partially duplicated as a chimeric gene (CHRFAM7A), which is expressed in the human brain and elsewhere in the body. The association between a 2bp deletion in CHRFAM7A and schizophrenia suggested that this duplicate gene might contribute to cognitive impairment. To examine the putative contribution of CHRFAM7A on receptor function, co-expression of α7 and the duplicate genes was carried out in cell lines and Xenopus oocytes. Expression of the duplicate alone yielded protein expression but no functional receptor and co-expression with α7 caused a significant reduction of the amplitude of the ACh-evoked currents. Reduced current amplitude was not correlated with a reduction of I-BTX binding, suggesting the presence of non-functional (ACh-silent) receptors. This hypothesis is supported by a larger increase of the ACh-evoked current by the allosteric modulator 1-(5-chloro-2,4-dimethoxy-phenyl)-3-(5-methyl-isoxazol-3-yl)-urea (PNU-120596) in cells expressing the duplicate than in the control. These results suggest that CHRFAM7A acts as a dominant negative modulator of CHRNA7 function and is critical for receptor regulation in humans. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Sub-grouping of Plasmodium falciparum 3D7 var genes based on sequence analysis of coding and non-coding regions

    DEFF Research Database (Denmark)

    Lavstsen, Thomas; Salanti, Ali; Jensen, Anja T R

    2003-01-01

    and organization of the 3D7 PfEMP1 repertoire was investigated on the basis of the complete genome sequence. METHODS: Using two tree-building methods we analysed the coding and non-coding sequences of 3D7 var and rif genes as well as var genes of other parasite strains. RESULTS: var genes can be sub...

  8. Three neuropeptide Y receptor genes in the spiny dogfish, Squalus acanthias, support en bloc duplications in early vertebrate evolution.

    Science.gov (United States)

    Salaneck, Erik; Ardell, David H; Larson, Earl T; Larhammar, Dan

    2003-08-01

    It has been debated whether the increase in gene number during early vertebrate evolution was due to multiple independent gene duplications or synchronous duplications of many genes. We describe here the cloning of three neuropeptide Y (NPY) receptor genes belonging to the Y1 subfamily in the spiny dogfish, Squalus acanthias, a cartilaginous fish. The three genes are orthologs of the mammalian subtypes Y1, Y4, and Y6, which are located in paralogous gene regions on different chromosomes in mammals. Thus, these genes arose by duplications of a chromosome region before the radiation of gnathostomes (jawed vertebrates). Estimates of duplication times from linearized trees together with evidence from other gene families supports two rounds of chromosome duplications or tetraploidizations early in vertebrate evolution. The anatomical distribution of mRNA was determined by reverse-transcriptase PCR and was found to differ from mammals, suggesting differential functional diversification of the new gene copies during the radiation of the vertebrate classes.

  9. A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4 Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle.

    Directory of Open Access Journals (Sweden)

    Bertram Brenig

    Full Text Available Aristaless-like homeobox 4 (ALX4 gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA and 289 White Galloway (WGA cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed.

  10. Mutations in the Arabidopsis AtMRS2-11/AtMGT10/VAR5 Gene Cause Leaf Reticulation

    Directory of Open Access Journals (Sweden)

    Shuang Liang

    2017-11-01

    Full Text Available In higher plants, the development of functional chloroplasts is essential for photosynthesis and many other physiological processes. With a long-term goal of elucidating the genetic regulation of chloroplast development, we identified two allelic leaf variegation mutants, variegated5-1 (var5-1 and var5-2. Both mutants showed a distinct leaf reticulation phenotype of yellow paraveinal regions and green interveinal regions, and the leaf reticulation phenotype correlated with photosynthetic defects. Through the identification of mutation sites in the two mutant alleles and the molecular complementation, we confirmed that VAR5 encodes a CorA family of Mg2+ transporters also known as AtMRS2-11/AtMGT10. Using protoplast transient expression and biochemical fractionation assays, we demonstrated that AtMRS2-11/AtMGT10/VAR5 likely localizes to the chloroplast envelope. Moreover, we established that AtMRS2-11/AtMGT10/VAR5 forms large molecular weight complexes in the chloroplast and the sizes of these complexes clearly exceed those of their bacterial counterparts, suggesting the compositions of CorA Mg2+ transporter complex is different between the chloroplast and bacteria. Our findings indicate that AtMRS2-11/AtMGT10/VAR5 plays an important role in the tissue specific regulation of chloroplast development.

  11. Xq28 duplications including MECP2 in five females: Expanding the phenotype to severe mental retardation.

    Science.gov (United States)

    Bijlsma, E K; Collins, A; Papa, F T; Tejada, M I; Wheeler, P; Peeters, E A J; Gijsbers, A C J; van de Kamp, J M; Kriek, M; Losekoot, M; Broekma, A J; Crolla, J A; Pollazzon, M; Mucciolo, M; Katzaki, E; Disciglio, V; Ferreri, M I; Marozza, A; Mencarelli, M A; Castagnini, C; Dosa, L; Ariani, F; Mari, F; Canitano, R; Hayek, G; Botella, M P; Gener, B; Mínguez, M; Renieri, A; Ruivenkamp, C A L

    2012-06-01

    Duplications leading to functional disomy of chromosome Xq28, including MECP2 as the critical dosage-sensitive gene, are associated with a distinct clinical phenotype in males, characterized by severe mental retardation, infantile hypotonia, progressive neurologic impairment, recurrent infections, bladder dysfunction, and absent speech. Female patients with Xq duplications including MECP2 are rare. Only recently submicroscopic duplications of this region on Xq28 have been recognized in four females, and a triplication in a fifth, all in combination with random X-chromosome inactivation (XCI). Based on this small series, it was concluded that in females with MECP2 duplication and random XCI, the typical symptoms of affected boys are not present. We present clinical and molecular data on a series of five females with an Xq28 duplication including the MECP2 gene, both isolated and as the result of a translocation, and compare them with the previously reported cases of small duplications in females. The collected data indicate that the associated phenotype in females is distinct from males with similar duplications, but the clinical effects may be as severe as seen in males. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  12. Teleost Fish-Specific Preferential Retention of Pigmentation Gene-Containing Families After Whole Genome Duplications in Vertebrates

    Science.gov (United States)

    Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas

    2018-01-01

    Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177

  13. Tissue-specific differential induction of duplicated fatty acid-binding protein genes by the peroxisome proliferator, clofibrate, in zebrafish (Danio rerio

    Directory of Open Access Journals (Sweden)

    Venkatachalam Ananda B

    2012-07-01

    Full Text Available Abstract Background Force, Lynch and Conery proposed the duplication-degeneration-complementation (DDC model in which partitioning of ancestral functions (subfunctionalization and acquisition of novel functions (neofunctionalization were the two primary mechanisms for the retention of duplicated genes. The DDC model was tested by analyzing the transcriptional induction of the duplicated fatty acid-binding protein (fabp genes by clofibrate in zebrafish. Clofibrate is a specific ligand of the peroxisome proliferator-activated receptor (PPAR; it activates PPAR which then binds to a peroxisome proliferator response element (PPRE to induce the transcriptional initiation of genes primarily involved in lipid homeostasis. Zebrafish was chosen as our model organism as it has many duplicated genes owing to a whole genome duplication (WGD event that occurred ~230-400 million years ago in the teleost fish lineage. We assayed the steady-state levels of fabp mRNA and heterogeneous nuclear RNA (hnRNA transcripts in liver, intestine, muscle, brain and heart for four sets of duplicated fabp genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, fabp10a/fabp10b and fabp11a/fabp11b in zebrafish fed different concentrations of clofibrate. Result Electron microscopy showed an increase in the number of peroxisomes and mitochondria in liver and heart, respectively, in zebrafish fed clofibrate. Clofibrate also increased the steady-state level of acox1 mRNA and hnRNA transcripts in different tissues, a gene with a functional PPRE. These results demonstrate that zebrafish is responsive to clofibrate, unlike some other fishes. The levels of fabp mRNA and hnRNA transcripts for the four sets of duplicated fabp genes was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. The level of hnRNA coded by a gene is an indirect estimate of the rate of transcriptional initiation of that gene. Clofibrate increased the steady-state level of fabp mRNAs and hn

  14. Nuclear pores and perinuclear expression sites of var and ribosomal DNA genes correspond to physically distinct regions in Plasmodium falciparum.

    Science.gov (United States)

    Guizetti, Julien; Martins, Rafael Miyazawa; Guadagnini, Stéphanie; Claes, Aurélie; Scherf, Artur

    2013-05-01

    The human malaria parasite Plasmodium falciparum modifies the erythrocyte it infects by exporting variant proteins to the host cell surface. The var gene family that codes for a large, variant adhesive surface protein called P. falciparum erythrocyte membrane protein 1 (PfEMP1) plays a particular role in this process, which is linked to pathogenesis and immune evasion. A single member of this gene family is highly transcribed while the other 59 members remain silenced. Importantly, var gene transcription occurs at a spatially restricted, but yet undefined, perinuclear site that is distinct from repressed var gene clusters. To advance our understanding of monoallelic expression, we investigated whether nuclear pores associate with the var gene expression site. To this end, we studied the nuclear pore organization during the asexual blood stage using a specific antibody directed against a subunit of the nuclear pore, P. falciparum Nup116 (PfNup116). Ring and schizont stage parasites showed highly polarized nuclear pore foci, whereas in trophozoite stage nuclear pores redistributed over the entire nuclear surface. Colocalization studies of var transcripts and anti-PfNup116 antibodies showed clear dissociation between nuclear pores and the var gene expression site in ring stage. Similar results were obtained for another differentially transcribed perinuclear gene family, the ribosomal DNA units. Furthermore, we show that in the poised state, the var gene locus is not physically linked to nuclear pores. Our results indicate that P. falciparum does form compartments of high transcriptional activity at the nuclear periphery which are, unlike the case in yeast, devoid of nuclear pores.

  15. GENE-dosage effects on fitness in recent adaptive duplications: ace-1 in the mosquito Culex pipiens.

    Science.gov (United States)

    Labbé, Pierrick; Milesi, Pascal; Yébakima, André; Pasteur, Nicole; Weill, Mylène; Lenormand, Thomas

    2014-07-01

    Gene duplications have long been advocated to contribute to the evolution of new functions. The role of selection in their early spread is more controversial. Unless duplications are favored for a direct benefit of increased expression, they are likely detrimental. In this article, we investigated the case of duplications favored because they combine already functionally divergent alleles. Their gene-dosage/fitness relations are poorly known because selection may operate on both overall expression and duplicates relative dosage. Using the well-documented case of Culex pipiens resistance to insecticides, we compared strains with various ace-1 allele combinations, including two duplicated alleles carrying both susceptible and resistant copies. The overall protein activity was nearly additive, but, surprisingly, fitness correlated better with the relative proportion of susceptible and resistant copies rather than any absolute measure of activity. Gene dosage is thus crucial, duplications stabilizing a "heterozygote" phenotype. It corroborates the view that these were favored because they fix a permanent heterosis, thereby solving the irreducible trade-off between resistance and synaptic transmission. Moreover, we showed that the contrasted successes of the two duplicated alleles in natural populations depend on genetic changes unrelated to ace-1, confirming the probable implication of recessive sublethal mutations linked to structural rearrangements in some duplications. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  16. A molecular epidemiological study of var gene diversity to characterize the reservoir of Plasmodium falciparum in humans in Africa.

    Directory of Open Access Journals (Sweden)

    Donald S Chen

    2011-02-01

    Full Text Available The reservoir of Plasmodium infection in humans has traditionally been defined by blood slide positivity. This study was designed to characterize the local reservoir of infection in relation to the diverse var genes that encode the major surface antigen of Plasmodium falciparum blood stages and underlie the parasite's ability to establish chronic infection and transmit from human to mosquito.We investigated the molecular epidemiology of the var multigene family at local sites in Gabon, Senegal and Kenya which differ in parasite prevalence and transmission intensity. 1839 distinct var gene types were defined by sequencing DBLα domains in the three sites. Only 76 (4.1% var types were found in more than one population indicating spatial heterogeneity in var types across the African continent. The majority of var types appeared only once in the population sample. Non-parametric statistical estimators predict in each population at minimum five to seven thousand distinct var types. Similar diversity of var types was seen in sites with different parasite prevalences.Var population genomics provides new insights into the epidemiology of P. falciparum in Africa where malaria has never been conquered. In particular, we have described the extensive reservoir of infection in local African sites and discovered a unique var population structure that can facilitate superinfection through minimal overlap in var repertoires among parasite genomes. Our findings show that var typing as a molecular surveillance system defines the extent of genetic complexity in the reservoir of infection to complement measures of malaria prevalence. The observed small scale spatial diversity of var genes suggests that var genetics could greatly inform current malaria mapping approaches and predict complex malaria population dynamics due to the import of var types to areas where no widespread pre-existing immunity in the population exists.

  17. A Molecular Epidemiological Study of var Gene Diversity to Characterize the Reservoir of Plasmodium falciparum in Humans in Africa

    Science.gov (United States)

    Leliwa-Sytek, Aleksandra; Smith, Terry-Ann; Peterson, Ingrid; Brown, Stuart M.; Migot-Nabias, Florence; Deloron, Philippe; Kortok, Moses M.; Marsh, Kevin; Daily, Johanna P.; Ndiaye, Daouda; Sarr, Ousmane; Mboup, Souleymane; Day, Karen P.

    2011-01-01

    Background The reservoir of Plasmodium infection in humans has traditionally been defined by blood slide positivity. This study was designed to characterize the local reservoir of infection in relation to the diverse var genes that encode the major surface antigen of Plasmodium falciparum blood stages and underlie the parasite's ability to establish chronic infection and transmit from human to mosquito. Methodology/Principal Findings We investigated the molecular epidemiology of the var multigene family at local sites in Gabon, Senegal and Kenya which differ in parasite prevalence and transmission intensity. 1839 distinct var gene types were defined by sequencing DBLα domains in the three sites. Only 76 (4.1%) var types were found in more than one population indicating spatial heterogeneity in var types across the African continent. The majority of var types appeared only once in the population sample. Non-parametric statistical estimators predict in each population at minimum five to seven thousand distinct var types. Similar diversity of var types was seen in sites with different parasite prevalences. Conclusions/Significance Var population genomics provides new insights into the epidemiology of P. falciparum in Africa where malaria has never been conquered. In particular, we have described the extensive reservoir of infection in local African sites and discovered a unique var population structure that can facilitate superinfection through minimal overlap in var repertoires among parasite genomes. Our findings show that var typing as a molecular surveillance system defines the extent of genetic complexity in the reservoir of infection to complement measures of malaria prevalence. The observed small scale spatial diversity of var genes suggests that var genetics could greatly inform current malaria mapping approaches and predict complex malaria population dynamics due to the import of var types to areas where no widespread pre-existing immunity in the population

  18. STRIDE: Species Tree Root Inference from Gene Duplication Events.

    Science.gov (United States)

    Emms, David M; Kelly, Steven

    2017-12-01

    The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Cloning and characterization of two duplicated interleukin-17A/F2 genes in common carp (Cyprinus carpio L.): Transcripts expression and bioactivity of recombinant IL-17A/F2.

    Science.gov (United States)

    Li, Hongxia; Yu, Juhua; Li, Jianlin; Tang, Yongkai; Yu, Fan; Zhou, Jie; Yu, Wenjuan

    2016-04-01

    Interleukin-17 (IL-17) plays an important role in inflammation and host defense in mammals. In this study, we identified two duplicated IL-17A/F2 genes in the common carp (Cyprinus carpio) (ccIL-17A/F2a and ccIL-17A/F2b), putative encoded proteins contain 140 amino acids (aa) with conserved IL-17 family motifs. Expression analysis revealed high constitutive expression of ccIL-17A/F2s in mucosal tissues, including gill, skin and intestine, their expression could be induced by Aeromonas hydrophila, suggesting a potential role in mucosal immunity. Recombinant ccIL-17A/F2a protein (rccIL-17A/F2a) produced in Escherichia coli could induce the expression of proinflammatory cytokines (IL-1β) and the antimicrobial peptides S100A1, S100A10a and S100A10b in the primary kidney in a dose- and time-dependent manner. Above findings suggest that ccIL-17A/F2 plays an important role in both proinflammatory and innate immunity. Two duplicated ccIL-17A/F2s showed different expression level with ccIL-17A/F2a higher than b, comparison of two 5' regulatory regions indicated the length from anticipated promoter to transcriptional start site (TSS) and putative transcription factor binding site (TFBS) were different. Promoter activity of ccIL-17A/F2a was 2.5 times of ccIL-17A/F2b which consistent with expression results of two genes. These suggest mutations in 5'regulatory region contributed to the differentiation of duplicated genes. To our knowledge, this is the first report to analyze 5'regulatory region of piscine IL-17 family genes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Voltage stability index based optimal placement of static VAR compensator and sizing using Cuckoo search algorithm

    Science.gov (United States)

    Venkateswara Rao, B.; Kumar, G. V. Nagesh; Chowdary, D. Deepak; Bharathi, M. Aruna; Patra, Stutee

    2017-07-01

    This paper furnish the new Metaheuristic algorithm called Cuckoo Search Algorithm (CSA) for solving optimal power flow (OPF) problem with minimization of real power generation cost. The CSA is found to be the most efficient algorithm for solving single objective optimal power flow problems. The CSA performance is tested on IEEE 57 bus test system with real power generation cost minimization as objective function. Static VAR Compensator (SVC) is one of the best shunt connected device in the Flexible Alternating Current Transmission System (FACTS) family. It has capable of controlling the voltage magnitudes of buses by injecting the reactive power to system. In this paper SVC is integrated in CSA based Optimal Power Flow to optimize the real power generation cost. SVC is used to improve the voltage profile of the system. CSA gives better results as compared to genetic algorithm (GA) in both without and with SVC conditions.

  1. Gene Duplication and Gene Expression Changes Play a Role in the Evolution of Candidate Pollen Feeding Genes in Heliconius Butterflies.

    Science.gov (United States)

    Smith, Gilbert; Macias-Muñoz, Aide; Briscoe, Adriana D

    2016-09-02

    Heliconius possess a unique ability among butterflies to feed on pollen. Pollen feeding significantly extends their lifespan, and is thought to have been important to the diversification of the genus. We used RNA sequencing to examine feeding-related gene expression in the mouthparts of four species of Heliconius and one nonpollen feeding species, Eueides isabella We hypothesized that genes involved in morphology and protein metabolism might be upregulated in Heliconius because they have longer proboscides than Eueides, and because pollen contains more protein than nectar. Using de novo transcriptome assemblies, we tested these hypotheses by comparing gene expression in mouthparts against antennae and legs. We first looked for genes upregulated in mouthparts across all five species and discovered several hundred genes, many of which had functional annotations involving metabolism of proteins (cocoonase), lipids, and carbohydrates. We then looked specifically within Heliconius where we found eleven common upregulated genes with roles in morphology (CPR cuticle proteins), behavior (takeout-like), and metabolism (luciferase-like). Closer examination of these candidates revealed that cocoonase underwent several duplications along the lineage leading to heliconiine butterflies, including two Heliconius-specific duplications. Luciferase-like genes also underwent duplication within lepidopterans, and upregulation in Heliconius mouthparts. Reverse-transcription PCR confirmed that three cocoonases, a peptidase, and one luciferase-like gene are expressed in the proboscis with little to no expression in labial palps and salivary glands. Our results suggest pollen feeding, like other dietary specializations, was likely facilitated by adaptive expansions of preexisting genes-and that the butterfly proboscis is involved in digestive enzyme production. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Microevolution of Duplications and Deletions and Their Impact on Gene Expression in the Nematode Pristionchus pacificus.

    Directory of Open Access Journals (Sweden)

    Praveen Baskaran

    Full Text Available The evolution of diversity across the animal kingdom has been accompanied by tremendous gene loss and gain. While comparative genomics has been fruitful to characterize differences in gene content across highly diverged species, little is known about the microevolution of structural variations that cause these differences in the first place. In order to investigate the genomic impact of structural variations, we made use of genomic and transcriptomic data from the nematode Pristionchus pacificus, which has been established as a satellite model to Caenorhabditis elegans for comparative biology. We exploit the fact that P. pacificus is a highly diverse species for which various genomic data including the draft genome of a sister species P. exspectatus is available. Based on resequencing coverage data for two natural isolates we identified large (> 2 kb deletions and duplications relative to the reference strain. By restriction to completely syntenic regions between P. pacificus and P. exspectatus, we were able to polarize the comparison and to assess the impact of structural variations on expression levels. We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. Further investigating expression of individual copies at sites that segregate between the duplicates, we found in the majority of cases only one of the copies to be expressed. Nevertheless, we still find that certain gene classes are strongly depleted in deletions as well as duplications, suggesting evolutionary constraint acting on synteny. In summary, our results are consistent with a model, where most structural variations are either deleterious or neutral and provide first insights into the microevolution of structural variations in the P. pacificus genome.

  3. Exact Algorithms for Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

    Science.gov (United States)

    Kordi, Misagh; Bansal, Mukul S

    2017-06-01

    Duplication-Transfer-Loss (DTL) reconciliation is a powerful method for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation seeks to reconcile gene trees with species trees by postulating speciation, duplication, transfer, and loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. In practice, however, gene trees are often non-binary due to uncertainty in the gene tree topologies, and DTL reconciliation with non-binary gene trees is known to be NP-hard. In this paper, we present the first exact algorithms for DTL reconciliation with non-binary gene trees. Specifically, we (i) show that the DTL reconciliation problem for non-binary gene trees is fixed-parameter tractable in the maximum degree of the gene tree, (ii) present an exponential-time, but in-practice efficient, algorithm to track and enumerate all optimal binary resolutions of a non-binary input gene tree, and (iii) apply our algorithms to a large empirical data set of over 4700 gene trees from 100 species to study the impact of gene tree uncertainty on DTL-reconciliation and to demonstrate the applicability and utility of our algorithms. The new techniques and algorithms introduced in this paper will help biologists avoid incorrect evolutionary inferences caused by gene tree uncertainty.

  4. Differential contributions to the transcriptome of duplicated genes in response to abiotic stresses in natural and synthetic polyploids.

    Science.gov (United States)

    Dong, Shaowei; Adams, Keith L

    2011-06-01

    Polyploidy has occurred throughout plant evolution and can result in considerable changes to gene expression when it takes place and over evolutionary time. Little is known about the effects of abiotic stress conditions on duplicate gene expression patterns in polyploid plants. We examined the expression patterns of 60 duplicated genes in leaves, roots and cotyledons of allotetraploid Gossypium hirsutum in response to five abiotic stress treatments (heat, cold, drought, high salt and water submersion) using single-strand conformation polymorphism assays, and 20 genes in a synthetic allotetraploid. Over 70% of the genes showed stress-induced changes in the relative expression levels of the duplicates under one or more stress treatments with frequent variability among treatments. Twelve pairs showed opposite changes in expression levels in response to different abiotic stress treatments. Stress-induced expression changes occurred in the synthetic allopolyploid, but there was little correspondence in patterns between the natural and synthetic polyploids. Our results indicate that abiotic stress conditions can have considerable effects on duplicate gene expression in a polyploid, with the effects varying by gene, stress and organ type. Differential expression in response to environmental stresses may be a factor in the preservation of some duplicated genes in polyploids. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  5. Phylogeography of var gene repertoires reveals fine-scale geospatial clustering of Plasmodium falciparum populations in a highly endemic area.

    Science.gov (United States)

    Tessema, Sofonias K; Monk, Stephanie L; Schultz, Mark B; Tavul, Livingstone; Reeder, John C; Siba, Peter M; Mueller, Ivo; Barry, Alyssa E

    2015-01-01

    Plasmodium falciparum malaria is a major global health problem that is being targeted for progressive elimination. Knowledge of local disease transmission patterns in endemic countries is critical to these elimination efforts. To investigate fine-scale patterns of malaria transmission, we have compared repertoires of rapidly evolving var genes in a highly endemic area. A total of 3680 high-quality DBLα-sequences were obtained from 68 P. falciparum isolates from ten villages spread over two distinct catchment areas on the north coast of Papua New Guinea (PNG). Modelling of the extent of var gene diversity in the two parasite populations predicts more than twice as many var gene alleles circulating within each catchment (Mugil = 906; Wosera = 1094) than previously recognized in PNG (Amele = 369). In addition, there were limited levels of var gene sharing between populations, consistent with local parasite population structure. Phylogeographic analyses demonstrate that while neutrally evolving microsatellite markers identified population structure only at the catchment level, var gene repertoires reveal further fine-scale geospatial clustering of parasite isolates. The clustering of parasite isolates by village in Mugil, but not in Wosera was consistent with the physical and cultural isolation of the human populations in the two catchments. The study highlights the microheterogeneity of P. falciparum transmission in highly endemic areas and demonstrates the potential of var genes as markers of local patterns of parasite population structure. © 2014 John Wiley & Sons Ltd.

  6. Duplication of the IGFBP-2 gene in teleost fish: protein structure and functionality conservation and gene expression divergence.

    Directory of Open Access Journals (Sweden)

    Jianfeng Zhou

    growth and development primarily by binding to and inhibiting IGF actions in vivo. The duplicated IGFBP-2 genes may provide additional flexibility in the regulation of IGF activities.

  7. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  8. New insights into the nutritional regulation of gluconeogenesis in carnivorous rainbow trout (Oncorhynchus mykiss): a gene duplication trail.

    Science.gov (United States)

    Marandel, Lucie; Seiliez, Iban; Véron, Vincent; Skiba-Cassy, Sandrine; Panserat, Stéphane

    2015-07-01

    The rainbow trout (Oncorhynchus mykiss) is considered to be a strictly carnivorous fish species that is metabolically adapted for high catabolism of proteins and low utilization of dietary carbohydrates. This species consequently has a "glucose-intolerant" phenotype manifested by persistent hyperglycemia when fed a high-carbohydrate diet. Gluconeogenesis in adult fish is also poorly, if ever, regulated by carbohydrates, suggesting that this metabolic pathway is involved in this specific phenotype. In this study, we hypothesized that the fate of duplicated genes after the salmonid-specific 4th whole genome duplication (Ss4R) may have led to adaptive innovation and that their study might provide new elements to enhance our understanding of gluconeogenesis and poor dietary carbohydrate use in this species. Our evolutionary analysis of gluconeogenic genes revealed that pck1, pck2, fbp1a, and g6pca were retained as singletons after Ss4r, while g6pcb1, g6pcb2, and fbp1b ohnolog pairs were maintained. For all genes, duplication may have led to sub- or neofunctionalization. Expression profiles suggest that the gluconeogenesis pathway remained active in trout fed a no-carbohydrate diet. When trout were fed a high-carbohydrate diet (30%), most of the gluconeogenic genes were non- or downregulated, except for g6pbc2 ohnologs, whose RNA levels were surprisingly increased. This study demonstrates that Ss4R in trout involved adaptive innovation via gene duplication and via the outcome of the resulting ohnologs. Indeed, maintenance of ohnologous g6pcb2 pair may contribute in a significant way to the glucose-intolerant phenotype of trout and may partially explain its poor use of dietary carbohydrates. Copyright © 2015 the American Physiological Society.

  9. Divergence of the bZIP Gene Family in Strawberry, Peach, and Apple Suggests Multiple Modes of Gene Evolution after Duplication

    Directory of Open Access Journals (Sweden)

    Xiao-Long Wang

    2015-01-01

    Full Text Available The basic leucine zipper (bZIP transcription factors are the most diverse members of dimerizing transcription factors. In the present study, 50, 116, and 47 bZIP genes were identified in Malus domestica (apple, Prunus persica (peach, and Fragaria vesca (strawberry, respectively. Species-specific duplication was the main contributor to the large number of bZIPs observed in apple. After WGD in apple genome, orthologous bZIP genes corresponding to strawberry on duplicated regions in apple genome were retained. However, in peach ancestor, these syntenic regions were quickly lost or deleted. Maybe the positive selection contributed to the expansion of clade S to adapt to the development and environment stresses. In addition, purifying selection was mainly responsible for bZIP sequence-specific DNA binding. The analysis of orthologous pairs between chromosomes indicates that these orthologs derived from one gene duplication located on one of the nine ancient chromosomes in the Rosaceae. The comparative analysis of bZIP genes in three species provides information on the evolutionary fate of bZIP genes in apple and peach after they diverged from strawberry.

  10. Prenatal diagnosis of foetuses with congenital abnormalities and duplication of the MECP2 region.

    Science.gov (United States)

    Fu, Fang; Liu, Huan-ling; Li, Ru; Han, Jin; Yang, Xin; Min, Pan; Zhen, Li; Zhang, Yong-ling; Xie, Gui-e; Lei, Ting-ying; Li, Yan; Li, Jian; Li, Dong-zhi; Liao, Can

    2014-08-10

    MECP2 duplication results in a well-recognised syndrome in 100% of affected male children; this syndrome is characterised by severe neurodevelopmental disabilities and recurrent infections. However, no sonographic findings have been reported for affected foetuses, and prenatal molecular diagnosis has not been possible for this disease due to lack of prenatal clinical presentation. In this study, we identified a small duplication comprising the MECP2 and L1CAM genes in the Xq28 region in a patient from a family with severe X-linked mental retardation and in a prenatal foetus with brain structural abnormalities. Using high-resolution chromosome microarray analysis (CMA) to screen 108 foetuses with congenital structural abnormalities, we identified additional three foetuses with the MECP2 duplication. Our study indicates that ventriculomegaly, hydrocephalus, agenesis of the corpus callosum, choroid plexus cysts, foetal growth restriction and hydronephrosis might be common ultrasound findings in prenatal foetuses with the MECP2 duplication and provides the first set of prenatal cases with MECP2 duplication, the ultrasonographic phenotype described in these patients will help to recognise the foetuses with possible MECP2 duplication and prompt the appropriate molecular testing. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Reciprocal deletion and duplication at 2q23.1 indicates a role for MBD5 in autism spectrum disorder.

    Science.gov (United States)

    Mullegama, Sureni V; Rosenfeld, Jill A; Orellana, Carmen; van Bon, Bregje W M; Halbach, Sara; Repnikova, Elena A; Brick, Lauren; Li, Chumei; Dupuis, Lucie; Rosello, Monica; Aradhya, Swaroop; Stavropoulos, D James; Manickam, Kandamurugu; Mitchell, Elyse; Hodge, Jennelle C; Talkowski, Michael E; Gusella, James F; Keller, Kory; Zonana, Jonathan; Schwartz, Stuart; Pyatt, Robert E; Waggoner, Darrel J; Shaffer, Lisa G; Lin, Angela E; de Vries, Bert B A; Mendoza-Londono, Roberto; Elsea, Sarah H

    2014-01-01

    Copy number variations associated with abnormal gene dosage have an important role in the genetic etiology of many neurodevelopmental disorders, including intellectual disability (ID) and autism. We hypothesize that the chromosome 2q23.1 region encompassing MBD5 is a dosage-dependent region, wherein deletion or duplication results in altered gene dosage. We previously established the 2q23.1 microdeletion syndrome and report herein 23 individuals with 2q23.1 duplications, thus establishing a complementary duplication syndrome. The observed phenotype includes ID, language impairments, infantile hypotonia and gross motor delay, behavioral problems, autistic features, dysmorphic facial features (pinnae anomalies, arched eyebrows, prominent nose, small chin, thin upper lip), and minor digital anomalies (fifth finger clinodactyly and large broad first toe). The microduplication size varies among all cases and ranges from 68 kb to 53.7 Mb, encompassing a region that includes MBD5, an important factor in methylation patterning and epigenetic regulation. We previously reported that haploinsufficiency of MBD5 is the primary causal factor in 2q23.1 microdeletion syndrome and that mutations in MBD5 are associated with autism. In this study, we demonstrate that MBD5 is the only gene in common among all duplication cases and that overexpression of MBD5 is likely responsible for the core clinical features present in 2q23.1 microduplication syndrome. Phenotypic analyses suggest that 2q23.1 duplication results in a slightly less severe phenotype than the reciprocal deletion. The features associated with a deletion, mutation or duplication of MBD5 and the gene expression changes observed support MBD5 as a dosage-sensitive gene critical for normal development.

  12. Sox genes in grass carp (Ctenopharyngodon idella with their implications for genome duplication and evolution

    Directory of Open Access Journals (Sweden)

    Tong Jingou

    2006-11-01

    Full Text Available Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella, one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes has two co-orthologs in grass carp, and the duplication of Sox4 and Sox11 occurred before the divergence of grass carp and zebrafish, which support the "fish-specific whole-genome duplication" theory. An estimation for the origin of grass carp based on the molecular clock using Sox1, Sox3 and Sox11 genes as markers indicates that grass carp (subfamily Leuciscinae and zebrafish (subfamily Danioninae diverged approximately 60 million years ago. The potential uses of Sox genes as markers in revealing the evolutionary history of grass carp are discussed.

  13. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G

    2014-01-01

    Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  14. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Directory of Open Access Journals (Sweden)

    Jill C Preston

    Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  15. Evidence of strain structure in Plasmodium falciparum var gene repertoires in children from Gabon, West Africa.

    Science.gov (United States)

    Day, Karen P; Artzy-Randrup, Yael; Tiedje, Kathryn E; Rougeron, Virginie; Chen, Donald S; Rask, Thomas S; Rorick, Mary M; Migot-Nabias, Florence; Deloron, Philippe; Luty, Adrian J F; Pascual, Mercedes

    2017-05-16

    Existing theory on competition for hosts between pathogen strains has proposed that immune selection can lead to the maintenance of strain structure consisting of discrete, weakly overlapping antigenic repertoires. This prediction of strain theory has conceptual overlap with fundamental ideas in ecology on niche partitioning and limiting similarity between coexisting species in an ecosystem, which oppose the hypothesis of neutral coexistence. For Plasmodium falciparum , strain theory has been specifically proposed in relation to the major surface antigen of the blood stage, known as Pf EMP1 and encoded by the multicopy multigene family known as the var genes. Deep sampling of the DBLα domain of var genes in the local population of Bakoumba, West Africa, was completed to define whether patterns of repertoire overlap support a role of immune selection under the opposing force of high outcrossing, a characteristic of areas of intense malaria transmission. Using a 454 high-throughput sequencing protocol, we report extremely high diversity of the DBLα domain and a large parasite population with DBLα repertoires structured into nonrandom patterns of overlap. Such population structure, significant for the high diversity of var genes that compose it at a local level, supports the existence of "strains" characterized by distinct var gene repertoires. Nonneutral, frequency-dependent competition would be at play and could underlie these patterns. With a computational experiment that simulates an intervention similar to mass drug administration, we argue that the observed repertoire structure matters for the antigenic var diversity of the parasite population remaining after intervention.

  16. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Science.gov (United States)

    Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.

  17. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Directory of Open Access Journals (Sweden)

    Olga V Popova

    Full Text Available Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida and Pycnophyes kielensis (Allomalorhagida. Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even

  18. Genomic evidence of gene duplication and adaptive evolution of Toll like receptors (TLR2 and TLR4) in reptiles.

    Science.gov (United States)

    Shang, Shuai; Zhong, Huaming; Wu, Xiaoyang; Wei, Qinguo; Zhang, Huanxin; Chen, Jun; Chen, Yao; Tang, Xuexi; Zhang, Honghai

    2018-04-01

    Toll-like receptors (TLRs) encoded by the TLR multigene family play an important role in initial pathogen recognition in vertebrates. Among the TLRs, TLR2 and TLR4 may be of particular importance to reptiles. In order to study the evolutionary patterns and structural characteristics of TLRs, we explored the available genomes of several representative members of reptiles. 25 TLR2 genes and 19 TLR4 genes from reptiles were obtained in this study. Phylogenetic results showed that the TLR2 gene duplication occurred in several species. Evolutionary analysis by at least two methods identified 30 and 13 common positively selected codons in TLR2 and TLR4, respectively. Most positively selected sites of TLR2 and TLR4 were located in the Leucine-rich repeat (LRRs). Branch model analysis showed that TLR2 genes were under different evolutionary forces in reptiles, while the TLR4 genes showed no significant selection pressure. The different evolutionary adaptation of TLR2 and TLR4 among the reptiles might be due to their different function in recognizing bacteria. Overall, we explored the structure and evolution of TLR2 and TLR4 genes in reptiles for the first time. Our study revealed valuable information regarding TLR2 and TLR4 in reptiles, and provided novel insights into the conservation concern of natural populations. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. A search for RNA insertions and NS3 gene duplication in the genome of cytopathic isolates of bovine viral diarrhea virus

    Directory of Open Access Journals (Sweden)

    V.L. Quadros

    2006-07-01

    Full Text Available Calves born persistently infected with non-cytopathic bovine viral diarrhea virus (ncpBVDV frequently develop a fatal gastroenteric illness called mucosal disease. Both the original virus (ncpBVDV and an antigenically identical but cytopathic virus (cpBVDV can be isolated from animals affected by mucosal disease. Cytopathic BVDVs originate from their ncp counterparts by diverse genetic mechanisms, all leading to the expression of the non-structural polypeptide NS3 as a discrete protein. In contrast, ncpBVDVs express only the large precursor polypeptide, NS2-3, which contains the NS3 sequence within its carboxy-terminal half. We report here the investigation of the mechanism leading to NS3 expression in 41 cpBVDV isolates. An RT-PCR strategy was employed to detect RNA insertions within the NS2-3 gene and/or duplication of the NS3 gene, two common mechanisms of NS3 expression. RT-PCR amplification revealed insertions in the NS2-3 gene of three cp isolates, with the inserts being similar in size to that present in the cpBVDV NADL strain. Sequencing of one such insert revealed a 296-nucleotide sequence with a central core of 270 nucleotides coding for an amino acid sequence highly homologous (98% to the NADL insert, a sequence corresponding to part of the cellular J-Domain gene. One cpBVDV isolate contained a duplication of the NS3 gene downstream from the original locus. In contrast, no detectable NS2-3 insertions or NS3 gene duplications were observed in the genome of 37 cp isolates. These results demonstrate that processing of NS2-3 without bulk mRNA insertions or NS3 gene duplications seems to be a frequent mechanism leading to NS3 expression and BVDV cytopathology.

  20. Gene duplications in prokaryotes can be associated with environmental adaptation.

    Science.gov (United States)

    Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn

    2010-10-20

    Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate

  1. Comparison of functional assays used in the clinical development of a placental malaria vaccine

    DEFF Research Database (Denmark)

    Pehrson, Caroline; Heno, Kristine Klysner; Adams, Yvonne

    2017-01-01

    BACKGROUND: Malaria in pregnancy is associated with significant morbidity in pregnant women and their offspring. Plasmodium falciparum infected erythrocytes (IE) express VAR2CSA that mediates binding to chondroitin sulphate A (CSA) in the placenta. Two VAR2CSA-based vaccines for placental malaria...

  2. Duplication and independent selection of cell-wall invertase genes GIF1 and OsCIN1 during rice evolution and domestication

    Directory of Open Access Journals (Sweden)

    Ge Song

    2010-04-01

    Full Text Available Abstract Background Various evolutionary models have been proposed to interpret the fate of paralogous duplicates, which provides substrates on which evolution selection could act. In particular, domestication, as a special selection, has played important role in crop cultivation with divergence of many genes controlling important agronomic traits. Recent studies have indicated that a pair of duplicate genes was often sub-functionalized from their ancestral functions held by the parental genes. We previously demonstrated that the rice cell-wall invertase (CWI gene GIF1 that plays an important role in the grain-filling process was most likely subjected to domestication selection in the promoter region. Here, we report that GIF1 and another CWI gene OsCIN1 constitute a pair of duplicate genes with differentiated expression and function through independent selection. Results Through synteny analysis, we show that GIF1 and another cell-wall invertase gene OsCIN1 were paralogues derived from a segmental duplication originated during genome duplication of grasses. Results based on analyses of population genetics and gene phylogenetic tree of 25 cultivars and 25 wild rice sequences demonstrated that OsCIN1 was also artificially selected during rice domestication with a fixed mutation in the coding region, in contrast to GIF1 that was selected in the promoter region. GIF1 and OsCIN1 have evolved into different expression patterns and probable different kinetics parameters of enzymatic activity with the latter displaying less enzymatic activity. Overexpression of GIF1 and OsCIN1 also resulted in different phenotypes, suggesting that OsCIN1 might regulate other unrecognized biological process. Conclusion How gene duplication and divergence contribute to genetic novelty and morphological adaptation has been an interesting issue to geneticists and biologists. Our discovery that the duplicated pair of GIF1 and OsCIN1 has experienced sub

  3. Effect of CSA Concentration on the Ammonia Sensing Properties of CSA-Doped PA6/PANI Composite Nanofibers

    Directory of Open Access Journals (Sweden)

    Zengyuan Pang

    2014-11-01

    Full Text Available Camphor sulfonic acid (CSA-doped polyamide 6/polyaniline (PA6/PANI composite nanofibers were fabricated using in situ polymerization of aniline under different CSA concentrations (0.02, 0.04, 0.06, 0.08 and 0.10 M with electrospun PA6 nanofibers as templates. The structural, morphological and ammonia sensing properties of the prepared composite nanofibers were studied using scanning electron microscopy (SEM, Fourier transform infrared spectroscopy (FT-IR, four-point probe techniques, X-ray diffraction (XRD and a home-made gas sensing test system. All the results indicated that the CSA concentration had a great influence on the sensing properties of CSA-doped PA6/PANI composite nanofibers. The composite nanofibers doped with 0.02 M CSA showed the best ammonia sensing properties, with a significant sensitivity toward ammonia (NH3 at room temperature, superior to that of the composite nanofibers doped with 0.04–0.10 mol/L CSA. It was found that for high concentrations of CSA, the number of PANI–H+ reacted with NH3 would not make up a high proportion of all PANI–H+ within certain limits. As a result, within a certain range even though higher CSA-doped PA6/PANI nanofibers had better conductivity, their ammonia sensing performance would degrade.

  4. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  5. Parental Origin of Interstitial Duplications at 15q11.2-q13.3 in Schizophrenia and Neurodevelopmental Disorders.

    Directory of Open Access Journals (Sweden)

    Anthony R Isles

    2016-05-01

    Full Text Available Duplications at 15q11.2-q13.3 overlapping the Prader-Willi/Angelman syndrome (PWS/AS region have been associated with developmental delay (DD, autism spectrum disorder (ASD and schizophrenia (SZ. Due to presence of imprinted genes within the region, the parental origin of these duplications may be key to the pathogenicity. Duplications of maternal origin are associated with disease, whereas the pathogenicity of paternal ones is unclear. To clarify the role of maternal and paternal duplications, we conducted the largest and most detailed study to date of parental origin of 15q11.2-q13.3 interstitial duplications in DD, ASD and SZ cohorts. We show, for the first time, that paternal duplications lead to an increased risk of developing DD/ASD/multiple congenital anomalies (MCA, but do not appear to increase risk for SZ. The importance of the epigenetic status of 15q11.2-q13.3 duplications was further underlined by analysis of a number of families, in which the duplication was paternally derived in the mother, who was unaffected, whereas her offspring, who inherited a maternally derived duplication, suffered from psychotic illness. Interestingly, the most consistent clinical characteristics of SZ patients with 15q11.2-q13.3 duplications were learning or developmental problems, found in 76% of carriers. Despite their lower pathogenicity, paternal duplications are less frequent in the general population with a general population prevalence of 0.0033% compared to 0.0069% for maternal duplications. This may be due to lower fecundity of male carriers and differential survival of embryos, something echoed in the findings that both types of duplications are de novo in just over 50% of cases. Isodicentric chromosome 15 (idic15 or interstitial triplications were not observed in SZ patients or in controls. Overall, this study refines the distinct roles of maternal and paternal interstitial duplications at 15q11.2-q13.3, underlining the critical importance of

  6. Parental Origin of Interstitial Duplications at 15q11.2-q13.3 in Schizophrenia and Neurodevelopmental Disorders

    Science.gov (United States)

    Isles, Anthony R.; Ingason, Andrés; Lowther, Chelsea; Gawlick, Micha; Stöber, Gerald; Potter, Harry; Georgieva, Lyudmila; Pizzo, Lucilla; Ozaki, Norio; Kushima, Itaru; Ikeda, Masashi; Iwata, Nakao; Levinson, Douglas F.; Gejman, Pablo V.; Shi, Jianxin; Sanders, Alan R.; Duan, Jubao; Sisodiya, Sanjay; Costain, Gregory; Degenhardt, Franziska; Giegling, Ina; Rujescu, Dan; Hreidarsson, Stefan J.; Saemundsen, Evald; Ahn, Joo Wook; Ogilvie, Caroline; Stefansson, Hreinn; Stefansson, Kari; O’Donovan, Michael C.; Owen, Michael J.; Bassett, Anne; Kirov, George

    2016-01-01

    Duplications at 15q11.2-q13.3 overlapping the Prader-Willi/Angelman syndrome (PWS/AS) region have been associated with developmental delay (DD), autism spectrum disorder (ASD) and schizophrenia (SZ). Due to presence of imprinted genes within the region, the parental origin of these duplications may be key to the pathogenicity. Duplications of maternal origin are associated with disease, whereas the pathogenicity of paternal ones is unclear. To clarify the role of maternal and paternal duplications, we conducted the largest and most detailed study to date of parental origin of 15q11.2-q13.3 interstitial duplications in DD, ASD and SZ cohorts. We show, for the first time, that paternal duplications lead to an increased risk of developing DD/ASD/multiple congenital anomalies (MCA), but do not appear to increase risk for SZ. The importance of the epigenetic status of 15q11.2-q13.3 duplications was further underlined by analysis of a number of families, in which the duplication was paternally derived in the mother, who was unaffected, whereas her offspring, who inherited a maternally derived duplication, suffered from psychotic illness. Interestingly, the most consistent clinical characteristics of SZ patients with 15q11.2-q13.3 duplications were learning or developmental problems, found in 76% of carriers. Despite their lower pathogenicity, paternal duplications are less frequent in the general population with a general population prevalence of 0.0033% compared to 0.0069% for maternal duplications. This may be due to lower fecundity of male carriers and differential survival of embryos, something echoed in the findings that both types of duplications are de novo in just over 50% of cases. Isodicentric chromosome 15 (idic15) or interstitial triplications were not observed in SZ patients or in controls. Overall, this study refines the distinct roles of maternal and paternal interstitial duplications at 15q11.2-q13.3, underlining the critical importance of maternally

  7. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

    Science.gov (United States)

    Harding, Tommy; Roger, Andrew J.; Simpson, Alastair G. B.

    2017-01-01

    The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles) grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones), ion homeostasis (e.g., Na+/H+ transporter), metabolism and transport of lipids (e.g., sterol biosynthetic genes), carbohydrate metabolism (e.g., glycosidases), and signal transduction pathways (e.g., transcription factors). A significantly high proportion (43%) of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs), as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like membrane

  8. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

    Directory of Open Access Journals (Sweden)

    Tommy Harding

    2017-05-01

    Full Text Available The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones, ion homeostasis (e.g., Na+/H+ transporter, metabolism and transport of lipids (e.g., sterol biosynthetic genes, carbohydrate metabolism (e.g., glycosidases, and signal transduction pathways (e.g., transcription factors. A significantly high proportion (43% of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs, as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like

  9. Whole-gene positive selection, elevated synonymous substitution rates, duplication, and indel evolution of the chloroplast clpP1 gene.

    Directory of Open Access Journals (Sweden)

    Per Erixon

    Full Text Available BACKGROUND: Synonymous DNA substitution rates in the plant chloroplast genome are generally relatively slow and lineage dependent. Non-synonymous rates are usually even slower due to purifying selection acting on the genes. Positive selection is expected to speed up non-synonymous substitution rates, whereas synonymous rates are expected to be unaffected. Until recently, positive selection has seldom been observed in chloroplast genes, and large-scale structural rearrangements leading to gene duplications are hitherto supposed to be rare. METHODOLOGY/PRINCIPLE FINDINGS: We found high substitution rates in the exons of the plastid clpP1 gene in Oenothera (the Evening Primrose family and three separate lineages in the tribe Sileneae (Caryophyllaceae, the Carnation family. Introns have been lost in some of the lineages, but where present, the intron sequences have substitution rates similar to those found in other introns of their genomes. The elevated substitution rates of clpP1 are associated with statistically significant whole-gene positive selection in three branches of the phylogeny. In two of the lineages we found multiple copies of the gene. Neighboring genes present in the duplicated fragments do not show signs of elevated substitution rates or positive selection. Although non-synonymous substitutions account for most of the increase in substitution rates, synonymous rates are also markedly elevated in some lineages. Whereas plant clpP1 genes experiencing negative (purifying selection are characterized by having very conserved lengths, genes under positive selection often have large insertions of more or less repetitive amino acid sequence motifs. CONCLUSIONS/SIGNIFICANCE: We found positive selection of the clpP1 gene in various plant lineages to correlated with repeated duplication of the clpP1 gene and surrounding regions, repetitive amino acid sequences, and increase in synonymous substitution rates. The present study sheds light on the

  10. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3' untranslated region and intronic cis-elements.

    Science.gov (United States)

    Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A

    2009-11-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var

  11. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

    Science.gov (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

    2016-01-01

    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  12. Molecular evolution of a Y chromosome to autosome gene duplication in Drosophila.

    Science.gov (United States)

    Dyer, Kelly A; White, Brooke E; Bray, Michael J; Piqué, Daniel G; Betancourt, Andrea J

    2011-03-01

    In contrast to the rest of the genome, the Y chromosome is restricted to males and lacks recombination. As a result, Y chromosomes are unable to respond efficiently to selection, and newly formed Y chromosomes degenerate until few genes remain. The rapid loss of genes from newly formed Y chromosomes has been well studied, but gene loss from highly degenerate Y chromosomes has only recently received attention. Here, we identify and characterize a Y to autosome duplication of the male fertility gene kl-5 that occurred during the evolution of the testacea group species of Drosophila. The duplication was likely DNA based, as other Y-linked genes remain on the Y chromosome, the locations of introns are conserved, and expression analyses suggest that regulatory elements remain linked. Genetic mapping reveals that the autosomal copy of kl-5 resides on the dot chromosome, a tiny autosome with strongly suppressed recombination. Molecular evolutionary analyses show that autosomal copies of kl-5 have reduced polymorphism and little recombination. Importantly, the rate of protein evolution of kl-5 has increased significantly in lineages where it is on the dot versus Y linked. Further analyses suggest this pattern is a consequence of relaxed purifying selection, rather than adaptive evolution. Thus, although the initial fixation of the kl-5 duplication may have been advantageous, slightly deleterious mutations have accumulated in the dot-linked copies of kl-5 faster than in the Y-linked copies. Because the dot chromosome contains seven times more genes than the Y and is exposed to selection in both males and females, these results suggest that the dot suffers the deleterious effects of genetic linkage to more selective targets compared with the Y chromosome. Thus, a highly degenerate Y chromosome may not be the worst environment in the genome, as is generally thought, but may in fact be protected from the accumulation of deleterious mutations relative to other nonrecombining

  13. Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)

    Science.gov (United States)

    Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru

    2018-04-01

    Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.

  14. From In Vivo to In Vitro: Dynamic Analysis of Plasmodium falciparum var Gene Expression Patterns of Patient Isolates during Adaptation to Culture

    Science.gov (United States)

    Huang, Yufu; Xue, Xiangyang; Yan, He; Sun, Xiaodong; Wang, Jian; McCutchan, Thomas F.; Pan, Weiqing

    2011-01-01

    Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1), encoded by the var gene family, plays a crucial role in disease virulence through its involvement in binding to various host cellular receptors during infection. Growing evidence suggests that differential expression of the various var subgroups may be involved in parasite virulence. To further explore this issue, we have collected isolates from symptomatic patients in south China-Myanmar border, and characterized their sequence diversity and transcription profiles over time of var gene family, and cytoadherence properties from the time of their initial collection and extending through a two month period of adaptation to culture. Initially, we established a highly diverse, DBLα (4 cysteines) subtype-enriched, but unique local repertoire of var-DBL1α sequences by cDNA cloning and sequencing. Next we observed a rapid transcriptional decline of upsA- and upsB-subtype var genes at ring stage through qRT-PCR assays, and a switching event from initial ICAM-I binding to the CD36-binding activity during the first week of adaptive cultivation in vitro. Moreover, predominant transcription of upsA var genes was observed to be correlated with those isolates that showed a higher parasitemia at the time of collection and the ICAM-1-binding phenotype in culture. Taken together, these data indicate that the initial stage of adaptive process in vitro significantly influences the transcription of virulence-related var subtypes and expression of PfEMP1 variants. Further, the specific upregulation of the upsA var genes is likely linked to the rapid propagation of the parasite during natural infection due to the A-type PfEMP1 variant-mediated growth advantages. PMID:21674009

  15. Different effects of CSA and CSB deficiency on sensitivity to oxidative DNA damage.

    NARCIS (Netherlands)

    H. de Waard (Harm); J. de Wit (Jan); J.-O. Andressoo (Jaan-Olle); C.T.M. van Oostrom (Conny); B. Riis (Bente); A. Weimann (Allan); H.E. Poulsen (Henrik); H. van Steeg (Harry); J.H.J. Hoeijmakers (Jan); G.T.J. van der Horst (Gijsbertus)

    2004-01-01

    textabstractMutations in the CSA and CSB genes cause Cockayne syndrome, a rare inherited disorder characterized by UV sensitivity, severe neurological abnormalities, and progeriod symptoms. Both gene products function in the transcription-coupled repair (TCR) subpathway of nucleotide excision repair

  16. Gene duplications in prokaryotes can be associated with environmental adaptation

    Directory of Open Access Journals (Sweden)

    Lempicki Richard A

    2010-10-01

    Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive

  17. Clinical and molecular characterization of duplications encompassing the human SHOX gene reveal a variable effect on stature.

    Science.gov (United States)

    Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert

    2009-07-01

    Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.

  18. A case report of two male siblings with autism and duplication of Xq13-q21, a region including three genes predisposing for autism.

    Science.gov (United States)

    Wentz, Elisabet; Vujic, Mihailo; Kärrstedt, Ewa-Lotta; Erlandsson, Anna; Gillberg, Christopher

    2014-05-01

    Autism spectrum disorder, severe behaviour problems and duplication of the Xq12 to Xq13 region have recently been described in three male relatives. To describe the psychiatric comorbidity and dysmorphic features, including craniosynostosis, of two male siblings with autism and duplication of the Xq13 to Xq21 region, and attempt to narrow down the number of duplicated genes proposed to be leading to global developmental delay and autism. We performed DNA sequencing of certain exons of the TWIST1 gene, the FGFR2 gene and the FGFR3 gene. We also performed microarray analysis of the DNA. In addition to autism, the two male siblings exhibited severe learning disability, self-injurious behaviour, temper tantrums and hyperactivity, and had no communicative language. Chromosomal analyses were normal. Neither of the two siblings showed mutations of the sequenced exons known to produce craniosynostosis. The microarray analysis detected an extra copy of a region on the long arm of chromosome X, chromosome band Xq13.1-q21.1. Comparison of our two cases with previously described patients allowed us to identify three genes predisposing for autism in the duplicated chromosomal region. Sagittal craniosynostosis is also a new finding linked to the duplication.

  19. Zebrafish IGF genes: gene duplication, conservation and divergence, and novel roles in midline and notochord development.

    Directory of Open Access Journals (Sweden)

    Shuming Zou

    Full Text Available Insulin-like growth factors (IGFs are key regulators of development, growth, and longevity. In most vertebrate species including humans, there is one IGF-1 gene and one IGF-2 gene. Here we report the identification and functional characterization of 4 distinct IGF genes (termed as igf-1a, -1b, -2a, and -2b in zebrafish. These genes encode 4 structurally distinct and functional IGF peptides. IGF-1a and IGF-2a mRNAs were detected in multiple tissues in adult fish. IGF-1b mRNA was detected only in the gonad and IGF-2b mRNA only in the liver. Functional analysis showed that all 4 IGFs caused similar developmental defects but with different potencies. Many of these embryos had fully or partially duplicated notochords, suggesting that an excess of IGF signaling causes defects in the midline formation and an expansion of the notochord. IGF-2a, the most potent IGF, was analyzed in depth. IGF-2a expression caused defects in the midline formation and expansion of the notochord but it did not alter the anterior neural patterning. These results not only provide new insights into the functional conservation and divergence of the multiple igf genes but also reveal a novel role of IGF signaling in midline formation and notochord development in a vertebrate model.

  20. Multiplex Ligation-dependent Probe Amplification Identification of Deletions and Duplications of the Duchenne Muscular Dystrophy Gene in Taiwanese Subjects

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2007-05-01

    Conclusion: MLPA was proven to be a powerful tool for the detection of DMD gene deletions and duplications in male patients and female carriers. There was a relatively lower frequency of deletion and a higher frequency of duplication of DMD gene in this population compared to previous reports.

  1. Differential retention of metabolic genes following whole-genome duplication.

    Science.gov (United States)

    Gout, Jean-François; Duret, Laurent; Kahn, Daniel

    2009-05-01

    Classical studies in Metabolic Control Theory have shown that metabolic fluxes usually exhibit little sensitivity to changes in individual enzyme activity, yet remain sensitive to global changes of all enzymes in a pathway. Therefore, little selective pressure is expected on the dosage or expression of individual metabolic genes, yet entire pathways should still be constrained. However, a direct estimate of this selective pressure had not been evaluated. Whole-genome duplications (WGDs) offer a good opportunity to address this question by analyzing the fates of metabolic genes during the massive gene losses that follow. Here, we take advantage of the successive rounds of WGD that occurred in the Paramecium lineage. We show that metabolic genes exhibit different gene retention patterns than nonmetabolic genes. Contrary to what was expected for individual genes, metabolic genes appeared more retained than other genes after the recent WGD, which was best explained by selection for gene expression operating on entire pathways. Metabolic genes also tend to be less retained when present at high copy number before WGD, contrary to other genes that show a positive correlation between gene retention and preduplication copy number. This is rationalized on the basis of the classical concave relationship relating metabolic fluxes with enzyme expression.

  2. Biological consequences of ancient gene acquisition and duplication in the large genome soil bacterium, ""solibacter usitatus"" strain Ellin6076

    Energy Technology Data Exchange (ETDEWEB)

    Challacombe, Jean F [Los Alamos National Laboratory; Eichorst, Stephanie A [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Kuske, Cheryl R [Los Alamos National Laboratory; Hauser, Loren [ORNL; Land, Miriam [ORNL

    2009-01-01

    Bacterial genome sizes range from ca. 0.5 to 10Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Sequenced genomes of strains in the phylum Acidobacteria revealed that 'Solibacter usistatus' strain Ellin6076 harbors a 9.9 Mb genome. This large genome appears to have arisen by horizontal gene transfer via ancient bacteriophage and plasmid-mediated transduction, as well as widespread small-scale gene duplications. This has resulted in an increased number of paralogs that are potentially ecologically important (ecoparalogs). Low amino acid sequence identities among functional group members and lack of conserved gene order and orientation in the regions containing similar groups of paralogs suggest that most of the paralogs were not the result of recent duplication events. The genome sizes of cultured subdivision 1 and 3 strains in the phylum Acidobacteria were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 1 were estimated to have smaller genome sizes ranging from ca. 2.0 to 4.8 Mb, whereas members of subdivision 3 had slightly larger genomes, from ca. 5.8 to 9.9 Mb. It is hypothesized that the large genome of strain Ellin6076 encodes traits that provide a selective metabolic, defensive and regulatory advantage in the variable soil environment.

  3. New prediction for the direct CP-violating parameter var-epsilon prime/var-epsilon and the ΔI=1/2 rule

    International Nuclear Information System (INIS)

    Wu, Yue-Liang

    2001-01-01

    The low-energy dynamics of QCD is investigated with special attention paid to the matching between QCD and chiral perturbation theory (ChPT), and also to some useful algebraic chiral operator relations which survive even when we include chiral loop corrections. It then allows us to evaluate the hadronic matrix elements below the energy scale Λ χ ≅1GeV. Based on the new analyses, we present a consistent prediction for both the direct CP-violating parameter var-epsilonprime/var-epsilon and the ΔI=1/2 rule in kaon decays. In the leading 1/N c approximation, the isospin amplitudes A 0 and A 2 are found to agree well with the data, and the direct CP-violating parameter var-epsilonprime/var-epsilon is predicted to be large, which also confirms our earlier conclusion. Its numerical value is var-epsilonprime/var-epsilon=23.6 -7.8 +12.4 x10 -4 (Imλ t /= 1.2x10 -4 ) which is no longer sensitive to the strange quark mass due to the matching conditions. Taking into account a simultaneous consistent analysis on the isospin amplitudes A 0 and A 2 , the ratio var-epsilonprime/var-epsilon is in favor of the values var-epsilonprime/var-epsilon=(20±9)x10 -4

  4. A var gene promoter implicated in severe malaria nucleates silencing and is regulated by 3’ untranslated region and intronic cis-elements

    Science.gov (United States)

    Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.

    2009-01-01

    Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of

  5. Parental Origin of Interstitial Duplications at 15q11.2-q13.3 in Schizophrenia and Neurodevelopmental Disorders

    DEFF Research Database (Denmark)

    Isles, Anthony R; Ingason, Andrés; Lowther, Chelsea

    2016-01-01

    Duplications at 15q11.2-q13.3 overlapping the Prader-Willi/Angelman syndrome (PWS/AS) region have been associated with developmental delay (DD), autism spectrum disorder (ASD) and schizophrenia (SZ). Due to presence of imprinted genes within the region, the parental origin of these duplications m...

  6. An ancient history of gene duplications, fusions and losses in the evolution of APOBEC3 mutators in mammals

    Science.gov (United States)

    2012-01-01

    Background The APOBEC3 (A3) genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals) already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure. PMID:22640020

  7. A case report of Chinese brothers with inherited MECP2-containing duplication: autism and intellectual disability, but not seizures or respiratory infections.

    Science.gov (United States)

    Xu, Xiu; Xu, Qiong; Zhang, Ying; Zhang, Xiaodi; Cheng, Tianlin; Wu, Bingbing; Ding, Yanhua; Lu, Ping; Zheng, Jingjing; Zhang, Min; Qiu, Zilong; Yu, Xiang

    2012-08-21

    Autistic spectrum disorders (ASDs) are a family of neurodevelopmental disorders with strong genetic components. Recent studies have shown that copy number variations in dosage sensitive genes can contribute significantly to these disorders. One such gene is the transcription factor MECP2, whose loss of function in females results in Rett syndrome, while its duplication in males results in developmental delay and autism. Here, we identified a Chinese family with two brothers both inheriting a 2.2 Mb MECP2-containing duplication (151,369,305 - 153,589,577) from their mother. In addition, both brothers also had a 213.7 kb duplication on Chromosome 2, inherited from their father. The older brother also carried a 48.4 kb duplication on Chromosome 2 inherited from the mother, and a 8.2 kb deletion at 11q13.5 inherited from the father. Based on the published literature, MECP2 is the most autism-associated gene among the identified CNVs. Consistently, the boys displayed clinical features in common with other patients carrying MECP2 duplications, including intellectual disability, autism, lack of speech, slight hypotonia and unsteadiness of movement. They also had slight dysmorphic features including a depressed nose bridge, large ears and midface hypoplasia. Interestingly, they did not exhibit other clinical features commonly observed in American-European patients with MECP2 duplication, including recurrent respiratory infections and epilepsy. To our knowledge, this is the first identification and characterization of Chinese Han patients with MECP2-containing duplications. Further cases are required to determine if the above described clinical differences are due to individual variations or related to the genetic background of the patients.

  8. Annelid Distal-less/Dlx duplications reveal varied post-duplication fates

    Directory of Open Access Journals (Sweden)

    Korchagina Natalia

    2011-08-01

    Full Text Available Abstract Background Dlx (Distal-less genes have various developmental roles and are widespread throughout the animal kingdom, usually occurring as single copy genes in non-chordates and as multiple copies in most chordate genomes. While the genomic arrangement and function of these genes is well known in vertebrates and arthropods, information about Dlx genes in other organisms is scarce. We investigate the presence of Dlx genes in several annelid species and examine Dlx gene expression in the polychaete Pomatoceros lamarckii. Results Two Dlx genes are present in P. lamarckii, Capitella teleta and Helobdella robusta. The C. teleta Dlx genes are closely linked in an inverted tail-to-tail orientation, reminiscent of the arrangement of vertebrate Dlx pairs, and gene conversion appears to have had a role in their evolution. The H. robusta Dlx genes, however, are not on the same genomic scaffold and display divergent sequences, while, if the P. lamarckii genes are linked in a tail-to-tail orientation they are a minimum of 41 kilobases apart and show no sign of gene conversion. No expression in P. lamarckii appendage development has been observed, which conflicts with the supposed conserved role of these genes in animal appendage development. These Dlx duplications do not appear to be annelid-wide, as the polychaete Platynereis dumerilii likely possesses only one Dlx gene. Conclusions On the basis of the currently accepted annelid phylogeny, we hypothesise that one Dlx duplication occurred in the annelid lineage after the divergence of P. dumerilii from the other lineages and these duplicates then had varied evolutionary fates in different species. We also propose that the ancestral role of Dlx genes is not related to appendage development.

  9. Host Mitochondrial Association Evolved in the Human Parasite Toxoplasma gondii via Neofunctionalization of a Gene Duplicate.

    Science.gov (United States)

    Adomako-Ankomah, Yaw; English, Elizabeth D; Danielson, Jeffrey J; Pernas, Lena F; Parker, Michelle L; Boulanger, Martin J; Dubey, Jitender P; Boyle, Jon P

    2016-05-01

    In Toxoplasma gondii, an intracellular parasite of humans and other animals, host mitochondrial association (HMA) is driven by a gene family that encodes multiple mitochondrial association factor 1 (MAF1) proteins. However, the importance of MAF1 gene duplication in the evolution of HMA is not understood, nor is the impact of HMA on parasite biology. Here we used within- and between-species comparative analysis to determine that the MAF1 locus is duplicated in T. gondii and its nearest extant relative Hammondia hammondi, but not another close relative, Neospora caninum Using cross-species complementation, we determined that the MAF1 locus harbors multiple distinct paralogs that differ in their ability to mediate HMA, and that only T. gondii and H. hammondi harbor HMA(+) paralogs. Additionally, we found that exogenous expression of an HMA(+) paralog in T. gondii strains that do not normally exhibit HMA provides a competitive advantage over their wild-type counterparts during a mouse infection. These data indicate that HMA likely evolved by neofunctionalization of a duplicate MAF1 copy in the common ancestor of T. gondii and H. hammondi, and that the neofunctionalized gene duplicate is selectively advantageous. Copyright © 2016 by the Genetics Society of America.

  10. Approximating the edit distance for genomes with duplicate genes under DCJ, insertion and deletion

    Directory of Open Access Journals (Sweden)

    Shao Mingfu

    2012-12-01

    Full Text Available Abstract Computing the edit distance between two genomes under certain operations is a basic problem in the study of genome evolution. The double-cut-and-join (DCJ model has formed the basis for most algorithmic research on rearrangements over the last few years. The edit distance under the DCJ model can be easily computed for genomes without duplicate genes. In this paper, we study the edit distance for genomes with duplicate genes under a model that includes DCJ operations, insertions and deletions. We prove that computing the edit distance is equivalent to finding the optimal cycle decomposition of the corresponding adjacency graph, and give an approximation algorithm with an approximation ratio of 1.5 + ∈.

  11. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  12. Dynamic CO₂ inhalation: a novel treatment for CSR-CSA associated with CHF.

    Science.gov (United States)

    Wan, Zhi Hui; Wen, Fang Jing; Hu, Ke

    2013-05-01

    Cheyne-Stokes respiration with central sleep apnea (CSR-CSA) is very common in patients with chronic congestive heart failure (CHF). A current concept of the key pathophysiological mechanism leading to CSR-CSA is a fluctuation of PaCO2 below and above the apneic threshold. A number of therapeutic approaches for CSR-CSA have been proposed-all with varying success, some of which include various modes of positive airway pressure among other strategies. However, CO2 oscillations seen in CSR-CSA have yet to be looked at as a specific therapeutic target by current treatments. Previous studies have shown that delivery of constant CO2 is efficacious in eliminating CSR-CSA by raising PaCO2, but there are serious concerns about the potential side effects, such as unwanted elevations in ventilation, work of breathing, and sympathetic nerve activity (SNA), and consequently CO2 inhalation therapy has not been recommended as a routine option for therapy. However, recent new studies into CO2 inhalation therapy have been made that may reshape its role as therapeutic. In this review, we will focus on the recent developments of administration of dynamic CO2 in the management of CSR-CSA in CHF patients.

  13. Myxococcus xanthus DK1622 Coordinates Expressions of the Duplicate groEL and Single groES Genes for Synergistic Functions of GroELs and GroES

    Directory of Open Access Journals (Sweden)

    Yue-zhong Li

    2017-04-01

    Full Text Available Chaperonin GroEL (Cpn60 requires cofactor GroES (Cpn10 for protein refolding in bacteria that possess single groEL and groES genes in a bicistronic groESL operon. Among 4,861 completely-sequenced prokaryotic genomes, 884 possess duplicate groEL genes and 770 possess groEL genes with no neighboring groES. It is unclear whether stand-alone groEL requires groES in order to function and, if required, how duplicate groEL genes and unequal groES genes balance their expressions. In Myxococcus xanthus DK1622, we determined that, while duplicate groELs were alternatively deletable, the single groES that clusters with groEL1 was essential for cell survival. Either GroEL1 or GroEL2 required interactions with GroES for in vitro and in vivo functions. Deletion of groEL1 or groEL2 resulted in decreased expressions of both groEL and groES; and ectopic complementation of groEL recovered not only the groEL but also groES expressions. The addition of an extra groES gene upstream groEL2 to form a bicistronic operon had almost no influence on groES expression and the cell survival rate, whereas over-expression of groES using a self-replicating plasmid simultaneously increased the groEL expressions. The results indicated that M. xanthus DK1622 cells coordinate expressions of the duplicate groEL and single groES genes for synergistic functions of GroELs and GroES. We proposed a potential regulation mechanism for the expression coordination.

  14. A case report of Chinese brothers with inherited MECP2-containing duplication: autism and intellectual disability, but not seizures or respiratory infections

    Directory of Open Access Journals (Sweden)

    Xu Xiu

    2012-08-01

    Full Text Available Abstract Background Autistic spectrum disorders (ASDs are a family of neurodevelopmental disorders with strong genetic components. Recent studies have shown that copy number variations in dosage sensitive genes can contribute significantly to these disorders. One such gene is the transcription factor MECP2, whose loss of function in females results in Rett syndrome, while its duplication in males results in developmental delay and autism. Case presentation Here, we identified a Chinese family with two brothers both inheriting a 2.2 Mb MECP2-containing duplication (151,369,305 – 153,589,577 from their mother. In addition, both brothers also had a 213.7 kb duplication on Chromosome 2, inherited from their father. The older brother also carried a 48.4 kb duplication on Chromosome 2 inherited from the mother, and a 8.2 kb deletion at 11q13.5 inherited from the father. Based on the published literature, MECP2 is the most autism-associated gene among the identified CNVs. Consistently, the boys displayed clinical features in common with other patients carrying MECP2 duplications, including intellectual disability, autism, lack of speech, slight hypotonia and unsteadiness of movement. They also had slight dysmorphic features including a depressed nose bridge, large ears and midface hypoplasia. Interestingly, they did not exhibit other clinical features commonly observed in American-European patients with MECP2 duplication, including recurrent respiratory infections and epilepsy. Conclusions To our knowledge, this is the first identification and characterization of Chinese Han patients with MECP2-containing duplications. Further cases are required to determine if the above described clinical differences are due to individual variations or related to the genetic background of the patients.

  15. Gene duplication, loss and selection in the evolution of saxitoxin biosynthesis in alveolates.

    Science.gov (United States)

    Murray, Shauna A; Diwan, Rutuja; Orr, Russell J S; Kohli, Gurjeet S; John, Uwe

    2015-11-01

    A group of marine dinoflagellates (Alveolata, Eukaryota), consisting of ∼10 species of the genus Alexandrium, Gymnodinium catenatum and Pyrodinium bahamense, produce the toxin saxitoxin and its analogues (STX), which can accumulate in shellfish, leading to ecosystem and human health impacts. The genes, sxt, putatively involved in STX biosynthesis, have recently been identified, however, the evolution of these genes within dinoflagellates is not clear. There are two reasons for this: uncertainty over the phylogeny of dinoflagellates; and that the sxt genes of many species of Alexandrium and other dinoflagellate genera are not known. Here, we determined the phylogeny of STX-producing and other dinoflagellates based on a concatenated eight-gene alignment. We determined the presence, diversity and phylogeny of sxtA, domains A1 and A4 and sxtG in 52 strains of Alexandrium, and a further 43 species of dinoflagellates and thirteen other alveolates. We confirmed the presence and high sequence conservation of sxtA, domain A4, in 40 strains (35 Alexandrium, 1 Pyrodinium, 4 Gymnodinium) of 8 species of STX-producing dinoflagellates, and absence from non-producing species. We found three paralogs of sxtA, domain A1, and a widespread distribution of sxtA1 in non-STX producing dinoflagellates, indicating duplication events in the evolution of this gene. One paralog, clade 2, of sxtA1 may be particularly related to STX biosynthesis. Similarly, sxtG appears to be generally restricted to STX-producing species, while three amidinotransferase gene paralogs were found in dinoflagellates. We investigated the role of positive (diversifying) selection following duplication in sxtA1 and sxtG, and found negative selection in clades of sxtG and sxtA1, clade 2, suggesting they were functionally constrained. Significant episodic diversifying selection was found in some strains in clade 3 of sxtA1, a clade that may not be involved in STX biosynthesis, indicating pressure for diversification

  16. TRPV5 and TRPV6 in transcellular Ca(2+) transport: regulation, gene duplication, and polymorphisms in African populations.

    Science.gov (United States)

    Peng, Ji-Bin

    2011-01-01

    TRPV5 and TRPV6 are unique members of the TRP super family. They are highly selective for Ca(2+) ions with multiple layers of Ca(2+)-dependent inactivation mechanisms, expressed at the apical membrane of Ca(2+) transporting epithelia, and robustly responsive to 1,25-dihydroxivitamin D(3). These features are well suited for their roles as Ca(2+) entry channels in the first step of transcellular Ca(2+) transport pathways, which are involved in intestinal absorption, renal reabsorption of Ca(2+), placental transfer of Ca(2+) to fetus, and many other processes. While TRPV6 is more broadly expressed in a variety of tissues such as esophagus, stomach, small intestine, colon, kidney, placenta, pancreas, prostate, uterus, salivary gland, and sweat gland, TRPV5 expression is relatively restricted to the distal convoluted tubule and connecting tubule of the kidney. There is only one TRPV6-like gene in fish and birds in comparison to both TRPV5 and TRPV6 genes in mammals, indicating TRPV5 gene was likely generated from duplication of TRPV6 gene during the evolution of mammals to meet the needs of complex renal function. TRPV5 and TRPV6 are subjected to vigorous regulations under physiological, pathological, and therapeutic conditions. The elevated TRPV6 level in malignant tumors such as prostate and breast cancers makes it a potential therapeutic target. TRPV6, and to a lesser extent TRPV5, exhibit unusually high levels of single nucleotide polymorphisms (SNPs) in African populations as compared to other populations, indicating TRPV6 gene was under selective pressure during or after humans migrated out of Africa. The SNPs of TRPV6 and TRPV5 likely contribute to the Ca(2+) conservation mechanisms in African populations.

  17. Assessing duplication and loss of APETALA1/FRUITFULL homologs in Ranunculales

    Science.gov (United States)

    Pabón-Mora, Natalia; Hidalgo, Oriane; Gleissberg, Stefan; Litt, Amy

    2013-01-01

    Gene duplication and loss provide raw material for evolutionary change within organismal lineages as functional diversification of gene copies provide a mechanism for phenotypic variation. Here we focus on the APETALA1/FRUITFULL MADS-box gene lineage evolution. AP1/FUL genes are angiosperm-specific and have undergone several duplications. By far the most significant one is the core-eudicot duplication resulting in the euAP1 and euFUL clades. Functional characterization of several euAP1 and euFUL genes has shown that both function in proper floral meristem identity, and axillary meristem repression. Independently, euAP1 genes function in floral meristem and sepal identity, whereas euFUL genes control phase transition, cauline leaf growth, compound leaf morphogenesis and fruit development. Significant functional variation has been detected in the function of pre-duplication basal-eudicot FUL-like genes, but the underlying mechanisms for change have not been identified. FUL-like genes in the Papaveraceae encode all functions reported for euAP1 and euFUL genes, whereas FUL-like genes in Aquilegia (Ranunculaceae) function in inflorescence development and leaf complexity, but not in flower or fruit development. Here we isolated FUL-like genes across the Ranunculales and used phylogenetic approaches to analyze their evolutionary history. We identified an early duplication resulting in the RanFL1 and RanFL2 clades. RanFL1 genes were present in all the families sampled and are mostly under strong negative selection in the MADS, I and K domains. RanFL2 genes were only identified from Eupteleaceae, Papaveraceae s.l., Menispermaceae and Ranunculaceae and show relaxed purifying selection at the I and K domains. We discuss how asymmetric sequence diversification, new motifs, differences in codon substitutions and likely protein-protein interactions resulting from this Ranunculiid-specific duplication can help explain the functional differences among basal-eudicot FUL-like genes

  18. Finding all sorting tandem duplication random loss operations

    DEFF Research Database (Denmark)

    Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang

    2011-01-01

    A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...

  19. The Vibrio cholerae var regulon encodes a metallo-β-lactamase and an antibiotic efflux pump, which are regulated by VarR, a LysR-type transcription factor.

    Directory of Open Access Journals (Sweden)

    Hong-Ting Victor Lin

    Full Text Available The genome sequence of V. cholerae O1 Biovar Eltor strain N16961 has revealed a putative antibiotic resistance (var regulon that is predicted to encode a transcriptional activator (VarR, which is divergently transcribed relative to the putative resistance genes for both a metallo-β-lactamase (VarG and an antibiotic efflux-pump (VarABCDEF. We sought to test whether these genes could confer antibiotic resistance and are organised as a regulon under the control of VarR. VarG was overexpressed and purified and shown to have β-lactamase activity against penicillins, cephalosporins and carbapenems, having the highest activity against meropenem. The expression of VarABCDEF in the Escherichia coli (ΔacrAB strain KAM3 conferred resistance to a range of drugs, but most significant resistance was to the macrolide spiramycin. A gel-shift analysis was used to determine if VarR bound to the promoter regions of the resistance genes. Consistent with the regulation of these resistance genes, VarR binds to three distinct intergenic regions, varRG, varGA and varBC located upstream and adjacent to varG, varA and varC, respectively. VarR can act as a repressor at the varRG promoter region; whilst this repression was relieved upon addition of β-lactams, these did not dissociate the VarR/varRG-DNA complex, indicating that the de-repression of varR by β-lactams is indirect. Considering that the genomic arrangement of VarR-VarG is strikingly similar to that of AmpR-AmpC system, it is possible that V. cholerae has evolved a system for resistance to the newer β-lactams that would prove more beneficial to the bacterium in light of current selective pressures.

  20. Human monoclonal IgG selection of Plasmodium falciparum for the expression of placental malaria-specific variant surface antigens

    DEFF Research Database (Denmark)

    Soerli, J; Barfod, L; Lavstsen, T

    2009-01-01

    Pregnancy-associated Plasmodium falciparum malaria (PAM) is a major cause of morbidity and mortality in African women and their offspring. PAM is characterized by accumulation of infected erythrocytes (IEs) that adhere to chondroitin sulphate A (CSA) in the placental intervillous space. We show h...... transcription of var2csa. The results corroborate current efforts to develop PAM-specific vaccines based on VAR2CSA....

  1. Cloning and characterization of three squalene epoxidase genes in panax vietnamensis var. fuscidicus, a rare medical plant with high content of ocotillot-type ginsenosides

    International Nuclear Information System (INIS)

    Ma, C.H.; Jiang, N.H.; Chen, J.W.; Zhang, G.H.

    2016-01-01

    Panax vietnamensis var. fuscidiscus, is a new variety of Panax. vietnamensis, which was first found in Jinping County, the southern part of Yunnan Province, China. It is also one of the most prized medicinal plants used in traditional ethnic minority medicine systems. This species contains higher content of ocotillol-type saponin, especially majonoside R2, which make this plant particularly suitable for identification of the SE genes responsible for the biosynthesis of ginsenosides. Three cDNAs encoding SE were cloned from P. vietnamensis var. fuscidiscus, and their molecular characterizations were investigated. The tissue-specific expression patterns of the three SE genes were analyzed by RT-qPCR. The transcription levels of these genes in Methyl jasmonate (MeJA)-treated leaves of P. vietnamensis var. fuscidiscus were also estimated by RT-qPCR. PvfSE, PvfSE2 and PvfSE3 differed in predicted membrane-spanning helices. Phylogenetic analysis grouped these SE into three different clades. The three PvfSE isoforms were all most highly expressed in leaves. Moreover, they exhibited different response patterns under MeJA induction. The three PvfSE isoforms may play different roles in sterol or ginsenoside biosynthesis in this herb This report is the first attempt to clone and expression analysis of SE from P. vietnamensis var. fuscidiscus and provides a new foundation for further understanding the role of SE in the biosynthesis of ginsenosides. (author)

  2. Sorting by Cuts, Joins, and Whole Chromosome Duplications.

    Science.gov (United States)

    Zeira, Ron; Shamir, Ron

    2017-02-01

    Genome rearrangement problems have been extensively studied due to their importance in biology. Most studied models assumed a single copy per gene. However, in reality, duplicated genes are common, most notably in cancer. In this study, we make a step toward handling duplicated genes by considering a model that allows the atomic operations of cut, join, and whole chromosome duplication. Given two linear genomes, [Formula: see text] with one copy per gene and [Formula: see text] with two copies per gene, we give a linear time algorithm for computing a shortest sequence of operations transforming [Formula: see text] into [Formula: see text] such that all intermediate genomes are linear. We also show that computing an optimal sequence with fewest duplications is NP-hard.

  3. Independent Origin and Global Distribution of Distinct Plasmodium vivax Duffy Binding Protein Gene Duplications.

    Directory of Open Access Journals (Sweden)

    Jessica B Hostetler

    2016-10-01

    Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.

  4. Expression response of duplicated metallothionein 3 gene to copper stress in Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Nevrtalová, Eva; Baloun, Jiří; Hudzieczek, Vojtěch; Čegan, Radim; Vyskot, Boris; Doležel, Jaroslav; Šafář, Jan; Milde, D.; Hobza, Roman

    2014-01-01

    Roč. 251, č. 6 (2014), s. 1427-1439 ISSN 0033-183X R&D Projects: GA ČR(CZ) GAP501/12/2220; GA ČR(CZ) GBP501/12/G090; GA ČR(CZ) GP13-34962P; GA ČR(CZ) GA522/09/0083 Institutional support: RVO:68081707 Keywords : Copper * Gene duplication * Metallothionein Subject RIV: BO - Biophysics; EF - Botanics (UEB-Q) Impact factor: 2.651, year: 2014

  5. Duplications involving a conserved regulatory element downstream of BMP2 are associated with brachydactyly type A2

    DEFF Research Database (Denmark)

    Dathe, Katarina; Kjaer, Klaus W; Brehm, Anja

    2009-01-01

    Autosomal-dominant brachydactyly type A2 (BDA2), a limb malformation characterized by hypoplastic middle phalanges of the second and fifth fingers, has been shown to be due to mutations in the Bone morphogenetic protein receptor 1B (BMPR1B) or in its ligand Growth and differentiation factor 5 (GDF5......). A linkage analysis performed in a mutation-negative family identified a novel locus for BDA2 on chromosome 20p12.3 that incorporates the gene for Bone morphogenetic protein 2 (BMP2). No point mutation was identified in BMP2, so a high-density array CGH analysis covering the critical interval...... within the identified duplication. Our results reveal an additional functional mechanism for the pathogenesis of BDA2, which is duplication of a regulatory element that affects the expression of BMP2 in the developing limb....

  6. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  7. Functional diversification of duplicated CYC2 clade genes in regulation of inflorescence development in Gerbera hybrida (Asteraceae).

    Science.gov (United States)

    Juntheikki-Palovaara, Inka; Tähtiharju, Sari; Lan, Tianying; Broholm, Suvi K; Rijpkema, Anneke S; Ruonala, Raili; Kale, Liga; Albert, Victor A; Teeri, Teemu H; Elomaa, Paula

    2014-09-01

    The complex inflorescences (capitula) of Asteraceae consist of different types of flowers. In Gerbera hybrida (gerbera), the peripheral ray flowers are bilaterally symmetrical and lack functional stamens while the central disc flowers are more radially symmetrical and hermaphroditic. Proteins of the CYC2 subclade of the CYC/TB1-like TCP domain transcription factors have been recruited several times independently for parallel evolution of bilaterally symmetrical flowers in various angiosperm plant lineages, and have also been shown to regulate flower-type identity in Asteraceae. The CYC2 subclade genes in gerbera show largely overlapping gene expression patterns. At the level of single flowers, their expression domain in petals shows a spatial shift from the dorsal pattern known so far in species with bilaterally symmetrical flowers, suggesting that this change in expression may have evolved after the origin of Asteraceae. Functional analysis indicates that GhCYC2, GhCYC3 and GhCYC4 mediate positional information at the proximal-distal axis of the inflorescence, leading to differentiation of ray flowers, but that they also regulate ray flower petal growth by affecting cell proliferation until the final size and shape of the petals is reached. Moreover, our data show functional diversification for the GhCYC5 gene. Ectopic activation of GhCYC5 increases flower density in the inflorescence, suggesting that GhCYC5 may promote the flower initiation rate during expansion of the capitulum. Our data thus indicate that modification of the ancestral network of TCP factors has, through gene duplications, led to the establishment of new expression domains and to functional diversification. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  8. DC8 and DC13 var genes associated with severe malaria bind avidly to diverse endothelial cells.

    Directory of Open Access Journals (Sweden)

    Marion Avril

    Full Text Available During blood stage infection, Plasmodium falciparum infected erythrocytes (IE bind to host blood vessels. This virulence determinant enables parasites to evade spleen-dependent killing mechanisms, but paradoxically in some cases may reduce parasite fitness by killing the host. Adhesion of infected erythrocytes is mediated by P. falciparum erythrocyte membrane protein 1 (PfEMP1, a family of polymorphic adhesion proteins encoded by var genes. Whereas cerebral binding and severe malaria are associated with parasites expressing DC8 and DC13 var genes, relatively little is known about the non-brain endothelial selection on severe malaria adhesive types. In this study, we selected P. falciparum-IEs on diverse endothelial cell types and demonstrate that DC8 and DC13 var genes were consistently among the major var transcripts selected on non-brain endothelial cells (lung, heart, bone marrow. To investigate the molecular basis for this avid endothelial binding activity, recombinant proteins were expressed from the predominant upregulated DC8 transcript, IT4var19. In-depth binding comparisons revealed that multiple extracellular domains from this protein bound brain and non-brain endothelial cells, and individual domains largely did not discriminate between different endothelial cell types. Additionally, we found that recombinant DC8 and DC13 CIDR1 domains exhibited a widespread endothelial binding activity and could compete for DC8-IE binding to brain endothelial cells, suggesting they may bind the same host receptor. Our findings provide new insights into the interaction of severe malaria adhesive types and host blood vessels and support the hypothesis that parasites causing severe malaria express PfEMP1 variants with a superior ability to adhere to diverse endothelial cell types, and may therefore endow these parasites with a growth and transmission advantage.

  9. Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

    Directory of Open Access Journals (Sweden)

    Giao Ngoc Nguyen

    2017-08-01

    Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

  10. AluY-mediated germline deletion, duplication and somatic stem cell reversion in UBE2T defines a new subtype of Fanconi anemia.

    Science.gov (United States)

    Virts, Elizabeth L; Jankowska, Anna; Mackay, Craig; Glaas, Marcel F; Wiek, Constanze; Kelich, Stephanie L; Lottmann, Nadine; Kennedy, Felicia M; Marchal, Christophe; Lehnert, Erik; Scharf, Rüdiger E; Dufour, Carlo; Lanciotti, Marina; Farruggia, Piero; Santoro, Alessandra; Savasan, Süreyya; Scheckenbach, Kathrin; Schipper, Jörg; Wagenmann, Martin; Lewis, Todd; Leffak, Michael; Farlow, Janice L; Foroud, Tatiana M; Honisch, Ellen; Niederacher, Dieter; Chakraborty, Sujata C; Vance, Gail H; Pruss, Dmitry; Timms, Kirsten M; Lanchbury, Jerry S; Alpi, Arno F; Hanenberg, Helmut

    2015-09-15

    Fanconi anemia (FA) is a rare inherited disorder clinically characterized by congenital malformations, progressive bone marrow failure and cancer susceptibility. At the cellular level, FA is associated with hypersensitivity to DNA-crosslinking genotoxins. Eight of 17 known FA genes assemble the FA E3 ligase complex, which catalyzes monoubiquitination of FANCD2 and is essential for replicative DNA crosslink repair. Here, we identify the first FA patient with biallelic germline mutations in the ubiquitin E2 conjugase UBE2T. Both mutations were aluY-mediated: a paternal deletion and maternal duplication of exons 2-6. These loss-of-function mutations in UBE2T induced a cellular phenotype similar to biallelic defects in early FA genes with the absence of FANCD2 monoubiquitination. The maternal duplication produced a mutant mRNA that could encode a functional protein but was degraded by nonsense-mediated mRNA decay. In the patient's hematopoietic stem cells, the maternal allele with the duplication of exons 2-6 spontaneously reverted to a wild-type allele by monoallelic recombination at the duplicated aluY repeat, thereby preventing bone marrow failure. Analysis of germline DNA of 814 normal individuals and 850 breast cancer patients for deletion or duplication of UBE2T exons 2-6 identified the deletion in only two controls, suggesting aluY-mediated recombinations within the UBE2T locus are rare and not associated with an increased breast cancer risk. Finally, a loss-of-function germline mutation in UBE2T was detected in a high-risk breast cancer patient with wild-type BRCA1/2. Cumulatively, we identified UBE2T as a bona fide FA gene (FANCT) that also may be a rare cancer susceptibility gene. © The Author 2015. Published by Oxford University Press.

  11. Functional analysis of duplicated Symbiosis Receptor Kinase (SymRK) genes during nodulation and mycorrhizal infection in soybean (Glycine max).

    Science.gov (United States)

    Indrasumunar, Arief; Wilde, Julia; Hayashi, Satomi; Li, Dongxue; Gresshoff, Peter M

    2015-03-15

    Association between legumes and rhizobia results in the formation of root nodules, where symbiotic nitrogen fixation occurs. The early stages of this association involve a complex of signalling events between the host and microsymbiont. Several genes dealing with early signal transduction have been cloned, and one of them encodes the leucine-rich repeat (LRR) receptor kinase (SymRK; also termed NORK). The Symbiosis Receptor Kinase gene is required by legumes to establish a root endosymbiosis with Rhizobium bacteria as well as mycorrhizal fungi. Using degenerate primer and BAC sequencing, we cloned duplicated SymRK homeologues in soybean called GmSymRKα and GmSymRKβ. These duplicated genes have high similarity of nucleotide (96%) and amino acid sequence (95%). Sequence analysis predicted a malectin-like domain within the extracellular domain of both genes. Several putative cis-acting elements were found in promoter regions of GmSymRKα and GmSymRKβ, suggesting a participation in lateral root development, cell division and peribacteroid membrane formation. The mutant of SymRK genes is not available in soybean; therefore, to know the functions of these genes, RNA interference (RNAi) of these duplicated genes was performed. For this purpose, RNAi construct of each gene was generated and introduced into the soybean genome by Agrobacterium rhizogenes-mediated hairy root transformation. RNAi of GmSymRKβ gene resulted in an increased reduction of nodulation and mycorrhizal infection than RNAi of GmSymRKα, suggesting it has the major activity of the duplicated gene pair. The results from the important crop legume soybean confirm the joint phenotypic action of GmSymRK genes in both mycorrhizal and rhizobial infection seen in model legumes. Copyright © 2015 Elsevier GmbH. All rights reserved.

  12. Divergent Evolutionary Patterns of NAC Transcription Factors Are Associated with Diversification and Gene Duplications in Angiosperm

    Directory of Open Access Journals (Sweden)

    Xiaoli Jin

    2017-06-01

    Full Text Available NAC (NAM/ATAF/CUC proteins constitute one of the biggest plant-specific transcription factor (TF families and have crucial roles in diverse developmental programs during plant growth. Phylogenetic analyses have revealed both conserved and lineage-specific NAC subfamilies, among which various origins and distinct features were observed. It is reasonable to hypothesize that there should be divergent evolutionary patterns of NAC TFs both between dicots and monocots, and among NAC subfamilies. In this study, we compared the gene duplication and loss, evolutionary rate, and selective pattern among non-lineage specific NAC subfamilies, as well as those between dicots and monocots, through genome-wide analyses of sequence and functional data in six dicot and five grass lineages. The number of genes gained in the dicot lineages was much larger than that in the grass lineages, while fewer gene losses were observed in the grass than that in the dicots. We revealed (1 uneven constitution of Clusters of Orthologous Groups (COGs and contrasting birth/death rates among subfamilies, and (2 two distinct evolutionary scenarios of NAC TFs between dicots and grasses. Our results demonstrated that relaxed selection, resulting from concerted gene duplications, may have permitted substitutions responsible for functional divergence of NAC genes into new lineages. The underlying mechanism of distinct evolutionary fates of NAC TFs shed lights on how evolutionary divergence contributes to differences in establishing NAC gene subfamilies and thus impacts the distinct features between dicots and grasses.

  13. De novo characterization of the Iris lactea var. chinensis transcriptome and an analysis of genes under cadmium or lead exposure.

    Science.gov (United States)

    Gu, Chun-Sun; Liu, Liang-Qin; Deng, Yan-Ming; Zhang, Yong-Xia; Wang, Zhi-Quan; Yuan, Hai-Yan; Huang, Su-Zhen

    2017-10-01

    Iris lactea var. chinensis (I. lactea var. chinensis) is tolerant to accumulations of cadmium (Cd) and lead (Pb). In this study, the transcriptome of I. lactea var. chinensis was investigated under Cd or Pb stresses. Using the gene ontology database, 31,974 unigenes were classified into biological process, cellular component and molecular function. In total, 13,132 unigenes were involved in enriched Encyclopedia of Genes and Genomes (KEGG) metabolic pathways, and the expression levels of 5904 unigenes were significantly changed after exposure to Cd or Pb stresses. Of these, 974 were co-up-regulated and 1281 were co-down-regulated under the two stresses. The transcriptome expression profiles of I. lactea var. chinensis under Cd or Pb stresses obtained in this study provided a resource for identifying common mechanisms in the detoxification of different heavy metals. Furthermore, the identified unigenes may be used for the genetic breeding of heavy-metal tolerant plants. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. A new resource for characterizing X-linked genes in Drosophila melanogaster: systematic coverage and subdivision of the X chromosome with nested, Y-linked duplications.

    Science.gov (United States)

    Cook, R Kimberley; Deal, Megan E; Deal, Jennifer A; Garton, Russell D; Brown, C Adam; Ward, Megan E; Andrade, Rachel S; Spana, Eric P; Kaufman, Thomas C; Cook, Kevin R

    2010-12-01

    Interchromosomal duplications are especially important for the study of X-linked genes. Males inheriting a mutation in a vital X-linked gene cannot survive unless there is a wild-type copy of the gene duplicated elsewhere in the genome. Rescuing the lethality of an X-linked mutation with a duplication allows the mutation to be used experimentally in complementation tests and other genetic crosses and it maps the mutated gene to a defined chromosomal region. Duplications can also be used to screen for dosage-dependent enhancers and suppressors of mutant phenotypes as a way to identify genes involved in the same biological process. We describe an ongoing project in Drosophila melanogaster to generate comprehensive coverage and extensive breakpoint subdivision of the X chromosome with megabase-scale X segments borne on Y chromosomes. The in vivo method involves the creation of X inversions on attached-XY chromosomes by FLP-FRT site-specific recombination technology followed by irradiation to induce large internal X deletions. The resulting chromosomes consist of the X tip, a medial X segment placed near the tip by an inversion, and a full Y. A nested set of medial duplicated segments is derived from each inversion precursor. We have constructed a set of inversions on attached-XY chromosomes that enable us to isolate nested duplicated segments from all X regions. To date, our screens have provided a minimum of 78% X coverage with duplication breakpoints spaced a median of nine genes apart. These duplication chromosomes will be valuable resources for rescuing and mapping X-linked mutations and identifying dosage-dependent modifiers of mutant phenotypes.

  15. Gene duplication and fragmentation in the zebra finch major histocompatibility complex.

    Science.gov (United States)

    Balakrishnan, Christopher N; Ekblom, Robert; Völker, Martin; Westerdahl, Helena; Godinez, Ricardo; Kotkiewicz, Holly; Burt, David W; Graves, Tina; Griffin, Darren K; Warren, Wesley C; Edwards, Scott V

    2010-04-01

    Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC) has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC) sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH) evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving chromosomal fission, gene duplication and translocation in the

  16. Gene duplication and fragmentation in the zebra finch major histocompatibility complex

    Directory of Open Access Journals (Sweden)

    Burt David W

    2010-04-01

    Full Text Available Abstract Background Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. Results The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. Conclusion The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving

  17. Homology blocks of Plasmodium falciparum var genes and clinically distinct forms of severe malaria in a local population.

    Science.gov (United States)

    Rorick, Mary M; Rask, Thomas S; Baskerville, Edward B; Day, Karen P; Pascual, Mercedes

    2013-11-06

    The primary target of the human immune response to the malaria parasite Plasmodium falciparum, P. falciparum erythrocyte membrane protein 1 (PfEMP1), is encoded by the members of the hyper-diverse var gene family. The parasite exhibits antigenic variation via mutually exclusive expression (switching) of the ~60 var genes within its genome. It is thought that different variants exhibit different host endothelial binding preferences that in turn result in different manifestations of disease. Var sequences comprise ancient sequence fragments, termed homology blocks (HBs), that recombine at exceedingly high rates. We use HBs to define distinct var types within a local population. We then reanalyze a dataset that contains clinical and var expression data to investigate whether the HBs allow for a description of sequence diversity corresponding to biological function, such that it improves our ability to predict disease phenotype from parasite genetics. We find that even a generic set of HBs, which are defined for a small number of non-local parasites: capture the majority of local sequence diversity; improve our ability to predict disease severity from parasite genetics; and reveal a previously hypothesized yet previously unobserved parasite genetic basis for two forms of severe disease. We find that the expression rates of some HBs correlate more strongly with severe disease phenotypes than the expression rates of classic var DBLα tag types, and principal components of HB expression rate profiles further improve genotype-phenotype models. More specifically, within the large Kenyan dataset that is the focus of this study, we observe that HB expression differs significantly for severe versus mild disease, and for rosetting versus impaired consciousness associated severe disease. The analysis of a second much smaller dataset from Mali suggests that these HB-phenotype associations are consistent across geographically distant populations, since we find evidence suggesting

  18. North Carolina macular dystrophy (MCDR1) caused by a novel tandem duplication of the PRDM13 gene.

    Science.gov (United States)

    Bowne, Sara J; Sullivan, Lori S; Wheaton, Dianna K; Locke, Kirsten G; Jones, Kaylie D; Koboldt, Daniel C; Fulton, Robert S; Wilson, Richard K; Blanton, Susan H; Birch, David G; Daiger, Stephen P

    2016-01-01

    To identify the underlying cause of disease in a large family with North Carolina macular dystrophy (NCMD). A large four-generation family (RFS355) with an autosomal dominant form of NCMD was ascertained. Family members underwent comprehensive visual function evaluations. Blood or saliva from six affected family members and three unaffected spouses was collected and DNA tested for linkage to the MCDR1 locus on chromosome 6q12. Three affected family members and two unaffected spouses underwent whole exome sequencing (WES) and subsequently, custom capture of the linkage region followed by next-generation sequencing (NGS). Standard PCR and dideoxy sequencing were used to further characterize the mutation. Of the 12 eyes examined in six affected individuals, all but two had Gass grade 3 macular degeneration features. Large central excavation of the retinal and choroid layers, referred to as a macular caldera, was seen in an age-independent manner in the grade 3 eyes. The calderas are unique to affected individuals with MCDR1. Genome-wide linkage mapping and haplotype analysis of markers from the chromosome 6q region were consistent with linkage to the MCDR1 locus. Whole exome sequencing and custom-capture NGS failed to reveal any rare coding variants segregating with the phenotype. Analysis of the custom-capture NGS sequencing data for copy number variants uncovered a tandem duplication of approximately 60 kb on chromosome 6q. This region contains two genes, CCNC and PRDM13 . The duplication creates a partial copy of CCNC and a complete copy of PRDM13 . The duplication was found in all affected members of the family and is not present in any unaffected members. The duplication was not seen in 200 ethnically matched normal chromosomes. The cause of disease in the original family with MCDR1 and several others has been recently reported to be dysregulation of the PRDM13 gene, caused by either single base substitutions in a DNase 1 hypersensitive site upstream of the CCNC

  19. A gene duplication led to specialized gamma-aminobutyrate and beta-alanine aminotransferase in yeast

    DEFF Research Database (Denmark)

    Andersen, Gorm; Andersen, Birgit; Dobritzsch, D.

    2007-01-01

    and related yeasts have two different genes/enzymes to apparently 'distinguish' between the two reactions in a single cell. It is likely that upon duplication similar to 200 million years ago, a specialized Uga1p evolved into a 'novel' transaminase enzyme with broader substrate specificity.......In humans, beta-alanine (BAL) and the neurotransmitter gamma-aminobutyrate (GABA) are transaminated by a single aminotransferase enzyme. Apparently, yeast originally also had a single enzyme, but the corresponding gene was duplicated in the Saccharomyces kluyveri lineage. SkUGA1 encodes a homologue...... to characterize the substrate specificity and kinetic parameters of the four enzymes. It was found that the cofactor pyridoxal 5'-phosphate is needed for enzymatic activity and alpha-ketoglutarate, and not pyruvate, as the amino group acceptor. SkPyd4p preferentially uses BAL as the amino group donor (V...

  20. Duplication of 7q36.3 encompassing the Sonic Hedgehog (SHH) gene is associated with congenital muscular hypertrophy

    DEFF Research Database (Denmark)

    Kristensen, Lone Krøldrup; Kjaergaard, S; Kirchhoff, Marianne

    2012-01-01

    with muscular hypertrophy and mildly retarded psychomotor development. Array-CGH identified a small duplication of 7q36.3 including the Sonic Hedgehog (SHH) gene in both the aborted foetus and the live born male sib. Neither of the parents carried the 7q36.3 duplication. The consequences of overexpression...

  1. Study of duplication 24bp of ARX gene among patients presenting a Mental Retardation with a syndromic and non syndromic forms

    International Nuclear Information System (INIS)

    Essouissi, Imen

    2006-01-01

    Mental Retardation (MR) is the most frequent handicap. It touches 3% of the general population. The genetic causes of this handicap account for 40% of these cases. ARX gene (Aristaless related homeobox gene) belongs to the family of the genes homeobox located in Xp22.1. It is considered as the most frequently muted gene after the FMR1 gene. It is implicated in various forms of syndromic and nonsyndromic MR. Several types of mutation were identified on the level of this gene, including deletions/insertions, duplications, missense and nonsense mutations, responsible for a wide spectrum of phenotypes. The goal of this work is to seek the most frequent change of gene ARX: duplication 24pb (at the origin of an expansion of the field poly has protein ARX in the position 144-155AA) among Tunisian boys presenting in particular family forms of non specific MR, sporadic forms of non specific MR like certain patients presenting a West syndrome.To prove the duplication of 24 Pb, we used in this work the Pcr technique. The change of duplication 24pb was not found in our series, this could be explained by the low number of cases family studied (38 families) and by the absence of connection studies accusing a mode of transmission related to X chromosome in particular for the sporadic cases. (Author)

  2. Comprehensive review of the duplication 3q syndrome and report of a patient with Currarino syndrome and de novo duplication 3q26.32-q27.2.

    Science.gov (United States)

    Dworschak, G C; Crétolle, C; Hilger, A; Engels, H; Korsch, E; Reutter, H; Ludwig, M

    2017-05-01

    Partial duplications of the long arm of chromosome 3, dup(3q), are a rare but well-described condition, sharing features of Cornelia de Lange syndrome. Around two thirds of cases are derived from unbalanced translocations, whereas pure dup(3q) have rarely been reported. Here, we provide an extensive review of the literature on dup(3q). This search revealed several patients with caudal malformations and anomalies, suggesting that caudal malformations or anomalies represent an inherent phenotypic feature of dup(3q). In this context, we report a patient with a pure de novo duplication 3q26.32-q27.2. The patient had the clinical diagnosis of Currarino syndrome (CS) (characterized by the triad of sacral anomalies, anorectal malformations and a presacral mass) and additional features, frequently detected in patients with a dup(3q). Mutations within the MNX1 gene were found to be causative in CS but no MNX1 mutation could be detected in our patient. Our comprehensive search for candidate genes located in the critical region of the duplication 3q syndrome, 3q26.3-q27, revealed a so far neglected phenotypic overlap of dup(3q) and the Pierpont syndrome, associated with a mutation of the TBL1XR1 gene on 3q26.32. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Burkitt lymphoma expresses oncofetal chondroitin sulfate without being a reservoir for placental malaria sequestration

    DEFF Research Database (Denmark)

    Agerbaek, Mette Ø; Bento Ayres Pereira, Marina Maria; Clausen, Thomas M

    2017-01-01

    in other non-malignant tissues and thus VAR2CSA generally facilitates parasite sequestration and accumulation in pregnant women. In this study, we show that the specific receptor for VAR2CSA, the oncofetal chondroitin sulfate (ofCS), is likewise present in BL tissue and cell lines. We therefore explored...

  4. Genome-Wide Identification and Functional Analysis of the Calcineurin B-like Protein and Calcineurin B-like Protein-Interacting Protein Kinase Gene Families in Turnip (Brassica rapa var. rapa

    Directory of Open Access Journals (Sweden)

    Xin Yin

    2017-07-01

    Full Text Available The calcineurin B-like protein (CBL–CBL-interacting protein kinase (CIPK complex has been identified as a primary component in calcium sensors that perceives various stress signals. Turnip (Brassica rapa var. rapa has been widely cultivated in the Qinghai–Tibet Plateau for a century as a food crop of worldwide economic significance. These CBL–CIPK complexes have been demonstrated to play crucial roles in plant response to various environmental stresses. However, no report is available on the genome-wide characterization of these two gene families in turnip. In the present study, 19 and 51 members of the BrrCBL and BrrCIPK genes, respectively, are first identified in turnip and phylogenetically grouped into three and two distinct clusters, respectively. The expansion of these two gene families is mainly attributable to segmental duplication. Moreover, the differences in expression patterns in quantitative real-time PCR, as well as interaction profiles in the yeast two-hybrid assay, suggest the functional divergence of paralog genes during long-term evolution in turnip. Overexpressing and complement lines in Arabidopsis reveal that BrrCBL9.2 improves, but BrrCBL9.1 does not affect, salt tolerance in Arabidopsis. Thus, the expansion of the BrrCBL and BrrCIPK gene families enables the functional differentiation and evolution of some new gene functions of paralog genes. These paralog genes then play prominent roles in turnip's adaptation to the adverse environment of the Qinghai–Tibet Plateau. Overall, the study results contribute to our understanding of the functions of the CBL–CIPK complex and provide basis for selecting appropriate genes for the in-depth functional studies of BrrCBL–BrrCIPK in turnip.

  5. Segmental duplications and evolutionary acquisition of UV damage response in the SPATA31 gene family of primates and humans.

    Science.gov (United States)

    Bekpen, Cemalettin; Künzel, Sven; Xie, Chen; Eaaswarkhanth, Muthukrishnan; Lin, Yen-Lung; Gokcumen, Omer; Akdis, Cezmi A; Tautz, Diethard

    2017-03-06

    Segmental duplications are an abundant source for novel gene functions and evolutionary adaptations. This mechanism of generating novelty was very active during the evolution of primates particularly in the human lineage. Here, we characterize the evolution and function of the SPATA31 gene family (former designation FAM75A), which was previously shown to be among the gene families with the strongest signal of positive selection in hominoids. The mouse homologue for this gene family is a single copy gene expressed during spermatogenesis. We show that in primates, the SPATA31 gene duplicated into SPATA31A and SPATA31C types and broadened the expression into many tissues. Each type became further segmentally duplicated in the line towards humans with the largest number of full-length copies found for SPATA31A in humans. Copy number estimates of SPATA31A based on digital PCR show an average of 7.5 with a range of 5-11 copies per diploid genome among human individuals. The primate SPATA31 genes also acquired new protein domains that suggest an involvement in UV response and DNA repair. We generated antibodies and show that the protein is re-localized from the nucleolus to the whole nucleus upon UV-irradiation suggesting a UV damage response. We used CRISPR/Cas mediated mutagenesis to knockout copies of the gene in human primary fibroblast cells. We find that cell lines with reduced functional copies as well as naturally occurring low copy number HFF cells show enhanced sensitivity towards UV-irradiation. The acquisition of new SPATA31 protein functions and its broadening of expression may be related to the evolution of the diurnal life style in primates that required a higher UV tolerance. The increased segmental duplications in hominoids as well as its fast evolution suggest the acquisition of further specific functions particularly in humans.

  6. An ace-1 gene duplication resorbs the fitness cost associated with resistance in Anopheles gambiae, the main malaria mosquito.

    Science.gov (United States)

    Assogba, Benoît S; Djogbénou, Luc S; Milesi, Pascal; Berthomieu, Arnaud; Perez, Julie; Ayala, Diego; Chandre, Fabrice; Makoutodé, Michel; Labbé, Pierrick; Weill, Mylène

    2015-10-05

    Widespread resistance to pyrethroids threatens malaria control in Africa. Consequently, several countries switched to carbamates and organophophates insecticides for indoor residual spraying. However, a mutation in the ace-1 gene conferring resistance to these compounds (ace-1(R) allele), is already present. Furthermore, a duplicated allele (ace-1(D)) recently appeared; characterizing its selective advantage is mandatory to evaluate the threat. Our data revealed that a unique duplication event, pairing a susceptible and a resistant copy of the ace-1 gene spread through West Africa. Further investigations revealed that, while ace-1(D) confers less resistance than ace-1(R), the high fitness cost associated with ace-1(R) is almost completely suppressed by the duplication for all traits studied. ace-1 duplication thus represents a permanent heterozygote phenotype, selected, and thus spreading, due to the mosaic nature of mosquito control. It provides malaria mosquito with a new evolutionary path that could hamper resistance management.

  7. Positive selection and ancient duplications in the evolution of class B floral homeotic genes of orchids and grasses

    Directory of Open Access Journals (Sweden)

    Koch Marcus A

    2009-04-01

    Full Text Available Abstract Background Positive selection is recognized as the prevalence of nonsynonymous over synonymous substitutions in a gene. Models of the functional evolution of duplicated genes consider neofunctionalization as key to the retention of paralogues. For instance, duplicate transcription factors are specifically retained in plant and animal genomes and both positive selection and transcriptional divergence appear to have played a role in their diversification. However, the relative impact of these two factors has not been systematically evaluated. Class B MADS-box genes, comprising DEF-like and GLO-like genes, encode developmental transcription factors essential for establishment of perianth and male organ identity in the flowers of angiosperms. Here, we contrast the role of positive selection and the known divergence in expression patterns of genes encoding class B-like MADS-box transcription factors from monocots, with emphasis on the family Orchidaceae and the order Poales. Although in the monocots these two groups are highly diverse and have a strongly canalized floral morphology, there is no information on the role of positive selection in the evolution of their distinctive flower morphologies. Published research shows that in Poales, class B-like genes are expressed in stamens and in lodicules, the perianth organs whose identity might also be specified by class B-like genes, like the identity of the inner tepals of their lily-like relatives. In orchids, however, the number and pattern of expression of class B-like genes have greatly diverged. Results The DEF-like genes from Orchidaceae form four well-supported, ancient clades of orthologues. In contrast, orchid GLO-like genes form a single clade of ancient orthologues and recent paralogues. DEF-like genes from orchid clade 2 (OMADS3-like genes are under less stringent purifying selection than the other orchid DEF-like and GLO-like genes. In comparison with orchids, purifying selection

  8. Measurement of the CP-violation parameter Re(var-epsilon '/var-epsilon)

    International Nuclear Information System (INIS)

    Gibbons, L.K.; Barker, A.R.; Briere, R.A.; Makoff, G.; Papadimitriou, V.; Patterson, J.R.; Schwingenheuer, B.; Somalwar, S.V.; Wah, Y.W.; Winstein, B.; Winston, R.; Woods, M.; Yamamoto, H.; Swallow, E.C.; Bock, G.J.; Coleman, R.; Enagonio, J.; Hsiung, Y.B.; Ramberg, E.; Stanfield, K.; Tschirhart, R.; Yamanaka, T.; Gollin, G.D.; Karlsson, M.; Okamitsu, J.K.; Debu, P.; Peyaud, B.; Turlay, R.; Vallage, B.

    1993-01-01

    A measurement of the CP-violation parameter Re(var-epsilon '/var-epsilon) has been made using the full E731 data set. We find Re(var-epsilon '/var-epsilon)=(7.4±5.2±2.9)x10 -4 where the first error is statistical and the second systematic

  9. Two Rounds of Whole Genome Duplication in the AncestralVertebrate

    Energy Technology Data Exchange (ETDEWEB)

    Dehal, Paramvir; Boore, Jeffrey L.

    2005-04-12

    The hypothesis that the relatively large and complex vertebrate genome was created by two ancient, whole genome duplications has been hotly debated, but remains unresolved. We reconstructed the evolutionary relationships of all gene families from the complete gene sets of a tunicate, fish, mouse, and human, then determined when each gene duplicated relative to the evolutionary tree of the organisms. We confirmed the results of earlier studies that there remains little signal of these events in numbers of duplicated genes, gene tree topology, or the number of genes per multigene family. However, when we plotted the genomic map positions of only the subset of paralogous genes that were duplicated prior to the fish-tetrapod split, their global physical organization provides unmistakable evidence of two distinct genome duplication events early in vertebrate evolution indicated by clear patterns of 4-way paralogous regions covering a large part of the human genome. Our results highlight the potential for these large-scale genomic events to have driven the evolutionary success of the vertebrate lineage.

  10. Genetic variability of human respiratory syncytial virus A strains circulating in Ontario: a novel genotype with a 72 nucleotide G gene duplication.

    Directory of Open Access Journals (Sweden)

    Alireza Eshaghi

    Full Text Available Human respiratory syncytial virus (HRSV is the main cause of acute lower respiratory infections in children under 2 years of age and causes repeated infections throughout life. We investigated the genetic variability of RSV-A circulating in Ontario during 2010-2011 winter season by sequencing and phylogenetic analysis of the G glycoprotein gene.Among the 201 consecutive RSV isolates studied, RSV-A (55.7% was more commonly observed than RSV-B (42.3%. 59.8% and 90.1% of RSV-A infections were among children ≤12 months and ≤5 years old, respectively. On phylogenetic analysis of the second hypervariable region of the 112 RSV-A strains, 110 (98.2% clustered within or adjacent to the NA1 genotype; two isolates were GA5 genotype. Eleven (10% NA1-related isolates clustered together phylogenetically as a novel RSV-A genotype, named ON1, containing a 72 nucleotide duplication in the C-terminal region of the attachment (G glycoprotein. The predicted polypeptide is lengthened by 24 amino acids and includes a23 amino acid duplication. Using RNA secondary structural software, a possible mechanism of duplication occurrence was derived. The 23 amino acid ON1 G gene duplication results in a repeat of 7 potential O-glycosylation sites including three O-linked sugar acceptors at residues 270, 275, and 283. Using Phylogenetic Analysis by Maximum Likelihood analysis, a total of 19 positively selected sites were observed among Ontario NA1 isolates; six were found to be codons which reverted to the previous state observed in the prototype RSV-A2 strain. The tendency of codon regression in the G-ectodomain may infer a decreased avidity of antibody to the current circulating strains. Further work is needed to document and further understand the emergence, virulence, pathogenicity and transmissibility of this novel RSV-A genotype with a72 nucleotide G gene duplication.

  11. DB2: a probabilistic approach for accurate detection of tandem duplication breakpoints using paired-end reads.

    Science.gov (United States)

    Yavaş, Gökhan; Koyutürk, Mehmet; Gould, Meetha P; McMahon, Sarah; LaFramboise, Thomas

    2014-03-05

    With the advent of paired-end high throughput sequencing, it is now possible to identify various types of structural variation on a genome-wide scale. Although many methods have been proposed for structural variation detection, most do not provide precise boundaries for identified variants. In this paper, we propose a new method, Distribution Based detection of Duplication Boundaries (DB2), for accurate detection of tandem duplication breakpoints, an important class of structural variation, with high precision and recall. Our computational experiments on simulated data show that DB2 outperforms state-of-the-art methods in terms of finding breakpoints of tandem duplications, with a higher positive predictive value (precision) in calling the duplications' presence. In particular, DB2's prediction of tandem duplications is correct 99% of the time even for very noisy data, while narrowing down the space of possible breakpoints within a margin of 15 to 20 bps on the average. Most of the existing methods provide boundaries in ranges that extend to hundreds of bases with lower precision values. Our method is also highly robust to varying properties of the sequencing library and to the sizes of the tandem duplications, as shown by its stable precision, recall and mean boundary mismatch performance. We demonstrate our method's efficacy using both simulated paired-end reads, and those generated from a melanoma sample and two ovarian cancer samples. Newly discovered tandem duplications are validated using PCR and Sanger sequencing. Our method, DB2, uses discordantly aligned reads, taking into account the distribution of fragment length to predict tandem duplications along with their breakpoints on a donor genome. The proposed method fine tunes the breakpoint calls by applying a novel probabilistic framework that incorporates the empirical fragment length distribution to score each feasible breakpoint. DB2 is implemented in Java programming language and is freely available

  12. Recessive VARS2 mutation underlies a novel syndrome with epilepsy, mental retardation, short stature, growth hormone deficiency, and hypogonadism

    KAUST Repository

    Alsemari, Abdulaziz

    2017-11-14

    Most mitochondrial and cytoplasmic aminoacyl-tRNA synthetases (aaRSs) are encoded by nuclear genes. Syndromic disorders resulting from mutation of aaRSs genes display significant phenotypic heterogeneity. We expand aaRSs-related phenotypes through characterization of the clinical and molecular basis of a novel autosomal-recessive syndrome manifesting severe mental retardation, ataxia, speech impairment, epilepsy, short stature, microcephaly, hypogonadism, and growth hormone deficiency.A G>A variant in exon 29 of VARS2 (c.3650G>A) (NM_006295) was identified in the index case. This homozygous variant was confirmed by Sanger sequencing and segregated with disease in the family studied. The c.3650G>A change results in alteration of arginine to histidine at residue 1217 (R1217H) of the mature protein and is predicted to be pathogenic.These findings contribute to a growing list of aaRSs disorders, broadens the spectrum of phenotypes attributable to VARS2 mutations, and provides new insight into genotype-phenotype correlations among the mitochondrial synthetase genes.

  13. Recessive VARS2 mutation underlies a novel syndrome with epilepsy, mental retardation, short stature, growth hormone deficiency, and hypogonadism

    KAUST Repository

    Alsemari, Abdulaziz; Al-Younes, Banan; Goljan, Ewa; Jaroudi, Dyala; BinHumaid, Faisal; Meyer, Brian F.; Arold, Stefan T.; Monies, Dorota

    2017-01-01

    Most mitochondrial and cytoplasmic aminoacyl-tRNA synthetases (aaRSs) are encoded by nuclear genes. Syndromic disorders resulting from mutation of aaRSs genes display significant phenotypic heterogeneity. We expand aaRSs-related phenotypes through characterization of the clinical and molecular basis of a novel autosomal-recessive syndrome manifesting severe mental retardation, ataxia, speech impairment, epilepsy, short stature, microcephaly, hypogonadism, and growth hormone deficiency.A G>A variant in exon 29 of VARS2 (c.3650G>A) (NM_006295) was identified in the index case. This homozygous variant was confirmed by Sanger sequencing and segregated with disease in the family studied. The c.3650G>A change results in alteration of arginine to histidine at residue 1217 (R1217H) of the mature protein and is predicted to be pathogenic.These findings contribute to a growing list of aaRSs disorders, broadens the spectrum of phenotypes attributable to VARS2 mutations, and provides new insight into genotype-phenotype correlations among the mitochondrial synthetase genes.

  14. Identification of a rare 17p13.3 duplication including the BHLHA9 and YWHAE genes in a family with developmental delay and behavioural problems

    Directory of Open Access Journals (Sweden)

    Capra Valeria

    2012-10-01

    Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.

  15. Molecular Evolution and Genetic Variation of G2-Like Transcription Factor Genes in Maize.

    Directory of Open Access Journals (Sweden)

    Fang Liu

    Full Text Available The productivity of maize (Zea mays L. depends on the development of chloroplasts, and G2-like transcription factors play a central role in regulating chloroplast development. In this study, we identified 59 G2-like genes in the B73 maize genome and systematically analyzed these genes at the molecular and evolutionary levels. Based on gene structure character, motif compositions and phylogenetic analysis, maize G2-like genes (ZmG1- ZmG59 were divided into seven groups (I-VII. By synteny analysis, 18 collinear gene pairs and strongly conserved microsyntny among regions hosting G2-like genes across maize and sorghum were found. Here, we showed that the vast majority of ZmG gene duplications resulted from whole genome duplication events rather than tandem duplications. After gene duplication events, some ZmG genes were silenced. The functions of G2-like genes were multifarious and most genes that are expressed in green tissues may relate to maize photosynthesis. The qRT-PCR showed that the expression of these genes was sensitive to low temperature and drought. Furthermore, we analyzed differences of ZmGs specific to cultivars in temperate and tropical regions at the population level. Interestingly, the single nucleotide polymorphism (SNP analysis revealed that nucleotide polymorphism associated with different temperature zones. Above all, G2-like genes were highly conserved during evolution, but polymorphism could be caused due to a different geographical location. Moreover, G2-like genes might be related to cold and drought stresses.

  16. Deletion/duplication mutation screening of TP53 gene in patients with transitional cell carcinoma of urinary bladder using multiplex ligation-dependent probe amplification.

    Science.gov (United States)

    Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba

    2016-02-01

    Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  17. Genetic analisys of a cross of gaillon (Brassica oleracea var. alboglabra with cauliflower (B.oleracea var. botrytis

    Directory of Open Access Journals (Sweden)

    Vanessa B.M.G. Spini

    2000-03-01

    Full Text Available The cauliflower (Brassica oleracea var. botrytis is an annual vegetable cultivated in Southern and Southwestern Brazil with limited production in the Northeast and Centralwest. A variety of Chinese kale, "kaai laan" or "gaillon" (Brassica oleracea var. alboglabra, produces seeds at high temperatures and therefore can do so in North and Northeastern Brazil. Gaillon and cauliflower were crossed 55 times using 10 gaillon plants as mothers and 4 cauliflower plants as pollen donors. From these crosses, in the F2 generation, 612 plants with inflorescence like gaillon and 48 plants with inflorescence like cauliflower were obtained, in a proportion similar to 15:1, implying that 2 pairs of genes entered into formation of the cauliflower inflorescence type. In order to study flower color, 339 plants were analyzed: 274 presented white flowers and 65, yellow flowers, denoting that this caracter is determined by 1 pair of genes, white being dominant over yellow; white flowers had a slighly higher adaptive value in our population. The characteristic waxy leaf showed a proportion of 3 waxy plants for 1 not waxy, indicating the action of one pair of genes.A couve-flor (Brassica oleracea var. botrytis é um vegetal anual e tem seu cultivo no Brasil limitado às regiões Sul e Sudeste, com pequena produção no Nordeste e Centro-Oeste. Uma variedade de couve da China, "kaai laan" ou "gaillon" (Brassica oleracea var. alboglabra, produz sementes em altas temperaturas e, portanto, é apta a produzir sementes no Norte e Nordeste do Brasil. Gaillon e couve-flor foram cruzados. Foram feitos 55 cruzamentos usando 10 plantas de gaillon como mãe e 4 plantas de couve-flor como doadores de pólen. Desses cruzamentos, na geração F2, 612 plantas com inflorescência tipo gaillon e 48 plantas com inflorescência tipo couve-flor foram obtidas, em proporção similar a 15:1, demonstrando que 2 pares de genes estão envolvidos na formação da inflorescência em couve

  18. Duplication at Xq28 involving IKBKG is associated with progressive macrocephaly, recurrent infections, ectodermal dysplasia, benign tumors, and neuropathy

    NARCIS (Netherlands)

    Asbeck, E. Van; Ramalingam, A.; Dvorak, C.; Chen, T.J.; Morava, E.

    2014-01-01

    Duplications on Xq28 are common, although quite variable in size, but usually include the MECP2 gene. Here, we present a patient with a unique, small, 167-kb duplication at Xq28, not including MECP2. The most important gene in the duplicated region was IKBKG, mutations in which can cause a variety

  19. Complete mitochondrial genome of Xingguo red carp (Cyprinus carpio var. singuonensis) and purse red carp (Cyprinus carpio var. wuyuanensis).

    Science.gov (United States)

    Hu, Guang-Fu; Liu, Xiang-Jiang; Li, Zhong; Liang, Hong-Wei; Hu, Shao-Na; Zou, Gui-Wei

    2016-01-01

    The complete mitochondrial genomes of Xingguo red carp (Cyprinus carpio var. singuonensis) and purse red carp (Cyprinus carpio var. wuyuanensis) were sequenced. Comparison of these two mitochondrial genomes revealed that the mtDNAs of these two common carp varieties were remarkably similar in genome length, gene order and content, and AT content. However, size variation between these two mitochondrial genomes presented here showed 39 site differences in overall length. About 2 site differences were located in rRNAs, 3 in tRNAs, 3 in the control region, 31 in protein-coding genes. Thirty-one variable bases in the protein-coding regions between the two varieties mitochondrial sequences led to three variable amino acids, which were mainly located in the protein ND5 and ND4.

  20. Computer Science and Convergence : CSA 2011 & WCC 2011 Proceedings

    CERN Document Server

    Chao, Han-Chieh; Obaidat, Mohammad; Kim, Jongsung

    2012-01-01

    Computer Science and Convergence is proceedings of the 3rd FTRA International Conference on Computer Science and its Applications (CSA-11) and The 2011 FTRA World Convergence Conference (FTRA WCC 2011). The topics of CSA and WCC cover the current hot topics satisfying the world-wide ever-changing needs. CSA-11 will be the most comprehensive conference focused on the various aspects of advances in computer science and its applications and will provide an opportunity for academic and industry professionals to discuss the latest issues and progress in the area of CSA. In addition, the conference will publish high quality papers which are closely related to the various theories and practical applications in CSA. Furthermore, we expect that the conference and its publications will be a trigger for further related research and technology improvements in this important subject. The main scope of CSA-11 is as follows: -      Mobile and ubiquitous computing -      Dependable, reliable and autonomic computi...

  1. Inventing an arsenal: adaptive evolution and neofunctionalization of snake venom phospholipase A2 genes

    Directory of Open Access Journals (Sweden)

    Lynch Vincent J

    2007-01-01

    Full Text Available Abstract Background Gene duplication followed by functional divergence has long been hypothesized to be the main source of molecular novelty. Convincing examples of neofunctionalization, however, remain rare. Snake venom phospholipase A2 genes are members of large multigene families with many diverse functions, thus they are excellent models to study the emergence of novel functions after gene duplications. Results Here, I show that positive Darwinian selection and neofunctionalization is common in snake venom phospholipase A2 genes. The pattern of gene duplication and positive selection indicates that adaptive molecular evolution occurs immediately after duplication events as novel functions emerge and continues as gene families diversify and are refined. Surprisingly, adaptive evolution of group-I phospholipases in elapids is also associated with speciation events, suggesting adaptation of the phospholipase arsenal to novel prey species after niche shifts. Mapping the location of sites under positive selection onto the crystal structure of phospholipase A2 identified regions evolving under diversifying selection are located on the molecular surface and are likely protein-protein interactions sites essential for toxin functions. Conclusion These data show that increases in genomic complexity (through gene duplications can lead to phenotypic complexity (venom composition and that positive Darwinian selection is a common evolutionary force in snake venoms. Finally, regions identified under selection on the surface of phospholipase A2 enzymes are potential candidate sites for structure based antivenin design.

  2. CSA/AZA, in the absence of prednisone, improves linear growth in renal transplanted children.

    Science.gov (United States)

    David-Neto, E; Nahas, W; Sampaio, E C; Ianhez, L E; Sabbaga, E; Arap, S

    1992-01-01

    We compared the results of 44 renal transplants in children, of whom 24 were treated with CSA/AZA and 20 with prednisone in combination with AZA and/or CSA. There were no differences in age distribution or mean ages at transplant between the two treatment groups. The CSA/AZA group had a longer follow-up (29 +/- 33 vs 17 +/- 18 months). At the last follow-up, five children in the CSA/AZA and none in the prednisone group had lost their grafts. Serum creatinine increased in both groups from 0.7 +/- 0.1 mg/dl and 0.9 +/- 0.1 mg/dl at the end of the first month to 1.1 +/- 0.2 mg/dl in the 36th month (CSA/AZA group) (P renal transplant in children, but only 75% tolerated AZA/CSA without same damage to their grafts.

  3. Mirror-image duplication of the primary axis and heart in Xenopus embryos by the overexpression of Msx-1 gene.

    Science.gov (United States)

    Chen, Y; Solursh, M

    1995-10-01

    The Msx-1 gene (formerly known as Hox-7) is a member of a discrete subclass of homeobox-containing genes. Examination of the expression pattern of Msx-1 in murine and avian embryos suggests that this gene may be involved in the regionalization of the medio-lateral axis during earlier development. We have examined the possible functions of Xenopus Msx-1 during early Xenopus embryonic development by overexpression of the Msx-1 gene. Overexpression of Msx-1 causes a left-right mirror-image duplication of primary axial structures, including notochord, neural tube, somites, suckers, and foregut. The embryonic developing heart is also mirror-image duplicated, including looping directions and polarity. These results indicate that Msx-1 may be involved in the mesoderm formation as well as left-right patterning in the early Xenopus embryonic development.

  4. Hypertension and Biliary Ductopenia in a Patient with Duplication of Exon 6 of the Gene

    Directory of Open Access Journals (Sweden)

    J. Uberos

    2012-01-01

    Full Text Available We describe a neonatal patient with biliary ductopenia featuring duplication of exon 6 of the JAG1 gene. Facial alterations were observed, consisting of a prominent forehead, sunken eyes, upward slanting palpebral fissures, hypertelorism, flat nasal root and prominent chin. From birth, these were accompanied by the development of haematuria and renal failure and by renal Doppler findings indicative of peripheral renal artery stenosis. JAG1 gene mutations on chromosome 20 have been associated with various anomalies, including biliary cholestasis, vertebral abnormalities, eye disorders, heart defects and facial dysmorphia. This syndrome, first described by Alagille, is an infrequent congenital disorder caused by a dominant autosomal inheritance with variable expressivity. Anatomopathological effects include the destruction and disappearance of hepatic bile ducts (ductopenia. The duplication of exon 6 of JAG1 has not previously been described as an alteration related to the Alagille syndrome with peripheral renal artery stenosis.

  5. Are duplicated genes responsible for anthracnose resistance in common bean?

    Science.gov (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  6. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia) gene family: tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes.

    Science.gov (United States)

    Harduin-Lepers, Anne; Petit, Daniel; Mollicone, Rosella; Delannoy, Philippe; Petit, Jean-Michel; Oriol, Rafael

    2008-09-23

    initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD) R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.

  7. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia gene family: Tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes

    Directory of Open Access Journals (Sweden)

    Petit Jean-Michel

    2008-09-01

    activities, in both invertebrates and vertebrates. The initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.

  8. A survey of innovation through duplication in the reduced genomes of twelve parasites.

    Directory of Open Access Journals (Sweden)

    Jeremy D DeBarry

    Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that

  9. Obtaining of transgenic papaya plants var. Maradol roja that carry out the rice oryzacystatin gene

    Directory of Open Access Journals (Sweden)

    Milady F. Mendoza

    2004-10-01

    Full Text Available Papaya (Carica papaya L., is severely affected by Papaya Ringspot virus, which belongs to plant potyvirus group. A recent strategy for pest control produced by this virus is the transformation with genes encoding cysteine proteinase inhibitors. Rice oryzacistatin gene encoding for cystatins, was inserted in a pCAMBIA binary vector, for genetic transformation of papaya somatic embryos var. Maradol roja, mediated by gene gun. Gene integration was confirmed by means of polimerase chain reaction using the primers designed from gene bar sequence. Forty out of eighty in vitro transgenic papaya lines amplified a 402 fragment which correspond to the expecting size. Key words: Carica papaya, genetic engineering, potyvirus, proteinase inhibitor

  10. A Rare de novo Interstitial Duplication at 4p15.2 in a Boy with Severe Congenital Heart Defects, Limb Anomalies, Hypogonadism, and Global Developmental Delay.

    Science.gov (United States)

    Liang, Liyang; Xie, Yingjun; Shen, Yiping; Yin, Qibin; Yuan, Haiming

    2016-01-01

    Proximal 4p deletion syndrome is a relatively rare genetic condition characterized by dysmorphic facial features, limb anomalies, minor congenital heart defects, hypogonadism, cafe-au-lait spots, developmental delay, tall and thin habitus, and intellectual disability. At present, over 20 cases of this syndrome have been published. However, duplication of the same region in proximal 4p has never been reported. Here, we describe a 2-year-5-month-old boy with severe congenital heart defects, limb anomalies, hypogonadism, distinctive facial features, pre- and postnatal developmental delay, and mild cognitive impairments. A de novo 4.5-Mb interstitial duplication at 4p15.2p15.1 was detected by chromosomal microarray analysis. Next-generation sequencing was employed and confirmed the duplication, but revealed no additional pathogenic variants. Several candidate genes in this interval responsible for the complex clinical phenotype were identified, such as RBPJ, STIM2, CCKAR, and LGI2. The results suggest a novel contiguous gene duplication syndrome. © 2016 S. Karger AG, Basel.

  11. Horizontal transfer, not duplication, drives the expansion of protein families in prokaryotes.

    Directory of Open Access Journals (Sweden)

    Todd J Treangen

    2011-01-01

    Full Text Available Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus, average-sized genomes (Bacillus, Enterobacteriaceae, and large genomes (Pseudomonas, Bradyrhizobiaceae to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes--xenologs--persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes--paralogs--are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein-protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families.

  12. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template.

    Science.gov (United States)

    Gouran, Hossein; Chakraborty, Sandeep; Rao, Basuthkar J; Asgeirsson, Bjarni; Dandekar, Abhaya

    2014-01-01

    Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC), implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF). In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

  13. Expression Pattern Similarities Support the Prediction of Orthologs Retaining Common Functions after Gene Duplication Events1[OPEN

    Science.gov (United States)

    Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.

    2016-01-01

    The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025

  14. Conservation of the abscission signaling peptide IDA during Angiosperm evolution: withstanding genome duplications and gain and loss of the receptors HAE/HSL2

    Directory of Open Access Journals (Sweden)

    Ida M. Stø

    2015-10-01

    Full Text Available The peptide INFLORESCENCE DEFICIENT IN ABSCISSION (IDA, which signals through the leucine-rich repeat receptor-like kinases HAESA (HAE and HAESA-LIKE2 (HSL2, controls different cell separation events in Arabidopsis thaliana. We hypothesize the involvement of this signaling module in abscission processes in other plant species even though they may shed other organs than A. thaliana. As the first step towards testing this hypothesis from an evolutionarily perspective we have identified genes encoding putative orthologues of IDA and its receptors by BLAST searches of publically available protein, nucleotide and genome databases for angiosperms. Genes encoding IDA or IDA-LIKE (IDL peptides and HSL proteins were found in all investigated species, which were selected as to represent each angiosperm order with available genomic sequences. The 12 amino acids representing the bioactive peptide in A. thaliana have virtually been unchanged throughout the evolution of the angiosperms; however, the number of IDL and HSL genes varies between different orders and species. The phylogenetic analyses suggest that IDA, HSL2 and the related HSL1 gene, were present in the species that gave rise to the angiosperms. HAE has arisen from HSL1 after a genome duplication that took place after the monocot - eudicots split. HSL1 has also independently been duplicated in the monocots, while HSL2 has been lost in gingers (Zingiberales and grasses (Poales. IDA has been duplicated in eudicots to give rise to functionally divergent IDL peptides. We postulate that the high number of IDL homologs present in the core eudicots is a result of multiple whole genome duplications. We substantiate the involvement of IDA and HAE/HSL2 homologs in abscission by providing gene expression data of different organ separation events from various species.

  15. Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Mara Sangiovanni

    2013-12-01

    Full Text Available Arabidopsis thaliana became the model organism for plant studies because of its small diploid genome, rapid lifecycle and short adult size. Its genome was the first among plants to be sequenced, becoming the reference in plant genomics. However, the Arabidopsis genome is characterized by an inherently complex organization, since it has undergone ancient whole genome duplications, followed by gene reduction, diploidization events and extended rearrangements, which relocated and split up the retained portions. These events, together with probable chromosome reductions, dramatically increased the genome complexity, limiting its role as a reference. The identification of paralogs and single copy genes within a highly duplicated genome is a prerequisite to understand its organization and evolution and to improve its exploitation in comparative genomics. This is still controversial, even in the widely studied Arabidopsis genome. This is also due to the lack of a reference bioinformatics pipeline that could exhaustively identify paralogs and singleton genes. We describe here a complete computational strategy to detect both duplicated and single copy genes in a genome, discussing all the methodological issues that may strongly affect the results, their quality and their reliability. This approach was used to analyze the organization of Arabidopsis nuclear protein coding genes, and besides classifying computationally defined paralogs into networks and single copy genes into different classes, it unraveled further intriguing aspects concerning the genome annotation and the gene relationships in this reference plant species. Since our results may be useful for comparative genomics and genome functional analyses, we organized a dedicated web interface to make them accessible to the scientific community.

  16. Targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae.

    Science.gov (United States)

    Takahashi, Tadashi; Sato, Atsushi; Ogawa, Masahiro; Hanya, Yoshiki; Oguma, Tetsuya

    2014-08-01

    We describe here the first successful construction of a targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae. The targeted tandem chromosomal duplication was achieved by using strains that had a 5'-deleted pyrG upstream of the region targeted for tandem chromosomal duplication and a 3'-deleted pyrG downstream of the target region. Consequently,strains bearing a 210-kb targeted tandem chromosomal duplication near the centromeric region of chromosome 8 and strains bearing a targeted tandem chromosomal duplication of a 700-kb region of chromosome 2 were successfully constructed. The strains bearing the tandem chromosomal duplication were efficiently obtained from the regenerated protoplast of the parental strains. However, the generation of the chromosomal duplication did not depend on the introduction of double-stranded breaks(DSBs) by I-SceI. The chromosomal duplications of these strains were stably maintained after five generations of culture under nonselective conditions. The strains bearing the tandem chromosomal duplication in the 700-kb region of chromosome 2 showed highly increased protease activity in solid-state culture, indicating that the duplication of large chromosomal segments could be a useful new breeding technology and gene analysis method.

  17. Crh and Oprm1 mediate anxiety-related behavior and social approach in a mouse model of MECP2 duplication syndrome.

    Science.gov (United States)

    Samaco, Rodney C; Mandel-Brehm, Caleigh; McGraw, Christopher M; Shaw, Chad A; McGill, Bryan E; Zoghbi, Huda Y

    2012-01-08

    Genomic duplications spanning Xq28 are associated with a spectrum of phenotypes, including anxiety and autism. The minimal region shared among affected individuals includes MECP2 and IRAK1, although it is unclear which gene when overexpressed causes anxiety and social behavior deficits. We report that doubling MECP2 levels causes heightened anxiety and autism-like features in mice and alters the expression of genes that influence anxiety and social behavior, such as Crh and Oprm1. To test the hypothesis that alterations in these two genes contribute to heightened anxiety and social behavior deficits, we analyzed MECP2 duplication mice (MECP2-TG1) that have reduced Crh and Oprm1 expression. In MECP2-TG1 animals, reducing the levels of Crh or its receptor, Crhr1, suppressed anxiety-like behavior; in contrast, reducing Oprm1 expression improved abnormal social behavior. These data indicate that increased MeCP2 levels affect molecular pathways underlying anxiety and social behavior and provide new insight into potential therapies for MECP2-related disorders.

  18. Towards a vaccine against pregnancy-associated malaria

    Directory of Open Access Journals (Sweden)

    Tuikue Ndam N.

    2008-09-01

    Full Text Available The consequences of pregnancy-associated malaria on pregnant women (anaemia, their babies (birth weight reduction, and infants (increased morbidity and mortality are well documented. Field observations during the last decade have underlined the key role of the interactions between P. falciparum variable surface antigens expressed on infected erythrocytes and a novel receptor: chondroitin sulfate A (CSA for the placental sequestration of infected erythrocytes. Identification of a distinct P. falciparum erythrocyte membrane protein 1 (PfEMP1 variant, VAR2CSA, as the dominant variant surface antigen and as a clinically important target for protective immune response to pregnancy-associated malaria has raised hope for developing a new preventive strategy based on inducing these immune responses by vaccination. However, despite particular structure and interclonal conservation of VAR2CSA among other PfEMP1, significant challenges still exist concerning the development of a VAR2CSA-based vaccine with profound efficacy.

  19. arXiv Observation of the $\\varXi^{-}_{b}\\to J/\\psi\\varLambda K^{-}$ decay

    CERN Document Server

    Aaij, Roel; Adinolfi, Marco; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Archilli, Flavio; d'Argent, Philippe; Arnau Romeu, Joan; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Babuschkin, Igor; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baker, Sophie; Balagura, Vladislav; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Baryshnikov, Fedor; Baszczyk, Mateusz; Batozskaya, Varvara; Batsukh, Baasansuren; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Bel, Lennaert; Bellee, Violaine; Belloli, Nicoletta; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Berezhnoy, Alexander; Bernet, Roland; Bertolin, Alessandro; Betancourt, Christopher; Betti, Federico; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bezshyiko, Iaroslava; Bifani, Simone; Billoir, Pierre; Bird, Thomas; Birnkraut, Alex; Bitadze, Alexander; Bizzeti, Andrea; Blake, Thomas; Blanc, Frederic; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Boettcher, Thomas; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Bordyuzhin, Igor; Borgheresi, Alessio; Borghi, Silvia; Borisyak, Maxim; Borsato, Martino; Bossu, Francesco; Boubdir, Meriem; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Buchanan, Emma; Burr, Christopher; Bursche, Albert; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Camboni, Alessandro; Campana, Pierluigi; Campora Perez, Daniel Hugo; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cavallero, Giovanni; Cenci, Riccardo; Chamont, David; Charles, Matthew; Charpentier, Philippe; Chatzikonstantinidis, Georgios; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chobanova, Veronika; Chrzaszcz, Marcin; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collazuol, Gianmaria; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombs, George; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Costa Sobral, Cayo Mar; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Da Cunha Marinho, Franciole; Dall'Occo, Elena; Dalseno, Jeremy; David, Pieter; Davis, Adam; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Serio, Marilisa; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Demmer, Moritz; Dendek, Adam; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Dijkstra, Hans; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Dungs, Kevin; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Déléage, Nicolas; Easo, Sajan; Ebert, Marcus; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Farley, Nathanael; Farry, Stephen; Fay, Robert; Fazzini, Davide; Ferguson, Dianne; Fernandez Prieto, Antonio; Ferrari, Fabio; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fini, Rosa Anna; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fleuret, Frederic; Fohl, Klaus; Fontana, Marianna; Fontanelli, Flavio; Forshaw, Dean Charles; Forty, Roger; Franco Lima, Vinicius; Frank, Markus; Frei, Christoph; Fu, Jinlin; Funk, Wolfgang; Furfaro, Emiliano; Färber, Christian; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; Garcia Martin, Luis Miguel; García Pardiñas, Julián; Garra Tico, Jordi; Garrido, Lluis; Garsed, Philip John; Gascon, David; Gaspar, Clara; Gavardi, Laura; Gazzoni, Giulio; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gizdov, Konstantin; Gligorov, Vladimir; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gorelov, Igor Vladimirovich; Gotti, Claudio; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Griffith, Peter; Grillo, Lucia; Gruberg Cazon, Barak Raimond; Grünberg, Oliver; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Göbel, Carla; Hadavizadeh, Thomas; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hamilton, Brian; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Jonathan; Hatch, Mark; He, Jibo; Head, Timothy; Heister, Arno; Hennessy, Karol; Henrard, Pierre; Henry, Louis; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hombach, Christoph; Hopchev, P H; Hulsbergen, Wouter; Humair, Thibaud; Hushchyn, Mikhail; Hutchcroft, David; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; Jiang, Feng; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Karacson, Matthias; Kariuki, James Mwangi; Karodia, Sarah; Kecke, Matthieu; Kelsey, Matthew; Kenzie, Matthew; Ketel, Tjeerd; Khairullin, Egor; Khanji, Basem; Khurewathanakul, Chitsanu; Kirn, Thomas; Klaver, Suzanne; Klimaszewski, Konrad; Koliiev, Serhii; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Kosmyntseva, Alena; Kozachuk, Anastasiia; Kozeiha, Mohamad; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krokovny, Pavel; Kruse, Florian; Krzemien, Wojciech; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kuonen, Axel Kevin; Kurek, Krzysztof; Kvaratskheliya, Tengiz; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lanfranchi, Gaia; Langenbruch, Christoph; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Leflat, Alexander; Lefrançois, Jacques; Lefèvre, Regis; Lemaitre, Florian; Lemos Cid, Edgar; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Tenglin; Li, Yiming; Likhomanenko, Tatiana; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Xuesong; Loh, David; Longstaff, Iain; Lopes, Jose; Lucchesi, Donatella; Lucio Martinez, Miriam; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Lusiani, Alberto; Lyu, Xiao-Rui; Machefert, Frederic; Maciuc, Florin; Maev, Oleg; Maguire, Kevin; Malde, Sneha; Malinin, Alexander; Maltsev, Timofei; Manca, Giulia; Mancinelli, Giampiero; Manning, Peter Michael; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marinangeli, Matthieu; Marino, Pietro; Marks, Jörg; Martellotti, Giuseppe; Martin, Morgan; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massacrier, Laure Marie; Massafferri, André; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Mauri, Andrea; Maurice, Emilie; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McNab, Andrew; McNulty, Ronan; Meadows, Brian; Meier, Frank; Meissner, Marco; Melnychuk, Dmytro; Merk, Marcel; Merli, Andrea; Michielin, Emanuele; Milanes, Diego Alejandro; Minard, Marie-Noelle; Mitzel, Dominik Stefan; Mogini, Andrea; Molina Rodriguez, Josue; Monroy, Ignacio Alberto; Monteil, Stephane; Morandin, Mauro; Morawski, Piotr; Mordà, Alessandro; Morello, Michael Joseph; Morgunova, Olga; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Mulder, Mick; Mussini, Manuel; Müller, Dominik; Müller, Janine; Müller, Katharina; Müller, Vanessa; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nandi, Anita; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Thi Dung; Nguyen-Mau, Chung; Nieswand, Simon; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Nogay, Alla; Novoselov, Alexey; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Oldeman, Rudolf; Onderwater, Gerco; Otalora Goicochea, Juan Martin; Otto, Adam; Owen, Patrick; Oyanguren, Maria Aranzazu; Pais, Preema Rennee; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parker, William; Parkes, Christopher; Passaleva, Giovanni; Pastore, Alessandra; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petrov, Aleksandr; Petruzzo, Marco; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pikies, Malgorzata; Pinci, Davide; Pistone, Alessandro; Piucci, Alessio; Placinta, Vlad-Mihai; Playfer, Stephen; Plo Casasus, Maximo; Poikela, Tuomas; Polci, Francesco; Poluektov, Anton; Polyakov, Ivan; Polycarpo, Erica; Pomery, Gabriela Johanna; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Poslavskii, Stanislav; Potterat, Cédric; Price, Eugenia; Price, Joseph David; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Quagliani, Renato; Rachwal, Bartolomiej; Rademacker, Jonas; Rama, Matteo; Ramos Pernas, Miguel; Rangel, Murilo; Raniuk, Iurii; Ratnikov, Fedor; Raven, Gerhard; Redi, Federico; Reichert, Stefanie; dos Reis, Alberto; Remon Alepuz, Clara; Renaudin, Victor; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vicente; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Rodriguez Perez, Pablo; Rogozhnikov, Alexey; Roiser, Stefan; Rollings, Alexandra Paige; Romanovskiy, Vladimir; Romero Vidal, Antonio; Ronayne, John William; Rotondo, Marcello; Rudolph, Matthew Scott; Ruf, Thomas; Ruiz Valls, Pablo; Saborido Silva, Juan Jose; Sadykhov, Elnur; Sagidova, Naylya; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrina, Darya; Schael, Stefan; Schellenberg, Margarete; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schubert, Konstantin; Schubiger, Maxime; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sergi, Antonino; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Siddi, Benedetto Gianluca; Silva Coutinho, Rafael; Silva de Oliveira, Luiz Gustavo; Simi, Gabriele; Simone, Saverio; Sirendi, Marek; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Eluned; Smith, Iwan Thomas; Smith, Jackson; Smith, Mark; Snoek, Hella; Soares Lavra, Lais; Sokoloff, Michael; Soler, Paul; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Stefko, Pavol; Stefkova, Slavorima; Steinkamp, Olaf; Stemmle, Simon; Stenyakin, Oleg; Stevens, Holger; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Syropoulos, Vasileios; Szczekowski, Marek; Szumlak, Tomasz; T'Jampens, Stephane; Tayduganov, Andrey; Tekampe, Tobias; Tellarini, Giulia; Teubert, Frederic; Thomas, Eric; van Tilburg, Jeroen; Tilley, Matthew James; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Topp-Joergensen, Stig; Toriello, Francis; Tournefier, Edwige; Tourneur, Stephane; Trabelsi, Karim; Traill, Murdo; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tully, Alison; Tuning, Niels; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagnoni, Vincenzo; Valassi, Andrea; Valat, Sebastien; Valenti, Giovanni; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vecchi, Stefania; van Veghel, Maarten; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Venkateswaran, Aravindhan; Vernet, Maxime; Vesterinen, Mika; Viana Barbosa, Joao Vitor; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Viemann, Harald; Vilasis-Cardona, Xavier; Vitti, Marcela; Volkov, Vladimir; Vollhardt, Achim; Voneki, Balazs; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Vázquez Sierra, Carlos; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wang, Jianchun; Ward, David; Wark, Heather Mckenzie; Watson, Nigel; Websdale, David; Weiden, Andreas; Whitehead, Mark; Wicht, Jean; Wilkinson, Guy; Wilkinson, Michael; Williams, Mark Richard James; Williams, Matthew; Williams, Mike; Williams, Timothy; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wraight, Kenneth; Wyllie, Kenneth; Xie, Yuehong; Xing, Zhou; Xu, Zhirui; Yang, Zhenwei; Yao, Yuezhe; Yin, Hang; Yu, Jiesheng; Yuan, Xuhao; Yushchenko, Oleg; Zarebski, Kristian Alexander; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Yanxi; Zhang, Yu; Zhelezov, Alexey; Zheng, Yangheng; Zhu, Xianglei; Zhukov, Valery; Zucchelli, Stefano

    2017-09-10

    The observation of the decay $\\varXi_{b}^{-}\\to J/\\psi\\varLambda K^{-}$ is reported, using a data sample corresponding to an integrated luminosity of $3~\\mathrm{fb}^{-1}$, collected by the LHCb detector in $pp$ collisions at centre-of-mass energies of $7$ and $8~\\mathrm{TeV}$. The production rate of $\\varXi_{b}^{-}$ baryons detected in the decay $\\varXi_{b}^{-}\\to J/\\psi\\varLambda K^{-}$ is measured relative to that of $\\varLambda_{b}^{0}$ baryons using the decay $\\varLambda_{b}^{0}\\to J/\\psi \\varLambda$. Integrated over the $b$-baryon transverse momentum $p_{\\rm T}<25~\\mathrm{GeV/}c $ and rapidity $2.0 < y < 4.5$, the measured ratio is \\begin{equation*} \\frac{f_{\\varXi_{b}^{-}}}{f_{\\varLambda_{b}^{0}}}\\frac{\\mathcal{B}(\\varXi_{b}^{-}\\to J/\\psi\\varLambda K^{-})}{\\mathcal{B}(\\varLambda_{b}^{0}\\to J/\\psi \\varLambda)}=(4.19\\pm 0.29~(\\mathrm{stat})\\pm0.14~(\\mathrm{syst}))\\times 10^{-2}, \\end{equation*}where $f_{\\varXi_{b}^{-}}$ and $f_{\\varLambda_{b}^{0}}$ are the fragmentation fractions of $b\\to\\varXi_{...

  20. Molecular cloning and expression analysis of turnip (Brassica rapa var. rapa sucrose transporter gene family

    Directory of Open Access Journals (Sweden)

    Yuanyuan Liu

    2017-06-01

    Full Text Available In higher plants, sugars (mainly sucrose are produced by photosynthetically assimilated carbon in mesophyll cells of leaves and translocated to heterotrophic organs to ensure plant growth and development. Sucrose transporters, or sucrose carriers (SUCs, play an important role in the long-distance transportation of sucrose from source organs to sink organs, thereby affecting crop yield and quality. The identification, characterization, and molecular function analysis of sucrose transporter genes have been reported for monocot and dicot plants. However, no relevant study has been reported on sucrose transporter genes in Brassica rapa var. rapa, a cruciferous root crop used mainly as vegetables and fodder. We identified and cloned 12 sucrose transporter genes from turnips, named BrrSUC1.1 to BrrSUC6.2 according to the SUC gene sequences of B. rapa pekinensis. We constructed a phylogenetic tree and analyzed conserved motifs for all 12 sucrose transporter genes identified. Real-time quantitative polymerase chain reaction was conducted to understand the expression levels of SUC genes in different tissues and developmental phases of the turnip. These findings add to our understanding of the genetics and physiology of sugar transport during taproot formation in turnips.

  1. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  2. Origin of a function by tandem gene duplication limits the evolutionary capability of its sister copy.

    Science.gov (United States)

    Hasselmann, Martin; Lechner, Sarah; Schulte, Christina; Beye, Martin

    2010-07-27

    The most remarkable outcome of a gene duplication event is the evolution of a novel function. Little information exists on how the rise of a novel function affects the evolution of its paralogous sister gene copy, however. We studied the evolution of the feminizer (fem) gene from which the gene complementary sex determiner (csd) recently derived by tandem duplication within the honey bee (Apis) lineage. Previous studies showed that fem retained its sex determination function, whereas the rise of csd established a new primary signal of sex determination. We observed a specific reduction of nonsynonymous to synonymous substitution ratios in Apis to non-Apis fem. We found a contrasting pattern at two other genetically linked genes, suggesting that hitchhiking effects to csd, the locus under balancing selection, is not the cause of this evolutionary pattern. We also excluded higher synonymous substitution rates by relative rate testing. These results imply that stronger purifying selection is operating at the fem gene in the presence of csd. We propose that csd's new function interferes with the function of Fem protein, resulting in molecular constraints and limited evolvability of fem in the Apis lineage. Elevated silent nucleotide polymorphism in fem relative to the genome-wide average suggests that genetic linkage to the csd gene maintained more nucleotide variation in today's population. Our findings provide evidence that csd functionally and genetically interferes with fem, suggesting that a newly evolved gene and its functions can limit the evolutionary capability of other genes in the genome.

  3. Dose effect of the uvsA+ gene product in duplication strains of Aspergillus nidulans

    International Nuclear Information System (INIS)

    Majerfeld, I.H.; Roper, J.A.

    1978-01-01

    Strains of Aspergillus nidulans which carry a particular segment of chromosome I in duplicate - one segment in normal position, the other translocated to chromosome II - are more resistant to uv light than are strains with a balanced haploid genome. A double dose of the uvsA + allele, carried on the duplicate segment, determines this enhanced resistance; this is shown by the descending order of resistance of duplication haploids uvsA + /uvsA + , uvsA1/uvsA + and uvsA1/uvsA1. An unbalanced diploid with three doses of the uvsA + allele also shows greater resistance than a balanced uvsA + //uvsA + diploid. However, in balanced diploids the uvsA1 allele appears to be completely recessive; uvsA + //uvsA + and uvsA + //uvsA1 diploids produce indistinguishable survival curves after uv irradiation. Thus, the uvsA + gene product is not rate-limiting in repair processes in strains with a balanced genome. The rate-limiting effect observed in these unbalanced strains presumably reflects an interaction of the uvsA + product and other functions determined by the rest of the genome. Duplication haploids and normal haploids lose photorepairable lesions at similar rates. This observation may be interpreted to indicate that differences in survival are not due to differences in the efficiency of excision of uv-induced pyrimidime dimers

  4. Mutations in circularly permuted GTPase family genes AtNOA1/RIF1/SVR10 and BPG2 suppress var2-mediated leaf variegation in Arabidopsis thaliana.

    Science.gov (United States)

    Qi, Yafei; Zhao, Jun; An, Rui; Zhang, Juan; Liang, Shuang; Shao, Jingxia; Liu, Xiayan; An, Lijun; Yu, Fei

    2016-03-01

    Leaf variegation mutants constitute a unique group of chloroplast development mutants and are ideal genetic materials to dissect the regulation of chloroplast development. We have utilized the Arabidopsis yellow variegated (var2) mutant and genetic suppressor analysis to probe the mechanisms of chloroplast development. Here we report the isolation of a new var2 suppressor locus SUPPRESSOR OF VARIEGATION (SVR10). Genetic mapping and molecular complementation indicated that SVR10 encodes a circularly permuted GTPase that has been reported as Arabidopsis thaliana NITRIC OXIDE ASSOCIATED 1 (AtNOA1) and RESISTANT TO INHIBITION BY FOSMIDOMYCIN 1 (RIF1). Biochemical evidence showed that SVR10/AtNOA1/RIF1 likely localizes to the chloroplast stroma. We further demonstrate that the mutant of a close homologue of SVR10/AtNOA1/RIF1, BRASSINAZOLE INSENSITIVE PALE GREEN 2 (BPG2), can also suppress var2 leaf variegation. Mutants of SVR10 and BPG2 are impaired in photosynthesis and the accumulation of chloroplast proteins. Interestingly, two-dimensional blue native gel analysis showed that mutants of SVR10 and BPG2 display defects in the assembly of thylakoid membrane complexes including reduced levels of major photosynthetic complexes and the abnormal accumulation of a chlorophyll-protein supercomplex containing photosystem I. Taken together, our findings suggest that SVR10 and BPG2 are functionally related with VAR2, likely through their potential roles in regulating chloroplast protein homeostasis, and both SVR10 and BPG2 are required for efficient thylakoid protein complex assembly and photosynthesis.

  5. Yeast Interspecies Comparative Proteomics Reveals Divergence in Expression Profiles and Provides Insights into Proteome Resource Allocation and Evolutionary Roles of Gene Duplication*

    Science.gov (United States)

    Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke

    2016-01-01

    Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under

  6. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    International Nuclear Information System (INIS)

    Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.

    2009-01-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  7. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    Energy Technology Data Exchange (ETDEWEB)

    Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)

    2009-10-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.

  8. Delineation of a new chromosome 20q11.2 duplication syndrome including the ASXL1 gene

    DEFF Research Database (Denmark)

    Avila, Magali; Kirchhoff, Eva Maria; Marle, Nathalie

    2013-01-01

    We report on three males with de novo overlapping 7.5, 9.8, and 10 Mb duplication of chromosome 20q11.2. Together with another patient previously published in the literature with overlapping 20q11 microduplication, we show that such patients display common clinical features including metopic ridg...

  9. Integrating multi-omics analyses of Nonomuraea dietziae to reveal the role of soybean oil in [(4'-OH)MeLeu]4-CsA overproduction.

    Science.gov (United States)

    Liu, Huanhuan; Huang, Di; Jin, Lina; Wang, Cheng; Liang, Shaoxiong; Wen, Jianping

    2017-07-14

    Nonomuraea dietziae is a promising microorganism to mediate the region-specific monooxygenation reaction of cyclosporine A (CsA). The main product [(4'-OH)MeLeu] 4 -CsA possesses high anti-HIV/HCV and hair growth-stimulating activities while avoiding the immunosuppressive effect of CsA. However, the low conversion efficiency restricts the clinical application. In this study, the production of [(4'-OH)MeLeu] 4 -CsA was greatly improved by 55.6% from 182.8 to 284.4 mg/L when supplementing soybean oil into the production medium, which represented the highest production of [(4'-OH)MeLeu] 4 -CsA so far. To investigate the effect of soybean oil on CsA conversion, some other plant oils (corn oil and peanut oil) and the major hydrolysates of soybean oil were fed into the production medium, respectively. The results demonstrated that the plant oils, rather than the hydrolysates, could significantly improve the [(4'-OH)MeLeu] 4 -CsA production, suggesting that soybean oil might not play its role in the lipid metabolic pathway. To further unveil the mechanism of [(4'-OH)MeLeu] 4 -CsA overproduction under the soybean oil condition, a proteomic analysis based on the two-dimensional gel electrophoresis coupled with MALDI TOF/TOF mass spectrometry was implemented. The results showed that central carbon metabolism, genetic information processing and energy metabolism were significantly up-regulated under the soybean oil condition. Moreover, the gas chromatography-mass spectrometry-based metabolomic analysis indicated that soybean oil had a great effect on amino acid metabolism and tricarboxylic acid cycle. In addition, the transcription levels of cytochrome P450 hydroxylase (CYP) genes for CsA conversion were determined by RT-qPCR and the results showed that most of the CYP genes were up-regulated under the soybean oil condition. These findings indicate that soybean oil could strengthen the primary metabolism and the CYP system to enhance the mycelium growth and the

  10. Genome-wide analysis of SU(VAR)3-9 distribution in chromosomes of Drosophila melanogaster.

    Science.gov (United States)

    Maksimov, Daniil A; Laktionov, Petr P; Posukh, Olga V; Belyakin, Stepan N; Koryakov, Dmitry E

    2018-03-01

    Histone modifications represent one of the key factors contributing to proper genome regulation. One of histone modifications involved in gene silencing is methylation of H3K9 residue. Present in the chromosomes across different eukaryotes, this epigenetic mark is controlled by SU(VAR)3-9 and its orthologs. Despite SU(VAR)3-9 was discovered over two decades ago, little is known about the details of its chromosomal distribution pattern. To fill in this gap, we used DamID-seq approach and obtained high-resolution genome-wide profiles for SU(VAR)3-9 in two somatic (salivary glands and brain ganglia) and two germline (ovarian nurse cells and testes) tissues of Drosophila melanogaster. Analysis of tissue and developmental expression of SU(VAR)3-9-bound genes indicates that in the somatic tissues tested, as well as in the ovarian nurse cells, SU(VAR)3-9 tends to associate with transcriptionally silent genes. In contrast, in the testes, SU(VAR)3-9 shows preferential association with testis-specific genes, and its binding appears dynamic during spermatogenesis. In somatic cells, the mere presence/absence of SU(VAR)3-9 binding correlates with lower/higher expression. No such correlation is found in the male germline. Interestingly, transcription units in piRNA clusters (particularly flanks thereof) are frequently targeted by SU(VAR)3-9, and Su(var)3-9 mutation affects the expression of select piRNA species. Our analyses suggest a context-dependent role of SU(VAR)3-9. In euchromatin, SU(VAR)3-9 may serve to fine-tune the expression of individual genes, whereas in heterochromatin, chromosome 4, and piRNA clusters, it may act more broadly over large chromatin domains.

  11. The complete chloroplast genome of traditional Chinese medical plants Paris polyphylla var. yunnanensis.

    Science.gov (United States)

    Song, Yun; Xu, Jin; Chen, NaiZhong; Li, MingFu

    2017-03-01

    Paris polyphylla var. yunnanensis is a perennial medical plant widely used in traditional Chinese medicine. Here, we report the complete chloroplast genome of P. polyphylla var. yunnanensis. The genome is 157 675 bp in length including a small single-copy region (SSC, 18 319 bp) and a large single-copy region (LSC, 84 108 bp) separated by a pair of inverted repeats (IRs, 27 624 bp). The genome contained 115 genes, including 81 protein-coding genes, 4 ribosomal RNA genes, and 30 tRNA genes. Among these genes, 13 harbored a single intron and 2 contained a couple of introns. The overall G + C content of the cpDNA is 37.4%, while the corresponding values of the LSC, SSC, and IR regions are 35.71%, 31.43%, and 41.87%, respectively. A Maximum-likelihood phylogenetic analysis suggested that genus Trillium, Paris, Fritillaria, and Lilium were strongly supported as monophyletic and the P. polyphylla var. yunnanensis is closely related to Trillium.

  12. A conserved segmental duplication within ELA.

    Science.gov (United States)

    Brinkmeyer-Langford, C L; Murphy, W J; Childers, C P; Skow, L C

    2010-12-01

    The assembled genomic sequence of the horse major histocompatibility complex (MHC) (equine lymphocyte antigen, ELA) is very similar to the homologous human HLA, with the notable exception of a large segmental duplication at the boundary of ELA class I and class III that is absent in HLA. The segmental duplication consists of a ∼ 710 kb region of at least 11 repeated blocks: 10 blocks each contain an MHC class I-like sequence and the helicase domain portion of a BAT1-like sequence, and the remaining unit contains the full-length BAT1 gene. Similar genomic features were found in other Perissodactyls, indicating an ancient origin, which is consistent with phylogenetic analyses. Reverse-transcriptase PCR (RT-PCR) of mRNA from peripheral white blood cells of healthy and chronically or acutely infected horses detected transcription from predicted open reading frames in several of the duplicated blocks. This duplication is not present in the sequenced MHCs of most other mammals, although a similar feature at the same relative position is present in the feline MHC (FLA). Striking sequence conservation throughout Perissodactyl evolution is consistent with a functional role for at least some of the genes included within this segmental duplication. © 2010 The Authors, Journal compilation © 2010 Stichting International Foundation for Animal Genetics.

  13. Statistical prediction of immunity to placental malaria based on multi-assay antibody data for malarial antigens

    DEFF Research Database (Denmark)

    Siriwardhana, Chathura; Fang, Rui; Salanti, Ali

    2017-01-01

    Background Plasmodium falciparum infections are especially severe in pregnant women because infected erythrocytes (IE) express VAR2CSA, a ligand that binds to placental trophoblasts, causing IE to accumulate in the placenta. Resulting inflammation and pathology increases a woman’s risk of anemia...... to 28 malarial antigens and used the data to develop statistical models for predicting if a woman has sufficient immunity to prevent PM. Methods Archival plasma samples from 1377 women were screened in a bead-based multiplex assay for Ab to 17 VAR2CSA-associated antigens (full length VAR2CSA (FV2), DBL...... in the following seven statistical approaches: logistic regression full model, logistic regression reduced model, recursive partitioning, random forests, linear discriminant analysis, quadratic discriminant analysis, and support vector machine. Results The best and simplest model proved to be the logistic...

  14. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  15. The effect of adjuvants on the immune response induced by a DBL4e-ID4 VAR2CSA based Plasmodium falciparum vaccine against placental malaria

    DEFF Research Database (Denmark)

    Pinto, V V; Salanti, A; Joergensen, L M

    2012-01-01

    720, Alhydrogel(®) and CAF01. Antibodies induced against DBL4¿-ID4 in combination with these adjuvants inhibited parasite binding to CSA from 82% to 99%. Although, different epitope recognition patterns were obtained for the different formulations, all adjuvant combinations induced strong Th1 and Th2......¿-ID4 to induce binding-inhibitory antibodies when formulated with adjuvants approved for human use. We have characterized the immune response of DBL4¿-ID4 in combination with Freund's complete and incomplete adjuvant and with three adjuvants currently being used in clinical trials: Montanide(®) ISA...... type responses, resulting in IgG with similar binding strength, with to the DBL4¿-ID4 antigen. These results demonstrate that the DBL4¿-ID4 antigen is highly immunogenic and that binding inhibitory antibodies are induced when formulated with any of the tested adjuvants....

  16. Gene conversion and DNA sequence polymorphism in the sex-determination gene fog-2 and its paralog ftr-1 in Caenorhabditis elegans.

    Science.gov (United States)

    Rane, Hallie S; Smith, Jessica M; Bergthorsson, Ulfar; Katju, Vaishali

    2010-07-01

    Gene conversion, a form of concerted evolution, bears enormous potential to shape the trajectory of sequence and functional divergence of gene paralogs subsequent to duplication events. fog-2, a sex-determination gene unique to Caenorhabditis elegans and implicated in the origin of hermaphroditism in this species, resulted from the duplication of ftr-1, an upstream gene of unknown function. Synonymous sequence divergence in regions of fog-2 and ftr-1 (excluding recent gene conversion tracts) suggests that the duplication occurred 46 million generations ago. Gene conversion between fog-2 and ftr-1 was previously discovered in experimental fog-2 knockout lines of C. elegans, whereby hermaphroditism was restored in mutant obligately outcrossing male-female populations. We analyzed DNA-sequence variation in fog-2 and ftr-1 within 40 isolates of C. elegans from diverse geographic locations in order to evaluate the contribution of gene conversion to genetic variation in the two gene paralogs. The analysis shows that gene conversion contributes significantly to DNA-sequence diversity in fog-2 and ftr-1 (22% and 34%, respectively) and may have the potential to alter sexual phenotypes in natural populations. A radical amino acid change in a conserved region of the F-box domain of fog-2 was found in natural isolates of C. elegans with significantly lower fecundity. We hypothesize that the lowered fecundity is due to reduced masculinization and less sperm production and that amino acid replacement substitutions and gene conversion in fog-2 may contribute significantly to variation in the degree of inbreeding and outcrossing in natural populations.

  17. An ancient duplication of exon 5 in the Snap25 gene is required for complex neuronal development/function.

    Directory of Open Access Journals (Sweden)

    Jenny U Johansson

    2008-11-01

    Full Text Available Alternative splicing is an evolutionary innovation to create functionally diverse proteins from a limited number of genes. SNAP-25 plays a central role in neuroexocytosis by bridging synaptic vesicles to the plasma membrane during regulated exocytosis. The SNAP-25 polypeptide is encoded by a single copy gene, but in higher vertebrates a duplication of exon 5 has resulted in two mutually exclusive splice variants, SNAP-25a and SNAP-25b. To address a potential physiological difference between the two SNAP-25 proteins, we generated gene targeted SNAP-25b deficient mouse mutants by replacing the SNAP-25b specific exon with a second SNAP-25a equivalent. Elimination of SNAP-25b expression resulted in developmental defects, spontaneous seizures, and impaired short-term synaptic plasticity. In adult mutants, morphological changes in hippocampus and drastically altered neuropeptide expression were accompanied by severe impairment of spatial learning. We conclude that the ancient exon duplication in the Snap25 gene provides additional SNAP-25-function required for complex neuronal processes in higher eukaryotes.

  18. MECP2 duplication phenotype in symptomatic females: report of three further cases

    OpenAIRE

    Novara, Francesca; Simonati, Alessandro; Sicca, Federico; Battini, Roberta; Fiori, Simona; Contaldo, Annarita; Criscuolo, Lucia; Zuffardi, Orsetta; Ciccone, Roberto

    2014-01-01

    Background Xq28 duplications, including MECP2 (methyl CpG-binding protein 2; OMIM 300005), have been identified in approximately 140 male patients presenting with hypotonia, severe developmental delay/intellectual disability, limited or absent speech and ambulation, and recurrent respiratory infections. Female patients with Xq28 duplication have been rarely reported and are usually asymptomatic. Altogether, only fifteen symptomatic females with Xq28 duplications including MECP2 have been repo...

  19. Using paleogenomics to study the evolution of gene families: origin and duplication history of the relaxin family hormones and their receptors.

    Directory of Open Access Journals (Sweden)

    Sergey Yegorov

    Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of

  20. The cytochrome P450 2AA gene cluster in zebrafish (Danio rerio): Expression of CYP2AA1 and CYP2AA2 and response to phenobarbital-type inducers

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, Akira [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Bainy, Afonso C.D. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Departamento de Bioquímica, CCB, Universidade Federal de Santa Catarina, Florianopolis, SC 88040-900 (Brazil); Woodin, Bruce R.; Goldstone, Jared V. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Stegeman, John J., E-mail: jstegeman@whoi.edu [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States)

    2013-10-01

    The cytochrome P450 (CYP) 2 gene family is the largest and most diverse CYP gene family in vertebrates. In zebrafish, we have identified 10 genes in a new subfamily, CYP2AA, which does not show orthology to any human or other mammalian CYP genes. Here we report evolutionary and structural relationships of the 10 CYP2AA genes and expression of the first two genes, CYP2AA1 and CYP2AA2. Parsimony reconstruction of the tandem duplication pattern for the CYP2AA cluster suggests that CYP2AA1, CYP2AA2 and CYP2AA3 likely arose in the earlier duplication events and thus are most diverged in function from the other CYP2AAs. On the other hand, CYP2AA8 and CYP2AA9 are genes that arose in the latest duplication event, implying functional similarity between these two CYPs. A molecular model of CYP2AA1 showing the sequence conservation across the CYP2AA cluster reveals that the regions with the highest variability within the cluster map onto CYP2AA1 near the substrate access channels, suggesting differing substrate specificities. Zebrafish CYP2AA1 transcript was expressed predominantly in the intestine, while CYP2AA2 was most highly expressed in the kidney, suggesting differing roles in physiology. In the liver CYP2AA2 expression but not that of CYP2AA1, was increased by 1,4-bis [2-(3,5-dichloropyridyloxy)] benzene (TCPOBOP) and, to a lesser extent, by phenobarbital (PB). In contrast, pregnenolone 16α-carbonitrile (PCN) increased CYP2AA1 expression, but not CYP2AA2 in the liver. The results identify a CYP2 subfamily in zebrafish that includes genes apparently induced by PB-type chemicals and PXR agonists, the first concrete in vivo evidence for a PB-type response in fish. - Highlights: • A tandemly duplicated cluster of ten CYP2AA genes was described in zebrafish. • Parsimony and duplication analyses suggest pathways to CYP2AA diversity. • Homology models reveal amino acid positions possibly related to functional diversity. • The CYP2AA locus does not share synteny with

  1. The cytochrome P450 2AA gene cluster in zebrafish (Danio rerio): Expression of CYP2AA1 and CYP2AA2 and response to phenobarbital-type inducers

    International Nuclear Information System (INIS)

    Kubota, Akira; Bainy, Afonso C.D.; Woodin, Bruce R.; Goldstone, Jared V.; Stegeman, John J.

    2013-01-01

    The cytochrome P450 (CYP) 2 gene family is the largest and most diverse CYP gene family in vertebrates. In zebrafish, we have identified 10 genes in a new subfamily, CYP2AA, which does not show orthology to any human or other mammalian CYP genes. Here we report evolutionary and structural relationships of the 10 CYP2AA genes and expression of the first two genes, CYP2AA1 and CYP2AA2. Parsimony reconstruction of the tandem duplication pattern for the CYP2AA cluster suggests that CYP2AA1, CYP2AA2 and CYP2AA3 likely arose in the earlier duplication events and thus are most diverged in function from the other CYP2AAs. On the other hand, CYP2AA8 and CYP2AA9 are genes that arose in the latest duplication event, implying functional similarity between these two CYPs. A molecular model of CYP2AA1 showing the sequence conservation across the CYP2AA cluster reveals that the regions with the highest variability within the cluster map onto CYP2AA1 near the substrate access channels, suggesting differing substrate specificities. Zebrafish CYP2AA1 transcript was expressed predominantly in the intestine, while CYP2AA2 was most highly expressed in the kidney, suggesting differing roles in physiology. In the liver CYP2AA2 expression but not that of CYP2AA1, was increased by 1,4-bis [2-(3,5-dichloropyridyloxy)] benzene (TCPOBOP) and, to a lesser extent, by phenobarbital (PB). In contrast, pregnenolone 16α-carbonitrile (PCN) increased CYP2AA1 expression, but not CYP2AA2 in the liver. The results identify a CYP2 subfamily in zebrafish that includes genes apparently induced by PB-type chemicals and PXR agonists, the first concrete in vivo evidence for a PB-type response in fish. - Highlights: • A tandemly duplicated cluster of ten CYP2AA genes was described in zebrafish. • Parsimony and duplication analyses suggest pathways to CYP2AA diversity. • Homology models reveal amino acid positions possibly related to functional diversity. • The CYP2AA locus does not share synteny with

  2. JIL-1 and Su(var)3-7 Interact Genetically and Counteract Each Other's Effect on Position-Effect Variegation in Drosophila

    Science.gov (United States)

    Deng, Huai; Cai, Weili; Wang, Chao; Lerach, Stephanie; Delattre, Marion; Girton, Jack; Johansen, Jørgen; Johansen, Kristen M.

    2010-01-01

    The essential JIL-1 histone H3S10 kinase is a key regulator of chromatin structure that functions to maintain euchromatic domains while counteracting heterochromatization and gene silencing. In the absence of the JIL-1 kinase, two of the major heterochromatin markers H3K9me2 and HP1a spread in tandem to ectopic locations on the chromosome arms. Here we address the role of the third major heterochromatin component, the zinc-finger protein Su(var)3-7. We show that the lethality but not the chromosome morphology defects associated with the null JIL-1 phenotype to a large degree can be rescued by reducing the dose of the Su(var)3-7 gene and that Su(var)3-7 and JIL-1 loss-of-function mutations have an antagonistic and counterbalancing effect on position-effect variegation (PEV). Furthermore, we show that in the absence of JIL-1 kinase activity, Su(var)3-7 gets redistributed and upregulated on the chromosome arms. Reducing the dose of the Su(var)3-7 gene dramatically decreases this redistribution; however, the spreading of H3K9me2 to the chromosome arms was unaffected, strongly indicating that ectopic Su(var)3-9 activity is not a direct cause of lethality. These observations suggest a model where Su(var)3-7 functions as an effector downstream of Su(var)3-9 and H3K9 dimethylation in heterochromatic spreading and gene silencing that is normally counteracted by JIL-1 kinase activity. PMID:20457875

  3. DNA binding properties of the small cascade subunit Csa5.

    Directory of Open Access Journals (Sweden)

    Michael Daume

    Full Text Available CRISPR-Cas systems provide immunity against viral attacks in archaeal and bacterial cells. Type I systems employ a Cas protein complex termed Cascade, which utilizes small CRISPR RNAs to detect and degrade the exogenic DNA. A small sequence motif, the PAM, marks the foreign substrates. Previously, a recombinant type I-A Cascade complex from the archaeon Thermoproteus tenax was shown to target and degrade DNA in vitro, dependent on a native PAM sequence. Here, we present the biochemical analysis of the small subunit, Csa5, of this Cascade complex. T. tenax Csa5 preferentially bound ssDNA and mutants that showed decreased ssDNA-binding and reduced Cascade-mediated DNA cleavage were identified. Csa5 oligomerization prevented DNA binding. Specific recognition of the PAM sequence was not observed. Phylogenetic analyses identified Csa5 as a universal member of type I-A systems and revealed three distinct groups. A potential role of Csa5 in R-loop stabilization is discussed.

  4. The Sequence and Analysis of Duplication Rich Human Chromosome 16

    Science.gov (United States)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-01-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  5. The sequence and analysis of duplication rich human chromosome 16

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-08-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  6. The hidden duplication past of the plant pathogen Phytophthora and its consequences for infection

    Directory of Open Access Journals (Sweden)

    Martens Cindy

    2010-06-01

    Full Text Available Abstract Background Oomycetes of the genus Phytophthora are pathogens that infect a wide range of plant species. For dicot hosts such as tomato, potato and soybean, Phytophthora is even the most important pathogen. Previous analyses of Phytophthora genomes uncovered many genes, large gene families and large genome sizes that can partially be explained by significant repeat expansion patterns. Results Analysis of the complete genomes of three different Phytophthora species, using a newly developed approach, unveiled a large number of small duplicated blocks, mainly consisting of two or three consecutive genes. Further analysis of these duplicated genes and comparison with the known gene and genome duplication history of ten other eukaryotes including parasites, algae, plants, fungi, vertebrates and invertebrates, suggests that the ancestor of P. infestans, P. sojae and P. ramorum most likely underwent a whole genome duplication (WGD. Genes that have survived in duplicate are mainly genes that are known to be preferentially retained following WGDs, but also genes important for pathogenicity and infection of the different hosts seem to have been retained in excess. As a result, the WGD might have contributed to the evolutionary and pathogenic success of Phytophthora. Conclusions The fact that we find many small blocks of duplicated genes indicates that the genomes of Phytophthora species have been heavily rearranged following the WGD. Most likely, the high repeat content in these genomes have played an important role in this rearrangement process. As a consequence, the paucity of retained larger duplicated blocks has greatly complicated previous attempts to detect remnants of a large-scale duplication event in Phytophthora. However, as we show here, our newly developed strategy to identify very small duplicated blocks might be a useful approach to uncover ancient polyploidy events, in particular for heavily rearranged genomes.

  7. The new CSA standard for leak detection

    Energy Technology Data Exchange (ETDEWEB)

    Pietsch, Ulli [TAU, Edmonton, Alberta, (Canada); Scott, Don [TransCanada Pipelines, Edmonton, Alberta, (Canada)

    2010-07-01

    Standards need to be updated regularly to reflect current technology and industry practices. This paper describes the new Canadian Standards Association (CSA) for leak detection called Recommended Practice for Liquid Hydrocarbon Pipeline System Leak Detection, Annex E, which can be found in the CSA Z662 Oil and Gas Pipeline Systems standard. The CSA formed a task force of industry experts and regulators for a period of 18 months to draft the new standards. Several comparisons were made with the American Petroleum Institute (API) recommended practice API 1130. This new version introduces and defines the terms, critical instrument, critical process and dependent instrument. The most significant improvement made by the new Annex E is the new requirement that an operating company must develop a leak detection strategy. The writing of a leak detection manual is given high priority. The use of both Annex E and API 1130 is recommended.

  8. Resolution and reconciliation of non-binary gene trees with transfers, duplications and losses.

    Science.gov (United States)

    Jacox, Edwin; Weller, Mathias; Tannier, Eric; Scornavacca, Celine

    2017-04-01

    Gene trees reconstructed from sequence alignments contain poorly supported branches when the phylogenetic signal in the sequences is insufficient to determine them all. When a species tree is available, the signal of gains and losses of genes can be used to correctly resolve the unsupported parts of the gene history. However finding a most parsimonious binary resolution of a non-binary tree obtained by contracting the unsupported branches is NP-hard if transfer events are considered as possible gene scale events, in addition to gene origination, duplication and loss. We propose an exact, parameterized algorithm to solve this problem in single-exponential time, where the parameter is the number of connected branches of the gene tree that show low support from the sequence alignment or, equivalently, the maximum number of children of any node of the gene tree once the low-support branches have been collapsed. This improves on the best known algorithm by an exponential factor. We propose a way to choose among optimal solutions based on the available information. We show the usability of this principle on several simulated and biological datasets. The results are comparable in quality to several other tested methods having similar goals, but our approach provides a lower running time and a guarantee that the produced solution is optimal. Our algorithm has been integrated into the ecceTERA phylogeny package, available at http://mbb.univ-montp2.fr/MBB/download_sources/16__ecceTERA and which can be run online at http://mbb.univ-montp2.fr/MBB/subsection/softExec.php?soft=eccetera . celine.scornavacca@umontpellier.fr. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  9. Rapid genome reshaping by multiple-gene loss after whole-genome duplication in teleost fish suggested by mathematical modeling

    Science.gov (United States)

    Sato, Yukuto; Tsukamoto, Katsumi; Nishida, Mutsumi

    2015-01-01

    Whole-genome duplication (WGD) is believed to be a significant source of major evolutionary innovation. Redundant genes resulting from WGD are thought to be lost or acquire new functions. However, the rates of gene loss and thus temporal process of genome reshaping after WGD remain unclear. The WGD shared by all teleost fish, one-half of all jawed vertebrates, was more recent than the two ancient WGDs that occurred before the origin of jawed vertebrates, and thus lends itself to analysis of gene loss and genome reshaping. Using a newly developed orthology identification pipeline, we inferred the post–teleost-specific WGD evolutionary histories of 6,892 protein-coding genes from nine phylogenetically representative teleost genomes on a time-calibrated tree. We found that rapid gene loss did occur in the first 60 My, with a loss of more than 70–80% of duplicated genes, and produced similar genomic gene arrangements within teleosts in that relatively short time. Mathematical modeling suggests that rapid gene loss occurred mainly by events involving simultaneous loss of multiple genes. We found that the subsequent 250 My were characterized by slow and steady loss of individual genes. Our pipeline also identified about 1,100 shared single-copy genes that are inferred to have become singletons before the divergence of clupeocephalan teleosts. Therefore, our comparative genome analysis suggests that rapid gene loss just after the WGD reshaped teleost genomes before the major divergence, and provides a useful set of marker genes for future phylogenetic analysis. PMID:26578810

  10. The complete chloroplast genome sequence of Dianthus superbus var. longicalycinus.

    Science.gov (United States)

    Gurusamy, Raman; Lee, Do-Hyung; Park, SeonJoo

    2016-05-01

    The complete chloroplast genome (cpDNA) sequence of Dianthus superbus var. longicalycinus is an economically important traditional Chinese medicine was reported and characterized. The cpDNA of Dianthus superbus var. longicalycinus is 149,539 bp, with 36.3% GC content. A pair of inverted repeats (IRs) of 24,803 bp is separated by a large single-copy region (LSC, 82,805 bp) and a small single-copy region (SSC, 17,128 bp). It encodes 85 protein-coding genes, 36 tRNA genes and 8 rRNA genes. Of 129 individual genes, 13 genes encoded one intron and three genes have two introns.

  11. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

    2012-01-01

    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  12. The effects of a partitioned var gene repertoire of Plasmodium falciparum on antigenic diversity and the acquisition of clinical immunity

    Directory of Open Access Journals (Sweden)

    Arinaminpathy Nimalan

    2008-01-01

    Full Text Available Abstract Background The human malaria parasite Plasmodium falciparum exploits antigenic diversity and within-host antigenic variation to evade the host's immune system. Of particular importance are the highly polymorphic var genes that encode the family of cell surface antigens PfEMP1 (Plasmodium falciparum Erythrocyte Membrane Protein 1. It has recently been shown that in spite of their extreme diversity, however, these genes fall into distinct groups according to chromosomal location or sequence similarity, and that recombination may be confined within these groups. Methods This study presents a mathematical analysis of how recombination hierarchies affect diversity, and, by using simple stochastic simulations, investigates how intra- and inter-genic diversity influence the rate at which individuals acquire clinical immunity. Results The analysis demonstrates that the partitioning of the var gene repertoire has a limiting effect on the total diversity attainable through recombination and that the limiting effect is strongly influenced by the respective sizes of each of the partitions. Furthermore, by associating expression of one of the groups with severe malaria it is demonstrated how a small number of infections can be sufficient to protect against disease despite a seemingly limitless number of possible non-identical repertoires. Conclusion Recombination hierarchies within the var gene repertoire of P. falciparum have a severe effect on strain diversity and the process of acquiring immunity against clinical malaria. Future studies will show how the existence of these recombining groups can offer an evolutionary advantage in spite of their restriction on diversity.

  13. Gene duplication and adaptive evolution of digestive proteases in Drosophila arizonae female reproductive tracts.

    Directory of Open Access Journals (Sweden)

    Erin S Kelleher

    2007-08-01

    Full Text Available It frequently has been postulated that intersexual coevolution between the male ejaculate and the female reproductive tract is a driving force in the rapid evolution of reproductive proteins. The dearth of research on female tracts, however, presents a major obstacle to empirical tests of this hypothesis. Here, we employ a comparative EST approach to identify 241 candidate female reproductive proteins in Drosophila arizonae, a repleta group species in which physiological ejaculate-female coevolution has been documented. Thirty-one of these proteins exhibit elevated amino acid substitution rates, making them candidates for molecular coevolution with the male ejaculate. Strikingly, we also discovered 12 unique digestive proteases whose expression is specific to the D. arizonae lower female reproductive tract. These enzymes belong to classes most commonly found in the gastrointestinal tracts of a diverse array of organisms. We show that these proteases are associated with recent, lineage-specific gene duplications in the Drosophila repleta species group, and exhibit strong signatures of positive selection. Observation of adaptive evolution in several female reproductive tract proteins indicates they are active players in the evolution of reproductive tract interactions. Additionally, pervasive gene duplication, adaptive evolution, and rapid acquisition of a novel digestive function by the female reproductive tract points to a novel coevolutionary mechanism of ejaculate-female interaction.

  14. Engineering application of in-core fuel management optimization code with CSA algorithm

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zhihong; Hu, Yongming [INET, Tsinghua university, Beijing 100084 (China)

    2009-06-15

    PWR in-core loading (reloading) pattern optimization is a complex combined problem. An excellent fuel management optimization code can greatly improve the efficiency of core reloading design, and bring economic and safety benefits. Today many optimization codes with experiences or searching algorithms (such as SA, GA, ANN, ACO) have been developed, while how to improve their searching efficiency and engineering usability still needs further research. CSA (Characteristic Statistic Algorithm) is a global optimization algorithm with high efficiency developed by our team. The performance of CSA has been proved on many problems (such as Traveling Salesman Problems). The idea of CSA is to induce searching direction by the statistic distribution of characteristic values. This algorithm is quite suitable for fuel management optimization. Optimization code with CSA has been developed and was used on many core models. The research in this paper is to improve the engineering usability of CSA code according to all the actual engineering requirements. Many new improvements have been completed in this code, such as: 1. Considering the asymmetry of burn-up in one assembly, the rotation of each assembly is considered as new optimization variables in this code. 2. Worth of control rods must satisfy the given constraint, so some relative modifications are added into optimization code. 3. To deal with the combination of alternate cycles, multi-cycle optimization is considered in this code. 4. To confirm the accuracy of optimization results, many identifications of the physics calculation module in this code have been done, and the parameters of optimization schemes are checked by SCIENCE code. The improved optimization code with CSA has been used on Qinshan nuclear plant of China. The reloading of cycle 7, 8, 9 (12 months, no burnable poisons) and the 18 months equilibrium cycle (with burnable poisons) reloading are optimized. At last, many optimized schemes are found by CSA code

  15. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

    Science.gov (United States)

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

    2014-05-01

    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.

  16. Preparation, quality control and biological evaluation of 99mTc-labelled cationic steroid antibiotic (CSA-13)

    International Nuclear Information System (INIS)

    Roohi, S.; Amir, N.; Mushtaq, A.; Salahuddin, S.M.; Jehangir, M.; Savage, P.B.

    2009-01-01

    Ceragenins (CSAs) are a new class of antimicrobial agents that display broad spectrum antibacterial activity and may find use in the treatment of various infections. A member of this class CSA-13 was labelled with 99m Tc using SnCl 2 .H 2 O as a reducing agent. The labelling efficiency depended on the ligand/reductant ratio, pH and volume of the reaction mixture. The radiochemical purity and stability of 99m Tc-CSA was determined by thin layer chromatography. Biodistribution studies of 99m Tc-CSA were performed in Sprague Dawley rats. Liver and spleen uptake was quite high. A significantly higher accumulation of 99m Tc-CSA was seen at sites of S. aureus infected rats. The results were compared with 99m Tc-Ciprofloxacin. (orig.)

  17. Adhesion of Plasmodium falciparum infected erythrocytes in ex vivo perfused placental tissue

    DEFF Research Database (Denmark)

    Pehrson, Caroline; Mathiesen, Line; Heno, Kristine K

    2016-01-01

    placental tissue. RESULTS: The ex vivo placental perfusion model was modified to study adhesion of infected erythrocytes binding to CSA, endothelial protein C receptor (EPCR) or a transgenic parasite where P. falciparum erythrocyte membrane protein 1 expression had been shut down. Infected erythrocytes......, such as binding to immunoglobulins. Furthermore, other parasite antigens have been associated with placental malaria. These findings have important implications for placental malaria vaccine design. The objective of this study was to adapt and describe a biologically relevant model of parasite adhesion in intact...... expressing VAR2CSA accumulated in perfused placental tissue whereas the EPCR binding and the transgenic parasite did not. Soluble CSA and antibodies specific against VAR2CSA inhibited binding of infected erythrocytes. CONCLUSION: The ex vivo model provides a novel way of studying receptor-ligand interactions...

  18. Prevalence and spectrum of large deletions or duplications in the major long QT syndrome-susceptibility genes and implications for long QT syndrome genetic testing.

    Science.gov (United States)

    Tester, David J; Benton, Amber J; Train, Laura; Deal, Barbara; Baudhuin, Linnea M; Ackerman, Michael J

    2010-10-15

    Long QT syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for 3 cardiac ion channel α-subunits (LQT1 to LQT3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. We set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes in unrelated patients who were mutation negative after point mutation analysis of LQT1- to LQT12-susceptibility genes. Forty-two unrelated, clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification, a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA multiplex ligation-dependent probe amplification LQTS kit from MRC-Holland was used to analyze the 3 major LQTS-associated genes, KCNQ1, KCNH2, and SCN5A, and the 2 minor genes, KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2 of 42 unrelated patients (4.8%, confidence interval 1.7 to 11). A deletion of KCNQ1 exon 3 was identified in a 10-year-old Caucasian boy with a corrected QT duration of 660 ms, a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17-year-old Caucasian girl with a corrected QT duration of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, because nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. Copyright © 2010 Elsevier Inc. All rights reserved.

  19. Screening for duplications, deletions and a common intronic mutation detects 35% of second mutations in patients with USH2A monoallelic mutations on Sanger sequencing.

    Science.gov (United States)

    Steele-Stallard, Heather B; Le Quesne Stabej, Polona; Lenassi, Eva; Luxon, Linda M; Claustres, Mireille; Roux, Anne-Francoise; Webster, Andrew R; Bitner-Glindzicz, Maria

    2013-08-08

    Usher Syndrome is the leading cause of inherited deaf-blindness. It is divided into three subtypes, of which the most common is Usher type 2, and the USH2A gene accounts for 75-80% of cases. Despite recent sequencing strategies, in our cohort a significant proportion of individuals with Usher type 2 have just one heterozygous disease-causing mutation in USH2A, or no convincing disease-causing mutations across nine Usher genes. The purpose of this study was to improve the molecular diagnosis in these families by screening USH2A for duplications, heterozygous deletions and a common pathogenic deep intronic variant USH2A: c.7595-2144A>G. Forty-nine Usher type 2 or atypical Usher families who had missing mutations (mono-allelic USH2A or no mutations following Sanger sequencing of nine Usher genes) were screened for duplications/deletions using the USH2A SALSA MLPA reagent kit (MRC-Holland). Identification of USH2A: c.7595-2144A>G was achieved by Sanger sequencing. Mutations were confirmed by a combination of reverse transcription PCR using RNA extracted from nasal epithelial cells or fibroblasts, and by array comparative genomic hybridisation with sequencing across the genomic breakpoints. Eight mutations were identified in 23 Usher type 2 families (35%) with one previously identified heterozygous disease-causing mutation in USH2A. These consisted of five heterozygous deletions, one duplication, and two heterozygous instances of the pathogenic variant USH2A: c.7595-2144A>G. No variants were found in the 15 Usher type 2 families with no previously identified disease-causing mutations. In 11 atypical families, none of whom had any previously identified convincing disease-causing mutations, the mutation USH2A: c.7595-2144A>G was identified in a heterozygous state in one family. All five deletions and the heterozygous duplication we report here are novel. This is the first time that a duplication in USH2A has been reported as a cause of Usher syndrome. We found that 8 of

  20. Single-copy genes define a conserved order between rice and wheat for understanding differences caused by duplication, deletion, and transposition of genes.

    Science.gov (United States)

    Singh, Nagendra K; Dalal, Vivek; Batra, Kamlesh; Singh, Binay K; Chitra, G; Singh, Archana; Ghazi, Irfan A; Yadav, Mahavir; Pandit, Awadhesh; Dixit, Rekha; Singh, Pradeep K; Singh, Harvinder; Koundal, Kirpa R; Gaikwad, Kishor; Mohapatra, Trilochan; Sharma, Tilak R

    2007-01-01

    The high-quality rice genome sequence is serving as a reference for comparative genome analysis in crop plants, especially cereals. However, early comparisons with bread wheat showed complex patterns of conserved synteny (gene content) and colinearity (gene order). Here, we show the presence of ancient duplicated segments in the progenitor of wheat, which were first identified in the rice genome. We also show that single-copy (SC) rice genes, those representing unique matches with wheat expressed sequence tag (EST) unigene contigs in the whole rice genome, show more than twice the proportion of genes mapping to syntenic wheat chromosome as compared to the multicopy (MC) or duplicated rice genes. While 58.7% of the 1,244 mapped SC rice genes were located in single syntenic wheat chromosome groups, the remaining 41.3% were distributed randomly to the other six non-syntenic wheat groups. This could only be explained by a background dispersal of genes in the genome through transposition or other unknown mechanism. The breakdown of rice-wheat synteny due to such transpositions was much greater near the wheat centromeres. Furthermore, the SC rice genes revealed a conserved primordial gene order that gives clues to the origin of rice and wheat chromosomes from a common ancestor through polyploidy, aneuploidy, centromeric fusions, and translocations. Apart from the bin-mapped wheat EST contigs, we also compared 56,298 predicted rice genes with 39,813 wheat EST contigs assembled from 409,765 EST sequences and identified 7,241 SC rice gene homologs of wheat. Based on the conserved colinearity of 1,063 mapped SC rice genes across the bins of individual wheat chromosomes, we predicted the wheat bin location of 6,178 unmapped SC rice gene homologs and validated the location of 213 of these in the telomeric bins of 21 wheat chromosomes with 35.4% initial success. This opens up the possibility of directed mapping of a large number of conserved SC rice gene homologs in wheat

  1. Localization of the Laevigatum powdery mildew resistance gene to barley chromosome 2 by the use of RFLP markers

    DEFF Research Database (Denmark)

    Giese, H.; Holm-Jensen, A.G.; Jensen, H.P.

    1993-01-01

    The powdery mildew disease resistance gene Ml(La) was found to belong to a locus on barely chromosome 2. We suggest that this locus be designated MlLa. Linkage analysis was carried out on 72 chromosome-doubled, spring-type progeny lines from a cross between the winter var 'Vogelsanger Gold' and t......' and the spring var 'Alf'. A map of chromosome 2 spanning 119 cM and flanked by two peroxidase gene loci was constructed. In addition to the Laevigatum resistance locus the map includes nine RFLP markers, the two peroxidase gene loci and the six-row locus in barley....

  2. The duplication 17p13.3 phenotype

    DEFF Research Database (Denmark)

    Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica

    2013-01-01

    . Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....

  3. Expression of Genes Related to Phenylpropanoid Biosynthesis in Different Organs of Ixeris dentata var. albiflora.

    Science.gov (United States)

    Lee, Sang-Hoon; Park, Yun-Ji; Park, Sang Un; Lee, Sang-Won; Kim, Seong-Cheol; Jung, Chan-Sik; Jang, Jae-Ki; Hur, Yoonkang; Kim, Yeon Bok

    2017-05-30

    Members of the genus Ixeris have long been used in traditional medicines as stomachics, sedatives, and diuretics. Phenylalanine ammonia-lyase (PAL), cinnamate-4-hydroxylase (C4H), 4-coumarate: coenzyme-A (CoA) ligase (4CL), chalcone synthase (CHS), and dihydroflavonol 4-reductase (DFR) are important enzymes in the phenylpropanoid pathway. In this study, we analyzed seven genes from Ixeris dentata var. albiflora that are involved in phenylpropanoid biosynthesis, using an Illumina/Solexa HiSeq 2000 platform. The amino acid sequence alignments for IdPAL s, IdC4H, Id4CL s, IdCHS , and IdDFR showed high identity to sequences from other plants. We also investigated transcript levels using quantitative real-time PCR, and analyzed the accumulation of phenylpropanoids in different organs of I. dentata var. albiflora using high-performance liquid chromatography. The transcript levels of IdC4H, Id4CL1 , IdCHS , and IdDFR were highest in the leaf. The catechin, chlorogenic acid, ferulic acid, and quercetin contents were also highest in the leaf. We suggest that expression of IdC4H, Id4CL1 , IdCHS , and IdDFR is associated with the accumulation of phenylpropanoids. Our results may provide baseline information for elucidating the mechanism of phenylpropanoid biosynthesis in different organs of I. dentata var. albiflora .

  4. Small homologous blocks in phytophthora genomes do not point to an ancient whole-genome duplication.

    Science.gov (United States)

    van Hooff, Jolien J E; Snel, Berend; Seidl, Michael F

    2014-05-01

    Genomes of the plant-pathogenic genus Phytophthora are characterized by small duplicated blocks consisting of two consecutive genes (2HOM blocks) and by an elevated abundance of similarly aged gene duplicates. Both properties, in particular the presence of 2HOM blocks, have been attributed to a whole-genome duplication (WGD) at the last common ancestor of Phytophthora. However, large intraspecies synteny-compelling evidence for a WGD-has not been detected. Here, we revisited the WGD hypothesis by deducing the age of 2HOM blocks. Two independent timing methods reveal that the majority of 2HOM blocks arose after divergence of the Phytophthora lineages. In addition, a large proportion of the 2HOM block copies colocalize on the same scaffold. Therefore, the presence of 2HOM blocks does not support a WGD at the last common ancestor of Phytophthora. Thus, genome evolution of Phytophthora is likely driven by alternative mechanisms, such as bursts of transposon activity.

  5. Space astronomy and astrophysics program by CSA

    Science.gov (United States)

    Laurin, Denis; Ouellet, Alain; Dupuis, Jean; Chicoine, Ruth-Ann

    2014-07-01

    Canada became actively engaged in space astronomy in the 1990s by contributing two fine guidance sensors to the FUSE Far-UV mission (NASA 1999-2008). In the same period, Canada contributed to ODIN's infrared instrument (ESA 2001-2006) and correlators for VSOP (JAXA 1997-2005). In early 2000, Canada developed its own space telescope, Micro-variability and Observations of STars (MOST), a 15-cm telescope on a microsatellite, operating since 2003, and more recently contributed to the realization of the BRITE nanosatellites constellation. Canada also provided hardware to the European Space Agency's Herschel HIFI instrument and simulators to the SPIRE instrument and data analysis tools for Planck. More recently the Canadian Space Agency (CSA) delivered detector units for the UVIT instrument on board the Indian Space Research Organisation's (ISRO) ASTROSAT. The CSA's most important contribution to a space astronomy mission to date is the Fine Guidance Senor (FGS) and Near Infrared Imager and Slitless Spectrograph (NIRISS) instrument to NASA's James Webb Space Telescope. The CSA is currently building the laser metrology system for JAXA's ASTRO-H hard X-ray telescope. Canadian astronomers contributed to several high profile stratospheric balloon projects investigating the CMB and the CSA recently established a balloon launch facility. As expressed in Canada's new Space Policy Framework announced in February 2014, Canada remains committed to future space exploration endeavors. The policy aims at ensure that Canada is a sought-after partner in the international space exploration missions that serve Canada's national interests; and continuing to invest in the development of Canadian contributions in the form of advanced systems and optical instruments. In the longer term, through consultations and in keeping the Canadian astronomical community's proposed Long Range Plan, the CSA is exploring possibilities to contributions to important missions such as WFIRST, SPICA and Athena

  6. Structural Studies on Plasmodium falciparum Erythrocyte Membrane Protein 1 (PfEMP1) Malaria Antigens Using Small Angle X-Ray Scattering (SAXS)

    DEFF Research Database (Denmark)

    Christoffersen, Stig

    Chemistry (App I) [1]. VAR2CSA binds specifically to CSA in the placental tissue of pregnant women hereby causing severe malaria symptoms endangering both mother and child. The minimal VAR2CSA region required to effectively bind CSA was determined to be the N-terminal DBL domain, DBL2X which we locate......Infection with the pathogenic Plasmodium falciparum parasite causes the potentially deadly Malaria disease which leads to over 1 million fatalities each year according to the WHO (World Health Organization). Individuals subjected to multiple infections gradually become immune to the disease...... symptoms and vaccine research is focused on trying to mimic or advance this immune acquisition. Immunity is primarily caused by acquisition of antibodies directed against a family of Plasmodium protein antigens called PfEMP1s located on the surface of infected erythrocytes. The PfEMP1 proteins are adhesive...

  7. Human ETS2 gene on chromosome 21 is not rearranged in Alzheimer disease

    International Nuclear Information System (INIS)

    Sacchi, N.; Nalbantoglu, J.; Sergovich, F.R.; Papas, T.S.

    1988-01-01

    The human ETS2 gene, a member of the ETS gene family, with sequence homology with the retroviral ets sequence of the avian erythroblastosis retrovirus E26 is located on chromosome 21. Molecular genetic analysis of Down syndrome (DS) patients with partial trisomy 21 allowed us to reinforce the supposition that ETS2 may be a gene of the minimal DS genetic region. It was originally proposed that a duplication of a portion of the DS region represents the genetic basis of Alzheimer disease, a condition associated also with DS. No evidence of either rearrangements or duplications of ETS2 could be detected in DNA from fibroblasts and brain tissue of Alzheimer disease patients with either the sporadic or the familiar form of the disease. Thus, an altered ETS2 gene dosage does not seem to be a genetic cause or component of Alzheimer disease

  8. Genome-Wide Analysis of the AP2/ERF Gene Family in Physic Nut and Overexpression of the JcERF011 Gene in Rice Increased Its Sensitivity to Salinity Stress.

    Science.gov (United States)

    Tang, Yuehui; Qin, Shanshan; Guo, Yali; Chen, Yanbo; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2016-01-01

    The AP2/ERF transcription factors play crucial roles in plant growth, development and responses to biotic and abiotic stresses. A total of 119 AP2/ERF genes (JcAP2/ERFs) have been identified in the physic nut genome; they include 16 AP2, 4 RAV, 1 Soloist, and 98 ERF genes. Phylogenetic analysis indicated that physic nut AP2 genes could be divided into 3 subgroups, while ERF genes could be classed into 11 groups or 43 subgroups. The AP2/ERF genes are non-randomly distributed across the 11 linkage groups of the physic nut genome and retain many duplicates which arose from ancient duplication events. The expression patterns of several JcAP2/ERF duplicates in the physic nut showed differences among four tissues (root, stem, leaf, and seed), and 38 JcAP2/ERF genes responded to at least one abiotic stressor (drought, salinity, phosphate starvation, and nitrogen starvation) in leaves and/or roots according to analysis of digital gene expression tag data. The expression of JcERF011 was downregulated by salinity stress in physic nut roots. Overexpression of the JcERF011 gene in rice plants increased its sensitivity to salinity stress. The increased expression levels of several salt tolerance-related genes were impaired in the JcERF011-overexpressing plants under salinity stress.

  9. "Tandem duplication-random loss" is not a real feature of oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Zhang Guofan

    2009-02-01

    Full Text Available Abstract Duplications and rearrangements of coding genes are major themes in the evolution of mitochondrial genomes, bearing important consequences in the function of mitochondria and the fitness of organisms. Yu et al. (BMC Genomics 2008, 9:477 reported the complete mt genome sequence of the oyster Crassostrea hongkongensis (16,475 bp and found that a DNA segment containing four tRNA genes (trnK1, trnC, trnQ1 and trnN, a duplicated (rrnS and a split rRNA gene (rrnL5' was absent compared with that of two other Crassostrea species. It was suggested that the absence was a novel case of "tandem duplication-random loss" with evolutionary significance. We independently sequenced the complete mt genome of three C. hongkongensis individuals, all of which were 18,622 bp and contained the segment that was missing in Yu et al.'s sequence. Further, we designed primers, verified sequences and demonstrated that the sequence loss in Yu et al.'s study was an artifact caused by placing primers in a duplicated region. The duplication and split of ribosomal RNA genes are unique for Crassostrea oysters and not lost in C. hongkongensis. Our study highlights the need for caution when amplifying and sequencing through duplicated regions of the genome.

  10. Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes.

    Science.gov (United States)

    Biedler, James K; Tu, Zhijian

    2010-07-08

    codon shows promoter activity at least as early as 3 hours in the developing Ae. aegypti embryo. The AaKLC2.1 promoter activity reached ~1600 fold over the negative control at 5 hr after egg deposition. Transcriptome profiling by use of high throughput sequencing technologies has proven to be a valuable method for the identification and discovery of early and transient zygotic genes. The evolutionary investigation of the KLC gene family reveals that duplication is a source for the evolution of new genes that play a role in the dynamic process of early embryonic development. AaKLC2.1 may provide a promoter for early zygotic-specific transgene expression, which is a key component of the Medea gene drive system.

  11. Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes

    Directory of Open Access Journals (Sweden)

    Tu Zhijian

    2010-07-01

    1 kb fragment upstream of the AaKLC2.1 start codon shows promoter activity at least as early as 3 hours in the developing Ae. aegypti embryo. The AaKLC2.1 promoter activity reached ~1600 fold over the negative control at 5 hr after egg deposition. Conclusions Transcriptome profiling by use of high throughput sequencing technologies has proven to be a valuable method for the identification and discovery of early and transient zygotic genes. The evolutionary investigation of the KLC gene family reveals that duplication is a source for the evolution of new genes that play a role in the dynamic process of early embryonic development. AaKLC2.1 may provide a promoter for early zygotic-specific transgene expression, which is a key component of the Medea gene drive system.

  12. ClinVar data parsing [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Xiaolei Zhang

    2017-05-01

    Full Text Available This software repository provides a pipeline for converting raw ClinVar data files into analysis-friendly tab-delimited tables, and also provides these tables for the most recent ClinVar release. Separate tables are generated for genome builds GRCh37 and GRCh38 as well as for mono-allelic variants and complex multi-allelic variants. Additionally, the tables are augmented with allele frequencies from the ExAC and gnomAD datasets as these are often consulted when analyzing ClinVar variants. Overall, this work provides ClinVar data in a format that is easier to work with and can be directly loaded into a variety of popular analysis tools such as R, python pandas, and SQL databases.

  13. FGFR3 gene mutation plus GRB10 gene duplication in a patient with achondroplasia plus growth delay with prenatal onset.

    Science.gov (United States)

    Yuan, Haiming; Huang, Linhuan; Hu, Xizi; Li, Qian; Sun, Xiaofang; Xie, Yingjun; Kong, Shu; Wang, Xiaoman

    2016-07-02

    Achondroplasia is a well-defined and common bone dysplasia. Genotype- and phenotype-level correlations have been found between the clinical symptoms of achondroplasia and achondroplasia-specific FGFR3 mutations. A 2-year-old boy with clinical features consistent with achondroplasia and Silver-Russell syndrome-like symptoms was found to carry a mutation in the fibroblast growth factor receptor-3 (FGFR3) gene at c.1138G > A (p.Gly380Arg) and a de novo 574 kb duplication at chromosome 7p12.1 that involved the entire growth-factor receptor bound protein 10 (GRB10) gene. Using quantitative real-time PCR analysis, GRB10 was over-expressed, and, using enzyme-linked immunosorbent assays for IGF1 and IGF-binding protein-3 (IGFBP3), we found that IGF1 and IGFBP3 were low-expressed in this patient. We demonstrate that a combination of uncommon, rare and exceptional molecular defects related to the molecular bases of particular birth defects can be analyzed and diagnosed to potentially explain the observed variability in the combination of molecular defects.

  14. TMPRSS2-ERG gene fusion status in minute (minimal) prostatic adenocarcinoma.

    Science.gov (United States)

    Albadine, Roula; Latour, Mathieu; Toubaji, Antoun; Haffner, Michael; Isaacs, William B; A Platz, Elizabeth; Meeker, Alan K; Demarzo, Angelo M; Epstein, Jonathan I; Netto, George J

    2009-11-01

    Minute prostatic adenocarcinomas are considered to be of insufficient virulence. Given recent suggestions of TMPRSS2-ERG gene fusion association with aggressive prostatic adenocarcinoma, we evaluated the incidence of TMPRSS2-ERG fusion in minute prostatic adenocarcinomas. A total of 45 consecutive prostatectomies with minute adenocarcinoma were used for tissue microarray construction. A total of 63 consecutive non-minimal, Gleason Score 6 tumors, from a separate PSA Era prostatectomy tissue microarray, were used for comparison. FISH was carried out using ERG break-apart probes. Tumors were assessed for fusion by deletion (Edel) or split (Esplit), duplicated fusions and low-level copy number gain in normal ERG gene locus. Minute adenocarcinomas: Fusion was evaluable in 32/45 tumors (71%). Fifteen out of 32 (47%) tumors were positive for fusion. Six (19%) were of the Edel class and 7 (22%) were classified as combined Edel+Esplit. Non-minute adenocarcinomas (pT2): Fusion was identified in 20/30 tumors (67%). Four (13%) were of Edel class and 5 (17%) were combined Edel+Esplit. Duplicated fusions were encountered in 5 (16%) tumors. Non-minute adenocarcinomas (pT3): Fusion was identified in 19/33 (58%). Fusion was due to a deletion in 6 (18%) tumors. Seven tumors (21%) were classified as combined Edel+Esplit. One tumor showed Esplit alone. Duplicated fusions were encountered in 3 (9%) cases. The incidence of duplicated fusions was higher in non-minute adenocarcinomas (13 vs 0%; P=0.03). A trend for higher incidence of low-level copy number gain in normal ERG gene locus without fusion was noted in non-minute adenocarcinomas (10 vs 0%; P=0.07). We found a TMPRSS2-ERG fusion rate of 47% in minute adenocarcinomas. The latter is not significantly different from that of grade matched non-minute adenocarcinomas. The incidence of duplicated fusion was higher in non-minute adenocarcinomas. Our finding of comparable rate of TMPRSS2-ERG fusion in minute adenocarcinomas may argue

  15. A novel pig feed formulation containing Aspergillus niger CSA35 ...

    African Journals Online (AJOL)

    This study investigated the effects of Aspergillus niger CSA35 pretreated-cassava (Manihot esculenta Crantz) peel feed (CPFG) on the body weight gain and some selected biochemical parameters of pigs. Cassava peels treated with biomass of A. niger CSA35 for a period of three weeks to initiate enzymatic digestion of ...

  16. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  17. Duplication of the dystroglycan gene in most branches of teleost fish

    Directory of Open Access Journals (Sweden)

    Giardina Bruno

    2007-05-01

    Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details

  18. Molecular mapping of the novel powdery mildew resistance gene Pm36 introgressed from Triticum turgidum var. dicoccoides in durum wheat.

    Science.gov (United States)

    Blanco, Antonio; Gadaleta, A; Cenci, A; Carluccio, A V; Abdelbacki, A M M; Simeone, R

    2008-06-01

    Powdery mildew, caused by Blumeria graminis f.sp. tritici, is one of the most important wheat diseases in many regions of the world. Triticum turgidum var. dicoccoides (2n=4x=AABB), the progenitor of cultivated wheats, shows particular promises as a donor of useful genetic variation for several traits, including disease resistances. The wild emmer accession MG29896, resistant to powdery mildew, was backcrossed to the susceptible durum wheat cultivar Latino, and a set of backcross inbred lines (BC(5)F(5)) was produced. Genetic analysis of F(3) populations from two resistant introgression lines (5BIL-29 x Latino and 5BIL-42 x Latino) indicated that the powdery mildew resistance is controlled by a single dominant gene. Molecular markers and the bulked segregant analysis were used to characterize and map the powdery mildew resistance. Five AFLP markers (XP43M32((250)), XP46M31((410)), XP41M37((100)), XP41M39((250)), XP39M32((120))), three genomic SSR markers (Xcfd07, Xwmc75, Xgwm408) and one EST-derived SSR marker (BJ261635) were found to be linked to the resistance gene in 5BIL-29 and only the BJ261635 marker in 5BIL-42. By means of Chinese Spring nullisomic-tetrasomic, ditelosomic and deletion lines, the polymorphic markers and the resistance gene were assigned to chromosome bin 5BL6-0.29-0.76. These results indicated that the two lines had the same resistance gene and that the introgressed dicoccoides chromosome segment was longer (35.5 cM) in 5BIL-29 than that introgressed in 5BIL-42 (less than 1.5 cM). As no powdery mildew resistance gene has been reported on chromosome arm 5BL, the novel resistance gene derived from var. dicoccoides was designated Pm36. The 244 bp allele of BJ261635 in 5BIL-42 can be used for marker-assisted selection during the wheat resistance breeding process for facilitating gene pyramiding.

  19. MLL duplication in a pediatric patient with B-cell lymphoblastic lymphoma.

    Science.gov (United States)

    Mater, David Van; Goodman, Barbara K; Wang, Endi; Gaca, Ana M; Wechsler, Daniel S

    2012-04-01

    Lymphoblastic lymphoma is the second most common type of non-Hodgkin lymphoma seen in children. Approximately, 90% of lymphoblastic lymphomas arise from T cells, with the remaining 10% being B-cell-lineage derived. Although T-cell lymphoblastic lymphoma most frequently occurs in the anterior mediastinum (thymus), B-cell lymphoblastic lymphoma (B-LBL) predominates in extranodal sites such as skin and bone. Here, we describe a pediatric B-LBL patient who presented with extensive abdominal involvement and whose lymphoma cells displayed segmental duplication of the mixed lineage leukemia (MLL) gene. MLL duplication/amplification has been described primarily in acute myeloid leukemia and myelodysplastic syndrome with no published reports of discrete MLL duplication/amplification events in B-LBL. The MLL gene duplication noted in this case may represent a novel mechanism for tumorigenesis in B-LBL.

  20. Exact eigenstates and open-quotes trivialityclose quotes of λ(var-phi *var-phi)2 theory in the Feshbach-Villars formulation

    International Nuclear Information System (INIS)

    Darewych, J.W.

    1997-01-01

    The complex scalar (Klein-Gordon) quantum field theory (QFT) with a λ(var-phi * var-phi) 2 interaction is considered in the Feshbach-Villars formulation. It is shown that exact few-particle eigenstates of the QFT Hamiltonian can be obtained. The resulting relativistic few-body equations correspond to Klein-Gordon particles interacting via delta-function, or open-quotes contact,close quotes potentials. Momentum-space solutions of the two-body equation yield a open-quotes trivialclose quotes unity S matrix. copyright 1997 The American Physical Society

  1. Emergence of a Homo sapiens-specific gene family and chromosome 16p11.2 CNV susceptibility.

    Science.gov (United States)

    Nuttle, Xander; Giannuzzi, Giuliana; Duyzend, Michael H; Schraiber, Joshua G; Narvaiza, Iñigo; Sudmant, Peter H; Penn, Osnat; Chiatante, Giorgia; Malig, Maika; Huddleston, John; Benner, Chris; Camponeschi, Francesca; Ciofi-Baffoni, Simone; Stessman, Holly A F; Marchetto, Maria C N; Denman, Laura; Harshman, Lana; Baker, Carl; Raja, Archana; Penewit, Kelsi; Janke, Nicolette; Tang, W Joyce; Ventura, Mario; Banci, Lucia; Antonacci, Francesca; Akey, Joshua M; Amemiya, Chris T; Gage, Fred H; Reymond, Alexandre; Eichler, Evan E

    2016-08-11

    Genetic differences that specify unique aspects of human evolution have typically been identified by comparative analyses between the genomes of humans and closely related primates, including more recently the genomes of archaic hominins. Not all regions of the genome, however, are equally amenable to such study. Recurrent copy number variation (CNV) at chromosome 16p11.2 accounts for approximately 1% of cases of autism and is mediated by a complex set of segmental duplications, many of which arose recently during human evolution. Here we reconstruct the evolutionary history of the locus and identify bolA family member 2 (BOLA2) as a gene duplicated exclusively in Homo sapiens. We estimate that a 95-kilobase-pair segment containing BOLA2 duplicated across the critical region approximately 282 thousand years ago (ka), one of the latest among a series of genomic changes that dramatically restructured the locus during hominid evolution. All humans examined carried one or more copies of the duplication, which nearly fixed early in the human lineage--a pattern unlikely to have arisen so rapidly in the absence of selection (P sapiens-specific duplication. In summary, the duplicative transposition of BOLA2 at the root of the H. sapiens lineage about 282 ka simultaneously increased copy number of a gene associated with iron homeostasis and predisposed our species to recurrent rearrangements associated with disease.

  2. Gene duplication and divergence affecting drug content in Cannabis sativa.

    Science.gov (United States)

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David

    2015-12-01

    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  3. Intragenic duplication: a novel mutational mechanism in hereditary pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, Maiken T; Geisz, Andrea; Brusgaard, Klaus

    2011-01-01

    In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide of cationic...

  4. Genome specific PPARαB duplicates in salmonids and insights into estrogenic regulation in brown trout.

    Science.gov (United States)

    Madureira, Tânia Vieira; Pinheiro, Ivone; de Paula Freire, Rafaelle; Rocha, Eduardo; Castro, Luis Filipe; Urbatzka, Ralph

    2017-06-01

    Peroxisome proliferator-activated receptors (PPARs) are key regulators of many processes in vertebrates, such as carbohydrate and lipid metabolism. PPARα, a member of the PPAR nuclear receptor gene subfamily (NR1C1), is involved in fatty acid metabolism, namely in peroxisomal β-oxidation. Two gene paralogues, pparαA and pparαB, were described in several teleost species with their origin dating back to the teleost-specific genome duplication (3R). Given the additional salmonid-specific genome duplication (4R), four genes could be theoretically anticipated for this gene subfamily. In this work, we examined the pparα gene repertoire in brown trout, Salmo trutta f. fario. Data disclosed two pparα-like sequences in brown trout. Phylogenetic analyses further revealed that the isolated genes are most likely genome pparαB duplicates, pparαBa and pparαBb, while pparαA is apparently absent in salmonids. Both genes showed a ubiquitous mRNA expression across a panel of 11 different organs. In vitro exposed primary brown trout hepatocytes strongly suggest that pparα gene paralogues are differently regulated by ethinylestradiol (EE2). PparαBb mRNA expression significantly decreased with dosage, reaching significance after exposure to 50μM EE2, while pparαBa mRNA increased, significant at 1μM EE2. The present data enhances the understanding of pparα function and evolution in teleost, and reinforces the evidence of a potential crosstalk between estrogenic and pparα signaling pathways. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Plasticity and innovation of regulatory mechanisms underlying seed oil content mediated by duplicated genes in the palaeopolyploid soybean.

    Science.gov (United States)

    Zhang, Dajian; Zhao, Meixia; Li, Shuai; Sun, Lianjun; Wang, Weidong; Cai, Chunmei; Dierking, Emily C; Ma, Jianxin

    2017-06-01

    Many plants have undergone whole genome duplication (WGD). However, how regulatory networks underlying a particular trait are reshaped in polyploids has not been experimentally investigated. Here we show that the regulatory pathways modulating seed oil content, which involve WRINKLED1 (WRI1), LEAFY COTYLEDON1 (LEC1), and LEC2 in Arabidopsis, have been modified in the palaeopolyploid soybean. Such modifications include functional reduction of GmWRI1b of the GmWRI1a/GmWRI1b homoeologous pair relevant to WRI1, complementary non-allelic dosage effects of the GmLEC1a/GmLEC1b homoeologous pair relevant to LEC1, pseudogenization of the singleton GmLEC2 relevant to LEC2, and the rise of the LEC2-like function of GmABI3b, contrasting to its homoeolog GmABI3a, which maintains the ABSCISIC ACID INSENSITIVE 3 (ABI3)-like function in modulating seed maturation and dormancy. The function of GmABI3b in modulating seed oil biosynthesis was fulfilled by direct binding to a RY (CATGCA) cis-regulatory element in the GmWRI1a promoter, which was absent in the GmWRI1b promoter, resulting in reduction of the GmWRI1b expression. Nevertheless, the three regulators each exhibited similar intensities of purifying selection to their respective duplicates since these pairs were formed by a WGD event that is proposed to have occurred approximately 13 million years ago (mya), suggesting that the differentiation in spatiotemporal expression between the duplicated genes is more likely to be the outcome of neutral variation in regulatory sequences. This study thus exemplifies the plasticity, dynamics, and novelty of regulatory networks mediated by WGD. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  6. Cockayne syndrome group B (Csb) and group a (Csa) deficiencies predispose to hearing loss and cochlear hair cell degeneration in mice.

    Science.gov (United States)

    Nagtegaal, A Paul; Rainey, Robert N; van der Pluijm, Ingrid; Brandt, Renata M C; van der Horst, Gijsbertus T J; Borst, J Gerard G; Segil, Neil

    2015-03-11

    Sensory hair cells in the cochlea, like most neuronal populations that are postmitotic, terminally differentiated, and non-regenerating, depend on robust mechanisms of self-renewal for lifelong survival. We report that hair cell homeostasis requires a specific sub-branch of the DNA damage nucleotide excision repair pathway, termed transcription-coupled repair (TCR). Cockayne syndrome (CS), caused by defects in TCR, is a rare DNA repair disorder with a broad clinical spectrum that includes sensorineural hearing loss. We tested hearing and analyzed the cellular integrity of the organ of Corti in two mouse models of this disease with mutations in the Csb gene (CSB(m/m) mice) and Csa gene (Csa(-/-) mice), respectively. Csb(m/m) and Csa(-/-) mice manifested progressive hearing loss, as measured by an increase in auditory brainstem response thresholds. In contrast to wild-type mice, mutant mice showed reduced or absent otoacoustic emissions, suggesting cochlear outer hair cell impairment. Hearing loss in Csb(m/m) and Csa(-/-) mice correlated with progressive hair cell loss in the base of the organ of Corti, starting between 6 and 13 weeks of age, which increased by 16 weeks of age in a basal-to-apical gradient, with outer hair cells more severely affected than inner hair cells. Our data indicate that the hearing loss observed in CS patients is reproduced in mouse models of this disease. We hypothesize that accumulating DNA damage, secondary to the loss of TCR, contributes to susceptibility to hearing loss. Copyright © 2015 the authors 0270-6474/15/354280-07$15.00/0.

  7. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    NARCIS (Netherlands)

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes.

  8. Quinclorac resistance induced by the suppression of the expression of 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase genes in Echinochloa crus-galli var. zelayensis.

    Science.gov (United States)

    Gao, Yuan; Li, Jun; Pan, Xukun; Liu, Dingrong; Napier, Richard; Dong, Liyao

    2018-04-01

    We previously reported that the mechanism of quinclorac resistance in Echinochloa crus-galli var. zelayensis may be closely related to ethylene biosynthesis and the detoxification of cyanide. Differences in EcCAS gene sequences and expression levels may result in higher capacity to detoxify cyanide in resistant biotypes, which may avoid cyanide accumulation and avoid more ethylene and cyanide production and then avoid damage. In the present study, we focused on the mechanism of resistance related to ethylene biosynthesis in E. crus-galli var. zelayensis. The fresh weight of susceptible and moderately resistant biotypes were significantly reduced after treatment with quinclorac. However, AOA, an ethylene biosynthesis inhibitor, reduced the impact of quinclorac. On pretreatment with AOA, ethylene production was significantly reduced in the three biotypes. The highly resistant biotype produced less ethylene compared to the other two biotypes. Three ACS and seven ACO genes, which are the key genes in ethylene biosynthesis, were obtained. The expression levels of EcACS-like, EcACS7, and EcACO1 varied in the three biotypes upon treatment with quinclorac, which could be manipulated by AOA. In summary, it is inferred that the expression of EcACS-like, EcACS7, and EcACO1 can be stimulated to varying extent after quinclorac treatment in three E. crus-galli var. zelayensis biotypes, which consequently results in varying levels of ethylene production. Lower expression of these three genes results in more resistance to quinclorac, which may also be related to quinclorac resistance in E. crus-galli var. zelayensis. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Analysis of high-identity segmental duplications in the grapevine genome

    Directory of Open Access Journals (Sweden)

    Carelli Francesco N

    2011-08-01

    Full Text Available Abstract Background Segmental duplications (SDs are blocks of genomic sequence of 1-200 kb that map to different loci in a genome and share a sequence identity > 90%. SDs show at the sequence level the same characteristics as other regions of the human genome: they contain both high-copy repeats and gene sequences. SDs play an important role in genome plasticity by creating new genes and modeling genome structure. Although data is plentiful for mammals, not much was known about the representation of SDs in plant genomes. In this regard, we performed a genome-wide analysis of high-identity SDs on the sequenced grapevine (Vitis vinifera genome (PN40024. Results We demonstrate that recent SDs (> 94% identity and >= 10 kb in size are a relevant component of the grapevine genome (85 Mb, 17% of the genome sequence. We detected mitochondrial and plastid DNA and genes (10% of gene annotation in segmentally duplicated regions of the nuclear genome. In particular, the nine highest copy number genes have a copy in either or both organelle genomes. Further we showed that several duplicated genes take part in the biosynthesis of compounds involved in plant response to environmental stress. Conclusions These data show the great influence of SDs and organelle DNA transfers in modeling the Vitis vinifera nuclear DNA structure as well as the impact of SDs in contributing to the adaptive capacity of grapevine and the nutritional content of grape products through genome variation. This study represents a step forward in the full characterization of duplicated genes important for grapevine cultural needs and human health.

  10. Isolation, identification and in silico analysis of alpha-amylase gene of Aspergillus niger strain CSA35 obtained from cassava undergoing spoilage

    Directory of Open Access Journals (Sweden)

    Oghenetega J. Avwioroko

    2018-07-01

    Full Text Available In this investigation, a gene (CDF_Amyl encoding extracellular α-amylase in Aspergillus niger strain CSA35 associated with cassava spoilage was amplified using specific primers and characterized in silico. The gene had a partial nucleotide sequence of 968 bp and encoded a protein of 222 aa residues with a molecular weight and isoelectric point of 25.13 kDa and 4.17, respectively. Its catalytic site was located in the active site domain. BLASTp analysis showed that the protein primary sequence of the α-amylase gene had 98% and 99% homologies with the α-amylase of A. niger and A. oryzae RIB40, respectively. The gene is more closely related to α-amylase genes from fungi than to bacterial, plant, or animal α-amylase genes. Restriction mapping of the gene showed it can be digested with restriction enzymes like NcoI, PstI, SmaI, and BcLI among others but not with EcoRI and EcoRV. Its protein product had a hydrophobicity score of − 0.43 but no transmembrane helix. The CDF_Amyl protein was subcellularly localized in the secretory pathway, an indication of its release into extracellular space after secretion. Also, the 3D structure of the CDF-Amyl protein was barrel-shaped with domains characteristic of α-amylases. The encoded α-amylase Vmax is 6.90 U/mg protein and Km is 6.70 mg/ml. It was concluded that the unique characteristics of the CDF_Amyl gene and its deduced protein could find applications in biotechnological, food and pharmaceutical industries where cloning and further modification of this gene would be required for product development and improvement.

  11. Evolution of trappin genes in mammals

    Directory of Open Access Journals (Sweden)

    Furutani Yutaka

    2010-01-01

    Full Text Available Abstract Background Trappin is a multifunctional host-defense peptide that has antiproteolytic, antiinflammatory, and antimicrobial activities. The numbers and compositions of trappin paralogs vary among mammalian species: human and sheep have a single trappin-2 gene; mouse and rat have no trappin gene; pig and cow have multiple trappin genes; and guinea pig has a trappin gene and two other derivativegenes. Independent duplications of trappin genes in pig and cow were observed recently after the species were separated. To determine whether these trappin gene duplications are restricted only to certain mammalian lineages, we analyzed recently-developed genome databases for the presence of duplicate trappin genes. Results The database analyses revealed that: 1 duplicated trappin multigenes were found recently in the nine-banded armadillo; 2 duplicated two trappin genes had been found in the Afrotherian species (elephant, tenrec, and hyrax since ancient days; 3 a single trappin-2 gene was found in various eutherians species; and 4 no typical trappin gene has been found in chicken, zebra finch, and opossum. Bayesian analysis estimated the date of the duplication of trappin genes in the Afrotheria, guinea pig, armadillo, cow, and pig to be 244, 35, 11, 13, and 3 million-years ago, respectively. The coding regions of trappin multigenes of almadillo, bovine, and pig evolved much faster than the noncoding exons, introns, and the flanking regions, showing that these genes have undergone accelerated evolution, and positive Darwinian selection was observed in pig-specific trappin paralogs. Conclusion These results suggest that trappin is an eutherian-specific molecule and eutherian genomes have the potential to form trappin multigenes.

  12. The vertebrate ancestral repertoire of visual opsins, transducin alpha subunits and oxytocin/vasopressin receptors was established by duplication of their shared genomic region in the two rounds of early vertebrate genome duplications.

    Science.gov (United States)

    Lagman, David; Ocampo Daza, Daniel; Widmark, Jenny; Abalo, Xesús M; Sundström, Görel; Larhammar, Dan

    2013-11-02

    Vertebrate color vision is dependent on four major color opsin subtypes: RH2 (green opsin), SWS1 (ultraviolet opsin), SWS2 (blue opsin), and LWS (red opsin). Together with the dim-light receptor rhodopsin (RH1), these form the family of vertebrate visual opsins. Vertebrate genomes contain many multi-membered gene families that can largely be explained by the two rounds of whole genome duplication (WGD) in the vertebrate ancestor (2R) followed by a third round in the teleost ancestor (3R). Related chromosome regions resulting from WGD or block duplications are said to form a paralogon. We describe here a paralogon containing the genes for visual opsins, the G-protein alpha subunit families for transducin (GNAT) and adenylyl cyclase inhibition (GNAI), the oxytocin and vasopressin receptors (OT/VP-R), and the L-type voltage-gated calcium channels (CACNA1-L). Sequence-based phylogenies and analyses of conserved synteny show that the above-mentioned gene families, and many neighboring gene families, expanded in the early vertebrate WGDs. This allows us to deduce the following evolutionary scenario: The vertebrate ancestor had a chromosome containing the genes for two visual opsins, one GNAT, one GNAI, two OT/VP-Rs and one CACNA1-L gene. This chromosome was quadrupled in 2R. Subsequent gene losses resulted in a set of five visual opsin genes, three GNAT and GNAI genes, six OT/VP-R genes and four CACNA1-L genes. These regions were duplicated again in 3R resulting in additional teleost genes for some of the families. Major chromosomal rearrangements have taken place in the teleost genomes. By comparison with the corresponding chromosomal regions in the spotted gar, which diverged prior to 3R, we could time these rearrangements to post-3R. We present an extensive analysis of the paralogon housing the visual opsin, GNAT and GNAI, OT/VP-R, and CACNA1-L gene families. The combined data imply that the early vertebrate WGD events contributed to the evolution of vision and the

  13. The Drosophila Su(var)3-7 gene is required for oogenesis and female fertility, genetically interacts with piwi and aubergine, but impacts only weakly transposon silencing.

    Science.gov (United States)

    Basquin, Denis; Spierer, Anne; Begeot, Flora; Koryakov, Dmitry E; Todeschini, Anne-Laure; Ronsseray, Stéphane; Vieira, Cristina; Spierer, Pierre; Delattre, Marion

    2014-01-01

    Heterochromatin is made of repetitive sequences, mainly transposable elements (TEs), the regulation of which is critical for genome stability. We have analyzed the role of the heterochromatin-associated Su(var)3-7 protein in Drosophila ovaries. We present evidences that Su(var)3-7 is required for correct oogenesis and female fertility. It accumulates in heterochromatic domains of ovarian germline and somatic cells nuclei, where it co-localizes with HP1. Homozygous mutant females display ovaries with frequent degenerating egg-chambers. Absence of Su(var)3-7 in embryos leads to defects in meiosis and first mitotic divisions due to chromatin fragmentation or chromosome loss, showing that Su(var)3-7 is required for genome integrity. Females homozygous for Su(var)3-7 mutations strongly impair repression of P-transposable element induced gonadal dysgenesis but have minor effects on other TEs. Su(var)3-7 mutations reduce piRNA cluster transcription and slightly impact ovarian piRNA production. However, this modest piRNA reduction does not correlate with transposon de-silencing, suggesting that the moderate effect of Su(var)3-7 on some TE repression is not linked to piRNA production. Strikingly, Su(var)3-7 genetically interacts with the piwi and aubergine genes, key components of the piRNA pathway, by strongly impacting female fertility without impairing transposon silencing. These results lead us to propose that the interaction between Su(var)3-7 and piwi or aubergine controls important developmental processes independently of transposon silencing.

  14. Insertional translocation leading to a 4q13 duplication including the EPHA5 gene in two siblings with attention-deficit hyperactivity disorder.

    Science.gov (United States)

    Matoso, Eunice; Melo, Joana B; Ferreira, Susana I; Jardim, Ana; Castelo, Teresa M; Weise, Anja; Carreira, Isabel M

    2013-08-01

    An insertional translocation (IT) can result in pure segmental aneusomy for the inserted genomic segment allowing to define a more accurate clinical phenotype. Here, we report on two siblings sharing an unbalanced IT inherited from the mother with a history of learning difficulty. An 8-year-old girl with developmental delay, speech disability, and attention-deficit hyperactivity disorder (ADHD), showed by GTG banding analysis a subtle interstitial alteration in 21q21. Oligonucleotide array comparative genomic hybridization (array-CGH) analysis showed a 4q13.1-q13.3 duplication spanning 8.6 Mb. Fluorescence in situ hybridization (FISH) with bacterial artificial chromosome (BAC) clones confirmed the rearrangement, a der(21)ins(21;4)(q21;q13.1q13.3). The duplication described involves 50 RefSeq genes including the EPHA5 gene that encodes for the EphA5 receptor involved in embryonic development of the brain and also in synaptic remodeling and plasticity thought to underlie learning and memory. The same rearrangement was observed in a younger brother with behavioral problems and also exhibiting ADHD. ADHD is among the most heritable of neuropsychiatric disorders. There are few reports of patients with duplications involving the proximal region of 4q and a mild phenotype. To the best of our knowledge this is the first report of a duplication restricted to band 4q13. This abnormality could be easily missed in children who have nonspecific cognitive impairment. The presence of this behavioral disorder in the two siblings reinforces the hypothesis that the region involved could include genes involved in ADHD. Copyright © 2013 Wiley Periodicals, Inc.

  15. Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

    Directory of Open Access Journals (Sweden)

    Yi-Bing Zhang

    Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

  16. Nuclear factor of activated T cell (NFAT) transcription proteins regulate genes involved in adipocyte metabolism and lipolysis

    International Nuclear Information System (INIS)

    Holowachuk, Eugene W.

    2007-01-01

    NFAT involvement in adipocyte physiological processes was examined by treatment with CsA and/or GSK3β inhibitors (Li + or TZDZ-8), which prevent or increase NFAT nuclear translocation, respectively. CsA treatment reduced basal and TNFα-induced rates of lipolysis by 50%. Adipocytes preincubated with Li + or TZDZ-8 prior to CsA and/or TNFα, exhibited enhanced basal rates of lipolysis and complete inhibition of CsA-mediated decreased rates of lipolysis. CsA treatment dramatically reduced the mRNA levels of adipocyte-specific genes (aP2, HSL, PPARγ, ACS and Adn), compared with control or TNFα-treatment, whereas Li + pretreatment blocked the inhibitory effects of CsA, and mRNA levels of aP2, HSL, PPARγ, and ACS were found at or above control levels. NFAT nuclear localization, assessed by EMSA, confirmed that CsA or Li + treatments inhibited or increased NFAT nuclear translocation, respectively. These results show that NFAT proteins in mature adipocytes participate in the transcriptional control of genes involved in adipocyte metabolism and lipolysis

  17. The fate of the duplicated androgen receptor in fishes: a late neofunctionalization event?

    Directory of Open Access Journals (Sweden)

    Haendler Bernard

    2008-12-01

    Full Text Available Abstract Background Based on the observation of an increased number of paralogous genes in teleost fishes compared with other vertebrates and on the conserved synteny between duplicated copies, it has been shown that a whole genome duplication (WGD occurred during the evolution of Actinopterygian fish. Comparative phylogenetic dating of this duplication event suggests that it occurred early on, specifically in teleosts. It has been proposed that this event might have facilitated the evolutionary radiation and the phenotypic diversification of the teleost fish, notably by allowing the sub- or neo-functionalization of many duplicated genes. Results In this paper, we studied in a wide range of Actinopterygians the duplication and fate of the androgen receptor (AR, NR3C4, a nuclear receptor known to play a key role in sex-determination in vertebrates. The pattern of AR gene duplication is consistent with an early WGD event: it has been duplicated into two genes AR-A and AR-B after the split of the Acipenseriformes from the lineage leading to teleost fish but before the divergence of Osteoglossiformes. Genomic and syntenic analyses in addition to lack of PCR amplification show that one of the duplicated copies, AR-B, was lost in several basal Clupeocephala such as Cypriniformes (including the model species zebrafish, Siluriformes, Characiformes and Salmoniformes. Interestingly, we also found that, in basal teleost fish (Osteoglossiformes and Anguilliformes, the two copies remain very similar, whereas, specifically in Percomorphs, one of the copies, AR-B, has accumulated substitutions in both the ligand binding domain (LBD and the DNA binding domain (DBD. Conclusion The comparison of the mutations present in these divergent AR-B with those known in human to be implicated in complete, partial or mild androgen insensitivity syndrome suggests that the existence of two distinct AR duplicates may be correlated to specific functional differences that may be

  18. Complete colonic duplication in children.

    Science.gov (United States)

    Khaleghnejad Tabari, Ahmad; Mirshemirani, Alireza; Khaleghnejad Tabari, Nasibeh

    2012-01-01

    Complete colonic duplication is a very rare congenital anomaly that may have different presentations according to its location and size. Complete colonic duplication can occur in 15% of gastrointestinal duplication. We report two cases of complete colonic duplications, and their characteristics. We present two patients with complete colonic duplication with different types and presentations. Case 1: A 2- year old boy presented to the clinic with abdominal protrusion, difficulty to defecate, chronic constipation and mucosal prolaps covered bulging (rectocele) since he was 6 months old. The patient had palpable pelvic mass with doughy consistency. Rectal exam confirmed perirectal mass with soft consistency. The patient underwent a surgical operation that had total tubular colorectal duplication with one blind end and was treated with simple fenestration of distal end, and was discharged without complication. After two years follow up, he had normal defecation and good weight gain. Case 2: A 2 -day old infant was referred with imperforate anus and complete duplication of recto-sigmoid colon, diphallus, double bladder, and hypospadiasis. After clinical and paraclinical investigations, he underwent operations in several stages in different periods, and was discharged without complications. After four years follow up, he led a normal life. The patients with complete duplication have to be examined carefully because of the high incidence of other systemic anomalies. Treatment includes simple resection of distal common wall, fenestration, and repair other associated anomalies.

  19. Evaluation of (+)-p-[11C]methylvesamicol for mapping sigma1 receptors: a comparison with [11C]SA4503

    International Nuclear Information System (INIS)

    Ishiwata, Kiichi; Kawamura, Kazunori; Yajima, Kazuyoshi; QingGeLeTu; Mori, Hirofumi; Shiba, Kazuhiro

    2006-01-01

    Vesamicol is a leading compound for positron emission tomography (PET) and single photon emission computed tomography (SPECT) tracers for mapping the vesicular acetylcholine transporter (VAChT). Recently, we found that (+)-p-methylvesamicol ((+)-PMV) has low affinity for VAChT (K i =199 nM), but has moderate to high affinity for sigma receptors: K i =3.0 nM for sigma 1 and K i =40.7 nM for sigma 2 , and that sigma 1 -selective SA4503 (K i =4.4 nM for sigma 1 and K i =242 nM for sigma 2 ) has moderate affinity for VAChT (K i =50.2 nM). In the present study, we examined the potential of (+)-[ 11 C]PMV as a PET radioligand for mapping sigma 1 receptors as compared with [ 11 C]SA4503. In rat brain, similar regional distribution patterns of (+)-[ 11 C]PMV and [ 11 C]SA4503 were shown by tissue dissection and by ex vivo autoradiography. Blocking experiments using (±)-PMV (-)-vesamicol, SA4503, haloperidol and (±)-pentazocine showed that the two tracers specifically bound to sigma 1 receptors, and that [ 11 C]SA4503 exhibited greater specific binding than (+)-[ 11 C]PMV. No sign of VAChT-specific binding by [ 11 C]SA4503 was observed in the striatum, which is rich in VAChT sites. In conclusion, (+)-[ 11 C]PMV specifically bound to sigma 1 receptors in the brain, but to a lesser extent than [ 11 C]SA4503, suggesting that (+)-[ 11 C]PMV is a less preferable PET ligand than [ 11 C]SA4503. On the other hand, the moderate affinity of [ 11 C]SA4503 for VAChT is negligible in vivo

  20. CSA-90 Promotes Bone Formation and Mitigates Methicillin-resistant Staphylococcus aureus Infection in a Rat Open Fracture Model.

    Science.gov (United States)

    Mills, Rebecca; Cheng, Tegan L; Mikulec, Kathy; Peacock, Lauren; Isaacs, David; Genberg, Carl; Savage, Paul B; Little, David G; Schindeler, Aaron

    2018-06-01

    Infection of open fractures remains a significant cause of morbidity and mortality to patients worldwide. Early administration of prophylactic antibiotics is known to improve outcomes; however, increasing concern regarding antimicrobial resistance makes finding new compounds for use in such cases a pressing area for further research. CSA-90, a synthetic peptidomimetic compound, has previously demonstrated promising antimicrobial action against Staphylococcus aureus in rat open fractures. However, its efficacy against antibiotic-resistant microorganisms, its potential as a therapeutic agent in addition to its prophylactic effects, and its proosteogenic properties all require further investigation. (1) Does prophylactic treatment with CSA-90 reduce infection rates in a rat open fracture model inoculated with S aureus, methicillin-resistant S aureus (MRSA), and methicillin-resistant Staphylococcus epidermidis (MRSE) as measured by survival, radiographic union, and deep tissue swab cultures? (2) Does CSA-90 reduce infection rates when administered later in the management of an open fracture as measured by survival, radiographic union, and deep tissue swab cultures? (3) Does CSA-90 demonstrate a synergistic proosteogenic effect with bone morphogenetic protein 2 (BMP-2) in a noninfected rat ectopic bone formation assay as assessed by micro-CT bone volume measurement? (4) Can CSA-90 elute and retain its antimicrobial efficacy in vitro when delivered using clinically relevant agents measured using a Kirby-Bauer disc diffusion assay? All in vivo studies were approved by the local animal ethics committee. In the open fracture studies, 12-week-old male Wistar rats underwent open midshaft femoral fractures stabilized with a 1.1-mm Kirschner wire and 10 µg BMP-2 ± 500 µg CSA-90 was applied to the fracture site using a collagen sponge along with 1 x 10 colony-forming units of bacteria (S aureus/MRSA/MRSE; n = 10 per group). In the delayed treatment study, débridement and

  1. Williams syndrome deletions and duplications: Genetic windows to understanding anxiety, sociality, autism, and schizophrenia.

    Science.gov (United States)

    Crespi, Bernard J; Procyshyn, Tanya L

    2017-08-01

    We describe and evaluate an integrative hypothesis for helping to explain the major neurocognitive features of individuals with Williams syndrome region deletions and duplications. First, we demonstrate how the cognitive differences between Williams syndrome individuals, individuals with duplications of this region, and healthy individuals parallel the differences between individuals subject to effects of increased or decreased oxytocin. Second, we synthesize evidence showing that variation in expression of the gene GTF2I (General Transcription Factor II-I) underlies the primary social phenotypes of Williams syndrome and that common genetic variation in GTF2I mediates oxytocin reactivity, and its correlates, in healthy populations. Third, we describe findings relevant to the hypothesis that the GTF2I gene is subject to parent of origin effects whose behavioral expression fits with predictions from the kinship theory of genomic imprinting. Fourth, we describe how Williams syndrome can be considered, in part, as an autistic syndrome of Lorna Wing's 'active-but-odd' autism subtype, in contrast to associations of duplications with both schizophrenia and autism. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. A case report: Becker muscular dystrophy presenting with epilepsy and dysgnosia induced by duplication mutation of Dystrophin gene.

    Science.gov (United States)

    Miao, Jing; Feng, Jia-Chun; Zhu, Dan; Yu, Xue-Fan

    2016-12-12

    Becker muscular dystrophy (BMD), a genetic disorder of X-linked recessive inheritance, typically presents with gradually progressive muscle weakness. The condition is caused by mutations of Dystrophin gene located at Xp21.2. Epilepsy is an infrequent manifestation of BMD, while cases of BMD with dysgnosia are extremely rare. We describe a 9-year-old boy with BMD, who presented with epilepsy and dysgnosia. Serum creatine kinase level was markedly elevated (3665 U/L). Wechsler intelligence tests showed a low intelligence quotient (IQ = 65). Electromyogram showed slight myogenic changes and skeletal muscle biopsy revealed muscular dystrophy. Immunohistochemical staining showed partial positivity of sarcolemma for dystrophin-N. Multiplex ligation-dependent probe amplification revealed a duplication mutation in exons 37-44 in the Dystrophin gene. The present case report helps to better understand the clinical and genetic features of BMD.

  3. Whole Genome and Tandem Duplicate Retention facilitated Glucosinolate Pathway Diversification in the Mustard Family.

    NARCIS (Netherlands)

    Hofberger, J.A.; Lyons, E.; Edger, P.P.; Pires, J.C.; Schranz, M.E.

    2013-01-01

    Plants share a common history of successive whole genome duplication (WGD) events retaining genomic patterns of duplicate gene copies (ohnologs) organized in conserved syntenic blocks. Duplication was often proposed to affect the origin of novel traits during evolution. However, genetic evidence

  4. A case report of Chinese brothers with inherited MECP2-containing duplication: autism and intellectual disability, but not seizures or respiratory infections

    OpenAIRE

    Xu, Xiu; Xu, Qiong; Zhang, Ying; Zhang, Xiaodi; Cheng, Tianlin; Wu, Bingbing; Ding, Yanhua; Lu, Ping; Zheng, Jingjing; Zhang, Min; Qiu, Zilong; Yu, Xiang

    2012-01-01

    Abstract Background Autistic spectrum disorders (ASDs) are a family of neurodevelopmental disorders with strong genetic components. Recent studies have shown that copy number variations in dosage sensitive genes can contribute significantly to these disorders. One such gene is the transcription factor MECP2, whose loss of function in females results in Rett syndrome, while its duplication in males results in developmental delay and autism. Case presentation Here, we identified a Chinese famil...

  5. A VAR2CSA:CSP conjugate capable of inducing dual specificity antibody responses

    DEFF Research Database (Denmark)

    Matondo, Sungwa; Thrane, Susan; Janitzek, Christoph Mikkel

    2017-01-01

    Catcher peptide. The covalent interaction between SpyTag/SpyCatcher enables the formation of DBL1x-DBL2x-ID2a:CSP conjugate vaccine. Immunogenicity and quality of antibody responses induced by the conjugate vaccine, as well as a control CSP-SpyCatcher vaccine, was tested in BALB/c mice.  Results: Serum samples...... obtained from mice immunized with the conjugate vaccine were able to recognize both untagged DBL1x-DBL2x-ID2a as well as CSP antigen. Moreover, the geometric mean anti-CSP antibody titer was 1.9-fold higher in serum (at day 35 and 55 post-first immunization) from mice immunized with the conjugate vaccine......, as compared to mice receiving the control vaccine.  Conclusion: The data obtained in this study serves as proof-of-concept for the simultaneous induction of antibodies directed against individual antigen components in a dual stage anti-malaria vaccine....

  6. Genome-wide signatures of 'rearrangement hotspots' within segmental duplications in humans.

    Directory of Open Access Journals (Sweden)

    Mohammed Uddin

    Full Text Available The primary objective of this study was to create a genome-wide high resolution map (i.e., >100 bp of 'rearrangement hotspots' which can facilitate the identification of regions capable of mediating de novo deletions or duplications in humans. A hierarchical method was employed to fragment segmental duplications (SDs into multiple smaller SD units. Combining an end space free pairwise alignment algorithm with a 'seed and extend' approach, we have exhaustively searched 409 million alignments to detect complex structural rearrangements within the reference-guided assembly of the NA18507 human genome (18× coverage, including the previously identified novel 4.8 Mb sequence from de novo assembly within this genome. We have identified 1,963 rearrangement hotspots within SDs which encompass 166 genes and display an enrichment of duplicated gene nucleotide variants (DNVs. These regions are correlated with increased non-allelic homologous recombination (NAHR event frequency which presumably represents the origin of copy number variations (CNVs and pathogenic duplications/deletions. Analysis revealed that 20% of the detected hotspots are clustered within the proximal and distal SD breakpoints flanked by the pathogenic deletions/duplications that have been mapped for 24 NAHR-mediated genomic disorders. FISH Validation of selected complex regions revealed 94% concordance with in silico localization of the highly homologous derivatives. Other results from this study indicate that intra-chromosomal recombination is enhanced in genic compared with agenic duplicated regions, and that gene desert regions comprising SDs may represent reservoirs for creation of novel genes. The generation of genome-wide signatures of 'rearrangement hotspots', which likely serve as templates for NAHR, may provide a powerful approach towards understanding the underlying mutational mechanism(s for development of constitutional and acquired diseases.

  7. The E2F-DP1 Transcription Factor Complex Regulates Centriole Duplication in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Jacqueline G. Miller

    2016-03-01

    Full Text Available Centrioles play critical roles in the organization of microtubule-based structures, from the mitotic spindle to cilia and flagella. In order to properly execute their various functions, centrioles are subjected to stringent copy number control. Central to this control mechanism is a precise duplication event that takes place during S phase of the cell cycle and involves the assembly of a single daughter centriole in association with each mother centriole . Recent studies have revealed that posttranslational control of the master regulator Plk4/ZYG-1 kinase and its downstream effector SAS-6 is key to ensuring production of a single daughter centriole. In contrast, relatively little is known about how centriole duplication is regulated at a transcriptional level. Here we show that the transcription factor complex EFL-1-DPL-1 both positively and negatively controls centriole duplication in the Caenorhabditis elegans embryo. Specifically, we find that down regulation of EFL-1-DPL-1 can restore centriole duplication in a zyg-1 hypomorphic mutant and that suppression of the zyg-1 mutant phenotype is accompanied by an increase in SAS-6 protein levels. Further, we find evidence that EFL-1-DPL-1 promotes the transcription of zyg-1 and other centriole duplication genes. Our results provide evidence that in a single tissue type, EFL-1-DPL-1 sets the balance between positive and negative regulators of centriole assembly and thus may be part of a homeostatic mechanism that governs centriole assembly.

  8. The cardiac calsequestrin gene transcription is modulated at the promoter by NFAT and MEF-2 transcription factors.

    Directory of Open Access Journals (Sweden)

    Rafael Estrada-Avilés

    Full Text Available Calsequestrin-2 (CASQ2 is the main Ca2+-binding protein inside the sarcoplasmic reticulum of cardiomyocytes. Previously, we demonstrated that MEF-2 and SRF binding sites within the human CASQ2 gene (hCASQ2 promoter region are functional in neonatal cardiomyocytes. In this work, we investigated if the calcineurin/NFAT pathway regulates hCASQ2 expression in neonatal cardiomyocytes. The inhibition of NFAT dephosphorylation with CsA or INCA-6, reduced both the luciferase activity of hCASQ2 promoter constructs (-3102/+176 bp and -288/+176 bp and the CASQ2 mRNA levels in neonatal rat cardiomyocytes. Additionally, NFATc1 and NFATc3 over-expressing neonatal cardiomyocytes showed a 2-3-fold increase in luciferase activity of both hCASQ2 promoter constructs, which was prevented by CsA treatment. Site-directed mutagenesis of the -133 bp MEF-2 binding site prevented trans-activation of hCASQ2 promoter constructs induced by NFAT overexpression. Chromatin Immunoprecipitation (ChIP assays revealed NFAT and MEF-2 enrichment within the -288 bp to +76 bp of the hCASQ2 gene promoter. Besides, a direct interaction between NFAT and MEF-2 proteins was demonstrated by protein co-immunoprecipitation experiments. Taken together, these data demonstrate that NFAT interacts with MEF-2 bound to the -133 bp binding site at the hCASQ2 gene promoter. In conclusion, in this work, we demonstrate that the Ca2+-calcineurin/NFAT pathway modulates the transcription of the hCASQ2 gene in neonatal cardiomyocytes.

  9. Enteric and rectal duplications and duplication cysts in the adult.

    Science.gov (United States)

    Simsek, Abdurrahman; Zeybek, Nazif; Yagci, Gokhan; Kaymakcioglu, Nihat; Tas, Huseyin; Saglam, Mutlu; Cetiner, Sadettin

    2005-03-01

    Alimentary tract duplication and duplication cysts are rare congenital malformations. The ileum is the most frequently affected site. However, alimentary tract duplication and duplication cysts can occur at any point along the gastrointestinal tract. Early diagnosis and prompt surgical treatment is the best way to prevent associated morbidity. This article presents the cases of three patients admitted to Gulhane Military Medical Academy with signs of acute abdomen, intra-abdominal mass and chronic abdominal pain. These patients were found to have enteric duplication, duplication cyst and/or retro-rectal cyst. The literature on alimentary tract duplications is reviewed.

  10. Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

    International Nuclear Information System (INIS)

    Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja; Tan, Qihua; Jochumsen, Kirsten; Fritzner, Niels; Brusgaard, Klaus; Dahlgaard, Jesper; Kruse, Torben A.

    2006-01-01

    The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips was three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation

  11. Development of the WRF-CO2 4D-Var assimilation system v1.0

    Science.gov (United States)

    Zheng, Tao; French, Nancy H. F.; Baxter, Martin

    2018-05-01

    Regional atmospheric CO2 inversions commonly use Lagrangian particle trajectory model simulations to calculate the required influence function, which quantifies the sensitivity of a receptor to flux sources. In this paper, an adjoint-based four-dimensional variational (4D-Var) assimilation system, WRF-CO2 4D-Var, is developed to provide an alternative approach. This system is developed based on the Weather Research and Forecasting (WRF) modeling system, including the system coupled to chemistry (WRF-Chem), with tangent linear and adjoint codes (WRFPLUS), and with data assimilation (WRFDA), all in version 3.6. In WRF-CO2 4D-Var, CO2 is modeled as a tracer and its feedback to meteorology is ignored. This configuration allows most WRF physical parameterizations to be used in the assimilation system without incurring a large amount of code development. WRF-CO2 4D-Var solves for the optimized CO2 flux scaling factors in a Bayesian framework. Two variational optimization schemes are implemented for the system: the first uses the limited memory Broyden-Fletcher-Goldfarb-Shanno (BFGS) minimization algorithm (L-BFGS-B) and the second uses the Lanczos conjugate gradient (CG) in an incremental approach. WRFPLUS forward, tangent linear, and adjoint models are modified to include the physical and dynamical processes involved in the atmospheric transport of CO2. The system is tested by simulations over a domain covering the continental United States at 48 km × 48 km grid spacing. The accuracy of the tangent linear and adjoint models is assessed by comparing against finite difference sensitivity. The system's effectiveness for CO2 inverse modeling is tested using pseudo-observation data. The results of the sensitivity and inverse modeling tests demonstrate the potential usefulness of WRF-CO2 4D-Var for regional CO2 inversions.

  12. Development of the WRF-CO2 4D-Var assimilation system v1.0

    Directory of Open Access Journals (Sweden)

    T. Zheng

    2018-05-01

    Full Text Available Regional atmospheric CO2 inversions commonly use Lagrangian particle trajectory model simulations to calculate the required influence function, which quantifies the sensitivity of a receptor to flux sources. In this paper, an adjoint-based four-dimensional variational (4D-Var assimilation system, WRF-CO2 4D-Var, is developed to provide an alternative approach. This system is developed based on the Weather Research and Forecasting (WRF modeling system, including the system coupled to chemistry (WRF-Chem, with tangent linear and adjoint codes (WRFPLUS, and with data assimilation (WRFDA, all in version 3.6. In WRF-CO2 4D-Var, CO2 is modeled as a tracer and its feedback to meteorology is ignored. This configuration allows most WRF physical parameterizations to be used in the assimilation system without incurring a large amount of code development. WRF-CO2 4D-Var solves for the optimized CO2 flux scaling factors in a Bayesian framework. Two variational optimization schemes are implemented for the system: the first uses the limited memory Broyden–Fletcher–Goldfarb–Shanno (BFGS minimization algorithm (L-BFGS-B and the second uses the Lanczos conjugate gradient (CG in an incremental approach. WRFPLUS forward, tangent linear, and adjoint models are modified to include the physical and dynamical processes involved in the atmospheric transport of CO2. The system is tested by simulations over a domain covering the continental United States at 48 km  ×  48 km grid spacing. The accuracy of the tangent linear and adjoint models is assessed by comparing against finite difference sensitivity. The system's effectiveness for CO2 inverse modeling is tested using pseudo-observation data. The results of the sensitivity and inverse modeling tests demonstrate the potential usefulness of WRF-CO2 4D-Var for regional CO2 inversions.

  13. A molecularly defined duplication set for the X chromosome of Drosophila melanogaster

    Energy Technology Data Exchange (ETDEWEB)

    Venken, Koen J. T.; Popodi, Ellen; Holtzman, Stacy L.; Schulze, Karen L.; Park, Soo; Carlson, Joseph W.; Hoskins, Roger A.; Bellen, Hugo J.; Kaufman, Thomas C.

    2010-07-22

    We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using C31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.

  14. Ancestral genomic duplication of the insulin gene in tilapia: An analysis of possible implications for clinical islet xenotransplantation using donor islets from transgenic tilapia expressing a humanized insulin gene.

    Science.gov (United States)

    Hrytsenko, Olga; Pohajdak, Bill; Wright, James R

    2016-07-03

    Tilapia, a teleost fish, have multiple large anatomically discrete islets which are easy to harvest, and when transplanted into diabetic murine recipients, provide normoglycemia and mammalian-like glucose tolerance profiles. Tilapia insulin differs structurally from human insulin which could preclude their use as islet donors for xenotransplantation. Therefore, we produced transgenic tilapia with islets expressing a humanized insulin gene. It is now known that fish genomes may possess an ancestral duplication and so tilapia may have a second insulin gene. Therefore, we cloned, sequenced, and characterized the tilapia insulin 2 transcript and found that its expression is negligible in islets, is not islet-specific, and would not likely need to be silenced in our transgenic fish.

  15. Multiple independent origins of mitochondrial control region duplications in the order Psittaciformes

    Science.gov (United States)

    Schirtzinger, Erin E.; Tavares, Erika S.; Gonzales, Lauren A.; Eberhard, Jessica R.; Miyaki, Cristina Y.; Sanchez, Juan J.; Hernandez, Alexis; Müeller, Heinrich; Graves, Gary R.; Fleischer, Robert C.; Wright, Timothy F.

    2012-01-01

    Mitochondrial genomes are generally thought to be under selection for compactness, due to their small size, consistent gene content, and a lack of introns or intergenic spacers. As more animal mitochondrial genomes are fully sequenced, rearrangements and partial duplications are being identified with increasing frequency, particularly in birds (Class Aves). In this study, we investigate the evolutionary history of mitochondrial control region states within the avian order Psittaciformes (parrots and cockatoos). To this aim, we reconstructed a comprehensive multi-locus phylogeny of parrots, used PCR of three diagnostic fragments to classify the mitochondrial control region state as single or duplicated, and mapped these states onto the phylogeny. We further sequenced 44 selected species to validate these inferences of control region state. Ancestral state reconstruction using a range of weighting schemes identified six independent origins of mitochondrial control region duplications within Psittaciformes. Analysis of sequence data showed that varying levels of mitochondrial gene and tRNA homology and degradation were present within a given clade exhibiting duplications. Levels of divergence between control regions within an individual varied from 0–10.9% with the differences occurring mainly between 51 and 225 nucleotides 3′ of the goose hairpin in domain I. Further investigations into the fates of duplicated mitochondrial genes, the potential costs and benefits of having a second control region, and the complex relationship between evolutionary rates, selection, and time since duplication are needed to fully explain these patterns in the mitochondrial genome. PMID:22543055

  16. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  17. Continuous In Situ Measurements of Near Bottom Chemistry and Sediment-Water Fluxes with the Chimney Sampler Array (CSA)

    Science.gov (United States)

    Martens, C. S.; Mendlovitz, H. P.; White, B. L.; Hoer, D.; Sleeper, K.; Chanton, J.; Wilson, R.; Lapham, L.

    2011-12-01

    The Chimney Sampler Array (CSA) was designed to measure in situ chemical and physical parameters within the benthic boundary layer plus methane and oxygen sediment-water chemical fluxes at upper slope sites in the northern Gulf of Mexico. The CSA can monitor temporal changes plus help to evaluate oceanographic and sub-seafloor processes that can influence the formation and stability of gas hydrates in underlying sediments. The CSA consists of vertical cylinders (chimneys) equipped with internal chemical sensors and with laboratory flume-calibrated washout rates. Chimney washout rates multiplied by chimney mean versus ambient concentrations allow calculation of net O2 and methane sediment-water fluxes. The CSA is emplaced on the seafloor by a ROVARD lander using a ROV for chimney deployments. The CSA presently includes two 30 cm diameter by 90 cm length cylinders that seal against the sediment with lead pellet beanbags; within each chimney cylinder are optode, conductivity and methane sensors. The CSA's data logger platform also includes pressure and turbidity sensors external to the chimneys along with an acoustic Doppler current meter to measure temporal variation in ambient current velocity and direction. The CSA was deployed aboard a ROVARD lander on 9/13/2010 in the northern Gulf of Mexico (Lat. 28 51.28440, Long. 088 29.39421) on biogeochemically active sediments within Block MC-118. A ROV was utilized for chimney deployment away from the ROVARD lander. The CSA monitored temporal changes in water column physical parameters, obtained near-bottom chemical data to compare with pore fluid and sediment core measurements and measured temporal variability in oxygen and methane sediment-water fluxes at two closely spaced stations at MC-118. A continuous, three-week data set was obtained that revealed daily cycles in chemical parameters and episodic flux events. Lower than ambient chimney dissolved O2 concentrations controlled by temporal variability in washout rates

  18. Facial duplication: case, review, and embryogenesis.

    Science.gov (United States)

    Barr, M

    1982-04-01

    The craniofacial anatomy of an infant with facial duplication is described. There were four eyes, two noses, two maxillae, and one mandible. Anterior to the single pituitary the brain was duplicated and there was bilateral arhinencephaly. Portions of the brain were extruded into a large frontal encephalocele. Cases of symmetrical facial duplication reported in the literature range from two complete faces on a single head (diprosopus) to simple nasal duplication. The variety of patterns of duplication suggests that the doubling of facial components arises in several different ways: Forking of the notochord, duplication of the prosencephalon, duplication of the olfactory placodes, and duplication of maxillary and/or mandibular growth centers around the margins of the stomatodeal plate. Among reported cases, the female:male ratio is 2:1.

  19. Parallel origins of duplications and the formation of pseudogenes in mitochondrial DNA from parthenogenetic lizards (Heteronotia binoei; Gekkonidae).

    Science.gov (United States)

    Zevering, C E; Moritz, C; Heideman, A; Sturm, R A

    1991-11-01

    Analysis of mitochondrial DNAs (mtDNAs) from parthenogenetic lizards of the Heteronotia binoei complex with restriction enzymes revealed an approximately 5-kb addition present in all 77 individuals. Cleavage site mapping suggested the presence of a direct tandem duplication spanning the 16S and 12S rRNA genes, the control region and most, if not all, of the gene for the subunit 1 of NADH dehydrogenase (ND1). The location of the duplication was confirmed by Southern hybridization. A restriction enzyme survey provided evidence for modifications to each copy of the duplicated sequence, including four large deletions. Each gene affected by a deletion was complemented by an intact version in the other copy of the sequence, although for one gene the functional copy was heteroplasmic for another deletion. Sequencing of a fragment from one copy of the duplication which encompassed the tRNA(leu)(UUR) and parts of the 16S rRNA and ND1 genes, revealed mutations expected to disrupt function. Thus, evolution subsequent to the duplication event has resulted in mitochondrial pseudogenes. The presence of duplications in all of these parthenogens, but not among representatives of their maternal sexual ancestors, suggests that the duplications arose in the parthenogenetic form. This provides the second instance in H. binoei of mtDNA duplication associated with the transition from sexual to parthenogenetic reproduction. The increased incidence of duplications in parthenogenetic lizards may be caused by errors in mtDNA replication due to either polyploidy or hybridity of their nuclear genomes.

  20. Cytoadhesion of Plasmodium falciparum-infected erythrocytes to chondroitin-4-sulfate is cooperative and shear enhanced

    DEFF Research Database (Denmark)

    Rieger, Harden; Yoshikawa, Hiroshi Y; Quadt, Katharina

    2015-01-01

    Infections with the human malaria parasite Plasmodium falciparum during pregnancy can lead to severe complications for both mother and child, resulting from the cytoadhesion of parasitized erythrocytes in the intervillous space of the placenta. Cytoadherence is conferred by the specific interacti...... was cooperative and shear stress induced. These findings suggest that the CSA density, together with allosteric effects in VAR2CSA, aid in discriminating between different CSA milieus....

  1. External cystic rectal duplication: an unusual presentation of rectal duplication cyst.

    Science.gov (United States)

    Karaman, I; Karaman, A; Arda, N; Cakmak, O

    2007-11-01

    Duplications of gastrointestinal tract are rare anomalies, and rectal duplications account for five percent of the alimentary tract duplications. We present an unusual case of rectal duplication, which was located externally in a newborn female, and discuss the types of distal hindgut duplications.

  2. The Drosophila Su(var)3–7 Gene Is Required for Oogenesis and Female Fertility, Genetically Interacts with piwi and aubergine, but Impacts Only Weakly Transposon Silencing

    Science.gov (United States)

    Begeot, Flora; Koryakov, Dmitry E.; Todeschini, Anne-Laure; Ronsseray, Stéphane; Vieira, Cristina; Spierer, Pierre; Delattre, Marion

    2014-01-01

    Heterochromatin is made of repetitive sequences, mainly transposable elements (TEs), the regulation of which is critical for genome stability. We have analyzed the role of the heterochromatin-associated Su(var)3–7 protein in Drosophila ovaries. We present evidences that Su(var)3–7 is required for correct oogenesis and female fertility. It accumulates in heterochromatic domains of ovarian germline and somatic cells nuclei, where it co-localizes with HP1. Homozygous mutant females display ovaries with frequent degenerating egg-chambers. Absence of Su(var)3–7 in embryos leads to defects in meiosis and first mitotic divisions due to chromatin fragmentation or chromosome loss, showing that Su(var)3–7 is required for genome integrity. Females homozygous for Su(var)3–7 mutations strongly impair repression of P-transposable element induced gonadal dysgenesis but have minor effects on other TEs. Su(var)3–7 mutations reduce piRNA cluster transcription and slightly impact ovarian piRNA production. However, this modest piRNA reduction does not correlate with transposon de-silencing, suggesting that the moderate effect of Su(var)3–7 on some TE repression is not linked to piRNA production. Strikingly, Su(var)3–7 genetically interacts with the piwi and aubergine genes, key components of the piRNA pathway, by strongly impacting female fertility without impairing transposon silencing. These results lead us to propose that the interaction between Su(var)3–7 and piwi or aubergine controls important developmental processes independently of transposon silencing. PMID:24820312

  3. Autism Spectrum Disorder, Developmental and Psychiatric Features in 16p11.2 Duplication.

    Science.gov (United States)

    Green Snyder, LeeAnne; D'Angelo, Debra; Chen, Qixuan; Bernier, Raphael; Goin-Kochel, Robin P; Wallace, Arianne Stevens; Gerdts, Jennifer; Kanne, Stephen; Berry, Leandra; Blaskey, Lisa; Kuschner, Emily; Roberts, Timothy; Sherr, Elliot; Martin, Christa L; Ledbetter, David H; Spiro, John E; Chung, Wendy K; Hanson, Ellen

    2016-08-01

    The 16p11.2 duplication (BP4-BP5) is associated with Autism Spectrum Disorder (ASD), although significant heterogeneity exists. Quantitative ASD, behavioral and neuropsychological measures and DSM-IV diagnoses in child and adult carriers were compared with familial non-carrier controls, and to published results from deletion carriers. The 16p11.2 duplication phenotype ranges widely from asymptomatic presentation to significant disability. The most common diagnoses were intellectual disability, motor delays and Attention Deficit Hyperactivity Disorder in children, and anxiety in adults. ASD occurred in nearly 20 % of child cases, but a majority of carriers did not show the unique social features of ASD. The 16p11.2 duplication phenotype is characterized by wider variability than the reciprocal deletion, likely reflecting contributions from additional risk factors.

  4. Detailed description of the Ócsa Bird Ringing Station, Hungary

    OpenAIRE

    Csörgő Tibor; Harnos Andrea; Rózsa Lajos; Karcza Zsolt; Fehérvári Péter

    2016-01-01

    The present paper acts as an introduction to a series that will describe the exploratory analyses of migration phenology and morphometrics of the most common passerine species at the Ócsa Bird Ringing Station. This station is situated in the Ócsa Landscape Protection Area that belongs to the Duna–Ipoly National Park, Hungary. The area is somewhat cooler and more humid than the surrounding agricultural fields and tree plantations, covered by a mosaic of diverse hygrophilous vegetation patches....

  5. Influence of Light and Temperature on Gene Expression Leading to Accumulation of Specific Flavonol Glycosides and Hydroxycinnamic Acid Derivatives in Kale (Brassica oleracea var. sabellica).

    Science.gov (United States)

    Neugart, Susanne; Krumbein, Angelika; Zrenner, Rita

    2016-01-01

    Light intensity and temperature are very important signals for the regulation of plant growth and development. Plants subjected to less favorable light or temperature conditions often respond with accumulation of secondary metabolites. Some of these metabolites have been identified as bioactive compounds, considered to exert positive effects on human health when consumed regularly. In order to test a typical range of growth parameters for the winter crop Brassica oleracea var. sabellica, plants were grown either at 400 μmol m(-2) s(-1) or 100 μmol m(-2) s(-1) at 10°C, or at 400 μmol m(-2) s(-1) with 5 or 15°C. The higher light intensity overall increased flavonol content of leaves, favoring the main quercetin glycosides, a caffeic acid monoacylated kaempferol triglycoside, and disinapoyl-gentiobiose. The higher temperature mainly increased the hydroxycinnamic acid derivative disinapoyl-gentiobiose, while at lower temperature synthesis is in favor of very complex sinapic acid acylated flavonol tetraglycosides such as kaempferol-3-O-sinapoyl-sophoroside-7-O-diglucoside. A global analysis of light and temperature dependent alterations of gene expression in B. oleracea var. sabellica leaves was performed with the most comprehensive Brassica microarray. When compared to the light experiment much less genes were differentially expressed in kale leaves grown at 5 or 15°C. A structured evaluation of differentially expressed genes revealed the expected enrichment in the functional categories of e.g. protein degradation at different light intensities or phytohormone metabolism at different temperature. Genes of the secondary metabolism namely phenylpropanoids are significantly enriched with both treatments. Thus, the genome of B. oleracea was screened for predicted genes putatively involved in the biosynthesis of flavonoids and hydroxycinnamic acid derivatives. All identified B. oleracea genes were analyzed for their most specific 60-mer oligonucleotides present on the

  6. CRISPR-Cas type I-A Cascade complex couples viral infection surveillance to host transcriptional regulation in the dependence of Csa3b

    Science.gov (United States)

    He, Fei; Vestergaard, Gisle; Peng, Wenfang; She, Qunxin

    2017-01-01

    Abstract CRISPR-Cas (clustered regularly interspaced short palindromic repeats and the associated genes) constitute adaptive immune systems in bacteria and archaea and they provide sequence specific immunity against foreign nucleic acids. CRISPR-Cas systems are activated by viral infection. However, little is known about how CRISPR-Cas systems are activated in response to viral infection or how their expression is controlled in the absence of viral infection. Here, we demonstrate that both the transcriptional regulator Csa3b, and the type I-A interference complex Cascade, are required to transcriptionally repress the interference gene cassette in the archaeon Sulfolobus. Csa3b binds to two palindromic repeat sites in the promoter region of the cassette and facilitates binding of the Cascade to the promoter region. Upon viral infection, loading of Cascade complexes onto crRNA-matching protospacers leads to relief of the transcriptional repression. Our data demonstrate a mechanism coupling CRISPR-Cas surveillance of protospacers to transcriptional regulation of the interference gene cassette thereby allowing a fast response to viral infection. PMID:27980065

  7. The detection of large deletions or duplications in genomic DNA.

    Science.gov (United States)

    Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

    2002-11-01

    While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

  8. Aberrant meiotic behavior in Agave tequilana Weber var. azul.

    Science.gov (United States)

    Ruvalcaba-Ruiz, Domingo; Rodríguez-Garay, Benjamin

    2002-10-23

    Agave tequilana Weber var. azul, is the only one variety permitted by federal law in México to be used for tequila production which is the most popular contemporary alcoholic beverage made from agave and recognized worldwide. Despite the economic, genetic, and ornamental value of the plant, it has not been subjected to detailed cytogenetic research, which could lead to a better understanding of its reproduction for future genetic improvement. The objective of this work was to study the meiotic behavior in pollen mother cells and its implications on the pollen viability in Agave tequilana Weber var. azul. The analysis of Pollen Mother Cells in anaphase I (A-I) showed 82.56% of cells with a normal anaphase and, 17.44% with an irregular anaphase. In which 5.28% corresponded to cells with side arm bridges (SAB); 3.68% cells with one bridge and one fragment; 2.58% of irregular anaphase showed cells with one or two lagging chromosomes and 2.95% showed one acentric fragment; cells with two bridges and cells with two bridges and one acentric fragment were observed in frequencies of 1.60% and 1.35% respectively. In anaphase II some cells showed bridges and fragments too. Aberrant A-I cells had many shrunken or empty pollen grains (42.00%) and 58.00 % viable pollen. The observed meiotic irregularities suggest that structural chromosome aberrations have occurred, such as heterozygous inversions, sister chromatid exchanges, deletions and duplications which in turn are reflected in a low pollen viability.

  9. Aberrant meiotic behavior in Agave tequilana Weber var. azul

    Directory of Open Access Journals (Sweden)

    Rodríguez-Garay Benjamin

    2002-10-01

    Full Text Available Abstract Background Agave tequilana Weber var. azul, is the only one variety permitted by federal law in México to be used for tequila production which is the most popular contemporary alcoholic beverage made from agave and recognized worldwide. Despite the economic, genetic, and ornamental value of the plant, it has not been subjected to detailed cytogenetic research, which could lead to a better understanding of its reproduction for future genetic improvement. The objective of this work was to study the meiotic behavior in pollen mother cells and its implications on the pollen viability in Agave tequilana Weber var. azul. Results The analysis of Pollen Mother Cells in anaphase I (A-I showed 82.56% of cells with a normal anaphase and, 17.44% with an irregular anaphase. In which 5.28% corresponded to cells with side arm bridges (SAB; 3.68% cells with one bridge and one fragment; 2.58% of irregular anaphase showed cells with one or two lagging chromosomes and 2.95% showed one acentric fragment; cells with two bridges and cells with two bridges and one acentric fragment were observed in frequencies of 1.60% and 1.35% respectively. In anaphase II some cells showed bridges and fragments too. Aberrant A-I cells had many shrunken or empty pollen grains (42.00% and 58.00 % viable pollen. Conclusion The observed meiotic irregularities suggest that structural chromosome aberrations have occurred, such as heterozygous inversions, sister chromatid exchanges, deletions and duplications which in turn are reflected in a low pollen viability.

  10. Oculocutaneous albinism in a patient with 17p13.2-pter duplication - a review on the molecular syndromology of 17p13 duplication.

    Science.gov (United States)

    Kucharczyk, Marzena; Jezela-Stanek, Aleksandra; Gieruszczak-Bialek, Dorota; Kugaudo, Monika; Cieslikowska, Agata; Pelc, Magdalena; Krajewska-Walasek, Malgorzata

    2015-06-01

    Chromosomal duplications involving 17p13.3 have recently been defined as a new distinctive syndrome with several diagnosed patients. Some variation is known to occur in the breakpoints of the duplicated region and, consequently, in the phenotype as well. We report on a patient, the fifth to our knowledge, a 4-year-old girl with a pure de novo subtelomeric 17p13.2-pter duplication. She presents all of the facial features described so far for this duplication and in addition, a unilateral palmar transversal crease and oculocutaneous albinism which has not been reported previously. A detailed molecular description of the reported aberration and correlation with the observed phenotypical features based on a literature review. We discuss the possible molecular etiology of albinism in regard to the mode of inheritance. The new data provided here may be useful for further genotype correlations in syndromes with oculocutaneous albinism, especially of autosomal dominant inheritance.

  11. Mre11-Sae2 and RPA Collaborate to Prevent Palindromic Gene Amplification.

    Science.gov (United States)

    Deng, Sarah K; Yin, Yi; Petes, Thomas D; Symington, Lorraine S

    2015-11-05

    Foldback priming at DNA double-stranded breaks is one mechanism proposed to initiate palindromic gene amplification, a common feature of cancer cells. Here, we show that small (5-9 bp) inverted repeats drive the formation of large palindromic duplications, the major class of chromosomal rearrangements recovered from yeast cells lacking Sae2 or the Mre11 nuclease. RPA dysfunction increased the frequency of palindromic duplications in Sae2 or Mre11 nuclease-deficient cells by ∼ 1,000-fold, consistent with intra-strand annealing to create a hairpin-capped chromosome that is subsequently replicated to form a dicentric isochromosome. The palindromic duplications were frequently associated with duplication of a second chromosome region bounded by a repeated sequence and a telomere, suggesting the dicentric chromosome breaks and repairs by recombination between dispersed repeats to acquire a telomere. We propose secondary structures within single-stranded DNA are potent instigators of genome instability, and RPA and Mre11-Sae2 play important roles in preventing their formation and propagation, respectively. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Enteric Duplication.

    Science.gov (United States)

    Jeziorczak, Paul M; Warner, Brad W

    2018-03-01

    Enteric duplications have been described throughout the entire gastrointestinal tract. The usual perinatal presentation is an abdominal mass. Duplications associated with the foregut have associated respiratory symptoms, whereas duplications in the midgut and hindgut can present with obstructive symptoms, perforation, nausea, emesis, hemorrhage, or be asymptomatic, and identified as an incidental finding. These are differentiated from other cystic lesions by the presence of a normal gastrointestinal mucosal epithelium. Enteric duplications are located on the mesenteric side of the native structures and are often singular with tubular or cystic characteristics. Management of enteric duplications often requires operative intervention with preservation of the native blood supply and intestine. These procedures are usually very well tolerated with low morbidity.

  13. A molecularly defined duplication set for the X chromosome of Drosophila melanogaster.

    Science.gov (United States)

    Venken, Koen J T; Popodi, Ellen; Holtzman, Stacy L; Schulze, Karen L; Park, Soo; Carlson, Joseph W; Hoskins, Roger A; Bellen, Hugo J; Kaufman, Thomas C

    2010-12-01

    We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using ΦC31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.

  14. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

  15. The house spider genome reveals an ancient whole-genome duplication during arachnid evolution.

    Science.gov (United States)

    Schwager, Evelyn E; Sharma, Prashant P; Clarke, Thomas; Leite, Daniel J; Wierschin, Torsten; Pechmann, Matthias; Akiyama-Oda, Yasuko; Esposito, Lauren; Bechsgaard, Jesper; Bilde, Trine; Buffry, Alexandra D; Chao, Hsu; Dinh, Huyen; Doddapaneni, HarshaVardhan; Dugan, Shannon; Eibner, Cornelius; Extavour, Cassandra G; Funch, Peter; Garb, Jessica; Gonzalez, Luis B; Gonzalez, Vanessa L; Griffiths-Jones, Sam; Han, Yi; Hayashi, Cheryl; Hilbrant, Maarten; Hughes, Daniel S T; Janssen, Ralf; Lee, Sandra L; Maeso, Ignacio; Murali, Shwetha C; Muzny, Donna M; Nunes da Fonseca, Rodrigo; Paese, Christian L B; Qu, Jiaxin; Ronshaugen, Matthew; Schomburg, Christoph; Schönauer, Anna; Stollewerk, Angelika; Torres-Oliva, Montserrat; Turetzek, Natascha; Vanthournout, Bram; Werren, John H; Wolff, Carsten; Worley, Kim C; Bucher, Gregor; Gibbs, Richard A; Coddington, Jonathan; Oda, Hiroki; Stanke, Mario; Ayoub, Nadia A; Prpic, Nikola-Michael; Flot, Jean-François; Posnien, Nico; Richards, Stephen; McGregor, Alistair P

    2017-07-31

    The duplication of genes can occur through various mechanisms and is thought to make a major contribution to the evolutionary diversification of organisms. There is increasing evidence for a large-scale duplication of genes in some chelicerate lineages including two rounds of whole genome duplication (WGD) in horseshoe crabs. To investigate this further, we sequenced and analyzed the genome of the common house spider Parasteatoda tepidariorum. We found pervasive duplication of both coding and non-coding genes in this spider, including two clusters of Hox genes. Analysis of synteny conservation across the P. tepidariorum genome suggests that there has been an ancient WGD in spiders. Comparison with the genomes of other chelicerates, including that of the newly sequenced bark scorpion Centruroides sculpturatus, suggests that this event occurred in the common ancestor of spiders and scorpions, and is probably independent of the WGDs in horseshoe crabs. Furthermore, characterization of the sequence and expression of the Hox paralogs in P. tepidariorum suggests that many have been subject to neo-functionalization and/or sub-functionalization since their duplication. Our results reveal that spiders and scorpions are likely the descendants of a polyploid ancestor that lived more than 450 MYA. Given the extensive morphological diversity and ecological adaptations found among these animals, rivaling those of vertebrates, our study of the ancient WGD event in Arachnopulmonata provides a new comparative platform to explore common and divergent evolutionary outcomes of polyploidization events across eukaryotes.

  16. Kinetics of B Cell responses to Plasmodium falciparum erythrocyte membrane protein 1 in Ghanaian women naturally exposed to malaria parasites

    DEFF Research Database (Denmark)

    Ampomah, Paulina; Stevenson, Liz; Ofori, Michael F

    2014-01-01

    . In this first, to our knowledge, longitudinal study of its kind, we measured B cell subset composition, as well as PfEMP1-specific Ab levels and memory B cell frequencies, in Ghanaian women followed from early pregnancy up to 1 y after delivery. Cell phenotypes and Ag-specific B cell function were assessed...... three times during and after pregnancy. Levels of IgG specific for pregnancy-restricted, VAR2CSA-type PfEMP1 increased markedly during pregnancy and declined after delivery, whereas IgG levels specific for two PfEMP1 proteins not restricted to pregnancy did not. Changes in VAR2CSA-specific memory B cell...

  17. In vitro antioxidant and anticancer effects of solvent fractions from Prunella vulgaris var. lilacina.

    Science.gov (United States)

    Hwang, Yu-Jin; Lee, Eun-Ju; Kim, Haeng-Ran; Hwang, Kyung-A

    2013-11-09

    Recently, considerable attention has been focused on exploring the potential antioxidant properties of plant extracts or isolated products of plant origin. Prunella vulgaris var. lilacina is widely distributed in Korea, Japan, China, and Europe, and it continues to be used to treat inflammation, eye pain, headache, and dizziness. However, reports on the antioxidant activities of P. vulgaris var. lilacina are limited, particularly concerning the relationship between its phenolic content and antioxidant capacity. In this study, we investigated the antioxidant and anticancer activities of an ethanol extract from P. vulgaris var. lilacina and its fractions. Dried powder of P. vulgaris var. lilacina was extracted with ethanol, and the extract was fractionated to produce the hexane fraction, butanol fraction, chloroform fraction and residual water fraction. The phenolic content was assayed using the Folin-Ciocalteu colorimetric method. Subsequently, the antioxidant activities of the ethanol extract and its fractions were analyzed employing various antioxidant assay methods including DPPH, FRAP, ABTS, SOD activity and production of reactive oxygen species. Additionally, the extract and fractions were assayed for their ability to exert cytotoxic activities on various cancer cells using the MTT assay. We also investigated the expression of genes associated with apoptotic cell death by RT-PCR. The total phenolic contents of the ethanol extract and water fraction of P. vulgaris var. lilacina were 303.66 and 322.80 mg GAE/g dry weight (or fractions), respectively. The results showed that the ethanol extract and the water fraction of P. vulgaris var. lilacina had higher antioxidant content than other solvent fractions, similar to their total phenolic content. Anticancer activity was also tested using the HepG2, HT29, A549, MKN45 and HeLa cancer cell lines. The results clearly demonstrated that the P. vulgaris var. lilacina ethanol extract induced significant cytotoxic effects

  18. Indirect semiquantitative determination of p34cdc2 levels in G1 and G2 cells of the carbohydrate-starved root meristems in Vicia faba var. minor

    Directory of Open Access Journals (Sweden)

    Justyna Polit

    2014-01-01

    Full Text Available In eukaryotes, the 34kDa kinase (p34 encoded by the cdc2 gene is a key regulator of both the onset of DNA synthesis (G1 to S phase transition and the onset of mitosis (G1 to M phase transition. Using mouse anti-human PSTAIRE and FITClabelled goat antibodies, indirect semiquantitative determination of p34cdc2 levels was performed in meristematic cells from the control (intact and excised, carbohydrate-starved main roots of Vicia faba var. minor. No evident differences in the intensity of fluorescence was found either between the G1 and G2 cells or between the control cells and the cells arrested at both Principal Control Points by carbohydrate starvation. It seems thus, that the cell cycle block induced in meristematic cells of V. faba var. minor is not correlated with the absolute level of the key cell cycle enzyme responsible for phosphory-lution of cellular proteins, but primarily with the altered activity of p34cdc2.

  19. A genome-wide RNAi screen to dissect centriole duplication and centrosome maturation in Drosophila.

    Directory of Open Access Journals (Sweden)

    Jeroen Dobbelaere

    2008-09-01

    Full Text Available Centrosomes comprise a pair of centrioles surrounded by an amorphous pericentriolar material (PCM. Here, we have performed a microscopy-based genome-wide RNA interference (RNAi screen in Drosophila cells to identify proteins required for centriole duplication and mitotic PCM recruitment. We analysed 92% of the Drosophila genome (13,059 genes and identified 32 genes involved in centrosome function. An extensive series of secondary screens classified these genes into four categories: (1 nine are required for centriole duplication, (2 11 are required for centrosome maturation, (3 nine are required for both functions, and (4 three genes regulate centrosome separation. These 32 hits include several new centrosomal components, some of which have human homologs. In addition, we find that the individual depletion of only two proteins, Polo and Centrosomin (Cnn can completely block centrosome maturation. Cnn is phosphorylated during mitosis in a Polo-dependent manner, suggesting that the Polo-dependent phosphorylation of Cnn initiates centrosome maturation in flies.

  20. Evolution of homeobox genes.

    Science.gov (United States)

    Holland, Peter W H

    2013-01-01

    Many homeobox genes encode transcription factors with regulatory roles in animal and plant development. Homeobox genes are found in almost all eukaryotes, and have diversified into 11 gene classes and over 100 gene families in animal evolution, and 10 to 14 gene classes in plants. The largest group in animals is the ANTP class which includes the well-known Hox genes, plus other genes implicated in development including ParaHox (Cdx, Xlox, Gsx), Evx, Dlx, En, NK4, NK3, Msx, and Nanog. Genomic data suggest that the ANTP class diversified by extensive tandem duplication to generate a large array of genes, including an NK gene cluster and a hypothetical ProtoHox gene cluster that duplicated to generate Hox and ParaHox genes. Expression and functional data suggest that NK, Hox, and ParaHox gene clusters acquired distinct roles in patterning the mesoderm, nervous system, and gut. The PRD class is also diverse and includes Pax2/5/8, Pax3/7, Pax4/6, Gsc, Hesx, Otx, Otp, and Pitx genes. PRD genes are not generally arranged in ancient genomic clusters, although the Dux, Obox, and Rhox gene clusters arose in mammalian evolution as did several non-clustered PRD genes. Tandem duplication and genome duplication expanded the number of homeobox genes, possibly contributing to the evolution of developmental complexity, but homeobox gene loss must not be ignored. Evolutionary changes to homeobox gene expression have also been documented, including Hox gene expression patterns shifting in concert with segmental diversification in vertebrates and crustaceans, and deletion of a Pitx1 gene enhancer in pelvic-reduced sticklebacks. WIREs Dev Biol 2013, 2:31-45. doi: 10.1002/wdev.78 For further resources related to this article, please visit the WIREs website. The author declares that he has no conflicts of interest. Copyright © 2012 Wiley Periodicals, Inc.

  1. Charge Sensitive Amplifier (CSA) in cold gas of Liquid Argon (LAr) Time Projection Chamber (TPC)

    International Nuclear Information System (INIS)

    Bechetoille, E; Mathez, H; Zoccarato, Y

    2011-01-01

    This paper presents our work on a 8-channel low noise Front-End electronic coupled to a Liquid Argon (LAr) TPC (Time Projection Chamber). Each channel consists of a Charge Sensitive Amplifier (CSA), a band pass filter and a 50 Ohms buffer as line driver. A serial link based on a 'i2c-like' protocol, provides multiple configuration features to the circuit by accessing slow control registers. In this paper, we describe the CSA, the shaper and the slow control part. The feedback network of the CSA is made of a capacitance and a resistor. Their values are respectively 250 fF and 4 MΩ. An input referred noise of, at most, 1500 e- rms must be achieved at -100 deg. C with an input detector capacitance of 250 pF to ensure a correct measurement of the minimal signal of 18000e- (2.88 fC). The power consumption in this cryogenic setup must be less than 40 mW from a 3.3 V power supply.

  2. Morphological and genetic differences between Coptis japonica var. anemonifolia H. Ohba and Coptis japonica var. major Satake in Hokuriku area.

    Science.gov (United States)

    Kitamura, Masashi; Ando, Hirokazu; Sasaki, Yohei

    2018-03-01

    Coptis japonica is widely distributed in Japan, and its dried rhizome is a source of the domestic herbal medicine Coptidis Rhizoma ( Oren). There are three varieties of C. japonica, two of which, namely, C. japonica var. anemonifolia and C. japonica var. major, are important as sources of traditional medicines. Coptis japonica var. anemonifolia and C. japonica var. major are distinguishable on the basis of their ternate or biternate compound leaves, respectively. In the Hokuriku area, where both C. japonica var. anemonifolia and C. japonica var. major grow naturally, some individual plants cannot be identified unambiguously on the basis of leaf morphology because changes in leaf morphology may occur due to intra-variety variation or crossbreeding between the two varieties. In addition, genetic differences between the two varieties have remained unclear. In this study, we employed new genetic and morphological classification approaches to discriminate between the two varieties. Based on the single nucleotide polymorphisms of the tetrahydroberberine oxidase gene, we found four conserved SNPs between the two varieties and were able to classify C. japonica into two varieties and crossbreeds. Furthermore, we introduced a new leaf type index based on the overall degree of leaflet dissection calculated by surface area of a leaflet and length of leaflet margin and petiolule. Using our new index we were able to discriminate between the two varieties and their crossbreeds more accurately than is possible with the conventional discrimination method. Our genetic and morphological classification methods may be used as novel benchmarks to discriminate between the two varieties and their crossbreeds.

  3. Evolutionary patterns of RNA-based duplication in non-mammalian chordates.

    Directory of Open Access Journals (Sweden)

    Ming Chen

    Full Text Available The role of RNA-based duplication, or retroposition, in the evolution of new gene functions in mammals, plants, and Drosophila has been widely reported. However, little is known about RNA-based duplication in non-mammalian chordates. In this study, we screened ten non-mammalian chordate genomes for retrocopies and investigated their evolutionary patterns. We identified numerous retrocopies in these species. Examination of the age distribution of these retrocopies revealed no burst of young retrocopies in ancient chordate species. Upon comparing these non-mammalian chordate species to the mammalian species, we observed that a larger fraction of the non-mammalian retrocopies was under strong evolutionary constraints than mammalian retrocopies are, as evidenced by signals of purifying selection and expression profiles. For the Western clawed frog, Medaka, and Sea squirt, many retrogenes have evolved gonad and brain expression patterns, similar to what was observed in human. Testing of retrogene movement in the Medaka genome, where the nascent sex chrosomes have been well assembled, did not reveal any significant gene movement. Taken together, our analyses demonstrate that RNA-based duplication generates many functional genes and can make a significant contribution to the evolution of non-mammalian genomes.

  4. In Vitro Variant Surface Antigen Expression in Plasmodium falciparum Parasites from a Semi-Immune Individual Is Not Correlated with Var Gene Transcription

    Science.gov (United States)

    Tschan, Serena; Flötenmeyer, Matthias; Koch, Iris; Berger, Jürgen; Kremsner, Peter; Frank, Matthias

    2016-01-01

    Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) is considered to be the main variant surface antigen (VSA) of Plasmodium falciparum and is mainly localized on electron-dense knobs in the membrane of the infected erythrocyte. Switches in PfEMP1 expression provide the basis for antigenic variation and are thought to be critical for parasite persistence during chronic infections. Recently, strain transcending anti-PfEMP1 immunity has been shown to develop early in life, challenging the role of PfEMP1 in antigenic variation during chronic infections. In this work we investigate how P. falciparum achieves persistence during a chronic asymptomatic infection. The infected individual (MOA) was parasitemic for 42 days and multilocus var gene genotyping showed persistence of the same parasite population throughout the infection. Parasites from the beginning of the infection were adapted to tissue culture and cloned by limiting dilution. Flow cytometry using convalescent serum detected a variable surface recognition signal on isogenic clonal parasites. Quantitative real-time PCR with a field isolate specific var gene primer set showed that the surface recognition signal was not correlated with transcription of individual var genes. Strain transcending anti-PfEMP1 immunity of the convalescent serum was demonstrated with CD36 selected and PfEMP1 knock-down NF54 clones. In contrast, knock-down of PfEMP1 did not have an effect on the antibody recognition signal in MOA clones. Trypsinisation of the membrane surface proteins abolished the surface recognition signal and immune electron microscopy revealed that antibodies from the convalescent serum bound to membrane areas without knobs and with knobs. Together the data indicate that PfEMP1 is not the main variable surface antigen during a chronic infection and suggest a role for trypsin sensitive non-PfEMP1 VSAs for parasite persistence in chronic infections. PMID:27907004

  5. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    OpenAIRE

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  6. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    OpenAIRE

    Thomas D Cuypers; Paulien Hogeweg

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  7. Radiological findings of male urethral duplication associated with bladder duplication: case report

    International Nuclear Information System (INIS)

    Kim, Hyoung Jung; Lim, Joo Won; Lee, Dong Ho; Ko, Young Tae

    2004-01-01

    Urethral duplication or accessory urethra is a rare congenital anomaly. Even rarer, is its association with bladder duplication. We report a case of urethral duplication associated with bladder duplication in a seven-year-old boy who underwent retrograde urethrography, sonography and magnetic resonance (MR) imaging. WhiIe retrograde urethrography can demonstrate the extent of the duplicated urethra, MR imaging and sonography can provide detailed information on the anatomy of the adjacent tissues as well as urethral duplication

  8. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    Science.gov (United States)

    Cuypers, Thomas D; Hogeweg, Paulien

    2014-04-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and adaptation remains unknown. Here, we study the duplicate retention pattern postWGD, by letting virtual cells adapt to environmental changes. The virtual cells have structured genomes that encode a regulatory network and simple metabolism. Populations are under selection for homeostasis and evolve by point mutations, small indels and WGD. After populations had initially adapted fully to fluctuating resource conditions re-adaptation to a broad range of novel environments was studied by tracking mutations in the line of descent. WGD was established in a minority (≈30%) of lineages, yet, these were significantly more successful at re-adaptation. Unexpectedly, WGD lineages conserved more seemingly redundant genes, yet had higher per gene mutation rates. While WGD duplicates of all functional classes were significantly over-retained compared to a model of neutral losses, duplicate retention was clearly biased towards highly connected TFs. Importantly, no subfunctionalization occurred in conserved pairs, strongly suggesting that dosage balance shaped retention. Meanwhile, singles diverged significantly. WGD, therefore, is a powerful mechanism to cope with environmental change, allowing conservation of a core machinery, while adapting the peripheral network to accommodate change.

  9. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    Directory of Open Access Journals (Sweden)

    Thomas D Cuypers

    2014-04-01

    Full Text Available Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and adaptation remains unknown. Here, we study the duplicate retention pattern postWGD, by letting virtual cells adapt to environmental changes. The virtual cells have structured genomes that encode a regulatory network and simple metabolism. Populations are under selection for homeostasis and evolve by point mutations, small indels and WGD. After populations had initially adapted fully to fluctuating resource conditions re-adaptation to a broad range of novel environments was studied by tracking mutations in the line of descent. WGD was established in a minority (≈30% of lineages, yet, these were significantly more successful at re-adaptation. Unexpectedly, WGD lineages conserved more seemingly redundant genes, yet had higher per gene mutation rates. While WGD duplicates of all functional classes were significantly over-retained compared to a model of neutral losses, duplicate retention was clearly biased towards highly connected TFs. Importantly, no subfunctionalization occurred in conserved pairs, strongly suggesting that dosage balance shaped retention. Meanwhile, singles diverged significantly. WGD, therefore, is a powerful mechanism to cope with environmental change, allowing conservation of a core machinery, while adapting the peripheral network to accommodate change.

  10. Evaluation of (+)-p-[{sup 11}C]methylvesamicol for mapping sigma{sub 1} receptors: a comparison with [{sup 11}C]SA4503

    Energy Technology Data Exchange (ETDEWEB)

    Ishiwata, Kiichi [Positron Medical Center, Tokyo Metropolitan Institute of Gerontology, Tokyo 173-0022 (Japan)]. E-mail: ishiwata@pet.tmig.or.jp; Kawamura, Kazunori [Positron Medical Center, Tokyo Metropolitan Institute of Gerontology, Tokyo 173-0022 (Japan); SHI Accelerator Service Ltd., Tokyo 141-0032 (Japan); Yajima, Kazuyoshi [The Medical and Pharmacological Research Center Foundation, Hakui 920-0631 (Japan); QingGeLeTu [Positron Medical Center, Tokyo Metropolitan Institute of Gerontology, Tokyo 173-0022 (Japan); Mori, Hirofumi [Advanced Science Research Center, Kanazawa University, Kanazawa 920-8640 (Japan); Shiba, Kazuhiro [Advanced Science Research Center, Kanazawa University, Kanazawa 920-8640 (Japan)

    2006-05-15

    Vesamicol is a leading compound for positron emission tomography (PET) and single photon emission computed tomography (SPECT) tracers for mapping the vesicular acetylcholine transporter (VAChT). Recently, we found that (+)-p-methylvesamicol ((+)-PMV) has low affinity for VAChT (K {sub i}=199 nM), but has moderate to high affinity for sigma receptors: K {sub i}=3.0 nM for sigma{sub 1} and K {sub i}=40.7 nM for sigma{sub 2}, and that sigma{sub 1}-selective SA4503 (K {sub i}=4.4 nM for sigma{sub 1} and K {sub i}=242 nM for sigma{sub 2}) has moderate affinity for VAChT (K {sub i}=50.2 nM). In the present study, we examined the potential of (+)-[{sup 11}C]PMV as a PET radioligand for mapping sigma{sub 1} receptors as compared with [{sup 11}C]SA4503. In rat brain, similar regional distribution patterns of (+)-[{sup 11}C]PMV and [{sup 11}C]SA4503 were shown by tissue dissection and by ex vivo autoradiography. Blocking experiments using ({+-})-PMV (-)-vesamicol, SA4503, haloperidol and ({+-})-pentazocine showed that the two tracers specifically bound to sigma{sub 1} receptors, and that [{sup 11}C]SA4503 exhibited greater specific binding than (+)-[{sup 11}C]PMV. No sign of VAChT-specific binding by [{sup 11}C]SA4503 was observed in the striatum, which is rich in VAChT sites. In conclusion, (+)-[{sup 11}C]PMV specifically bound to sigma{sub 1} receptors in the brain, but to a lesser extent than [{sup 11}C]SA4503, suggesting that (+)-[{sup 11}C]PMV is a less preferable PET ligand than [{sup 11}C]SA4503. On the other hand, the moderate affinity of [{sup 11}C]SA4503 for VAChT is negligible in vivo.

  11. CRISPR-Cas type I-A Cascade complex couples viral infection surveillance to host transcriptional regulation in the dependence of Csa3b.

    Science.gov (United States)

    He, Fei; Vestergaard, Gisle; Peng, Wenfang; She, Qunxin; Peng, Xu

    2017-02-28

    CRISPR-Cas (clustered regularly interspaced short palindromic repeats and the associated genes) constitute adaptive immune systems in bacteria and archaea and they provide sequence specific immunity against foreign nucleic acids. CRISPR-Cas systems are activated by viral infection. However, little is known about how CRISPR-Cas systems are activated in response to viral infection or how their expression is controlled in the absence of viral infection. Here, we demonstrate that both the transcriptional regulator Csa3b, and the type I-A interference complex Cascade, are required to transcriptionally repress the interference gene cassette in the archaeon Sulfolobus. Csa3b binds to two palindromic repeat sites in the promoter region of the cassette and facilitates binding of the Cascade to the promoter region. Upon viral infection, loading of Cascade complexes onto crRNA-matching protospacers leads to relief of the transcriptional repression. Our data demonstrate a mechanism coupling CRISPR-Cas surveillance of protospacers to transcriptional regulation of the interference gene cassette thereby allowing a fast response to viral infection. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Regeneration of Used Frying Palm Oil with Coffee Silverskin (CS), CS Ash (CSA) and Nanoparticles of CS (NCS).

    Science.gov (United States)

    Ismail, Samir Abd-Elmonem A; El-Anany, Ayman Mohammed; Ali, Rehab Farouk M

    2017-01-01

    The present investigation aimed to evaluate the efficiency of coffee silverskin (CS), CS ash (CSA) and nanoparticles of CS (NCS) in regeneration the quality of used frying palm oil. The adsorbents were mixed individually with used frying palm oil at level 4% (w/v) for 60 min. The properties of CS, CSA and NCS adsorbents were studied using (SEM) scanning electron microscopy technique. Some of physico-chemical characteristics of used frying palm oil (UFPO) and UFPO treated with adsorbents were determined. The results showed that the CS ash particles composed of irregular spherical and semispherical grains with deep cavities. The size of particles of CS ash ranged in diameter from 1.1 to 1.7 µm. The morphology of NCS consisted of cluster-type spherical nanoparticles and flakes. The particle size of NCS varies from 0.9 to 1.7 µm. Purification treatments caused marked (poil compared to untreated oil. The treatment of UFPO with 4% of adsorbents caused significant reductions in the content of free fatty acids ranged from 51.2 to 65.0%. The lowest level of peroxide (2.1 meq/kg) was recorded for UFPO treated with 4% of NCS. The highest reductions (72.8; 70.0%) in p-anisidine value were observed in UFPO treated with 4% of CSA and NCS, respectively. Treatment of UFPO with 4% of CS, CSA and NCS significantly lowered the polar content from 13.9% to 6.3, 4.8 and 3.9%, respectively. The results also indicate that CSA and NCS have nearly the same adsorption efficiency in lowering polymer content of UFPO. Filtration treatment of UFPO with 4% of CS, CSA and NCS markedly lowered the viscosity and colour values of treated UFPO.

  13. Analysis of expressed sequence tags (ESTs) from avocado seed (Persea americana var. drymifolia) reveals abundant expression of the gene encoding the antimicrobial peptide snakin.

    Science.gov (United States)

    Guzmán-Rodríguez, Jaquelina J; Ibarra-Laclette, Enrique; Herrera-Estrella, Luis; Ochoa-Zarzosa, Alejandra; Suárez-Rodríguez, Luis María; Rodríguez-Zapata, Luis C; Salgado-Garciglia, Rafael; Jimenez-Moraila, Beatriz; López-Meza, Joel E; López-Gómez, Rodolfo

    2013-09-01

    Avocado is one of the most important fruits in the world. Avocado "native mexicano" (Persea americana var. drymifolia) seeds are widely used in the propagation of this plant and are the primary source of rootstocks globally for a variety of avocado cultivars, such as the Hass avocado. Here, we report the isolation of 5005 ESTs from the 5' ends of P. americana var. drymifolia seed cDNA clones representing 1584 possible unigenes. These avocado seed ESTs were compared with the avocado flower EST library, and we detected several genes that are expressed either in both tissues or only in the seed. The snakin gene, which encodes an element of the innate immune response in plants, was one of those most frequently found among the seed ESTs, and this suggests that it is abundantly expressed in the avocado seed. We expressed the snakin gene in a heterologous system, namely the bovine endothelial cell line BVE-E6E7. Conditioned media from transfected BVE-E6E7 cells showed antimicrobial activity against strains of Escherichia coli and Staphylococcus aureus. This is the first study of the function of the snakin gene in plant seed tissue, and our observations suggest that this gene might play a protective role in the avocado seed. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  14. Duplication of 20p12.3 associated with familial Wolff-Parkinson-White syndrome.

    Science.gov (United States)

    Mills, Kimberly I; Anderson, Jacqueline; Levy, Philip T; Cole, F Sessions; Silva, Jennifer N A; Kulkarni, Shashikant; Shinawi, Marwan

    2013-01-01

    Wolff-Parkinson-White (WPW) syndrome is caused by preexcitation of the ventricular myocardium via an accessory pathway which increases the risk for paroxysmal supraventricular tachycardia. The condition is often sporadic and of unknown etiology in the majority of cases. Autosomal dominant inheritance and association with congenital heart defects or ventricular hypertrophy were described. Microdeletions of 20p12.3 have been associated with WPW syndrome with either cognitive dysfunction or Alagille syndrome. Here, we describe the association of 20p12.3 duplication with WPW syndrome in a patient who presented with non-immune hydrops. Her paternal uncle carries the duplication and has attention-deficit hyperactivity disorder and electrocardiographic findings consistent with WPW. The 769 kb duplication was detected by the Affymetrix Whole Genome-Human SNP Array 6.0 and encompasses two genes and the first two exons of a third gene. We discuss the potential role of the genes in the duplicated region in the pathogenesis of WPW and possible neurobehavioral abnormalities. Our data provide additional support for a significant role of 20p12.3 chromosomal rearrangements in the etiology of WPW syndrome. Copyright © 2012 Wiley Periodicals, Inc.

  15. Estimates of methyl 13C and 1H CSA values (Δσ) in proteins from cross-correlated spin relaxation

    International Nuclear Information System (INIS)

    Tugarinov, Vitali; Scheurer, Christoph; Brueschweiler, Rafael; Kay, Lewis E.

    2004-01-01

    Simple pulse schemes are presented for the measurement of methyl 13 C and 1 H CSA values from 1 H- 13 C dipole/ 13 C CSA and 1 H- 13 C dipole/ 1 H CSA cross-correlated relaxation. The methodology is applied to protein L and malate synthase G. Average 13 C CSA values are considerably smaller for Ile than Leu/Val (17 vs 25 ppm) and are in good agreement with previous solid state NMR studies of powders of amino acids and dipeptides and in reasonable agreement with quantum-chemical DFT calculations of methyl carbon CSA values in peptide fragments. Small averaged 1 H CSA values on the order of 1 ppm are measured, consistent with a solid state NMR determination of the methyl group 1 H CSA in dimethylmalonic acid

  16. Gene Duplication of the zebrafish kit ligand and partitioning of melanocyte development functions to kit ligand a.

    Directory of Open Access Journals (Sweden)

    Keith A Hultman

    2007-01-01

    Full Text Available The retention of particular genes after the whole genome duplication in zebrafish has given insights into how genes may evolve through partitioning of ancestral functions. We examine the partitioning of expression patterns and functions of two zebrafish kit ligands, kit ligand a (kitla and kit ligand b (kitlb, and discuss their possible coevolution with the duplicated zebrafish kit receptors (kita and kitb. In situ hybridizations show that kitla mRNA is expressed in the trunk adjacent to the notochord in the middle of each somite during stages of melanocyte migration and later expressed in the skin, when the receptor is required for melanocyte survival. kitla is also expressed in other regions complementary to kita receptor expression, including the pineal gland, tail bud, and ear. In contrast, kitlb mRNA is expressed in brain ventricles, ear, and cardinal vein plexus, in regions generally not complementary to either zebrafish kit receptor ortholog. However, like kitla, kitlb is expressed in the skin during stages consistent with melanocyte survival. Thus, it appears that kita and kitla have maintained congruent expression patterns, while kitb and kitlb have evolved divergent expression patterns. We demonstrate the interaction of kita and kitla by morpholino knockdown analysis. kitla morphants, but not kitlb morphants, phenocopy the null allele of kita, with defects for both melanocyte migration and survival. Furthermore, kitla morpholino, but not kitlb morpholino, interacts genetically with a sensitized allele of kita, confirming that kitla is the functional ligand to kita. Last, we examine kitla overexpression in embryos, which results in hyperpigmentation caused by an increase in the number and size of melanocytes. This hyperpigmentation is dependent on kita function. We conclude that following genome duplication, kita and kitla have maintained their receptor-ligand relationship, coevolved complementary expression patterns, and that

  17. Cgl2 plays an essential role in cuticular wax biosynthesis in cabbage (Brassica oleracea L. var. capitata).

    Science.gov (United States)

    Liu, Dongming; Tang, Jun; Liu, Zezhou; Dong, Xin; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao; Sun, Peitian; Liu, Yumei; Li, Zhansheng; Ye, Zhibiao; Fang, Zhiyuan; Yang, Limei

    2017-11-28

    The aerial parts of most land plants are covered with cuticular wax which is important for plants to avoid harmful factors. There is still no cloning study about wax synthesis gene of the alcohol-forming pathway in Brassica species. Scanning electron microscopy (SEM) showed that, compared with wild type (WT), wax crystal are severely reduced in both the adaxial and abaxial sides of cabbage (Brassica oleracea L. var. capitata L.) leaves from the LD10GL mutant. Genetic analysis results revealed that the glossy trait of LD10GL is controlled by a single recessive gene, and fine mapping results revealed that the target gene Cgl2 (Cabbage glossy 2) is located within a physical region of 170 kb on chromosome 1. Based on sequence analysis of the genes in the mapped region, the gene designated Bol013612 was speculated to be the candidate gene. Gene Bol013612 is homologous to Arabidopsis CER4, which encodes fatty acyl-coenzyme A reductase. Sequencing identified a single nucleotide substitution at an intron/exon boundary that results in an insertion of six nucleotides in the cDNA of Bol013612 in LD10GL. The phenotypic defect of LD10GL was confirmed by a functional complementation test with Arabidopsis mutant cer4. Our results indicated that wax crystals of cabbage mutant LD10GL are severely reduced and mutation of gene Bol013612 causes a glossy phenotype in the LD10GL mutant.

  18. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Science.gov (United States)

    Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-07-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  19. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Directory of Open Access Journals (Sweden)

    Philippe Ganot

    2011-07-01

    Full Text Available Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion, which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones or aposymbiotic (also called bleached A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm. A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both

  20. Gene duplication and neo-functionalization in the evolutionary and functional divergence of the metazoan copper transporters Ctr1 and Ctr2.

    Science.gov (United States)

    Logeman, Brandon L; Wood, L Kent; Lee, Jaekwon; Thiele, Dennis J

    2017-07-07

    Copper is an essential element for proper organismal development and is involved in a range of processes, including oxidative phosphorylation, neuropeptide biogenesis, and connective tissue maturation. The copper transporter (Ctr) family of integral membrane proteins is ubiquitously found in eukaryotes and mediates the high-affinity transport of Cu + across both the plasma membrane and endomembranes. Although mammalian Ctr1 functions as a Cu + transporter for Cu acquisition and is essential for embryonic development, a homologous protein, Ctr2, has been proposed to function as a low-affinity Cu transporter, a lysosomal Cu exporter, or a regulator of Ctr1 activity, but its functional and evolutionary relationship to Ctr1 is unclear. Here we report a biochemical, genetic, and phylogenetic comparison of metazoan Ctr1 and Ctr2, suggesting that Ctr2 arose over 550 million years ago as a result of a gene duplication event followed by loss of Cu + transport activity. Using a random mutagenesis and growth selection approach, we identified amino acid substitutions in human and mouse Ctr2 proteins that support copper-dependent growth in yeast and enhance copper accumulation in Ctr1 -/- mouse embryonic fibroblasts. These mutations revert Ctr2 to a more ancestral Ctr1-like state while maintaining endogenous functions, such as stimulating Ctr1 cleavage. We suggest key structural aspects of metazoan Ctr1 and Ctr2 that discriminate between their biological roles, providing mechanistic insights into the evolutionary, biochemical, and functional relationships between these two related proteins. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Tandem duplication of 11p12-p13 in a child with borderline development delay and eye abnormalities: dose effect of the PAX6 gene product?

    NARCIS (Netherlands)

    Aalfs, C. M.; Fantes, J. A.; Wenniger-Prick, L. J.; Sluijter, S.; Hennekam, R. C.; van Heyningen, V.; Hoovers, J. M.

    1997-01-01

    We report on a girl with a duplication of chromosome band 11p12-->13, which includes the Wilms tumor gene (WT1) and the aniridia gene (PAX6). The girl had borderline developmental delay, mild facial anomalies, and eye abnormalities. Eye findings were also present in most of the 11 other published

  2. Characterization of the past and current duplication activities in the human 22q11.2 region

    Directory of Open Access Journals (Sweden)

    Morrow Bernice

    2011-01-01

    Full Text Available Abstract Background Segmental duplications (SDs on 22q11.2 (LCR22, serve as substrates for meiotic non-allelic homologous recombination (NAHR events resulting in several clinically significant genomic disorders. Results To understand the duplication activity leading to the complicated SD structure of this region, we have applied the A-Bruijn graph algorithm to decompose the 22q11.2 SDs to 523 fundamental duplication sequences, termed subunits. Cross-species syntenic analysis of primate genomes demonstrates that many of these LCR22 subunits emerged very recently, especially those implicated in human genomic disorders. Some subunits have expanded more actively than others, and young Alu SINEs, are associated much more frequently with duplicated sequences that have undergone active expansion, confirming their role in mediating recombination events. Many copy number variations (CNVs exist on 22q11.2, some flanked by SDs. Interestingly, two chromosome breakpoints for 13 CNVs (mean length 65 kb are located in paralogous subunits, providing direct evidence that SD subunits could contribute to CNV formation. Sequence analysis of PACs or BACs identified extra CNVs, specifically, 10 insertions and 18 deletions within 22q11.2; four were more than 10 kb in size and most contained young AluYs at their breakpoints. Conclusions Our study indicates that AluYs are implicated in the past and current duplication events, and moreover suggests that DNA rearrangements in 22q11.2 genomic disorders perhaps do not occur randomly but involve both actively expanded duplication subunits and Alu elements.

  3. Defining the Effect of the 16p11.2 Duplication on Cognition, Behavior, and Medical Comorbidities

    Science.gov (United States)

    D’Angelo, Debra; Lebon, Sébastien; Chen, Qixuan; Martin-Brevet, Sandra; Snyder, LeeAnne Green; Hippolyte, Loyse; Hanson, Ellen; Maillard, Anne M.; Faucett, W. Andrew; Macé, Aurélien; Pain, Aurélie; Bernier, Raphael; Chawner, Samuel J. R. A.; David, Albert; Andrieux, Joris; Aylward, Elizabeth; Baujat, Genevieve; Caldeira, Ines; Conus, Philippe; Ferrari, Carrina; Forzano, Francesca; Gérard, Marion; Goin-Kochel, Robin P.; Grant, Ellen; Hunter, Jill V.; Isidor, Bertrand; Jacquette, Aurélia; Jønch, Aia E.; Keren, Boris; Lacombe, Didier; Caignec, Cédric Le; Martin, Christa Lese; Männik, Katrin; Metspalu, Andres; Mignot, Cyril; Mukherjee, Pratik; Owen, Michael J.; Passeggeri, Marzia; Rooryck-Thambo, Caroline; Rosenfeld, Jill A.; Spence, Sarah J.; Steinman, Kyle J.; Tjernagel, Jennifer; Van Haelst, Mieke; Shen, Yiping; Draganski, Bogdan; Sherr, Elliott H.; Ledbetter, David H.; van den Bree, Marianne B. M.; Beckmann, Jacques S.; Spiro, John E.; Reymond, Alexandre; Jacquemont, Sébastien; Chung, Wendy K.

    2018-01-01

    IMPORTANCE The 16p11.2 BP4-BP5 duplication is the copy number variant most frequently associated with autism spectrum disorder (ASD), schizophrenia, and comorbidities such as decreased body mass index (BMI). OBJECTIVES To characterize the effects of the 16p11.2 duplication on cognitive, behavioral, medical, and anthropometric traits and to understand the specificity of these effects by systematically comparing results in duplication carriers and reciprocal deletion carriers, who are also at risk for ASD. DESIGN, SETTING, AND PARTICIPANTS This international cohort study of 1006 study participants compared 270 duplication carriers with their 102 intrafamilial control individuals, 390 reciprocal deletion carriers, and 244 deletion controls from European and North American cohorts. Data were collected from August 1, 2010, to May 31, 2015 and analyzed from January 1 to August 14, 2015. Linear mixed models were used to estimate the effect of the duplication and deletion on clinical traits by comparison with noncarrier relatives. MAIN OUTCOMES AND MEASURES Findings on the Full-Scale IQ (FSIQ), Nonverbal IQ, and Verbal IQ; the presence of ASD or other DSM-IV diagnoses; BMI; head circumference; and medical data. RESULTS Among the 1006 study participants, the duplication was associated with a mean FSIQ score that was lower by 26.3 points between proband carriers and noncarrier relatives and a lower mean FSIQ score (16.2-11.4 points) in nonproband carriers. The mean overall effect of the deletion was similar (−22.1 points; P 100) compared with the deletion group (P < .001). Parental FSIQ predicted part of this variation (approximately 36.0% in hereditary probands). Although the frequency of ASD was similar in deletion and duplication proband carriers (16.0% and 20.0%, respectively), the FSIQ was significantly lower (by 26.3 points) in the duplication probands with ASD. There also were lower head circumference and BMI measurements among duplication carriers, which is

  4. Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)

    DEFF Research Database (Denmark)

    Ronander, Elena; Bengtsson, Dominique C; Joergensen, Louise

    2012-01-01

    Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes. The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has...... been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors...... fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE(1). Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human...

  5. Bactericidal Activity of Ceragenin CSA-13 in Cell Culture and in an Animal Model of Peritoneal Infection.

    Science.gov (United States)

    Bucki, Robert; Niemirowicz, Katarzyna; Wnorowska, Urszula; Byfield, Fitzroy J; Piktel, Ewelina; Wątek, Marzena; Janmey, Paul A; Savage, Paul B

    2015-10-01

    Ceragenins constitute a novel family of cationic antibiotics characterized by a broad spectrum of antimicrobial activities, which have mostly been assessed in vitro. Using a polarized human lung epithelial cell culture system, we evaluated the antibacterial activities of the ceragenin CSA-13 against two strains of Pseudomonas aeruginosa (PAO1 and Xen5). Additionally, the biodistribution and bactericidal activity of a CSA-13-IRDye 800CW derivate were assessed using an animal model of peritoneal infection after PAO1 challenge. In cell culture, CSA-13 bactericidal activities against PAO1 and Xen5 were higher than the activities of the human cathelicidin peptide LL-37. Increased CSA-13 activity was observed in polarized human lung epithelial cell cultures subjected to butyric acid treatment, which is known to increase endogenous LL-37 production. Eight hours after intravenous or intraperitoneal injection, the greatest CSA-13-IRDye 800CW accumulation was observed in mouse liver and kidneys. CSA-13-IRDye 800CW administration resulted in decreased bacterial outgrowth from abdominal fluid collected from animals subjected to intraperitoneal PAO1 infection. These observations indicate that CSA-13 may synergistically interact with antibacterial factors that are naturally present at mucosal surfaces and it maintains its antibacterial activity in the infected abdominal cavity. Cationic lipids such as CSA-13 represent excellent candidates for the development of new antibacterial compounds. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  6. Duplicate retention in signalling proteins and constraints from network dynamics.

    Science.gov (United States)

    Soyer, O S; Creevey, C J

    2010-11-01

    Duplications are a major driving force behind evolution. Most duplicates are believed to fix through genetic drift, but it is not clear whether this process affects all duplications equally or whether there are certain gene families that are expected to show neutral expansions under certain circumstances. Here, we analyse the neutrality of duplications in different functional classes of signalling proteins based on their effects on response dynamics. We find that duplications involving intermediary proteins in a signalling network are neutral more often than those involving receptors. Although the fraction of neutral duplications in all functional classes increase with decreasing population size and selective pressure on dynamics, this effect is most pronounced for receptors, indicating a possible expansion of receptors in species with small population size. In line with such an expectation, we found a statistically significant increase in the number of receptors as a fraction of genome size in eukaryotes compared with prokaryotes. Although not confirmative, these results indicate that neutral processes can be a significant factor in shaping signalling networks and affect proteins from different functional classes differently. © 2010 The Authors. Journal Compilation © 2010 European Society For Evolutionary Biology.

  7. The complete chloroplast genome sequence of Gentiana lawrencei var. farreri (Gentianaceae) and comparative analysis with its congeneric species.

    Science.gov (United States)

    Fu, Peng-Cheng; Zhang, Yan-Zhao; Geng, Hui-Min; Chen, Shi-Long

    2016-01-01

    The chloroplast (cp) genome is useful in plant systematics, genetic diversity analysis, molecular identification and divergence dating. The genus Gentiana contains 362 species, but there are only two valuable complete cp genomes. The purpose of this study is to report the characterization of complete cp genome of G. lawrencei var. farreri , which is endemic to the Qinghai-Tibetan Plateau (QTP). Using high throughput sequencing technology, we got the complete nucleotide sequence of the G. lawrencei var. farreri cp genome. The comparison analysis including genome difference and gene divergence was performed with its congeneric species G. straminea . The simple sequence repeats (SSRs) and phylogenetics were studied as well. The cp genome of G. lawrencei var. farreri is a circular molecule of 138,750 bp, containing a pair of 24,653 bp inverted repeats which are separated by small and large single-copy regions of 11,365 and 78,082 bp, respectively. The cp genome contains 130 known genes, including 85 protein coding genes (PCGs), eight ribosomal RNA genes and 37 tRNA genes. Comparative analyses indicated that G. lawrencei var. farreri is 10,241 bp shorter than its congeneric species G. straminea. Four large gaps were detected that are responsible for 85% of the total sequence loss. Further detailed analyses revealed that 10 PCGs were included in the four gaps that encode nine NADH dehydrogenase subunits. The cp gene content, order and orientation are similar to those of its congeneric species, but with some variation among the PCGs. Three genes, ndhB , ndhF and clpP , have high nonsynonymous to synonymous values. There are 34 SSRs in the G. lawrencei var. farreri cp genome, of which 25 are mononucleotide repeats: no dinucleotide repeats were detected. Comparison with the G. straminea cp genome indicated that five SSRs have length polymorphisms and 23 SSRs are species-specific. The phylogenetic analysis of 48 PCGs from 12 Gentianales taxa cp genomes clearly identified

  8. A VAR2CSA:CSP conjugate capable of inducing dual specificity ...

    African Journals Online (AJOL)

    Background: Vaccine antigens targeting specific P. falciparum parasite stages are under pre-clinical and clinical development. It seems plausible that vaccine with multiple specificities will offer higher protection. With this hypothesis, we exploited the Spy- Tag/SpyCatcher conjugation system to make a, post expression, dual ...

  9. A VAR2CSA:CSP conjugate capable of inducing dual specificity ...

    African Journals Online (AJOL)

    Background: Vaccine antigens targeting specific P. falciparum parasite stages are under pre-clinical ... against individual antigen components in a dual stage anti-malaria vaccine. ..... (D8428, Sigma Aldrich) was prepared in Dulbecco's PBS.

  10. Meiotic UV-sensitive mutant that causes deletion of duplications in neurospora

    International Nuclear Information System (INIS)

    Newmeyer, D.; Galeazzi, D.R.

    1978-01-01

    The meiotic-3 (mei-3) mutant of Neurospora crassa has several effects: (1) when homozygous, it almost completely blocks meiosis and ascospore formation, (2) it is sensitive to uv, (3) its growth is inhibited by histidine, and (4) it increases the instability of nontandem duplications. This was shown for duplications produced by five different rearrangements and was demonstrated by two different criteria. The effects on meiosis and duplication instability are expressed strongly at 25 0 ; the effects on sensitivity to uv and to histidine are expressed strongly at 38.5 0 but only slightly at 25 0 . Nevertheless, all four effects were shown to be due to a single gene. Mei-3 is not allelic with previously reported uv-sensitive mutants. Two other results were obtained that are not necessarily due to mei-3: (1) a cross involving mei-3 produced a new unlinked meiotic mutant, mei-4, which is not sensitive to uv or histidine, and (2) a burst of several new mutants occurred in a different mei-3 stock, including a partial revertant to mei-3. Mei-3 has previously been shown to cause frequent complete loss of a terminal duplicate segment, beginning exactly at the original rearrangement breakpoint. Possible mechanisms are discussed by which a uv-sensitive mutant could cause such precise deletions

  11. A novel duplication polymorphism in the FANCA promoter and its association with breast and ovarian cancer

    International Nuclear Information System (INIS)

    Thompson, Ella; Dragovic, Rebecca L; Stephenson, Sally-Anne; Eccles, Diana M; Campbell, Ian G; Dobrovic, Alexander

    2005-01-01

    The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer

  12. A novel duplication polymorphism in the FANCA promoter and its association with breast and ovarian cancer.

    Science.gov (United States)

    Thompson, Ella; Dragovic, Rebecca L; Stephenson, Sally-Anne; Eccles, Diana M; Campbell, Ian G; Dobrovic, Alexander

    2005-04-29

    The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer.

  13. A novel duplication polymorphism in the FANCA promoter and its association with breast and ovarian cancer

    Directory of Open Access Journals (Sweden)

    Campbell Ian G

    2005-04-01

    Full Text Available Abstract The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. Methods We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. Results The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. Conclusion The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer.

  14. Mutations in Cockayne Syndrome-Associated Genes (Csa and Csb) Predispose to Cisplatin-Induced Hearing Loss in Mice

    Science.gov (United States)

    Rainey, Robert N.; Ng, Sum-yan; Llamas, Juan; van der Horst, Gijsbertus T. J.

    2016-01-01

    sensorineural hearing loss. We show that mouse models of Cockayne syndrome, a progeroid disorder resulting from a defect in the transcription-coupled DNA repair (TCR) branch of nucleotide excision repair, are hypersensitive to cisplatin-induced hearing loss and sensory hair cell death in the organ of Corti, the mammalian auditory sensory epithelium. Our work indicates that Csa and Csb, two genes involved in TCR, are preferentially required to protect against cisplatin ototoxicity, relative to global genome repair-specific elements of nucleotide excision repair, and suggests that TCR is a major force maintaining DNA integrity in the cochlea. The Cockayne syndrome mice thus represent a model for testing the contribution of DNA repair mechanisms to cisplatin ototoxicity. PMID:27122034

  15. The role of duplications in the evolution of genomes highlights the need for evolutionary-based approaches in comparative genomics

    Directory of Open Access Journals (Sweden)

    Levasseur Anthony

    2011-02-01

    Full Text Available Abstract Understanding the evolutionary plasticity of the genome requires a global, comparative approach in which genetic events are considered both in a phylogenetic framework and with regard to population genetics and environmental variables. In the mechanisms that generate adaptive and non-adaptive changes in genomes, segmental duplications (duplication of individual genes or genomic regions and polyploidization (whole genome duplications are well-known driving forces. The probability of fixation and maintenance of duplicates depends on many variables, including population sizes and selection regimes experienced by the corresponding genes: a combination of stochastic and adaptive mechanisms has shaped all genomes. A survey of experimental work shows that the distinction made between fixation and maintenance of duplicates still needs to be conceptualized and mathematically modeled. Here we review the mechanisms that increase or decrease the probability of fixation or maintenance of duplicated genes, and examine the outcome of these events on the adaptation of the organisms. Reviewers This article was reviewed by Dr. Etienne Joly, Dr. Lutz Walter and Dr. W. Ford Doolittle.

  16. Functional diversification upon leader protease domain duplication in the Citrus tristeza virus genome: Role of RNA sequences and the encoded proteins.

    Science.gov (United States)

    Kang, Sung-Hwan; Atallah, Osama O; Sun, Yong-Duo; Folimonova, Svetlana Y

    2018-01-15

    Viruses from the family Closteroviridae show an example of intra-genome duplications of more than one gene. In addition to the hallmark coat protein gene duplication, several members possess a tandem duplication of papain-like leader proteases. In this study, we demonstrate that domains encoding the L1 and L2 proteases in the Citrus tristeza virus genome underwent a significant functional divergence at the RNA and protein levels. We show that the L1 protease is crucial for viral accumulation and establishment of initial infection, whereas its coding region is vital for virus transport. On the other hand, the second protease is indispensable for virus infection of its natural citrus host, suggesting that L2 has evolved an important adaptive function that mediates virus interaction with the woody host. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Expression of embryonic hemoglobin genes in mice heterozygous for α-thalassemia or β-duplication traits and in mice heterozygous for both traits

    International Nuclear Information System (INIS)

    Popp, R.A.; Marsh, C.L.; Skow, L.C.

    1981-01-01

    Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous α-thalassemic embryos, expression of EI (x 2 y 2 ) and EII (α 2 y 2 ) is deficient because the x- and α-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- and α-globin genes indicates that these genes must be closely linked. Reduced x- and α-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y 4 hemoglobin also appears in β-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and β-globin genes. In double heterozygotes, which have a single functional allele of x- and α-globin genes and three functional alleles of y- and β-globin genes, synthesis of α and non-α chains is severely imbalanced and half of the total hemoglobin is y 4 . Mouse y 4 has a high affinity for oxygen, P 50 of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues

  18. Mapping 22q11.2 Gene Dosage Effects on Brain Morphometry.

    Science.gov (United States)

    Lin, Amy; Ching, Christopher R K; Vajdi, Ariana; Sun, Daqiang; Jonas, Rachel K; Jalbrzikowski, Maria; Kushan-Wells, Leila; Pacheco Hansen, Laura; Krikorian, Emma; Gutman, Boris; Dokoru, Deepika; Helleman, Gerhard; Thompson, Paul M; Bearden, Carrie E

    2017-06-28

    Reciprocal chromosomal rearrangements at the 22q11.2 locus are associated with elevated risk of neurodevelopmental disorders. The 22q11.2 deletion confers the highest known genetic risk for schizophrenia, but a duplication in the same region is strongly associated with autism and is less common in schizophrenia cases than in the general population. Here we conducted the first study of 22q11.2 gene dosage effects on brain structure in a sample of 143 human subjects: 66 with 22q11.2 deletions (22q-del; 32 males), 21 with 22q11.2 duplications (22q-dup; 14 males), and 56 age- and sex-matched controls (31 males). 22q11.2 gene dosage varied positively with intracranial volume, gray and white matter volume, and cortical surface area (deletion control > duplication). Widespread differences were observed for cortical surface area with more localized effects on cortical thickness. These diametric patterns extended into subcortical regions: 22q-dup carriers had a significantly larger right hippocampus, on average, but lower right caudate and corpus callosum volume, relative to 22q-del carriers. Novel subcortical shape analysis revealed greater radial distance (thickness) of the right amygdala and left thalamus, and localized increases and decreases in subregions of the caudate, putamen, and hippocampus in 22q-dup relative to 22q-del carriers. This study provides the first evidence that 22q11.2 is a genomic region associated with gene-dose-dependent brain phenotypes. Pervasive effects on cortical surface area imply that this copy number variant affects brain structure early in the course of development. SIGNIFICANCE STATEMENT Probing naturally occurring reciprocal copy number variation in the genome may help us understand mechanisms underlying deviations from typical brain and cognitive development. The 22q11.2 genomic region is particularly susceptible to chromosomal rearrangements and contains many genes crucial for neuronal development and migration. Not surprisingly

  19. Genetics Home Reference: 7q11.23 duplication syndrome

    Science.gov (United States)

    ... Duplication Syndrome. 2015 Nov 25. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Ledbetter N, Mefford HC, Smith RJH, Stephens K, editors. GeneReviews® [Internet]. Seattle (WA): ...

  20. Quantitative measurement of duplicated DNA as a diagnostic test for Charcot-Marie-Tooth disease type 1a

    NARCIS (Netherlands)

    Hensels, G. W.; Janssen, E. A.; Hoogendijk, J. E.; Valentijn, L. J.; Baas, F.; Bolhuis, P. A.

    1993-01-01

    Charcot-Marie-Tooth disease type 1 (CMT1) is a hereditary motor and sensory neuropathy. The autosomal dominant subtype is often linked with a large duplication on chromosome 17p11.2. The gene encoding the peripheral myelin protein PMP 22 (the critical gene in this subtype of CMT1) is located within

  1. winged eye Induces Transdetermination of Drosophila Imaginal Disc by Acting in Concert with a Histone Methyltransferase, Su(var3-9

    Directory of Open Access Journals (Sweden)

    Keita Masuko

    2018-01-01

    Full Text Available Summary: Drosophila imaginal disc cells exhibit a remarkable ability to convert cell fates in response to various perturbations, a phenomenon called transdetermination (TD. We previously identified winged eye (wge as a factor that induces eye-to-wing TD upon overexpression in eye imaginal discs, but the molecular mechanisms underlying TD have remained largely unclear. Here, we found that wge induces various histone modifications and enhances the methylation of Lys9 on histone H3 (H3K9, a feature of heterochromatin. A histone methyltransferase, Su(var3-9, is required for wge-mediated H3K9 methylation and eye-to-wing TD. Su(var3-9 is also required for classical wound-induced TD but not for normal development, suggesting its involvement in several types of imaginal disc TDs. Transcriptome analysis revealed that wge represses eye identity genes independently of Su(var3-9 and activates TD-related genes by acting together with Su(var3-9. These findings provide new insights into diverse types of chromatin regulation at progressive steps of cell-fate conversions. : Drosophila imaginal discs switch disc identity by a process known as transdetermination. Masuko et al. demonstrate that expression of the winged eye gene induces transdetermination through histone modifications such as H3K9-methylation. winged eye regulates expression of transdetermination-related genes via a histone methyltransferase, Su(var3-9. Keywords: Drosophila, imaginal disc, transdetermination, heterochromatin, cell fate, winged eye, reprogramming, Su(var3-9

  2. Long-term heat storage in calcium sulfoaluminate cement (CSA) based concrete

    Energy Technology Data Exchange (ETDEWEB)

    Kaufmann, Josef P.; Winnefeld, Frank [Empa Swiss Federal Laboratories for Materials Science and Technology, Duebendorf (Switzerland). Lab. for Concrete and Construction Chemistry

    2011-07-01

    In general, the selection of materials proposed for solar heat storage is based on one of two principal processes: sensible heat storage or latent heat storage. Sensible heat storage utilizes the specific heat capacity of a material, while latent heat storage is based on the change in enthalpy (heat content) associated with a phase change of the material. Long time sensible heat storage requires excellent thermal insulation whereas latent heat storage allows permanent (seasonal) storage without significant energy losses and any special insulation. Ettringite, one of the cement hydration products, exhibits a high dehydration enthalpy. Calcium sulfoaluminate cement based concrete containing a high amount of ettringite is henceproposed as an efficient latent heat storage material. Compared to conventional heat storage materials this innovative concrete mixture has a high loss-free storage energy density (> 100-150 kWh/m{sup 3}) which is much higher than the one of paraffin or the (loss-sensitive) sensible heat of water. Like common concrete the CSA-concrete is stable and even may carry loads. The dehydration of the CSA-concrete is achieved at temperatures below 100 C. The rehydration process occurs as soon as water (liquid or vapor) is added. In contrast to paraffin, the phase change temperature is not fixed and the latent heat may be recovered at any desired temperature. Furthermore the heat conductivity of this material is high, so that the energy transfer from/to an exchange medium is easy. Additionally CSA-concrete is not flammable and absolutely safe regarding any health aspects. The cost of such CSA-concrete isin the order of normal concrete. The main application is seen in house heating systems. Solar heat, mostly generated during the summer period by means of roof collectors, can be stored in CSA-concrete until the winter. A part or even the whole annual heatingenergy may be produced and saved locally by the householder himself. Additional applications may be

  3. Embryonic duplications in sheep.

    Science.gov (United States)

    Dennis, S M

    1975-02-01

    Twenty-seven embryonic duplications were examined during a 3-year investigation into the causes of perinatal lamb mortality. Twenty of the 27 were anomalous twins with 19 being conjoined (diplopagus 9 and heteropagus 10). The various duplications were: haloacardius acephalus 1, diprosopus 2, dicephalus 2, dipypus 3, diprosopus dipygus 1, syncephalus dipygus 1, pygopagus parasiticus 1, heteropagus dipygus 3, melodidymus 6, polyury 4, penile duplication 2, and bilateral otognathia 1. Four lambs were living and the time of death of the others was: parturient 8, and post-parturient 15. Average dry weight of the lambs was 3.35 kg (range 1.59 to 5.45 kg). Breed distribution was: Merino 77.8%, Crossbred 14.8%, Dorset Horn 3.7%, and Corriedale 3.7%. The caudal region was involved in 10 of the conjoined twins (52.6%), anterior region in 7 (36.9%), and both anterior and caudal regions in 2 (10.5%). Associated defects were present in 70.4% of the 27 lambs, the most common being atresia ani.

  4. Partial AZFc duplications not deletions are associated with male infertility in the Yi population of Yunnan Province, China.

    Science.gov (United States)

    Ye, Jun-jie; Ma, Li; Yang, Li-juan; Wang, Jin-huan; Wang, Yue-li; Guo, Hai; Gong, Ning; Nie, Wen-hui; Zhao, Shu-hua

    2013-09-01

    There are many reports on associations between spermatogenesis and partial azoospermia factor c (AZFc) deletions as well as duplications; however, results are conflicting, possibly due to differences in methodology and ethnic background. The purpose of this study is to investigate the association of AZFc polymorphisms and male infertility in the Yi ethnic population, residents within Yunnan Province, China. A total of 224 infertile patients and 153 fertile subjects were selected in the Yi ethnic population. The study was performed by sequence-tagged site plus/minus (STS+/-) analysis followed by gene dosage and gene copy definition analysis. Y haplotypes of 215 cases and 115 controls were defined by 12 binary markers using single nucleotide polymorphism on Y chromosome (Y-SNP) multiplex assays based on single base primer extension technology. The distribution of Y haplotypes was not significantly different between the case and control groups. The frequencies of both gr/gr (7.6% vs. 8.5%) and b2/b3 (6.3% vs. 8.5%) deletions do not show significant differences. Similarly, single nucleotide variant (SNV) analysis shows no significant difference of gene copy definition between the cases and controls. However, the frequency of partial duplications in the infertile group (4.0%) is significantly higher than that in the control group (0.7%). Further, we found a case with sY1206 deletion which had two CDY1 copies but removed half of DAZ genes. Our results show that male infertility is associated with partial AZFc duplications, but neither gr/gr nor b2/b3 deletions, suggesting that partial AZFc duplications rather than deletions are risk factors for male infertility in Chinese-Yi population.

  5. ESTIMASI NILAI VaR PORTOFOLIO MENGGUNAKAN FUNGSI ARCHIMEDEAN COPULA

    Directory of Open Access Journals (Sweden)

    AULIA ATIKA PRAWIBTA SUHARTO

    2017-01-01

    Full Text Available Value at Risk explains the magnitude of the worst losses occurred in financial products investments with a certain level of confidence and time interval. The purpose of this study is to estimate the VaR of portfolio using Archimedean Copula family. The methods for calculating the VaR are as follows: (1 calculating the stock return; (2 calculating descriptive statistics of return; (3 checking for the nature of autocorrelation and heteroscedasticity effects on stock return data; (4 checking for the presence of extreme value by using Pareto tail; (5 estimating the parameters of Achimedean Copula family; (6 conducting simulations of Archimedean Copula; (7 estimating the value of the stock portfolio VaR. This study uses the closing price of TLKM and GGRM. At 90% the VaR obtained using Clayton, Gumbel, Frank copulas are 0.9562%, 1.0189%, 0.9827% respectively. At 95% the VaR obtained using Clayton, Gumbel, Frank copulas are 1.2930%, 1.2522%, 1.3152% respectively. At 99% the VaR obtained using Clayton, Gumbel, Frank copulas are 2.0327%, 1.9164%, is 1.8678% respectively. In conclusion estimation of VaR using Clayton copula yields the highest VaR.

  6. Genetics and fine mapping of a purple leaf gene, BoPr, in ornamental kale (Brassica oleracea L. var. acephala).

    Science.gov (United States)

    Liu, Xiao-Ping; Gao, Bao-Zhen; Han, Feng-Qing; Fang, Zhi-Yuan; Yang, Li-Mei; Zhuang, Mu; Lv, Hong-Hao; Liu, Yu-Mei; Li, Zhan-Sheng; Cai, Cheng-Cheng; Yu, Hai-Long; Li, Zhi-Yuan; Zhang, Yang-Yong

    2017-03-14

    Due to its variegated and colorful leaves, ornamental kale (Brassica oleracea L. var. acephala) has become a popular ornamental plant. In this study, we report the fine mapping and analysis of a candidate purple leaf gene using a backcross population and an F 2 population derived from two parental lines: W1827 (with white leaves) and P1835 (with purple leaves). Genetic analysis indicated that the purple leaf trait is controlled by a single dominant gene, which we named BoPr. Using markers developed based on the reference genome '02-12', the BoPr gene was preliminarily mapped to a 280-kb interval of chromosome C09, with flanking markers M17 and BoID4714 at genetic distances of 4.3 cM and 1.5 cM, respectively. The recombination rate within this interval is almost 12 times higher than the usual level, which could be caused by assembly error for reference genome '02-12' at this interval. Primers were designed based on 'TO1000', another B. oleracea reference genome. Among the newly designed InDel markers, BRID485 and BRID490 were found to be the closest to BoPr, flanking the gene at genetic distances of 0.1 cM and 0.2 cM, respectively; the interval between the two markers is 44.8 kb (reference genome 'TO1000'). Seven annotated genes are located within the 44.8 kb genomic region, of which only Bo9g058630 shows high homology to AT5G42800 (dihydroflavonol reductase), which was identified as a candidate gene for BoPr. Blast analysis revealed that this 44.8 kb interval is located on an unanchored scaffold (Scaffold000035_P2) of '02-12', confirming the existence of assembly error at the interval between M17 and BoID4714 for reference genome '02-12'. This study identified a candidate gene for BoPr and lays a foundation for the cloning and functional analysis of this gene.

  7. The evolution and appearance of C3 duplications in fish originate an exclusive teleost c3 gene form with anti-inflammatory activity.

    Directory of Open Access Journals (Sweden)

    Gabriel Forn-Cuní

    Full Text Available The complement system acts as a first line of defense and promotes organism homeostasis by modulating the fates of diverse physiological processes. Multiple copies of component genes have been previously identified in fish, suggesting a key role for this system in aquatic organisms. Herein, we confirm the presence of three different previously reported complement c3 genes (c3.1, c3.2, c3.3 and identify five additional c3 genes (c3.4, c3.5, c3.6, c3.7, c3.8 in the zebrafish genome. Additionally, we evaluate the mRNA expression levels of the different c3 genes during ontogeny and in different tissues under steady-state and inflammatory conditions. Furthermore, while reconciling the phylogenetic tree with the fish species tree, we uncovered an event of c3 duplication common to all teleost fishes that gave rise to an exclusive c3 paralog (c3.7 and c3.8. These paralogs showed a distinct ability to regulate neutrophil migration in response to injury compared with the other c3 genes and may play a role in maintaining the balance between inflammatory and homeostatic processes in zebrafish.

  8. Identificación de proteínas que interaccionan con CypA, CypB y FKBP12 y su implicación en la toxicidad renal producida por los inmunosupresores CsA y FK506

    OpenAIRE

    Suñé Rodríguez, Guillermo

    2008-01-01

    La Ciclosporina A (CsA) es un fármaco inmunosupresor que ha supuesto una revolución en el trasplante de órganos. A pesar de sus propiedades anti-inflamatorias, su uso se ha visto limitado por los efectos tóxicos que causa en algunos pacientes. La CsA inhibe la trascripción de genes involucrados en el sistema inmune. Se cree que esta inhibición es la causante de los efectos tóxicos producidos por el fármaco. El modo de acción de CsA está mediado por la unión de sus principales receptores intra...

  9. Transcriptome sequence analysis of an ornamental plant, Ananas comosus var. bracteatus, revealed the potential unigenes involved in terpenoid and phenylpropanoid biosynthesis.

    Science.gov (United States)

    Ma, Jun; Kanakala, S; He, Yehua; Zhang, Junli; Zhong, Xiaolan

    2015-01-01

    Ananas comosus var. bracteatus (Red Pineapple) is an important ornamental plant for its colorful leaves and decorative red fruits. Because of its complex genome, it is difficult to understand the molecular mechanisms involved in the growth and development. Thus high-throughput transcriptome sequencing of Ananas comosus var. bracteatus is necessary to generate large quantities of transcript sequences for the purpose of gene discovery and functional genomic studies. The Ananas comosus var. bracteatus transcriptome was sequenced by the Illumina paired-end sequencing technology. We obtained a total of 23.5 million high quality sequencing reads, 1,555,808 contigs and 41,052 unigenes. In total 41,052 unigenes of Ananas comosus var. bracteatus, 23,275 unigenes were annotated in the NCBI non-redundant protein database and 23,134 unigenes were annotated in the Swiss-Port database. Out of these, 17,748 and 8,505 unigenes were assigned to gene ontology categories and clusters of orthologous groups, respectively. Functional annotation against Kyoto Encyclopedia of Genes and Genomes Pathway database identified 5,825 unigenes which were mapped to 117 pathways. The assembly predicted many unigenes that were previously unknown. The annotated unigenes were compared against pineapple, rice, maize, Arabidopsis, and sorghum. Unigenes that did not match any of those five sequence datasets are considered to be Ananas comosus var. bracteatus unique. We predicted unigenes encoding enzymes involved in terpenoid and phenylpropanoid biosynthesis. The sequence data provide the most comprehensive transcriptomic resource currently available for Ananas comosus var. bracteatus. To our knowledge; this is the first report on the de novo transcriptome sequencing of the Ananas comosus var. bracteatus. Unigenes obtained in this study, may help improve future gene expression, genetic and genomics studies in Ananas comosus var. bracteatus.

  10. Transcriptome sequence analysis of an ornamental plant, Ananas comosus var. bracteatus, revealed the potential unigenes involved in terpenoid and phenylpropanoid biosynthesis.

    Directory of Open Access Journals (Sweden)

    Jun Ma

    Full Text Available Ananas comosus var. bracteatus (Red Pineapple is an important ornamental plant for its colorful leaves and decorative red fruits. Because of its complex genome, it is difficult to understand the molecular mechanisms involved in the growth and development. Thus high-throughput transcriptome sequencing of Ananas comosus var. bracteatus is necessary to generate large quantities of transcript sequences for the purpose of gene discovery and functional genomic studies.The Ananas comosus var. bracteatus transcriptome was sequenced by the Illumina paired-end sequencing technology. We obtained a total of 23.5 million high quality sequencing reads, 1,555,808 contigs and 41,052 unigenes. In total 41,052 unigenes of Ananas comosus var. bracteatus, 23,275 unigenes were annotated in the NCBI non-redundant protein database and 23,134 unigenes were annotated in the Swiss-Port database. Out of these, 17,748 and 8,505 unigenes were assigned to gene ontology categories and clusters of orthologous groups, respectively. Functional annotation against Kyoto Encyclopedia of Genes and Genomes Pathway database identified 5,825 unigenes which were mapped to 117 pathways. The assembly predicted many unigenes that were previously unknown. The annotated unigenes were compared against pineapple, rice, maize, Arabidopsis, and sorghum. Unigenes that did not match any of those five sequence datasets are considered to be Ananas comosus var. bracteatus unique. We predicted unigenes encoding enzymes involved in terpenoid and phenylpropanoid biosynthesis.The sequence data provide the most comprehensive transcriptomic resource currently available for Ananas comosus var. bracteatus. To our knowledge; this is the first report on the de novo transcriptome sequencing of the Ananas comosus var. bracteatus. Unigenes obtained in this study, may help improve future gene expression, genetic and genomics studies in Ananas comosus var. bracteatus.

  11. Identification and characterization of the Spodoptera Su(var) 3-9 histone H3K9 trimethyltransferase and its effect in AcMNPV infection.

    Science.gov (United States)

    Li, Binbin; Li, Sisi; Yin, Juan; Zhong, Jiang

    2013-01-01

    Histone H3-lysine(9) (H3K9) trimethyltransferase gene Su(var) 3-9 was cloned and identified in three Spodoptera insects, Spodopterafrugiperda (S. frugiperda), S. exigua and S. litura. Sequence analysis showed that Spodoptera Su(var) 3-9 is highly conserved evolutionarily. Su(var) 3-9 protein was found to be localized in the nucleus in Sf9 cells, and interact with histone H3, and the heterochromatin protein 1a (HP1a) and HP1b. A dose-dependent enzymatic activity was found at both 27 °C and 37 °C in vitro, with higher activity at 27 °C. Addition of specific inhibitor chaetocin resulted in decreased histone methylation level and host chromatin relaxation. In contrast, overexpression of Su(var) 3-9 caused increased histone methylation level and cellular genome compaction. In AcMNV-infected Sf9 cells, the transcription of Su(var) 3-9 increased at late time of infection, although the mRNA levels of most cellular genes decreased. Pre-treatment of Sf9 cells with chaetocin speeded up viral DNA replication, and increased the transcription level of a variety of virus genes, whereas in Sf9 cells pre-transformed with Su(var) 3-9 expression vector, viral DNA replication slow down slightly. These findings suggest that Su(var) 3-9 might participate in the viral genes expression an genome replication repression during AcMNPV infection. It provided a new insight for the understanding virus-host interaction mechanism.

  12. Bactericidal activities of the cationic steroid CSA-13 and the cathelicidin peptide LL-37 against Helicobacter pylori in simulated gastric juice

    Directory of Open Access Journals (Sweden)

    Janmey Paul A

    2009-09-01

    Full Text Available Abstract Background The worldwide appearance of drug-resistant strains of H. pylori motivates a search for new agents with therapeutic potential against this family of bacteria that colonizes the stomach, and is associated with adenocarcinoma development. This study was designed to assess in vitro the anti-H. pylori potential of cathelicidin LL-37 peptide, which is naturally present in gastric juice, its optimized synthetic analog WLBU2, and the non-peptide antibacterial agent ceragenin CSA-13. Results In agreement with previous studies, increased expression of hCAP-18/LL-37 was observed in gastric mucosa obtained from H. pylori infected subjects. MBC (minimum bactericidal concentration values determined in nutrient-containing media range from 100-800 μg/ml for LL-37, 17.8-142 μg/ml for WLBU2 and 0.275-8.9 μg/ml for ceragenin CSA-13. These data indicate substantial, but widely differing antibacterial activities against clinical isolates of H. pylori. After incubation in simulated gastric juice (low pH with presence of pepsin CSA-13, but not LL-37 or WLBU2, retained antibacterial activity. Compared to LL-37 and WLBU2 peptides, CSA-13 activity was also more resistant to inhibition by isolated host gastric mucins. Conclusion These data indicate that cholic acid-based antimicrobial agents such as CSA-13 resist proteolytic degradation and inhibition by mucin and have potential for treatment of H. pylori infections, including those caused by the clarithromycin and/or metronidazole-resistant strains.

  13. Analysis of genomic DNA of DcACS1, a 1-aminocyclopropane-1-carboxylate synthase gene, expressed in senescing petals of carnation (Dianthus caryophyllus) and its orthologous genes in D. superbus var. longicalycinus.

    Science.gov (United States)

    Harada, Taro; Murakoshi, Yuino; Torii, Yuka; Tanase, Koji; Onozaki, Takashi; Morita, Shigeto; Masumura, Takehiro; Satoh, Shigeru

    2011-04-01

    Carnation (Dianthus caryophyllus) flowers exhibit climacteric ethylene production followed by petal wilting, a senescence symptom. DcACS1, which encodes 1-aminocyclopropane-1-carboxylate synthase (ACS), is a gene involved in this phenomenon. We determined the genomic DNA structure of DcACS1 by genomic PCR. In the genome of 'Light Pink Barbara', we found two distinct nucleotide sequences: one corresponding to the gene previously shown as DcACS1, designated here as DcACS1a, and the other novel one designated as DcACS1b. It was revealed that both DcACS1a and DcACS1b have five exons and four introns. These two genes had almost identical nucleotide sequences in exons, but not in some introns and 3'-UTR. Analysis of transcript accumulation revealed that DcACS1b is expressed in senescing petals as well as DcACS1a. Genomic PCR analysis of 32 carnation cultivars showed that most cultivars have only DcACS1a and some have both DcACS1a and DcACS1b. Moreover, we found two DcACS1 orthologous genes with different nucleotide sequences from D. superbus var. longicalycinus, and designated them as DsuACS1a and DsuACS1b. Petals of D. superbus var. longicalycinus produced ethylene in response to exogenous ethylene, accompanying accumulation of DsuACS1 transcripts. These data suggest that climacteric ethylene production in flowers was genetically established before the cultivation of carnation.

  14. Paracentric inversion of chromosome 2 associated with cryptic duplication of 2q14 and deletion of 2q37 in a patient with autism.

    Science.gov (United States)

    Devillard, Françoise; Guinchat, Vincent; Moreno-De-Luca, Daniel; Tabet, Anne-Claude; Gruchy, Nicolas; Guillem, Pascale; Nguyen Morel, Marie-Ange; Leporrier, Nathalie; Leboyer, Marion; Jouk, Pierre-Simon; Lespinasse, James; Betancur, Catalina

    2010-09-01

    We describe a patient with autism and a paracentric inversion of chromosome 2q14.2q37.3, with a concurrent duplication of the proximal breakpoint at 2q14.1q14.2 and a deletion of the distal breakpoint at 2q37.3. The abnormality was derived from his mother with a balanced paracentric inversion. The inversion in the child appeared to be cytogenetically balanced but subtelomere FISH revealed a cryptic deletion at the 2q37.3 breakpoint. High-resolution single nucleotide polymorphism array confirmed the presence of a 3.5 Mb deletion that extended to the telomere, and showed a 4.2 Mb duplication at 2q14.1q14.2. FISH studies using a 2q14.2 probe showed that the duplicated segment was located at the telomeric end of chromosome 2q. This recombinant probably resulted from breakage of a dicentric chromosome. The child had autism, mental retardation, speech and language delay, hyperactivity, growth retardation with growth hormone deficiency, insulin-dependent diabetes, and mild facial dysmorphism. Most of these features have been previously described in individuals with simple terminal deletion of 2q37. Pure duplications of the proximal chromosome 2q are rare and no specific syndrome has been defined yet, so the contribution of the 2q14.1q14.2 duplication to the phenotype of the patient is unknown. These findings underscore the need to explore apparently balanced chromosomal rearrangements inherited from a phenotypically normal parent in subjects with autism and/or developmental delay. In addition, they provide further evidence indicating that chromosome 2q terminal deletions are among the most frequently reported cytogenetic abnormalities in individuals with autism.

  15. Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

    Science.gov (United States)

    Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

    2012-01-01

    Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

  16. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Science.gov (United States)

    Martínez-Alberola, Fernando; Del Campo, Eva M; Lázaro-Gimeno, David; Mezquita-Claramonte, Sergio; Molins, Arantxa; Mateu-Andrés, Isabel; Pedrola-Monfort, Joan; Casano, Leonardo M; Barreno, Eva

    2013-01-01

    Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt) in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  17. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Directory of Open Access Journals (Sweden)

    Fernando Martínez-Alberola

    Full Text Available Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  18. Doses from aquatic pathways in CSA-N288.1: deterministic and stochastic predictions compared

    Energy Technology Data Exchange (ETDEWEB)

    Chouhan, S.L.; Davis, P

    2002-04-01

    The conservatism and uncertainty in the Canadian Standards Association (CSA) model for calculating derived release limits (DRLs) for aquatic emissions of radionuclides from nuclear facilities was investigated. The model was run deterministically using the recommended default values for its parameters, and its predictions were compared with the distributed doses obtained by running the model stochastically. Probability density functions (PDFs) for the model parameters for the stochastic runs were constructed using data reported in the literature and results from experimental work done by AECL. The default values recommended for the CSA model for some parameters were found to be lower than the central values of the PDFs in about half of the cases. Doses (ingestion, groundshine and immersion) calculated as the median of 400 stochastic runs were higher than the deterministic doses predicted using the CSA default values of the parameters for more than half (85 out of the 163) of the cases. Thus, the CSA model is not conservative for calculating DRLs for aquatic radionuclide emissions, as it was intended to be. The output of the stochastic runs was used to determine the uncertainty in the CSA model predictions. The uncertainty in the total dose was high, with the 95% confidence interval exceeding an order of magnitude for all radionuclides. A sensitivity study revealed that total ingestion doses to adults predicted by the CSA model are sensitive primarily to water intake rates, bioaccumulation factors for fish and marine biota, dietary intakes of fish and marine biota, the fraction of consumed food arising from contaminated sources, the irrigation rate, occupancy factors and the sediment solid/liquid distribution coefficient. To improve DRL models, further research into aquatic exposure pathways should concentrate on reducing the uncertainty in these parameters. The PDFs given here can he used by other modellers to test and improve their models and to ensure that DRLs

  19. XX male sex reversal with genital abnormalities associated with a de novo SOX3 gene duplication.

    Science.gov (United States)

    Moalem, Sharon; Babul-Hirji, Riyana; Stavropolous, Dmitri J; Wherrett, Diane; Bägli, Darius J; Thomas, Paul; Chitayat, David

    2012-07-01

    Differentiation of the bipotential gonad into testis is initiated by the Y chromosome-linked gene SRY (Sex-determining Region Y) through upregulation of its autosomal direct target gene SOX9 (Sry-related HMG box-containing gene 9). Sequence and chromosome homology studies have shown that SRY most probably evolved from SOX3, which in humans is located at Xq27.1. Mutations causing SOX3 loss-of-function do not affect the sex determination in mice or humans. However, transgenic mouse studies have shown that ectopic expression of Sox3 in the bipotential gonad results in upregulation of Sox9, resulting in testicular induction and XX male sex reversal. However, the mechanism by which these rearrangements cause sex reversal and the frequency with which they are associated with disorders of sex development remains unclear. Rearrangements of the SOX3 locus were identified recently in three cases of human XX male sex reversal. We report on a case of XX male sex reversal associated with a novel de novo duplication of the SOX3 gene. These data provide additional evidence that SOX3 gain-of-function in the XX bipotential gonad causes XX male sex reversal and further support the hypothesis that SOX3 is the evolutionary antecedent of SRY. Copyright © 2012 Wiley Periodicals, Inc.

  20. p53 protects against genome instability following centriole duplication failure

    Science.gov (United States)

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389