Directory of Open Access Journals (Sweden)
Mara Sangiovanni
2013-12-01
Full Text Available Arabidopsis thaliana became the model organism for plant studies because of its small diploid genome, rapid lifecycle and short adult size. Its genome was the first among plants to be sequenced, becoming the reference in plant genomics. However, the Arabidopsis genome is characterized by an inherently complex organization, since it has undergone ancient whole genome duplications, followed by gene reduction, diploidization events and extended rearrangements, which relocated and split up the retained portions. These events, together with probable chromosome reductions, dramatically increased the genome complexity, limiting its role as a reference. The identification of paralogs and single copy genes within a highly duplicated genome is a prerequisite to understand its organization and evolution and to improve its exploitation in comparative genomics. This is still controversial, even in the widely studied Arabidopsis genome. This is also due to the lack of a reference bioinformatics pipeline that could exhaustively identify paralogs and singleton genes. We describe here a complete computational strategy to detect both duplicated and single copy genes in a genome, discussing all the methodological issues that may strongly affect the results, their quality and their reliability. This approach was used to analyze the organization of Arabidopsis nuclear protein coding genes, and besides classifying computationally defined paralogs into networks and single copy genes into different classes, it unraveled further intriguing aspects concerning the genome annotation and the gene relationships in this reference plant species. Since our results may be useful for comparative genomics and genome functional analyses, we organized a dedicated web interface to make them accessible to the scientific community.
Divergence of gene body DNA methylation and evolution of plant duplicate genes.
Directory of Open Access Journals (Sweden)
Jun Wang
Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.
Paralogous Genes as a Tool to Study the Regulation of Gene Expression
DEFF Research Database (Denmark)
Hoffmann, Robert D
The genomes of plants are marked by reoccurring events of whole-genome duplication. These events are major contributors to speciation and provide the genetic material for organisms to evolve ever greater complexity. Duplicated genes, referred to as paralogs, may be retained because they acquired...... regions. These results suggest that a concurrent purifying selection acts on coding and non-coding sequences of paralogous genes in A. thaliana. Mutational analyses of the promoters from a paralogous gene pair were performed in transgenic A. thaliana plants. The results revealed a 170-bp long DNA sequence...... that forms a bifunctional cis-regulatory module; it represses gene expression in the sporophyte while activating it in pollen. This finding is important for many aspects of gene regulation and the transcriptional changes underlying gametophyte development. In conclusion, the presented thesis suggests that...
Hoffmann, Robert D; Palmgren, Michael
2016-06-13
Whole-genome duplications in the ancestors of many diverse species provided the genetic material for evolutionary novelty. Several models explain the retention of paralogous genes. However, how these models are reflected in the evolution of coding and non-coding sequences of paralogous genes is unknown. Here, we analyzed the coding and non-coding sequences of paralogous genes in Arabidopsis thaliana and compared these sequences with those of orthologous genes in Arabidopsis lyrata. Paralogs with lower expression than their duplicate had more nonsynonymous substitutions, were more likely to fractionate, and exhibited less similar expression patterns with their orthologs in the other species. Also, lower-expressed genes had greater tissue specificity. Orthologous conserved non-coding sequences in the promoters, introns, and 3' untranslated regions were less abundant at lower-expressed genes compared to their higher-expressed paralogs. A gene ontology (GO) term enrichment analysis showed that paralogs with similar expression levels were enriched in GO terms related to ribosomes, whereas paralogs with different expression levels were enriched in terms associated with stress responses. Loss of conserved non-coding sequences in one gene of a paralogous gene pair correlates with reduced expression levels that are more tissue specific. Together with increased mutation rates in the coding sequences, this suggests that similar forces of purifying selection act on coding and non-coding sequences. We propose that coding and non-coding sequences evolve concurrently following gene duplication.
Directory of Open Access Journals (Sweden)
Matthew A Carrigan
Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates
Characterization of paralogous protein families in rice
Directory of Open Access Journals (Sweden)
Zhu Wei
2008-02-01
Full Text Available Abstract Background High gene numbers in plant genomes reflect polyploidy and major gene duplication events. Oryza sativa, cultivated rice, is a diploid monocotyledonous species with a ~390 Mb genome that has undergone segmental duplication of a substantial portion of its genome. This, coupled with other genetic events such as tandem duplications, has resulted in a substantial number of its genes, and resulting proteins, occurring in paralogous families. Results Using a computational pipeline that utilizes Pfam and novel protein domains, we characterized paralogous families in rice and compared these with paralogous families in the model dicotyledonous diploid species, Arabidopsis thaliana. Arabidopsis, which has undergone genome duplication as well, has a substantially smaller genome (~120 Mb and gene complement compared to rice. Overall, 53% and 68% of the non-transposable element-related rice and Arabidopsis proteins could be classified into paralogous protein families, respectively. Singleton and paralogous family genes differed substantially in their likelihood of encoding a protein of known or putative function; 26% and 66% of singleton genes compared to 73% and 96% of the paralogous family genes encode a known or putative protein in rice and Arabidopsis, respectively. Furthermore, a major skew in the distribution of specific gene function was observed; a total of 17 Gene Ontology categories in both rice and Arabidopsis were statistically significant in their differential distribution between paralogous family and singleton proteins. In contrast to mammalian organisms, we found that duplicated genes in rice and Arabidopsis tend to have more alternative splice forms. Using data from Massively Parallel Signature Sequencing, we show that a significant portion of the duplicated genes in rice show divergent expression although a correlation between sequence divergence and correlation of expression could be seen in very young genes. Conclusion
Gene duplications in prokaryotes can be associated with environmental adaptation.
Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn
2010-10-20
Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate
Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization
Directory of Open Access Journals (Sweden)
Xi-Yin Wang
2011-01-01
Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.
FUNCTIONAL SPECIALIZATION OF DUPLICATED FLAVONOID BIOSYNTHESIS GENES IN WHEAT
Directory of Open Access Journals (Sweden)
Khlestkina E.
2012-08-01
Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.
Gene duplications in prokaryotes can be associated with environmental adaptation
Directory of Open Access Journals (Sweden)
Lempicki Richard A
2010-10-01
Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive
Signals of historical interlocus gene conversion in human segmental duplications.
Directory of Open Access Journals (Sweden)
Beth L Dumont
Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.
Gene conversion homogenizes the CMT1A paralogous repeats
Directory of Open Access Journals (Sweden)
Hurles Matthew E
2001-12-01
Full Text Available Abstract Background Non-allelic homologous recombination between paralogous repeats is increasingly being recognized as a major mechanism causing both pathogenic microdeletions and duplications, and structural polymorphism in the human genome. It has recently been shown empirically that gene conversion can homogenize such repeats, resulting in longer stretches of absolute identity that may increase the rate of non-allelic homologous recombination. Results Here, a statistical test to detect gene conversion between pairs of non-coding sequences is presented. It is shown that the 24 kb Charcot-Marie-Tooth type 1A paralogous repeats (CMT1A-REPs exhibit the imprint of gene conversion processes whilst control orthologous sequences do not. In addition, Monte Carlo simulations of the evolutionary divergence of the CMT1A-REPs, incorporating two alternative models for gene conversion, generate repeats that are statistically indistinguishable from the observed repeats. Bounds are placed on the rate of these conversion processes, with central values of 1.3 × 10-4 and 5.1 × 10-5 per generation for the alternative models. Conclusions This evidence presented here suggests that gene conversion may have played an important role in the evolution of the CMT1A-REP paralogous repeats. The rates of these processes are such that it is probable that homogenized CMT1A-REPs are polymorphic within modern populations. Gene conversion processes are similarly likely to play an important role in the evolution of other segmental duplications and may influence the rate of non-allelic homologous recombination between them.
Duprey, Alexandre; Nasser, William; Léonard, Simon; Brochier-Armanet, Céline; Reverchon, Sylvie
2016-11-01
After a gene duplication event, the resulting paralogous genes frequently acquire distinct expression profiles, roles, and/or functions but the underlying mechanisms are poorly understood. While transcription start site (TSS) turnover, i.e., the repositioning of the TSS during evolution, is widespread in eukaryotes, it is less documented in bacteria. Using pelD and pelE, two closely related paralogous genes encoding key virulence factors in Dickeya, a gamma proteobacterial genus of phytopathogens, we show that pelE has been selected as an initiator of bacterial aggression, while pelD acts at a later stage, thanks to modifications in the transcriptional regulation of these two genes. This expression change is linked to a few mutations that caused a shift in the position of the pelETSS and the rapid divergence in the regulation of these genes after their duplication. Genomic surveys detected additional examples of putative turnovers in other bacteria. This first report of TSS shifting in bacteria suggests that this mechanism could play a major role in paralogous genes fixation in prokaryotes. © 2016 Federation of European Biochemical Societies.
Preston, Jill C.; Kellogg, Elizabeth A.
2006-01-01
Gene duplication is an important mechanism for the generation of evolutionary novelty. Paralogous genes that are not silenced may evolve new functions (neofunctionalization) that will alter the developmental outcome of preexisting genetic pathways, partition ancestral functions (subfunctionalization) into divergent developmental modules, or function redundantly. Functional divergence can occur by changes in the spatio-temporal patterns of gene expression and/or by changes in the activities of their protein products. We reconstructed the evolutionary history of two paralogous monocot MADS-box transcription factors, FUL1 and FUL2, and determined the evolution of sequence and gene expression in grass AP1/FUL-like genes. Monocot AP1/FUL-like genes duplicated at the base of Poaceae and codon substitutions occurred under relaxed selection mostly along the branch leading to FUL2. Following the duplication, FUL1 was apparently lost from early diverging taxa, a pattern consistent with major changes in grass floral morphology. Overlapping gene expression patterns in leaves and spikelets indicate that FUL1 and FUL2 probably share some redundant functions, but that FUL2 may have become temporally restricted under partial subfunctionalization to particular stages of floret development. These data have allowed us to reconstruct the history of AP1/FUL-like genes in Poaceae and to hypothesize a role for this gene duplication in the evolution of the grass spikelet. PMID:16816429
International Nuclear Information System (INIS)
Cohen-Gihon, Inbar; Nussinov, Ruth; Sharan, Roded
2011-01-01
During evolution, organisms have gained functional complexity mainly by modifying and improving existing functioning systems rather than creating new ones ab initio. Here we explore the interplay between two processes which during evolution have had major roles in the acquisition of new functions: gene duplication and protein domain rearrangements. We consider four possible evolutionary scenarios: gene families that have undergone none of these event types; only gene duplication; only domain rearrangement, or both events. We characterize each of the four evolutionary scenarios by functional attributes. Our analysis of ten fungal genomes indicates that at least for the fungi clade, species significantly appear to gain complexity by gene duplication accompanied by the expansion of existing domain architectures via rearrangements. We show that paralogs gaining new domain architectures via duplication tend to adopt new functions compared to paralogs that preserve their domain architectures. We conclude that evolution of protein families through gene duplication and domain rearrangement is correlated with their functional properties. We suggest that in general, new functions are acquired via the integration of gene duplication and domain rearrangements rather than each process acting independently
Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia.
Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C
2010-02-01
The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.
Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.
Directory of Open Access Journals (Sweden)
Nemanja Vukašinović
Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.
The odds of duplicate gene persistence after polyploidization
Directory of Open Access Journals (Sweden)
Chain Frédéric JJ
2011-12-01
Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.
Gu, Xun; Wang, Yufeng; Gu, Jianying
2002-06-01
The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.
Adomako-Ankomah, Yaw; English, Elizabeth D; Danielson, Jeffrey J; Pernas, Lena F; Parker, Michelle L; Boulanger, Martin J; Dubey, Jitender P; Boyle, Jon P
2016-05-01
In Toxoplasma gondii, an intracellular parasite of humans and other animals, host mitochondrial association (HMA) is driven by a gene family that encodes multiple mitochondrial association factor 1 (MAF1) proteins. However, the importance of MAF1 gene duplication in the evolution of HMA is not understood, nor is the impact of HMA on parasite biology. Here we used within- and between-species comparative analysis to determine that the MAF1 locus is duplicated in T. gondii and its nearest extant relative Hammondia hammondi, but not another close relative, Neospora caninum Using cross-species complementation, we determined that the MAF1 locus harbors multiple distinct paralogs that differ in their ability to mediate HMA, and that only T. gondii and H. hammondi harbor HMA(+) paralogs. Additionally, we found that exogenous expression of an HMA(+) paralog in T. gondii strains that do not normally exhibit HMA provides a competitive advantage over their wild-type counterparts during a mouse infection. These data indicate that HMA likely evolved by neofunctionalization of a duplicate MAF1 copy in the common ancestor of T. gondii and H. hammondi, and that the neofunctionalized gene duplicate is selectively advantageous. Copyright © 2016 by the Genetics Society of America.
Directory of Open Access Journals (Sweden)
Bergthorsson Ulfar
2011-09-01
Full Text Available Abstract Background Duplicated genes frequently experience asymmetric rates of sequence evolution. Relaxed selective constraints and positive selection have both been invoked to explain the observation that one paralog within a gene-duplicate pair exhibits an accelerated rate of sequence evolution. In the majority of studies where asymmetric divergence has been established, there is no indication as to which gene copy, ancestral or derived, is evolving more rapidly. In this study we investigated the effect of local synteny (gene-neighborhood conservation and codon usage on the sequence evolution of gene duplicates in the S. cerevisiae genome. We further distinguish the gene duplicates into those that originated from a whole-genome duplication (WGD event (ohnologs versus small-scale duplications (SSD to determine if there exist any differences in their patterns of sequence evolution. Results For SSD pairs, the derived copy evolves faster than the ancestral copy. However, there is no relationship between rate asymmetry and synteny conservation (ancestral-like versus derived-like in ohnologs. mRNA abundance and optimal codon usage as measured by the CAI is lower in the derived SSD copies relative to ancestral paralogs. Moreover, in the case of ohnologs, the faster-evolving copy has lower CAI and lowered expression. Conclusions Together, these results suggest that relaxation of selection for codon usage and gene expression contribute to rate asymmetry in the evolution of duplicated genes and that in SSD pairs, the relaxation of selection stems from the loss of ancestral regulatory information in the derived copy.
Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family
Directory of Open Access Journals (Sweden)
Bowerman Bruce
2009-08-01
Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456
Rane, Hallie S; Smith, Jessica M; Bergthorsson, Ulfar; Katju, Vaishali
2010-07-01
Gene conversion, a form of concerted evolution, bears enormous potential to shape the trajectory of sequence and functional divergence of gene paralogs subsequent to duplication events. fog-2, a sex-determination gene unique to Caenorhabditis elegans and implicated in the origin of hermaphroditism in this species, resulted from the duplication of ftr-1, an upstream gene of unknown function. Synonymous sequence divergence in regions of fog-2 and ftr-1 (excluding recent gene conversion tracts) suggests that the duplication occurred 46 million generations ago. Gene conversion between fog-2 and ftr-1 was previously discovered in experimental fog-2 knockout lines of C. elegans, whereby hermaphroditism was restored in mutant obligately outcrossing male-female populations. We analyzed DNA-sequence variation in fog-2 and ftr-1 within 40 isolates of C. elegans from diverse geographic locations in order to evaluate the contribution of gene conversion to genetic variation in the two gene paralogs. The analysis shows that gene conversion contributes significantly to DNA-sequence diversity in fog-2 and ftr-1 (22% and 34%, respectively) and may have the potential to alter sexual phenotypes in natural populations. A radical amino acid change in a conserved region of the F-box domain of fog-2 was found in natural isolates of C. elegans with significantly lower fecundity. We hypothesize that the lowered fecundity is due to reduced masculinization and less sperm production and that amino acid replacement substitutions and gene conversion in fog-2 may contribute significantly to variation in the degree of inbreeding and outcrossing in natural populations.
Phylogenetic reconstruction of orthology, paralogy, and conserved synteny for dog and human.
Goodstadt, Leo; Ponting, Chris P
2006-09-29
Accurate predictions of orthology and paralogy relationships are necessary to infer human molecular function from experiments in model organisms. Previous genome-scale approaches to predicting these relationships have been limited by their use of protein similarity and their failure to take into account multiple splicing events and gene prediction errors. We have developed PhyOP, a new phylogenetic orthology prediction pipeline based on synonymous rate estimates, which accurately predicts orthology and paralogy relationships for transcripts, genes, exons, or genomic segments between closely related genomes. We were able to identify orthologue relationships to human genes for 93% of all dog genes from Ensembl. Among 1:1 orthologues, the alignments covered a median of 97.4% of protein sequences, and 92% of orthologues shared essentially identical gene structures. PhyOP accurately recapitulated genomic maps of conserved synteny. Benchmarking against predictions from Ensembl and Inparanoid showed that PhyOP is more accurate, especially in its predictions of paralogy. Nearly half (46%) of PhyOP paralogy predictions are unique. Using PhyOP to investigate orthologues and paralogues in the human and dog genomes, we found that the human assembly contains 3-fold more gene duplications than the dog. Species-specific duplicate genes, or "in-paralogues," are generally shorter and have fewer exons than 1:1 orthologues, which is consistent with selective constraints and mutation biases based on the sizes of duplicated genes. In-paralogues have experienced elevated amino acid and synonymous nucleotide substitution rates. Duplicates possess similar biological functions for either the dog or human lineages. Having accounted for 2,954 likely pseudogenes and gene fragments, and after separating 346 erroneously merged genes, we estimated that the human genome encodes a minimum of 19,700 protein-coding genes, similar to the gene count of nematode worms. PhyOP is a fast and robust
Phylogenetic reconstruction of orthology, paralogy, and conserved synteny for dog and human.
Directory of Open Access Journals (Sweden)
Leo Goodstadt
2006-09-01
Full Text Available Accurate predictions of orthology and paralogy relationships are necessary to infer human molecular function from experiments in model organisms. Previous genome-scale approaches to predicting these relationships have been limited by their use of protein similarity and their failure to take into account multiple splicing events and gene prediction errors. We have developed PhyOP, a new phylogenetic orthology prediction pipeline based on synonymous rate estimates, which accurately predicts orthology and paralogy relationships for transcripts, genes, exons, or genomic segments between closely related genomes. We were able to identify orthologue relationships to human genes for 93% of all dog genes from Ensembl. Among 1:1 orthologues, the alignments covered a median of 97.4% of protein sequences, and 92% of orthologues shared essentially identical gene structures. PhyOP accurately recapitulated genomic maps of conserved synteny. Benchmarking against predictions from Ensembl and Inparanoid showed that PhyOP is more accurate, especially in its predictions of paralogy. Nearly half (46% of PhyOP paralogy predictions are unique. Using PhyOP to investigate orthologues and paralogues in the human and dog genomes, we found that the human assembly contains 3-fold more gene duplications than the dog. Species-specific duplicate genes, or "in-paralogues," are generally shorter and have fewer exons than 1:1 orthologues, which is consistent with selective constraints and mutation biases based on the sizes of duplicated genes. In-paralogues have experienced elevated amino acid and synonymous nucleotide substitution rates. Duplicates possess similar biological functions for either the dog or human lineages. Having accounted for 2,954 likely pseudogenes and gene fragments, and after separating 346 erroneously merged genes, we estimated that the human genome encodes a minimum of 19,700 protein-coding genes, similar to the gene count of nematode worms. PhyOP is a
Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A
2015-06-08
The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Nathanson Lubov
2011-09-01
Full Text Available Abstract Background A major goal of molecular evolutionary biology is to understand the fate and consequences of duplicated genes. In this context, aphids are intriguing because the newly sequenced pea aphid genome harbors an extraordinary number of lineage-specific gene duplications relative to other insect genomes. Though many of their duplicated genes may be involved in their complex life cycle, duplications in nutrient amino acid transporters appear to be associated rather with their essential amino acid poor diet and the intracellular symbiosis aphids rely on to compensate for dietary deficits. Past work has shown that some duplicated amino acid transporters are highly expressed in the specialized cells housing the symbionts, including a paralog of an aphid-specific expansion homologous to the Drosophila gene slimfast. Previous data provide evidence that these bacteriocyte-expressed transporters mediate amino acid exchange between aphids and their symbionts. Results We report that some nutrient amino acid transporters show male-biased expression. Male-biased expression characterizes three paralogs in the aphid-specific slimfast expansion, and the male-biased expression is conserved across two aphid species for at least two paralogs. One of the male-biased paralogs has additionally experienced an accelerated rate of non-synonymous substitutions. Conclusions This is the first study to document male-biased slimfast expression. Our data suggest that the male-biased aphid slimfast paralogs diverged from their ancestral function to fill a functional role in males. Furthermore, our results provide evidence that members of the slimfast expansion are maintained in the aphid genome not only for the previously hypothesized role in mediating amino acid exchange between the symbiotic partners, but also for sex-specific roles.
Directory of Open Access Journals (Sweden)
Brenner Sydney
2008-06-01
Full Text Available Abstract Background One of the many gene families that expanded in early vertebrate evolution is the neuropeptide (NPY receptor family of G-protein coupled receptors. Earlier work by our lab suggested that several of the NPY receptor genes found in extant vertebrates resulted from two genome duplications before the origin of jawed vertebrates (gnathostomes and one additional genome duplication in the actinopterygian lineage, based on their location on chromosomes sharing several gene families. In this study we have investigated, in five vertebrate genomes, 45 gene families with members close to the NPY receptor genes in the compact genomes of the teleost fishes Tetraodon nigroviridis and Takifugu rubripes. These correspond to Homo sapiens chromosomes 4, 5, 8 and 10. Results Chromosome regions with conserved synteny were identified and confirmed by phylogenetic analyses in H. sapiens, M. musculus, D. rerio, T. rubripes and T. nigroviridis. 26 gene families, including the NPY receptor genes, (plus 3 described recently by other labs showed a tree topology consistent with duplications in early vertebrate evolution and in the actinopterygian lineage, thereby supporting expansion through block duplications. Eight gene families had complications that precluded analysis (such as short sequence length or variable number of repeated domains and another eight families did not support block duplications (because the paralogs in these families seem to have originated in another time window than the proposed genome duplication events. RT-PCR carried out with several tissues in T. rubripes revealed that all five NPY receptors were expressed in the brain and subtypes Y2, Y4 and Y8 were also expressed in peripheral organs. Conclusion We conclude that the phylogenetic analyses and chromosomal locations of these gene families support duplications of large blocks of genes or even entire chromosomes. Thus, these results are consistent with two early vertebrate
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
Energy Technology Data Exchange (ETDEWEB)
Challacombe, Jean F [Los Alamos National Laboratory; Eichorst, Stephanie A [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Kuske, Cheryl R [Los Alamos National Laboratory; Hauser, Loren [ORNL; Land, Miriam [ORNL
2009-01-01
Bacterial genome sizes range from ca. 0.5 to 10Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Sequenced genomes of strains in the phylum Acidobacteria revealed that 'Solibacter usistatus' strain Ellin6076 harbors a 9.9 Mb genome. This large genome appears to have arisen by horizontal gene transfer via ancient bacteriophage and plasmid-mediated transduction, as well as widespread small-scale gene duplications. This has resulted in an increased number of paralogs that are potentially ecologically important (ecoparalogs). Low amino acid sequence identities among functional group members and lack of conserved gene order and orientation in the regions containing similar groups of paralogs suggest that most of the paralogs were not the result of recent duplication events. The genome sizes of cultured subdivision 1 and 3 strains in the phylum Acidobacteria were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 1 were estimated to have smaller genome sizes ranging from ca. 2.0 to 4.8 Mb, whereas members of subdivision 3 had slightly larger genomes, from ca. 5.8 to 9.9 Mb. It is hypothesized that the large genome of strain Ellin6076 encodes traits that provide a selective metabolic, defensive and regulatory advantage in the variable soil environment.
Czech Academy of Sciences Publication Activity Database
Symonová, Radka; Havelka, M.; Amemiya, C. T.; Howell, M. W.; Kořínková, Tereza; Flajšhans, M.; Gela, D.; Ráb, Petr
2017-01-01
Roč. 18, č. 1 (2017), č. článku 19. ISSN 1471-2156 R&D Projects: GA ČR GA14-02940S; GA MŠk EF15_003/0000460 Institutional support: RVO:67985904 Keywords : hoxA/D paralogs mapping * sturgeon whole genome duplication * ancient fish genome * rediploidization Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 2.266, year: 2016
Zimmer, Christoph T; Garrood, William T; Singh, Kumar Saurabh; Randall, Emma; Lueke, Bettina; Gutbrod, Oliver; Matthiesen, Svend; Kohler, Maxie; Nauen, Ralf; Davies, T G Emyr; Bass, Chris
2018-01-22
Gene duplication is a major source of genetic variation that has been shown to underpin the evolution of a wide range of adaptive traits [1, 2]. For example, duplication or amplification of genes encoding detoxification enzymes has been shown to play an important role in the evolution of insecticide resistance [3-5]. In this context, gene duplication performs an adaptive function as a result of its effects on gene dosage and not as a source of functional novelty [3, 6-8]. Here, we show that duplication and neofunctionalization of a cytochrome P450, CYP6ER1, led to the evolution of insecticide resistance in the brown planthopper. Considerable genetic variation was observed in the coding sequence of CYP6ER1 in populations of brown planthopper collected from across Asia, but just two sequence variants are highly overexpressed in resistant strains and metabolize imidacloprid. Both variants are characterized by profound amino-acid alterations in substrate recognition sites, and the introduction of these mutations into a susceptible P450 sequence is sufficient to confer resistance. CYP6ER1 is duplicated in resistant strains with individuals carrying paralogs with and without the gain-of-function mutations. Despite numerical parity in the genome, the susceptible and mutant copies exhibit marked asymmetry in their expression with the resistant paralogs overexpressed. In the primary resistance-conferring CYP6ER1 variant, this results from an extended region of novel sequence upstream of the gene that provides enhanced expression. Our findings illustrate the versatility of gene duplication in providing opportunities for functional and regulatory innovation during the evolution of an adaptive trait. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.
Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L
2015-12-01
Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.
Two Rounds of Whole Genome Duplication in the AncestralVertebrate
Energy Technology Data Exchange (ETDEWEB)
Dehal, Paramvir; Boore, Jeffrey L.
2005-04-12
The hypothesis that the relatively large and complex vertebrate genome was created by two ancient, whole genome duplications has been hotly debated, but remains unresolved. We reconstructed the evolutionary relationships of all gene families from the complete gene sets of a tunicate, fish, mouse, and human, then determined when each gene duplicated relative to the evolutionary tree of the organisms. We confirmed the results of earlier studies that there remains little signal of these events in numbers of duplicated genes, gene tree topology, or the number of genes per multigene family. However, when we plotted the genomic map positions of only the subset of paralogous genes that were duplicated prior to the fish-tetrapod split, their global physical organization provides unmistakable evidence of two distinct genome duplication events early in vertebrate evolution indicated by clear patterns of 4-way paralogous regions covering a large part of the human genome. Our results highlight the potential for these large-scale genomic events to have driven the evolutionary success of the vertebrate lineage.
Don't throw the baby out with the bathwater: identifying and mapping paralogs in salmonids.
Dufresne, France
2016-01-01
Many eukaryotic genomes contain a large fraction of gene duplicates (or paralogs) as a result of ancient or recent whole-genome duplications (Ohno 1970; Jaillon et al. 2004; Kellis et al. 2004). Identifying paralogs with NGS data is a pervasive problem in both ancient polyploids and neopolyploids. Likewise, paralogs are often treated as a nuisance that has to be detected and removed (Everett et al. 2012). In this issue of Molecular Ecology Resources, Waples et al. (2015) show that exclusion might not be necessary and how we may miss out on important genomic information in doing so. They present a novel statistical approach to detect paralogs based on the segregation of RAD loci in haploid offspring and test their method by constructing linkage maps with and without these duplicated loci in chum salmon, Oncorhynchus keta (Fig.1). Their linkage map including the resolved paralogs shows that these are mostly located in the distal regions of several linkage groups. Particularly intriguing is their finding that these homoeologous regions appear impoverished in transposable elements (TE). Given the role that TE play in genome remodelling, it is noteworthy that these elements are of low abundance in regions showing residual tetrasomic inheritance. This raises the question whether re-diploidization is constrained in these regions and whether they might have a role to play in salmonid speciation. This study provides an original approach to identifying duplicated loci in species with a pedigree, as well as providing a dense linkage map for chum salmon, and interesting insights into the retention of gene duplicates in an ancient polyploid. © 2015 John Wiley & Sons Ltd.
Salaneck, Erik; Ardell, David H; Larson, Earl T; Larhammar, Dan
2003-08-01
It has been debated whether the increase in gene number during early vertebrate evolution was due to multiple independent gene duplications or synchronous duplications of many genes. We describe here the cloning of three neuropeptide Y (NPY) receptor genes belonging to the Y1 subfamily in the spiny dogfish, Squalus acanthias, a cartilaginous fish. The three genes are orthologs of the mammalian subtypes Y1, Y4, and Y6, which are located in paralogous gene regions on different chromosomes in mammals. Thus, these genes arose by duplications of a chromosome region before the radiation of gnathostomes (jawed vertebrates). Estimates of duplication times from linearized trees together with evidence from other gene families supports two rounds of chromosome duplications or tetraploidizations early in vertebrate evolution. The anatomical distribution of mRNA was determined by reverse-transcriptase PCR and was found to differ from mammals, suggesting differential functional diversification of the new gene copies during the radiation of the vertebrate classes.
Investigating the effect of paralogs on microarray gene-set analysis
LENUS (Irish Health Repository)
Faure, Andre J
2011-01-24
Abstract Background In order to interpret the results obtained from a microarray experiment, researchers often shift focus from analysis of individual differentially expressed genes to analyses of sets of genes. These gene-set analysis (GSA) methods use previously accumulated biological knowledge to group genes into sets and then aim to rank these gene sets in a way that reflects their relative importance in the experimental situation in question. We suspect that the presence of paralogs affects the ability of GSA methods to accurately identify the most important sets of genes for subsequent research. Results We show that paralogs, which typically have high sequence identity and similar molecular functions, also exhibit high correlation in their expression patterns. We investigate this correlation as a potential confounding factor common to current GSA methods using Indygene http:\\/\\/www.cbio.uct.ac.za\\/indygene, a web tool that reduces a supplied list of genes so that it includes no pairwise paralogy relationships above a specified sequence similarity threshold. We use the tool to reanalyse previously published microarray datasets and determine the potential utility of accounting for the presence of paralogs. Conclusions The Indygene tool efficiently removes paralogy relationships from a given dataset and we found that such a reduction, performed prior to GSA, has the ability to generate significantly different results that often represent novel and plausible biological hypotheses. This was demonstrated for three different GSA approaches when applied to the reanalysis of previously published microarray datasets and suggests that the redundancy and non-independence of paralogs is an important consideration when dealing with GSA methodologies.
Tian, Feng-Xia; Zang, Jian-Lei; Wang, Tan; Xie, Yu-Li; Zhang, Jin; Hu, Jian-Jun
2015-01-01
Aldehyde dehydrogenases (ALDHs) constitute a superfamily of NAD(P)+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.
Directory of Open Access Journals (Sweden)
Feng-Xia Tian
Full Text Available Aldehyde dehydrogenases (ALDHs constitute a superfamily of NAD(P+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.
Karn, Robert C; Chung, Amanda G; Laukaitis, Christina M
2014-01-01
The Androgen-binding protein (Abp) region of the mouse genome contains 30 Abpa genes encoding alpha subunits and 34 Abpbg genes encoding betagamma subunits, their products forming dimers composed of an alpha and a betagamma subunit. We endeavored to determine how many Abp genes are expressed as proteins in tears and saliva, and as transcripts in the exocrine glands producing them. Using standard PCR, we amplified Abp transcripts from cDNA libraries of C57BL/6 mice and found fifteen Abp gene transcripts in the lacrimal gland and five in the submandibular gland. Proteomic analyses identified proteins corresponding to eleven of the lacrimal gland transcripts, all of them different from the three salivary ABPs reported previously. Our qPCR results showed that five of the six transcripts that lacked corresponding proteins are expressed at very low levels compared to those transcripts with proteins. We found 1) no overlap in the repertoires of expressed Abp paralogs in lacrimal gland/tears and salivary glands/saliva; 2) substantial sex-limited expression of lacrimal gland/tear expressed-paralogs in males but no sex-limited expression in females; and 3) that the lacrimal gland/tear expressed-paralogs are found exclusively in ancestral clades 1, 2 and 3 of the five clades described previously while the salivary glands/saliva expressed-paralogs are found only in clade 5. The number of instances of extremely low levels of transcription without corresponding protein production in paralogs specific to tears and saliva suggested the role of subfunctionalization, a derived condition wherein genes that may have been expressed highly in both glands ancestrally were down-regulated subsequent to duplication. Thus, evidence for subfunctionalization can be seen in our data and we argue that the partitioning of paralog expression between lacrimal and salivary glands that we report here occurred as the result of adaptive evolution.
Gene duplication, loss and selection in the evolution of saxitoxin biosynthesis in alveolates.
Murray, Shauna A; Diwan, Rutuja; Orr, Russell J S; Kohli, Gurjeet S; John, Uwe
2015-11-01
A group of marine dinoflagellates (Alveolata, Eukaryota), consisting of ∼10 species of the genus Alexandrium, Gymnodinium catenatum and Pyrodinium bahamense, produce the toxin saxitoxin and its analogues (STX), which can accumulate in shellfish, leading to ecosystem and human health impacts. The genes, sxt, putatively involved in STX biosynthesis, have recently been identified, however, the evolution of these genes within dinoflagellates is not clear. There are two reasons for this: uncertainty over the phylogeny of dinoflagellates; and that the sxt genes of many species of Alexandrium and other dinoflagellate genera are not known. Here, we determined the phylogeny of STX-producing and other dinoflagellates based on a concatenated eight-gene alignment. We determined the presence, diversity and phylogeny of sxtA, domains A1 and A4 and sxtG in 52 strains of Alexandrium, and a further 43 species of dinoflagellates and thirteen other alveolates. We confirmed the presence and high sequence conservation of sxtA, domain A4, in 40 strains (35 Alexandrium, 1 Pyrodinium, 4 Gymnodinium) of 8 species of STX-producing dinoflagellates, and absence from non-producing species. We found three paralogs of sxtA, domain A1, and a widespread distribution of sxtA1 in non-STX producing dinoflagellates, indicating duplication events in the evolution of this gene. One paralog, clade 2, of sxtA1 may be particularly related to STX biosynthesis. Similarly, sxtG appears to be generally restricted to STX-producing species, while three amidinotransferase gene paralogs were found in dinoflagellates. We investigated the role of positive (diversifying) selection following duplication in sxtA1 and sxtG, and found negative selection in clades of sxtG and sxtA1, clade 2, suggesting they were functionally constrained. Significant episodic diversifying selection was found in some strains in clade 3 of sxtA1, a clade that may not be involved in STX biosynthesis, indicating pressure for diversification
Horizontal transfer, not duplication, drives the expansion of protein families in prokaryotes.
Directory of Open Access Journals (Sweden)
Todd J Treangen
2011-01-01
Full Text Available Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus, average-sized genomes (Bacillus, Enterobacteriaceae, and large genomes (Pseudomonas, Bradyrhizobiaceae to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes--xenologs--persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes--paralogs--are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein-protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families.
Jabbour, Florian; Cossard, Guillaume; Le Guilloux, Martine; Sannier, Julie; Nadot, Sophie; Damerval, Catherine
2014-01-01
Floral bilateral symmetry (zygomorphy) has evolved several times independently in angiosperms from radially symmetrical (actinomorphic) ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc) have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like) lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.
Directory of Open Access Journals (Sweden)
Florian Jabbour
Full Text Available Floral bilateral symmetry (zygomorphy has evolved several times independently in angiosperms from radially symmetrical (actinomorphic ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.
Directory of Open Access Journals (Sweden)
Marion Ouedraogo
Full Text Available BACKGROUND: There has been a surge in studies linking genome structure and gene expression, with special focus on duplicated genes. Although initially duplicated from the same sequence, duplicated genes can diverge strongly over evolution and take on different functions or regulated expression. However, information on the function and expression of duplicated genes remains sparse. Identifying groups of duplicated genes in different genomes and characterizing their expression and function would therefore be of great interest to the research community. The 'Duplicated Genes Database' (DGD was developed for this purpose. METHODOLOGY: Nine species were included in the DGD. For each species, BLAST analyses were conducted on peptide sequences corresponding to the genes mapped on a same chromosome. Groups of duplicated genes were defined based on these pairwise BLAST comparisons and the genomic location of the genes. For each group, Pearson correlations between gene expression data and semantic similarities between functional GO annotations were also computed when the relevant information was available. CONCLUSIONS: The Duplicated Gene Database provides a list of co-localised and duplicated genes for several species with the available gene co-expression level and semantic similarity value of functional annotation. Adding these data to the groups of duplicated genes provides biological information that can prove useful to gene expression analyses. The Duplicated Gene Database can be freely accessed through the DGD website at http://dgd.genouest.org.
A survey of innovation through duplication in the reduced genomes of twelve parasites.
Directory of Open Access Journals (Sweden)
Jeremy D DeBarry
Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that
Directory of Open Access Journals (Sweden)
Shu-Ting Pan
2016-06-01
Full Text Available The human cytochrome P450 (CYP superfamily consisting of 57 functional genes is the most important group of Phase I drug metabolizing enzymes that oxidize a large number of xenobiotics and endogenous compounds, including therapeutic drugs and environmental toxicants. The CYP superfamily has been shown to expand itself through gene duplication, and some of them become pseudogenes due to gene mutations. Orthologs and paralogs are homologous genes resulting from speciation or duplication, respectively. To explore the evolutionary and functional relationships of human CYPs, we conducted this bioinformatic study to identify their corresponding paralogs, homologs, and orthologs. The functional implications and implications in drug discovery and evolutionary biology were then discussed. GeneCards and Ensembl were used to identify the paralogs of human CYPs. We have used a panel of online databases to identify the orthologs of human CYP genes: NCBI, Ensembl Compara, GeneCards, OMA (“Orthologous MAtrix” Browser, PATHER, TreeFam, EggNOG, and Roundup. The results show that each human CYP has various numbers of paralogs and orthologs using GeneCards and Ensembl. For example, the paralogs of CYP2A6 include CYP2A7, 2A13, 2B6, 2C8, 2C9, 2C18, 2C19, 2D6, 2E1, 2F1, 2J2, 2R1, 2S1, 2U1, and 2W1; CYP11A1 has 6 paralogs including CYP11B1, 11B2, 24A1, 27A1, 27B1, and 27C1; CYP51A1 has only three paralogs: CYP26A1, 26B1, and 26C1; while CYP20A1 has no paralog. The majority of human CYPs are well conserved from plants, amphibians, fishes, or mammals to humans due to their important functions in physiology and xenobiotic disposition. The data from different approaches are also cross-validated and validated when experimental data are available. These findings facilitate our understanding of the evolutionary relationships and functional implications of the human CYP superfamily in drug discovery.
Duplicability of self-interacting human genes.
LENUS (Irish Health Repository)
Pérez-Bercoff, Asa
2010-01-01
BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.
Directory of Open Access Journals (Sweden)
Yong Guo
Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.
Lyubetsky, Vassily; Gershgorin, Roman; Gorbunov, Konstantin
2017-12-06
Chromosome structure is a very limited model of the genome including the information about its chromosomes such as their linear or circular organization, the order of genes on them, and the DNA strand encoding a gene. Gene lengths, nucleotide composition, and intergenic regions are ignored. Although highly incomplete, such structure can be used in many cases, e.g., to reconstruct phylogeny and evolutionary events, to identify gene synteny, regulatory elements and promoters (considering highly conserved elements), etc. Three problems are considered; all assume unequal gene content and the presence of gene paralogs. The distance problem is to determine the minimum number of operations required to transform one chromosome structure into another and the corresponding transformation itself including the identification of paralogs in two structures. We use the DCJ model which is one of the most studied combinatorial rearrangement models. Double-, sesqui-, and single-operations as well as deletion and insertion of a chromosome region are considered in the model; the single ones comprise cut and join. In the reconstruction problem, a phylogenetic tree with chromosome structures in the leaves is given. It is necessary to assign the structures to inner nodes of the tree to minimize the sum of distances between terminal structures of each edge and to identify the mutual paralogs in a fairly large set of structures. A linear algorithm is known for the distance problem without paralogs, while the presence of paralogs makes it NP-hard. If paralogs are allowed but the insertion and deletion operations are missing (and special constraints are imposed), the reduction of the distance problem to integer linear programming is known. Apparently, the reconstruction problem is NP-hard even in the absence of paralogs. The problem of contigs is to find the optimal arrangements for each given set of contigs, which also includes the mutual identification of paralogs. We proved that these
Tang, Ke-Yi; Wang, Xin; Wan, Qiu-Hong; Fang, Sheng-Guo
2018-04-01
The β-defensin, one of the antimicrobial peptides (AMPs), is a significant component of the innate immune with a broad range of antimicrobial activities. Differing from the widely-studied mammals and birds, limited information about β-defensins has been reported in reptiles, especially in crocodilians. As a same ancient species as dinosaurs and the most endangered species of 23 crocodilians, the survival of Chinese alligator (Alligator sinensis) means a powerful immune system and possible involvement of AMPs in its immune resistance. In this study, we identified 20 novel Alligator sinensisβ-defensin genes (AsBDs) from a 390 kb region using bioinformatic and experimental approaches, and successfully distinguished six orthologous AsBDs to birds and nine paralogous AsBDs undergoing gene duplication events. The amino acid alignment shows that the AsBD paralogs, like α-defensins, encode a significantly longer pro-piece comparing with the orthologs. The calculation of non-synonymous (d N ) and synonymous (d S ) substitutions in the mature peptide reveals that the AsBD paralogs experience a significantly higher selective pressure (d N /d S ) than the orthologs, but a similar evolutionary force to α-defensins. The gene expression result indicates that the AsBD paralogs have a significantly higher expression level than the orthologos in gastrointestinal tract where the host is vulnerable to enteric pathogenic bacteria, as observed in α-defensins. These three pieces of evidence demonstrate that the AsBD paralogs do play an important role in maintaining long-term survival of this endangered reptile. Thus, this survey of AsBDs on the genomic structure, evolutionary characteristics, and expression pattern provides a genetic and immunological foundation for further investigating their antimicrobial function and alternative antibiotics potentiality. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.
Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet
2016-02-01
Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.
Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C
2016-02-01
Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.
The Creatine Transporter Gene Paralogous at 16p11.2 Is Expressed in Human Brain
Directory of Open Access Journals (Sweden)
Nadia Bayou
2008-01-01
We report on the clinical, cytogenetic, and molecular findings in a boy with autism carrying a de novo translocation t(7;16(p22.1;p11.2. The chromosome 16 breakpoint disrupts the paralogous SLC6A8 gene also called SLC6A10 or CT2. Predicted translation of exons and RT-PCR analysis reveal specific expression of the creatine transporter paralogous in testis and brain. Several studies reported on the role of X-linked creatine transporter mutations in individuals with mental retardation, with or without autism. The existence of disruption in SLC6A8 paralogous gene associated with idiopathic autism suggests that this gene may be involved in the autistic phenotype in our patient.
Directory of Open Access Journals (Sweden)
Ge Song
2010-04-01
Full Text Available Abstract Background Various evolutionary models have been proposed to interpret the fate of paralogous duplicates, which provides substrates on which evolution selection could act. In particular, domestication, as a special selection, has played important role in crop cultivation with divergence of many genes controlling important agronomic traits. Recent studies have indicated that a pair of duplicate genes was often sub-functionalized from their ancestral functions held by the parental genes. We previously demonstrated that the rice cell-wall invertase (CWI gene GIF1 that plays an important role in the grain-filling process was most likely subjected to domestication selection in the promoter region. Here, we report that GIF1 and another CWI gene OsCIN1 constitute a pair of duplicate genes with differentiated expression and function through independent selection. Results Through synteny analysis, we show that GIF1 and another cell-wall invertase gene OsCIN1 were paralogues derived from a segmental duplication originated during genome duplication of grasses. Results based on analyses of population genetics and gene phylogenetic tree of 25 cultivars and 25 wild rice sequences demonstrated that OsCIN1 was also artificially selected during rice domestication with a fixed mutation in the coding region, in contrast to GIF1 that was selected in the promoter region. GIF1 and OsCIN1 have evolved into different expression patterns and probable different kinetics parameters of enzymatic activity with the latter displaying less enzymatic activity. Overexpression of GIF1 and OsCIN1 also resulted in different phenotypes, suggesting that OsCIN1 might regulate other unrecognized biological process. Conclusion How gene duplication and divergence contribute to genetic novelty and morphological adaptation has been an interesting issue to geneticists and biologists. Our discovery that the duplicated pair of GIF1 and OsCIN1 has experienced sub
Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN
Li, Zhen; Van de Peer, Yves; De Smet, Riet
2016-01-01
Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215
Directory of Open Access Journals (Sweden)
Gabriel Forn-Cuní
Full Text Available The complement system acts as a first line of defense and promotes organism homeostasis by modulating the fates of diverse physiological processes. Multiple copies of component genes have been previously identified in fish, suggesting a key role for this system in aquatic organisms. Herein, we confirm the presence of three different previously reported complement c3 genes (c3.1, c3.2, c3.3 and identify five additional c3 genes (c3.4, c3.5, c3.6, c3.7, c3.8 in the zebrafish genome. Additionally, we evaluate the mRNA expression levels of the different c3 genes during ontogeny and in different tissues under steady-state and inflammatory conditions. Furthermore, while reconciling the phylogenetic tree with the fish species tree, we uncovered an event of c3 duplication common to all teleost fishes that gave rise to an exclusive c3 paralog (c3.7 and c3.8. These paralogs showed a distinct ability to regulate neutrophil migration in response to injury compared with the other c3 genes and may play a role in maintaining the balance between inflammatory and homeostatic processes in zebrafish.
Directory of Open Access Journals (Sweden)
Monique N O'Leary
Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.
Richardson, Dale N.; Wiehe, Thomas
Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.
Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas
2018-01-01
Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177
Acri-Nunes-Miranda, Roberta; Mondragón-Palomino, Mariana
2014-01-01
The diverse flowers of Orchidaceae are the result of several major morphological transitions, among them the most studied is the differentiation of the inner median tepal into the labellum, a perianth organ key in pollinator attraction. Type A peloria lacking stamens and with ectopic labella in place of inner lateral tepals are useful for testing models on the genes specifying these organs by comparing their patterns of expression between wild-type and peloric flowers. Previous studies focused on DEFICIENS- and GLOBOSA-like MADS-box genes because of their conserved role in perianth and stamen development. The "orchid code" model summarizes this work and shows in Orchidaceae there are four paralogous lineages of DEFICIENS/AP3-like genes differentially expressed in each floral whorl. Experimental tests of this model showed the conserved, higher expression of genes from two specific DEF-like gene lineages is associated with labellum development. The present study tests whether eight MADS-box candidate SEP-, FUL-, AG-, and STK-like genes have been specifically duplicated in the Orchidaceae and are also differentially expressed in association with the distinct flower organs of Phalaenopsis hyb. "Athens." The gene trees indicate orchid-specific duplications. In a way analogous to what is observed in labellum-specific DEF-like genes, a two-fold increase in the expression of SEP3-like gene PhaMADS7 was measured in the labellum-like inner lateral tepals of peloric flowers. The overlap between SEP3-like and DEF-like genes suggests both are associated with labellum specification and similar positional cues determine their domains of expression. In contrast, the uniform messenger levels of FUL-like genes suggest they are involved in the development of all organs and their expression in the ovary suggests cell differentiation starts before pollination. As previously reported AG-like and STK-like genes are exclusively expressed in gynostemium and ovary, however no evidence for
Insights into three whole-genome duplications gleaned from the Paramecium caudatum genome sequence.
McGrath, Casey L; Gout, Jean-Francois; Doak, Thomas G; Yanagi, Akira; Lynch, Michael
2014-08-01
Paramecium has long been a model eukaryote. The sequence of the Paramecium tetraurelia genome reveals a history of three successive whole-genome duplications (WGDs), and the sequences of P. biaurelia and P. sexaurelia suggest that these WGDs are shared by all members of the aurelia species complex. Here, we present the genome sequence of P. caudatum, a species closely related to the P. aurelia species group. P. caudatum shares only the most ancient of the three WGDs with the aurelia complex. We found that P. caudatum maintains twice as many paralogs from this early event as the P. aurelia species, suggesting that post-WGD gene retention is influenced by subsequent WGDs and supporting the importance of selection for dosage in gene retention. The availability of P. caudatum as an outgroup allows an expanded analysis of the aurelia intermediate and recent WGD events. Both the Guanine+Cytosine (GC) content and the expression level of preduplication genes are significant predictors of duplicate retention. We find widespread asymmetrical evolution among aurelia paralogs, which is likely caused by gradual pseudogenization rather than by neofunctionalization. Finally, cases of divergent resolution of intermediate WGD duplicates between aurelia species implicate this process acts as an ongoing reinforcement mechanism of reproductive isolation long after a WGD event. Copyright © 2014 by the Genetics Society of America.
Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.
Directory of Open Access Journals (Sweden)
Cheng Zou
2009-07-01
Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.
Hasselmann, Martin; Lechner, Sarah; Schulte, Christina; Beye, Martin
2010-07-27
The most remarkable outcome of a gene duplication event is the evolution of a novel function. Little information exists on how the rise of a novel function affects the evolution of its paralogous sister gene copy, however. We studied the evolution of the feminizer (fem) gene from which the gene complementary sex determiner (csd) recently derived by tandem duplication within the honey bee (Apis) lineage. Previous studies showed that fem retained its sex determination function, whereas the rise of csd established a new primary signal of sex determination. We observed a specific reduction of nonsynonymous to synonymous substitution ratios in Apis to non-Apis fem. We found a contrasting pattern at two other genetically linked genes, suggesting that hitchhiking effects to csd, the locus under balancing selection, is not the cause of this evolutionary pattern. We also excluded higher synonymous substitution rates by relative rate testing. These results imply that stronger purifying selection is operating at the fem gene in the presence of csd. We propose that csd's new function interferes with the function of Fem protein, resulting in molecular constraints and limited evolvability of fem in the Apis lineage. Elevated silent nucleotide polymorphism in fem relative to the genome-wide average suggests that genetic linkage to the csd gene maintained more nucleotide variation in today's population. Our findings provide evidence that csd functionally and genetically interferes with fem, suggesting that a newly evolved gene and its functions can limit the evolutionary capability of other genes in the genome.
Comparative analysis of NBS-LRR genes and their response to Aspergillus flavus in Arachis.
Directory of Open Access Journals (Sweden)
Hui Song
Full Text Available Studies have demonstrated that nucleotide-binding site-leucine-rich repeat (NBS-LRR genes respond to pathogen attack in plants. Characterization of NBS-LRR genes in peanut is not well documented. The newly released whole genome sequences of Arachis duranensis and Arachis ipaënsis have allowed a global analysis of this important gene family in peanut to be conducted. In this study, we identified 393 (AdNBS and 437 (AiNBS NBS-LRR genes from A. duranensis and A. ipaënsis, respectively, using bioinformatics approaches. Full-length sequences of 278 AdNBS and 303 AiNBS were identified. Fifty-one orthologous, four AdNBS paralogous, and six AiNBS paralogous gene pairs were predicted. All paralogous gene pairs were located in the same chromosomes, indicating that tandem duplication was the most likely mechanism forming these paralogs. The paralogs mainly underwent purifying selection, but most LRR 8 domains underwent positive selection. More gene clusters were found in A. ipaënsis than in A. duranensis, possibly owing to tandem duplication events occurring more frequently in A. ipaënsis. The expression profile of NBS-LRR genes was different between A. duranensis and A. hypogaea after Aspergillus flavus infection. The up-regulated expression of NBS-LRR in A. duranensis was continuous, while these genes responded to the pathogen temporally in A. hypogaea.
Evolution of trappin genes in mammals
Directory of Open Access Journals (Sweden)
Furutani Yutaka
2010-01-01
Full Text Available Abstract Background Trappin is a multifunctional host-defense peptide that has antiproteolytic, antiinflammatory, and antimicrobial activities. The numbers and compositions of trappin paralogs vary among mammalian species: human and sheep have a single trappin-2 gene; mouse and rat have no trappin gene; pig and cow have multiple trappin genes; and guinea pig has a trappin gene and two other derivativegenes. Independent duplications of trappin genes in pig and cow were observed recently after the species were separated. To determine whether these trappin gene duplications are restricted only to certain mammalian lineages, we analyzed recently-developed genome databases for the presence of duplicate trappin genes. Results The database analyses revealed that: 1 duplicated trappin multigenes were found recently in the nine-banded armadillo; 2 duplicated two trappin genes had been found in the Afrotherian species (elephant, tenrec, and hyrax since ancient days; 3 a single trappin-2 gene was found in various eutherians species; and 4 no typical trappin gene has been found in chicken, zebra finch, and opossum. Bayesian analysis estimated the date of the duplication of trappin genes in the Afrotheria, guinea pig, armadillo, cow, and pig to be 244, 35, 11, 13, and 3 million-years ago, respectively. The coding regions of trappin multigenes of almadillo, bovine, and pig evolved much faster than the noncoding exons, introns, and the flanking regions, showing that these genes have undergone accelerated evolution, and positive Darwinian selection was observed in pig-specific trappin paralogs. Conclusion These results suggest that trappin is an eutherian-specific molecule and eutherian genomes have the potential to form trappin multigenes.
Effect of Duplicate Genes on Mouse Genetic Robustness: An Update
Directory of Open Access Journals (Sweden)
Zhixi Su
2014-01-01
Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.
Functional requirements driving the gene duplication in 12 Drosophila species.
Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui
2013-08-15
Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.
Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes
Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.
2003-01-01
Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650
Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang
2012-06-15
Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication
Directory of Open Access Journals (Sweden)
Roberta eAcri-Nunes-Miranda
2014-03-01
Full Text Available The diverse flowers of Orchidaceae are the result of several major morphological transitions, among them the most studied is the differentiation of the inner median tepal into the labellum, a perianth organ key in pollinator attraction. Type A peloria lacking stamens and with ectopic labella in place of inner lateral tepals are useful for testing models on the genes specifying these organs by comparing their patterns of expression between wild-type and peloric flowers. Previous studies focused on DEFICIENS and GLOBOSA-like MADS-box genes because of their conserved role in perianth and stamen development. The ‘orchid code’ model summarizes this work and shows in Orchidaceae there are four paralogous lineages of DEFICIENS/AP3-like genes differentially expressed in each floral whorl. Experimental tests of this model showed the conserved, higher expression of genes from two specific DEF-like gene lineages is associated with labellum development. The present study tests whether eight MADS-box candidate SEP-, FUL-, AG- and STK-like genes have been specifically duplicated in the Orchidaceae and are also differentially expressed in association with the distinct flower organs of Phalaenopsis hyb. Athens. The gene trees indicate orchid-specific duplications. In a way analogous to what is observed in labellum-specific DEF-like genes, a two-fold increase in the expression of SEP3-like gene PhaMADS7 was measured in the labellum-like inner lateral tepals of peloric flowers. The overlap between SEP3-like and DEF-like genes suggests both are associated with labellum specification and similar positional cues determine their domains of expression. In contrast, the uniform messenger levels of FUL-like genes suggest they are involved in the development of all organs and their expression in the ovary suggests cell differentiation starts before pollination. As previously reported AG-like and STK-like are exclusively expressed in gynostemium and ovary, however no
Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion
Directory of Open Access Journals (Sweden)
Jeffrey A. Fawcett
2011-02-01
Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.
Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S
2012-08-19
Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.
International Nuclear Information System (INIS)
Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.
2009-01-01
The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family
Energy Technology Data Exchange (ETDEWEB)
Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)
2009-10-01
The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.
Rooting phylogenies using gene duplications: an empirical example from the bees (Apoidea).
Brady, Seán G; Litman, Jessica R; Danforth, Bryan N
2011-09-01
The placement of the root node in a phylogeny is fundamental to characterizing evolutionary relationships. The root node of bee phylogeny remains unclear despite considerable previous attention. In order to test alternative hypotheses for the location of the root node in bees, we used the F1 and F2 paralogs of elongation factor 1-alpha (EF-1α) to compare the tree topologies that result when using outgroup versus paralogous rooting. Fifty-two taxa representing each of the seven bee families were sequenced for both copies of EF-1α. Two datasets were analyzed. In the first (the "concatenated" dataset), the F1 and F2 copies for each species were concatenated and the tree was rooted using appropriate outgroups (sphecid and crabronid wasps). In the second dataset (the "duplicated" dataset), the F1 and F2 copies were aligned to each another and each copy for all taxa were treated as separate terminals. In this dataset, the root was placed between the F1 and F2 copies (e.g., paralog rooting). Bayesian analyses demonstrate that the outgroup rooting approach outperforms paralog rooting, recovering deeper clades and showing stronger support for groups well established by both morphological and other molecular data. Sequence characteristics of the two copies were compared at the amino acid level, but little evidence was found to suggest that one copy is more functionally conserved. Although neither approach yields an unambiguous root to the tree, both approaches strongly indicate that the root of bee phylogeny does not fall near Colletidae, as has been previously proposed. We discuss paralog rooting as a general strategy and why this approach performs relatively poorly with our particular dataset. Copyright © 2011 Elsevier Inc. All rights reserved.
Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi
2015-02-15
WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.
A role for gene duplication and natural variation of gene expression in the evolution of metabolism.
Directory of Open Access Journals (Sweden)
Daniel J Kliebenstein
Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.
Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.
Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M
2017-08-01
Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.
Directory of Open Access Journals (Sweden)
Gadagkar Sudhindra R
2010-04-01
Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions
Directory of Open Access Journals (Sweden)
Baumgarten Andrew
2004-06-01
Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.
Maintenance and Loss of Duplicated Genes by Dosage Subfunctionalization.
Gout, Jean-Francois; Lynch, Michael
2015-08-01
Whole-genome duplications (WGDs) have contributed to gene-repertoire enrichment in many eukaryotic lineages. However, most duplicated genes are eventually lost and it is still unclear why some duplicated genes are evolutionary successful whereas others quickly turn to pseudogenes. Here, we show that dosage constraints are major factors opposing post-WGD gene loss in several Paramecium species that share a common ancestral WGD. We propose a model where a majority of WGD-derived duplicates preserve their ancestral function and are retained to produce enough of the proteins performing this same ancestral function. Under this model, the expression level of individual duplicated genes can evolve neutrally as long as they maintain a roughly constant summed expression, and this allows random genetic drift toward uneven contributions of the two copies to total expression. Our analysis suggests that once a high level of imbalance is reached, which can require substantial lengths of time, the copy with the lowest expression level contributes a small enough fraction of the total expression that selection no longer opposes its loss. Extension of our analysis to yeast species sharing a common ancestral WGD yields similar results, suggesting that duplicated-gene retention for dosage constraints followed by divergence in expression level and eventual deterministic gene loss might be a universal feature of post-WGD evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.
Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu
2016-09-01
Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.
Exon duplications in the ATP7A gene
DEFF Research Database (Denmark)
Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko
2011-01-01
the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...
Orthology and paralogy constraints: satisfiability and consistency
Lafond, Manuel; El-Mabrouk, Nadia
2014-01-01
Background A variety of methods based on sequence similarity, reconciliation, synteny or functional characteristics, can be used to infer orthology and paralogy relations between genes of a given gene family G . But is a given set C of orthology/paralogy constraints possible, i.e., can they simultaneously co-exist in an evolutionary history for G ? While previous studies have focused on full sets of constraints, here we consider the general case where C does not necessarily involve a ...
Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi
2013-01-01
The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833
Directory of Open Access Journals (Sweden)
Bee Katharine J
2008-04-01
Full Text Available Abstract Background Brd2 belongs to the bromodomain-extraterminal domain (BET family of transcriptional co-regulators, and functions as a pivotal histone-directed recruitment scaffold in chromatin modification complexes affecting signal-dependent transcription. Brd2 facilitates expression of genes promoting proliferation and is implicated in apoptosis and in egg maturation and meiotic competence in mammals; it is also a susceptibility gene for juvenile myoclonic epilepsy (JME in humans. The brd2 ortholog in Drosophila is a maternal effect, embryonic lethal gene that regulates several homeotic loci, including Ultrabithorax. Despite its importance, there are few systematic studies of Brd2 developmental expression in any organism. To help elucidate both conserved and novel gene functions, we cloned and characterized expression of brd2 cDNAs in zebrafish, a vertebrate system useful for genetic analysis of development and disease, and for study of the evolution of gene families and functional diversity in chordates. Results We identify cDNAs representing two paralogous brd2 loci in zebrafish, brd2a on chromosome 19 and brd2b on chromosome 16. By sequence similarity, syntenic and phylogenetic analyses, we present evidence for structural divergence of brd2 after gene duplication in fishes. brd2 paralogs show potential for modular domain combinations, and exhibit distinct RNA expression patterns throughout development. RNA in situ hybridizations in oocytes and embryos implicate brd2a and brd2b as maternal effect genes involved in egg polarity and egg to embryo transition, and as zygotic genes important for development of the vertebrate nervous system and for morphogenesis and differentiation of the digestive tract. Patterns of brd2 developmental expression in zebrafish are consistent with its proposed role in Homeobox gene regulation. Conclusion Expression profiles of zebrafish brd2 paralogs support a role in vertebrate developmental patterning and
Identifying pathogenicity of human variants via paralog-based yeast complementation.
Directory of Open Access Journals (Sweden)
Fan Yang
2017-05-01
Full Text Available To better understand the health implications of personal genomes, we now face a largely unmet challenge to identify functional variants within disease-associated genes. Functional variants can be identified by trans-species complementation, e.g., by failure to rescue a yeast strain bearing a mutation in an orthologous human gene. Although orthologous complementation assays are powerful predictors of pathogenic variation, they are available for only a few percent of human disease genes. Here we systematically examine the question of whether complementation assays based on paralogy relationships can expand the number of human disease genes with functional variant detection assays. We tested over 1,000 paralogous human-yeast gene pairs for complementation, yielding 34 complementation relationships, of which 33 (97% were novel. We found that paralog-based assays identified disease variants with success on par with that of orthology-based assays. Combining all homology-based assay results, we found that complementation can often identify pathogenic variants outside the homologous sequence region, presumably because of global effects on protein folding or stability. Within our search space, paralogy-based complementation more than doubled the number of human disease genes with a yeast-based complementation assay for disease variation.
Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira
2016-10-13
PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.
Comparative inference of duplicated genes produced by polyploidization in soybean genome.
Yang, Yanmei; Wang, Jinpeng; Di, Jianyong
2013-01-01
Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.
Kim, Seon-Hee; Bae, Young-An
2017-09-01
Tyrosinase provides an essential activity during egg production in diverse platyhelminths by mediating sclerotization of eggshells. In this study, we investigated the genomic and evolutionary features of tyrosinases in parasitic platyhelminths whose genomic information is available. A pair of paralogous tyrosinases was detected in most trematodes, whereas they were lost in cyclophyllidean cestodes. A pseudophyllidean cestode displaying egg biology similar to that of trematodes possessed an orthologous gene. Interestingly, one of the paralogous tyrosinases appeared to have been multiplied into three copies in Clonorchis sinensis and Opisthorchis viverrini. In addition, a fifth tyrosinase gene that was minimally transcribed through all developmental stages was further detected in these opisthorchiid genomes. Phylogenetic analyses demonstrated that the tyrosinase gene has undergone duplication at least three times in platyhelminths. The additional opisthorchiid gene arose from the first duplication. A paralogous copy generated from these gene duplications, except for the last one, seemed to be lost in the major neodermatans lineages. In C. sinensis, tyrosinase gene expressions were initiated following sexual maturation and the levels were significantly enhanced by the presence of O2 and bile. Taken together, our data suggest that tyrosinase has evolved lineage-specifically across platyhelminths related to its copy number and induction mechanism.
Recombination facilitates neofunctionalization of duplicate genes via originalization
Directory of Open Access Journals (Sweden)
Huang Ren
2010-06-01
Full Text Available Abstract Background Recently originalization was proposed to be an effective way of duplicate-gene preservation, in which recombination provokes the high frequency of original (or wild-type allele on both duplicated loci. Because the high frequency of wild-type allele might drive the arising and accumulating of advantageous mutation, it is hypothesized that recombination might enlarge the probability of neofunctionalization (Pneo of duplicate genes. In this article this hypothesis has been tested theoretically. Results Results show that through originalization recombination might not only shorten mean time to neofunctionalizaiton, but also enlarge Pneo. Conclusions Therefore, recombination might facilitate neofunctionalization via originalization. Several extensive applications of these results on genomic evolution have been discussed: 1. Time to nonfunctionalization can be much longer than a few million generations expected before; 2. Homogenization on duplicated loci results from not only gene conversion, but also originalization; 3. Although the rate of advantageous mutation is much small compared with that of degenerative mutation, Pneo cannot be expected to be small.
Orthology and paralogy constraints: satisfiability and consistency.
Lafond, Manuel; El-Mabrouk, Nadia
2014-01-01
A variety of methods based on sequence similarity, reconciliation, synteny or functional characteristics, can be used to infer orthology and paralogy relations between genes of a given gene family G. But is a given set C of orthology/paralogy constraints possible, i.e., can they simultaneously co-exist in an evolutionary history for G? While previous studies have focused on full sets of constraints, here we consider the general case where C does not necessarily involve a constraint for each pair of genes. The problem is subdivided in two parts: (1) Is C satisfiable, i.e. can we find an event-labeled gene tree G inducing C? (2) Is there such a G which is consistent, i.e., such that all displayed triplet phylogenies are included in a species tree? Previous results on the Graph sandwich problem can be used to answer to (1), and we provide polynomial-time algorithms for satisfiability and consistency with a given species tree. We also describe a new polynomial-time algorithm for the case of consistency with an unknown species tree and full knowledge of pairwise orthology/paralogy relationships, as well as a branch-and-bound algorithm in the case when unknown relations are present. We show that our algorithms can be used in combination with ProteinOrtho, a sequence similarity-based orthology detection tool, to extract a set of robust orthology/paralogy relationships.
The house spider genome reveals an ancient whole-genome duplication during arachnid evolution.
Schwager, Evelyn E; Sharma, Prashant P; Clarke, Thomas; Leite, Daniel J; Wierschin, Torsten; Pechmann, Matthias; Akiyama-Oda, Yasuko; Esposito, Lauren; Bechsgaard, Jesper; Bilde, Trine; Buffry, Alexandra D; Chao, Hsu; Dinh, Huyen; Doddapaneni, HarshaVardhan; Dugan, Shannon; Eibner, Cornelius; Extavour, Cassandra G; Funch, Peter; Garb, Jessica; Gonzalez, Luis B; Gonzalez, Vanessa L; Griffiths-Jones, Sam; Han, Yi; Hayashi, Cheryl; Hilbrant, Maarten; Hughes, Daniel S T; Janssen, Ralf; Lee, Sandra L; Maeso, Ignacio; Murali, Shwetha C; Muzny, Donna M; Nunes da Fonseca, Rodrigo; Paese, Christian L B; Qu, Jiaxin; Ronshaugen, Matthew; Schomburg, Christoph; Schönauer, Anna; Stollewerk, Angelika; Torres-Oliva, Montserrat; Turetzek, Natascha; Vanthournout, Bram; Werren, John H; Wolff, Carsten; Worley, Kim C; Bucher, Gregor; Gibbs, Richard A; Coddington, Jonathan; Oda, Hiroki; Stanke, Mario; Ayoub, Nadia A; Prpic, Nikola-Michael; Flot, Jean-François; Posnien, Nico; Richards, Stephen; McGregor, Alistair P
2017-07-31
The duplication of genes can occur through various mechanisms and is thought to make a major contribution to the evolutionary diversification of organisms. There is increasing evidence for a large-scale duplication of genes in some chelicerate lineages including two rounds of whole genome duplication (WGD) in horseshoe crabs. To investigate this further, we sequenced and analyzed the genome of the common house spider Parasteatoda tepidariorum. We found pervasive duplication of both coding and non-coding genes in this spider, including two clusters of Hox genes. Analysis of synteny conservation across the P. tepidariorum genome suggests that there has been an ancient WGD in spiders. Comparison with the genomes of other chelicerates, including that of the newly sequenced bark scorpion Centruroides sculpturatus, suggests that this event occurred in the common ancestor of spiders and scorpions, and is probably independent of the WGDs in horseshoe crabs. Furthermore, characterization of the sequence and expression of the Hox paralogs in P. tepidariorum suggests that many have been subject to neo-functionalization and/or sub-functionalization since their duplication. Our results reveal that spiders and scorpions are likely the descendants of a polyploid ancestor that lived more than 450 MYA. Given the extensive morphological diversity and ecological adaptations found among these animals, rivaling those of vertebrates, our study of the ancient WGD event in Arachnopulmonata provides a new comparative platform to explore common and divergent evolutionary outcomes of polyploidization events across eukaryotes.
Directory of Open Access Journals (Sweden)
Yan Koon-Kiu
2007-11-01
Full Text Available Abstract Background The evolution of the full repertoire of proteins encoded in a given genome is mostly driven by gene duplications, deletions, and sequence modifications of existing proteins. Indirect information about relative rates and other intrinsic parameters of these three basic processes is contained in the proteome-wide distribution of sequence identities of pairs of paralogous proteins. Results We introduce a simple mathematical framework based on a stochastic birth-and-death model that allows one to extract some of this information and apply it to the set of all pairs of paralogous proteins in H. pylori, E. coli, S. cerevisiae, C. elegans, D. melanogaster, and H. sapiens. It was found that the histogram of sequence identities p generated by an all-to-all alignment of all protein sequences encoded in a genome is well fitted with a power-law form ~ p-γ with the value of the exponent γ around 4 for the majority of organisms used in this study. This implies that the intra-protein variability of substitution rates is best described by the Gamma-distribution with the exponent α ≈ 0.33. Different features of the shape of such histograms allow us to quantify the ratio between the genome-wide average deletion/duplication rates and the amino-acid substitution rate. Conclusion We separately measure the short-term ("raw" duplication and deletion rates rdup∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsgaKjabbwha1jabbchaWbqaaiabgEHiQaaaaaa@3283@, rdel∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsga
Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu
2016-01-01
Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883
Biewer, M; Lechner, S; Hasselmann, M
2016-01-01
Studying the fate of duplicated genes provides informative insight into the evolutionary plasticity of biological pathways to which they belong. In the paralogous sex-determining genes complementary sex determiner (csd) and feminizer (fem) of honey bee species (genus Apis), only heterozygous csd initiates female development. Here, the full-length coding sequences of the genes csd and fem of the phylogenetically basal dwarf honey bee Apis florea are characterized. Compared with other Apis species, remarkable evolutionary changes in the formation and localization of a protein-interacting (coiled-coil) motif and in the amino acids coding for the csd characteristic hypervariable region (HVR) are observed. Furthermore, functionally different csd alleles were isolated as genomic fragments from a random population sample. In the predicted potential specifying domain (PSD), a high ratio of πN/πS=1.6 indicated positive selection, whereas signs of balancing selection, commonly found in other Apis species, are missing. Low nucleotide diversity on synonymous and genome-wide, non-coding sites as well as site frequency analyses indicated a strong impact of genetic drift in A. florea, likely linked to its biology. Along the evolutionary trajectory of ~30 million years of csd evolution, episodic diversifying selection seems to have acted differently among distinct Apis branches. Consistently low amino-acid differences within the PSD among pairs of functional heterozygous csd alleles indicate that the HVR is the most important region for determining allele specificity. We propose that in the early history of the lineage-specific fem duplication giving rise to csd in Apis, A. florea csd stands as a remarkable example for the plasticity of initial sex-determining signals.
Duplication of the dystroglycan gene in most branches of teleost fish
Directory of Open Access Journals (Sweden)
Giardina Bruno
2007-05-01
Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details
Walker, Kimberly A; Griggs, Lauren A; Obrist, Markus; Bode, Addys; Summers, R Patrick; Miller, Virginia L
2016-06-15
The Yersinia enterocolitica Ysa type III secretion system (T3SS) is associated with intracellular survival, and, like other characterized T3SSs, it is tightly controlled. Expression of the ysa genes is only detected following growth at low temperatures (26°C) and in high concentrations of sodium chloride (290 mM) in the medium. The YsrSTR phosphorelay (PR) system is required for ysa expression and likely responds to NaCl. During our investigations into the Ysr PR system, we discovered that genes YE3578 and YE3579 are remarkably similar to ysrR and ysrS, respectively, and are probably a consequence of a gene duplication event. The amino acid differences between YE3578 and ysrR are primarily clustered into two short regions. The differences between YE3579 and ysrS are nearly all located in the periplasmic sensing domain; the cytoplasmic domains are 98% identical. We investigated whether these paralogs were capable of activating ysa gene expression. We found that the sensor paralog, named DygS, is capable of compensating for loss of ysrS, but the response regulator paralog, DygR, cannot complement a ysrR gene deletion. In addition, YsrR, but not DygR, interacts with the histidine phosphorelay protein YsrT. Thus, DygS likely activates ysa gene expression in response to a signal other than NaCl and provides an example of a phosphorelay system in which two sensor kinases feed into the same regulatory pathway. All organisms need mechanisms to promote survival in changing environments. Prokaryotic phosphorelay systems are minimally comprised of a histidine kinase (HK) that senses an extracellular stimulus and a response regulator (RR) but can contain three or more proteins. Through gene duplication, a unique hybrid HK was created. We show that, while the hybrid appears to retain all of the phosphorelay functions, it responds to a different signal than the original. Both HKs transmit the signal to the same RR, which activates a promoter that transcribes a set of genes
Population Level Purifying Selection and Gene Expression Shape Subgenome Evolution in Maize.
Pophaly, Saurabh D; Tellier, Aurélien
2015-12-01
The maize ancestor experienced a recent whole-genome duplication (WGD) followed by gene erosion which generated two subgenomes, the dominant subgenome (maize1) experiencing fewer deletions than maize2. We take advantage of available extensive polymorphism and gene expression data in maize to study purifying selection and gene expression divergence between WGD retained paralog pairs. We first report a strong correlation in nucleotide diversity between duplicate pairs, except for upstream regions. We then show that maize1 genes are under stronger purifying selection than maize2. WGD retained genes have higher gene dosage and biased Gene Ontologies consistent with previous studies. The relative gene expression of paralogs across tissues demonstrates that 98% of duplicate pairs have either subfunctionalized in a tissuewise manner or have diverged consistently in their expression thereby preventing functional complementation. Tissuewise subfunctionalization seems to be a hallmark of transcription factors, whereas consistent repression occurs for macromolecular complexes. We show that dominant gene expression is a strong determinant of the strength of purifying selection, explaining the inferred stronger negative selection on maize1 genes. We propose a novel expression-based classification of duplicates which is more robust to explain observed polymorphism patterns than the subgenome location. Finally, upstream regions of repressed genes exhibit an enrichment in transposable elements which indicates a possible mechanism for expression divergence. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene
Directory of Open Access Journals (Sweden)
Shomron Noam
2007-11-01
Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.
Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes
Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.
2011-01-01
vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289
Convergent evolution of gene networks by single-gene duplications in higher eukaryotes.
Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich
2004-03-01
By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix-loop-helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks emerging through single-gene duplications, the dominant importance of molecular modularity in the bottom-up construction of complex biological entities, and the convergent evolution of networks.
Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina
2017-05-01
Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Christensen Ashley R
2012-02-01
Full Text Available Abstract Background Gene duplication and the subsequent divergence in function of the resulting paralogs via subfunctionalization and/or neofunctionalization is hypothesized to have played a major role in the evolution of plant form. The LEAFY HULL STERILE1 (LHS1 SEPALLATA (SEP genes have been linked with the origin and diversification of the grass spikelet, but it is uncertain 1 when the duplication event that produced the LHS1 clade and its paralogous lineage Oryza sativa MADS5 (OSM5 occurred, and 2 how changes in gene structure and/or expression might have contributed to subfunctionalization and/or neofunctionalization in the two lineages. Methods Phylogenetic relationships among 84 SEP genes were estimated using Bayesian methods. RNA expression patterns were inferred using in situ hybridization. The patterns of protein sequence and RNA expression evolution were reconstructed using maximum parsimony (MP and maximum likelihood (ML methods, respectively. Results Phylogenetic analyses mapped the LHS1/OSM5 duplication event to the base of the grass family. MP character reconstructions estimated a change from cytosine to thymine in the first codon position of the first amino acid after the Zea mays MADS3 (ZMM3 domain converted a glutamine to a stop codon in the OSM5 ancestor following the LHS1/OSM5 duplication event. RNA expression analyses of OSM5 co-orthologs in Avena sativa, Chasmanthium latifolium, Hordeum vulgare, Pennisetum glaucum, and Sorghum bicolor followed by ML reconstructions of these data and previously published analyses estimated a complex pattern of gain and loss of LHS1 and OSM5 expression in different floral organs and different flowers within the spikelet or inflorescence. Conclusions Previous authors have reported that rice OSM5 and LHS1 proteins have different interaction partners indicating that the truncation of OSM5 following the LHS1/OSM5 duplication event has resulted in both partitioned and potentially novel gene
Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.
Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J
2016-11-04
Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types
Roux, Julien; Liu, Jialin; Robinson-Rechavi, Marc
2017-11-01
The evolutionary history of vertebrates is marked by three ancient whole-genome duplications: two successive rounds in the ancestor of vertebrates, and a third one specific to teleost fishes. Biased loss of most duplicates enriched the genome for specific genes, such as slow evolving genes, but this selective retention process is not well understood. To understand what drives the long-term preservation of duplicate genes, we characterized duplicated genes in terms of their expression patterns. We used a new method of expression enrichment analysis, TopAnat, applied to in situ hybridization data from thousands of genes from zebrafish and mouse. We showed that the presence of expression in the nervous system is a good predictor of a higher rate of retention of duplicate genes after whole-genome duplication. Further analyses suggest that purifying selection against the toxic effects of misfolded or misinteracting proteins, which is particularly strong in nonrenewing neural tissues, likely constrains the evolution of coding sequences of nervous system genes, leading indirectly to the preservation of duplicate genes after whole-genome duplication. Whole-genome duplications thus greatly contributed to the expansion of the toolkit of genes available for the evolution of profound novelties of the nervous system at the base of the vertebrate radiation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Finnerty, John R; Mazza, Maureen E; Jezewski, Peter A
2009-01-20
Msx originated early in animal evolution and is implicated in human genetic disorders. To reconstruct the functional evolution of Msx and inform the study of human mutations, we analyzed the phylogeny and synteny of 46 metazoan Msx proteins and tracked the duplication, diversification and loss of conserved motifs. Vertebrate Msx sequences sort into distinct Msx1, Msx2 and Msx3 clades. The sister-group relationship between MSX1 and MSX2 reflects their derivation from the 4p/5q chromosomal paralogon, a derivative of the original "MetaHox" cluster. We demonstrate physical linkage between Msx and other MetaHox genes (Hmx, NK1, Emx) in a cnidarian. Seven conserved domains, including two Groucho repression domains (N- and C-terminal), were present in the ancestral Msx. In cnidarians, the Groucho domains are highly similar. In vertebrate Msx1, the N-terminal Groucho domain is conserved, while the C-terminal domain diverged substantially, implying a novel function. In vertebrate Msx2 and Msx3, the C-terminal domain was lost. MSX1 mutations associated with ectodermal dysplasia or orofacial clefting disorders map to conserved domains in a non-random fashion. Msx originated from a MetaHox ancestor that also gave rise to Tlx, Demox, NK, and possibly EHGbox, Hox and ParaHox genes. Duplication, divergence or loss of domains played a central role in the functional evolution of Msx. Duplicated domains allow pleiotropically expressed proteins to evolve new functions without disrupting existing interaction networks. Human missense sequence variants reside within evolutionarily conserved domains, likely disrupting protein function. This phylogenomic evaluation of candidate disease markers will inform clinical and functional studies.
Directory of Open Access Journals (Sweden)
Finnerty John R
2009-01-01
Full Text Available Abstract Background Msx originated early in animal evolution and is implicated in human genetic disorders. To reconstruct the functional evolution of Msx and inform the study of human mutations, we analyzed the phylogeny and synteny of 46 metazoan Msx proteins and tracked the duplication, diversification and loss of conserved motifs. Results Vertebrate Msx sequences sort into distinct Msx1, Msx2 and Msx3 clades. The sister-group relationship between MSX1 and MSX2 reflects their derivation from the 4p/5q chromosomal paralogon, a derivative of the original "MetaHox" cluster. We demonstrate physical linkage between Msx and other MetaHox genes (Hmx, NK1, Emx in a cnidarian. Seven conserved domains, including two Groucho repression domains (N- and C-terminal, were present in the ancestral Msx. In cnidarians, the Groucho domains are highly similar. In vertebrate Msx1, the N-terminal Groucho domain is conserved, while the C-terminal domain diverged substantially, implying a novel function. In vertebrate Msx2 and Msx3, the C-terminal domain was lost. MSX1 mutations associated with ectodermal dysplasia or orofacial clefting disorders map to conserved domains in a non-random fashion. Conclusion Msx originated from a MetaHox ancestor that also gave rise to Tlx, Demox, NK, and possibly EHGbox, Hox and ParaHox genes. Duplication, divergence or loss of domains played a central role in the functional evolution of Msx. Duplicated domains allow pleiotropically expressed proteins to evolve new functions without disrupting existing interaction networks. Human missense sequence variants reside within evolutionarily conserved domains, likely disrupting protein function. This phylogenomic evaluation of candidate disease markers will inform clinical and functional studies.
Duplication and Diversification of the Hypoxia-Inducible IGFBP-1 Gene in Zebrafish
DEFF Research Database (Denmark)
Kamei, Hiroyasu; Lu, Ling; Jiao, Shuang
2008-01-01
Background: Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenabilit...
Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants
Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong
2010-01-01
Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...
The zebrafish genome: a review and msx gene case study.
Postlethwait, J H
2006-01-01
Zebrafish is one of several important teleost models for understanding principles of vertebrate developmental, molecular, organismal, genetic, evolutionary, and genomic biology. Efficient investigation of the molecular genetic basis of induced mutations depends on knowledge of the zebrafish genome. Principles of zebrafish genomic analysis, including gene mapping, ortholog identification, conservation of syntenies, genome duplication, and evolution of duplicate gene function are discussed here using as a case study the zebrafish msxa, msxb, msxc, msxd, and msxe genes, which together constitute zebrafish orthologs of tetrapod Msx1, Msx2, and Msx3. Genomic analysis suggests orthologs for this difficult to understand group of paralogs.
Biedler, James K; Tu, Zhijian
2010-07-08
The maternal zygotic transition marks the time at which transcription from the zygotic genome is initiated and a subset of maternal RNAs are progressively degraded in the developing embryo. A number of early zygotic genes have been identified in Drosophila melanogaster and comparisons to sequenced mosquito genomes suggest that some of these early zygotic genes such as bottleneck are fast-evolving or subject to turnover in dipteran insects. One objective of this study is to identify early zygotic genes from the yellow fever mosquito Aedes aegypti to study their evolution. We are also interested in obtaining early zygotic promoters that will direct transgene expression in the early embryo as part of a Medea gene drive system. Two novel early zygotic kinesin light chain genes we call AaKLC2.1 and AaKLC2.2 were identified by transcriptome sequencing of Aedes aegypti embryos at various time points. These two genes have 98% nucleotide and amino acid identity in their coding regions and show transcription confined to the early zygotic stage according to gene-specific RT-PCR analysis. These AaKLC2 genes have a paralogous gene (AaKLC1) in Ae. aegypti. Phylogenetic inference shows that an ortholog to the AaKLC2 genes is only found in the sequenced genome of Culex quinquefasciatus. In contrast, AaKLC1 gene orthologs are found in all three sequenced mosquito species including Anopheles gambiae. There is only one KLC gene in D. melanogaster and other sequenced holometabolous insects that appears to be similar to AaKLC1. Unlike AaKLC2, AaKLC1 is expressed in all life stages and tissues tested, which is consistent with the expression pattern of the An. gambiae and D. melanogaster KLC genes. Phylogenetic inference also suggests that AaKLC2 genes and their likely C. quinquefasciatus ortholog are fast-evolving genes relative to the highly conserved AaKLC1-like paralogs. Embryonic injection of a luciferase reporter under the control of a 1 kb fragment upstream of the AaKLC2.1 start
Directory of Open Access Journals (Sweden)
Tu Zhijian
2010-07-01
Full Text Available Abstract Background The maternal zygotic transition marks the time at which transcription from the zygotic genome is initiated and a subset of maternal RNAs are progressively degraded in the developing embryo. A number of early zygotic genes have been identified in Drosophila melanogaster and comparisons to sequenced mosquito genomes suggest that some of these early zygotic genes such as bottleneck are fast-evolving or subject to turnover in dipteran insects. One objective of this study is to identify early zygotic genes from the yellow fever mosquito Aedes aegypti to study their evolution. We are also interested in obtaining early zygotic promoters that will direct transgene expression in the early embryo as part of a Medea gene drive system. Results Two novel early zygotic kinesin light chain genes we call AaKLC2.1 and AaKLC2.2 were identified by transcriptome sequencing of Aedes aegypti embryos at various time points. These two genes have 98% nucleotide and amino acid identity in their coding regions and show transcription confined to the early zygotic stage according to gene-specific RT-PCR analysis. These AaKLC2 genes have a paralogous gene (AaKLC1 in Ae. aegypti. Phylogenetic inference shows that an ortholog to the AaKLC2 genes is only found in the sequenced genome of Culex quinquefasciatus. In contrast, AaKLC1 gene orthologs are found in all three sequenced mosquito species including Anopheles gambiae. There is only one KLC gene in D. melanogaster and other sequenced holometabolous insects that appears to be similar to AaKLC1. Unlike AaKLC2, AaKLC1 is expressed in all life stages and tissues tested, which is consistent with the expression pattern of the An. gambiae and D. melanogaster KLC genes. Phylogenetic inference also suggests that AaKLC2 genes and their likely C. quinquefasciatus ortholog are fast-evolving genes relative to the highly conserved AaKLC1-like paralogs. Embryonic injection of a luciferase reporter under the control of a
Kursel, Lisa E; Malik, Harmit S
2017-06-01
Despite their essential role in the process of chromosome segregation in most eukaryotes, centromeric histones show remarkable evolutionary lability. Not only have they been lost in multiple insect lineages, but they have also undergone gene duplication in multiple plant lineages. Based on detailed study of a handful of model organisms including Drosophila melanogaster, centromeric histone duplication is considered to be rare in animals. Using a detailed phylogenomic study, we find that Cid, the centromeric histone gene, has undergone at least four independent gene duplications during Drosophila evolution. We find duplicate Cid genes in D. eugracilis (Cid2), in the montium species subgroup (Cid3, Cid4) and in the entire Drosophila subgenus (Cid5). We show that Cid3, Cid4, and Cid5 all localize to centromeres in their respective species. Some Cid duplicates are primarily expressed in the male germline. With rare exceptions, Cid duplicates have been strictly retained after birth, suggesting that they perform nonredundant centromeric functions, independent from the ancestral Cid. Indeed, each duplicate encodes a distinct N-terminal tail, which may provide the basis for distinct protein-protein interactions. Finally, we show some Cid duplicates evolve under positive selection whereas others do not. Taken together, our results support the hypothesis that Drosophila Cid duplicates have subfunctionalized. Thus, these gene duplications provide an unprecedented opportunity to dissect the multiple roles of centromeric histones. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
The fate of the duplicated androgen receptor in fishes: a late neofunctionalization event?
Directory of Open Access Journals (Sweden)
Haendler Bernard
2008-12-01
Full Text Available Abstract Background Based on the observation of an increased number of paralogous genes in teleost fishes compared with other vertebrates and on the conserved synteny between duplicated copies, it has been shown that a whole genome duplication (WGD occurred during the evolution of Actinopterygian fish. Comparative phylogenetic dating of this duplication event suggests that it occurred early on, specifically in teleosts. It has been proposed that this event might have facilitated the evolutionary radiation and the phenotypic diversification of the teleost fish, notably by allowing the sub- or neo-functionalization of many duplicated genes. Results In this paper, we studied in a wide range of Actinopterygians the duplication and fate of the androgen receptor (AR, NR3C4, a nuclear receptor known to play a key role in sex-determination in vertebrates. The pattern of AR gene duplication is consistent with an early WGD event: it has been duplicated into two genes AR-A and AR-B after the split of the Acipenseriformes from the lineage leading to teleost fish but before the divergence of Osteoglossiformes. Genomic and syntenic analyses in addition to lack of PCR amplification show that one of the duplicated copies, AR-B, was lost in several basal Clupeocephala such as Cypriniformes (including the model species zebrafish, Siluriformes, Characiformes and Salmoniformes. Interestingly, we also found that, in basal teleost fish (Osteoglossiformes and Anguilliformes, the two copies remain very similar, whereas, specifically in Percomorphs, one of the copies, AR-B, has accumulated substitutions in both the ligand binding domain (LBD and the DNA binding domain (DBD. Conclusion The comparison of the mutations present in these divergent AR-B with those known in human to be implicated in complete, partial or mild androgen insensitivity syndrome suggests that the existence of two distinct AR duplicates may be correlated to specific functional differences that may be
Cao, Yunpeng; Meng, Dandan; Abdullah, Muhammad; Jin, Qing; Lin, Yi; Cai, Yongping
2018-04-23
The VQ motif-containing gene, a member of the plant-specific genes, is involved in the plant developmental process and various stress responses. The VQ motif-containing gene family has been studied in several plants, such as rice ( Oryza sativa ), maize ( Zea mays ), and Arabidopsis ( Arabidopsis thaliana ). However, no systematic study has been performed in Pyrus species, which have important economic value. In our study, we identified 41 and 28 VQ motif-containing genes in Pyrus bretschneideri and Pyrus communis , respectively. Phylogenetic trees were calculated using A. thaliana and O. sativa VQ motif-containing genes as a template, allowing us to categorize these genes into nine subfamilies. Thirty-two and eight paralogous of VQ motif-containing genes were found in P. bretschneideri and P. communis , respectively, showing that the VQ motif-containing genes had a more remarkable expansion in P. bretschneideri than in P. communis . A total of 31 orthologous pairs were identified from the P. bretschneideri and P. communis VQ motif-containing genes. Additionally, among the paralogs, we found that these duplication gene pairs probably derived from segmental duplication/whole-genome duplication (WGD) events in the genomes of P. bretschneideri and P. communis , respectively. The gene expression profiles in both P. bretschneideri and P. communis fruits suggested functional redundancy for some orthologous gene pairs derived from a common ancestry, and sub-functionalization or neo-functionalization for some of them. Our study provided the first systematic evolutionary analysis of the VQ motif-containing genes in Pyrus , and highlighted the diversification and duplication of VQ motif-containing genes in both P. bretschneideri and P. communis .
Directory of Open Access Journals (Sweden)
Denovan-Wright Eileen M
2009-09-01
Full Text Available Abstract Background In the Duplication-Degeneration-Complementation (DDC model, subfunctionalization and neofunctionalization have been proposed as important processes driving the retention of duplicated genes in the genome. These processes are thought to occur by gain or loss of regulatory elements in the promoters of duplicated genes. We tested the DDC model by determining the transcriptional induction of fatty acid-binding proteins (Fabps genes by dietary fatty acids (FAs in zebrafish. We chose zebrafish for this study for two reasons: extensive bioinformatics resources are available for zebrafish at zfin.org and zebrafish contains many duplicated genes owing to a whole genome duplication event that occurred early in the ray-finned fish lineage approximately 230-400 million years ago. Adult zebrafish were fed diets containing either fish oil (12% lipid, rich in highly unsaturated fatty acid, sunflower oil (12% lipid, rich in linoleic acid, linseed oil (12% lipid, rich in linolenic acid, or low fat (4% lipid, low fat diet for 10 weeks. FA profiles and the steady-state levels of fabp mRNA and heterogeneous nuclear RNA in intestine, liver, muscle and brain of zebrafish were determined. Result FA profiles assayed by gas chromatography differed in the intestine, brain, muscle and liver depending on diet. The steady-state level of mRNA for three sets of duplicated genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, and fabp11a/fabp11b, was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. In brain, the steady-state level of fabp7b mRNAs was induced in fish fed the linoleic acid-rich diet; in intestine, the transcript level of fabp1b.1 and fabp7b were elevated in fish fed the linolenic acid-rich diet; in liver, the level of fabp7a mRNAs was elevated in fish fed the low fat diet; and in muscle, the level of fabp7a and fabp11a mRNAs were elevated in fish fed the linolenic acid-rich or the low fat diets. In all cases
International Nuclear Information System (INIS)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-01-01
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society
Energy Technology Data Exchange (ETDEWEB)
Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles
2000-09-18
A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.
Chen, Yuan; Ding, Yun; Zhang, Zuming; Wang, Wen; Chen, Jun-Yuan; Ueno, Naoto; Mao, Bingyu
2011-12-20
The evolution of the central nervous system (CNS) is one of the most striking changes during the transition from invertebrates to vertebrates. As a major source of genetic novelties, gene duplication might play an important role in the functional innovation of vertebrate CNS. In this study, we focused on a group of CNS-biased genes that duplicated during early vertebrate evolution. We investigated the tempo-spatial expression patterns of 33 duplicate gene families and their orthologs during the embryonic development of the vertebrate Xenopus laevis and the cephalochordate Brachiostoma belcheri. Almost all the identified duplicate genes are differentially expressed in the CNS in Xenopus embryos, and more than 50% and 30% duplicate genes are expressed in the telencephalon and mid-hindbrain boundary, respectively, which are mostly considered as two innovations in the vertebrate CNS. Interestingly, more than 50% of the amphioxus orthologs do not show apparent expression in the CNS in amphioxus embryos as detected by in situ hybridization, indicating that some of the vertebrate CNS-biased duplicate genes might arise from non-CNS genes in invertebrates. Our data accentuate the functional contribution of gene duplication in the CNS evolution of vertebrate and uncover an invertebrate non-CNS history for some vertebrate CNS-biased duplicate genes. Copyright © 2011. Published by Elsevier Ltd.
Evolution dynamics of a model for gene duplication under adaptive conflict
Ancliff, Mark; Park, Jeong-Man
2014-06-01
We present and solve the dynamics of a model for gene duplication showing escape from adaptive conflict. We use a Crow-Kimura quasispecies model of evolution where the fitness landscape is a function of Hamming distances from two reference sequences, which are assumed to optimize two different gene functions, to describe the dynamics of a mixed population of individuals with single and double copies of a pleiotropic gene. The evolution equations are solved through a spin coherent state path integral, and we find two phases: one is an escape from an adaptive conflict phase, where each copy of a duplicated gene evolves toward subfunctionalization, and the other is a duplication loss of function phase, where one copy maintains its pleiotropic form and the other copy undergoes neutral mutation. The phase is determined by a competition between the fitness benefits of subfunctionalization and the greater mutational load associated with maintaining two gene copies. In the escape phase, we find a dynamics of an initial population of single gene sequences only which escape adaptive conflict through gene duplication and find that there are two time regimes: until a time t* single gene sequences dominate, and after t* double gene sequences outgrow single gene sequences. The time t* is identified as the time necessary for subfunctionalization to evolve and spread throughout the double gene sequences, and we show that there is an optimum mutation rate which minimizes this time scale.
Evolution of the vertebrate insulin receptor substrate (Irs) gene family.
Al-Salam, Ahmad; Irwin, David M
2017-06-23
Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.
Directory of Open Access Journals (Sweden)
Huang Yong
2009-11-01
Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on
Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster
Directory of Open Access Journals (Sweden)
Jakobek Judy L
2007-07-01
Full Text Available Abstract Background The biosynthesis of aflatoxin (AF involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST and O-methylsterigmatocystin (OMST, the respective penultimate and ultimate precursors of AF. Although these precursors are chemically and structurally very similar, their accumulation differs at the species level for Aspergilli. Notable examples are A. nidulans that synthesizes only ST, A. flavus that makes predominantly AF, and A. parasiticus that generally produces either AF or OMST. Whether these differences are important in the evolutionary/ecological processes of species adaptation and diversification is unknown. Equally unknown are the specific genomic mechanisms responsible for ordering and clustering of genes in the AF pathway of Aspergillus. Results To elucidate the mechanisms that have driven formation of these clusters, we performed systematic searches of aflatoxin cluster homologs across five Aspergillus genomes. We found a high level of gene duplication and identified seven modules consisting of highly correlated gene pairs (aflA/aflB, aflR/aflS, aflX/aflY, aflF/aflE, aflT/aflQ, aflC/aflW, and aflG/aflL. With the exception of A. nomius, contrasts of mean Ka/Ks values across all cluster genes showed significant differences in selective pressure between section Flavi and non-section Flavi species. A. nomius mean Ka/Ks values were more similar to partial clusters in A. fumigatus and A. terreus. Overall, mean Ka/Ks values were significantly higher for section Flavi than for non-section Flavi species. Conclusion Our results implicate several genomic mechanisms in the evolution of ST, OMST and AF cluster genes. Gene modules may arise from duplications of a single gene, whereby the function of the pre-duplication gene is retained in the copy (aflF/aflE or the copies may partition the ancestral function (aflA/aflB. In some gene modules, the
2012-01-01
Background Common carp (Cyprinus carpio) is thought to have undergone one extra round of genome duplication compared to zebrafish. Transcriptome analysis has been used to study the existence and timing of genome duplication in species for which genome sequences are incomplete. Large-scale transcriptome data for the common carp genome should help reveal the timing of the additional duplication event. Results We have sequenced the transcriptome of common carp using 454 pyrosequencing. After assembling the 454 contigs and the published common carp sequences together, we obtained 49,669 contigs and identified genes using homology searches and an ab initio method. We identified 4,651 orthologous pairs between common carp and zebrafish and found 129,984 paralogous pairs within the common carp. An estimation of the synonymous substitution rate in the orthologous pairs indicated that common carp and zebrafish diverged 120 million years ago (MYA). We identified one round of genome duplication in common carp and estimated that it had occurred 5.6 to 11.3 MYA. In zebrafish, no genome duplication event after speciation was observed, suggesting that, compared to zebrafish, common carp had undergone an additional genome duplication event. We annotated the common carp contigs with Gene Ontology terms and KEGG pathways. Compared with zebrafish gene annotations, we found that a set of biological processes and pathways were enriched in common carp. Conclusions The assembled contigs helped us to estimate the time of the fourth-round of genome duplication in common carp. The resource that we have built as part of this study will help advance functional genomics and genome annotation studies in the future. PMID:22424280
Gene Duplication Leads to Altered Membrane Topology of a Cytochrome P450 Enzyme in Seed Plants.
Renault, Hugues; De Marothy, Minttu; Jonasson, Gabriella; Lara, Patricia; Nelson, David R; Nilsson, IngMarie; André, François; von Heijne, Gunnar; Werck-Reichhart, Danièle
2017-08-01
Evolution of the phenolic metabolism was critical for the transition of plants from water to land. A cytochrome P450, CYP73, with cinnamate 4-hydroxylase (C4H) activity, catalyzes the first plant-specific and rate-limiting step in this pathway. The CYP73 gene is absent from green algae, and first detected in bryophytes. A CYP73 duplication occurred in the ancestor of seed plants and was retained in Taxaceae and most angiosperms. In spite of a clear divergence in primary sequence, both paralogs can fulfill comparable cinnamate hydroxylase roles both in vitro and in vivo. One of them seems dedicated to the biosynthesis of lignin precursors. Its N-terminus forms a single membrane spanning helix and its properties and length are highly constrained. The second is characterized by an elongated and variable N-terminus, reminiscent of ancestral CYP73s. Using as proxies the Brachypodium distachyon proteins, we show that the elongation of the N-terminus does not result in an altered subcellular localization, but in a distinct membrane topology. Insertion in the membrane of endoplasmic reticulum via a double-spanning open hairpin structure allows reorientation to the lumen of the catalytic domain of the protein. In agreement with participation to a different functional unit and supramolecular organization, the protein displays modified heme proximal surface. These data suggest the evolution of divergent C4H enzymes feeding different branches of the phenolic network in seed plants. It shows that specialization required for retention of gene duplicates may result from altered protein topology rather than change in enzyme activity. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Polytomy refinement for the correction of dubious duplications in gene trees.
Lafond, Manuel; Chauve, Cedric; Dondi, Riccardo; El-Mabrouk, Nadia
2014-09-01
Large-scale methods for inferring gene trees are error-prone. Correcting gene trees for weakly supported features often results in non-binary trees, i.e. trees with polytomies, thus raising the natural question of refining such polytomies into binary trees. A feature pointing toward potential errors in gene trees are duplications that are not supported by the presence of multiple gene copies. We introduce the problem of refining polytomies in a gene tree while minimizing the number of created non-apparent duplications in the resulting tree. We show that this problem can be described as a graph-theoretical optimization problem. We provide a bounded heuristic with guaranteed optimality for well-characterized instances. We apply our algorithm to a set of ray-finned fish gene trees from the Ensembl database to illustrate its ability to correct dubious duplications. The C++ source code for the algorithms and simulations described in the article are available at http://www-ens.iro.umontreal.ca/~lafonman/software.php. Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press.
Directory of Open Access Journals (Sweden)
Michael H. Kohn
2008-01-01
Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.
Comparative sequence analysis of nitrogen fixation-related genes in six legumes
Directory of Open Access Journals (Sweden)
Dong Hyun eKim
2013-08-01
Full Text Available Legumes play an important role as food and forage crops in international agriculture especially in developing countries. Legumes have a unique biological process called nitrogen fixation (NF by which they convert atmospheric nitrogen to ammonia. Although legume genomes have undergone polyploidization, duplication and divergence, NF-related genes, because of their essential functional role for legumes, might have remained conserved. To understand the relationship of divergence and evolutionary processes in legumes, this study analyzes orthologs and paralogs for selected 20 NF-related genes by using comparative genomic approaches in six legumes i.e. Medicago truncatula (Mt, Cicer arietinum, Lotus japonicus, Cajanus cajan (Cc, Phaseolus vulgaris (Pv and Glycine max (Gm. Subsequently, sequence distances, numbers of synonymous substitutions per synonymous site (Ks and nonsynonymous substitutions per nonsynonymous site (Ka between orthologs and paralogs were calculated and compared across legumes. These analyses suggest the closest relationship between Gm and Cc and the farthest distance between Mt and Pv in 6 legumes. Ks proportional plots clearly showed ancient genome duplication in all legumes, whole genome duplication event in Gm and also speciation pattern in different legumes. This study also reported some interesting observations e.g. no peak at Ks 0.4 in Gm-Gm, location of two independent genes next to each other in Mt and low Ks values for outparalogs for three genes as compared to other 12 genes. In summary, this study underlines the importance of NF-related genes and provides important insights in genome organization and evolutionary aspects of six legume species analyzed.
Evolutionary diversification of plant shikimate kinase gene duplicates.
Directory of Open Access Journals (Sweden)
Geoffrey Fucile
2008-12-01
Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.
Duplication and diversification of the hypoxia-inducible IGFBP-1 gene in zebrafish.
Directory of Open Access Journals (Sweden)
Hiroyasu Kamei
2008-08-01
Full Text Available Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenability to genetic and experimental manipulation and because it possess a large number of duplicated genes.We report the identification and characterization of two hypoxia-inducible genes in zebrafish that are co-ortholgs of human IGF binding protein-1 (IGFBP-1. IGFBP-1 is a secreted protein that binds to IGF and modulates IGF actions in somatic growth, development, and aging. Like their human and mouse counterparts, in adult zebrafish igfbp-1a and igfbp-1b are exclusively expressed in the liver. During embryogenesis, the two genes are expressed in overlapping spatial domains but with distinct temporal patterns. While zebrafish IGFBP-1a mRNA was easily detected throughout embryogenesis, IGFBP-1b mRNA was detectable only in advanced stages. Hypoxia induces igfbp-1a expression in early embryogenesis, but induces the igfbp-1b expression later in embryogenesis. Both IGFBP-1a and -b are capable of IGF binding, but IGFBP-1b has much lower affinities for IGF-I and -II because of greater dissociation rates. Overexpression of IGFBP-1a and -1b in zebrafish embryos caused significant decreases in growth and developmental rates. When tested in cultured zebrafish embryonic cells, IGFBP-1a and -1b both inhibited IGF-1-induced cell proliferation but the activity of IGFBP-1b was significantly weaker.These results indicate subfunction partitioning of the duplicated IGFBP-1 genes at the levels of gene expression, physiological regulation, protein structure, and biological actions. The duplicated IGFBP-1 may provide additional flexibility in fine-tuning IGF signaling activities under hypoxia and other catabolic conditions.
Shiina, Takashi; Ando, Asako; Suto, Yumiko; Kasai, Fumio; Shigenari, Atsuko; Takishima, Nobusada; Kikkawa, Eri; Iwata, Kyoko; Kuwano, Yuko; Kitamura, Yuka; Matsuzawa, Yumiko; Sano, Kazumi; Nogami, Masahiro; Kawata, Hisako; Li, Suyun; Fukuzumi, Yasuhito; Yamazaki, Masaaki; Tashiro, Hiroyuki; Tamiya, Gen; Kohda, Atsushi; Okumura, Katsuzumi; Ikemura, Toshimichi; Soeda, Eiichi; Mizuki, Nobuhisa; Kimura, Minoru; Bahram, Seiamak; Inoko, Hidetoshi
2001-01-01
Human chromosomes 1q21–q25, 6p21.3–22.2, 9q33–q34, and 19p13.1–p13.4 carry clusters of paralogous loci, to date best defined by the flagship 6p MHC region. They have presumably been created by two rounds of large-scale genomic duplications around the time of vertebrate emergence. Phylogenetically, the 1q21–25 region seems most closely related to the 6p21.3 MHC region, as it is only the MHC paralogous region that includes bona fide MHC class I genes, the CD1 and MR1 loci. Here, to clarify the genomic structure of this model MHC paralogous region as well as to gain insight into the evolutionary dynamics of the entire quadriplication process, a detailed analysis of a critical 1.7 megabase (Mb) region was performed. To this end, a composite, deep, YAC, BAC, and PAC contig encompassing all five CD1 genes and linking the centromeric +P5 locus to the telomeric KRTC7 locus was constructed. Within this contig a 1.1-Mb BAC and PAC core segment joining CD1D to FCER1A was fully sequenced and thoroughly analyzed. This led to the mapping of a total of 41 genes (12 expressed genes, 12 possibly expressed genes, and 17 pseudogenes), among which 31 were novel. The latter include 20 olfactory receptor (OR) genes, 9 of which are potentially expressed. Importantly, CD1, SPTA1, OR, and FCERIA belong to multigene families, which have paralogues in the other three regions. Furthermore, it is noteworthy that 12 of the 13 expressed genes in the 1q21–q22 region around the CD1 loci are immunologically relevant. In addition to CD1A-E, these include SPTA1, MNDA, IFI-16, AIM2, BL1A, FY and FCERIA. This functional convergence of structurally unrelated genes is reminiscent of the 6p MHC region, and perhaps represents the emergence of yet another antigen presentation gene cluster, in this case dedicated to lipid/glycolipid antigens rather than antigen-derived peptides. [The nucleotide sequence data reported in this paper have been submitted to the DDBJ, EMBL, and GenBank databases under
A salmonid EST genomic study: genes, duplications, phylogeny and microarrays
Directory of Open Access Journals (Sweden)
Brahmbhatt Sonal
2008-11-01
Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is
A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR
Energy Technology Data Exchange (ETDEWEB)
Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others
1996-07-01
Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.
Directory of Open Access Journals (Sweden)
Joana Pereira
Full Text Available The Hedgehog (Hh gene family codes for a class of secreted proteins composed of two active domains that act as signalling molecules during embryo development, namely for the development of the nervous and skeletal systems and the formation of the testis cord. While only one Hh gene is found typically in invertebrate genomes, most vertebrates species have three (Sonic hedgehog--Shh; Indian hedgehog--Ihh; and Desert hedgehog--Dhh, each with different expression patterns and functions, which likely helped promote the increasing complexity of vertebrates and their successful diversification. In this study, we used comparative genomic and adaptive evolutionary analyses to characterize the evolution of the Hh genes in vertebrates following the two major whole genome duplication (WGD events. To overcome the lack of Hh-coding sequences on avian publicly available databases, we used an extensive dataset of 45 avian and three non-avian reptilian genomes to show that birds have all three Hh paralogs. We find suggestions that following the WGD events, vertebrate Hh paralogous genes evolved independently within similar linkage groups and under different evolutionary rates, especially within the catalytic domain. The structural regions around the ion-binding site were identified to be under positive selection in the signaling domain. These findings contrast with those observed in invertebrates, where different lineages that experienced gene duplication retained similar selective constraints in the Hh orthologs. Our results provide new insights on the evolutionary history of the Hh gene family, the functional roles of these paralogs in vertebrate species, and on the location of mutational hotspots.
Pereira, Joana; Johnson, Warren E; O'Brien, Stephen J; Jarvis, Erich D; Zhang, Guojie; Gilbert, M Thomas P; Vasconcelos, Vitor; Antunes, Agostinho
2014-01-01
The Hedgehog (Hh) gene family codes for a class of secreted proteins composed of two active domains that act as signalling molecules during embryo development, namely for the development of the nervous and skeletal systems and the formation of the testis cord. While only one Hh gene is found typically in invertebrate genomes, most vertebrates species have three (Sonic hedgehog--Shh; Indian hedgehog--Ihh; and Desert hedgehog--Dhh), each with different expression patterns and functions, which likely helped promote the increasing complexity of vertebrates and their successful diversification. In this study, we used comparative genomic and adaptive evolutionary analyses to characterize the evolution of the Hh genes in vertebrates following the two major whole genome duplication (WGD) events. To overcome the lack of Hh-coding sequences on avian publicly available databases, we used an extensive dataset of 45 avian and three non-avian reptilian genomes to show that birds have all three Hh paralogs. We find suggestions that following the WGD events, vertebrate Hh paralogous genes evolved independently within similar linkage groups and under different evolutionary rates, especially within the catalytic domain. The structural regions around the ion-binding site were identified to be under positive selection in the signaling domain. These findings contrast with those observed in invertebrates, where different lineages that experienced gene duplication retained similar selective constraints in the Hh orthologs. Our results provide new insights on the evolutionary history of the Hh gene family, the functional roles of these paralogs in vertebrate species, and on the location of mutational hotspots.
The prevalence of gene duplications and their ancient origin in Rhodobacter sphaeroides 2.4.1
Directory of Open Access Journals (Sweden)
Cho Hyuk
2010-12-01
Full Text Available Abstract Background Rhodobacter sphaeroides 2.4.1 is a metabolically versatile organism that belongs to α-3 subdivision of Proteobacteria. The present study was to identify the extent, history, and role of gene duplications in R. sphaeroides 2.4.1, an organism that possesses two chromosomes. Results A protein similarity search (BLASTP identified 1247 orfs (~29.4% of the total protein coding orfs that are present in 2 or more copies, 37.5% (234 gene-pairs of which exist in duplicate copies. The distribution of the duplicate gene-pairs in all Clusters of Orthologous Groups (COGs differed significantly when compared to the COG distribution across the whole genome. Location plots revealed clusters of gene duplications that possessed the same COG classification. Phylogenetic analyses were performed to determine a tree topology predicting either a Type-A or Type-B phylogenetic relationship. A Type-A phylogenetic relationship shows that a copy of the protein-pair matches more with an ortholog from a species closely related to R. sphaeroides while a Type-B relationship predicts the highest match between both copies of the R. sphaeroides protein-pair. The results revealed that ~77% of the proteins exhibited a Type-A phylogenetic relationship demonstrating the ancient origin of these gene duplications. Additional analyses on three other strains of R. sphaeroides revealed varying levels of gene loss and retention in these strains. Also, analyses on common gene pairs among the four strains revealed that these genes experience similar functional constraints and undergo purifying selection. Conclusions Although the results suggest that the level of gene duplication in organisms with complex genome structuring (more than one chromosome seems to be not markedly different from that in organisms with only a single chromosome, these duplications may have aided in genome reorganization in this group of eubacteria prior to the formation of R. sphaeroides as gene
Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A
2010-01-01
Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.
Restriction and Recruitment—Gene Duplication and the Origin and Evolution of Snake Venom Toxins
Hargreaves, Adam D.; Swain, Martin T.; Hegarty, Matthew J.; Logan, Darren W.; Mulley, John F.
2014-01-01
Snake venom has been hypothesized to have originated and diversified through a process that involves duplication of genes encoding body proteins with subsequent recruitment of the copy to the venom gland, where natural selection acts to develop or increase toxicity. However, gene duplication is known to be a rare event in vertebrate genomes, and the recruitment of duplicated genes to a novel expression domain (neofunctionalization) is an even rarer process that requires the evolution of novel combinations of transcription factor binding sites in upstream regulatory regions. Therefore, although this hypothesis concerning the evolution of snake venom is very unlikely and should be regarded with caution, it is nonetheless often assumed to be established fact, hindering research into the true origins of snake venom toxins. To critically evaluate this hypothesis, we have generated transcriptomic data for body tissues and salivary and venom glands from five species of venomous and nonvenomous reptiles. Our comparative transcriptomic analysis of these data reveals that snake venom does not evolve through the hypothesized process of duplication and recruitment of genes encoding body proteins. Indeed, our results show that many proposed venom toxins are in fact expressed in a wide variety of body tissues, including the salivary gland of nonvenomous reptiles and that these genes have therefore been restricted to the venom gland following duplication, not recruited. Thus, snake venom evolves through the duplication and subfunctionalization of genes encoding existing salivary proteins. These results highlight the danger of the elegant and intuitive “just-so story” in evolutionary biology. PMID:25079342
Catalase/peroxidases (KatGs) are a superfamily of reactive oxygen species (ROS)-degrading enzymes believed to be horizontally acquired by ancient Ascomycota from bacteria. Subsequent gene duplication resulted in two KatG paralogs in ascomycetes: the widely distributed intracellular KatG1 group, and ...
Ascorbate peroxidase-related (APx-R) is not a duplicable gene.
Dunand, Christophe; Mathé, Catherine; Lazzarotto, Fernanda; Margis, Rogério; Margis-Pinheiro, Marcia
2011-12-01
Phylogenetic, genomic and functional analyses have allowed the identification of a new class of putative heme peroxidases, so called APx-R (APx-Related). These new class, mainly present in the green lineage (including green algae and land plants), can also be detected in other unicellular chloroplastic organisms. Except for recent polyploid organisms, only single-copy of APx-R gene was detected in each genome, suggesting that the majority of the APx-R extra-copies were lost after chromosomal or segmental duplications. In a similar way, most APx-R co-expressed genes in Arabidopsis genome do not have conserved extra-copies after chromosomal duplications and are predicted to be localized in organelles, as are the APx-R. The member of this gene network can be considered as unique gene, well conserved through the evolution due to a strong negative selection pressure and a low evolution rate. © 2011 Landes Bioscience
Gene duplication as a major force in evolution
Indian Academy of Sciences (India)
Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...
The impact of paralogy on phylogenomic studies - a case study on annelid relationships.
Directory of Open Access Journals (Sweden)
Torsten H Struck
Full Text Available Phylogenomic studies based on hundreds of genes derived from expressed sequence tags libraries are increasingly used to reveal the phylogeny of taxa. A prerequisite for these studies is the assignment of genes into clusters of orthologous sequences. Sophisticated methods of orthology prediction are used in such analyses, but it is rarely assessed whether paralogous sequences have been erroneously grouped together as orthologous sequences after the prediction, and whether this had an impact on the phylogenetic reconstruction using a super-matrix approach. Herein, I tested the impact of paralogous sequences on the reconstruction of annelid relationships based on phylogenomic datasets. Using single-partition analyses, screening for bootstrap support, blast searches and pruning of sequences in the supermatrix, wrongly assigned paralogous sequences were found in eight partitions and the placement of five taxa (the annelids Owenia, Scoloplos, Sthenelais and Eurythoe and the nemertean Cerebratulus including the robust bootstrap support could be attributed to the presence of paralogous sequences in two partitions. Excluding these sequences resulted in a different, weaker supported placement for these taxa. Moreover, the analyses revealed that paralogous sequences impacted the reconstruction when only a single taxon represented a previously supported higher taxon such as a polychaete family. One possibility of a priori detection of wrongly assigned paralogous sequences could combine 1 a screening of single-partition analyses based on criteria such as nodal support or internal branch length with 2 blast searches of suspicious cases as presented herein. Also possible are a posteriori approaches in which support for specific clades is investigated by comparing alternative hypotheses based on differences in per-site likelihoods. Increasing the sizes of EST libraries will also decrease the likelihood of wrongly assigned paralogous sequences, and in the case
On the Complexity of Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.
Kordi, Misagh; Bansal, Mukul S
2017-01-01
Duplication-Transfer-Loss (DTL) reconciliation has emerged as a powerful technique for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation takes as input a gene family phylogeny and the corresponding species phylogeny, and reconciles the two by postulating speciation, gene duplication, horizontal gene transfer, and gene loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. However, gene trees are frequently non-binary. With such non-binary gene trees, the reconciliation problem seeks to find a binary resolution of the gene tree that minimizes the reconciliation cost. Given the prevalence of non-binary gene trees, many efficient algorithms have been developed for this problem in the context of the simpler Duplication-Loss (DL) reconciliation model. Yet, no efficient algorithms exist for DTL reconciliation with non-binary gene trees and the complexity of the problem remains unknown. In this work, we resolve this open question by showing that the problem is, in fact, NP-hard. Our reduction applies to both the dated and undated formulations of DTL reconciliation. By resolving this long-standing open problem, this work will spur the development of both exact and heuristic algorithms for this important problem.
Karn, Robert C; Laukaitis, Christina M
2012-01-01
Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.
Dos Santos, Helena G; Siltberg-Liberles, Jessica
2016-09-19
One of the largest multigene families in Metazoa are the tyrosine kinases (TKs). These are important multifunctional proteins that have evolved as dynamic switches that perform tyrosine phosphorylation and other noncatalytic activities regulated by various allosteric mechanisms. TKs interact with each other and with other molecules, ultimately activating and inhibiting different signaling pathways. TKs are implicated in cancer and almost 30 FDA-approved TK inhibitors are available. However, specific binding is a challenge when targeting an active site that has been conserved in multiple protein paralogs for millions of years. A cassette domain (CD) containing SH3-SH2-Tyrosine Kinase domains reoccurs in vertebrate nonreceptor TKs. Although part of the CD function is shared between TKs, it also presents TK specific features. Here, the evolutionary dynamics of sequence, structure, and phosphorylation across the CD in 17 TK paralogs have been investigated in a large-scale study. We establish that TKs often have ortholog-specific structural disorder and phosphorylation patterns, while secondary structure elements, as expected, are highly conserved. Further, domain-specific differences are at play. Notably, we found the catalytic domain to fluctuate more in certain secondary structure elements than the regulatory domains. By elucidating how different properties evolve after gene duplications and which properties are specifically conserved within orthologs, the mechanistic understanding of protein evolution is enriched and regions supposedly critical for functional divergence across paralogs are highlighted. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Convergent evolution of gene networks by single-gene duplications in higher eukaryotes
Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich
2004-01-01
By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix–loop–helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks e...
Directory of Open Access Journals (Sweden)
Michael B Walker
Full Text Available Arrangements of genes along chromosomes are a product of evolutionary processes, and we can expect that preferable arrangements will prevail over the span of evolutionary time, often being reflected in the non-random clustering of structurally and/or functionally related genes. Such non-random arrangements can arise by two distinct evolutionary processes: duplications of DNA sequences that give rise to clusters of genes sharing both sequence similarity and common sequence features and the migration together of genes related by function, but not by common descent. To provide a background for distinguishing between the two, which is important for future efforts to unravel the evolutionary processes involved, we here provide a description of the extent to which ancestrally related genes are found in proximity.Towards this purpose, we combined information from five genomic datasets, InterPro, SCOP, PANTHER, Ensembl protein families, and Ensembl gene paralogs. The results are provided in publicly available datasets (http://cgd.jax.org/datasets/clustering/paraclustering.shtml describing the extent to which ancestrally related genes are in proximity beyond what is expected by chance (i.e. form paraclusters in the human and nine other vertebrate genomes, as well as the D. melanogaster, C. elegans, A. thaliana, and S. cerevisiae genomes. With the exception of Saccharomyces, paraclusters are a common feature of the genomes we examined. In the human genome they are estimated to include at least 22% of all protein coding genes. Paraclusters are far more prevalent among some gene families than others, are highly species or clade specific and can evolve rapidly, sometimes in response to environmental cues. Altogether, they account for a large portion of the functional clustering previously reported in several genomes.
On Computing Breakpoint Distances for Genomes with Duplicate Genes.
Shao, Mingfu; Moret, Bernard M E
2017-06-01
A fundamental problem in comparative genomics is to compute the distance between two genomes in terms of its higher level organization (given by genes or syntenic blocks). For two genomes without duplicate genes, we can easily define (and almost always efficiently compute) a variety of distance measures, but the problem is NP-hard under most models when genomes contain duplicate genes. To tackle duplicate genes, three formulations (exemplar, maximum matching, and any matching) have been proposed, all of which aim to build a matching between homologous genes so as to minimize some distance measure. Of the many distance measures, the breakpoint distance (the number of nonconserved adjacencies) was the first one to be studied and remains of significant interest because of its simplicity and model-free property. The three breakpoint distance problems corresponding to the three formulations have been widely studied. Although we provided last year a solution for the exemplar problem that runs very fast on full genomes, computing optimal solutions for the other two problems has remained challenging. In this article, we describe very fast, exact algorithms for these two problems. Our algorithms rely on a compact integer-linear program that we further simplify by developing an algorithm to remove variables, based on new results on the structure of adjacencies and matchings. Through extensive experiments using both simulations and biological data sets, we show that our algorithms run very fast (in seconds) on mammalian genomes and scale well beyond. We also apply these algorithms (as well as the classic orthology tool MSOAR) to create orthology assignment, then compare their quality in terms of both accuracy and coverage. We find that our algorithm for the "any matching" formulation significantly outperforms other methods in terms of accuracy while achieving nearly maximum coverage.
Decoding the Divergent Subcellular Location of Two Highly Similar Paralogous LEA Proteins
Directory of Open Access Journals (Sweden)
Marie-Hélène Avelange-Macherel
2018-05-01
Full Text Available Many mitochondrial proteins are synthesized as precursors in the cytosol with an N-terminal mitochondrial targeting sequence (MTS which is cleaved off upon import. Although much is known about import mechanisms and MTS structural features, the variability of MTS still hampers robust sub-cellular software predictions. Here, we took advantage of two paralogous late embryogenesis abundant proteins (LEA from Arabidopsis with different subcellular locations to investigate structural determinants of mitochondrial import and gain insight into the evolution of the LEA genes. LEA38 and LEA2 are short proteins of the LEA_3 family, which are very similar along their whole sequence, but LEA38 is targeted to mitochondria while LEA2 is cytosolic. Differences in the N-terminal protein sequences were used to generate a series of mutated LEA2 which were expressed as GFP-fusion proteins in leaf protoplasts. By combining three types of mutation (substitution, charge inversion, and segment replacement, we were able to redirect the mutated LEA2 to mitochondria. Analysis of the effect of the mutations and determination of the LEA38 MTS cleavage site highlighted important structural features within and beyond the MTS. Overall, these results provide an explanation for the likely loss of mitochondrial location after duplication of the ancestral gene.
Elusive Origins of the Extra Genes in Aspergillus oryzae
Khaldi, Nora; Wolfe, Kenneth H.
2008-01-01
The genome sequence of Aspergillus oryzae revealed unexpectedly that this species has approximately 20% more genes than its congeneric species A. nidulans and A. fumigatus. Where did these extra genes come from? Here, we evaluate several possible causes of the elevated gene number. Many gene families are expanded in A. oryzae relative to A. nidulans and A. fumigatus, but we find no evidence of ancient whole-genome duplication or other segmental duplications, either in A. oryzae or in the common ancestor of the genus Aspergillus. We show that the presence of divergent pairs of paralogs is a feature peculiar to A. oryzae and is not shared with A. nidulans or A. fumigatus. In phylogenetic trees that include paralog pairs from A. oryzae, we frequently find that one of the genes in a pair from A. oryzae has the expected orthologous relationship with A. nidulans, A. fumigatus and other species in the subphylum Eurotiomycetes, whereas the other A. oryzae gene falls outside this clade but still within the Ascomycota. We identified 456 such gene pairs in A. oryzae. Further phylogenetic analysis did not however indicate a single consistent evolutionary origin for the divergent members of these pairs. Approximately one-third of them showed phylogenies that are suggestive of horizontal gene transfer (HGT) from Sordariomycete species, and these genes are closer together in the A. oryzae genome than expected by chance, but no unique Sordariomycete donor species was identifiable. The postulated HGTs from Sordariomycetes still leave the majority of extra A. oryzae genes unaccounted for. One possible explanation for our observations is that A. oryzae might have been the recipient of many separate HGT events from diverse donors. PMID:18725939
Elusive origins of the extra genes in Aspergillus oryzae.
Directory of Open Access Journals (Sweden)
Nora Khaldi
Full Text Available The genome sequence of Aspergillus oryzae revealed unexpectedly that this species has approximately 20% more genes than its congeneric species A. nidulans and A. fumigatus. Where did these extra genes come from? Here, we evaluate several possible causes of the elevated gene number. Many gene families are expanded in A. oryzae relative to A. nidulans and A. fumigatus, but we find no evidence of ancient whole-genome duplication or other segmental duplications, either in A. oryzae or in the common ancestor of the genus Aspergillus. We show that the presence of divergent pairs of paralogs is a feature peculiar to A. oryzae and is not shared with A. nidulans or A. fumigatus. In phylogenetic trees that include paralog pairs from A. oryzae, we frequently find that one of the genes in a pair from A. oryzae has the expected orthologous relationship with A. nidulans, A. fumigatus and other species in the subphylum Eurotiomycetes, whereas the other A. oryzae gene falls outside this clade but still within the Ascomycota. We identified 456 such gene pairs in A. oryzae. Further phylogenetic analysis did not however indicate a single consistent evolutionary origin for the divergent members of these pairs. Approximately one-third of them showed phylogenies that are suggestive of horizontal gene transfer (HGT from Sordariomycete species, and these genes are closer together in the A. oryzae genome than expected by chance, but no unique Sordariomycete donor species was identifiable. The postulated HGTs from Sordariomycetes still leave the majority of extra A. oryzae genes unaccounted for. One possible explanation for our observations is that A. oryzae might have been the recipient of many separate HGT events from diverse donors.
Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C
2008-02-12
The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.
Pydiura, Nikolay; Pirko, Yaroslav; Galinousky, Dmitry; Postovoitova, Anastasiia; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav
2018-06-08
Flax (Linum usitatissimum L.) is a valuable food and fiber crop cultivated for its quality fiber and seed oil. α-, β-, γ-tubulins and actins are the main structural proteins of the cytoskeleton. α- and γ-tubulin and actin genes have not been characterized yet in the flax genome. In this study, we have identified 6 α-tubulin genes, 13 β-tubulin genes, 2 γ-tubulin genes, and 15 actin genes in the flax genome and analysed the phylogenetic relationships between flax and A. thaliana tubulin and actin genes. Six α-tubulin genes are represented by 3 paralogous pairs, among 13 β-tubulin genes 7 different isotypes can be distinguished, 6 of which are encoded by two paralogous genes each. γ-tubulin is represented by a paralogous pair of genes one of which may be not functional. Fifteen actin genes represent 7 paralogous pairs - 7 actin isotypes and a sequentially duplicated copy of one of the genes of one of the isotypes. Exon-intron structure analysis has shown intron length polymorphism within the β-tubulin genes and intron number variation among the α-tubulin gene: 3 or 4 introns are found in two or four genes, respectively. Intron positioning occurs at conservative sites, as observed in numerous other plant species. Flax actin genes show both intron length polymorphisms and variation in the number of intron that may be 2 or 3. These data will be useful to support further studies on the specificity, functioning, regulation and evolution of the flax cytoskeleton proteins. This article is protected by copyright. All rights reserved.
GENE-dosage effects on fitness in recent adaptive duplications: ace-1 in the mosquito Culex pipiens.
Labbé, Pierrick; Milesi, Pascal; Yébakima, André; Pasteur, Nicole; Weill, Mylène; Lenormand, Thomas
2014-07-01
Gene duplications have long been advocated to contribute to the evolution of new functions. The role of selection in their early spread is more controversial. Unless duplications are favored for a direct benefit of increased expression, they are likely detrimental. In this article, we investigated the case of duplications favored because they combine already functionally divergent alleles. Their gene-dosage/fitness relations are poorly known because selection may operate on both overall expression and duplicates relative dosage. Using the well-documented case of Culex pipiens resistance to insecticides, we compared strains with various ace-1 allele combinations, including two duplicated alleles carrying both susceptible and resistant copies. The overall protein activity was nearly additive, but, surprisingly, fitness correlated better with the relative proportion of susceptible and resistant copies rather than any absolute measure of activity. Gene dosage is thus crucial, duplications stabilizing a "heterozygote" phenotype. It corroborates the view that these were favored because they fix a permanent heterosis, thereby solving the irreducible trade-off between resistance and synaptic transmission. Moreover, we showed that the contrasted successes of the two duplicated alleles in natural populations depend on genetic changes unrelated to ace-1, confirming the probable implication of recessive sublethal mutations linked to structural rearrangements in some duplications. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.
STRIDE: Species Tree Root Inference from Gene Duplication Events.
Emms, David M; Kelly, Steven
2017-12-01
The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Duplication and relocation of the functional DPY19L2 gene within low copy repeats
Directory of Open Access Journals (Sweden)
Cheung Joseph
2006-03-01
Full Text Available Abstract Background Low copy repeats (LCRs are thought to play an important role in recent gene evolution, especially when they facilitate gene duplications. Duplicate genes are fundamental to adaptive evolution, providing substrates for the development of new or shared gene functions. Moreover, silencing of duplicate genes can have an indirect effect on adaptive evolution by causing genomic relocation of functional genes. These changes are theorized to have been a major factor in speciation. Results Here we present a novel example showing functional gene relocation within a LCR. We characterize the genomic structure and gene content of eight related LCRs on human Chromosomes 7 and 12. Two members of a novel transmembrane gene family, DPY19L, were identified in these regions, along with six transcribed pseudogenes. One of these genes, DPY19L2, is found on Chromosome 12 and is not syntenic with its mouse orthologue. Instead, the human locus syntenic to mouse Dpy19l2 contains a pseudogene, DPY19L2P1. This indicates that the ancestral copy of this gene has been silenced, while the descendant copy has remained active. Thus, the functional copy of this gene has been relocated to a new genomic locus. We then describe the expansion and evolution of the DPY19L gene family from a single gene found in invertebrate animals. Ancient duplications have led to multiple homologues in different lineages, with three in fish, frogs and birds and four in mammals. Conclusion Our results show that the DPY19L family has expanded throughout the vertebrate lineage and has undergone recent primate-specific evolution within LCRs.
Smith, Gilbert; Macias-Muñoz, Aide; Briscoe, Adriana D
2016-09-02
Heliconius possess a unique ability among butterflies to feed on pollen. Pollen feeding significantly extends their lifespan, and is thought to have been important to the diversification of the genus. We used RNA sequencing to examine feeding-related gene expression in the mouthparts of four species of Heliconius and one nonpollen feeding species, Eueides isabella We hypothesized that genes involved in morphology and protein metabolism might be upregulated in Heliconius because they have longer proboscides than Eueides, and because pollen contains more protein than nectar. Using de novo transcriptome assemblies, we tested these hypotheses by comparing gene expression in mouthparts against antennae and legs. We first looked for genes upregulated in mouthparts across all five species and discovered several hundred genes, many of which had functional annotations involving metabolism of proteins (cocoonase), lipids, and carbohydrates. We then looked specifically within Heliconius where we found eleven common upregulated genes with roles in morphology (CPR cuticle proteins), behavior (takeout-like), and metabolism (luciferase-like). Closer examination of these candidates revealed that cocoonase underwent several duplications along the lineage leading to heliconiine butterflies, including two Heliconius-specific duplications. Luciferase-like genes also underwent duplication within lepidopterans, and upregulation in Heliconius mouthparts. Reverse-transcription PCR confirmed that three cocoonases, a peptidase, and one luciferase-like gene are expressed in the proboscis with little to no expression in labial palps and salivary glands. Our results suggest pollen feeding, like other dietary specializations, was likely facilitated by adaptive expansions of preexisting genes-and that the butterfly proboscis is involved in digestive enzyme production. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Exact Algorithms for Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.
Kordi, Misagh; Bansal, Mukul S
2017-06-01
Duplication-Transfer-Loss (DTL) reconciliation is a powerful method for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation seeks to reconcile gene trees with species trees by postulating speciation, duplication, transfer, and loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. In practice, however, gene trees are often non-binary due to uncertainty in the gene tree topologies, and DTL reconciliation with non-binary gene trees is known to be NP-hard. In this paper, we present the first exact algorithms for DTL reconciliation with non-binary gene trees. Specifically, we (i) show that the DTL reconciliation problem for non-binary gene trees is fixed-parameter tractable in the maximum degree of the gene tree, (ii) present an exponential-time, but in-practice efficient, algorithm to track and enumerate all optimal binary resolutions of a non-binary input gene tree, and (iii) apply our algorithms to a large empirical data set of over 4700 gene trees from 100 species to study the impact of gene tree uncertainty on DTL-reconciliation and to demonstrate the applicability and utility of our algorithms. The new techniques and algorithms introduced in this paper will help biologists avoid incorrect evolutionary inferences caused by gene tree uncertainty.
Dong, Shaowei; Adams, Keith L
2011-06-01
Polyploidy has occurred throughout plant evolution and can result in considerable changes to gene expression when it takes place and over evolutionary time. Little is known about the effects of abiotic stress conditions on duplicate gene expression patterns in polyploid plants. We examined the expression patterns of 60 duplicated genes in leaves, roots and cotyledons of allotetraploid Gossypium hirsutum in response to five abiotic stress treatments (heat, cold, drought, high salt and water submersion) using single-strand conformation polymorphism assays, and 20 genes in a synthetic allotetraploid. Over 70% of the genes showed stress-induced changes in the relative expression levels of the duplicates under one or more stress treatments with frequent variability among treatments. Twelve pairs showed opposite changes in expression levels in response to different abiotic stress treatments. Stress-induced expression changes occurred in the synthetic allopolyploid, but there was little correspondence in patterns between the natural and synthetic polyploids. Our results indicate that abiotic stress conditions can have considerable effects on duplicate gene expression in a polyploid, with the effects varying by gene, stress and organ type. Differential expression in response to environmental stresses may be a factor in the preservation of some duplicated genes in polyploids. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.
Calvete, Oriol; González, Josefa; Betrán, Esther; Ruiz, Alfredo
2012-01-01
Chromosomal inversions are usually portrayed as simple two-breakpoint rearrangements changing gene order but not gene number or structure. However, increasing evidence suggests that inversion breakpoints may often have a complex structure and entail gene duplications with potential functional consequences. Here, we used a combination of different techniques to investigate the breakpoint structure and the functional consequences of a complex rearrangement fixed in Drosophila buzzatii and comprising two tandemly arranged inversions sharing the middle breakpoint: 2m and 2n. By comparing the sequence in the breakpoint regions between D. buzzatii (inverted chromosome) and D. mojavensis (noninverted chromosome), we corroborate the breakpoint reuse at the molecular level and infer that inversion 2m was associated with a duplication of a ∼13 kb segment and likely generated by staggered breaks plus repair by nonhomologous end joining. The duplicated segment contained the gene CG4673, involved in nuclear transport, and its two nested genes CG5071 and CG5079. Interestingly, we found that other than the inversion and the associated duplication, both breakpoints suffered additional rearrangements, that is, the proximal breakpoint experienced a microinversion event associated at both ends with a 121-bp long duplication that contains a promoter. As a consequence of all these different rearrangements, CG5079 has been lost from the genome, CG5071 is now a single copy nonnested gene, and CG4673 has a transcript ∼9 kb shorter and seems to have acquired a more complex gene regulation. Our results illustrate the complex effects of chromosomal rearrangements and highlight the need of complementing genomic approaches with detailed sequence-level and functional analyses of breakpoint regions if we are to fully understand genome structure, function, and evolutionary dynamics. PMID:22328714
Directory of Open Access Journals (Sweden)
Nishida Mutsumi
2007-11-01
Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.
Directory of Open Access Journals (Sweden)
Xiao-Long Wang
2015-01-01
Full Text Available The basic leucine zipper (bZIP transcription factors are the most diverse members of dimerizing transcription factors. In the present study, 50, 116, and 47 bZIP genes were identified in Malus domestica (apple, Prunus persica (peach, and Fragaria vesca (strawberry, respectively. Species-specific duplication was the main contributor to the large number of bZIPs observed in apple. After WGD in apple genome, orthologous bZIP genes corresponding to strawberry on duplicated regions in apple genome were retained. However, in peach ancestor, these syntenic regions were quickly lost or deleted. Maybe the positive selection contributed to the expansion of clade S to adapt to the development and environment stresses. In addition, purifying selection was mainly responsible for bZIP sequence-specific DNA binding. The analysis of orthologous pairs between chromosomes indicates that these orthologs derived from one gene duplication located on one of the nine ancient chromosomes in the Rosaceae. The comparative analysis of bZIP genes in three species provides information on the evolutionary fate of bZIP genes in apple and peach after they diverged from strawberry.
Structure and vascular tissue expression of duplicated TERMINAL EAR1-like paralogues in poplar.
Charon, Céline; Vivancos, Julien; Mazubert, Christelle; Paquet, Nicolas; Pilate, Gilles; Dron, Michel
2010-02-01
TERMINAL EAR1-like (TEL) genes encode putative RNA-binding proteins only found in land plants. Previous studies suggested that they may regulate tissue and organ initiation in Poaceae. Two TEL genes were identified in both Populus trichocarpa and the hybrid aspen Populus tremula x P. alba, named, respectively, PoptrTEL1-2 and PtaTEL1-2. The analysis of the organisation around the PoptrTEL genes in the P. trichocarpa genome and the estimation of the synonymous substitution rate for PtaTEL1-2 genes indicate that the paralogous link between these two Populus TEL genes probably results from the Salicoid large-scale gene-duplication event. Phylogenetic analyses confirmed their orthology link with the other TEL genes. The expression pattern of both PtaTEL genes appeared to be restricted to the mother cells of the plant body: leaf founder cells, leaf primordia, axillary buds and root differentiating tissues, as well as to mother cells of vascular tissues. Most interestingly, PtaTEL1-2 transcripts were found in differentiating cells of secondary xylem and phloem, but probably not in the cambium itself. Taken together, these results indicate specific expression of the TEL genes in differentiating cells controlling tissue and organ development in Populus (and other Angiosperm species).
Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G
2014-01-01
Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.
Directory of Open Access Journals (Sweden)
Jill C Preston
Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.
Simulating evolution of protein complexes through gene duplication and co-option.
Haarsma, Loren; Nelesen, Serita; VanAndel, Ethan; Lamine, James; VandeHaar, Peter
2016-06-21
We present a model of the evolution of protein complexes with novel functions through gene duplication, mutation, and co-option. Under a wide variety of input parameters, digital organisms evolve complexes of 2-5 bound proteins which have novel functions but whose component proteins are not independently functional. Evolution of complexes with novel functions happens more quickly as gene duplication rates increase, point mutation rates increase, protein complex functional probability increases, protein complex functional strength increases, and protein family size decreases. Evolution of complexity is inhibited when the metabolic costs of making proteins exceeds the fitness gain of having functional proteins, or when point mutation rates get so large the functional proteins undergo deleterious mutations faster than new functional complexes can evolve. Copyright © 2016 Elsevier Ltd. All rights reserved.
Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.
Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V
2016-01-01
Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.
Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.
Directory of Open Access Journals (Sweden)
Olga V Popova
Full Text Available Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida and Pycnophyes kielensis (Allomalorhagida. Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even
Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures
Directory of Open Access Journals (Sweden)
Kesterson Robert A
2003-04-01
Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.
Conservation, duplication, and loss of the Tor signaling pathway in the fungal kingdom
Directory of Open Access Journals (Sweden)
Heitman Joseph
2010-09-01
Full Text Available Abstract Background The nutrient-sensing Tor pathway governs cell growth and is conserved in nearly all eukaryotic organisms from unicellular yeasts to multicellular organisms, including humans. Tor is the target of the immunosuppressive drug rapamycin, which in complex with the prolyl isomerase FKBP12 inhibits Tor functions. Rapamycin is a gold standard drug for organ transplant recipients that was approved by the FDA in 1999 and is finding additional clinical indications as a chemotherapeutic and antiproliferative agent. Capitalizing on the plethora of recently sequenced genomes we have conducted comparative genomic studies to annotate the Tor pathway throughout the fungal kingdom and related unicellular opisthokonts, including Monosiga brevicollis, Salpingoeca rosetta, and Capsaspora owczarzaki. Results Interestingly, the Tor signaling cascade is absent in three microsporidian species with available genome sequences, the only known instance of a eukaryotic group lacking this conserved pathway. The microsporidia are obligate intracellular pathogens with highly reduced genomes, and we hypothesize that they lost the Tor pathway as they adapted and streamlined their genomes for intracellular growth in a nutrient-rich environment. Two TOR paralogs are present in several fungal species as a result of either a whole genome duplication or independent gene/segmental duplication events. One such event was identified in the amphibian pathogen Batrachochytrium dendrobatidis, a chytrid responsible for worldwide global amphibian declines and extinctions. Conclusions The repeated independent duplications of the TOR gene in the fungal kingdom might reflect selective pressure acting upon this kinase that populates two proteinaceous complexes with different cellular roles. These comparative genomic analyses illustrate the evolutionary trajectory of a central nutrient-sensing cascade that enables diverse eukaryotic organisms to respond to their natural
Findeisen, Peggy; Mühlhausen, Stefanie; Dempewolf, Silke; Hertzog, Jonny; Zietlow, Alexander; Carlomagno, Teresa; Kollmar, Martin
2014-08-27
Tubulins belong to the most abundant proteins in eukaryotes providing the backbone for many cellular substructures like the mitotic and meiotic spindles, the intracellular cytoskeletal network, and the axonemes of cilia and flagella. Homologs have even been reported for archaea and bacteria. However, a taxonomically broad and whole-genome-based analysis of the tubulin protein family has never been performed, and thus, the number of subfamilies, their taxonomic distribution, and the exact grouping of the supposed archaeal and bacterial homologs are unknown. Here, we present the analysis of 3,524 tubulins from 504 species. The tubulins formed six major subfamilies, α to ζ. Species of all major kingdoms of the eukaryotes encode members of these subfamilies implying that they must have already been present in the last common eukaryotic ancestor. The proposed archaeal homologs grouped together with the bacterial TubZ proteins as sister clade to the FtsZ proteins indicating that tubulins are unique to eukaryotes. Most species contained α- and/or β-tubulin gene duplicates resulting from recent branch- and species-specific duplication events. This shows that tubulins cannot be used for constructing species phylogenies without resolving their ortholog-paralog relationships. The many gene duplicates and also the independent loss of the δ-, ε-, or ζ-tubulins, which have been shown to be part of the triplet microtubules in basal bodies, suggest that tubulins can functionally substitute each other. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Görel Sundström
Full Text Available BACKGROUND: The opioid system is involved in reward and pain mechanisms and consists in mammals of four receptors and several peptides. The peptides are derived from four prepropeptide genes, PENK, PDYN, PNOC and POMC, encoding enkephalins, dynorphins, orphanin/nociceptin and beta-endorphin, respectively. Previously we have described how two rounds of genome doubling (2R before the origin of jawed vertebrates formed the receptor family. METHODOLOGY/PRINCIPAL FINDINGS: Opioid peptide gene family members were investigated using a combination of sequence-based phylogeny and chromosomal locations of the peptide genes in various vertebrates. Several adjacent gene families were investigated similarly. The results show that the ancestral peptide gene gave rise to two additional copies in the genome doublings. The fourth member was generated by a local gene duplication, as the genes encoding POMC and PNOC are located on the same chromosome in the chicken genome and all three teleost genomes that we have studied. A translocation has disrupted this synteny in mammals. The PDYN gene seems to have been lost in chicken, but not in zebra finch. Duplicates of some peptide genes have arisen in the teleost fishes. Within the prepropeptide precursors, peptides have been lost or gained in different lineages. CONCLUSIONS/SIGNIFICANCE: The ancestral peptide and receptor genes were located on the same chromosome and were thus duplicated concomitantly. However, subsequently genetic linkage has been lost. In conclusion, the system of opioid peptides and receptors was largely formed by the genome doublings that took place early in vertebrate evolution.
Singh, Param Priya; Arora, Jatin; Isambert, Hervé
2015-07-01
Whole genome duplications (WGD) have now been firmly established in all major eukaryotic kingdoms. In particular, all vertebrates descend from two rounds of WGDs, that occurred in their jawless ancestor some 500 MY ago. Paralogs retained from WGD, also coined 'ohnologs' after Susumu Ohno, have been shown to be typically associated with development, signaling and gene regulation. Ohnologs, which amount to about 20 to 35% of genes in the human genome, have also been shown to be prone to dominant deleterious mutations and frequently implicated in cancer and genetic diseases. Hence, identifying ohnologs is central to better understand the evolution of vertebrates and their susceptibility to genetic diseases. Early computational analyses to identify vertebrate ohnologs relied on content-based synteny comparisons between the human genome and a single invertebrate outgroup genome or within the human genome itself. These approaches are thus limited by lineage specific rearrangements in individual genomes. We report, in this study, the identification of vertebrate ohnologs based on the quantitative assessment and integration of synteny conservation between six amniote vertebrates and six invertebrate outgroups. Such a synteny comparison across multiple genomes is shown to enhance the statistical power of ohnolog identification in vertebrates compared to earlier approaches, by overcoming lineage specific genome rearrangements. Ohnolog gene families can be browsed and downloaded for three statistical confidence levels or recompiled for specific, user-defined, significance criteria at http://ohnologs.curie.fr/. In the light of the importance of WGD on the genetic makeup of vertebrates, our analysis provides a useful resource for researchers interested in gaining further insights on vertebrate evolution and genetic diseases.
Evolution of the vertebrate Pax4/6 class of genes with focus on its novel member, the Pax10 gene.
Feiner, Nathalie; Meyer, Axel; Kuraku, Shigehiro
2014-06-19
The members of the paired box (Pax) family regulate key developmental pathways in many metazoans as tissue-specific transcription factors. Vertebrate genomes typically possess nine Pax genes (Pax1-9), which are derived from four proto-Pax genes in the vertebrate ancestor that were later expanded through the so-called two-round (2R) whole-genome duplication. A recent study proposed that pax6a genes of a subset of teleost fishes (namely, acanthopterygians) are remnants of a paralog generated in the 2R genome duplication, to be renamed pax6.3, and reported one more group of vertebrate Pax genes (Pax6.2), most closely related to the Pax4/6 class. We propose to designate this new member Pax10 instead and reconstruct the evolutionary history of the Pax4/6/10 class with solid phylogenetic evidence. Our synteny analysis showed that Pax4, -6, and -10 originated in the 2R genome duplications early in vertebrate evolution. The phylogenetic analyses of relationships between teleost pax6a and other Pax4, -6, and -10 genes, however, do not support the proposed hypothesis of an ancient origin of the acanthopterygian pax6a genes in the 2R genome duplication. Instead, we confirmed the traditional scenario that the acanthopterygian pax6a is derived from the more recent teleost-specific genome duplication. Notably, Pax6 is present in all vertebrates surveyed to date, whereas Pax4 and -10 were lost multiple times in independent vertebrate lineages, likely because of their restricted expression patterns: Among Pax6-positive domains, Pax10 has retained expression in the adult retina alone, which we documented through in situ hybridization and quantitative reverse transcription polymerase chain reaction experiments on zebrafish, Xenopus, and anole lizard. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Luís Filipe Costa Castro
Full Text Available BACKGROUND: Aspartic proteases comprise a large group of enzymes involved in peptide proteolysis. This collection includes prominent enzymes globally categorized as pepsins, which are derived from pepsinogen precursors. Pepsins are involved in gastric digestion, a hallmark of vertebrate physiology. An important member among the pepsinogens is pepsinogen C (Pgc. A particular aspect of Pgc is its apparent single copy status, which contrasts with the numerous gene copies found for example in pepsinogen A (Pga. Although gene sequences with similarity to Pgc have been described in some vertebrate groups, no exhaustive evolutionary framework has been considered so far. METHODOLOGY/PRINCIPAL FINDINGS: By combining phylogenetics and genomic analysis, we find an unexpected Pgc diversity in the vertebrate sub-phylum. We were able to reconstruct gene duplication timings relative to the divergence of major vertebrate clades. Before tetrapod divergence, a single Pgc gene tandemly expanded to produce two gene lineages (Pgbc and Pgc2. These have been differentially retained in various classes. Accordingly, we find Pgc2 in sauropsids, amphibians and marsupials, but not in eutherian mammals. Pgbc was retained in amphibians, but duplicated in the ancestor of amniotes giving rise to Pgb and Pgc1. The latter was retained in mammals and probably in reptiles and marsupials but not in birds. Pgb was kept in all of the amniote clade with independent episodes of loss in some mammalian species. Lineage specific expansions of Pgc2 and Pgbc have also occurred in marsupials and amphibians respectively. We find that teleost and tetrapod Pgc genes reside in distinct genomic regions hinting at a possible translocation. CONCLUSIONS: We conclude that the repertoire of Pgc genes is larger than previously reported, and that tandem duplications have modelled the history of Pgc genes. We hypothesize that gene expansion lead to functional divergence in tetrapods, coincident with the
Microbial Evolution: Xenology (Apparently) Trumps Paralogy.
Eme, Laura; Doolittle, W Ford
2016-11-21
Within-genome gene duplication is generally considered the source of extra copies when higher dosage is required and a starting point for evolution of new function. A new study suggests that horizontal gene transfer can appear to play both roles. Copyright © 2016 Elsevier Ltd. All rights reserved.
Harding, Tommy; Roger, Andrew J.; Simpson, Alastair G. B.
2017-01-01
The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles) grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones), ion homeostasis (e.g., Na+/H+ transporter), metabolism and transport of lipids (e.g., sterol biosynthetic genes), carbohydrate metabolism (e.g., glycosidases), and signal transduction pathways (e.g., transcription factors). A significantly high proportion (43%) of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs), as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like membrane
Directory of Open Access Journals (Sweden)
Tommy Harding
2017-05-01
Full Text Available The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones, ion homeostasis (e.g., Na+/H+ transporter, metabolism and transport of lipids (e.g., sterol biosynthetic genes, carbohydrate metabolism (e.g., glycosidases, and signal transduction pathways (e.g., transcription factors. A significantly high proportion (43% of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs, as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like
Directory of Open Access Journals (Sweden)
Venkatachalam Ananda B
2012-07-01
Full Text Available Abstract Background Force, Lynch and Conery proposed the duplication-degeneration-complementation (DDC model in which partitioning of ancestral functions (subfunctionalization and acquisition of novel functions (neofunctionalization were the two primary mechanisms for the retention of duplicated genes. The DDC model was tested by analyzing the transcriptional induction of the duplicated fatty acid-binding protein (fabp genes by clofibrate in zebrafish. Clofibrate is a specific ligand of the peroxisome proliferator-activated receptor (PPAR; it activates PPAR which then binds to a peroxisome proliferator response element (PPRE to induce the transcriptional initiation of genes primarily involved in lipid homeostasis. Zebrafish was chosen as our model organism as it has many duplicated genes owing to a whole genome duplication (WGD event that occurred ~230-400 million years ago in the teleost fish lineage. We assayed the steady-state levels of fabp mRNA and heterogeneous nuclear RNA (hnRNA transcripts in liver, intestine, muscle, brain and heart for four sets of duplicated fabp genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, fabp10a/fabp10b and fabp11a/fabp11b in zebrafish fed different concentrations of clofibrate. Result Electron microscopy showed an increase in the number of peroxisomes and mitochondria in liver and heart, respectively, in zebrafish fed clofibrate. Clofibrate also increased the steady-state level of acox1 mRNA and hnRNA transcripts in different tissues, a gene with a functional PPRE. These results demonstrate that zebrafish is responsive to clofibrate, unlike some other fishes. The levels of fabp mRNA and hnRNA transcripts for the four sets of duplicated fabp genes was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. The level of hnRNA coded by a gene is an indirect estimate of the rate of transcriptional initiation of that gene. Clofibrate increased the steady-state level of fabp mRNAs and hn
Directory of Open Access Journals (Sweden)
Eichler Evan E
2008-08-01
Full Text Available Abstract Background It has been suggested that chromosomal rearrangements harbor the molecular footprint of the biological phenomena which they induce, in the form, for instance, of changes in the sequence divergence rates of linked genes. So far, all the studies of these potential associations have focused on the relationship between structural changes and the rates of evolution of single-copy DNA and have tried to exclude segmental duplications (SDs. This is paradoxical, since SDs are one of the primary forces driving the evolution of structure and function in our genomes and have been linked not only with novel genes acquiring new functions, but also with overall higher DNA sequence divergence and major chromosomal rearrangements. Results Here we take the opposite view and focus on SDs. We analyze several of the features of SDs, including the rates of intraspecific divergence between paralogous copies of human SDs and of interspecific divergence between human SDs and chimpanzee DNA. We study how divergence measures relate to chromosomal rearrangements, while considering other factors that affect evolutionary rates in single copy DNA. Conclusion We find that interspecific SD divergence behaves similarly to divergence of single-copy DNA. In contrast, old and recent paralogous copies of SDs do present different patterns of intraspecific divergence. Also, we show that some relatively recent SDs accumulate in regions that carry inversions in sister lineages.
Directory of Open Access Journals (Sweden)
Per Erixon
Full Text Available BACKGROUND: Synonymous DNA substitution rates in the plant chloroplast genome are generally relatively slow and lineage dependent. Non-synonymous rates are usually even slower due to purifying selection acting on the genes. Positive selection is expected to speed up non-synonymous substitution rates, whereas synonymous rates are expected to be unaffected. Until recently, positive selection has seldom been observed in chloroplast genes, and large-scale structural rearrangements leading to gene duplications are hitherto supposed to be rare. METHODOLOGY/PRINCIPLE FINDINGS: We found high substitution rates in the exons of the plastid clpP1 gene in Oenothera (the Evening Primrose family and three separate lineages in the tribe Sileneae (Caryophyllaceae, the Carnation family. Introns have been lost in some of the lineages, but where present, the intron sequences have substitution rates similar to those found in other introns of their genomes. The elevated substitution rates of clpP1 are associated with statistically significant whole-gene positive selection in three branches of the phylogeny. In two of the lineages we found multiple copies of the gene. Neighboring genes present in the duplicated fragments do not show signs of elevated substitution rates or positive selection. Although non-synonymous substitutions account for most of the increase in substitution rates, synonymous rates are also markedly elevated in some lineages. Whereas plant clpP1 genes experiencing negative (purifying selection are characterized by having very conserved lengths, genes under positive selection often have large insertions of more or less repetitive amino acid sequence motifs. CONCLUSIONS/SIGNIFICANCE: We found positive selection of the clpP1 gene in various plant lineages to correlated with repeated duplication of the clpP1 gene and surrounding regions, repetitive amino acid sequences, and increase in synonymous substitution rates. The present study sheds light on the
Directory of Open Access Journals (Sweden)
Choi Beom-Soon
2008-12-01
Full Text Available Abstract Background Soybean lipoxygenases (Lxs play important roles in plant resistance and in conferring the distinct bean flavor. Lxs comprise a multi-gene family that includes GmLx1, GmLx2 and GmLx3, and many of these genes have been characterized. We were interested in investigating the relationship between the soybean lipoxygenase isozymes from an evolutionary perspective, since soybean has undergone two rounds of polyploidy. Here we report the tetrad genome structure of soybean Lx regions produced by ancient and recent polyploidy. Also, comparative genomics with Medicago truncatula was performed to estimate Lxs in the common ancestor of soybean and Medicago. Results Two Lx regions in Medicago truncatula showing synteny with soybean were analyzed. Differential evolutionary rates between soybean and Medicago were observed and the median Ks values of Mt-Mt, Gm-Mt, and Gm-Gm paralogs were determined to be 0.75, 0.62, and 0.46, respectively. Thus the comparison of Gm-Mt paralogs (Ks = 0.62 and Gm-Mt orthologs (Ks = 0.45 supports the ancient duplication of Lx regions in the common ancestor prior to the Medicago-Glycine split. After speciation, no Lx regions generated by another polyploidy were identified in Medicago. Instead tandem duplication of Lx genes was observed. On the other hand, a lineage-specific duplication occurred in soybean resulting in two pairs of Lx regions. Each pair of soybean regions was co-orthologous to one Lx region in Medicago. A total of 34 Lx genes (15 MtLxs and 19 GmLxs were divided into two groups by phylogenetic analysis. Our study shows that the Lx gene family evolved from two distinct Lx genes in the most recent common ancestor. Conclusion This study analyzed two pairs of Lx regions generated by two rounds of polyploidy in soybean. Each pair of soybean homeologous regions is co-orthologous to one region of Medicago, demonstrating the quartet structure of the soybean genome. Differential evolutionary rates between
Marandel, Lucie; Panserat, Stéphane; Plagnes-Juan, Elisabeth; Arbenoits, Eva; Soengas, José Luis; Bobe, Julien
2017-05-02
Glucose-6-phosphate (G6pc) is a key enzyme involved in the regulation of the glucose homeostasis. The present study aims at revisiting and clarifying the evolutionary history of g6pc genes in vertebrates. g6pc duplications happened by successive rounds of whole genome duplication that occurred during vertebrate evolution. g6pc duplicated before or around Osteichthyes/Chondrichthyes radiation, giving rise to g6pca and g6pcb as a consequence of the second vertebrate whole genome duplication. g6pca was lost after this duplication in Sarcopterygii whereas both g6pca and g6pcb then duplicated as a consequence of the teleost-specific whole genome duplication. One g6pca duplicate was lost after this duplication in teleosts. Similarly one g6pcb2 duplicate was lost at least in the ancestor of percomorpha. The analysis of the evolution of spatial expression patterns of g6pc genes in vertebrates showed that all g6pc were mainly expressed in intestine and liver whereas teleost-specific g6pcb2 genes were mainly and surprisingly expressed in brain and heart. g6pcb2b, one gene previously hypothesised to be involved in the glucose intolerant phenotype in trout, was unexpectedly up-regulated (as it was in liver) by carbohydrates in trout telencephalon without showing significant changes in other brain regions. This up-regulation is in striking contrast with expected glucosensing mechanisms suggesting that its positive response to glucose relates to specific unknown processes in this brain area. Our results suggested that the fixation and the divergence of g6pc duplicated genes during vertebrates' evolution may lead to adaptive novelty and probably to the emergence of novel phenotypes related to glucose homeostasis.
Targeted Exon Skipping to Correct Exon Duplications in the Dystrophin Gene
Directory of Open Access Journals (Sweden)
Kane L Greer
2014-01-01
Full Text Available Duchenne muscular dystrophy is a severe muscle-wasting disease caused by mutations in the dystrophin gene that ablate functional protein expression. Although exonic deletions are the most common Duchenne muscular dystrophy lesion, duplications account for 10–15% of reported disease-causing mutations, and exon 2 is the most commonly duplicated exon. Here, we describe the in vitro evaluation of phosphorodiamidate morpholino oligomers coupled to a cell-penetrating peptide and 2′-O-methyl phosphorothioate oligonucleotides, using three distinct strategies to reframe the dystrophin transcript in patient cells carrying an exon 2 duplication. Differences in exon-skipping efficiencies in vitro were observed between oligomer analogues of the same sequence, with the phosphorodiamidate morpholino oligomer coupled to a cell-penetrating peptide proving the most effective. Differences in exon 2 excision efficiency between normal and exon 2 duplication cells, were apparent, indicating that exon context influences oligomer-induced splice switching. Skipping of a single copy of exon 2 was induced in the cells carrying an exon 2 duplication, the simplest strategy to restore the reading frame and generate a normal dystrophin transcript. In contrast, multiexon skipping of exons 2–7 to generate a Becker muscular dystrophy-like dystrophin transcript was more challenging and could only be induced efficiently with the phosphorodiamidate morpholino oligomer chemistry.
Molecular evolution of a Y chromosome to autosome gene duplication in Drosophila.
Dyer, Kelly A; White, Brooke E; Bray, Michael J; Piqué, Daniel G; Betancourt, Andrea J
2011-03-01
In contrast to the rest of the genome, the Y chromosome is restricted to males and lacks recombination. As a result, Y chromosomes are unable to respond efficiently to selection, and newly formed Y chromosomes degenerate until few genes remain. The rapid loss of genes from newly formed Y chromosomes has been well studied, but gene loss from highly degenerate Y chromosomes has only recently received attention. Here, we identify and characterize a Y to autosome duplication of the male fertility gene kl-5 that occurred during the evolution of the testacea group species of Drosophila. The duplication was likely DNA based, as other Y-linked genes remain on the Y chromosome, the locations of introns are conserved, and expression analyses suggest that regulatory elements remain linked. Genetic mapping reveals that the autosomal copy of kl-5 resides on the dot chromosome, a tiny autosome with strongly suppressed recombination. Molecular evolutionary analyses show that autosomal copies of kl-5 have reduced polymorphism and little recombination. Importantly, the rate of protein evolution of kl-5 has increased significantly in lineages where it is on the dot versus Y linked. Further analyses suggest this pattern is a consequence of relaxed purifying selection, rather than adaptive evolution. Thus, although the initial fixation of the kl-5 duplication may have been advantageous, slightly deleterious mutations have accumulated in the dot-linked copies of kl-5 faster than in the Y-linked copies. Because the dot chromosome contains seven times more genes than the Y and is exposed to selection in both males and females, these results suggest that the dot suffers the deleterious effects of genetic linkage to more selective targets compared with the Y chromosome. Thus, a highly degenerate Y chromosome may not be the worst environment in the genome, as is generally thought, but may in fact be protected from the accumulation of deleterious mutations relative to other nonrecombining
Directory of Open Access Journals (Sweden)
Chenfei Zheng
Full Text Available Complete mitochondrial (mt genome sequences with duplicate control regions (CRs have been detected in various animal species. In Testudines, duplicate mtCRs have been reported in the mtDNA of the Asian big-headed turtle, Platysternon megacephalum, which has three living subspecies. However, the evolutionary pattern of these CRs remains unclear. In this study, we report the completed sequences of duplicate CRs from 20 individuals belonging to three subspecies of this turtle and discuss the micro-evolutionary analysis of the evolution of duplicate CRs. Genetic distances calculated with MEGA 4.1 using the complete duplicate CR sequences revealed that within turtle subspecies, genetic distances between orthologous copies from different individuals were 0.63% for CR1 and 1.2% for CR2app:addword:respectively, and the average distance between paralogous copies of CR1 and CR2 was 4.8%. Phylogenetic relationships were reconstructed from the CR sequences, excluding the variable number of tandem repeats (VNTRs at the 3' end using three methods: neighbor-joining, maximum likelihood algorithm, and Bayesian inference. These data show that any two CRs within individuals were more genetically distant from orthologous genes in different individuals within the same subspecies. This suggests independent evolution of the two mtCRs within each P. megacephalum subspecies. Reconstruction of separate phylogenetic trees using different CR components (TAS, CD, CSB, and VNTRs suggested the role of recombination in the evolution of duplicate CRs. Consequently, recombination events were detected using RDP software with break points at ≈290 bp and ≈1,080 bp. Based on these results, we hypothesize that duplicate CRs in P. megacephalum originated from heterological ancestral recombination of mtDNA. Subsequent recombination could have resulted in homogenization during independent evolutionary events, thus maintaining the functions of duplicate CRs in the mtDNA of P
Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert
2009-07-01
Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.
The cellular robustness by genetic redundancy in budding yeast.
Directory of Open Access Journals (Sweden)
Jingjing Li
2010-11-01
Full Text Available The frequent dispensability of duplicated genes in budding yeast is heralded as a hallmark of genetic robustness contributed by genetic redundancy. However, theoretical predictions suggest such backup by redundancy is evolutionarily unstable, and the extent of genetic robustness contributed from redundancy remains controversial. It is anticipated that, to achieve mutual buffering, the duplicated paralogs must at least share some functional overlap. However, counter-intuitively, several recent studies reported little functional redundancy between these buffering duplicates. The large yeast genetic interactions released recently allowed us to address these issues on a genome-wide scale. We herein characterized the synthetic genetic interactions for ∼500 pairs of yeast duplicated genes originated from either whole-genome duplication (WGD or small-scale duplication (SSD events. We established that functional redundancy between duplicates is a pre-requisite and thus is highly predictive of their backup capacity. This observation was particularly pronounced with the use of a newly introduced metric in scoring functional overlap between paralogs on the basis of gene ontology annotations. Even though mutual buffering was observed to be prevalent among duplicated genes, we showed that the observed backup capacity is largely an evolutionarily transient state. The loss of backup capacity generally follows a neutral mode, with the buffering strength decreasing in proportion to divergence time, and the vast majority of the paralogs have already lost their backup capacity. These observations validated previous theoretic predictions about instability of genetic redundancy. However, departing from the general neutral mode, intriguingly, our analysis revealed the presence of natural selection in stabilizing functional overlap between SSD pairs. These selected pairs, both WGD and SSD, tend to have decelerated functional evolution, have higher propensities of co
Functional studies of heading date-related gene TaPRR73, a paralog of Ppd1 in common wheat
Directory of Open Access Journals (Sweden)
Wenping eZhang
2016-06-01
Full Text Available Photoperiod response-related genes play a crucial role in duration of the plant growth. In this study, we focused on TaPRR73, a paralog of Green Revolution gene Ppd1 (TaPRR37. We found that overexpression of the truncated TaPRR73 form lacking part of the N-terminal PR domain in transgenic rice promoted heading under long day conditions. Association analysis in common wheat verified that TaPRR73 was an important agronomic photoperiod response gene that significantly affected heading date and plant height; expression analysis proved that specific alleles of TaPRR73-A1 had highly expressed levels in earlier heading lines; the distribution of haplotypes indicated that one of these alleles had been selected in breeding programs. Our results demonstrated that TaPRR73 contributed to regulation of heading date in wheat and could be useful in wheat breeding and in broadening adaptation of the crop to new regions.
Directory of Open Access Journals (Sweden)
Taro Tsujimura
2010-12-01
Full Text Available A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC clones encompassing the two genes and identified a 0.6-kb "LWS-activating region" (LAR upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins.
Directory of Open Access Journals (Sweden)
Hsiao-Lin Hwa
2007-05-01
Conclusion: MLPA was proven to be a powerful tool for the detection of DMD gene deletions and duplications in male patients and female carriers. There was a relatively lower frequency of deletion and a higher frequency of duplication of DMD gene in this population compared to previous reports.
Differential retention of metabolic genes following whole-genome duplication.
Gout, Jean-François; Duret, Laurent; Kahn, Daniel
2009-05-01
Classical studies in Metabolic Control Theory have shown that metabolic fluxes usually exhibit little sensitivity to changes in individual enzyme activity, yet remain sensitive to global changes of all enzymes in a pathway. Therefore, little selective pressure is expected on the dosage or expression of individual metabolic genes, yet entire pathways should still be constrained. However, a direct estimate of this selective pressure had not been evaluated. Whole-genome duplications (WGDs) offer a good opportunity to address this question by analyzing the fates of metabolic genes during the massive gene losses that follow. Here, we take advantage of the successive rounds of WGD that occurred in the Paramecium lineage. We show that metabolic genes exhibit different gene retention patterns than nonmetabolic genes. Contrary to what was expected for individual genes, metabolic genes appeared more retained than other genes after the recent WGD, which was best explained by selection for gene expression operating on entire pathways. Metabolic genes also tend to be less retained when present at high copy number before WGD, contrary to other genes that show a positive correlation between gene retention and preduplication copy number. This is rationalized on the basis of the classical concave relationship relating metabolic fluxes with enzyme expression.
Horizontal gene transfer and the evolution of transcriptionalregulation in Escherichia coli
Energy Technology Data Exchange (ETDEWEB)
Price, Morgan N.; Dehal, Paramvir S.; Arkin, Adam P.
2007-12-20
Background: Most bacterial genes were acquired by horizontalgene transfer from other bacteria instead of being inherited bycontinuous vertical descent from an ancient ancestor}. To understand howthe regulation of these {acquired} genes evolved, we examined theevolutionary histories of transcription factors and of regulatoryinteractions from the model bacterium Escherichia coli K12. Results:Although most transcription factors have paralogs, these usually arose byhorizontal gene transfer rather than by duplication within the E. colilineage, as previously believed. In general, most neighbor regulators --regulators that are adjacent to genes that they regulate -- were acquiredby horizontal gene transfer, while most global regulators evolvedvertically within the gamma-Proteobacteria. Neighbor regulators wereoften acquired together with the adjacent operon that they regulate, sothe proximity might be maintained by repeated transfers (like "selfishoperons"). Many of the as-yet-uncharacterized (putative) regulators havealso been acquired together with adjacent genes, so we predict that theseare neighbor regulators as well. When we analyzed the histories ofregulatory interactions, we found that the evolution of regulation byduplication was rare, and surprisingly, many of the regulatoryinteractions that are shared between paralogs result from convergentevolution. Another surprise was that horizontally transferred genes aremore likely than other genes to be regulated by multiple regulators, andmost of this complex regulation probably evolved after the transfer.Conclusions: Our results highlight the rapid evolution of niche-specificgene regulation in bacteria.
Tracking the evolution of a cold stress associated gene family in cold tolerant grasses
DEFF Research Database (Denmark)
Sandve, Simen R; Rudi, Heidi; Asp, Torben
2008-01-01
to the repeat motifs of the IRI-domain in cold tolerant grasses. Finally we show that the LRR-domain of carrot and grass IRI proteins both share homology to an Arabidopsis thaliana LRR-trans membrane protein kinase (LRR-TPK). Conclusion The diverse IRI-like genes identified in this study tell a tale...... of a complex evolutionary history including birth of an ice binding domain, a burst of gene duplication events after cold tolerant grasses radiated from rice, protein domain structure differentiation between paralogs, and sub- and/or neofunctionalisation of IRI-like proteins. From our sequence analysis we...
Directory of Open Access Journals (Sweden)
Praveen Baskaran
Full Text Available The evolution of diversity across the animal kingdom has been accompanied by tremendous gene loss and gain. While comparative genomics has been fruitful to characterize differences in gene content across highly diverged species, little is known about the microevolution of structural variations that cause these differences in the first place. In order to investigate the genomic impact of structural variations, we made use of genomic and transcriptomic data from the nematode Pristionchus pacificus, which has been established as a satellite model to Caenorhabditis elegans for comparative biology. We exploit the fact that P. pacificus is a highly diverse species for which various genomic data including the draft genome of a sister species P. exspectatus is available. Based on resequencing coverage data for two natural isolates we identified large (> 2 kb deletions and duplications relative to the reference strain. By restriction to completely syntenic regions between P. pacificus and P. exspectatus, we were able to polarize the comparison and to assess the impact of structural variations on expression levels. We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. Further investigating expression of individual copies at sites that segregate between the duplicates, we found in the majority of cases only one of the copies to be expressed. Nevertheless, we still find that certain gene classes are strongly depleted in deletions as well as duplications, suggesting evolutionary constraint acting on synteny. In summary, our results are consistent with a model, where most structural variations are either deleterious or neutral and provide first insights into the microevolution of structural variations in the P. pacificus genome.
Annelid Distal-less/Dlx duplications reveal varied post-duplication fates
Directory of Open Access Journals (Sweden)
Korchagina Natalia
2011-08-01
Full Text Available Abstract Background Dlx (Distal-less genes have various developmental roles and are widespread throughout the animal kingdom, usually occurring as single copy genes in non-chordates and as multiple copies in most chordate genomes. While the genomic arrangement and function of these genes is well known in vertebrates and arthropods, information about Dlx genes in other organisms is scarce. We investigate the presence of Dlx genes in several annelid species and examine Dlx gene expression in the polychaete Pomatoceros lamarckii. Results Two Dlx genes are present in P. lamarckii, Capitella teleta and Helobdella robusta. The C. teleta Dlx genes are closely linked in an inverted tail-to-tail orientation, reminiscent of the arrangement of vertebrate Dlx pairs, and gene conversion appears to have had a role in their evolution. The H. robusta Dlx genes, however, are not on the same genomic scaffold and display divergent sequences, while, if the P. lamarckii genes are linked in a tail-to-tail orientation they are a minimum of 41 kilobases apart and show no sign of gene conversion. No expression in P. lamarckii appendage development has been observed, which conflicts with the supposed conserved role of these genes in animal appendage development. These Dlx duplications do not appear to be annelid-wide, as the polychaete Platynereis dumerilii likely possesses only one Dlx gene. Conclusions On the basis of the currently accepted annelid phylogeny, we hypothesise that one Dlx duplication occurred in the annelid lineage after the divergence of P. dumerilii from the other lineages and these duplicates then had varied evolutionary fates in different species. We also propose that the ancestral role of Dlx genes is not related to appendage development.
The impact of genome triplication on tandem gene evolution in Brassica rapa
Directory of Open Access Journals (Sweden)
Lu eFang
2012-11-01
Full Text Available Whole genome duplication (WGD and tandem duplication (TD are both important modes of gene expansion. However, how whole genome duplication influences tandemly duplicated genes is not well studied. We used Brassica rapa, which has undergone an additional genome triplication (WGT and shares a common ancestor with Arabidopsis thaliana, Arabidopsis lyrata and Thellungiella parvula, to investigate the impact of genome triplication on tandem gene evolution. We identified 2,137, 1,569, 1,751 and 1,135 tandem gene arrays in B. rapa, A. thaliana, A. lyrata and T. parvula respectively. Among them, 414 conserved tandem arrays are shared by the 3 species without WGT, which were also considered as existing in the diploid ancestor of B. rapa. Thus, after genome triplication, B. rapa should have 1,242 tandem arrays according to the 414 conserved tandems. Here, we found 400 out of the 414 tandems had at least one syntenic ortholog in the genome of B. rapa. Furthermore, 294 out of the 400 shared syntenic orthologs maintain tandem arrays (more than one gene for each syntenic hit in B. rapa. For the 294 tandem arrays, we obtained 426 copies of syntenic paralogous tandems in the triplicated genome of B. rapa. In this study, we demonstrated that tandem arrays in B. rapa were dramatically fractionated after WGT when compared either to non-tandem genes in the B. rapa genome or to the tandem arrays in closely related species that have not experienced a recent whole-genome polyploidization event.
Grone, Brian P; Maruska, Karen P
2015-05-01
To investigate the origins of the vertebrate stress-response system, we searched sequenced vertebrate genomes for genes resembling corticotropin-releasing hormone (CRH). We found that vertebrate genomes possess, in addition to CRH, another gene that resembles CRH in sequence and syntenic environment. This paralogous gene was previously identified only in the elephant shark (a holocephalan), but we find it also in marsupials, monotremes, lizards, turtles, birds, and fishes. We examined the relationship of this second vertebrate CRH gene, which we name CRH2, to CRH1 (previously known as CRH) and urocortin1/urotensin1 (UCN1/UTS1) in primitive fishes, teleosts, and tetrapods. The paralogs CRH1 and CRH2 likely evolved via duplication of CRH during a whole-genome duplication early in the vertebrate lineage. CRH2 was subsequently lost in both teleost fishes and eutherian mammals but retained in other lineages. To determine where CRH2 is expressed relative to CRH1 and UTS1, we used in situ hybridization on brain tissue from spotted gar (Lepisosteus oculatus), a neopterygian fish closely related to teleosts. In situ hybridization revealed widespread distribution of both crh1 and uts1 in the brain. Expression of crh2 was restricted to the putative secondary gustatory/secondary visceral nucleus, which also expressed calcitonin-related polypeptide alpha (calca), a marker of parabrachial nucleus in mammals. Thus, the evolutionary history of CRH2 includes restricted expression in the brain, sequence changes, and gene loss, likely reflecting release of selective constraints following whole-genome duplication. The discovery of CRH2 opens many new possibilities for understanding the diverse functions of the CRH family of peptides across vertebrates. © 2015 Wiley Periodicals, Inc.
Approximating the edit distance for genomes with duplicate genes under DCJ, insertion and deletion
Directory of Open Access Journals (Sweden)
Shao Mingfu
2012-12-01
Full Text Available Abstract Computing the edit distance between two genomes under certain operations is a basic problem in the study of genome evolution. The double-cut-and-join (DCJ model has formed the basis for most algorithmic research on rearrangements over the last few years. The edit distance under the DCJ model can be easily computed for genomes without duplicate genes. In this paper, we study the edit distance for genomes with duplicate genes under a model that includes DCJ operations, insertions and deletions. We prove that computing the edit distance is equivalent to finding the optimal cycle decomposition of the corresponding adjacency graph, and give an approximation algorithm with an approximation ratio of 1.5 + ∈.
Directory of Open Access Journals (Sweden)
Hélène L Citerne
Full Text Available TCP ECE genes encode transcription factors which have received much attention for their repeated recruitment in the control of floral symmetry in core eudicots, and more recently in monocots. Major duplications of TCP ECE genes have been described in core eudicots, but the evolutionary history of this gene family is unknown in basal eudicots. Reconstructing the phylogeny of ECE genes in basal eudicots will help set a framework for understanding the functional evolution of these genes. TCP ECE genes were sequenced in all major lineages of basal eudicots and Gunnera which belongs to the sister clade to all other core eudicots. We show that in these lineages they have a complex evolutionary history with repeated duplications. We estimate the timing of the two major duplications already identified in the core eudicots within a timeframe before the divergence of Gunnera and after the divergence of Proteales. We also use a synteny-based approach to examine the extent to which the expansion of TCP ECE genes in diverse eudicot lineages may be due to genome-wide duplications. The three major core-eudicot specific clades share a number of collinear genes, and their common evolutionary history may have originated at the γ event. Genomic comparisons in Arabidopsis thaliana and Solanumlycopersicum highlight their separate polyploid origin, with syntenic fragments with and without TCP ECE genes showing differential gene loss and genomic rearrangements. Comparison between recently available genomes from two basal eudicots Aquilegiacoerulea and Nelumbonucifera suggests that the two TCP ECE paralogs in these species are also derived from large-scale duplications. TCP ECE loci from basal eudicots share many features with the three main core eudicot loci, and allow us to infer the makeup of the ancestral eudicot locus.
Duplications and losses in gene families of rust pathogens highlight putative effectors.
Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M
2014-01-01
Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
Gene duplication and the evolution of hemoglobin isoform differentiation in birds.
Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F
2012-11-02
The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.
Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*
Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.
2012-01-01
The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007
Comparing genomes with rearrangements and segmental duplications.
Shao, Mingfu; Moret, Bernard M E
2015-06-15
Large-scale evolutionary events such as genomic rearrange.ments and segmental duplications form an important part of the evolution of genomes and are widely studied from both biological and computational perspectives. A basic computational problem is to infer these events in the evolutionary history for given modern genomes, a task for which many algorithms have been proposed under various constraints. Algorithms that can handle both rearrangements and content-modifying events such as duplications and losses remain few and limited in their applicability. We study the comparison of two genomes under a model including general rearrangements (through double-cut-and-join) and segmental duplications. We formulate the comparison as an optimization problem and describe an exact algorithm to solve it by using an integer linear program. We also devise a sufficient condition and an efficient algorithm to identify optimal substructures, which can simplify the problem while preserving optimality. Using the optimal substructures with the integer linear program (ILP) formulation yields a practical and exact algorithm to solve the problem. We then apply our algorithm to assign in-paralogs and orthologs (a necessary step in handling duplications) and compare its performance with that of the state-of-the-art method MSOAR, using both simulations and real data. On simulated datasets, our method outperforms MSOAR by a significant margin, and on five well-annotated species, MSOAR achieves high accuracy, yet our method performs slightly better on each of the 10 pairwise comparisons. http://lcbb.epfl.ch/softwares/coser. © The Author 2015. Published by Oxford University Press.
Finding all sorting tandem duplication random loss operations
DEFF Research Database (Denmark)
Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang
2011-01-01
A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...
Sorting by Cuts, Joins, and Whole Chromosome Duplications.
Zeira, Ron; Shamir, Ron
2017-02-01
Genome rearrangement problems have been extensively studied due to their importance in biology. Most studied models assumed a single copy per gene. However, in reality, duplicated genes are common, most notably in cancer. In this study, we make a step toward handling duplicated genes by considering a model that allows the atomic operations of cut, join, and whole chromosome duplication. Given two linear genomes, [Formula: see text] with one copy per gene and [Formula: see text] with two copies per gene, we give a linear time algorithm for computing a shortest sequence of operations transforming [Formula: see text] into [Formula: see text] such that all intermediate genomes are linear. We also show that computing an optimal sequence with fewest duplications is NP-hard.
Araud, Tanguy; Graw, Sharon; Berger, Ralph; Lee, Michael; Neveu, Estele; Bertrand, Daniel; Leonard, Sherry
2011-10-15
The human α7 neuronal nicotinic acetylcholine receptor gene (CHRNA7) is a candidate gene for schizophrenia and an important drug target for cognitive deficits in the disorder. Activation of the α7*nAChR, results in opening of the channel and entry of mono- and divalent cations, including Ca(2+), that presynaptically participates to neurotransmitter release and postsynaptically to down-stream changes in gene expression. Schizophrenic patients have low levels of α7*nAChR, as measured by binding of the ligand [(125)I]-α-bungarotoxin (I-BTX). The structure of the gene, CHRNA7, is complex. During evolution, CHRNA7 was partially duplicated as a chimeric gene (CHRFAM7A), which is expressed in the human brain and elsewhere in the body. The association between a 2bp deletion in CHRFAM7A and schizophrenia suggested that this duplicate gene might contribute to cognitive impairment. To examine the putative contribution of CHRFAM7A on receptor function, co-expression of α7 and the duplicate genes was carried out in cell lines and Xenopus oocytes. Expression of the duplicate alone yielded protein expression but no functional receptor and co-expression with α7 caused a significant reduction of the amplitude of the ACh-evoked currents. Reduced current amplitude was not correlated with a reduction of I-BTX binding, suggesting the presence of non-functional (ACh-silent) receptors. This hypothesis is supported by a larger increase of the ACh-evoked current by the allosteric modulator 1-(5-chloro-2,4-dimethoxy-phenyl)-3-(5-methyl-isoxazol-3-yl)-urea (PNU-120596) in cells expressing the duplicate than in the control. These results suggest that CHRFAM7A acts as a dominant negative modulator of CHRNA7 function and is critical for receptor regulation in humans. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Jessica B Hostetler
2016-10-01
Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.
Highly syntenic regions in the genomes of soybean, Medicago truncatula, and Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
Roe Bruce A
2005-08-01
Full Text Available Abstract Background Recent genome sequencing enables mega-base scale comparisons between related genomes. Comparisons between animals, plants, fungi, and bacteria demonstrate extensive synteny tempered by rearrangements. Within the legume plant family, glimpses of synteny have also been observed. Characterizing syntenic relationships in legumes is important in transferring knowledge from model legumes to crops that are important sources of protein, fixed nitrogen, and health-promoting compounds. Results We have uncovered two large soybean regions exhibiting synteny with M. truncatula and with a network of segmentally duplicated regions in Arabidopsis. In all, syntenic regions comprise over 500 predicted genes spanning 3 Mb. Up to 75% of soybean genes are colinear with M. truncatula, including one region in which 33 of 35 soybean predicted genes with database support are colinear to M. truncatula. In some regions, 60% of soybean genes share colinearity with a network of A. thaliana duplications. One region is especially interesting because this 500 kbp segment of soybean is syntenic to two paralogous regions in M. truncatula on different chromosomes. Phylogenetic analysis of individual genes within these regions demonstrates that one is orthologous to the soybean region, with which it also shows substantially denser synteny and significantly lower levels of synonymous nucleotide substitutions. The other M. truncatula region is inferred to be paralogous, presumably resulting from a duplication event preceding speciation. Conclusion The presence of well-defined M. truncatula segments showing orthologous and paralogous relationships with soybean allows us to explore the evolution of contiguous genomic regions in the context of ancient genome duplication and speciation events.
Dunaway, Keith W; Islam, M Saharul; Coulson, Rochelle L; Lopez, S Jesse; Vogel Ciernia, Annie; Chu, Roy G; Yasui, Dag H; Pessah, Isaac N; Lott, Paul; Mordaunt, Charles; Meguro-Horike, Makiko; Horike, Shin-Ichi; Korf, Ian; LaSalle, Janine M
2016-12-13
Rare variants enriched for functions in chromatin regulation and neuronal synapses have been linked to autism. How chromatin and DNA methylation interact with environmental exposures at synaptic genes in autism etiologies is currently unclear. Using whole-genome bisulfite sequencing in brain tissue and a neuronal cell culture model carrying a 15q11.2-q13.3 maternal duplication, we find that significant global DNA hypomethylation is enriched over autism candidate genes and affects gene expression. The cumulative effect of multiple chromosomal duplications and exposure to the pervasive persistent organic pollutant PCB 95 altered methylation of more than 1,000 genes. Hypomethylated genes were enriched for H2A.Z, increased maternal UBE3A in Dup15q corresponded to reduced levels of RING1B, and bivalently modified H2A.Z was altered by PCB 95 and duplication. These results demonstrate the compounding effects of genetic and environmental insults on the neuronal methylome that converge upon dysregulation of chromatin and synaptic genes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.
Duplications and losses in gene families of rust pathogens highlight putative effectors
Directory of Open Access Journals (Sweden)
Amanda L. Pendleton
2014-06-01
Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
Directory of Open Access Journals (Sweden)
Tong Jingou
2006-11-01
Full Text Available Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella, one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes has two co-orthologs in grass carp, and the duplication of Sox4 and Sox11 occurred before the divergence of grass carp and zebrafish, which support the "fish-specific whole-genome duplication" theory. An estimation for the origin of grass carp based on the molecular clock using Sox1, Sox3 and Sox11 genes as markers indicates that grass carp (subfamily Leuciscinae and zebrafish (subfamily Danioninae diverged approximately 60 million years ago. The potential uses of Sox genes as markers in revealing the evolutionary history of grass carp are discussed.
Indrasumunar, Arief; Wilde, Julia; Hayashi, Satomi; Li, Dongxue; Gresshoff, Peter M
2015-03-15
Association between legumes and rhizobia results in the formation of root nodules, where symbiotic nitrogen fixation occurs. The early stages of this association involve a complex of signalling events between the host and microsymbiont. Several genes dealing with early signal transduction have been cloned, and one of them encodes the leucine-rich repeat (LRR) receptor kinase (SymRK; also termed NORK). The Symbiosis Receptor Kinase gene is required by legumes to establish a root endosymbiosis with Rhizobium bacteria as well as mycorrhizal fungi. Using degenerate primer and BAC sequencing, we cloned duplicated SymRK homeologues in soybean called GmSymRKα and GmSymRKβ. These duplicated genes have high similarity of nucleotide (96%) and amino acid sequence (95%). Sequence analysis predicted a malectin-like domain within the extracellular domain of both genes. Several putative cis-acting elements were found in promoter regions of GmSymRKα and GmSymRKβ, suggesting a participation in lateral root development, cell division and peribacteroid membrane formation. The mutant of SymRK genes is not available in soybean; therefore, to know the functions of these genes, RNA interference (RNAi) of these duplicated genes was performed. For this purpose, RNAi construct of each gene was generated and introduced into the soybean genome by Agrobacterium rhizogenes-mediated hairy root transformation. RNAi of GmSymRKβ gene resulted in an increased reduction of nodulation and mycorrhizal infection than RNAi of GmSymRKα, suggesting it has the major activity of the duplicated gene pair. The results from the important crop legume soybean confirm the joint phenotypic action of GmSymRK genes in both mycorrhizal and rhizobial infection seen in model legumes. Copyright © 2015 Elsevier GmbH. All rights reserved.
Cook, R Kimberley; Deal, Megan E; Deal, Jennifer A; Garton, Russell D; Brown, C Adam; Ward, Megan E; Andrade, Rachel S; Spana, Eric P; Kaufman, Thomas C; Cook, Kevin R
2010-12-01
Interchromosomal duplications are especially important for the study of X-linked genes. Males inheriting a mutation in a vital X-linked gene cannot survive unless there is a wild-type copy of the gene duplicated elsewhere in the genome. Rescuing the lethality of an X-linked mutation with a duplication allows the mutation to be used experimentally in complementation tests and other genetic crosses and it maps the mutated gene to a defined chromosomal region. Duplications can also be used to screen for dosage-dependent enhancers and suppressors of mutant phenotypes as a way to identify genes involved in the same biological process. We describe an ongoing project in Drosophila melanogaster to generate comprehensive coverage and extensive breakpoint subdivision of the X chromosome with megabase-scale X segments borne on Y chromosomes. The in vivo method involves the creation of X inversions on attached-XY chromosomes by FLP-FRT site-specific recombination technology followed by irradiation to induce large internal X deletions. The resulting chromosomes consist of the X tip, a medial X segment placed near the tip by an inversion, and a full Y. A nested set of medial duplicated segments is derived from each inversion precursor. We have constructed a set of inversions on attached-XY chromosomes that enable us to isolate nested duplicated segments from all X regions. To date, our screens have provided a minimum of 78% X coverage with duplication breakpoints spaced a median of nine genes apart. These duplication chromosomes will be valuable resources for rescuing and mapping X-linked mutations and identifying dosage-dependent modifiers of mutant phenotypes.
Differential paralog divergence modulates genome evolution across yeast species.
Directory of Open Access Journals (Sweden)
Monica R Sanchez
2017-02-01
Full Text Available Evolutionary outcomes depend not only on the selective forces acting upon a species, but also on the genetic background. However, large timescales and uncertain historical selection pressures can make it difficult to discern such important background differences between species. Experimental evolution is one tool to compare evolutionary potential of known genotypes in a controlled environment. Here we utilized a highly reproducible evolutionary adaptation in Saccharomyces cerevisiae to investigate whether experimental evolution of other yeast species would select for similar adaptive mutations. We evolved populations of S. cerevisiae, S. paradoxus, S. mikatae, S. uvarum, and interspecific hybrids between S. uvarum and S. cerevisiae for ~200-500 generations in sulfate-limited continuous culture. Wild-type S. cerevisiae cultures invariably amplify the high affinity sulfate transporter gene, SUL1. However, while amplification of the SUL1 locus was detected in S. paradoxus and S. mikatae populations, S. uvarum cultures instead selected for amplification of the paralog, SUL2. We measured the relative fitness of strains bearing deletions and amplifications of both SUL genes from different species, confirming that, converse to S. cerevisiae, S. uvarum SUL2 contributes more to fitness in sulfate limitation than S. uvarum SUL1. By measuring the fitness and gene expression of chimeric promoter-ORF constructs, we were able to delineate the cause of this differential fitness effect primarily to the promoter of S. uvarum SUL1. Our data show evidence of differential sub-functionalization among the sulfate transporters across Saccharomyces species through recent changes in noncoding sequence. Furthermore, these results show a clear example of how such background differences due to paralog divergence can drive changes in genome evolution.
Gene duplication and fragmentation in the zebra finch major histocompatibility complex.
Balakrishnan, Christopher N; Ekblom, Robert; Völker, Martin; Westerdahl, Helena; Godinez, Ricardo; Kotkiewicz, Holly; Burt, David W; Graves, Tina; Griffin, Darren K; Warren, Wesley C; Edwards, Scott V
2010-04-01
Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC) has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC) sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH) evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving chromosomal fission, gene duplication and translocation in the
Gene duplication and fragmentation in the zebra finch major histocompatibility complex
Directory of Open Access Journals (Sweden)
Burt David W
2010-04-01
Full Text Available Abstract Background Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. Results The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. Conclusion The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving
North Carolina macular dystrophy (MCDR1) caused by a novel tandem duplication of the PRDM13 gene.
Bowne, Sara J; Sullivan, Lori S; Wheaton, Dianna K; Locke, Kirsten G; Jones, Kaylie D; Koboldt, Daniel C; Fulton, Robert S; Wilson, Richard K; Blanton, Susan H; Birch, David G; Daiger, Stephen P
2016-01-01
To identify the underlying cause of disease in a large family with North Carolina macular dystrophy (NCMD). A large four-generation family (RFS355) with an autosomal dominant form of NCMD was ascertained. Family members underwent comprehensive visual function evaluations. Blood or saliva from six affected family members and three unaffected spouses was collected and DNA tested for linkage to the MCDR1 locus on chromosome 6q12. Three affected family members and two unaffected spouses underwent whole exome sequencing (WES) and subsequently, custom capture of the linkage region followed by next-generation sequencing (NGS). Standard PCR and dideoxy sequencing were used to further characterize the mutation. Of the 12 eyes examined in six affected individuals, all but two had Gass grade 3 macular degeneration features. Large central excavation of the retinal and choroid layers, referred to as a macular caldera, was seen in an age-independent manner in the grade 3 eyes. The calderas are unique to affected individuals with MCDR1. Genome-wide linkage mapping and haplotype analysis of markers from the chromosome 6q region were consistent with linkage to the MCDR1 locus. Whole exome sequencing and custom-capture NGS failed to reveal any rare coding variants segregating with the phenotype. Analysis of the custom-capture NGS sequencing data for copy number variants uncovered a tandem duplication of approximately 60 kb on chromosome 6q. This region contains two genes, CCNC and PRDM13 . The duplication creates a partial copy of CCNC and a complete copy of PRDM13 . The duplication was found in all affected members of the family and is not present in any unaffected members. The duplication was not seen in 200 ethnically matched normal chromosomes. The cause of disease in the original family with MCDR1 and several others has been recently reported to be dysregulation of the PRDM13 gene, caused by either single base substitutions in a DNase 1 hypersensitive site upstream of the CCNC
A gene duplication led to specialized gamma-aminobutyrate and beta-alanine aminotransferase in yeast
DEFF Research Database (Denmark)
Andersen, Gorm; Andersen, Birgit; Dobritzsch, D.
2007-01-01
and related yeasts have two different genes/enzymes to apparently 'distinguish' between the two reactions in a single cell. It is likely that upon duplication similar to 200 million years ago, a specialized Uga1p evolved into a 'novel' transaminase enzyme with broader substrate specificity.......In humans, beta-alanine (BAL) and the neurotransmitter gamma-aminobutyrate (GABA) are transaminated by a single aminotransferase enzyme. Apparently, yeast originally also had a single enzyme, but the corresponding gene was duplicated in the Saccharomyces kluyveri lineage. SkUGA1 encodes a homologue...... to characterize the substrate specificity and kinetic parameters of the four enzymes. It was found that the cofactor pyridoxal 5'-phosphate is needed for enzymatic activity and alpha-ketoglutarate, and not pyruvate, as the amino group acceptor. SkPyd4p preferentially uses BAL as the amino group donor (V...
DEFF Research Database (Denmark)
Kristensen, Lone Krøldrup; Kjaergaard, S; Kirchhoff, Marianne
2012-01-01
with muscular hypertrophy and mildly retarded psychomotor development. Array-CGH identified a small duplication of 7q36.3 including the Sonic Hedgehog (SHH) gene in both the aborted foetus and the live born male sib. Neither of the parents carried the 7q36.3 duplication. The consequences of overexpression...
Nývltová, Eva; Šuták, Robert; Harant, Karel; Šedinová, Miroslava; Hrdy, Ivan; Paces, Jan; Vlček, Čestmír; Tachezy, Jan
2013-04-30
In most eukaryotes, the mitochondrion is the main organelle for the formation of iron-sulfur (FeS) clusters. This function is mediated through the iron-sulfur cluster assembly machinery, which was inherited from the α-proteobacterial ancestor of mitochondria. In Archamoebae, including pathogenic Entamoeba histolytica and free-living Mastigamoeba balamuthi, the complex iron-sulfur cluster machinery has been replaced by an ε-proteobacterial nitrogen fixation (NIF) system consisting of two components: NifS (cysteine desulfurase) and NifU (scaffold protein). However, the cellular localization of the NIF system and the involvement of mitochondria in archamoebal FeS assembly are controversial. Here, we show that the genes for both NIF components are duplicated within the M. balamuthi genome. One paralog of each protein contains an amino-terminal extension that targets proteins to mitochondria (NifS-M and NifU-M), and the second paralog lacks a targeting signal, thereby reflecting the cytosolic form of the NIF machinery (NifS-C and NifU-C). The dual localization of the NIF system corresponds to the presence of FeS proteins in both cellular compartments, including detectable hydrogenase activity in Mastigamoeba cytosol and mitochondria. In contrast, E. histolytica possesses only single genes encoding NifS and NifU, respectively, and there is no evidence for the presence of the NIF machinery in its reduced mitochondria. Thus, M. balamuthi is unique among eukaryotes in that its FeS cluster formation is mediated through two most likely independent NIF machineries present in two cellular compartments.
International Nuclear Information System (INIS)
Essouissi, Imen
2006-01-01
Mental Retardation (MR) is the most frequent handicap. It touches 3% of the general population. The genetic causes of this handicap account for 40% of these cases. ARX gene (Aristaless related homeobox gene) belongs to the family of the genes homeobox located in Xp22.1. It is considered as the most frequently muted gene after the FMR1 gene. It is implicated in various forms of syndromic and nonsyndromic MR. Several types of mutation were identified on the level of this gene, including deletions/insertions, duplications, missense and nonsense mutations, responsible for a wide spectrum of phenotypes. The goal of this work is to seek the most frequent change of gene ARX: duplication 24pb (at the origin of an expansion of the field poly has protein ARX in the position 144-155AA) among Tunisian boys presenting in particular family forms of non specific MR, sporadic forms of non specific MR like certain patients presenting a West syndrome.To prove the duplication of 24 Pb, we used in this work the Pcr technique. The change of duplication 24pb was not found in our series, this could be explained by the low number of cases family studied (38 families) and by the absence of connection studies accusing a mode of transmission related to X chromosome in particular for the sporadic cases. (Author)
Bekpen, Cemalettin; Künzel, Sven; Xie, Chen; Eaaswarkhanth, Muthukrishnan; Lin, Yen-Lung; Gokcumen, Omer; Akdis, Cezmi A; Tautz, Diethard
2017-03-06
Segmental duplications are an abundant source for novel gene functions and evolutionary adaptations. This mechanism of generating novelty was very active during the evolution of primates particularly in the human lineage. Here, we characterize the evolution and function of the SPATA31 gene family (former designation FAM75A), which was previously shown to be among the gene families with the strongest signal of positive selection in hominoids. The mouse homologue for this gene family is a single copy gene expressed during spermatogenesis. We show that in primates, the SPATA31 gene duplicated into SPATA31A and SPATA31C types and broadened the expression into many tissues. Each type became further segmentally duplicated in the line towards humans with the largest number of full-length copies found for SPATA31A in humans. Copy number estimates of SPATA31A based on digital PCR show an average of 7.5 with a range of 5-11 copies per diploid genome among human individuals. The primate SPATA31 genes also acquired new protein domains that suggest an involvement in UV response and DNA repair. We generated antibodies and show that the protein is re-localized from the nucleolus to the whole nucleus upon UV-irradiation suggesting a UV damage response. We used CRISPR/Cas mediated mutagenesis to knockout copies of the gene in human primary fibroblast cells. We find that cell lines with reduced functional copies as well as naturally occurring low copy number HFF cells show enhanced sensitivity towards UV-irradiation. The acquisition of new SPATA31 protein functions and its broadening of expression may be related to the evolution of the diurnal life style in primates that required a higher UV tolerance. The increased segmental duplications in hominoids as well as its fast evolution suggest the acquisition of further specific functions particularly in humans.
Assogba, Benoît S; Djogbénou, Luc S; Milesi, Pascal; Berthomieu, Arnaud; Perez, Julie; Ayala, Diego; Chandre, Fabrice; Makoutodé, Michel; Labbé, Pierrick; Weill, Mylène
2015-10-05
Widespread resistance to pyrethroids threatens malaria control in Africa. Consequently, several countries switched to carbamates and organophophates insecticides for indoor residual spraying. However, a mutation in the ace-1 gene conferring resistance to these compounds (ace-1(R) allele), is already present. Furthermore, a duplicated allele (ace-1(D)) recently appeared; characterizing its selective advantage is mandatory to evaluate the threat. Our data revealed that a unique duplication event, pairing a susceptible and a resistant copy of the ace-1 gene spread through West Africa. Further investigations revealed that, while ace-1(D) confers less resistance than ace-1(R), the high fitness cost associated with ace-1(R) is almost completely suppressed by the duplication for all traits studied. ace-1 duplication thus represents a permanent heterozygote phenotype, selected, and thus spreading, due to the mosaic nature of mosquito control. It provides malaria mosquito with a new evolutionary path that could hamper resistance management.
An enhanced method for sequence walking and paralog mining: TOPO® Vector-Ligation PCR
Directory of Open Access Journals (Sweden)
Davis Thomas M
2010-03-01
Full Text Available Abstract Background Although technological advances allow for the economical acquisition of whole genome sequences, many organisms' genomes remain unsequenced, and fully sequenced genomes may contain gaps. Researchers reliant upon partial genomic or heterologous sequence information require methods for obtaining unknown sequences from loci of interest. Various PCR based techniques are available for sequence walking - i.e., the acquisition of unknown DNA sequence adjacent to known sequence. Many such methods require rigid, elaborate protocols and/or impose narrowly confined options in the choice of restriction enzymes for necessary genomic digests. We describe a new method, TOPO® Vector-Ligation PCR (or TVL-PCR that innovatively integrates available tools and familiar concepts to offer advantages as a means of both targeted sequence walking and paralog mining. Findings TVL-PCR exploits the ligation efficiency of the pCR®4-TOPO® (Invitrogen, Carlsbad, California vector system to capture fragments of unknown sequence by creating chimeric molecules containing defined priming sites at both ends. Initially, restriction enzyme-digested genomic DNA is end-repaired to create 3' adenosine overhangs and is then ligated to pCR4-TOPO vectors. The ligation product pool is used directly as a template for nested PCR, using specific primers to target orthologous sequences, or degenerate primers to enable capture of paralogous gene family members. We demonstrated the efficacy of this method by capturing entire coding and partial promoter sequences of several strawberry Superman-like genes. Conclusions TVL-PCR is a convenient and efficient method for DNA sequence walking and paralog mining that is applicable to any organism for which relevant DNA sequence is available as a basis for primer design.
A strong deletion bias in nonallelic gene conversion.
Directory of Open Access Journals (Sweden)
Raquel Assis
Full Text Available Gene conversion is the unidirectional transfer of genetic information between orthologous (allelic or paralogous (nonallelic genomic segments. Though a number of studies have examined nucleotide replacements, little is known about length difference mutations produced by gene conversion. Here, we investigate insertions and deletions produced by nonallelic gene conversion in 338 Drosophila and 10,149 primate paralogs. Using a direct phylogenetic approach, we identify 179 insertions and 614 deletions in Drosophila paralogs, and 132 insertions and 455 deletions in primate paralogs. Thus, nonallelic gene conversion is strongly deletion-biased in both lineages, with almost 3.5 times as many conversion-induced deletions as insertions. In primates, the deletion bias is considerably stronger for long indels and, in both lineages, the per-site rate of gene conversion is orders of magnitudes higher than that of ordinary mutation. Due to this high rate, deletion-biased nonallelic gene conversion plays a key role in genome size evolution, leading to the cooperative shrinkage and eventual disappearance of selectively neutral paralogs.
Directory of Open Access Journals (Sweden)
Capra Valeria
2012-10-01
Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.
Wentz, Elisabet; Vujic, Mihailo; Kärrstedt, Ewa-Lotta; Erlandsson, Anna; Gillberg, Christopher
2014-05-01
Autism spectrum disorder, severe behaviour problems and duplication of the Xq12 to Xq13 region have recently been described in three male relatives. To describe the psychiatric comorbidity and dysmorphic features, including craniosynostosis, of two male siblings with autism and duplication of the Xq13 to Xq21 region, and attempt to narrow down the number of duplicated genes proposed to be leading to global developmental delay and autism. We performed DNA sequencing of certain exons of the TWIST1 gene, the FGFR2 gene and the FGFR3 gene. We also performed microarray analysis of the DNA. In addition to autism, the two male siblings exhibited severe learning disability, self-injurious behaviour, temper tantrums and hyperactivity, and had no communicative language. Chromosomal analyses were normal. Neither of the two siblings showed mutations of the sequenced exons known to produce craniosynostosis. The microarray analysis detected an extra copy of a region on the long arm of chromosome X, chromosome band Xq13.1-q21.1. Comparison of our two cases with previously described patients allowed us to identify three genes predisposing for autism in the duplicated chromosomal region. Sagittal craniosynostosis is also a new finding linked to the duplication.
Singh, Sangeeta; Chand, Suresh; Singh, N. K.; Sharma, Tilak Raj
2015-01-01
The resistance (R) genes and defense response (DR) genes have become very important resources for the development of disease resistant cultivars. In the present investigation, genome-wide identification, expression, phylogenetic and synteny analysis was done for R and DR-genes across three species of rice viz: Oryza sativa ssp indica cv 93-11, Oryza sativa ssp japonica and wild rice species, Oryza brachyantha. We used the in silico approach to identify and map 786 R -genes and 167 DR-genes, 672 R-genes and 142 DR-genes, 251 R-genes and 86 DR-genes in the japonica, indica and O. brachyanth a genomes, respectively. Our analysis showed that 60.5% and 55.6% of the R-genes are tandemly repeated within clusters and distributed over all the rice chromosomes in indica and japonica genomes, respectively. The phylogenetic analysis along with motif distribution shows high degree of conservation of R- and DR-genes in clusters. In silico expression analysis of R-genes and DR-genes showed more than 85% were expressed genes showing corresponding EST matches in the databases. This study gave special emphasis on mechanisms of gene evolution and duplication for R and DR genes across species. Analysis of paralogs across rice species indicated 17% and 4.38% R-genes, 29% and 11.63% DR-genes duplication in indica and Oryza brachyantha, as compared to 20% and 26% duplication of R-genes and DR-genes in japonica respectively. We found that during the course of duplication only 9.5% of R- and DR-genes changed their function and rest of the genes have maintained their identity. Syntenic relationship across three genomes inferred that more orthology is shared between indica and japonica genomes as compared to brachyantha genome. Genome wide identification of R-genes and DR-genes in the rice genome will help in allele mining and functional validation of these genes, and to understand molecular mechanism of disease resistance and their evolution in rice and related species. PMID:25902056
Marandel, Lucie; Seiliez, Iban; Véron, Vincent; Skiba-Cassy, Sandrine; Panserat, Stéphane
2015-07-01
The rainbow trout (Oncorhynchus mykiss) is considered to be a strictly carnivorous fish species that is metabolically adapted for high catabolism of proteins and low utilization of dietary carbohydrates. This species consequently has a "glucose-intolerant" phenotype manifested by persistent hyperglycemia when fed a high-carbohydrate diet. Gluconeogenesis in adult fish is also poorly, if ever, regulated by carbohydrates, suggesting that this metabolic pathway is involved in this specific phenotype. In this study, we hypothesized that the fate of duplicated genes after the salmonid-specific 4th whole genome duplication (Ss4R) may have led to adaptive innovation and that their study might provide new elements to enhance our understanding of gluconeogenesis and poor dietary carbohydrate use in this species. Our evolutionary analysis of gluconeogenic genes revealed that pck1, pck2, fbp1a, and g6pca were retained as singletons after Ss4r, while g6pcb1, g6pcb2, and fbp1b ohnolog pairs were maintained. For all genes, duplication may have led to sub- or neofunctionalization. Expression profiles suggest that the gluconeogenesis pathway remained active in trout fed a no-carbohydrate diet. When trout were fed a high-carbohydrate diet (30%), most of the gluconeogenic genes were non- or downregulated, except for g6pbc2 ohnologs, whose RNA levels were surprisingly increased. This study demonstrates that Ss4R in trout involved adaptive innovation via gene duplication and via the outcome of the resulting ohnologs. Indeed, maintenance of ohnologous g6pcb2 pair may contribute in a significant way to the glucose-intolerant phenotype of trout and may partially explain its poor use of dietary carbohydrates. Copyright © 2015 the American Physiological Society.
Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba
2016-02-01
Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith
2016-01-01
Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well
Chen, Y; Solursh, M
1995-10-01
The Msx-1 gene (formerly known as Hox-7) is a member of a discrete subclass of homeobox-containing genes. Examination of the expression pattern of Msx-1 in murine and avian embryos suggests that this gene may be involved in the regionalization of the medio-lateral axis during earlier development. We have examined the possible functions of Xenopus Msx-1 during early Xenopus embryonic development by overexpression of the Msx-1 gene. Overexpression of Msx-1 causes a left-right mirror-image duplication of primary axial structures, including notochord, neural tube, somites, suckers, and foregut. The embryonic developing heart is also mirror-image duplicated, including looping directions and polarity. These results indicate that Msx-1 may be involved in the mesoderm formation as well as left-right patterning in the early Xenopus embryonic development.
Genome sequence and genetic diversity of European ash trees
DEFF Research Database (Denmark)
Sollars, Elizabeth S A; Harper, Andrea L; Kelly, Laura J
2017-01-01
-heterozygosity Fraxinus excelsior tree from Gloucestershire, UK, annotating 38,852 protein-coding genes of which 25% appear ash specific when compared with the genomes of ten other plant species. Analyses of paralogous genes suggest a whole-genome duplication shared with olive (Olea europaea, Oleaceae). We also re...
Hypertension and Biliary Ductopenia in a Patient with Duplication of Exon 6 of the Gene
Directory of Open Access Journals (Sweden)
J. Uberos
2012-01-01
Full Text Available We describe a neonatal patient with biliary ductopenia featuring duplication of exon 6 of the JAG1 gene. Facial alterations were observed, consisting of a prominent forehead, sunken eyes, upward slanting palpebral fissures, hypertelorism, flat nasal root and prominent chin. From birth, these were accompanied by the development of haematuria and renal failure and by renal Doppler findings indicative of peripheral renal artery stenosis. JAG1 gene mutations on chromosome 20 have been associated with various anomalies, including biliary cholestasis, vertebral abnormalities, eye disorders, heart defects and facial dysmorphia. This syndrome, first described by Alagille, is an infrequent congenital disorder caused by a dominant autosomal inheritance with variable expressivity. Anatomopathological effects include the destruction and disappearance of hepatic bile ducts (ductopenia. The duplication of exon 6 of JAG1 has not previously been described as an alteration related to the Alagille syndrome with peripheral renal artery stenosis.
Directory of Open Access Journals (Sweden)
Xin Yin
2017-07-01
Full Text Available The calcineurin B-like protein (CBL–CBL-interacting protein kinase (CIPK complex has been identified as a primary component in calcium sensors that perceives various stress signals. Turnip (Brassica rapa var. rapa has been widely cultivated in the Qinghai–Tibet Plateau for a century as a food crop of worldwide economic significance. These CBL–CIPK complexes have been demonstrated to play crucial roles in plant response to various environmental stresses. However, no report is available on the genome-wide characterization of these two gene families in turnip. In the present study, 19 and 51 members of the BrrCBL and BrrCIPK genes, respectively, are first identified in turnip and phylogenetically grouped into three and two distinct clusters, respectively. The expansion of these two gene families is mainly attributable to segmental duplication. Moreover, the differences in expression patterns in quantitative real-time PCR, as well as interaction profiles in the yeast two-hybrid assay, suggest the functional divergence of paralog genes during long-term evolution in turnip. Overexpressing and complement lines in Arabidopsis reveal that BrrCBL9.2 improves, but BrrCBL9.1 does not affect, salt tolerance in Arabidopsis. Thus, the expansion of the BrrCBL and BrrCIPK gene families enables the functional differentiation and evolution of some new gene functions of paralog genes. These paralog genes then play prominent roles in turnip's adaptation to the adverse environment of the Qinghai–Tibet Plateau. Overall, the study results contribute to our understanding of the functions of the CBL–CIPK complex and provide basis for selecting appropriate genes for the in-depth functional studies of BrrCBL–BrrCIPK in turnip.
Expansion and contraction of the DUP240 multigene family in Saccharomyces cerevisiae populations.
Leh-Louis, Véronique; Wirth, Bénédicte; Potier, Serge; Souciet, Jean-Luc; Despons, Laurence
2004-01-01
The influence of duplicated sequences on chromosomal stability is poorly understood. To characterize chromosomal rearrangements involving duplicated sequences, we compared the organization of tandem repeats of the DUP240 gene family in 15 Saccharomyces cerevisiae strains of various origins. The DUP240 gene family consists of 10 members of unknown function in the reference strain S288C. Five DUP240 paralogs on chromosome I and two on chromosome VII are arranged as tandem repeats that are highl...
Gouran, Hossein; Chakraborty, Sandeep; Rao, Basuthkar J; Asgeirsson, Bjarni; Dandekar, Abhaya
2014-01-01
Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC), implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF). In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.
Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.
2016-01-01
The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025
Wang, Yong; Yang, Jiang Ke; Lee, On On; Li, Tie Gang; Al-Suwailem, Abdulaziz M.; Danchin, Antoine; Qian, Pei-Yuan
2011-01-01
The complexity and dynamics of microbial metagenomes may be evaluated by genome size, gene duplication and the disruption rate between lineages. In this study, we pyrosequenced the metagenomes of microbes obtained from the brine and sediment of a deep-sea brine pool in the Red Sea to explore the possible genomic adaptations of the microbes in response to environmental changes. The microbes from the brine and sediments (both surface and deep layers) of the Atlantis II Deep brine pool had similar communities whereas the effective genome size varied from 7.4 Mb in the brine to more than 9 Mb in the sediment. This genome expansion in the sediment samples was due to gene duplication as evidenced by enrichment of the homologs. The duplicated genes were highly disrupted, on average by 47.6% and 70% for the surface and deep layers of the Atlantis II Deep sediment samples, respectively. The disruptive effects appeared to be mainly due to point mutations and frameshifts. In contrast, the homologs from the Atlantis II Deep brine sample were highly conserved and they maintained relatively small copy numbers. Likely, the adaptation of the microbes in the sediments was coupled with pseudogenizations and possibly functional diversifications of the paralogs in the expanded genomes. The maintenance of the pseudogenes in the large genomes is discussed. © 2011 Wang et al.
Wang, Yong
2011-12-21
The complexity and dynamics of microbial metagenomes may be evaluated by genome size, gene duplication and the disruption rate between lineages. In this study, we pyrosequenced the metagenomes of microbes obtained from the brine and sediment of a deep-sea brine pool in the Red Sea to explore the possible genomic adaptations of the microbes in response to environmental changes. The microbes from the brine and sediments (both surface and deep layers) of the Atlantis II Deep brine pool had similar communities whereas the effective genome size varied from 7.4 Mb in the brine to more than 9 Mb in the sediment. This genome expansion in the sediment samples was due to gene duplication as evidenced by enrichment of the homologs. The duplicated genes were highly disrupted, on average by 47.6% and 70% for the surface and deep layers of the Atlantis II Deep sediment samples, respectively. The disruptive effects appeared to be mainly due to point mutations and frameshifts. In contrast, the homologs from the Atlantis II Deep brine sample were highly conserved and they maintained relatively small copy numbers. Likely, the adaptation of the microbes in the sediments was coupled with pseudogenizations and possibly functional diversifications of the paralogs in the expanded genomes. The maintenance of the pseudogenes in the large genomes is discussed. © 2011 Wang et al.
Directory of Open Access Journals (Sweden)
Yong Wang
Full Text Available The complexity and dynamics of microbial metagenomes may be evaluated by genome size, gene duplication and the disruption rate between lineages. In this study, we pyrosequenced the metagenomes of microbes obtained from the brine and sediment of a deep-sea brine pool in the Red Sea to explore the possible genomic adaptations of the microbes in response to environmental changes. The microbes from the brine and sediments (both surface and deep layers of the Atlantis II Deep brine pool had similar communities whereas the effective genome size varied from 7.4 Mb in the brine to more than 9 Mb in the sediment. This genome expansion in the sediment samples was due to gene duplication as evidenced by enrichment of the homologs. The duplicated genes were highly disrupted, on average by 47.6% and 70% for the surface and deep layers of the Atlantis II Deep sediment samples, respectively. The disruptive effects appeared to be mainly due to point mutations and frameshifts. In contrast, the homologs from the Atlantis II Deep brine sample were highly conserved and they maintained relatively small copy numbers. Likely, the adaptation of the microbes in the sediments was coupled with pseudogenizations and possibly functional diversifications of the paralogs in the expanded genomes. The maintenance of the pseudogenes in the large genomes is discussed.
Directory of Open Access Journals (Sweden)
Paul D Thomas
Full Text Available A recent paper (Nehrt et al., PLoS Comput. Biol. 7:e1002073, 2011 has proposed a metric for the "functional similarity" between two genes that uses only the Gene Ontology (GO annotations directly derived from published experimental results. Applying this metric, the authors concluded that paralogous genes within the mouse genome or the human genome are more functionally similar on average than orthologous genes between these genomes, an unexpected result with broad implications if true. We suggest, based on both theoretical and empirical considerations, that this proposed metric should not be interpreted as a functional similarity, and therefore cannot be used to support any conclusions about the "ortholog conjecture" (or, more properly, the "ortholog functional conservation hypothesis". First, we reexamine the case studies presented by Nehrt et al. as examples of orthologs with divergent functions, and come to a very different conclusion: they actually exemplify how GO annotations for orthologous genes provide complementary information about conserved biological functions. We then show that there is a global ascertainment bias in the experiment-based GO annotations for human and mouse genes: particular types of experiments tend to be performed in different model organisms. We conclude that the reported statistical differences in annotations between pairs of orthologous genes do not reflect differences in biological function, but rather complementarity in experimental approaches. Our results underscore two general considerations for researchers proposing novel types of analysis based on the GO: 1 that GO annotations are often incomplete, potentially in a biased manner, and subject to an "open world assumption" (absence of an annotation does not imply absence of a function, and 2 that conclusions drawn from a novel, large-scale GO analysis should whenever possible be supported by careful, in-depth examination of examples, to help ensure the
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy
Directory of Open Access Journals (Sweden)
Muhammad I. Ullah
2017-12-01
Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
Roles of ATR1 paralogs YMR279c and YOR378w in boron stress tolerance
International Nuclear Information System (INIS)
Bozdag, Gonensin Ozan; Uluisik, Irem; Gulculer, Gulce Sila; Karakaya, Huseyin C.; Koc, Ahmet
2011-01-01
Highlights: → ATR1 paralog YMR279c plays role in boron detoxification. → YMR279c overexpression lowers cytoplasmic boron levels. → ATR1 paralog YOR378w has no roles in boron stress response. -- Abstract: Boron is a necessary nutrient for plants and animals, however excess of it causes toxicity. Previously, Atr1 and Arabidopsis Bor1 homolog were identified as the boron efflux pump in yeast, which lower the cytosolic boron concentration and help cells to survive in the presence of toxic amount of boron. In this study, we analyzed ATR1 paralogs, YMR279c and YOR378w, to understand whether they participate in boron stress tolerance in yeast. Even though these genes share homology with ATR1, neither their deletion rendered cells boron sensitive nor their expression was significantly upregulated by boron treatment. However, expression of YMR279, but not YOR378w, from the constitutive GAPDH promoter on a high copy plasmid provided remarkable boron resistance by decreasing intracellular boron levels. Thus our results suggest the presence of a third boron exporter, YMR279c, which functions similar to ATR1 and provides boron resistance in yeast.
Directory of Open Access Journals (Sweden)
V.L. Quadros
2006-07-01
Full Text Available Calves born persistently infected with non-cytopathic bovine viral diarrhea virus (ncpBVDV frequently develop a fatal gastroenteric illness called mucosal disease. Both the original virus (ncpBVDV and an antigenically identical but cytopathic virus (cpBVDV can be isolated from animals affected by mucosal disease. Cytopathic BVDVs originate from their ncp counterparts by diverse genetic mechanisms, all leading to the expression of the non-structural polypeptide NS3 as a discrete protein. In contrast, ncpBVDVs express only the large precursor polypeptide, NS2-3, which contains the NS3 sequence within its carboxy-terminal half. We report here the investigation of the mechanism leading to NS3 expression in 41 cpBVDV isolates. An RT-PCR strategy was employed to detect RNA insertions within the NS2-3 gene and/or duplication of the NS3 gene, two common mechanisms of NS3 expression. RT-PCR amplification revealed insertions in the NS2-3 gene of three cp isolates, with the inserts being similar in size to that present in the cpBVDV NADL strain. Sequencing of one such insert revealed a 296-nucleotide sequence with a central core of 270 nucleotides coding for an amino acid sequence highly homologous (98% to the NADL insert, a sequence corresponding to part of the cellular J-Domain gene. One cpBVDV isolate contained a duplication of the NS3 gene downstream from the original locus. In contrast, no detectable NS2-3 insertions or NS3 gene duplications were observed in the genome of 37 cp isolates. These results demonstrate that processing of NS2-3 without bulk mRNA insertions or NS3 gene duplications seems to be a frequent mechanism leading to NS3 expression and BVDV cytopathology.
Dose effect of the uvsA+ gene product in duplication strains of Aspergillus nidulans
International Nuclear Information System (INIS)
Majerfeld, I.H.; Roper, J.A.
1978-01-01
Strains of Aspergillus nidulans which carry a particular segment of chromosome I in duplicate - one segment in normal position, the other translocated to chromosome II - are more resistant to uv light than are strains with a balanced haploid genome. A double dose of the uvsA + allele, carried on the duplicate segment, determines this enhanced resistance; this is shown by the descending order of resistance of duplication haploids uvsA + /uvsA + , uvsA1/uvsA + and uvsA1/uvsA1. An unbalanced diploid with three doses of the uvsA + allele also shows greater resistance than a balanced uvsA + //uvsA + diploid. However, in balanced diploids the uvsA1 allele appears to be completely recessive; uvsA + //uvsA + and uvsA + //uvsA1 diploids produce indistinguishable survival curves after uv irradiation. Thus, the uvsA + gene product is not rate-limiting in repair processes in strains with a balanced genome. The rate-limiting effect observed in these unbalanced strains presumably reflects an interaction of the uvsA + product and other functions determined by the rest of the genome. Duplication haploids and normal haploids lose photorepairable lesions at similar rates. This observation may be interpreted to indicate that differences in survival are not due to differences in the efficiency of excision of uv-induced pyrimidime dimers
2012-01-01
Background The APOBEC3 (A3) genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals) already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure. PMID:22640020
Directory of Open Access Journals (Sweden)
Palmer Jeffrey D
2006-09-01
Full Text Available Abstract Background Horizontal gene transfer (HGT to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts, where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and
Rice, Danny W; Palmer, Jeffrey D
2006-01-01
Background Horizontal gene transfer (HGT) to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts), where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and cryptophyte plastids to the
Function of Rad51 paralogs in eukaryotic homologous recombinational repair
International Nuclear Information System (INIS)
Liu, N.; Skowronek, K.
2003-01-01
Full text: Homologous recombinational repair (HRR) is an important mechanism for maintaining genetic integrity and cancer prevention by accurately repair of DNA double strand breaks induced by environmental insults or occurred in DNA replication. A critical step in HRR is the polymerization of Rad51 on single stranded DNA to form nuclear protein filaments, the later conduct DNA strand paring and exchange between homologous strands. A number of proteins, including replication protein A (RPA), Rad52 and Rad51 paralogs, are suggested to modulate or facilitate the process of Rad51 filament formation. Five Rad51 paralogs, namely XRCC2, XRCC3, Rad51B, Rad51C and Rad51D have been identified in eucaryotic cells. These proteins show distant protein sequence identity to Rad51, to yeast Rad51 paralogs (Rad55 and Rad57) and to each other. Hamster or chicken mutants of Rad51 paralogs exhibit hypersensitivity to a variety of DNA damaging agents, especially cross-linking agents, and are defective in assembly of Rad51 onto HRR site after DNA damage. Recent data from our and other labs showed that Rad51 paralogs constitute two distinct complexes in cell extracts, one contains XRCC2, Rad51B, Rad51C and Rad51D, and the other contains Rad51C and XRCC3. Rad51C is involved in both complexes. Our results also showed that XRCC3-Rad51C complex interacts with Rad51 in vivo. Furthermore, overexpression of Rad52 can partially suppress the hypersensitivity of XRCC2 mutant irs1 to ionizing radiation and corrected the defects in Rad51 focus formation. These results suggest that XRCC2 and other Rad51 paralogs play a mediator function to Rad51 in the early stage of HRR
Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke
2016-01-01
Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under
A conserved segmental duplication within ELA.
Brinkmeyer-Langford, C L; Murphy, W J; Childers, C P; Skow, L C
2010-12-01
The assembled genomic sequence of the horse major histocompatibility complex (MHC) (equine lymphocyte antigen, ELA) is very similar to the homologous human HLA, with the notable exception of a large segmental duplication at the boundary of ELA class I and class III that is absent in HLA. The segmental duplication consists of a ∼ 710 kb region of at least 11 repeated blocks: 10 blocks each contain an MHC class I-like sequence and the helicase domain portion of a BAT1-like sequence, and the remaining unit contains the full-length BAT1 gene. Similar genomic features were found in other Perissodactyls, indicating an ancient origin, which is consistent with phylogenetic analyses. Reverse-transcriptase PCR (RT-PCR) of mRNA from peripheral white blood cells of healthy and chronically or acutely infected horses detected transcription from predicted open reading frames in several of the duplicated blocks. This duplication is not present in the sequenced MHCs of most other mammals, although a similar feature at the same relative position is present in the feline MHC (FLA). Striking sequence conservation throughout Perissodactyl evolution is consistent with a functional role for at least some of the genes included within this segmental duplication. © 2010 The Authors, Journal compilation © 2010 Stichting International Foundation for Animal Genetics.
Rapid duplication and loss of nbs-encoding genes in eurosids II
International Nuclear Information System (INIS)
Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.
2015-01-01
Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)
Directory of Open Access Journals (Sweden)
Xiaoli Jin
2017-06-01
Full Text Available NAC (NAM/ATAF/CUC proteins constitute one of the biggest plant-specific transcription factor (TF families and have crucial roles in diverse developmental programs during plant growth. Phylogenetic analyses have revealed both conserved and lineage-specific NAC subfamilies, among which various origins and distinct features were observed. It is reasonable to hypothesize that there should be divergent evolutionary patterns of NAC TFs both between dicots and monocots, and among NAC subfamilies. In this study, we compared the gene duplication and loss, evolutionary rate, and selective pattern among non-lineage specific NAC subfamilies, as well as those between dicots and monocots, through genome-wide analyses of sequence and functional data in six dicot and five grass lineages. The number of genes gained in the dicot lineages was much larger than that in the grass lineages, while fewer gene losses were observed in the grass than that in the dicots. We revealed (1 uneven constitution of Clusters of Orthologous Groups (COGs and contrasting birth/death rates among subfamilies, and (2 two distinct evolutionary scenarios of NAC TFs between dicots and grasses. Our results demonstrated that relaxed selection, resulting from concerted gene duplications, may have permitted substitutions responsible for functional divergence of NAC genes into new lineages. The underlying mechanism of distinct evolutionary fates of NAC TFs shed lights on how evolutionary divergence contributes to differences in establishing NAC gene subfamilies and thus impacts the distinct features between dicots and grasses.
Directory of Open Access Journals (Sweden)
Jenny U Johansson
2008-11-01
Full Text Available Alternative splicing is an evolutionary innovation to create functionally diverse proteins from a limited number of genes. SNAP-25 plays a central role in neuroexocytosis by bridging synaptic vesicles to the plasma membrane during regulated exocytosis. The SNAP-25 polypeptide is encoded by a single copy gene, but in higher vertebrates a duplication of exon 5 has resulted in two mutually exclusive splice variants, SNAP-25a and SNAP-25b. To address a potential physiological difference between the two SNAP-25 proteins, we generated gene targeted SNAP-25b deficient mouse mutants by replacing the SNAP-25b specific exon with a second SNAP-25a equivalent. Elimination of SNAP-25b expression resulted in developmental defects, spontaneous seizures, and impaired short-term synaptic plasticity. In adult mutants, morphological changes in hippocampus and drastically altered neuropeptide expression were accompanied by severe impairment of spatial learning. We conclude that the ancient exon duplication in the Snap25 gene provides additional SNAP-25-function required for complex neuronal processes in higher eukaryotes.
Suthanthiram, Backiyarani; Subbaraya, Uma; Marimuthu Somasundram, Saraswathi; Muthu, Mayilvaganan
2016-01-01
The WRKY family of transcription factors orchestrate the reprogrammed expression of the complex network of defense genes at various biotic and abiotic stresses. Within the last 96 million years, three rounds of Musa polyploidization events had occurred from selective pressure causing duplication of MusaWRKYs with new activities. Here, we identified a total of 153 WRKY transcription factors available from the DH Pahang genome. Based on their phylogenetic relationship, the MusaWRKYs available with complete gene sequence were classified into the seven common WRKY sub-groups. Synteny analyses data revealed paralogous relationships, with 17 MusaWRKY gene pairs originating from the duplication events that had occurred within the Musa lineage. We also found 15 other MusaWRKY gene pairs originating from much older duplication events that had occurred along Arecales and Poales lineage of commelinids. Based on the synonymous and nonsynonymous substitution rates, the fate of duplicated MusaWRKY genes was predicted to have undergone sub-functionalization in which the duplicated gene copies retain a subset of the ancestral gene function. Also, to understand the regulatory roles of MusaWRKY during a biotic stress, Illumina sequencing was performed on resistant and susceptible cultivars during the infection of root lesion nematode, Pratylenchus coffeae. The differential WRKY gene expression analysis in nematode resistant and susceptible cultivars during challenged and unchallenged conditions had distinguished: 1) MusaWRKYs participating in general banana defense mechanism against P.coffeae common to both susceptible and resistant cultivars, 2) MusaWRKYs that may aid in the pathogen survival as suppressors of plant triggered immunity, 3) MusaWRKYs that may aid in the host defense as activators of plant triggered immunity and 4) cultivar specific MusaWRKY regulation. Mainly, MusaWRKY52, -69 and -92 are found to be P.coffeae specific and can act as activators or repressors in a
Directory of Open Access Journals (Sweden)
Raja Kaliyappan
Full Text Available The WRKY family of transcription factors orchestrate the reprogrammed expression of the complex network of defense genes at various biotic and abiotic stresses. Within the last 96 million years, three rounds of Musa polyploidization events had occurred from selective pressure causing duplication of MusaWRKYs with new activities. Here, we identified a total of 153 WRKY transcription factors available from the DH Pahang genome. Based on their phylogenetic relationship, the MusaWRKYs available with complete gene sequence were classified into the seven common WRKY sub-groups. Synteny analyses data revealed paralogous relationships, with 17 MusaWRKY gene pairs originating from the duplication events that had occurred within the Musa lineage. We also found 15 other MusaWRKY gene pairs originating from much older duplication events that had occurred along Arecales and Poales lineage of commelinids. Based on the synonymous and nonsynonymous substitution rates, the fate of duplicated MusaWRKY genes was predicted to have undergone sub-functionalization in which the duplicated gene copies retain a subset of the ancestral gene function. Also, to understand the regulatory roles of MusaWRKY during a biotic stress, Illumina sequencing was performed on resistant and susceptible cultivars during the infection of root lesion nematode, Pratylenchus coffeae. The differential WRKY gene expression analysis in nematode resistant and susceptible cultivars during challenged and unchallenged conditions had distinguished: 1 MusaWRKYs participating in general banana defense mechanism against P.coffeae common to both susceptible and resistant cultivars, 2 MusaWRKYs that may aid in the pathogen survival as suppressors of plant triggered immunity, 3 MusaWRKYs that may aid in the host defense as activators of plant triggered immunity and 4 cultivar specific MusaWRKY regulation. Mainly, MusaWRKY52, -69 and -92 are found to be P.coffeae specific and can act as activators or
Assessing duplication and loss of APETALA1/FRUITFULL homologs in Ranunculales
Pabón-Mora, Natalia; Hidalgo, Oriane; Gleissberg, Stefan; Litt, Amy
2013-01-01
Gene duplication and loss provide raw material for evolutionary change within organismal lineages as functional diversification of gene copies provide a mechanism for phenotypic variation. Here we focus on the APETALA1/FRUITFULL MADS-box gene lineage evolution. AP1/FUL genes are angiosperm-specific and have undergone several duplications. By far the most significant one is the core-eudicot duplication resulting in the euAP1 and euFUL clades. Functional characterization of several euAP1 and euFUL genes has shown that both function in proper floral meristem identity, and axillary meristem repression. Independently, euAP1 genes function in floral meristem and sepal identity, whereas euFUL genes control phase transition, cauline leaf growth, compound leaf morphogenesis and fruit development. Significant functional variation has been detected in the function of pre-duplication basal-eudicot FUL-like genes, but the underlying mechanisms for change have not been identified. FUL-like genes in the Papaveraceae encode all functions reported for euAP1 and euFUL genes, whereas FUL-like genes in Aquilegia (Ranunculaceae) function in inflorescence development and leaf complexity, but not in flower or fruit development. Here we isolated FUL-like genes across the Ranunculales and used phylogenetic approaches to analyze their evolutionary history. We identified an early duplication resulting in the RanFL1 and RanFL2 clades. RanFL1 genes were present in all the families sampled and are mostly under strong negative selection in the MADS, I and K domains. RanFL2 genes were only identified from Eupteleaceae, Papaveraceae s.l., Menispermaceae and Ranunculaceae and show relaxed purifying selection at the I and K domains. We discuss how asymmetric sequence diversification, new motifs, differences in codon substitutions and likely protein-protein interactions resulting from this Ranunculiid-specific duplication can help explain the functional differences among basal-eudicot FUL-like genes
Directory of Open Access Journals (Sweden)
Koch Marcus A
2009-04-01
Full Text Available Abstract Background Positive selection is recognized as the prevalence of nonsynonymous over synonymous substitutions in a gene. Models of the functional evolution of duplicated genes consider neofunctionalization as key to the retention of paralogues. For instance, duplicate transcription factors are specifically retained in plant and animal genomes and both positive selection and transcriptional divergence appear to have played a role in their diversification. However, the relative impact of these two factors has not been systematically evaluated. Class B MADS-box genes, comprising DEF-like and GLO-like genes, encode developmental transcription factors essential for establishment of perianth and male organ identity in the flowers of angiosperms. Here, we contrast the role of positive selection and the known divergence in expression patterns of genes encoding class B-like MADS-box transcription factors from monocots, with emphasis on the family Orchidaceae and the order Poales. Although in the monocots these two groups are highly diverse and have a strongly canalized floral morphology, there is no information on the role of positive selection in the evolution of their distinctive flower morphologies. Published research shows that in Poales, class B-like genes are expressed in stamens and in lodicules, the perianth organs whose identity might also be specified by class B-like genes, like the identity of the inner tepals of their lily-like relatives. In orchids, however, the number and pattern of expression of class B-like genes have greatly diverged. Results The DEF-like genes from Orchidaceae form four well-supported, ancient clades of orthologues. In contrast, orchid GLO-like genes form a single clade of ancient orthologues and recent paralogues. DEF-like genes from orchid clade 2 (OMADS3-like genes are under less stringent purifying selection than the other orchid DEF-like and GLO-like genes. In comparison with orchids, purifying selection
The Sequence and Analysis of Duplication Rich Human Chromosome 16
Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.
2004-01-01
We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.
The sequence and analysis of duplication rich human chromosome 16
Energy Technology Data Exchange (ETDEWEB)
Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.
2004-08-01
We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.
Characterization of the past and current duplication activities in the human 22q11.2 region
Directory of Open Access Journals (Sweden)
Morrow Bernice
2011-01-01
Full Text Available Abstract Background Segmental duplications (SDs on 22q11.2 (LCR22, serve as substrates for meiotic non-allelic homologous recombination (NAHR events resulting in several clinically significant genomic disorders. Results To understand the duplication activity leading to the complicated SD structure of this region, we have applied the A-Bruijn graph algorithm to decompose the 22q11.2 SDs to 523 fundamental duplication sequences, termed subunits. Cross-species syntenic analysis of primate genomes demonstrates that many of these LCR22 subunits emerged very recently, especially those implicated in human genomic disorders. Some subunits have expanded more actively than others, and young Alu SINEs, are associated much more frequently with duplicated sequences that have undergone active expansion, confirming their role in mediating recombination events. Many copy number variations (CNVs exist on 22q11.2, some flanked by SDs. Interestingly, two chromosome breakpoints for 13 CNVs (mean length 65 kb are located in paralogous subunits, providing direct evidence that SD subunits could contribute to CNV formation. Sequence analysis of PACs or BACs identified extra CNVs, specifically, 10 insertions and 18 deletions within 22q11.2; four were more than 10 kb in size and most contained young AluYs at their breakpoints. Conclusions Our study indicates that AluYs are implicated in the past and current duplication events, and moreover suggests that DNA rearrangements in 22q11.2 genomic disorders perhaps do not occur randomly but involve both actively expanded duplication subunits and Alu elements.
The hidden duplication past of the plant pathogen Phytophthora and its consequences for infection
Directory of Open Access Journals (Sweden)
Martens Cindy
2010-06-01
Full Text Available Abstract Background Oomycetes of the genus Phytophthora are pathogens that infect a wide range of plant species. For dicot hosts such as tomato, potato and soybean, Phytophthora is even the most important pathogen. Previous analyses of Phytophthora genomes uncovered many genes, large gene families and large genome sizes that can partially be explained by significant repeat expansion patterns. Results Analysis of the complete genomes of three different Phytophthora species, using a newly developed approach, unveiled a large number of small duplicated blocks, mainly consisting of two or three consecutive genes. Further analysis of these duplicated genes and comparison with the known gene and genome duplication history of ten other eukaryotes including parasites, algae, plants, fungi, vertebrates and invertebrates, suggests that the ancestor of P. infestans, P. sojae and P. ramorum most likely underwent a whole genome duplication (WGD. Genes that have survived in duplicate are mainly genes that are known to be preferentially retained following WGDs, but also genes important for pathogenicity and infection of the different hosts seem to have been retained in excess. As a result, the WGD might have contributed to the evolutionary and pathogenic success of Phytophthora. Conclusions The fact that we find many small blocks of duplicated genes indicates that the genomes of Phytophthora species have been heavily rearranged following the WGD. Most likely, the high repeat content in these genomes have played an important role in this rearrangement process. As a consequence, the paucity of retained larger duplicated blocks has greatly complicated previous attempts to detect remnants of a large-scale duplication event in Phytophthora. However, as we show here, our newly developed strategy to identify very small duplicated blocks might be a useful approach to uncover ancient polyploidy events, in particular for heavily rearranged genomes.
Sato, Yukuto; Tsukamoto, Katsumi; Nishida, Mutsumi
2015-01-01
Whole-genome duplication (WGD) is believed to be a significant source of major evolutionary innovation. Redundant genes resulting from WGD are thought to be lost or acquire new functions. However, the rates of gene loss and thus temporal process of genome reshaping after WGD remain unclear. The WGD shared by all teleost fish, one-half of all jawed vertebrates, was more recent than the two ancient WGDs that occurred before the origin of jawed vertebrates, and thus lends itself to analysis of gene loss and genome reshaping. Using a newly developed orthology identification pipeline, we inferred the post–teleost-specific WGD evolutionary histories of 6,892 protein-coding genes from nine phylogenetically representative teleost genomes on a time-calibrated tree. We found that rapid gene loss did occur in the first 60 My, with a loss of more than 70–80% of duplicated genes, and produced similar genomic gene arrangements within teleosts in that relatively short time. Mathematical modeling suggests that rapid gene loss occurred mainly by events involving simultaneous loss of multiple genes. We found that the subsequent 250 My were characterized by slow and steady loss of individual genes. Our pipeline also identified about 1,100 shared single-copy genes that are inferred to have become singletons before the divergence of clupeocephalan teleosts. Therefore, our comparative genome analysis suggests that rapid gene loss just after the WGD reshaped teleost genomes before the major divergence, and provides a useful set of marker genes for future phylogenetic analysis. PMID:26578810
Czech Academy of Sciences Publication Activity Database
Stenger, B.L.S.; Clark, M.E.; Kváč, Martin; Khan, E.; Giddings, C.W.; Dyer, N.W.; Schultz, J.L.; McEvoy, J.M.
2015-01-01
Roč. 32, JUN 2015 (2015), s. 113-123 ISSN 1567-1348 R&D Projects: GA MŠk(CZ) LH11061 Institutional support: RVO:60077344 Keywords : Cryptosporidium * Paralogy * 18S rRNA * 18S rDNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 2.591, year: 2015
Paralogs hnRNP L and hnRNP LL exhibit overlapping but distinct RNA binding constraints.
Directory of Open Access Journals (Sweden)
Sarah A Smith
Full Text Available HnRNP (heterogeneous nuclear ribonucleoprotein proteins are a large family of RNA-binding proteins that regulate numerous aspects of RNA processing. Interestingly, several paralogous pairs of hnRNPs exist that exhibit similar RNA-binding specificity to one another, yet have non-redundant functional targets in vivo. In this study we systematically investigate the possibility that the paralogs hnRNP L and hnRNP LL have distinct RNA binding determinants that may underlie their lack of functional redundancy. Using a combination of RNAcompete and native gel analysis we find that while both hnRNP L and hnRNP LL preferentially bind sequences that contain repeated CA dinucleotides, these proteins differ in their requirement for the spacing of the CAs. Specifically, hnRNP LL has a more stringent requirement for a two nucleotide space between CA repeats than does hnRNP L, resulting in hnRNP L binding more promiscuously than does hnRNP LL. Importantly, this differential requirement for the spacing of CA dinucleotides explains the previously observed differences in the sensitivity of hnRNP L and LL to mutations within the CD45 gene. We suggest that overlapping but divergent RNA-binding preferences, as we show here for hnRNP L and hnRNP LL, may be commonplace among other hnRNP paralogs.
A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome
Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de
2012-01-01
De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH
Nahas, John V; Iosue, Christine L; Shaik, Noor F; Selhorst, Kathleen; He, Bin Z; Wykoff, Dennis D
2018-05-10
Convergent evolution is often due to selective pressures generating a similar phenotype. We observe relatively recent duplications in a spectrum of Saccharomycetaceae yeast species resulting in multiple phosphatases that are regulated by different nutrient conditions - thiamine and phosphate starvation. This specialization is both transcriptional and at the level of phosphatase substrate specificity. In Candida glabrata , loss of the ancestral phosphatase family was compensated by the co-option of a different histidine phosphatase family with three paralogs. Using RNA-seq and functional assays, we identify one of these paralogs, CgPMU3 , as a thiamine phosphatase. We further determine that the 81% identical paralog CgPMU2 does not encode thiamine phosphatase activity; however, both are capable of cleaving the phosphatase substrate, 1-napthyl-phosphate. We functionally demonstrate that members of this family evolved novel enzymatic functions for phosphate and thiamine starvation, and are regulated transcriptionally by either nutrient condition, and observe similar trends in other yeast species. This independent, parallel evolution involving two different families of histidine phosphatases suggests that there were likely similar selective pressures on multiple yeast species to recycle thiamine and phosphate. In this work, we focused on duplication and specialization, but there is also repeated loss of phosphatases, indicating that the expansion and contraction of the phosphatase family is dynamic in many Ascomycetes. The dynamic evolution of the phosphatase gene families is perhaps just one example of how gene duplication, co-option, and transcriptional and functional specialization together allow species to adapt to their environment with existing genetic resources. Copyright © 2018, G3: Genes, Genomes, Genetics.
International Nuclear Information System (INIS)
Veelen, Lieneke R. van; Essers, Jeroen; Rakt, Mandy W.M.M. van de; Odijk, Hanny; Pastink, Albert; Zdzienicka, MaIgorzata Z.; Paulusma, Coen C.; Kanaar, Roland
2005-01-01
Homologous recombination is of major importance for the prevention of genomic instability during chromosome duplication and repair of DNA damage, especially double-strand breaks. Biochemical experiments have revealed that during the process of homologous recombination the RAD52 group proteins, including Rad51, Rad52 and Rad54, are involved in an essential step: formation of a joint molecule between the broken DNA and the intact repair template. Accessory proteins for this reaction include the Rad51 paralogs and BRCA2. The significance of homologous recombination for the cell is underscored by the evolutionary conservation of the Rad51, Rad52 and Rad54 proteins from yeast to humans. Upon treatment of cells with ionizing radiation, the RAD52 group proteins accumulate at the sites of DNA damage into so-called foci. For the yeast Saccharomyces cerevisiae, foci formation of Rad51 and Rad54 is abrogated in the absence of Rad52, while Rad51 foci formation does occur in the absence of the Rad51 paralog Rad55. By contrast, we show here that in mammalian cells, Rad52 is not required for foci formation of Rad51 and Rad54. Furthermore, radiation-induced foci formation of Rad51 and Rad54 is impaired in all Rad51 paralog and BRCA2 mutant cell lines tested, while Rad52 foci formation is not influenced by a mutation in any of these recombination proteins. Despite their evolutionary conservation and biochemical similarities, S. cerevisiae and mammalian Rad52 appear to differentially contribute to the DNA-damage response
MSOAR 2.0: Incorporating tandem duplications into ortholog assignment based on genome rearrangement
Directory of Open Access Journals (Sweden)
Zhang Liqing
2010-01-01
Full Text Available Abstract Background Ortholog assignment is a critical and fundamental problem in comparative genomics, since orthologs are considered to be functional counterparts in different species and can be used to infer molecular functions of one species from those of other species. MSOAR is a recently developed high-throughput system for assigning one-to-one orthologs between closely related species on a genome scale. It attempts to reconstruct the evolutionary history of input genomes in terms of genome rearrangement and gene duplication events. It assumes that a gene duplication event inserts a duplicated gene into the genome of interest at a random location (i.e., the random duplication model. However, in practice, biologists believe that genes are often duplicated by tandem duplications, where a duplicated gene is located next to the original copy (i.e., the tandem duplication model. Results In this paper, we develop MSOAR 2.0, an improved system for one-to-one ortholog assignment. For a pair of input genomes, the system first focuses on the tandemly duplicated genes of each genome and tries to identify among them those that were duplicated after the speciation (i.e., the so-called inparalogs, using a simple phylogenetic tree reconciliation method. For each such set of tandemly duplicated inparalogs, all but one gene will be deleted from the concerned genome (because they cannot possibly appear in any one-to-one ortholog pairs, and MSOAR is invoked. Using both simulated and real data experiments, we show that MSOAR 2.0 is able to achieve a better sensitivity and specificity than MSOAR. In comparison with the well-known genome-scale ortholog assignment tool InParanoid, Ensembl ortholog database, and the orthology information extracted from the well-known whole-genome multiple alignment program MultiZ, MSOAR 2.0 shows the highest sensitivity. Although the specificity of MSOAR 2.0 is slightly worse than that of InParanoid in the real data experiments
Directory of Open Access Journals (Sweden)
Erin S Kelleher
2007-08-01
Full Text Available It frequently has been postulated that intersexual coevolution between the male ejaculate and the female reproductive tract is a driving force in the rapid evolution of reproductive proteins. The dearth of research on female tracts, however, presents a major obstacle to empirical tests of this hypothesis. Here, we employ a comparative EST approach to identify 241 candidate female reproductive proteins in Drosophila arizonae, a repleta group species in which physiological ejaculate-female coevolution has been documented. Thirty-one of these proteins exhibit elevated amino acid substitution rates, making them candidates for molecular coevolution with the male ejaculate. Strikingly, we also discovered 12 unique digestive proteases whose expression is specific to the D. arizonae lower female reproductive tract. These enzymes belong to classes most commonly found in the gastrointestinal tracts of a diverse array of organisms. We show that these proteases are associated with recent, lineage-specific gene duplications in the Drosophila repleta species group, and exhibit strong signatures of positive selection. Observation of adaptive evolution in several female reproductive tract proteins indicates they are active players in the evolution of reproductive tract interactions. Additionally, pervasive gene duplication, adaptive evolution, and rapid acquisition of a novel digestive function by the female reproductive tract points to a novel coevolutionary mechanism of ejaculate-female interaction.
Directory of Open Access Journals (Sweden)
Yue-zhong Li
2017-04-01
Full Text Available Chaperonin GroEL (Cpn60 requires cofactor GroES (Cpn10 for protein refolding in bacteria that possess single groEL and groES genes in a bicistronic groESL operon. Among 4,861 completely-sequenced prokaryotic genomes, 884 possess duplicate groEL genes and 770 possess groEL genes with no neighboring groES. It is unclear whether stand-alone groEL requires groES in order to function and, if required, how duplicate groEL genes and unequal groES genes balance their expressions. In Myxococcus xanthus DK1622, we determined that, while duplicate groELs were alternatively deletable, the single groES that clusters with groEL1 was essential for cell survival. Either GroEL1 or GroEL2 required interactions with GroES for in vitro and in vivo functions. Deletion of groEL1 or groEL2 resulted in decreased expressions of both groEL and groES; and ectopic complementation of groEL recovered not only the groEL but also groES expressions. The addition of an extra groES gene upstream groEL2 to form a bicistronic operon had almost no influence on groES expression and the cell survival rate, whereas over-expression of groES using a self-replicating plasmid simultaneously increased the groEL expressions. The results indicated that M. xanthus DK1622 cells coordinate expressions of the duplicate groEL and single groES genes for synergistic functions of GroELs and GroES. We proposed a potential regulation mechanism for the expression coordination.
Czech Academy of Sciences Publication Activity Database
Nevrtalová, Eva; Baloun, Jiří; Hudzieczek, Vojtěch; Čegan, Radim; Vyskot, Boris; Doležel, Jaroslav; Šafář, Jan; Milde, D.; Hobza, Roman
2014-01-01
Roč. 251, č. 6 (2014), s. 1427-1439 ISSN 0033-183X R&D Projects: GA ČR(CZ) GAP501/12/2220; GA ČR(CZ) GBP501/12/G090; GA ČR(CZ) GP13-34962P; GA ČR(CZ) GA522/09/0083 Institutional support: RVO:68081707 Keywords : Copper * Gene duplication * Metallothionein Subject RIV: BO - Biophysics; EF - Botanics (UEB-Q) Impact factor: 2.651, year: 2014
Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila
2014-05-01
Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.
Singh, Nagendra K; Dalal, Vivek; Batra, Kamlesh; Singh, Binay K; Chitra, G; Singh, Archana; Ghazi, Irfan A; Yadav, Mahavir; Pandit, Awadhesh; Dixit, Rekha; Singh, Pradeep K; Singh, Harvinder; Koundal, Kirpa R; Gaikwad, Kishor; Mohapatra, Trilochan; Sharma, Tilak R
2007-01-01
The high-quality rice genome sequence is serving as a reference for comparative genome analysis in crop plants, especially cereals. However, early comparisons with bread wheat showed complex patterns of conserved synteny (gene content) and colinearity (gene order). Here, we show the presence of ancient duplicated segments in the progenitor of wheat, which were first identified in the rice genome. We also show that single-copy (SC) rice genes, those representing unique matches with wheat expressed sequence tag (EST) unigene contigs in the whole rice genome, show more than twice the proportion of genes mapping to syntenic wheat chromosome as compared to the multicopy (MC) or duplicated rice genes. While 58.7% of the 1,244 mapped SC rice genes were located in single syntenic wheat chromosome groups, the remaining 41.3% were distributed randomly to the other six non-syntenic wheat groups. This could only be explained by a background dispersal of genes in the genome through transposition or other unknown mechanism. The breakdown of rice-wheat synteny due to such transpositions was much greater near the wheat centromeres. Furthermore, the SC rice genes revealed a conserved primordial gene order that gives clues to the origin of rice and wheat chromosomes from a common ancestor through polyploidy, aneuploidy, centromeric fusions, and translocations. Apart from the bin-mapped wheat EST contigs, we also compared 56,298 predicted rice genes with 39,813 wheat EST contigs assembled from 409,765 EST sequences and identified 7,241 SC rice gene homologs of wheat. Based on the conserved colinearity of 1,063 mapped SC rice genes across the bins of individual wheat chromosomes, we predicted the wheat bin location of 6,178 unmapped SC rice gene homologs and validated the location of 213 of these in the telomeric bins of 21 wheat chromosomes with 35.4% initial success. This opens up the possibility of directed mapping of a large number of conserved SC rice gene homologs in wheat
Identification of the gene for Nance-Horan syndrome (NHS).
Brooks, S P; Ebenezer, N D; Poopalasundaram, S; Lehmann, O J; Moore, A T; Hardcastle, A J
2004-10-01
The disease intervals for Nance-Horan syndrome (NHS [MIM 302350]) and X linked congenital cataract (CXN) overlap on Xp22. To identify the gene or genes responsible for these diseases. Families with NHS were ascertained. The refined locus for CXN was used to focus the search for candidate genes, which were screened by polymerase chain reaction and direct sequencing of potential exons and intron-exon splice sites. Genomic structures and homologies were determined using bioinformatics. Expression studies were undertaken using specific exonic primers to amplify human fetal cDNA and mouse RNA. A novel gene NHS, with no known function, was identified as causative for NHS. Protein truncating mutations were detected in all three NHS pedigrees, but no mutation was identified in a CXN family, raising the possibility that NHS and CXN may not be allelic. The NHS gene forms a new gene family with a closely related novel gene NHS-Like1 (NHSL1). NHS and NHSL1 lie in paralogous duplicated chromosomal intervals on Xp22 and 6q24, and NHSL1 is more broadly expressed than NHS in human fetal tissues. This study reports the independent identification of the gene causative for Nance-Horan syndrome and extends the number of mutations identified.
Directory of Open Access Journals (Sweden)
Shuming Zou
Full Text Available Insulin-like growth factors (IGFs are key regulators of development, growth, and longevity. In most vertebrate species including humans, there is one IGF-1 gene and one IGF-2 gene. Here we report the identification and functional characterization of 4 distinct IGF genes (termed as igf-1a, -1b, -2a, and -2b in zebrafish. These genes encode 4 structurally distinct and functional IGF peptides. IGF-1a and IGF-2a mRNAs were detected in multiple tissues in adult fish. IGF-1b mRNA was detected only in the gonad and IGF-2b mRNA only in the liver. Functional analysis showed that all 4 IGFs caused similar developmental defects but with different potencies. Many of these embryos had fully or partially duplicated notochords, suggesting that an excess of IGF signaling causes defects in the midline formation and an expansion of the notochord. IGF-2a, the most potent IGF, was analyzed in depth. IGF-2a expression caused defects in the midline formation and expansion of the notochord but it did not alter the anterior neural patterning. These results not only provide new insights into the functional conservation and divergence of the multiple igf genes but also reveal a novel role of IGF signaling in midline formation and notochord development in a vertebrate model.
Czech Academy of Sciences Publication Activity Database
Boutte, J.; Aliaga, B.; Lima, O.; de Carvalho, J.F.; Ainouche, A.; Macas, Jiří; Rousseau-Gueutin, M.; Coriton, O.; Ainouche, M.; Salmon, A.
2016-01-01
Roč. 6, č. 1 (2016), s. 29-40 ISSN 2160-1836 Institutional support: RVO:60077344 Keywords : poaceae * duplication * paralogy * bioinformatics * polyploidy Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.861, year: 2016
Directory of Open Access Journals (Sweden)
Maritrini Colón
Full Text Available BACKGROUND: Gene duplication is a key evolutionary mechanism providing material for the generation of genes with new or modified functions. The fate of duplicated gene copies has been amply discussed and several models have been put forward to account for duplicate conservation. The specialization model considers that duplication of a bifunctional ancestral gene could result in the preservation of both copies through subfunctionalization, resulting in the distribution of the two ancestral functions between the gene duplicates. Here we investigate whether the presumed bifunctional character displayed by the single branched chain amino acid aminotransferase present in K. lactis has been distributed in the two paralogous genes present in S. cerevisiae, and whether this conservation has impacted S. cerevisiae metabolism. PRINCIPAL FINDINGS: Our results show that the KlBat1 orthologous BCAT is a bifunctional enzyme, which participates in the biosynthesis and catabolism of branched chain aminoacids (BCAAs. This dual role has been distributed in S. cerevisiae Bat1 and Bat2 paralogous proteins, supporting the specialization model posed to explain the evolution of gene duplications. BAT1 is highly expressed under biosynthetic conditions, while BAT2 expression is highest under catabolic conditions. Bat1 and Bat2 differential relocalization has favored their physiological function, since biosynthetic precursors are generated in the mitochondria (Bat1, while catabolic substrates are accumulated in the cytosol (Bat2. Under respiratory conditions, in the presence of ammonium and BCAAs the bat1Δ bat2Δ double mutant shows impaired growth, indicating that Bat1 and Bat2 could play redundant roles. In K. lactis wild type growth is independent of BCAA degradation, since a Klbat1Δ mutant grows under this condition. CONCLUSIONS: Our study shows that BAT1 and BAT2 differential expression and subcellular relocalization has resulted in the distribution of the
Baskar, Venkidasamy; Park, Se Won
2015-07-01
Glucosinolates (GSL) are one of the major secondary metabolites of the Brassicaceae family. In the present study, we aim at characterizing the multiple paralogs of aliphatic GSL regulators, such as BrMYB28 and BrMYB29 genes in Brassica rapa ssp. pekinensis, by quantitative real-time PCR (qRT-PCR) analysis in different tissues and at various developmental stages. An overlapping gene expression pattern between the BrMYBs as well as their downstream genes (DSGs) was found at different developmental stages. Among the BrMYB28 and BrMYB29 paralogous genes, the BrMYB28.3 and BrMYB29.1 genes were dominantly expressed in most of the developmental stages, compared to the other paralogs of the BrMYB genes. Furthermore, the differential expression pattern of the BrMYBs was observed under various stress treatments. Interestingly, BrMYB28.2 showed the least expression in most developmental stages, while its expression was remarkably high in different stress conditions. More specifically, the BrMYB28.2, BrMYB28.3, and BrMYB29.1 genes were highly responsive to various abiotic and biotic stresses, further indicating their possible role in stress tolerance. Moreover, the in silico cis motif analysis in the upstream regulatory regions of BrMYBs showed the presence of various putative stress-specific motifs, which further indicated their responsiveness to biotic and abiotic stresses. These observations suggest that the dominantly expressed BrMYBs, both in different developmental stages and under various stress treatments (BrMYB28.3 and BrMYB29.1), may be potential candidate genes for altering the GSL level through genetic modification studies in B. rapa ssp. pekinensis. Copyright © 2015. Published by Elsevier SAS.
RANGER-DTL 2.0: Rigorous Reconstruction of Gene-Family Evolution by Duplication, Transfer, and Loss.
Bansal, Mukul S; Kellis, Manolis; Kordi, Misagh; Kundu, Soumya
2018-04-24
RANGER-DTL 2.0 is a software program for inferring gene family evolution using Duplication-Transfer-Loss reconciliation. This new software is highly scalable and easy to use, and offers many new features not currently available in any other reconciliation program. RANGER-DTL 2.0 has a particular focus on reconciliation accuracy and can account for many sources of reconciliation uncertainty including uncertain gene tree rooting, gene tree topological uncertainty, multiple optimal reconciliations, and alternative event cost assignments. RANGER-DTL 2.0 is open-source and written in C ++ and Python. Pre-compiled executables, source code (open-source under GNU GPL), and a detailed manual are freely available from http://compbio.engr.uconn.edu/software/RANGER-DTL/. mukul.bansal@uconn.edu.
The duplication 17p13.3 phenotype
DEFF Research Database (Denmark)
Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica
2013-01-01
. Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....
Are duplicated genes responsible for anthracnose resistance in common bean?
Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida
2017-01-01
The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.
Sharma, Bharti; Guo, Chunce; Kong, Hongzhi; Kramer, Elena M
2011-08-01
• The petals of the lower eudicot family Ranunculaceae are thought to have been derived many times independently from stamens. However, investigation of the genetic basis of their identity has suggested an alternative hypothesis: that they share a commonly inherited petal identity program. This theory is based on the fact that an ancient paralogous lineage of APETALA3 (AP3) in the Ranunculaceae appears to have a conserved, petal-specific expression pattern. • Here, we have used a combination of approaches, including RNAi, comparative gene expression and molecular evolutionary studies, to understand the function of this petal-specific AP3 lineage. • Functional analysis of the Aquilegia locus AqAP3-3 has demonstrated that the paralog is required for petal identity with little contribution to the identity of the other floral organs. Expanded expression studies and analyses of molecular evolutionary patterns provide further evidence that orthologs of AqAP3-3 are primarily expressed in petals and are under higher purifying selection across the family than the other AP3 paralogs. • Taken together, these findings suggest that the AqAP3-3 lineage underwent progressive subfunctionalization within the order Ranunculales, ultimately yielding a specific role in petal identity that has probably been conserved, in stark contrast with the multiple independent origins predicted by botanical theories. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.
"Tandem duplication-random loss" is not a real feature of oyster mitochondrial genomes
Directory of Open Access Journals (Sweden)
Zhang Guofan
2009-02-01
Full Text Available Abstract Duplications and rearrangements of coding genes are major themes in the evolution of mitochondrial genomes, bearing important consequences in the function of mitochondria and the fitness of organisms. Yu et al. (BMC Genomics 2008, 9:477 reported the complete mt genome sequence of the oyster Crassostrea hongkongensis (16,475 bp and found that a DNA segment containing four tRNA genes (trnK1, trnC, trnQ1 and trnN, a duplicated (rrnS and a split rRNA gene (rrnL5' was absent compared with that of two other Crassostrea species. It was suggested that the absence was a novel case of "tandem duplication-random loss" with evolutionary significance. We independently sequenced the complete mt genome of three C. hongkongensis individuals, all of which were 18,622 bp and contained the segment that was missing in Yu et al.'s sequence. Further, we designed primers, verified sequences and demonstrated that the sequence loss in Yu et al.'s study was an artifact caused by placing primers in a duplicated region. The duplication and split of ribosomal RNA genes are unique for Crassostrea oysters and not lost in C. hongkongensis. Our study highlights the need for caution when amplifying and sequencing through duplicated regions of the genome.
Tornow, J; Santangelo, G M
1994-06-01
A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.
The evolutionary history of the SAL1 gene family in eutherian mammals
Directory of Open Access Journals (Sweden)
Callebaut Isabelle
2011-05-01
Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.
MLL duplication in a pediatric patient with B-cell lymphoblastic lymphoma.
Mater, David Van; Goodman, Barbara K; Wang, Endi; Gaca, Ana M; Wechsler, Daniel S
2012-04-01
Lymphoblastic lymphoma is the second most common type of non-Hodgkin lymphoma seen in children. Approximately, 90% of lymphoblastic lymphomas arise from T cells, with the remaining 10% being B-cell-lineage derived. Although T-cell lymphoblastic lymphoma most frequently occurs in the anterior mediastinum (thymus), B-cell lymphoblastic lymphoma (B-LBL) predominates in extranodal sites such as skin and bone. Here, we describe a pediatric B-LBL patient who presented with extensive abdominal involvement and whose lymphoma cells displayed segmental duplication of the mixed lineage leukemia (MLL) gene. MLL duplication/amplification has been described primarily in acute myeloid leukemia and myelodysplastic syndrome with no published reports of discrete MLL duplication/amplification events in B-LBL. The MLL gene duplication noted in this case may represent a novel mechanism for tumorigenesis in B-LBL.
Directory of Open Access Journals (Sweden)
Bertram Brenig
Full Text Available Aristaless-like homeobox 4 (ALX4 gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA and 289 White Galloway (WGA cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed.
When outgroups fail; phylogenomics of rooting the emerging pathogen, Coxiella burnetii.
Pearson, Talima; Hornstra, Heidie M; Sahl, Jason W; Schaack, Sarah; Schupp, James M; Beckstrom-Sternberg, Stephen M; O'Neill, Matthew W; Priestley, Rachael A; Champion, Mia D; Beckstrom-Sternberg, James S; Kersh, Gilbert J; Samuel, James E; Massung, Robert F; Keim, Paul
2013-09-01
Rooting phylogenies is critical for understanding evolution, yet the importance, intricacies and difficulties of rooting are often overlooked. For rooting, polymorphic characters among the group of interest (ingroup) must be compared to those of a relative (outgroup) that diverged before the last common ancestor (LCA) of the ingroup. Problems arise if an outgroup does not exist, is unknown, or is so distant that few characters are shared, in which case duplicated genes originating before the LCA can be used as proxy outgroups to root diverse phylogenies. Here, we describe a genome-wide expansion of this technique that can be used to solve problems at the other end of the evolutionary scale: where ingroup individuals are all very closely related to each other, but the next closest relative is very distant. We used shared orthologous single nucleotide polymorphisms (SNPs) from 10 whole genome sequences of Coxiella burnetii, the causative agent of Q fever in humans, to create a robust, but unrooted phylogeny. To maximize the number of characters informative about the rooting, we searched entire genomes for polymorphic duplicated regions where orthologs of each paralog could be identified so that the paralogs could be used to root the tree. Recent radiations, such as those of emerging pathogens, often pose rooting challenges due to a lack of ingroup variation and large genomic differences with known outgroups. Using a phylogenomic approach, we created a robust, rooted phylogeny for C. burnetii. [Coxiella burnetii; paralog SNPs; pathogen evolution; phylogeny; recent radiation; root; rooting using duplicated genes.].
Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S
2014-01-10
Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first
A synergism between adaptive effects and evolvability drives whole genome duplication to fixation
Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.
Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes.
Analysis of high-identity segmental duplications in the grapevine genome
Directory of Open Access Journals (Sweden)
Carelli Francesco N
2011-08-01
Full Text Available Abstract Background Segmental duplications (SDs are blocks of genomic sequence of 1-200 kb that map to different loci in a genome and share a sequence identity > 90%. SDs show at the sequence level the same characteristics as other regions of the human genome: they contain both high-copy repeats and gene sequences. SDs play an important role in genome plasticity by creating new genes and modeling genome structure. Although data is plentiful for mammals, not much was known about the representation of SDs in plant genomes. In this regard, we performed a genome-wide analysis of high-identity SDs on the sequenced grapevine (Vitis vinifera genome (PN40024. Results We demonstrate that recent SDs (> 94% identity and >= 10 kb in size are a relevant component of the grapevine genome (85 Mb, 17% of the genome sequence. We detected mitochondrial and plastid DNA and genes (10% of gene annotation in segmentally duplicated regions of the nuclear genome. In particular, the nine highest copy number genes have a copy in either or both organelle genomes. Further we showed that several duplicated genes take part in the biosynthesis of compounds involved in plant response to environmental stress. Conclusions These data show the great influence of SDs and organelle DNA transfers in modeling the Vitis vinifera nuclear DNA structure as well as the impact of SDs in contributing to the adaptive capacity of grapevine and the nutritional content of grape products through genome variation. This study represents a step forward in the full characterization of duplicated genes important for grapevine cultural needs and human health.
Directory of Open Access Journals (Sweden)
Giao Ngoc Nguyen
2017-08-01
Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.
Matoso, Eunice; Melo, Joana B; Ferreira, Susana I; Jardim, Ana; Castelo, Teresa M; Weise, Anja; Carreira, Isabel M
2013-08-01
An insertional translocation (IT) can result in pure segmental aneusomy for the inserted genomic segment allowing to define a more accurate clinical phenotype. Here, we report on two siblings sharing an unbalanced IT inherited from the mother with a history of learning difficulty. An 8-year-old girl with developmental delay, speech disability, and attention-deficit hyperactivity disorder (ADHD), showed by GTG banding analysis a subtle interstitial alteration in 21q21. Oligonucleotide array comparative genomic hybridization (array-CGH) analysis showed a 4q13.1-q13.3 duplication spanning 8.6 Mb. Fluorescence in situ hybridization (FISH) with bacterial artificial chromosome (BAC) clones confirmed the rearrangement, a der(21)ins(21;4)(q21;q13.1q13.3). The duplication described involves 50 RefSeq genes including the EPHA5 gene that encodes for the EphA5 receptor involved in embryonic development of the brain and also in synaptic remodeling and plasticity thought to underlie learning and memory. The same rearrangement was observed in a younger brother with behavioral problems and also exhibiting ADHD. ADHD is among the most heritable of neuropsychiatric disorders. There are few reports of patients with duplications involving the proximal region of 4q and a mild phenotype. To the best of our knowledge this is the first report of a duplication restricted to band 4q13. This abnormality could be easily missed in children who have nonspecific cognitive impairment. The presence of this behavioral disorder in the two siblings reinforces the hypothesis that the region involved could include genes involved in ADHD. Copyright © 2013 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Alireza Eshaghi
Full Text Available Human respiratory syncytial virus (HRSV is the main cause of acute lower respiratory infections in children under 2 years of age and causes repeated infections throughout life. We investigated the genetic variability of RSV-A circulating in Ontario during 2010-2011 winter season by sequencing and phylogenetic analysis of the G glycoprotein gene.Among the 201 consecutive RSV isolates studied, RSV-A (55.7% was more commonly observed than RSV-B (42.3%. 59.8% and 90.1% of RSV-A infections were among children ≤12 months and ≤5 years old, respectively. On phylogenetic analysis of the second hypervariable region of the 112 RSV-A strains, 110 (98.2% clustered within or adjacent to the NA1 genotype; two isolates were GA5 genotype. Eleven (10% NA1-related isolates clustered together phylogenetically as a novel RSV-A genotype, named ON1, containing a 72 nucleotide duplication in the C-terminal region of the attachment (G glycoprotein. The predicted polypeptide is lengthened by 24 amino acids and includes a23 amino acid duplication. Using RNA secondary structural software, a possible mechanism of duplication occurrence was derived. The 23 amino acid ON1 G gene duplication results in a repeat of 7 potential O-glycosylation sites including three O-linked sugar acceptors at residues 270, 275, and 283. Using Phylogenetic Analysis by Maximum Likelihood analysis, a total of 19 positively selected sites were observed among Ontario NA1 isolates; six were found to be codons which reverted to the previous state observed in the prototype RSV-A2 strain. The tendency of codon regression in the G-ectodomain may infer a decreased avidity of antibody to the current circulating strains. Further work is needed to document and further understand the emergence, virulence, pathogenicity and transmissibility of this novel RSV-A genotype with a72 nucleotide G gene duplication.
SPOCS: Software for Predicting and Visualizing Orthology/Paralogy Relationships Among Genomes
Energy Technology Data Exchange (ETDEWEB)
Curtis, Darren S.; Phillips, Aaron R.; Callister, Stephen J.; Conlan, Sean; McCue, Lee Ann
2013-10-15
At the rate that prokaryotic genomes can now be generated, comparative genomics studies require a flexible method for quickly and accurately predicting orthologs among the rapidly changing set of genomes available. SPOCS implements a graph-based ortholog prediction method to generate a simple tab-delimited table of orthologs and in addition, html files that provide a visualization of the predicted ortholog/paralog relationships to which gene/protein expression metadata may be overlaid. AVAILABILITY AND IMPLEMENTATION: A SPOCS web application is freely available at http://cbb.pnnl.gov/portal/tools/spocs.html. Source code for Linux systems is also freely available under an open source license at http://cbb.pnnl.gov/portal/software/spocs.html; the Boost C++ libraries and BLAST are required.
Horizontal and vertical growth of S. cerevisiae metabolic network.
Grassi, Luigi
2011-10-14
BACKGROUND: The growth and development of a biological organism is reflected by its metabolic network, the evolution of which relies on the essential gene duplication mechanism. There are two current views about the evolution of metabolic networks. The retrograde model hypothesizes that a pathway evolves by recruiting novel enzymes in a direction opposite to the metabolic flow. The patchwork model is instead based on the assumption that the evolution is based on the exploitation of broad-specificity enzymes capable of catalysing a variety of metabolic reactions. RESULTS: We analysed a well-studied unicellular eukaryotic organism, S. cerevisiae, and studied the effect of the removal of paralogous gene products on its metabolic network. Our results, obtained using different paralog and network definitions, show that, after an initial period when gene duplication was indeed instrumental in expanding the metabolic space, the latter reached an equilibrium and subsequent gene duplications were used as a source of more specialized enzymes rather than as a source of novel reactions. We also show that the switch between the two evolutionary strategies in S. cerevisiae can be dated to about 350 million years ago. CONCLUSIONS: Our data, obtained through a novel analysis methodology, strongly supports the hypothesis that the patchwork model better explains the more recent evolution of the S. cerevisiae metabolic network. Interestingly, the effects of a patchwork strategy acting before the Euascomycete-Hemiascomycete divergence are still detectable today.
Hofberger, J.A.; Lyons, E.; Edger, P.P.; Pires, J.C.; Schranz, M.E.
2013-01-01
Plants share a common history of successive whole genome duplication (WGD) events retaining genomic patterns of duplicate gene copies (ohnologs) organized in conserved syntenic blocks. Duplication was often proposed to affect the origin of novel traits during evolution. However, genetic evidence
Roquin Paralogs Differentially Regulate Functional NKT Cell Subsets.
Drees, Christoph; Vahl, J Christoph; Bortoluzzi, Sabrina; Heger, Klaus D; Fischer, Julius C; Wunderlich, F Thomas; Peschel, Christian; Schmidt-Supprian, Marc
2017-04-01
NKT cells represent a small subset of glycolipid-recognizing T cells that are heavily implicated in human allergic, autoimmune, and malignant diseases. In the thymus, precursor cells recognize self-glycolipids by virtue of their semi-invariant TCR, which triggers NKT cell lineage commitment and maturation. During their development, NKT cells are polarized into the NKT1, NKT2, and NKT17 subsets, defined through their cytokine-secretion patterns and the expression of key transcription factors. However, we have largely ignored how the differentiation into the NKT cell subsets is regulated. In this article, we describe the mRNA-binding Roquin-1 and -2 proteins as central regulators of murine NKT cell fate decisions. In the thymus, T cell-specific ablation of the Roquin paralogs leads to a dramatic expansion of NKT17 cells, whereas peripheral mature NKT cells are essentially absent. Roquin-1/2-deficient NKT17 cells show exaggerated lineage-specific expression of nearly all NKT17-defining proteins tested. We show through mixed bone marrow chimera experiments that NKT17 polarization is mediated through cell-intrinsic mechanisms early during NKT cell development. In contrast, the loss of peripheral NKT cells is due to cell-extrinsic factors. Surprisingly, Roquin paralog-deficient NKT cells are, in striking contrast to conventional T cells, compromised in their ability to secrete cytokines. Altogether, we show that Roquin paralogs regulate the development and function of NKT cell subsets in the thymus and periphery. Copyright © 2017 by The American Association of Immunologists, Inc.
Genome-wide signatures of 'rearrangement hotspots' within segmental duplications in humans.
Directory of Open Access Journals (Sweden)
Mohammed Uddin
Full Text Available The primary objective of this study was to create a genome-wide high resolution map (i.e., >100 bp of 'rearrangement hotspots' which can facilitate the identification of regions capable of mediating de novo deletions or duplications in humans. A hierarchical method was employed to fragment segmental duplications (SDs into multiple smaller SD units. Combining an end space free pairwise alignment algorithm with a 'seed and extend' approach, we have exhaustively searched 409 million alignments to detect complex structural rearrangements within the reference-guided assembly of the NA18507 human genome (18× coverage, including the previously identified novel 4.8 Mb sequence from de novo assembly within this genome. We have identified 1,963 rearrangement hotspots within SDs which encompass 166 genes and display an enrichment of duplicated gene nucleotide variants (DNVs. These regions are correlated with increased non-allelic homologous recombination (NAHR event frequency which presumably represents the origin of copy number variations (CNVs and pathogenic duplications/deletions. Analysis revealed that 20% of the detected hotspots are clustered within the proximal and distal SD breakpoints flanked by the pathogenic deletions/duplications that have been mapped for 24 NAHR-mediated genomic disorders. FISH Validation of selected complex regions revealed 94% concordance with in silico localization of the highly homologous derivatives. Other results from this study indicate that intra-chromosomal recombination is enhanced in genic compared with agenic duplicated regions, and that gene desert regions comprising SDs may represent reservoirs for creation of novel genes. The generation of genome-wide signatures of 'rearrangement hotspots', which likely serve as templates for NAHR, may provide a powerful approach towards understanding the underlying mutational mechanism(s for development of constitutional and acquired diseases.
Directory of Open Access Journals (Sweden)
Holt Robert A
2010-04-01
Full Text Available Abstract Background Salmonids are one of the most intensely studied fish, in part due to their economic and environmental importance, and in part due to a recent whole genome duplication in the common ancestor of salmonids. This duplication greatly impacts species diversification, functional specialization, and adaptation. Extensive new genomic resources have recently become available for Atlantic salmon (Salmo salar, but documentation of allelic versus duplicate reference genes remains a major uncertainty in the complete characterization of its genome and its evolution. Results From existing expressed sequence tag (EST resources and three new full-length cDNA libraries, 9,057 reference quality full-length gene insert clones were identified for Atlantic salmon. A further 1,365 reference full-length clones were annotated from 29,221 northern pike (Esox lucius ESTs. Pairwise dN/dS comparisons within each of 408 sets of duplicated salmon genes using northern pike as a diploid out-group show asymmetric relaxation of selection on salmon duplicates. Conclusions 9,057 full-length reference genes were characterized in S. salar and can be used to identify alleles and gene family members. Comparisons of duplicated genes show that while purifying selection is the predominant force acting on both duplicates, consistent with retention of functionality in both copies, some relaxation of pressure on gene duplicates can be identified. In addition, there is evidence that evolution has acted asymmetrically on paralogs, allowing one of the pair to diverge at a faster rate.
Enteric and rectal duplications and duplication cysts in the adult.
Simsek, Abdurrahman; Zeybek, Nazif; Yagci, Gokhan; Kaymakcioglu, Nihat; Tas, Huseyin; Saglam, Mutlu; Cetiner, Sadettin
2005-03-01
Alimentary tract duplication and duplication cysts are rare congenital malformations. The ileum is the most frequently affected site. However, alimentary tract duplication and duplication cysts can occur at any point along the gastrointestinal tract. Early diagnosis and prompt surgical treatment is the best way to prevent associated morbidity. This article presents the cases of three patients admitted to Gulhane Military Medical Academy with signs of acute abdomen, intra-abdominal mass and chronic abdominal pain. These patients were found to have enteric duplication, duplication cyst and/or retro-rectal cyst. The literature on alimentary tract duplications is reviewed.
International Nuclear Information System (INIS)
Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja; Tan, Qihua; Jochumsen, Kirsten; Fritzner, Niels; Brusgaard, Klaus; Dahlgaard, Jesper; Kruse, Torben A.
2006-01-01
The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips was three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation
A molecularly defined duplication set for the X chromosome of Drosophila melanogaster
Energy Technology Data Exchange (ETDEWEB)
Venken, Koen J. T.; Popodi, Ellen; Holtzman, Stacy L.; Schulze, Karen L.; Park, Soo; Carlson, Joseph W.; Hoskins, Roger A.; Bellen, Hugo J.; Kaufman, Thomas C.
2010-07-22
We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using C31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.
Directory of Open Access Journals (Sweden)
Zhining Sa
2017-08-01
Full Text Available Side effects from targeted drugs remain a serious concern. One reason is the nonselective binding of a drug to unintended proteins such as its paralogs, which are highly homologous in sequences and have similar structures and drug-binding pockets. To identify targetable differences between paralogs, we analyzed two types (type-I and type-II of functional divergence between two paralogs in the known target protein receptor family G-protein coupled receptors (GPCRs at the amino acid level. Paralogous protein receptors in glucagon-like subfamily, glucagon receptor (GCGR and glucagon-like peptide-1 receptor (GLP-1R, exhibit divergence in ligands and are clinically validated drug targets for type 2 diabetes. Our data showed that type-II amino acids were significantly enriched in the binding sites of antagonist MK-0893 to GCGR, which had a radical shift in physicochemical properties between GCGR and GLP-1R. We also examined the role of type-I amino acids between GCGR and GLP-1R. The divergent features between GCGR and GLP-1R paralogs may be helpful in their discrimination, thus enabling the identification of binding sites to reduce undesirable side effects and increase the target specificity of drugs.
Pont, Caroline; Murat, Florent; Confolent, Carole; Balzergue, Sandrine; Salse, Jérôme
2011-12-02
Whole genome duplication is a common evolutionary event in plants. Bread wheat (Triticum aestivum L.) is a good model to investigate the impact of paleo- and neoduplications on the organization and function of modern plant genomes. We performed an RNA sequencing-based inference of the grain filling gene network in bread wheat and identified a set of 37,695 non-redundant sequence clusters, which is an unprecedented resolution corresponding to an estimated half of the wheat genome unigene repertoire. Using the Brachypodium distachyon genome as a reference for the Triticeae, we classified gene clusters into orthologous, paralogous, and homoeologous relationships. Based on this wheat gene evolutionary classification, older duplicated copies (dating back 50 to 70 million years) exhibit more than 80% gene loss and expression divergence while recent duplicates (dating back 1.5 to 3 million years) show only 54% gene loss and 36 to 49% expression divergence. We suggest that structural shuffling due to duplicated gene loss is a rapid process, whereas functional shuffling due to neo- and/or subfunctionalization of duplicates is a longer process, and that both shuffling mechanisms drive functional redundancy erosion. We conclude that, as a result of these mechanisms, half the gene duplicates in plants are structurally and functionally altered within 10 million years of evolution, and the diploidization process is completed after 45 to 50 million years following polyploidization.
The evolution of Dscam genes across the arthropods.
Armitage, Sophie A O; Freiburg, Rebecca Y; Kurtz, Joachim; Bravo, Ignacio G
2012-04-13
One way of creating phenotypic diversity is through alternative splicing of precursor mRNAs. A gene that has evolved a hypervariable form is Down syndrome cell adhesion molecule (Dscam-hv), which in Drosophila melanogaster can produce thousands of isoforms via mutually exclusive alternative splicing. The extracellular region of this protein is encoded by three variable exon clusters, each containing multiple exon variants. The protein is vital for neuronal wiring where the extreme variability at the somatic level is required for axonal guidance, and it plays a role in immunity where the variability has been hypothesised to relate to recognition of different antigens. Dscam-hv has been found across the Pancrustacea. Additionally, three paralogous non-hypervariable Dscam-like genes have also been described for D. melanogaster. Here we took a bioinformatics approach, building profile Hidden Markov Models to search across species for putative orthologs to the Dscam genes and for hypervariable alternatively spliced exons, and inferring the phylogenetic relationships among them. Our aims were to examine whether Dscam orthologs exist outside the Bilateria, whether the origin of Dscam-hv could lie outside the Pancrustacea, when the Dscam-like orthologs arose, how many alternatively spliced exons of each exon cluster were present in the most common recent ancestor, and how these clusters evolved. Our results suggest that the origin of Dscam genes may lie after the split between the Cnidaria and the Bilateria and supports the hypothesis that Dscam-hv originated in the common ancestor of the Pancrustacea. Our phylogeny of Dscam gene family members shows six well-supported clades: five containing Dscam-like genes and one containing all the Dscam-hv genes, a seventh clade contains arachnid putative Dscam genes. Furthermore, the exon clusters appear to have experienced different evolutionary histories. Dscam genes have undergone independent duplication events in the insects and
The evolution of Dscam genes across the arthropods
Directory of Open Access Journals (Sweden)
Armitage Sophie AO
2012-04-01
Full Text Available Abstract Background One way of creating phenotypic diversity is through alternative splicing of precursor mRNAs. A gene that has evolved a hypervariable form is Down syndrome cell adhesion molecule (Dscam-hv, which in Drosophila melanogaster can produce thousands of isoforms via mutually exclusive alternative splicing. The extracellular region of this protein is encoded by three variable exon clusters, each containing multiple exon variants. The protein is vital for neuronal wiring where the extreme variability at the somatic level is required for axonal guidance, and it plays a role in immunity where the variability has been hypothesised to relate to recognition of different antigens. Dscam-hv has been found across the Pancrustacea. Additionally, three paralogous non-hypervariable Dscam-like genes have also been described for D. melanogaster. Here we took a bioinformatics approach, building profile Hidden Markov Models to search across species for putative orthologs to the Dscam genes and for hypervariable alternatively spliced exons, and inferring the phylogenetic relationships among them. Our aims were to examine whether Dscam orthologs exist outside the Bilateria, whether the origin of Dscam-hv could lie outside the Pancrustacea, when the Dscam-like orthologs arose, how many alternatively spliced exons of each exon cluster were present in the most common recent ancestor, and how these clusters evolved. Results Our results suggest that the origin of Dscam genes may lie after the split between the Cnidaria and the Bilateria and supports the hypothesis that Dscam-hv originated in the common ancestor of the Pancrustacea. Our phylogeny of Dscam gene family members shows six well-supported clades: five containing Dscam-like genes and one containing all the Dscam-hv genes, a seventh clade contains arachnid putative Dscam genes. Furthermore, the exon clusters appear to have experienced different evolutionary histories. Conclusions Dscam genes have
Schirtzinger, Erin E.; Tavares, Erika S.; Gonzales, Lauren A.; Eberhard, Jessica R.; Miyaki, Cristina Y.; Sanchez, Juan J.; Hernandez, Alexis; Müeller, Heinrich; Graves, Gary R.; Fleischer, Robert C.; Wright, Timothy F.
2012-01-01
Mitochondrial genomes are generally thought to be under selection for compactness, due to their small size, consistent gene content, and a lack of introns or intergenic spacers. As more animal mitochondrial genomes are fully sequenced, rearrangements and partial duplications are being identified with increasing frequency, particularly in birds (Class Aves). In this study, we investigate the evolutionary history of mitochondrial control region states within the avian order Psittaciformes (parrots and cockatoos). To this aim, we reconstructed a comprehensive multi-locus phylogeny of parrots, used PCR of three diagnostic fragments to classify the mitochondrial control region state as single or duplicated, and mapped these states onto the phylogeny. We further sequenced 44 selected species to validate these inferences of control region state. Ancestral state reconstruction using a range of weighting schemes identified six independent origins of mitochondrial control region duplications within Psittaciformes. Analysis of sequence data showed that varying levels of mitochondrial gene and tRNA homology and degradation were present within a given clade exhibiting duplications. Levels of divergence between control regions within an individual varied from 0–10.9% with the differences occurring mainly between 51 and 225 nucleotides 3′ of the goose hairpin in domain I. Further investigations into the fates of duplicated mitochondrial genes, the potential costs and benefits of having a second control region, and the complex relationship between evolutionary rates, selection, and time since duplication are needed to fully explain these patterns in the mitochondrial genome. PMID:22543055
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
Directory of Open Access Journals (Sweden)
Tran Lan T
2012-08-01
Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic
Directory of Open Access Journals (Sweden)
Alex N Nguyen Ba
2017-04-01
Full Text Available Regulatory networks often increase in complexity during evolution through gene duplication and divergence of component proteins. Two models that explain this increase in complexity are: 1 adaptive changes after gene duplication, such as resolution of adaptive conflicts, and 2 non-adaptive processes such as duplication, degeneration and complementation. Both of these models predict complementary changes in the retained duplicates, but they can be distinguished by direct fitness measurements in organisms with short generation times. Previously, it has been observed that repeated duplication of an essential protein in the spindle checkpoint pathway has occurred multiple times over the eukaryotic tree of life, leading to convergent protein domain organization in its duplicates. Here, we replace the paralog pair in S. cerevisiae with a single-copy protein from a species that did not undergo gene duplication. Surprisingly, using quantitative fitness measurements in laboratory conditions stressful for the spindle-checkpoint pathway, we find no evidence that reorganization of protein function after gene duplication is beneficial. We then reconstruct several evolutionary intermediates from the inferred ancestral network to the extant one, and find that, at the resolution of our assay, there exist stepwise mutational paths from the single protein to the divergent pair of extant proteins with no apparent fitness defects. Parallel evolution has been taken as strong evidence for natural selection, but our results suggest that even in these cases, reorganization of protein function after gene duplication may be explained by neutral processes.
Zevering, C E; Moritz, C; Heideman, A; Sturm, R A
1991-11-01
Analysis of mitochondrial DNAs (mtDNAs) from parthenogenetic lizards of the Heteronotia binoei complex with restriction enzymes revealed an approximately 5-kb addition present in all 77 individuals. Cleavage site mapping suggested the presence of a direct tandem duplication spanning the 16S and 12S rRNA genes, the control region and most, if not all, of the gene for the subunit 1 of NADH dehydrogenase (ND1). The location of the duplication was confirmed by Southern hybridization. A restriction enzyme survey provided evidence for modifications to each copy of the duplicated sequence, including four large deletions. Each gene affected by a deletion was complemented by an intact version in the other copy of the sequence, although for one gene the functional copy was heteroplasmic for another deletion. Sequencing of a fragment from one copy of the duplication which encompassed the tRNA(leu)(UUR) and parts of the 16S rRNA and ND1 genes, revealed mutations expected to disrupt function. Thus, evolution subsequent to the duplication event has resulted in mitochondrial pseudogenes. The presence of duplications in all of these parthenogens, but not among representatives of their maternal sexual ancestors, suggests that the duplications arose in the parthenogenetic form. This provides the second instance in H. binoei of mtDNA duplication associated with the transition from sexual to parthenogenetic reproduction. The increased incidence of duplications in parthenogenetic lizards may be caused by errors in mtDNA replication due to either polyploidy or hybridity of their nuclear genomes.
External cystic rectal duplication: an unusual presentation of rectal duplication cyst.
Karaman, I; Karaman, A; Arda, N; Cakmak, O
2007-11-01
Duplications of gastrointestinal tract are rare anomalies, and rectal duplications account for five percent of the alimentary tract duplications. We present an unusual case of rectal duplication, which was located externally in a newborn female, and discuss the types of distal hindgut duplications.
The detection of large deletions or duplications in genomic DNA.
Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R
2002-11-01
While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.
Targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae.
Takahashi, Tadashi; Sato, Atsushi; Ogawa, Masahiro; Hanya, Yoshiki; Oguma, Tetsuya
2014-08-01
We describe here the first successful construction of a targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae. The targeted tandem chromosomal duplication was achieved by using strains that had a 5'-deleted pyrG upstream of the region targeted for tandem chromosomal duplication and a 3'-deleted pyrG downstream of the target region. Consequently,strains bearing a 210-kb targeted tandem chromosomal duplication near the centromeric region of chromosome 8 and strains bearing a targeted tandem chromosomal duplication of a 700-kb region of chromosome 2 were successfully constructed. The strains bearing the tandem chromosomal duplication were efficiently obtained from the regenerated protoplast of the parental strains. However, the generation of the chromosomal duplication did not depend on the introduction of double-stranded breaks(DSBs) by I-SceI. The chromosomal duplications of these strains were stably maintained after five generations of culture under nonselective conditions. The strains bearing the tandem chromosomal duplication in the 700-kb region of chromosome 2 showed highly increased protease activity in solid-state culture, indicating that the duplication of large chromosomal segments could be a useful new breeding technology and gene analysis method.
Directory of Open Access Journals (Sweden)
Sergey Yegorov
Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of
Jeziorczak, Paul M; Warner, Brad W
2018-03-01
Enteric duplications have been described throughout the entire gastrointestinal tract. The usual perinatal presentation is an abdominal mass. Duplications associated with the foregut have associated respiratory symptoms, whereas duplications in the midgut and hindgut can present with obstructive symptoms, perforation, nausea, emesis, hemorrhage, or be asymptomatic, and identified as an incidental finding. These are differentiated from other cystic lesions by the presence of a normal gastrointestinal mucosal epithelium. Enteric duplications are located on the mesenteric side of the native structures and are often singular with tubular or cystic characteristics. Management of enteric duplications often requires operative intervention with preservation of the native blood supply and intestine. These procedures are usually very well tolerated with low morbidity.
A molecularly defined duplication set for the X chromosome of Drosophila melanogaster.
Venken, Koen J T; Popodi, Ellen; Holtzman, Stacy L; Schulze, Karen L; Park, Soo; Carlson, Joseph W; Hoskins, Roger A; Bellen, Hugo J; Kaufman, Thomas C
2010-12-01
We describe a molecularly defined duplication kit for the X chromosome of Drosophila melanogaster. A set of 408 overlapping P[acman] BAC clones was used to create small duplications (average length 88 kb) covering the 22-Mb sequenced portion of the chromosome. The BAC clones were inserted into an attP docking site on chromosome 3L using ΦC31 integrase, allowing direct comparison of different transgenes. The insertions complement 92% of the essential and viable mutations and deletions tested, demonstrating that almost all Drosophila genes are compact and that the current annotations of the genome are reasonably accurate. Moreover, almost all genes are tolerated at twice the normal dosage. Finally, we more precisely mapped two regions at which duplications cause diplo-lethality in males. This collection comprises the first molecularly defined duplication set to cover a whole chromosome in a multicellular organism. The work presented removes a long-standing barrier to genetic analysis of the Drosophila X chromosome, will greatly facilitate functional assays of X-linked genes in vivo, and provides a model for functional analyses of entire chromosomes in other species.
Directory of Open Access Journals (Sweden)
Anton S. Sulima
2017-11-01
Full Text Available During the initial step of the symbiosis between legumes (Fabaceae and nitrogen-fixing bacteria (rhizobia, the bacterial signal molecule known as the Nod factor (nodulation factor is recognized by plant LysM motif-containing receptor-like kinases (LysM-RLKs. The fifth chromosome of barrel medic (Medicago truncatula Gaertn. contains a cluster of paralogous LysM-RLK genes, one of which is known to participate in symbiosis. In the syntenic region of the pea (Pisum sativum L. genome, three genes have been identified: PsK1 and PsSym37, two symbiosis-related LysM-RLK genes with known sequences, and the unsequenced PsSym2 gene which presumably encodes a LysM-RLK and is associated with increased selectivity to certain Nod factors. In this work, we identified a new gene encoding a LysM-RLK, designated as PsLykX, within the Sym2 genomic region. We sequenced the first exons (corresponding to the protein receptor domain of PsSym37, PsK1, and PsLykX from a large set of pea genotypes of diverse origin. The nucleotide diversity of these fragments was estimated and groups of haplotypes for each gene were revealed. Footprints of selection pressure were detected via comparative analyses of SNP distribution across the first exons of these genes and their homologs MtLYK2, MtLYK3, and MtLYK4 from M. truncatula retrieved from the Medicago Hapmap project. Despite the remarkable similarity among all the studied genes, they exhibited contrasting selection signatures, possibly pointing to diversification of their functions. Signatures of balancing selection were found in LysM1-encoding parts of PsSym37 and PsK1, suggesting that the diversity of these parts may be important for pea LysM-RLKs. The first exons of PsSym37 and PsK1 displayed signatures of purifying selection, as well as MtLYK2 of M. truncatula. Evidence of positive selection affecting primarily LysM domains was found in all three investigated M. truncatula genes, as well as in the pea gene PsLykX. The data
Asbeck, E. Van; Ramalingam, A.; Dvorak, C.; Chen, T.J.; Morava, E.
2014-01-01
Duplications on Xq28 are common, although quite variable in size, but usually include the MECP2 gene. Here, we present a patient with a unique, small, 167-kb duplication at Xq28, not including MECP2. The most important gene in the duplicated region was IKBKG, mutations in which can cause a variety
Resolution and reconciliation of non-binary gene trees with transfers, duplications and losses.
Jacox, Edwin; Weller, Mathias; Tannier, Eric; Scornavacca, Celine
2017-04-01
Gene trees reconstructed from sequence alignments contain poorly supported branches when the phylogenetic signal in the sequences is insufficient to determine them all. When a species tree is available, the signal of gains and losses of genes can be used to correctly resolve the unsupported parts of the gene history. However finding a most parsimonious binary resolution of a non-binary tree obtained by contracting the unsupported branches is NP-hard if transfer events are considered as possible gene scale events, in addition to gene origination, duplication and loss. We propose an exact, parameterized algorithm to solve this problem in single-exponential time, where the parameter is the number of connected branches of the gene tree that show low support from the sequence alignment or, equivalently, the maximum number of children of any node of the gene tree once the low-support branches have been collapsed. This improves on the best known algorithm by an exponential factor. We propose a way to choose among optimal solutions based on the available information. We show the usability of this principle on several simulated and biological datasets. The results are comparable in quality to several other tested methods having similar goals, but our approach provides a lower running time and a guarantee that the produced solution is optimal. Our algorithm has been integrated into the ecceTERA phylogeny package, available at http://mbb.univ-montp2.fr/MBB/download_sources/16__ecceTERA and which can be run online at http://mbb.univ-montp2.fr/MBB/subsection/softExec.php?soft=eccetera . celine.scornavacca@umontpellier.fr. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Evolutionary patterns of RNA-based duplication in non-mammalian chordates.
Directory of Open Access Journals (Sweden)
Ming Chen
Full Text Available The role of RNA-based duplication, or retroposition, in the evolution of new gene functions in mammals, plants, and Drosophila has been widely reported. However, little is known about RNA-based duplication in non-mammalian chordates. In this study, we screened ten non-mammalian chordate genomes for retrocopies and investigated their evolutionary patterns. We identified numerous retrocopies in these species. Examination of the age distribution of these retrocopies revealed no burst of young retrocopies in ancient chordate species. Upon comparing these non-mammalian chordate species to the mammalian species, we observed that a larger fraction of the non-mammalian retrocopies was under strong evolutionary constraints than mammalian retrocopies are, as evidenced by signals of purifying selection and expression profiles. For the Western clawed frog, Medaka, and Sea squirt, many retrogenes have evolved gonad and brain expression patterns, similar to what was observed in human. Testing of retrogene movement in the Medaka genome, where the nascent sex chrosomes have been well assembled, did not reveal any significant gene movement. Taken together, our analyses demonstrate that RNA-based duplication generates many functional genes and can make a significant contribution to the evolution of non-mammalian genomes.
A synergism between adaptive effects and evolvability drives whole genome duplication to fixation
Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.
2014-01-01
Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...
A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.
Thomas D Cuypers; Paulien Hogeweg
2014-01-01
Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...
Akagi, Takashi; Henry, Isabelle M; Morimoto, Takuya; Tao, Ryutaro
2016-06-01
Self-incompatibility (SI) is an important plant reproduction mechanism that facilitates the maintenance of genetic diversity within species. Three plant families, the Solanaceae, Rosaceae and Plantaginaceae, share an S-RNase-based gametophytic SI (GSI) system that involves a single S-RNase as the pistil S determinant and several F-box genes as pollen S determinants that act via non-self-recognition. Previous evidence has suggested a specific self-recognition mechanism in Prunus (Rosaceae), raising questions about the generality of the S-RNase-based GSI system. We investigated the evolution of the pollen S determinant by comparing the sequences of the Prunus S haplotype-specific F-box gene (SFB) with those of its orthologs in other angiosperm genomes. Our results indicate that the Prunus SFB does not cluster with the pollen S of other plants and diverged early after the establishment of the Eudicots. Our results further indicate multiple F-box gene duplication events, specifically in the Rosaceae family, and suggest that the Prunus SFB gene originated in a recent Prunus-specific gene duplication event. Transcriptomic and evolutionary analyses of the Prunus S paralogs are consistent with the establishment of a Prunus-specific SI system, and the possibility of subfunctionalization differentiating the newly generated SFB from the original pollen S determinant. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Radiological findings of male urethral duplication associated with bladder duplication: case report
International Nuclear Information System (INIS)
Kim, Hyoung Jung; Lim, Joo Won; Lee, Dong Ho; Ko, Young Tae
2004-01-01
Urethral duplication or accessory urethra is a rare congenital anomaly. Even rarer, is its association with bladder duplication. We report a case of urethral duplication associated with bladder duplication in a seven-year-old boy who underwent retrograde urethrography, sonography and magnetic resonance (MR) imaging. WhiIe retrograde urethrography can demonstrate the extent of the duplicated urethra, MR imaging and sonography can provide detailed information on the anatomy of the adjacent tissues as well as urethral duplication
A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.
Cuypers, Thomas D; Hogeweg, Paulien
2014-04-01
Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and adaptation remains unknown. Here, we study the duplicate retention pattern postWGD, by letting virtual cells adapt to environmental changes. The virtual cells have structured genomes that encode a regulatory network and simple metabolism. Populations are under selection for homeostasis and evolve by point mutations, small indels and WGD. After populations had initially adapted fully to fluctuating resource conditions re-adaptation to a broad range of novel environments was studied by tracking mutations in the line of descent. WGD was established in a minority (≈30%) of lineages, yet, these were significantly more successful at re-adaptation. Unexpectedly, WGD lineages conserved more seemingly redundant genes, yet had higher per gene mutation rates. While WGD duplicates of all functional classes were significantly over-retained compared to a model of neutral losses, duplicate retention was clearly biased towards highly connected TFs. Importantly, no subfunctionalization occurred in conserved pairs, strongly suggesting that dosage balance shaped retention. Meanwhile, singles diverged significantly. WGD, therefore, is a powerful mechanism to cope with environmental change, allowing conservation of a core machinery, while adapting the peripheral network to accommodate change.
A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.
Directory of Open Access Journals (Sweden)
Thomas D Cuypers
2014-04-01
Full Text Available Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and adaptation remains unknown. Here, we study the duplicate retention pattern postWGD, by letting virtual cells adapt to environmental changes. The virtual cells have structured genomes that encode a regulatory network and simple metabolism. Populations are under selection for homeostasis and evolve by point mutations, small indels and WGD. After populations had initially adapted fully to fluctuating resource conditions re-adaptation to a broad range of novel environments was studied by tracking mutations in the line of descent. WGD was established in a minority (≈30% of lineages, yet, these were significantly more successful at re-adaptation. Unexpectedly, WGD lineages conserved more seemingly redundant genes, yet had higher per gene mutation rates. While WGD duplicates of all functional classes were significantly over-retained compared to a model of neutral losses, duplicate retention was clearly biased towards highly connected TFs. Importantly, no subfunctionalization occurred in conserved pairs, strongly suggesting that dosage balance shaped retention. Meanwhile, singles diverged significantly. WGD, therefore, is a powerful mechanism to cope with environmental change, allowing conservation of a core machinery, while adapting the peripheral network to accommodate change.
Rasmussen, S. R.; Füchtbauer, W.; Novero, M.; Volpe, V.; Malkov, N.; Genre, A.; Bonfante, P.; Stougaard, J.; Radutoiu, S.
2016-07-01
Functional divergence of paralogs following gene duplication is one of the mechanisms leading to evolution of novel pathways and traits. Here we show that divergence of Lys11 and Nfr5 LysM receptor kinase paralogs of Lotus japonicus has affected their specificity for lipochitooligosaccharides (LCOs) decorations, while the innate capacity to recognize and induce a downstream signalling after perception of rhizobial LCOs (Nod factors) was maintained. Regardless of this conserved ability, Lys11 was found neither expressed, nor essential during nitrogen-fixing symbiosis, providing an explanation for the determinant role of Nfr5 gene during Lotus-rhizobia interaction. Lys11 was expressed in root cortex cells associated with intraradical colonizing arbuscular mycorrhizal fungi. Detailed analyses of lys11 single and nfr1nfr5lys11 triple mutants revealed a functional arbuscular mycorrhizal symbiosis, indicating that Lys11 alone, or its possible shared function with the Nod factor receptors is not essential for the presymbiotic phases of AM symbiosis. Hence, both subfunctionalization and specialization appear to have shaped the function of these paralogs where Lys11 acts as an AM-inducible gene, possibly to fine-tune later stages of this interaction.
Duplication of 20p12.3 associated with familial Wolff-Parkinson-White syndrome.
Mills, Kimberly I; Anderson, Jacqueline; Levy, Philip T; Cole, F Sessions; Silva, Jennifer N A; Kulkarni, Shashikant; Shinawi, Marwan
2013-01-01
Wolff-Parkinson-White (WPW) syndrome is caused by preexcitation of the ventricular myocardium via an accessory pathway which increases the risk for paroxysmal supraventricular tachycardia. The condition is often sporadic and of unknown etiology in the majority of cases. Autosomal dominant inheritance and association with congenital heart defects or ventricular hypertrophy were described. Microdeletions of 20p12.3 have been associated with WPW syndrome with either cognitive dysfunction or Alagille syndrome. Here, we describe the association of 20p12.3 duplication with WPW syndrome in a patient who presented with non-immune hydrops. Her paternal uncle carries the duplication and has attention-deficit hyperactivity disorder and electrocardiographic findings consistent with WPW. The 769 kb duplication was detected by the Affymetrix Whole Genome-Human SNP Array 6.0 and encompasses two genes and the first two exons of a third gene. We discuss the potential role of the genes in the duplicated region in the pathogenesis of WPW and possible neurobehavioral abnormalities. Our data provide additional support for a significant role of 20p12.3 chromosomal rearrangements in the etiology of WPW syndrome. Copyright © 2012 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Benner Steven A
2005-03-01
Full Text Available Abstract Background Blocks of duplicated genomic DNA sequence longer than 1000 base pairs are known as low copy repeats (LCRs. Identified by their sequence similarity, LCRs are abundant in the human genome, and are interesting because they may represent recent adaptive events, or potential future adaptive opportunities within the human lineage. Sequence analysis tools are needed, however, to decide whether these interpretations are likely, whether a particular set of LCRs represents nearly neutral drift creating junk DNA, or whether the appearance of LCRs reflects assembly error. Here we investigate an LCR family containing the sulfotransferase (SULT 1A genes involved in drug metabolism, cancer, hormone regulation, and neurotransmitter biology as a first step for defining the problems that those tools must manage. Results Sequence analysis here identified a fourth sulfotransferase gene, which may be transcriptionally active, located on human chromosome 16. Four regions of genomic sequence containing the four human SULT1A paralogs defined a new LCR family. The stem hominoid SULT1A progenitor locus was identified by comparative genomics involving complete human and rodent genomes, and a draft chimpanzee genome. SULT1A expansion in hominoid genomes was followed by positive selection acting on specific protein sites. This episode of adaptive evolution appears to be responsible for the dopamine sulfonation function of some SULT enzymes. Each of the conclusions that this bioinformatic analysis generated using data that has uncertain reliability (such as that from the chimpanzee genome sequencing project has been confirmed experimentally or by a "finished" chromosome 16 assembly, both of which were published after the submission of this manuscript. Conclusion SULT1A genes expanded from one to four copies in hominoids during intra-chromosomal LCR duplications, including (apparently one after the divergence of chimpanzees and humans. Thus, LCRs may
The Brassica oleracea genome reveals the asymmetrical evolution of polyploid genomes
Liu, Shengyi; Liu, Yumei; Yang, Xinhua; Tong, Chaobo; Edwards, David; Parkin, Isobel A. P.; Zhao, Meixia; Ma, Jianxin; Yu, Jingyin; Huang, Shunmou; Wang, Xiyin; Wang, Junyi; Lu, Kun; Fang, Zhiyuan; Bancroft, Ian; Yang, Tae-Jin; Hu, Qiong; Wang, Xinfa; Yue, Zhen; Li, Haojie; Yang, Linfeng; Wu, Jian; Zhou, Qing; Wang, Wanxin; King, Graham J; Pires, J. Chris; Lu, Changxin; Wu, Zhangyan; Sampath, Perumal; Wang, Zhuo; Guo, Hui; Pan, Shengkai; Yang, Limei; Min, Jiumeng; Zhang, Dong; Jin, Dianchuan; Li, Wanshun; Belcram, Harry; Tu, Jinxing; Guan, Mei; Qi, Cunkou; Du, Dezhi; Li, Jiana; Jiang, Liangcai; Batley, Jacqueline; Sharpe, Andrew G; Park, Beom-Seok; Ruperao, Pradeep; Cheng, Feng; Waminal, Nomar Espinosa; Huang, Yin; Dong, Caihua; Wang, Li; Li, Jingping; Hu, Zhiyong; Zhuang, Mu; Huang, Yi; Huang, Junyan; Shi, Jiaqin; Mei, Desheng; Liu, Jing; Lee, Tae-Ho; Wang, Jinpeng; Jin, Huizhe; Li, Zaiyun; Li, Xun; Zhang, Jiefu; Xiao, Lu; Zhou, Yongming; Liu, Zhongsong; Liu, Xuequn; Qin, Rui; Tang, Xu; Liu, Wenbin; Wang, Yupeng; Zhang, Yangyong; Lee, Jonghoon; Kim, Hyun Hee; Denoeud, France; Xu, Xun; Liang, Xinming; Hua, Wei; Wang, Xiaowu; Wang, Jun; Chalhoub, Boulos; Paterson, Andrew H
2014-01-01
Polyploidization has provided much genetic variation for plant adaptive evolution, but the mechanisms by which the molecular evolution of polyploid genomes establishes genetic architecture underlying species differentiation are unclear. Brassica is an ideal model to increase knowledge of polyploid evolution. Here we describe a draft genome sequence of Brassica oleracea, comparing it with that of its sister species B. rapa to reveal numerous chromosome rearrangements and asymmetrical gene loss in duplicated genomic blocks, asymmetrical amplification of transposable elements, differential gene co-retention for specific pathways and variation in gene expression, including alternative splicing, among a large number of paralogous and orthologous genes. Genes related to the production of anticancer phytochemicals and morphological variations illustrate consequences of genome duplication and gene divergence, imparting biochemical and morphological variation to B. oleracea. This study provides insights into Brassica genome evolution and will underpin research into the many important crops in this genus. PMID:24852848
Directory of Open Access Journals (Sweden)
Keith A Hultman
2007-01-01
Full Text Available The retention of particular genes after the whole genome duplication in zebrafish has given insights into how genes may evolve through partitioning of ancestral functions. We examine the partitioning of expression patterns and functions of two zebrafish kit ligands, kit ligand a (kitla and kit ligand b (kitlb, and discuss their possible coevolution with the duplicated zebrafish kit receptors (kita and kitb. In situ hybridizations show that kitla mRNA is expressed in the trunk adjacent to the notochord in the middle of each somite during stages of melanocyte migration and later expressed in the skin, when the receptor is required for melanocyte survival. kitla is also expressed in other regions complementary to kita receptor expression, including the pineal gland, tail bud, and ear. In contrast, kitlb mRNA is expressed in brain ventricles, ear, and cardinal vein plexus, in regions generally not complementary to either zebrafish kit receptor ortholog. However, like kitla, kitlb is expressed in the skin during stages consistent with melanocyte survival. Thus, it appears that kita and kitla have maintained congruent expression patterns, while kitb and kitlb have evolved divergent expression patterns. We demonstrate the interaction of kita and kitla by morpholino knockdown analysis. kitla morphants, but not kitlb morphants, phenocopy the null allele of kita, with defects for both melanocyte migration and survival. Furthermore, kitla morpholino, but not kitlb morpholino, interacts genetically with a sensitized allele of kita, confirming that kitla is the functional ligand to kita. Last, we examine kitla overexpression in embryos, which results in hyperpigmentation caused by an increase in the number and size of melanocytes. This hyperpigmentation is dependent on kita function. We conclude that following genome duplication, kita and kitla have maintained their receptor-ligand relationship, coevolved complementary expression patterns, and that
Molecular evolution of the polyamine oxidase gene family in Metazoa
Directory of Open Access Journals (Sweden)
Polticelli Fabio
2012-06-01
monophyletic clades including, respectively, all the SMOs and APAOs from vertebrates. The two vertebrate monophyletic clades clustered strictly mirroring the organismal phylogeny of fishes, amphibians, reptiles, birds, and mammals. Evidences from comparative genomic analysis, structural evolution and functional divergence in a phylogenetic framework across Metazoa suggested an evolutionary scenario where the ancestor PAO coding sequence, present in invertebrates as an orthologous gene, has been duplicated in the vertebrate branch to originate the paralogous SMO and APAO genes. A further genome evolution event concerns the SMO gene of placental, but not marsupial and monotremate, mammals which increased its functional variation following an alternative splicing (AS mechanism. Conclusions In this study the explicit integration in a phylogenomic framework of phylogenetic tree construction, structure prediction, and biochemical function data/prediction, allowed inferring the molecular evolutionary history of the PAO gene family and to disambiguate paralogous genes related by duplication event (SMO and APAO and orthologous genes related by speciation events (PAOs, SMOs/APAOs. Further, while in vertebrates experimental data corroborate SMO and APAO molecular function predictions, in invertebrates the finding of a supported phylogenetic clusters of insect PAOs and the co-occurrence of two PAO variants in the amphioxus urgently claim the need for future structure-function studies.
Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile
2011-07-01
Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the
Directory of Open Access Journals (Sweden)
Philippe Ganot
2011-07-01
Full Text Available Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion, which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones or aposymbiotic (also called bleached A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm. A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both
Gene conversion limits divergence of mammalian TLR1 and TLR6
Directory of Open Access Journals (Sweden)
Dunoyer-Geindre Sylvie
2007-08-01
Full Text Available Abstract Background Toll-like receptors (TLR recognize pathogen-associated molecular patterns and are important mediators of the innate immune system. TLR1 and TLR6 are paralogs and located in tandem on the same chromosome in mammals. They form heterodimers with TLR2 and bind lipopeptide components of gram-positive and gram-negative bacterial cell walls. To identify conserved stretches in TLR1 and TLR6, that may be important for their function, we compared their protein sequences in nine mammalian species(Homo sapiens, Pan troglodytes, Macaca mulatta, Mus musculus, Rattus norvegicus; Erinaceus europaeus, Bos Taurus, Sus scrofa and Canis familiaris. Results The N-terminal sequences of the orthologous proteins showed greater similarity than corresponding paralog sequences. However, we identified a region of 300 amino acids towards the C-terminus of TLR1 and TLR6, where paralogs had a greater degree of sequence identity than orthologs. Preservation of DNA sequence identity of paralogs in this region was observed in all nine mammalian species investigated, and is due to independent gene conversion events. The regions having undergone gene conversion in each species are almost identical and encode the leucine-rich repeat motifs 16 to 19, the C-terminal cap motif, the transmembrane domain and most of the intracellular Toll/interleukin-1 receptor (TIR domain. Conclusion Our results show that, for a specific conserved region, divergence of TLR1 and TLR6 is limited by gene conversion, most likely because of the need for co-evolution with multiple intracellular and extracellular binding partners. Thus, gene conversion provides a mechanism for limiting the divergence of functional regions of protein paralogs, while allowing other domains to evolve diversified functions.
Contrasting patterns in the evolution of the Rab GTPase family in Archaeplastida
Directory of Open Access Journals (Sweden)
Romana Petrželková
2014-12-01
Full Text Available Rab GTPases are a vast group of proteins serving a role of master regulators in membrane trafficking in eukaryotes. Previous studies delineated some 23 Rab and Rab-like paralogs ancestral for eukaryotes and mapped their current phylogenetic distribution, but the analyses relied on a limited sampling of the eukaryotic diversity. Taking advantage of the recent growth of genome and transcriptome resources for phylogenetically diverse plants and algae, we reanalyzed the evolution of the Rab family in eukaryotes with the primary plastid, collectively constituting the presumably monophyletic supergroup Archaeplastida. Our most important novel findings are as follows: (i the ancestral set of Rabs in Archaeplastida included not only the paralogs Rab1, Rab2, Rab5, Rab6, Rab7, Rab8, Rab11, Rab18, Rab23, Rab24, Rab28, IFT27, and RTW (=Rabl2, as suggested previously, but also Rab14 and Rab34, because Rab14 exists in glaucophytes and Rab34 is present in glaucophytes and some green algae; (ii except in embryophytes, Rab gene duplications have been rare in Archaeplastida. Most notable is the independent emergence of divergent, possibly functionally novel, in-paralogs of Rab1 and Rab11 in several archaeplastidial lineages; (iii recurrent gene losses have been a significant factor shaping Rab gene complements in archaeplastidial species; for example, the Rab21 paralog was lost at least six times independently within Archaeplastida, once in the lineage leading to the “core” eudicots; (iv while the glaucophyte Cyanophora paradoxa has retained the highest number of ancestral Rab paralogs among all archaeplastidial species studied so far, rhodophytes underwent an extreme reduction of the Rab gene set along their stem lineage, resulting in only six paralogs (Rab1, Rab2, Rab6, Rab7, Rab11, and Rab18 present in modern red algae. Especially notable is the absence of Rab5, a virtually universal paralog essential for the endocytic pathway, suggesting that endocytosis
Aalfs, C. M.; Fantes, J. A.; Wenniger-Prick, L. J.; Sluijter, S.; Hennekam, R. C.; van Heyningen, V.; Hoovers, J. M.
1997-01-01
We report on a girl with a duplication of chromosome band 11p12-->13, which includes the Wilms tumor gene (WT1) and the aniridia gene (PAX6). The girl had borderline developmental delay, mild facial anomalies, and eye abnormalities. Eye findings were also present in most of the 11 other published
Chevanne, Damien; Saupe, Sven J; Clavé, Corinne; Paoletti, Mathieu
2010-05-06
Genes involved in non-self recognition and host defence are typically capable of rapid diversification and exploit specialized genetic mechanism to that end. Fungi display a non-self recognition phenomenon termed heterokaryon incompatibility that operates when cells of unlike genotype fuse and leads to the cell death of the fusion cell. In the fungus Podospora anserina, three genes controlling this allorecognition process het-d, het-e and het-r are paralogs belonging to the same hnwd gene family. HNWD proteins are STAND proteins (signal transduction NTPase with multiple domains) that display a WD-repeat domain controlling recognition specificity. Based on genomic sequence analysis of different P. anserina isolates, it was established that repeat regions of all members of the gene family are extremely polymorphic and undergoing concerted evolution arguing for frequent recombination within and between family members. Herein, we directly analyzed the genetic instability and diversification of this allorecognition gene family. We have constituted a collection of 143 spontaneous mutants of the het-R (HNWD2) and het-E (hnwd5) genes with altered recognition specificities. The vast majority of the mutants present rearrangements in the repeat arrays with deletions, duplications and other modifications as well as creation of novel repeat unit variants. We investigate the extreme genetic instability of these genes and provide a direct illustration of the diversification strategy of this eukaryotic allorecognition gene family.
Duplicate retention in signalling proteins and constraints from network dynamics.
Soyer, O S; Creevey, C J
2010-11-01
Duplications are a major driving force behind evolution. Most duplicates are believed to fix through genetic drift, but it is not clear whether this process affects all duplications equally or whether there are certain gene families that are expected to show neutral expansions under certain circumstances. Here, we analyse the neutrality of duplications in different functional classes of signalling proteins based on their effects on response dynamics. We find that duplications involving intermediary proteins in a signalling network are neutral more often than those involving receptors. Although the fraction of neutral duplications in all functional classes increase with decreasing population size and selective pressure on dynamics, this effect is most pronounced for receptors, indicating a possible expansion of receptors in species with small population size. In line with such an expectation, we found a statistically significant increase in the number of receptors as a fraction of genome size in eukaryotes compared with prokaryotes. Although not confirmative, these results indicate that neutral processes can be a significant factor in shaping signalling networks and affect proteins from different functional classes differently. © 2010 The Authors. Journal Compilation © 2010 European Society For Evolutionary Biology.
Baurens, Franc-Christophe; Bocs, Stéphanie; Rouard, Mathieu; Matsumoto, Takashi; Miller, Robert N G; Rodier-Goud, Marguerite; MBéguié-A-MBéguié, Didier; Yahiaoui, Nabila
2010-07-16
Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. A
Churova, Maria V; Meshcheryakova, Olga V; Ruchev, Mikhail; Nemova, Nina N
2017-09-01
This study was conducted to characterize the features of muscle-specific genes expression during development of brown trout Salmo trutta inhabiting the river Krivoy ruchey (Kola Peninsula, Russia). Gene expression levels of myogenic regulatory factors (MRFs - MyoD1 paralogs (MyoD1a, MyoD1b, MyoD1c), Myf5, myogenin), myostatin paralogs (MSTN-1a, MSTN-1b, MSTN-2a), fast skeletal myosin heavy chain (MyHC) were measured in the white muscles of brown trout parr of ages 0+ (under-yearling), 1+ (yearling) and 2+ (two year old) and smolts of age 2+. Multidirectional changes in MyoD1 and MSTN paralogs expression along with myogenin, Myf 5 and MyHC expression levels in white muscles in parr of trout with age were revealed. The expression of MyoD1c, myogenin, MSTN-2a was the highest in 0+ parr and then decreased. MyoD1a/b expression levels didn't differ between age groups. The simultaneous elevation of MyHC, Myf5, MSTN-1a, and MSTN-1b was found in trout yearlings. In smolts, expression levels of MSTN paralogs, MyHC, Myf5, MyoD1a was lower than in parr. But in contrast, the MyoD1c and myogenin mRNA levels was higher in smolts. The study revealed that there are definite patterns in simultaneous muscle-specific genes expression in age groups of parr and smolts. As MyoD and MSTN paralogs expression changed differently in dependence on age and stage, it was suggested that paralogs of the same gene complementarily control myogenesis during development. Copyright © 2017 Elsevier Inc. All rights reserved.
Analysis of the reptile CD1 genes: evolutionary implications.
Yang, Zhi; Wang, Chunyan; Wang, Tao; Bai, Jianhui; Zhao, Yu; Liu, Xuhan; Ma, Qingwei; Wu, Xiaobing; Guo, Ying; Zhao, Yaofeng; Ren, Liming
2015-06-01
CD1, as the third family of antigen-presenting molecules, is previously only found in mammals and chickens, which suggests that the chicken and mammalian CD1 shared a common ancestral gene emerging at least 310 million years ago. Here, we describe CD1 genes in the green anole lizard and Crocodylia, demonstrating that CD1 is ubiquitous in mammals, birds, and reptiles. Although the reptilian CD1 protein structures are predicted to be similar to human CD1d and chicken CD1.1, CD1 isotypes are not found to be orthologous between mammals, birds, and reptiles according to phylogenetic analyses, suggesting an independent diversification of CD1 isotypes during the speciation of mammals, birds, and reptiles. In the green anole lizard, although the single CD1 locus and MHC I gene are located on the same chromosome, there is an approximately 10-Mb-long sequence in between, and interestingly, several genes flanking the CD1 locus belong to the MHC paralogous region on human chromosome 19. The CD1 genes in Crocodylia are located in two loci, respectively linked to the MHC region and MHC paralogous region (corresponding to the MHC paralogous region on chromosome 19). These results provide new insights for studying the origin and evolution of CD1.
Evolutionary analysis of the highly dynamic CHEK2 duplicon in anthropoids
Directory of Open Access Journals (Sweden)
Fernandes António MG
2008-10-01
Full Text Available Abstract Background Segmental duplications (SDs are euchromatic portions of genomic DNA (≥ 1 kb that occur at more than one site within the genome, and typically share a high level of sequence identity (>90%. Approximately 5% of the human genome is composed of such duplicated sequences. Here we report the detailed investigation of CHEK2 duplications. CHEK2 is a multiorgan cancer susceptibility gene encoding a cell cycle checkpoint kinase acting in the DNA-damage response signalling pathway. The continuous presence of the CHEK2 gene in all eukaryotes and its important role in maintaining genome stability prompted us to investigate the duplicative evolution and phylogeny of CHEK2 and its paralogs during anthropoid evolution. Results To study CHEK2 duplicon evolution in anthropoids we applied a combination of comparative FISH and in silico analyses. Our comparative FISH results with a CHEK2 fosmid probe revealed the single-copy status of CHEK2 in New World monkeys, Old World monkeys and gibbons. Whereas a single CHEK2 duplication was detected in orangutan, a multi-site signal pattern indicated a burst of duplication in African great apes and human. Phylogenetic analysis of paralogous and ancestral CHEK2 sequences in human, chimpanzee and rhesus macaque confirmed this burst of duplication, which occurred after the radiation of orangutan and African great apes. In addition, we used inter-species quantitative PCR to determine CHEK2 copy numbers. An amplification of CHEK2 was detected in African great apes and the highest CHEK2 copy number of all analysed species was observed in the human genome. Furthermore, we detected variation in CHEK2 copy numbers within the analysed set of human samples. Conclusion Our detailed analysis revealed the highly dynamic nature of CHEK2 duplication during anthropoid evolution. We determined a burst of CHEK2 duplication after the radiation of orangutan and African great apes and identified the highest CHEK2 copy number
Directory of Open Access Journals (Sweden)
Hewitt Jane E
2010-11-01
Full Text Available Abstract Background DUX4 is causally involved in the molecular pathogenesis of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD. It has previously been proposed to have arisen by retrotransposition of DUXC, one of four known intron-containing DUX genes. Here, we investigate the evolutionary history of this multi-member double-homeobox gene family in eutherian mammals. Results Our analysis of the DUX family shows the distribution of different homologues across the mammalian class, including events of secondary loss. Phylogenetic comparison, analysis of gene structures and information from syntenic regions confirm the paralogous relationship of Duxbl and DUXB and characterize their relationship with DUXA and DUXC. We further identify Duxbl pseudogene orthologues in primates. A survey of non-mammalian genomes identified a single-homeobox gene (sDUX as a likely representative homologue of the mammalian DUX ancestor before the homeobox duplication. Based on the gene structure maps, we suggest a possible mechanism for the generation of the DUX gene structure. Conclusions Our study underlines how secondary loss of orthologues can obscure the true ancestry of individual gene family members. Their relationships should be considered when interpreting the relevance of functional data from DUX4 homologues such as Dux and Duxbl to FSHD.
International Nuclear Information System (INIS)
Thompson, Ella; Dragovic, Rebecca L; Stephenson, Sally-Anne; Eccles, Diana M; Campbell, Ian G; Dobrovic, Alexander
2005-01-01
The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer
Thompson, Ella; Dragovic, Rebecca L; Stephenson, Sally-Anne; Eccles, Diana M; Campbell, Ian G; Dobrovic, Alexander
2005-04-29
The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer.
Directory of Open Access Journals (Sweden)
Campbell Ian G
2005-04-01
Full Text Available Abstract The FANCA gene is one of the genes in which mutations lead to Fanconi anaemia, a rare autosomal recessive disorder characterised by congenital abnormalities, bone marrow failure, and predisposition to malignancy. FANCA is also a potential breast and ovarian cancer susceptibility gene. A novel allele was identified which has a tandem duplication of a 13 base pair sequence in the promoter region. Methods We screened germline DNA from 352 breast cancer patients, 390 ovarian cancer patients and 256 normal controls to determine if the presence of either of these two alleles was associated with an increased risk of breast or ovarian cancer. Results The duplication allele had a frequency of 0.34 in the normal controls. There was a non-significant decrease in the frequency of the duplication allele in breast cancer patients. The frequency of the duplication allele was significantly decreased in ovarian cancer patients. However, when malignant and benign tumours were considered separately, the decrease was only significant in benign tumours. Conclusion The allele with the tandem duplication does not appear to modify breast cancer risk but may act as a low penetrance protective allele for ovarian cancer.
Directory of Open Access Journals (Sweden)
Levasseur Anthony
2011-02-01
Full Text Available Abstract Understanding the evolutionary plasticity of the genome requires a global, comparative approach in which genetic events are considered both in a phylogenetic framework and with regard to population genetics and environmental variables. In the mechanisms that generate adaptive and non-adaptive changes in genomes, segmental duplications (duplication of individual genes or genomic regions and polyploidization (whole genome duplications are well-known driving forces. The probability of fixation and maintenance of duplicates depends on many variables, including population sizes and selection regimes experienced by the corresponding genes: a combination of stochastic and adaptive mechanisms has shaped all genomes. A survey of experimental work shows that the distinction made between fixation and maintenance of duplicates still needs to be conceptualized and mathematically modeled. Here we review the mechanisms that increase or decrease the probability of fixation or maintenance of duplicated genes, and examine the outcome of these events on the adaptation of the organisms. Reviewers This article was reviewed by Dr. Etienne Joly, Dr. Lutz Walter and Dr. W. Ford Doolittle.
Armesto, Paula; Infante, Carlos; Cousin, Xavier; Ponce, Marian; Manchado, Manuel
2015-04-01
In the present work, seven genes encoding Na(+),K(+)-ATPase (NKA) β-subunits in the teleost Solea senegalensis are described for the first time. Sequence analysis of the predicted polypeptides revealed a high degree of conservation with those of other vertebrate species and maintenance of important motifs involved in structure and function. Phylogenetic analysis clustered the seven genes into four main clades: β1 (atp1b1a and atp1b1b), β2 (atp1b2a and atp1b2b), β3 (atp1b3a and atp1b3b) and β4 (atp1b4). In juveniles, all paralogous transcripts were detected in the nine tissues examined albeit with different expression patterns. The most ubiquitous expressed gene was atp1b1a whereas atp1b1b was mainly detected in osmoregulatory organs (gill, kidney and intestine), and atp1b2a, atp1b2b, atp1b3a, atp1b3b and atp1b4 in brain. An expression analysis in three brain regions and pituitary revealed that β1-type transcripts were more abundant in pituitary than the other β paralogs with slight differences between brain regions. Quantification of mRNA abundance in gills after a salinity challenge showed an activation of atp1b1a and atp1b1b at high salinity water (60 ppt) and atp1b3a and atp1b3b in response to low salinity (5 ppt). Transcriptional analysis during larval development showed specific expression patterns for each paralog. Moreover, no differences in the expression profiles between larvae cultivated at 10 and 35 ppt were observed except for atp1b4 with higher mRNA levels at 10 than 35 ppt at 18 days post hatch. Whole-mount in situ hybridization analysis revealed that atp1b1b was mainly localized in gut, pronephric tubule, gill, otic vesicle, and chordacentrum of newly hatched larvae. All these data suggest distinct roles of NKA β subunits in tissues, during development and osmoregulation with β1 subunits involved in the adaptation to hyperosmotic conditions and β3 subunits to hypoosmotic environments. Copyright © 2014 Elsevier Inc. All rights reserved.
Genetics Home Reference: 7q11.23 duplication syndrome
... Duplication Syndrome. 2015 Nov 25. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Ledbetter N, Mefford HC, Smith RJH, Stephens K, editors. GeneReviews® [Internet]. Seattle (WA): ...
Evolution of cholinesterases in the animal kingdom.
Pezzementi, Leo; Chatonnet, Arnaud
2010-09-06
Cholinesterases emerged from a family of enzymes and proteins with adhesion properties. This family is absent in plants and expanded in multicellular animals. True cholinesterases appeared in triploblastic animals together with the cholinergic system. Lineage specific duplications resulted in two acetylcholinesterases in most hexapods and in up to four genes in nematodes. In vertebrates the duplication leading to acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) is now considered to be an ancient event which occurred before the split of osteichthyes. The product of one or the other of the paralogues is responsible for the physiological hydrolysis of acetylcholine, depending on the species lineage and tissue considered. The BChE gene seems to have been lost in some fish lineages. The complete genome of amphioxus (Branchiostoma floridae: cephalochordate) contains a large number of duplicated genes or pseudogenes of cholinesterases. Sequence comparison and tree constructions raise the question of considering the atypical ChE studied in this organism as a representative of ancient BChE. Thus nematodes, arthropods, annelids, molluscs, and vertebrates typically possess two paralogous genes coding for cholinesterases. The origin of the duplication(s) is discussed. The mode of attachment through alternative C-terminal coding exons seems to have evolved independently from the catalytic part of the gene. Copyright (c) 2010 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Michael M Magwire
2011-10-01
Full Text Available To understand the molecular basis of how hosts evolve resistance to their parasites, we have investigated the genes that cause variation in the susceptibility of Drosophila melanogaster to viral infection. Using a host-specific pathogen of D. melanogaster called the sigma virus (Rhabdoviridae, we mapped a major-effect polymorphism to a region containing two paralogous genes called CHKov1 and CHKov2. In a panel of inbred fly lines, we found that a transposable element insertion in the protein coding sequence of CHKov1 is associated with increased resistance to infection. Previous research has shown that this insertion results in a truncated messenger RNA that encodes a far shorter protein than the susceptible allele. This resistant allele has rapidly increased in frequency under directional selection and is now the commonest form of the gene in natural populations. Using genetic mapping and site-specific recombination, we identified a third genotype with considerably greater resistance that is currently rare in the wild. In these flies there have been two duplications, resulting in three copies of both the truncated allele of CHKov1 and CHKov2 (one of which is also truncated. Remarkably, the truncated allele of CHKov1 has previously been found to confer resistance to organophosphate insecticides. As estimates of the age of this allele predate the use of insecticides, it is likely that this allele initially functioned as a defence against viruses and fortuitously "pre-adapted" flies to insecticides. These results demonstrate that strong selection by parasites for increased host resistance can result in major genetic changes and rapid shifts in allele frequencies; and, contrary to the prevailing view that resistance to pathogens can be a costly trait to evolve, the pleiotropic effects of these changes can have unexpected benefits.
Yuan, Haiming; Huang, Linhuan; Hu, Xizi; Li, Qian; Sun, Xiaofang; Xie, Yingjun; Kong, Shu; Wang, Xiaoman
2016-07-02
Achondroplasia is a well-defined and common bone dysplasia. Genotype- and phenotype-level correlations have been found between the clinical symptoms of achondroplasia and achondroplasia-specific FGFR3 mutations. A 2-year-old boy with clinical features consistent with achondroplasia and Silver-Russell syndrome-like symptoms was found to carry a mutation in the fibroblast growth factor receptor-3 (FGFR3) gene at c.1138G > A (p.Gly380Arg) and a de novo 574 kb duplication at chromosome 7p12.1 that involved the entire growth-factor receptor bound protein 10 (GRB10) gene. Using quantitative real-time PCR analysis, GRB10 was over-expressed, and, using enzyme-linked immunosorbent assays for IGF1 and IGF-binding protein-3 (IGFBP3), we found that IGF1 and IGFBP3 were low-expressed in this patient. We demonstrate that a combination of uncommon, rare and exceptional molecular defects related to the molecular bases of particular birth defects can be analyzed and diagnosed to potentially explain the observed variability in the combination of molecular defects.
Gene duplication and divergence affecting drug content in Cannabis sativa.
Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David
2015-12-01
Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Discriminating the reaction types of plant type III polyketide synthases.
Shimizu, Yugo; Ogata, Hiroyuki; Goto, Susumu
2017-07-01
Functional prediction of paralogs is challenging in bioinformatics because of rapid functional diversification after gene duplication events combined with parallel acquisitions of similar functions by different paralogs. Plant type III polyketide synthases (PKSs), producing various secondary metabolites, represent a paralogous family that has undergone gene duplication and functional alteration. Currently, there is no computational method available for the functional prediction of type III PKSs. We developed a plant type III PKS reaction predictor, pPAP, based on the recently proposed classification of type III PKSs. pPAP combines two kinds of similarity measures: one calculated by profile hidden Markov models (pHMMs) built from functionally and structurally important partial sequence regions, and the other based on mutual information between residue positions. pPAP targets PKSs acting on ring-type starter substrates, and classifies their functions into four reaction types. The pHMM approach discriminated two reaction types with high accuracy (97.5%, 39/40), but its accuracy decreased when discriminating three reaction types (87.8%, 43/49). When combined with a correlation-based approach, all 49 PKSs were correctly discriminated, and pPAP was still highly accurate (91.4%, 64/70) even after adding other reaction types. These results suggest pPAP, which is based on linear discriminant analyses of similarity measures, is effective for plant type III PKS function prediction. pPAP is freely available at ftp://ftp.genome.jp/pub/tools/ppap/. goto@kuicr.kyoto-u.ac.jp. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Bijlsma, E K; Collins, A; Papa, F T; Tejada, M I; Wheeler, P; Peeters, E A J; Gijsbers, A C J; van de Kamp, J M; Kriek, M; Losekoot, M; Broekma, A J; Crolla, J A; Pollazzon, M; Mucciolo, M; Katzaki, E; Disciglio, V; Ferreri, M I; Marozza, A; Mencarelli, M A; Castagnini, C; Dosa, L; Ariani, F; Mari, F; Canitano, R; Hayek, G; Botella, M P; Gener, B; Mínguez, M; Renieri, A; Ruivenkamp, C A L
2012-06-01
Duplications leading to functional disomy of chromosome Xq28, including MECP2 as the critical dosage-sensitive gene, are associated with a distinct clinical phenotype in males, characterized by severe mental retardation, infantile hypotonia, progressive neurologic impairment, recurrent infections, bladder dysfunction, and absent speech. Female patients with Xq duplications including MECP2 are rare. Only recently submicroscopic duplications of this region on Xq28 have been recognized in four females, and a triplication in a fifth, all in combination with random X-chromosome inactivation (XCI). Based on this small series, it was concluded that in females with MECP2 duplication and random XCI, the typical symptoms of affected boys are not present. We present clinical and molecular data on a series of five females with an Xq28 duplication including the MECP2 gene, both isolated and as the result of a translocation, and compare them with the previously reported cases of small duplications in females. The collected data indicate that the associated phenotype in females is distinct from males with similar duplications, but the clinical effects may be as severe as seen in males. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Martínez-Alberola, Fernando; Del Campo, Eva M; Lázaro-Gimeno, David; Mezquita-Claramonte, Sergio; Molins, Arantxa; Mateu-Andrés, Isabel; Pedrola-Monfort, Joan; Casano, Leonardo M; Barreno, Eva
2013-01-01
Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt) in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.
Directory of Open Access Journals (Sweden)
Fernando Martínez-Alberola
Full Text Available Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.
XX male sex reversal with genital abnormalities associated with a de novo SOX3 gene duplication.
Moalem, Sharon; Babul-Hirji, Riyana; Stavropolous, Dmitri J; Wherrett, Diane; Bägli, Darius J; Thomas, Paul; Chitayat, David
2012-07-01
Differentiation of the bipotential gonad into testis is initiated by the Y chromosome-linked gene SRY (Sex-determining Region Y) through upregulation of its autosomal direct target gene SOX9 (Sry-related HMG box-containing gene 9). Sequence and chromosome homology studies have shown that SRY most probably evolved from SOX3, which in humans is located at Xq27.1. Mutations causing SOX3 loss-of-function do not affect the sex determination in mice or humans. However, transgenic mouse studies have shown that ectopic expression of Sox3 in the bipotential gonad results in upregulation of Sox9, resulting in testicular induction and XX male sex reversal. However, the mechanism by which these rearrangements cause sex reversal and the frequency with which they are associated with disorders of sex development remains unclear. Rearrangements of the SOX3 locus were identified recently in three cases of human XX male sex reversal. We report on a case of XX male sex reversal associated with a novel de novo duplication of the SOX3 gene. These data provide additional evidence that SOX3 gain-of-function in the XX bipotential gonad causes XX male sex reversal and further support the hypothesis that SOX3 is the evolutionary antecedent of SRY. Copyright © 2012 Wiley Periodicals, Inc.
p53 protects against genome instability following centriole duplication failure
Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield
2015-01-01
Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389
Directory of Open Access Journals (Sweden)
Hossein Gouran
2014-09-01
Full Text Available Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC, implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF. In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.
Questioning the ubiquity of neofunctionalization.
Directory of Open Access Journals (Sweden)
Todd A Gibson
2009-01-01
Full Text Available Gene duplication provides much of the raw material from which functional diversity evolves. Two evolutionary mechanisms have been proposed that generate functional diversity: neofunctionalization, the de novo acquisition of function by one duplicate, and subfunctionalization, the partitioning of ancestral functions between gene duplicates. With protein interactions as a surrogate for protein functions, evidence of prodigious neofunctionalization and subfunctionalization has been identified in analyses of empirical protein interactions and evolutionary models of protein interactions. However, we have identified three phenomena that have contributed to neofunctionalization being erroneously identified as a significant factor in protein interaction network evolution. First, self-interacting proteins are underreported in interaction data due to biological artifacts and design limitations in the two most common high-throughput protein interaction assays. Second, evolutionary inferences have been drawn from paralog analysis without consideration for concurrent and subsequent duplication events. Third, the theoretical model of prodigious neofunctionalization is unable to reproduce empirical network clustering and relies on untenable parameter requirements. In light of these findings, we believe that protein interaction evolution is more persuasively characterized by subfunctionalization and self-interactions.
Clinical features of SMARCA2 duplication overlap with Coffin-Siris syndrome.
Miyake, Noriko; Abdel-Salam, Ghada; Yamagata, Takanori; Eid, Maha M; Osaka, Hitoshi; Okamoto, Nobuhiko; Mohamed, Amal M; Ikeda, Takahiro; Afifi, Hanan H; Piard, Juliette; van Maldergem, Lionel; Mizuguchi, Takeshi; Miyatake, Satoko; Tsurusaki, Yoshinori; Matsumoto, Naomichi
2016-10-01
Coffin-Siris syndrome is a rare congenital malformation and intellectual disability syndrome. Mutations in at least seven genes have been identified. Here, we performed copy number analysis in 37 patients with features of CSS in whom no causative mutations were identified by exome sequencing. We identified a patient with a 9p24.3-p22.2 duplication and another patient with the chromosome der(6)t(6;9)(p25;p21)mat. Both patients share a duplicated 15.8-Mb region containing 46 protein coding genes, including SMARCA2. Dominant negative effects of SMARCA2 mutations may contribute to Nicolaides-Baraitser syndrome. We conclude that their features better resemble Coffin-Siris syndrome, rather than Nicolaides-Baraitser syndrome and that these features likely arise from SMARCA2 over-dosage. Pure 9p duplications (not caused by unbalanced translocations) are rare. Copy number analysis in patients with features that overlap with Coffin-Siris syndrome is recommended to further determine their genetic aspects. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
A phylogenomic gene cluster resource: The phylogeneticallyinferred groups (PhlGs) database
Energy Technology Data Exchange (ETDEWEB)
Dehal, Paramvir S.; Boore, Jeffrey L.
2005-08-25
We present here the PhIGs database, a phylogenomic resource for sequenced genomes. Although many methods exist for clustering gene families, very few attempt to create truly orthologous clusters sharing descent from a single ancestral gene across a range of evolutionary depths. Although these non-phylogenetic gene family clusters have been used broadly for gene annotation, errors are known to be introduced by the artifactual association of slowly evolving paralogs and lack of annotation for those more rapidly evolving. A full phylogenetic framework is necessary for accurate inference of function and for many studies that address pattern and mechanism of the evolution of the genome. The automated generation of evolutionary gene clusters, creation of gene trees, determination of orthology and paralogy relationships, and the correlation of this information with gene annotations, expression information, and genomic context is an important resource to the scientific community.
Tandemly Arrayed Genes in Vertebrate Genomes
Directory of Open Access Journals (Sweden)
Deng Pan
2008-01-01
Full Text Available Tandemly arrayed genes (TAGs are duplicated genes that are linked as neighbors on a chromosome, many of which have important physiological and biochemical functions. Here we performed a survey of these genes in 11 available vertebrate genomes. TAGs account for an average of about 14% of all genes in these vertebrate genomes, and about 25% of all duplications. The majority of TAGs (72–94% have parallel transcription orientation (i.e., they are encoded on the same strand in contrast to the genome, which has about 50% of its genes in parallel transcription orientation. The majority of tandem arrays have only two members. In all species, the proportion of genes that belong to TAGs tends to be higher in large gene families than in small ones; together with our recent finding that tandem duplication played a more important role than retroposition in large families, this fact suggests that among all types of duplication mechanisms, tandem duplication is the predominant mechanism of duplication, especially in large families. Finally, several species have a higher proportion of large tandem arrays that are species-specific than random expectation.
Reciprocal deletion and duplication at 2q23.1 indicates a role for MBD5 in autism spectrum disorder.
Mullegama, Sureni V; Rosenfeld, Jill A; Orellana, Carmen; van Bon, Bregje W M; Halbach, Sara; Repnikova, Elena A; Brick, Lauren; Li, Chumei; Dupuis, Lucie; Rosello, Monica; Aradhya, Swaroop; Stavropoulos, D James; Manickam, Kandamurugu; Mitchell, Elyse; Hodge, Jennelle C; Talkowski, Michael E; Gusella, James F; Keller, Kory; Zonana, Jonathan; Schwartz, Stuart; Pyatt, Robert E; Waggoner, Darrel J; Shaffer, Lisa G; Lin, Angela E; de Vries, Bert B A; Mendoza-Londono, Roberto; Elsea, Sarah H
2014-01-01
Copy number variations associated with abnormal gene dosage have an important role in the genetic etiology of many neurodevelopmental disorders, including intellectual disability (ID) and autism. We hypothesize that the chromosome 2q23.1 region encompassing MBD5 is a dosage-dependent region, wherein deletion or duplication results in altered gene dosage. We previously established the 2q23.1 microdeletion syndrome and report herein 23 individuals with 2q23.1 duplications, thus establishing a complementary duplication syndrome. The observed phenotype includes ID, language impairments, infantile hypotonia and gross motor delay, behavioral problems, autistic features, dysmorphic facial features (pinnae anomalies, arched eyebrows, prominent nose, small chin, thin upper lip), and minor digital anomalies (fifth finger clinodactyly and large broad first toe). The microduplication size varies among all cases and ranges from 68 kb to 53.7 Mb, encompassing a region that includes MBD5, an important factor in methylation patterning and epigenetic regulation. We previously reported that haploinsufficiency of MBD5 is the primary causal factor in 2q23.1 microdeletion syndrome and that mutations in MBD5 are associated with autism. In this study, we demonstrate that MBD5 is the only gene in common among all duplication cases and that overexpression of MBD5 is likely responsible for the core clinical features present in 2q23.1 microduplication syndrome. Phenotypic analyses suggest that 2q23.1 duplication results in a slightly less severe phenotype than the reciprocal deletion. The features associated with a deletion, mutation or duplication of MBD5 and the gene expression changes observed support MBD5 as a dosage-sensitive gene critical for normal development.
Duplications of the neuropeptide receptor gene VIPR2 confer significant risk for schizophrenia.
LENUS (Irish Health Repository)
Vacic, Vladimir
2011-03-24
Rare copy number variants (CNVs) have a prominent role in the aetiology of schizophrenia and other neuropsychiatric disorders. Substantial risk for schizophrenia is conferred by large (>500-kilobase) CNVs at several loci, including microdeletions at 1q21.1 (ref. 2), 3q29 (ref. 3), 15q13.3 (ref. 2) and 22q11.2 (ref. 4) and microduplication at 16p11.2 (ref. 5). However, these CNVs collectively account for a small fraction (2-4%) of cases, and the relevant genes and neurobiological mechanisms are not well understood. Here we performed a large two-stage genome-wide scan of rare CNVs and report the significant association of copy number gains at chromosome 7q36.3 with schizophrenia. Microduplications with variable breakpoints occurred within a 362-kilobase region and were detected in 29 of 8,290 (0.35%) patients versus 2 of 7,431 (0.03%) controls in the combined sample. All duplications overlapped or were located within 89 kilobases upstream of the vasoactive intestinal peptide receptor gene VIPR2. VIPR2 transcription and cyclic-AMP signalling were significantly increased in cultured lymphocytes from patients with microduplications of 7q36.3. These findings implicate altered vasoactive intestinal peptide signalling in the pathogenesis of schizophrenia and indicate the VPAC2 receptor as a potential target for the development of new antipsychotic drugs.
Duplicate editorial on duplicate publication.
Corson, Stephen L; Decherney, Alan H
2005-04-01
The authors define and discuss the various forms taken by duplicate publications, and provide suggested remedies to help authors, editors, reviewers, and readers avoid this form of internal plagiarism.
Drews, Anna; Strandh, Maria; Råberg, Lars; Westerdahl, Helena
2017-06-26
The Major Histocompatibility Complex (MHC) plays a central role in immunity and has been given considerable attention by evolutionary ecologists due to its associations with fitness-related traits. Songbirds have unusually high numbers of MHC class I (MHC-I) genes, but it is not known whether all are expressed and equally important for immune function. Classical MHC-I genes are highly expressed, polymorphic and present peptides to T-cells whereas non-classical MHC-I genes have lower expression, are more monomorphic and do not present peptides to T-cells. To get a better understanding of the highly duplicated MHC genes in songbirds, we studied gene expression in a phylogenetic framework in three species of sparrows (house sparrow, tree sparrow and Spanish sparrow), using high-throughput sequencing. We hypothesize that sparrows could have classical and non-classical genes, as previously indicated though never tested using gene expression. The phylogenetic analyses reveal two distinct types of MHC-I alleles among the three sparrow species, one with high and one with low level of polymorphism, thus resembling classical and non-classical genes, respectively. All individuals had both types of alleles, but there was copy number variation both within and among the sparrow species. However, the number of highly polymorphic alleles that were expressed did not vary between species, suggesting that the structural genomic variation is counterbalanced by conserved gene expression. Overall, 50% of the MHC-I alleles were expressed in sparrows. Expression of the highly polymorphic alleles was very variable, whereas the alleles with low polymorphism had uniformly low expression. Interestingly, within an individual only one or two alleles from the polymorphic genes were highly expressed, indicating that only a single copy of these is highly expressed. Taken together, the phylogenetic reconstruction and the analyses of expression suggest that sparrows have both classical and non
Rooting gene trees without outgroups: EP rooting.
Sinsheimer, Janet S; Little, Roderick J A; Lake, James A
2012-01-01
Gene sequences are routinely used to determine the topologies of unrooted phylogenetic trees, but many of the most important questions in evolution require knowing both the topologies and the roots of trees. However, general algorithms for calculating rooted trees from gene and genomic sequences in the absence of gene paralogs are few. Using the principles of evolutionary parsimony (EP) (Lake JA. 1987a. A rate-independent technique for analysis of nucleic acid sequences: evolutionary parsimony. Mol Biol Evol. 4:167-181) and its extensions (Cavender, J. 1989. Mechanized derivation of linear invariants. Mol Biol Evol. 6:301-316; Nguyen T, Speed TP. 1992. A derivation of all linear invariants for a nonbalanced transversion model. J Mol Evol. 35:60-76), we explicitly enumerate all linear invariants that solely contain rooting information and derive algorithms for rooting gene trees directly from gene and genomic sequences. These new EP linear rooting invariants allow one to determine rooted trees, even in the complete absence of outgroups and gene paralogs. EP rooting invariants are explicitly derived for three taxon trees, and rules for their extension to four or more taxa are provided. The method is demonstrated using 18S ribosomal DNA to illustrate how the new animal phylogeny (Aguinaldo AMA et al. 1997. Evidence for a clade of nematodes, arthropods, and other moulting animals. Nature 387:489-493; Lake JA. 1990. Origin of the metazoa. Proc Natl Acad Sci USA 87:763-766) may be rooted directly from sequences, even when they are short and paralogs are unavailable. These results are consistent with the current root (Philippe H et al. 2011. Acoelomorph flatworms are deuterostomes related to Xenoturbella. Nature 470:255-260).
Tester, David J; Benton, Amber J; Train, Laura; Deal, Barbara; Baudhuin, Linnea M; Ackerman, Michael J
2010-10-15
Long QT syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for 3 cardiac ion channel α-subunits (LQT1 to LQT3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. We set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes in unrelated patients who were mutation negative after point mutation analysis of LQT1- to LQT12-susceptibility genes. Forty-two unrelated, clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification, a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA multiplex ligation-dependent probe amplification LQTS kit from MRC-Holland was used to analyze the 3 major LQTS-associated genes, KCNQ1, KCNH2, and SCN5A, and the 2 minor genes, KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2 of 42 unrelated patients (4.8%, confidence interval 1.7 to 11). A deletion of KCNQ1 exon 3 was identified in a 10-year-old Caucasian boy with a corrected QT duration of 660 ms, a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17-year-old Caucasian girl with a corrected QT duration of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, because nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. Copyright © 2010 Elsevier Inc. All rights reserved.
Miao, Jing; Feng, Jia-Chun; Zhu, Dan; Yu, Xue-Fan
2016-12-12
Becker muscular dystrophy (BMD), a genetic disorder of X-linked recessive inheritance, typically presents with gradually progressive muscle weakness. The condition is caused by mutations of Dystrophin gene located at Xp21.2. Epilepsy is an infrequent manifestation of BMD, while cases of BMD with dysgnosia are extremely rare. We describe a 9-year-old boy with BMD, who presented with epilepsy and dysgnosia. Serum creatine kinase level was markedly elevated (3665 U/L). Wechsler intelligence tests showed a low intelligence quotient (IQ = 65). Electromyogram showed slight myogenic changes and skeletal muscle biopsy revealed muscular dystrophy. Immunohistochemical staining showed partial positivity of sarcolemma for dystrophin-N. Multiplex ligation-dependent probe amplification revealed a duplication mutation in exons 37-44 in the Dystrophin gene. The present case report helps to better understand the clinical and genetic features of BMD.
Dworschak, G C; Crétolle, C; Hilger, A; Engels, H; Korsch, E; Reutter, H; Ludwig, M
2017-05-01
Partial duplications of the long arm of chromosome 3, dup(3q), are a rare but well-described condition, sharing features of Cornelia de Lange syndrome. Around two thirds of cases are derived from unbalanced translocations, whereas pure dup(3q) have rarely been reported. Here, we provide an extensive review of the literature on dup(3q). This search revealed several patients with caudal malformations and anomalies, suggesting that caudal malformations or anomalies represent an inherent phenotypic feature of dup(3q). In this context, we report a patient with a pure de novo duplication 3q26.32-q27.2. The patient had the clinical diagnosis of Currarino syndrome (CS) (characterized by the triad of sacral anomalies, anorectal malformations and a presacral mass) and additional features, frequently detected in patients with a dup(3q). Mutations within the MNX1 gene were found to be causative in CS but no MNX1 mutation could be detected in our patient. Our comprehensive search for candidate genes located in the critical region of the duplication 3q syndrome, 3q26.3-q27, revealed a so far neglected phenotypic overlap of dup(3q) and the Pierpont syndrome, associated with a mutation of the TBL1XR1 gene on 3q26.32. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Ishibashi, Misaki; Nabe, Takeshi; Nitta, Yoko; Tsuruta, Hiroki; Iduhara, Miho; Uno, Yuichi
2018-03-01
Fra a 1 protein in strawberry causes oral allergic syndrome. Over 39 Fra a 1 paralogs have been identified in strawberry genome. Fra a 1.01 is major accumulating protein in edible organs. Strawberry fruits contain allergenic proteins that cause oral allergic syndrome. The hypothesized major allergen is Fra a 1, an ortholog of the birch pollen allergen protein Bet v 1. We organized Fra a 1 genes and analyzed their localizations at the transcriptional and translational levels. In total, 15 new Fra a 1 proteins were identified from the genomic database, increasing the total number of Fra a 1 to 30 proteins encoded by 39 genes. Fra a 1.02 was mostly expressed in receptacles, and Fra a 1.01 in achenes, when analyzed by RNA sequencing. Immunoblotting showed that the Fra a 1.01 protein was broadly accumulated in strawberry organs, while the Fra a 1.02 protein was mostly expressed in receptacles. Recombinant Fra a 1.01 strongly reacted with human IgE. The mRNA and protein expression levels of Fra a 1 did not correlate, indicating the importance of protein levels when evaluating the abundance of allergens in strawberry. Based on the localizations, accumulation levels and reactivity to human IgE, we determined that Fra a 1.01 was the most important allergen, followed by Fra a 1.02, and then other Fra a 1 proteins. The information obtained here will be useful for selecting the target Fra a 1 paralogs when breeding hypoallergenic strawberry.
A Theory of Utility Conditionals: Paralogical Reasoning from Decision-Theoretic Leakage
Bonnefon, Jean-Francois
2009-01-01
Many "if p, then q" conditionals have decision-theoretic features, such as antecedents or consequents that relate to the utility functions of various agents. These decision-theoretic features leak into reasoning processes, resulting in various paralogical conclusions. The theory of utility conditionals offers a unified account of the various forms…
Karn, Robert C; Laukaitis, Christina M
2014-08-01
In the present article, we summarize two aspects of our work on mouse ABP (androgen-binding protein): (i) the sexual selection function producing incipient reinforcement on the European house mouse hybrid zone, and (ii) the mechanism behind the dramatic expansion of the Abp gene region in the mouse genome. Selection unifies these two components, although the ways in which selection has acted differ. At the functional level, strong positive selection has acted on key sites on the surface of one face of the ABP dimer, possibly to influence binding to a receptor. A different kind of selection has apparently driven the recent and rapid expansion of the gene region, probably by increasing the amount of Abp transcript, in one or both of two ways. We have shown previously that groups of Abp genes behave as LCRs (low-copy repeats), duplicating as relatively large blocks of genes by NAHR (non-allelic homologous recombination). The second type of selection involves the close link between the accumulation of L1 elements and the expansion of the Abp gene family by NAHR. It is probably predicated on an initial selection for increased transcription of existing Abp genes and/or an increase in Abp gene number providing more transcriptional sites. Either or both could increase initial transcript production, a quantitative change similar to increasing the volume of a radio transmission. In closing, we also provide a note on Abp gene nomenclature.
Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke
The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.
The sea lamprey meiotic map improves resolution of ancient vertebrate genome duplications.
Smith, Jeramiah J; Keinath, Melissa C
2015-08-01
It is generally accepted that many genes present in vertebrate genomes owe their origin to two whole-genome duplications that occurred deep in the ancestry of the vertebrate lineage. However, details regarding the timing and outcome of these duplications are not well resolved. We present high-density meiotic and comparative genomic maps for the sea lamprey (Petromyzon marinus), a representative of an ancient lineage that diverged from all other vertebrates ∼550 million years ago. Linkage analyses yielded a total of 95 linkage groups, similar to the estimated number of germline chromosomes (1n ∼ 99), spanning a total of 5570.25 cM. Comparative mapping data yield strong support for the hypothesis that a single whole-genome duplication occurred in the basal vertebrate lineage, but do not strongly support a hypothetical second event. Rather, these comparative maps reveal several evolutionarily independent segmental duplications occurring over the last 600+ million years of chordate evolution. This refined history of vertebrate genome duplication should permit more precise investigations of vertebrate evolution. © 2015 Smith and Keinath; Published by Cold Spring Harbor Laboratory Press.
The evolution of the tape measure protein: units, duplications and losses
Directory of Open Access Journals (Sweden)
Poisson Guylaine
2011-10-01
Full Text Available Abstract Background A large family of viruses that infect bacteria, called phages, is characterized by long tails used to inject DNA into their victims' cells. The tape measure protein got its name because the length of the corresponding gene is proportional to the length of the phage's tail: a fact shown by actually copying or splicing out parts of DNA in exemplar species. A natural question is whether there exist units for these tape measures, and if different tape measures have different units and lengths. Such units would allow us to retrace the evolution of tape measure proteins using their duplication/loss history. The vast number of sequenced phages genomes allows us to attack this problem with a comparative genomics approach. Results Here we describe a subset of phages whose tape measure proteins contain variable numbers of an 11 amino acids sequence repeat, aligned with sequence similarity, structural properties, and simple arithmetics. This subset provides a unique opportunity for the combinatorial study of phage evolution, without the added uncertainties of multiple alignments, which are trivial in this case, or of protein functions, that are well established. We give a heuristic that reconstructs the duplication history of these sequences, using divergent strains to discriminate between mutations that occurred before and after speciation, or lineage divergence. The heuristic is based on an efficient algorithm that gives an exhaustive enumeration of all possible parsimonious reconstructions of the duplication/speciation history of a single nucleotide. Finally, we present a method that allows, when possible, to discriminate between duplication and loss events. Conclusions Establishing the evolutionary history of viruses is difficult, in part due to extensive recombinations and gene transfers, and high mutation rates that often erase detectable similarity between homologous genes. In this paper, we introduce new tools to address this
Directory of Open Access Journals (Sweden)
Dan-Dan Zhang
Full Text Available Lepidopteran pheromone receptors (PRs, for which orthologies are evident among closely related species, provide an intriguing example of gene family evolution in terms of how new functions may arise. However, only a limited number of PRs have been functionally characterized so far and thus evolutionary scenarios suffer from elements of speculation. In this study we investigated the turnip moth Agrotis segetum, in which female moths produce a mixture of chemically related pheromone components that elicit specific responses from receptor cells on male antennae. We cloned nine A. segetum PR genes and the Orco gene by degenerate primer based RT-PCR. The nine PR genes, named as AsegOR1 and AsegOR3-10, fall into four distinct orthologous clusters of known lepidopteran PRs, of which one contains six paralogues. The paralogues are under relaxed selective pressure, contrasting with the purifying selection on other clusters. We identified the receptors AsegOR9, AsegOR4 and AsegOR5, specific for the respective homologous pheromone components (Z-5-decenyl, (Z-7-dodecenyl and (Z-9-tetradecenyl acetates, by two-electrode voltage clamp recording from Xenopus laevis oocytes co-expressing Orco and each PR candidate. These receptors occur in three different orthologous clusters. We also found that the six paralogues with high sequence similarity vary dramatically in ligand selectivity and sensitivity. Different from AsegOR9, AsegOR6 showed a relatively large response to the behavioural antagonist (Z-5-decenol, and a small response to (Z-5-decenyl acetate. AsegOR1 was broadly tuned, but most responsive to (Z-5-decenyl acetate, (Z-7-dodecenyl acetate and the behavioural antagonist (Z-8-dodecenyl acetate. AsegOR8 and AsegOR7, which differ from AsegOR6 and AsegOR1 by 7 and 10 aa respectively, showed much lower sensitivities. AsegOR10 showed only small responses to all the tested compounds. These results suggest that new receptors arise through gene duplication, and
The evolution of CHROMOMETHYLASES and gene body DNA methylation in plants.
Bewick, Adam J; Niederhuth, Chad E; Ji, Lexiang; Rohr, Nicholas A; Griffin, Patrick T; Leebens-Mack, Jim; Schmitz, Robert J
2017-05-01
The evolution of gene body methylation (gbM), its origins, and its functional consequences are poorly understood. By pairing the largest collection of transcriptomes (>1000) and methylomes (77) across Viridiplantae, we provide novel insights into the evolution of gbM and its relationship to CHROMOMETHYLASE (CMT) proteins. CMTs are evolutionary conserved DNA methyltransferases in Viridiplantae. Duplication events gave rise to what are now referred to as CMT1, 2 and 3. Independent losses of CMT1, 2, and 3 in eudicots, CMT2 and ZMET in monocots and monocots/commelinids, variation in copy number, and non-neutral evolution suggests overlapping or fluid functional evolution of this gene family. DNA methylation within genes is widespread and is found in all major taxonomic groups of Viridiplantae investigated. Genes enriched with methylated CGs (mCG) were also identified in species sister to angiosperms. The proportion of genes and DNA methylation patterns associated with gbM are restricted to angiosperms with a functional CMT3 or ortholog. However, mCG-enriched genes in the gymnosperm Pinus taeda shared some similarities with gbM genes in Amborella trichopoda. Additionally, gymnosperms and ferns share a CMT homolog closely related to CMT2 and 3. Hence, the dependency of gbM on a CMT most likely extends to all angiosperms and possibly gymnosperms and ferns. The resulting gene family phylogeny of CMT transcripts from the most diverse sampling of plants to date redefines our understanding of CMT evolution and its evolutionary consequences on DNA methylation. Future, functional tests of homologous and paralogous CMTs will uncover novel roles and consequences to the epigenome.
Intragenic duplication: a novel mutational mechanism in hereditary pancreatitis
DEFF Research Database (Denmark)
Joergensen, Maiken T; Geisz, Andrea; Brusgaard, Klaus
2011-01-01
In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide of cationic...
Genome-wide survey and developmental expression mapping of zebrafish SET domain-containing genes.
Directory of Open Access Journals (Sweden)
Xiao-Jian Sun
Full Text Available SET domain-containing proteins represent an evolutionarily conserved family of epigenetic regulators, which are responsible for most histone lysine methylation. Since some of these genes have been revealed to be essential for embryonic development, we propose that the zebrafish, a vertebrate model organism possessing many advantages for developmental studies, can be utilized to study the biological functions of these genes and the related epigenetic mechanisms during early development. To this end, we have performed a genome-wide survey of zebrafish SET domain genes. 58 genes total have been identified. Although gene duplication events give rise to several lineage-specific paralogs, clear reciprocal orthologous relationship reveals high conservation between zebrafish and human SET domain genes. These data were further subject to an evolutionary analysis ranging from yeast to human, leading to the identification of putative clusters of orthologous groups (COGs of this gene family. By means of whole-mount mRNA in situ hybridization strategy, we have also carried out a developmental expression mapping of these genes. A group of maternal SET domain genes, which are implicated in the programming of histone modification states in early development, have been identified and predicted to be responsible for all known sites of SET domain-mediated histone methylation. Furthermore, some genes show specific expression patterns in certain tissues at certain stages, suggesting the involvement of epigenetic mechanisms in the development of these systems. These results provide a global view of zebrafish SET domain histone methyltransferases in evolutionary and developmental dimensions and pave the way for using zebrafish to systematically study the roles of these genes during development.
Energy Technology Data Exchange (ETDEWEB)
Merson, Rebeka R., E-mail: rmerson@ric.edu [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Biology Department, Rhode Island College, 500 Mt. Pleasant Ave., Providence, RI 02908 (United States); Karchner, Sibel I.; Hahn, Mark E. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States)
2009-08-13
The aryl hydrocarbon receptor (AHR) mediates the toxic effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and related compounds. In some mammalian cell lines, TCDD induces G1 cell cycle arrest, which depends on an interaction between the AHR and the retinoblastoma tumor suppressor (RB). Mammals possess one AHR, whereas fishes possess two or more AHR paralogs that differ in the domains important for AHR-RB interactions in mammals. To test the hypothesis that fish AHR paralogs differ in their ability to interact with RB, we cloned RB cDNA from Atlantic killifish, Fundulus heteroclitus, and studied the interactions of killifish RB protein with killifish AHR1 and AHR2. In coimmunoprecipitation experiments, in vitro-expressed killifish RB coprecipitated with both AHR1 and AHR2. Consistent with these results, both killifish AHR1 and AHR2 interacted with RB in mammalian two-hybrid assays. These results suggest that both fish AHR1 and AHR2 paralogs may have the potential to influence cell proliferation through interactions with RB.
Directory of Open Access Journals (Sweden)
Erin M Kollitz
Full Text Available The vertebrate genome is a result of two rapid and successive rounds of whole genome duplication, referred to as 1R and 2R. Furthermore, teleost fish have undergone a third whole genome duplication (3R specific to their lineage, resulting in the retention of multiple gene paralogs. The more recent 3R event in teleosts provides a unique opportunity to gain insight into how genes evolve through specific evolutionary processes. In this study we compare molecular activities of vitamin D receptors (VDR from basal species that diverged at key points in vertebrate evolution in order to infer derived and ancestral VDR functions of teleost paralogs. Species include the sea lamprey (Petromyzon marinus, a 1R jawless fish; the little skate (Leucoraja erinacea, a cartilaginous fish that diverged after the 2R event; and the Senegal bichir (Polypterus senegalus, a primitive 2R ray-finned fish. Saturation binding assays and gel mobility shift assays demonstrate high affinity ligand binding and classic DNA binding characteristics of VDR has been conserved across vertebrate evolution. Concentration response curves in transient transfection assays reveal EC50 values in the low nanomolar range, however maximum transactivational efficacy varies significantly between receptor orthologs. Protein-protein interactions were investigated using co-transfection, mammalian 2-hybrid assays, and mutations of coregulator activation domains. We then combined these results with our previous study of VDR paralogs from 3R teleosts into a bioinformatics analysis. Our results suggest that 1, 25D3 acts as a partial agonist in basal species. Furthermore, our bioinformatics analysis suggests that functional differences between VDR orthologs and paralogs are influenced by differential protein interactions with essential coregulator proteins. We speculate that we may be observing a change in the pharmacodynamics relationship between VDR and 1, 25D3 throughout vertebrate evolution that may
Madureira, Tânia Vieira; Pinheiro, Ivone; de Paula Freire, Rafaelle; Rocha, Eduardo; Castro, Luis Filipe; Urbatzka, Ralph
2017-06-01
Peroxisome proliferator-activated receptors (PPARs) are key regulators of many processes in vertebrates, such as carbohydrate and lipid metabolism. PPARα, a member of the PPAR nuclear receptor gene subfamily (NR1C1), is involved in fatty acid metabolism, namely in peroxisomal β-oxidation. Two gene paralogues, pparαA and pparαB, were described in several teleost species with their origin dating back to the teleost-specific genome duplication (3R). Given the additional salmonid-specific genome duplication (4R), four genes could be theoretically anticipated for this gene subfamily. In this work, we examined the pparα gene repertoire in brown trout, Salmo trutta f. fario. Data disclosed two pparα-like sequences in brown trout. Phylogenetic analyses further revealed that the isolated genes are most likely genome pparαB duplicates, pparαBa and pparαBb, while pparαA is apparently absent in salmonids. Both genes showed a ubiquitous mRNA expression across a panel of 11 different organs. In vitro exposed primary brown trout hepatocytes strongly suggest that pparα gene paralogues are differently regulated by ethinylestradiol (EE2). PparαBb mRNA expression significantly decreased with dosage, reaching significance after exposure to 50μM EE2, while pparαBa mRNA increased, significant at 1μM EE2. The present data enhances the understanding of pparα function and evolution in teleost, and reinforces the evidence of a potential crosstalk between estrogenic and pparα signaling pathways. Copyright © 2017 Elsevier Inc. All rights reserved.
Hrytsenko, Olga; Pohajdak, Bill; Wright, James R
2016-07-03
Tilapia, a teleost fish, have multiple large anatomically discrete islets which are easy to harvest, and when transplanted into diabetic murine recipients, provide normoglycemia and mammalian-like glucose tolerance profiles. Tilapia insulin differs structurally from human insulin which could preclude their use as islet donors for xenotransplantation. Therefore, we produced transgenic tilapia with islets expressing a humanized insulin gene. It is now known that fish genomes may possess an ancestral duplication and so tilapia may have a second insulin gene. Therefore, we cloned, sequenced, and characterized the tilapia insulin 2 transcript and found that its expression is negligible in islets, is not islet-specific, and would not likely need to be silenced in our transgenic fish.
DEFF Research Database (Denmark)
Jiang, Lu; Ingvardsen, Christina Rønn; Lübberstedt, Thomas
2008-01-01
the isolation and characterization of the Pic19R gene family members from the inbred line FAP1360A, which shows complete resistance to SCMV. Two primer pairs were designed based on the conserved regions among the known Pic19 paralogs and used for rapid amplification of cDNA ends of FAP1360A. Six full-length c...... of the Pic19R family indicated that the Pic19R-1 paralog is identical to the known Rxo1 gene conferring resistance to rice bacterial streak disease and none of the other Pic19R paralogs seems to be involved in resistance to SCMV...
Facial duplication: case, review, and embryogenesis.
Barr, M
1982-04-01
The craniofacial anatomy of an infant with facial duplication is described. There were four eyes, two noses, two maxillae, and one mandible. Anterior to the single pituitary the brain was duplicated and there was bilateral arhinencephaly. Portions of the brain were extruded into a large frontal encephalocele. Cases of symmetrical facial duplication reported in the literature range from two complete faces on a single head (diprosopus) to simple nasal duplication. The variety of patterns of duplication suggests that the doubling of facial components arises in several different ways: Forking of the notochord, duplication of the prosencephalon, duplication of the olfactory placodes, and duplication of maxillary and/or mandibular growth centers around the margins of the stomatodeal plate. Among reported cases, the female:male ratio is 2:1.
Zuriaga, Elena; Romero, Carlos; Blanca, Jose Miguel; Badenes, Maria Luisa
2018-01-27
Plum pox virus (PPV), causing Sharka disease, is one of the main limiting factors for Prunus production worldwide. In apricot (Prunus armeniaca L.) the major PPV resistance locus (PPVres), comprising ~ 196 kb, has been mapped to the upper part of linkage group 1. Within the PPVres, 68 genomic variants linked in coupling to PPV resistance were identified within 23 predicted transcripts according to peach genome annotation. Taking into account the predicted functions inferred from sequence homology, some members of a cluster of meprin and TRAF-C homology domain (MATHd)-containing genes were pointed as PPV resistance candidate genes. Here, we have characterized the global apricot transcriptome response to PPV-D infection identifying six PPVres locus genes (ParP-1 to ParP-6) differentially expressed in resistant/susceptible cultivars. Two of them (ParP-3 and ParP-4), that encode MATHd proteins, appear clearly down-regulated in resistant cultivars, as confirmed by qRT-PCR. Concurrently, variant calling was performed using whole-genome sequencing data of 24 apricot cultivars (10 PPV-resistant and 14 PPV-susceptible) and 2 wild relatives (PPV-susceptible). ParP-3 and ParP-4, named as Prunus armeniaca PPVres MATHd-containing genes (ParPMC), are the only 2 genes having allelic variants linked in coupling to PPV resistance. ParPMC1 has 1 nsSNP, while ParPMC2 has 15 variants, including a 5-bp deletion within the second exon that produces a frameshift mutation. ParPMC1 and ParPMC2 are adjacent and highly homologous (87.5% identity) suggesting they are paralogs originated from a tandem duplication. Cultivars carrying the ParPMC2 resistant (mutated) allele show lack of expression in both ParPMC2 and especially ParPMC1. Accordingly, we hypothesize that ParPMC2 is a pseudogene that mediates down-regulation of its functional paralog ParPMC1 by silencing. As a whole, results strongly support ParPMC1 and/or ParPMC2 as host susceptibility genes required for PPV infection which
Directory of Open Access Journals (Sweden)
Jianfeng Zhou
growth and development primarily by binding to and inhibiting IGF actions in vivo. The duplicated IGFBP-2 genes may provide additional flexibility in the regulation of IGF activities.
Sorting cancer karyotypes using double-cut-and-joins, duplications and deletions.
Zeira, Ron; Shamir, Ron
2018-05-03
Problems of genome rearrangement are central in both evolution and cancer research. Most genome rearrangement models assume that the genome contains a single copy of each gene and the only changes in the genome are structural, i.e., reordering of segments. In contrast, tumor genomes also undergo numerical changes such as deletions and duplications, and thus the number of copies of genes varies. Dealing with unequal gene content is a very challenging task, addressed by few algorithms to date. More realistic models are needed to help trace genome evolution during tumorigenesis. Here we present a model for the evolution of genomes with multiple gene copies using the operation types double-cut-and-joins, duplications and deletions. The events supported by the model are reversals, translocations, tandem duplications, segmental deletions, and chromosomal amplifications and deletions, covering most types of structural and numerical changes observed in tumor samples. Our goal is to find a series of operations of minimum length that transform one karyotype into the other. We show that the problem is NP-hard and give an integer linear programming formulation that solves the problem exactly under some mild assumptions. We test our method on simulated genomes and on ovarian cancer genomes. Our study advances the state of the art in two ways: It allows a broader set of operations than extant models, thus being more realistic, and it is the first study attempting to reconstruct the full sequence of structural and numerical events during cancer evolution. Code and data are available in https://github.com/Shamir-Lab/Sorting-Cancer-Karyotypes. ronzeira@post.tau.ac.il, rshamir@tau.ac.il. Supplementary data are available at Bioinformatics online.
Gene transposition causing natural variation for growth in Arabidopsis thaliana.
Vlad, Daniela; Rappaport, Fabrice; Simon, Matthieu; Loudet, Olivier
2010-05-13
A major challenge in biology is to identify molecular polymorphisms responsible for variation in complex traits of evolutionary and agricultural interest. Using the advantages of Arabidopsis thaliana as a model species, we sought to identify new genes and genetic mechanisms underlying natural variation for shoot growth using quantitative genetic strategies. More quantitative trait loci (QTL) still need be resolved to draw a general picture as to how and where in the pathways adaptation is shaping natural variation and the type of molecular variation involved. Phenotypic variation for shoot growth in the Bur-0 x Col-0 recombinant inbred line set was decomposed into several QTLs. Nearly-isogenic lines generated from the residual heterozygosity segregating among lines revealed an even more complex picture, with major variation controlled by opposite linked loci and masked by the segregation bias due to the defective phenotype of SG3 (Shoot Growth-3), as well as epistasis with SG3i (SG3-interactor). Using principally a fine-mapping strategy, we have identified the underlying gene causing phenotypic variation at SG3: At4g30720 codes for a new chloroplast-located protein essential to ensure a correct electron flow through the photosynthetic chain and, hence, photosynthesis efficiency and normal growth. The SG3/SG3i interaction is the result of a structural polymorphism originating from the duplication of the gene followed by divergent paralogue's loss between parental accessions. Species-wide, our results illustrate the very dynamic rate of duplication/transposition, even over short periods of time, resulting in several divergent--but still functional-combinations of alleles fixed in different backgrounds. In predominantly selfing species like Arabidopsis, this variation remains hidden in wild populations but is potentially revealed when divergent individuals outcross. This work highlights the need for improved tools and algorithms to resolve structural variation
The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.
Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M
2013-05-29
Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in
Markov, Gabriel V; Meyer, Jan M; Panda, Oishika; Artyukhin, Alexander B; Claaßen, Marc; Witte, Hanh; Schroeder, Frank C; Sommer, Ralf J
2016-10-01
Small-molecule signaling in nematode dauer formation has emerged as a major model to study chemical communication in development and evolution. Developmental arrest as nonfeeding and stress-resistant dauer larvae represents the major survival and dispersal strategy. Detailed studies in Caenorhabditis elegans and Pristionchus pacificus revealed that small-molecule communication changes rapidly in evolution resulting in extreme structural diversity of small-molecule compounds. In C. elegans, a blend of ascarosides constitutes the dauer pheromone, whereas the P. pacificus dauer pheromone includes additional paratosides and integrates building blocks from diverse primary metabolic pathways. Despite this complexity of small-molecule structures and functions, little is known about the biosynthesis of small molecules in nematodes outside C. elegans Here, we show that the genes encoding enzymes of the peroxisomal β-oxidation pathway involved in small-molecule biosynthesis evolve rapidly, including gene duplications and domain switching. The thiolase daf-22, the most downstream factor in C. elegans peroxisomal β-oxidation, has duplicated in P. pacificus, resulting in Ppa-daf-22.1, which still contains the sterol-carrier-protein (SCP) domain that was lost in C. elegans daf-22, and Ppa-daf-22.2. Using the CRISPR/Cas9 system, we induced mutations in both P. pacificus daf-22 genes and identified an unexpected complexity of functional conservation and divergence. Under well-fed conditions, ascaroside biosynthesis proceeds exclusively via Ppa-daf-22.1 In contrast, starvation conditions induce Ppa-daf-22.2 activity, resulting in the production of a specific subset of ascarosides. Gene expression studies indicate a reciprocal up-regulation of both Ppa-daf-22 genes, which is, however, independent of starvation. Thus, our study reveals an unexpected functional complexity of dauer development and evolution. © The Author 2016. Published by Oxford University Press on behalf of the
Genomewide identification and expression analysis of the ARF gene ...
Indian Academy of Sciences (India)
Figure 1. Phylogenetic relation of apple ARF genes. The phylogenetic tree was constructed based on a complete protein sequence align- ment of MdARFs by the neighbour-joining method with bootstrapping analysis (1000 replicates). The scale bar represents 0.05 amino acid substitutions per site. Paralogous gene pairs ...
Duplication of 17(p11.2p11.2) in a male child with autism and severe language delay.
Nakamine, Alisa; Ouchanov, Leonid; Jiménez, Patricia; Manghi, Elina R; Esquivel, Marcela; Monge, Silvia; Fallas, Marietha; Burton, Barbara K; Szomju, Barbara; Elsea, Sarah H; Marshall, Christian R; Scherer, Stephen W; McInnes, L Alison
2008-03-01
Duplications of 17(p11.2p11.2) have been associated with various behavioral manifestations including attention deficits, obsessive-compulsive symptoms, autistic traits, and language delay. We are conducting a genetic study of autism and are screening all cases for submicroscopic chromosomal abnormalities, in addition to standard karyotyping, and fragile X testing. Using array-based comparative genomic hybridization analysis of data from the Affymetrix GeneChip(R) Human Mapping Array set, we detected a duplication of approximately 3.3 Mb on chromosome 17p11.2 in a male child with autism and severe expressive language delay. The duplication was confirmed by measuring the copy number of genomic DNA using quantitative polymerase chain reaction. Gene expression analyses revealed increased expression of three candidate genes for the Smith-Magenis neurobehavioral phenotype, RAI1, DRG2, and RASD1, in transformed lymphocytes from Case 81A, suggesting gene dosage effects. Our results add to a growing body of evidence suggesting that duplications of 17(p11.2p11.2) result in language delay as well as autism and related phenotypes. As Smith-Magenis syndrome is also associated with language delay, a gene involved in acquisition of language may lie within this interval. Whether a parent of origin effect, gender of the case, the presence of allelic variation, or changes in expression of genes outside the breakpoints influence the resultant phenotype remains to be determined. (c) 2007 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Anthony R Isles
2016-05-01
Full Text Available Duplications at 15q11.2-q13.3 overlapping the Prader-Willi/Angelman syndrome (PWS/AS region have been associated with developmental delay (DD, autism spectrum disorder (ASD and schizophrenia (SZ. Due to presence of imprinted genes within the region, the parental origin of these duplications may be key to the pathogenicity. Duplications of maternal origin are associated with disease, whereas the pathogenicity of paternal ones is unclear. To clarify the role of maternal and paternal duplications, we conducted the largest and most detailed study to date of parental origin of 15q11.2-q13.3 interstitial duplications in DD, ASD and SZ cohorts. We show, for the first time, that paternal duplications lead to an increased risk of developing DD/ASD/multiple congenital anomalies (MCA, but do not appear to increase risk for SZ. The importance of the epigenetic status of 15q11.2-q13.3 duplications was further underlined by analysis of a number of families, in which the duplication was paternally derived in the mother, who was unaffected, whereas her offspring, who inherited a maternally derived duplication, suffered from psychotic illness. Interestingly, the most consistent clinical characteristics of SZ patients with 15q11.2-q13.3 duplications were learning or developmental problems, found in 76% of carriers. Despite their lower pathogenicity, paternal duplications are less frequent in the general population with a general population prevalence of 0.0033% compared to 0.0069% for maternal duplications. This may be due to lower fecundity of male carriers and differential survival of embryos, something echoed in the findings that both types of duplications are de novo in just over 50% of cases. Isodicentric chromosome 15 (idic15 or interstitial triplications were not observed in SZ patients or in controls. Overall, this study refines the distinct roles of maternal and paternal interstitial duplications at 15q11.2-q13.3, underlining the critical importance of
Isles, Anthony R.; Ingason, Andrés; Lowther, Chelsea; Gawlick, Micha; Stöber, Gerald; Potter, Harry; Georgieva, Lyudmila; Pizzo, Lucilla; Ozaki, Norio; Kushima, Itaru; Ikeda, Masashi; Iwata, Nakao; Levinson, Douglas F.; Gejman, Pablo V.; Shi, Jianxin; Sanders, Alan R.; Duan, Jubao; Sisodiya, Sanjay; Costain, Gregory; Degenhardt, Franziska; Giegling, Ina; Rujescu, Dan; Hreidarsson, Stefan J.; Saemundsen, Evald; Ahn, Joo Wook; Ogilvie, Caroline; Stefansson, Hreinn; Stefansson, Kari; O’Donovan, Michael C.; Owen, Michael J.; Bassett, Anne; Kirov, George
2016-01-01
Duplications at 15q11.2-q13.3 overlapping the Prader-Willi/Angelman syndrome (PWS/AS) region have been associated with developmental delay (DD), autism spectrum disorder (ASD) and schizophrenia (SZ). Due to presence of imprinted genes within the region, the parental origin of these duplications may be key to the pathogenicity. Duplications of maternal origin are associated with disease, whereas the pathogenicity of paternal ones is unclear. To clarify the role of maternal and paternal duplications, we conducted the largest and most detailed study to date of parental origin of 15q11.2-q13.3 interstitial duplications in DD, ASD and SZ cohorts. We show, for the first time, that paternal duplications lead to an increased risk of developing DD/ASD/multiple congenital anomalies (MCA), but do not appear to increase risk for SZ. The importance of the epigenetic status of 15q11.2-q13.3 duplications was further underlined by analysis of a number of families, in which the duplication was paternally derived in the mother, who was unaffected, whereas her offspring, who inherited a maternally derived duplication, suffered from psychotic illness. Interestingly, the most consistent clinical characteristics of SZ patients with 15q11.2-q13.3 duplications were learning or developmental problems, found in 76% of carriers. Despite their lower pathogenicity, paternal duplications are less frequent in the general population with a general population prevalence of 0.0033% compared to 0.0069% for maternal duplications. This may be due to lower fecundity of male carriers and differential survival of embryos, something echoed in the findings that both types of duplications are de novo in just over 50% of cases. Isodicentric chromosome 15 (idic15) or interstitial triplications were not observed in SZ patients or in controls. Overall, this study refines the distinct roles of maternal and paternal interstitial duplications at 15q11.2-q13.3, underlining the critical importance of maternally
Zhang, Dajian; Zhao, Meixia; Li, Shuai; Sun, Lianjun; Wang, Weidong; Cai, Chunmei; Dierking, Emily C; Ma, Jianxin
2017-06-01
Many plants have undergone whole genome duplication (WGD). However, how regulatory networks underlying a particular trait are reshaped in polyploids has not been experimentally investigated. Here we show that the regulatory pathways modulating seed oil content, which involve WRINKLED1 (WRI1), LEAFY COTYLEDON1 (LEC1), and LEC2 in Arabidopsis, have been modified in the palaeopolyploid soybean. Such modifications include functional reduction of GmWRI1b of the GmWRI1a/GmWRI1b homoeologous pair relevant to WRI1, complementary non-allelic dosage effects of the GmLEC1a/GmLEC1b homoeologous pair relevant to LEC1, pseudogenization of the singleton GmLEC2 relevant to LEC2, and the rise of the LEC2-like function of GmABI3b, contrasting to its homoeolog GmABI3a, which maintains the ABSCISIC ACID INSENSITIVE 3 (ABI3)-like function in modulating seed maturation and dormancy. The function of GmABI3b in modulating seed oil biosynthesis was fulfilled by direct binding to a RY (CATGCA) cis-regulatory element in the GmWRI1a promoter, which was absent in the GmWRI1b promoter, resulting in reduction of the GmWRI1b expression. Nevertheless, the three regulators each exhibited similar intensities of purifying selection to their respective duplicates since these pairs were formed by a WGD event that is proposed to have occurred approximately 13 million years ago (mya), suggesting that the differentiation in spatiotemporal expression between the duplicated genes is more likely to be the outcome of neutral variation in regulatory sequences. This study thus exemplifies the plasticity, dynamics, and novelty of regulatory networks mediated by WGD. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Rectal duplication with sciatic hernia.
Nosek, Marzena; Golonka, Anna; Kalińska-Lipert, Anita; Nachulewicz, Paweł
2015-07-01
Rectal duplications represent 5% of all duplications in the alimentary tract, and they are very rarely diagnosed during the neonatal period. The authors present the method of investigation and the results of surgical treatment of a full-term neonate with a sciatic hernia containing a rectal duplication. The procedure started with three-port laparoscopy, but excision of the tubular duplication of the rectum was possible only by a transanal endorectal pull-through approach. The sciatic hernia was closed, and plastic sutures on the buttock finished the procedure. The coincidence of sciatic hernia with rectal duplication is extremely rare, and the method of treatment depends exclusively on the anatomical conditions.
Craniofacial duplication: a case report.
Suryawanshi, Pradeep; Deshpande, Mandar; Verma, Nitin; Mahendrakar, Vivek; Mahendrakar, Sandhya
2013-09-01
A craniofacial duplication or diprosopus is an unusual variant of conjoined twinning. The reported incidence is one in 180,000-15 million births and 35 cases have been reported till date. The phenotype is wide, with the partial duplication of a few facial structures to complete dicephalus. A complete duplication is associated with a high incidence of anomalies in the central nervous system, cardiovascular system, gastrointestinal system and the respiratory system, whereas no major anomalies are found in the infants with a partial duplication. A term baby with the features of a craniofacial duplication has been described, with the proposed theories on embryogenesis and a brief review of the literature.
Evaluation of contrast in duplicated radiographs
International Nuclear Information System (INIS)
Thunthy, K.H.; Weinberg, R.
1982-01-01
This investigation evaluated changes in the contrast of duplicated radiographs made at different ultraviolet light exposures. Increasing ultraviolet light exposure had different effects on the duplicates of originals of different background densities. When correctly exposed, a duplicate radiograph enhanced contrast. When originals had the same contrast but different background densities, their duplicates did not have the same contrast. It was not possible to duplicate accurately all the different contrasts measured on an original. It was possible, however, to produce duplicates with all contrasts greater than those of the original
Shang, Shuai; Zhong, Huaming; Wu, Xiaoyang; Wei, Qinguo; Zhang, Huanxin; Chen, Jun; Chen, Yao; Tang, Xuexi; Zhang, Honghai
2018-04-01
Toll-like receptors (TLRs) encoded by the TLR multigene family play an important role in initial pathogen recognition in vertebrates. Among the TLRs, TLR2 and TLR4 may be of particular importance to reptiles. In order to study the evolutionary patterns and structural characteristics of TLRs, we explored the available genomes of several representative members of reptiles. 25 TLR2 genes and 19 TLR4 genes from reptiles were obtained in this study. Phylogenetic results showed that the TLR2 gene duplication occurred in several species. Evolutionary analysis by at least two methods identified 30 and 13 common positively selected codons in TLR2 and TLR4, respectively. Most positively selected sites of TLR2 and TLR4 were located in the Leucine-rich repeat (LRRs). Branch model analysis showed that TLR2 genes were under different evolutionary forces in reptiles, while the TLR4 genes showed no significant selection pressure. The different evolutionary adaptation of TLR2 and TLR4 among the reptiles might be due to their different function in recognizing bacteria. Overall, we explored the structure and evolution of TLR2 and TLR4 genes in reptiles for the first time. Our study revealed valuable information regarding TLR2 and TLR4 in reptiles, and provided novel insights into the conservation concern of natural populations. Copyright © 2017 Elsevier B.V. All rights reserved.
Schwartze, Volker U; Winter, Sascha; Shelest, Ekaterina; Marcet-Houben, Marina; Horn, Fabian; Wehner, Stefanie; Linde, Jörg; Valiante, Vito; Sammeth, Michael; Riege, Konstantin; Nowrousian, Minou; Kaerger, Kerstin; Jacobsen, Ilse D; Marz, Manja; Brakhage, Axel A; Gabaldón, Toni; Böcker, Sebastian; Voigt, Kerstin
2014-08-01
Lichtheimia species are the second most important cause of mucormycosis in Europe. To provide broader insights into the molecular basis of the pathogenicity-associated traits of the basal Mucorales, we report the full genome sequence of L. corymbifera and compared it to the genome of Rhizopus oryzae, the most common cause of mucormycosis worldwide. The genome assembly encompasses 33.6 MB and 12,379 protein-coding genes. This study reveals four major differences of the L. corymbifera genome to R. oryzae: (i) the presence of an highly elevated number of gene duplications which are unlike R. oryzae not due to whole genome duplication (WGD), (ii) despite the relatively high incidence of introns, alternative splicing (AS) is not frequently observed for the generation of paralogs and in response to stress, (iii) the content of repetitive elements is strikingly low (<5%), (iv) L. corymbifera is typically haploid. Novel virulence factors were identified which may be involved in the regulation of the adaptation to iron-limitation, e.g. LCor01340.1 encoding a putative siderophore transporter and LCor00410.1 involved in the siderophore metabolism. Genes encoding the transcription factors LCor08192.1 and LCor01236.1, which are similar to GATA type regulators and to calcineurin regulated CRZ1, respectively, indicating an involvement of the calcineurin pathway in the adaption to iron limitation. Genes encoding MADS-box transcription factors are elevated up to 11 copies compared to the 1-4 copies usually found in other fungi. More findings are: (i) lower content of tRNAs, but unique codons in L. corymbifera, (ii) Over 25% of the proteins are apparently specific for L. corymbifera. (iii) L. corymbifera contains only 2/3 of the proteases (known to be essential virulence factors) in comparison to R. oryzae. On the other hand, the number of secreted proteases, however, is roughly twice as high as in R. oryzae.
Cao, Yunpeng; Han, Yahui; Meng, Dandan; Li, Dahui; Jin, Qing; Lin, Yi; Cai, Yongping
2017-01-01
The ethylene-insensitive3/ethylene-insensitive3-like ( EIN3/EIL ) proteins are a type of nuclear-localized protein with DNA-binding activity in plants. Although the EIN3/EIL gene family has been studied in several plant species, little is known about comprehensive study of the EIN3/EIL gene family in Rosaceae. In this study, ten, five, four, and five EIN3/EIL genes were identified in the genomes of pear ( Pyrus bretschneideri ), mei ( Prunus mume ), peach ( Prunus persica ) and strawberry ( Fragaria vesca ), respectively. Twenty-eight chromosomal segments of EIL/EIN3 gene family were found in four Rosaceae species, and these segments could form seven orthologous or paralogous groups based on interspecies or intraspecies gene colinearity (microsynteny) analysis. Moreover, the highly conserved regions of microsynteny were found in four Rosaceae species. Subsequently it was found that both whole genome duplication and tandem duplication events significantly contributed to the EIL/EIN3 gene family expansion. Gene expression analysis of the EIL/EIN3 genes in the pear revealed subfunctionalization for several PbEIL genes derived from whole genome duplication. It is noteworthy that according to environmental selection pressure analysis, the strong purifying selection should dominate the maintenance of the EIL/EIN3 gene family in four Rosaceae species. These results provided useful information on Rosaceae EIL/EIN3 genes, as well as insights into the evolution of this gene family in four Rosaceae species. Furthermore, high level of microsynteny in the four Rosaceae plants suggested that a large-scale genome duplication event in the EIL/EIN3 gene family was predated to speciation.
Directory of Open Access Journals (Sweden)
Yunpeng Cao
2017-05-01
Full Text Available The ethylene-insensitive3/ethylene-insensitive3-like (EIN3/EIL proteins are a type of nuclear-localized protein with DNA-binding activity in plants. Although the EIN3/EIL gene family has been studied in several plant species, little is known about comprehensive study of the EIN3/EIL gene family in Rosaceae. In this study, ten, five, four, and five EIN3/EIL genes were identified in the genomes of pear (Pyrus bretschneideri, mei (Prunus mume, peach (Prunus persica and strawberry (Fragaria vesca, respectively. Twenty-eight chromosomal segments of EIL/EIN3 gene family were found in four Rosaceae species, and these segments could form seven orthologous or paralogous groups based on interspecies or intraspecies gene colinearity (microsynteny analysis. Moreover, the highly conserved regions of microsynteny were found in four Rosaceae species. Subsequently it was found that both whole genome duplication and tandem duplication events significantly contributed to the EIL/EIN3 gene family expansion. Gene expression analysis of the EIL/EIN3 genes in the pear revealed subfunctionalization for several PbEIL genes derived from whole genome duplication. It is noteworthy that according to environmental selection pressure analysis, the strong purifying selection should dominate the maintenance of the EIL/EIN3 gene family in four Rosaceae species. These results provided useful information on Rosaceae EIL/EIN3 genes, as well as insights into the evolution of this gene family in four Rosaceae species. Furthermore, high level of microsynteny in the four Rosaceae plants suggested that a large-scale genome duplication event in the EIL/EIN3 gene family was predated to speciation.
A genome-wide RNAi screen to dissect centriole duplication and centrosome maturation in Drosophila.
Directory of Open Access Journals (Sweden)
Jeroen Dobbelaere
2008-09-01
Full Text Available Centrosomes comprise a pair of centrioles surrounded by an amorphous pericentriolar material (PCM. Here, we have performed a microscopy-based genome-wide RNA interference (RNAi screen in Drosophila cells to identify proteins required for centriole duplication and mitotic PCM recruitment. We analysed 92% of the Drosophila genome (13,059 genes and identified 32 genes involved in centrosome function. An extensive series of secondary screens classified these genes into four categories: (1 nine are required for centriole duplication, (2 11 are required for centrosome maturation, (3 nine are required for both functions, and (4 three genes regulate centrosome separation. These 32 hits include several new centrosomal components, some of which have human homologs. In addition, we find that the individual depletion of only two proteins, Polo and Centrosomin (Cnn can completely block centrosome maturation. Cnn is phosphorylated during mitosis in a Polo-dependent manner, suggesting that the Polo-dependent phosphorylation of Cnn initiates centrosome maturation in flies.
Lagman, David; Ocampo Daza, Daniel; Widmark, Jenny; Abalo, Xesús M; Sundström, Görel; Larhammar, Dan
2013-11-02
Vertebrate color vision is dependent on four major color opsin subtypes: RH2 (green opsin), SWS1 (ultraviolet opsin), SWS2 (blue opsin), and LWS (red opsin). Together with the dim-light receptor rhodopsin (RH1), these form the family of vertebrate visual opsins. Vertebrate genomes contain many multi-membered gene families that can largely be explained by the two rounds of whole genome duplication (WGD) in the vertebrate ancestor (2R) followed by a third round in the teleost ancestor (3R). Related chromosome regions resulting from WGD or block duplications are said to form a paralogon. We describe here a paralogon containing the genes for visual opsins, the G-protein alpha subunit families for transducin (GNAT) and adenylyl cyclase inhibition (GNAI), the oxytocin and vasopressin receptors (OT/VP-R), and the L-type voltage-gated calcium channels (CACNA1-L). Sequence-based phylogenies and analyses of conserved synteny show that the above-mentioned gene families, and many neighboring gene families, expanded in the early vertebrate WGDs. This allows us to deduce the following evolutionary scenario: The vertebrate ancestor had a chromosome containing the genes for two visual opsins, one GNAT, one GNAI, two OT/VP-Rs and one CACNA1-L gene. This chromosome was quadrupled in 2R. Subsequent gene losses resulted in a set of five visual opsin genes, three GNAT and GNAI genes, six OT/VP-R genes and four CACNA1-L genes. These regions were duplicated again in 3R resulting in additional teleost genes for some of the families. Major chromosomal rearrangements have taken place in the teleost genomes. By comparison with the corresponding chromosomal regions in the spotted gar, which diverged prior to 3R, we could time these rearrangements to post-3R. We present an extensive analysis of the paralogon housing the visual opsin, GNAT and GNAI, OT/VP-R, and CACNA1-L gene families. The combined data imply that the early vertebrate WGD events contributed to the evolution of vision and the
Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S
2010-10-07
PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out
Complete colonic duplication in children.
Khaleghnejad Tabari, Ahmad; Mirshemirani, Alireza; Khaleghnejad Tabari, Nasibeh
2012-01-01
Complete colonic duplication is a very rare congenital anomaly that may have different presentations according to its location and size. Complete colonic duplication can occur in 15% of gastrointestinal duplication. We report two cases of complete colonic duplications, and their characteristics. We present two patients with complete colonic duplication with different types and presentations. Case 1: A 2- year old boy presented to the clinic with abdominal protrusion, difficulty to defecate, chronic constipation and mucosal prolaps covered bulging (rectocele) since he was 6 months old. The patient had palpable pelvic mass with doughy consistency. Rectal exam confirmed perirectal mass with soft consistency. The patient underwent a surgical operation that had total tubular colorectal duplication with one blind end and was treated with simple fenestration of distal end, and was discharged without complication. After two years follow up, he had normal defecation and good weight gain. Case 2: A 2 -day old infant was referred with imperforate anus and complete duplication of recto-sigmoid colon, diphallus, double bladder, and hypospadiasis. After clinical and paraclinical investigations, he underwent operations in several stages in different periods, and was discharged without complications. After four years follow up, he led a normal life. The patients with complete duplication have to be examined carefully because of the high incidence of other systemic anomalies. Treatment includes simple resection of distal common wall, fenestration, and repair other associated anomalies.
Gene family size conservation is a good indicator of evolutionary rates.
Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen
2010-08-01
The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.
Prenatal diagnosis of foetuses with congenital abnormalities and duplication of the MECP2 region.
Fu, Fang; Liu, Huan-ling; Li, Ru; Han, Jin; Yang, Xin; Min, Pan; Zhen, Li; Zhang, Yong-ling; Xie, Gui-e; Lei, Ting-ying; Li, Yan; Li, Jian; Li, Dong-zhi; Liao, Can
2014-08-10
MECP2 duplication results in a well-recognised syndrome in 100% of affected male children; this syndrome is characterised by severe neurodevelopmental disabilities and recurrent infections. However, no sonographic findings have been reported for affected foetuses, and prenatal molecular diagnosis has not been possible for this disease due to lack of prenatal clinical presentation. In this study, we identified a small duplication comprising the MECP2 and L1CAM genes in the Xq28 region in a patient from a family with severe X-linked mental retardation and in a prenatal foetus with brain structural abnormalities. Using high-resolution chromosome microarray analysis (CMA) to screen 108 foetuses with congenital structural abnormalities, we identified additional three foetuses with the MECP2 duplication. Our study indicates that ventriculomegaly, hydrocephalus, agenesis of the corpus callosum, choroid plexus cysts, foetal growth restriction and hydronephrosis might be common ultrasound findings in prenatal foetuses with the MECP2 duplication and provides the first set of prenatal cases with MECP2 duplication, the ultrasonographic phenotype described in these patients will help to recognise the foetuses with possible MECP2 duplication and prompt the appropriate molecular testing. Copyright © 2014 Elsevier B.V. All rights reserved.
Human GW182 Paralogs Are the Central Organizers for RNA-Mediated Control of Transcription.
Hicks, Jessica A; Li, Liande; Matsui, Masayuki; Chu, Yongjun; Volkov, Oleg; Johnson, Krystal C; Corey, David R
2017-08-15
In the cytoplasm, small RNAs can control mammalian translation by regulating the stability of mRNA. In the nucleus, small RNAs can also control transcription and splicing. The mechanisms for RNA-mediated nuclear regulation are not understood and remain controversial, hindering the effective application of nuclear RNAi and investigation of its natural regulatory roles. Here, we reveal that the human GW182 paralogs TNRC6A/B/C are central organizing factors critical to RNA-mediated transcriptional activation. Mass spectrometry of purified nuclear lysates followed by experimental validation demonstrates that TNRC6A interacts with proteins involved in protein degradation, RNAi, the CCR4-NOT complex, the mediator complex, and histone-modifying complexes. Functional analysis implicates TNRC6A, NAT10, MED14, and WDR5 in RNA-mediated transcriptional activation. These findings describe protein complexes capable of bridging RNA-mediated sequence-specific recognition of noncoding RNA transcripts with the regulation of gene transcription. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Isles, Anthony R; Ingason, Andrés; Lowther, Chelsea
2016-01-01
Duplications at 15q11.2-q13.3 overlapping the Prader-Willi/Angelman syndrome (PWS/AS) region have been associated with developmental delay (DD), autism spectrum disorder (ASD) and schizophrenia (SZ). Due to presence of imprinted genes within the region, the parental origin of these duplications m...
Jiménez-Delgado, Senda; Pascual-Anaya, Juan; Garcia-Fernàndez, Jordi
2009-07-01
The discovery that most regulatory genes were conserved among animals from distant phyla challenged the ideas that gene duplication and divergence of homologous coding sequences were the basis for major morphological changes in metazoan evolution. In recent years, however, the interest for the roles, conservation and changes of non-coding sequences grew-up in parallel with genome sequencing projects. Presently, many independent studies are highlighting the importance that subtle changes in cis-regulatory regions had in the evolution of morphology trough the Animal Kingdom. Here we will show and discuss some of these studies, and underscore the future of cis-Evo-Devo research. Nevertheless, we would also explore how gene duplication, which includes duplication of regulatory regions, may have been critical for spatial or temporal co-option of new regulatory networks, causing the deployment of new transcriptome scenarios, and how these induced morphological changes were critical for the evolution of new forms. Forty years after Susumu Ohno famous sentence 'natural selection merely modifies, while redundancy creates', we suggest the alternative: 'natural selection modifies, while redundancy of cis-regulatory elements innovates', and propose the Duplication-Degeneration-Innovation model to explain the increased evolvability of duplicated cis-regulatory regions. Paradoxically, making regulation simpler by subfunctionalization paved the path for future complexity or, in other words, 'to make it simple to make it complex'.
Small homologous blocks in phytophthora genomes do not point to an ancient whole-genome duplication.
van Hooff, Jolien J E; Snel, Berend; Seidl, Michael F
2014-05-01
Genomes of the plant-pathogenic genus Phytophthora are characterized by small duplicated blocks consisting of two consecutive genes (2HOM blocks) and by an elevated abundance of similarly aged gene duplicates. Both properties, in particular the presence of 2HOM blocks, have been attributed to a whole-genome duplication (WGD) at the last common ancestor of Phytophthora. However, large intraspecies synteny-compelling evidence for a WGD-has not been detected. Here, we revisited the WGD hypothesis by deducing the age of 2HOM blocks. Two independent timing methods reveal that the majority of 2HOM blocks arose after divergence of the Phytophthora lineages. In addition, a large proportion of the 2HOM block copies colocalize on the same scaffold. Therefore, the presence of 2HOM blocks does not support a WGD at the last common ancestor of Phytophthora. Thus, genome evolution of Phytophthora is likely driven by alternative mechanisms, such as bursts of transposon activity.
Dissecting a Hidden Gene Duplication: The Arabidopsis thaliana SEC10 Locus
Czech Academy of Sciences Publication Activity Database
Vukašinović, Nemanja; Cvrčková, F.; Eliáš, M.; Cole, R.; Fowler, J.E.; Žárský, Viktor; Synek, Lukáš
2014-01-01
Roč. 9, č. 4 (2014) E-ISSN 1932-6203 R&D Projects: GA ČR GPP501/11/P853; GA ČR(CZ) GAP305/11/1629 Grant - others:GA MŠk ME10033 Institutional support: RVO:61389030 Keywords : WHOLE-GENOME * ARABIDOPSIS-THALIANA * RECENT SEGMENTAL DUPLICATIONS Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.234, year: 2014
Li, Hongxia; Yu, Juhua; Li, Jianlin; Tang, Yongkai; Yu, Fan; Zhou, Jie; Yu, Wenjuan
2016-04-01
Interleukin-17 (IL-17) plays an important role in inflammation and host defense in mammals. In this study, we identified two duplicated IL-17A/F2 genes in the common carp (Cyprinus carpio) (ccIL-17A/F2a and ccIL-17A/F2b), putative encoded proteins contain 140 amino acids (aa) with conserved IL-17 family motifs. Expression analysis revealed high constitutive expression of ccIL-17A/F2s in mucosal tissues, including gill, skin and intestine, their expression could be induced by Aeromonas hydrophila, suggesting a potential role in mucosal immunity. Recombinant ccIL-17A/F2a protein (rccIL-17A/F2a) produced in Escherichia coli could induce the expression of proinflammatory cytokines (IL-1β) and the antimicrobial peptides S100A1, S100A10a and S100A10b in the primary kidney in a dose- and time-dependent manner. Above findings suggest that ccIL-17A/F2 plays an important role in both proinflammatory and innate immunity. Two duplicated ccIL-17A/F2s showed different expression level with ccIL-17A/F2a higher than b, comparison of two 5' regulatory regions indicated the length from anticipated promoter to transcriptional start site (TSS) and putative transcription factor binding site (TFBS) were different. Promoter activity of ccIL-17A/F2a was 2.5 times of ccIL-17A/F2b which consistent with expression results of two genes. These suggest mutations in 5'regulatory region contributed to the differentiation of duplicated genes. To our knowledge, this is the first report to analyze 5'regulatory region of piscine IL-17 family genes. Copyright © 2016 Elsevier Ltd. All rights reserved.
Multiple zebrafish atoh1 genes specify a diversity of neuronal types in the zebrafish cerebellum.
Kidwell, Chelsea U; Su, Chen-Ying; Hibi, Masahiko; Moens, Cecilia B
2018-06-01
A single Atoh1 basic-helix-loop-helix transcription factor specifies multiple neuron types in the mammalian cerebellum and anterior hindbrain. The zebrafish genome encodes three paralagous atoh1 genes whose functions in cerebellum and anterior hindbrain development we explore here. With use of a transgenic reporter, we report that zebrafish atoh1c-expressing cells are organized in two distinct domains that are separated both by space and developmental time. An early isthmic expression domain gives rise to an extracerebellar population in rhombomere 1 and an upper rhombic lip domain gives rise to granule cell progenitors that migrate to populate all four granule cell territories of the fish cerebellum. Using genetic mutants we find that of the three zebrafish atoh1 paralogs, atoh1c and atoh1a are required for the full complement of granule neurons. Surprisingly, the two genes are expressed in non-overlapping granule cell progenitor populations, indicating that fish use duplicate atoh1 genes to generate granule cell diversity that is not detected in mammals. Finally, live imaging of granule cell migration in wildtype and atoh1c mutant embryos reveals that while atoh1c is not required for granule cell specification per se, it is required for granule cells to delaminate and migrate away from the rhombic lip. Copyright © 2018 Elsevier Inc. All rights reserved.
Zhang, Jin; Liu, Bobin; Li, Jianbo; Zhang, Li; Wang, Yan; Zheng, Huanquan; Lu, Mengzhu; Chen, Jun
2015-03-14
Heat shock proteins (Hsps) are molecular chaperones that are involved in many normal cellular processes and stress responses, and heat shock factors (Hsfs) are the transcriptional activators of Hsps. Hsfs and Hsps are widely coordinated in various biological processes. Although the roles of Hsfs and Hsps in stress responses have been well characterized in Arabidopsis, their roles in perennial woody species undergoing various environmental stresses remain unclear. Here, a comprehensive identification and analysis of Hsf and Hsp families in poplars is presented. In Populus trichocarpa, we identified 42 paralogous pairs, 66.7% resulting from a whole genome duplication. The gene structure and motif composition are relatively conserved in each subfamily. Microarray and quantitative real-time RT-PCR analyses showed that most of the Populus Hsf and Hsp genes are differentially expressed upon exposure to various stresses. A coexpression network between Populus Hsf and Hsp genes was generated based on their expression. Coordinated relationships were validated by transient overexpression and subsequent qPCR analyses. The comprehensive analysis indicates that different sets of PtHsps are downstream of particular PtHsfs and provides a basis for functional studies aimed at revealing the roles of these families in poplar development and stress responses.
Crespi, Bernard J; Procyshyn, Tanya L
2017-08-01
We describe and evaluate an integrative hypothesis for helping to explain the major neurocognitive features of individuals with Williams syndrome region deletions and duplications. First, we demonstrate how the cognitive differences between Williams syndrome individuals, individuals with duplications of this region, and healthy individuals parallel the differences between individuals subject to effects of increased or decreased oxytocin. Second, we synthesize evidence showing that variation in expression of the gene GTF2I (General Transcription Factor II-I) underlies the primary social phenotypes of Williams syndrome and that common genetic variation in GTF2I mediates oxytocin reactivity, and its correlates, in healthy populations. Third, we describe findings relevant to the hypothesis that the GTF2I gene is subject to parent of origin effects whose behavioral expression fits with predictions from the kinship theory of genomic imprinting. Fourth, we describe how Williams syndrome can be considered, in part, as an autistic syndrome of Lorna Wing's 'active-but-odd' autism subtype, in contrast to associations of duplications with both schizophrenia and autism. Copyright © 2017 Elsevier Ltd. All rights reserved.
Molecular mechanisms of extensive mitochondrial gene rearrangementin plethodontid salamanders
Energy Technology Data Exchange (ETDEWEB)
Mueller, Rachel Lockridge; Boore, Jeffrey L.
2005-06-01
Extensive gene rearrangement is reported in the mitochondrial genomes of lungless salamanders (Plethodontidae). In each genome with a novel gene order, there is evidence that the rearrangement was mediated by duplication of part of the mitochondrial genome, including the presence of both pseudogenes and additional, presumably functional, copies of duplicated genes. All rearrangement-mediating duplications include either the origin of light strand replication and the nearby tRNA genes or the regions flanking the origin of heavy strand replication. The latter regions comprise nad6, trnE, cob, trnT, an intergenic spacer between trnT and trnP and, in some genomes, trnP, the control region, trnF, rrnS, trnV, rrnL, trnL1, and nad1. In some cases, two copies of duplicated genes, presumptive regulatory regions, and/or sequences with no assignable function have been retained in the genome following the initial duplication; in other genomes, only one of the duplicated copies has been retained. Both tandem and non-tandem duplications are present in these genomes, suggesting different duplication mechanisms. In some of these mtDNAs, up to 25 percent of the total length is composed of tandem duplications of non-coding sequence that includes putative regulatory regions and/or pseudogenes of tRNAs and protein-coding genes along with otherwise unassignable sequences. These data indicate that imprecise initiation and termination of replication, slipped-strand mispairing, and intra-molecular recombination may all have played a role in generating repeats during the evolutionary history of plethodontid mitochondrial genomes.
Holland, Peter W H
2013-01-01
Many homeobox genes encode transcription factors with regulatory roles in animal and plant development. Homeobox genes are found in almost all eukaryotes, and have diversified into 11 gene classes and over 100 gene families in animal evolution, and 10 to 14 gene classes in plants. The largest group in animals is the ANTP class which includes the well-known Hox genes, plus other genes implicated in development including ParaHox (Cdx, Xlox, Gsx), Evx, Dlx, En, NK4, NK3, Msx, and Nanog. Genomic data suggest that the ANTP class diversified by extensive tandem duplication to generate a large array of genes, including an NK gene cluster and a hypothetical ProtoHox gene cluster that duplicated to generate Hox and ParaHox genes. Expression and functional data suggest that NK, Hox, and ParaHox gene clusters acquired distinct roles in patterning the mesoderm, nervous system, and gut. The PRD class is also diverse and includes Pax2/5/8, Pax3/7, Pax4/6, Gsc, Hesx, Otx, Otp, and Pitx genes. PRD genes are not generally arranged in ancient genomic clusters, although the Dux, Obox, and Rhox gene clusters arose in mammalian evolution as did several non-clustered PRD genes. Tandem duplication and genome duplication expanded the number of homeobox genes, possibly contributing to the evolution of developmental complexity, but homeobox gene loss must not be ignored. Evolutionary changes to homeobox gene expression have also been documented, including Hox gene expression patterns shifting in concert with segmental diversification in vertebrates and crustaceans, and deletion of a Pitx1 gene enhancer in pelvic-reduced sticklebacks. WIREs Dev Biol 2013, 2:31-45. doi: 10.1002/wdev.78 For further resources related to this article, please visit the WIREs website. The author declares that he has no conflicts of interest. Copyright © 2012 Wiley Periodicals, Inc.
Williams Syndrome and 15q Duplication: Coincidence versus Association.
Khokhar, Aditi; Agarwal, Swashti; Perez-Colon, Sheila
2017-01-01
Williams syndrome is a multisystem disorder caused by contiguous gene deletion in 7q11.23, commonly associated with distinctive facial features, supravalvular aortic stenosis, short stature, idiopathic hypercalcemia, developmental delay, joint laxity, and a friendly personality. The clinical features of 15q11q13 duplication syndrome include autism, mental retardation, ataxia, seizures, developmental delay, and behavioral problems. We report a rare case of a girl with genetically confirmed Williams syndrome and coexisting 15q duplication syndrome. The patient underwent treatment for central precocious puberty and later presented with primary amenorrhea. The karyotype revealed 47,XX,+mar. FISH analysis for the marker chromosome showed partial trisomy/tetrasomy for proximal chromosome 15q (15p13q13). FISH using an ELN -specific probe demonstrated a deletion in the Williams syndrome critical region in 7q11.23. To our knowledge, a coexistence of Williams syndrome and 15q duplication syndrome has not been reported in the literature. Our patient had early pubertal development, which has been described in some patients with Williams syndrome. However, years later after discontinuing gonadotropin-releasing hormone analogue treatment, she developed primary amenorrhea.
Analysis Of Segmental Duplications In The Pig Genome Based On Next-Generation Sequencing
DEFF Research Database (Denmark)
Fadista, João; Bendixen, Christian
Segmental duplications are >1kb segments of duplicated DNA present in a genome with high sequence identity (>90%). They are associated with genomic rearrangements and provide a significant source of gene and genome evolution within mammalian genomes. Although segmental duplications have been...... extensively studied in other organisms, its analysis in pig has been hampered by the lack of a complete pig genome assembly. By measuring the depth of coverage of Illumina whole-genome shotgun sequencing reads of the Tabasco animal aligned to the latest pig genome assembly (Sus scrofa 10 – based also...... and their associated copy number alterations, focusing on the global organization of these segments and their possible functional significance in porcine phenotypes. This work provides insights into mammalian genome evolution and generates a valuable resource for porcine genomics research...
Rectal duplication: a case report.
Didden, K; Masereel, B; Geyskens, P
2013-01-01
Gastrointestinal tract duplications are uncommon congenital abnormalities, that may occur anywhere along the alimentary tract. Most frequently they occur at the level of the small bowel tract and are symptomatic before the age of two. In our case we report the history of a 68-years old women with a colon duplication, especially a rectal duplication. This is very exceptional.
Pathogenomic inference of virulence-associated genes in Leptospira interrogans.
Lehmann, Jason S; Fouts, Derrick E; Haft, Daniel H; Cannella, Anthony P; Ricaldi, Jessica N; Brinkac, Lauren; Harkins, Derek; Durkin, Scott; Sanka, Ravi; Sutton, Granger; Moreno, Angelo; Vinetz, Joseph M; Matthias, Michael A
2013-01-01
Leptospirosis is a globally important, neglected zoonotic infection caused by spirochetes of the genus Leptospira. Since genetic transformation remains technically limited for pathogenic Leptospira, a systems biology pathogenomic approach was used to infer leptospiral virulence genes by whole genome comparison of culture-attenuated Leptospira interrogans serovar Lai with its virulent, isogenic parent. Among the 11 pathogen-specific protein-coding genes in which non-synonymous mutations were found, a putative soluble adenylate cyclase with host cell cAMP-elevating activity, and two members of a previously unstudied ∼15 member paralogous gene family of unknown function were identified. This gene family was also uniquely found in the alpha-proteobacteria Bartonella bacilliformis and Bartonella australis that are geographically restricted to the Andes and Australia, respectively. How the pathogenic Leptospira and these two Bartonella species came to share this expanded gene family remains an evolutionary mystery. In vivo expression analyses demonstrated up-regulation of 10/11 Leptospira genes identified in the attenuation screen, and profound in vivo, tissue-specific up-regulation by members of the paralogous gene family, suggesting a direct role in virulence and host-pathogen interactions. The pathogenomic experimental design here is generalizable as a functional systems biology approach to studying bacterial pathogenesis and virulence and should encourage similar experimental studies of other pathogens.
Expanded functional diversity of shaker K(+ channels in cnidarians is driven by gene expansion.
Directory of Open Access Journals (Sweden)
Timothy Jegla
Full Text Available The genome of the cnidarian Nematostella vectensis (starlet sea anemone provides a molecular genetic view into the first nervous systems, which appeared in a late common ancestor of cnidarians and bilaterians. Nematostella has a surprisingly large and diverse set of neuronal signaling genes including paralogs of most neuronal signaling molecules found in higher metazoans. Several ion channel gene families are highly expanded in the sea anemone, including three subfamilies of the Shaker K(+ channel gene family: Shaker (Kv1, Shaw (Kv3 and Shal (Kv4. In order to better understand the physiological significance of these voltage-gated K(+ channel expansions, we analyzed the function of 18 members of the 20 gene Shaker subfamily in Nematostella. Six of the Nematostella Shaker genes express functional homotetrameric K(+ channels in vitro. These include functional orthologs of bilaterian Shakers and channels with an unusually high threshold for voltage activation. We identified 11 Nematostella Shaker genes with a distinct "silent" or "regulatory" phenotype; these encode subunits that function only in heteromeric channels and serve to further diversify Nematostella Shaker channel gating properties. Subunits with the regulatory phenotype have not previously been found in the Shaker subfamily, but have evolved independently in the Shab (Kv2 family in vertebrates and the Shal family in a cnidarian. Phylogenetic analysis indicates that regulatory subunits were present in ancestral cnidarians, but have continued to diversity at a high rate after the split between anthozoans and hydrozoans. Comparison of Shaker family gene complements from diverse metazoan species reveals frequent, large scale duplication has produced highly unique sets of Shaker channels in the major metazoan lineages.
Reversion in variants from a duplication strain of Aspergillus nidulans
International Nuclear Information System (INIS)
Menezes, E.M.; Azevedo, J.L.
1978-01-01
Strains of Aspergillus nidulans with a chromosome segment in duplicate, one in normal position and one translocated to another chromosome, are unstable at mitosis. In addition to variants which result from deletions in either of the duplicate segments, which usually have improved morphology, they produce variants with deteriorated morphology. Three deteriorated variants reverted frequently to parental type morphology, both spontaneously and after ultra-violet treatment. Of six reversions analysed genetically, five were due to suppressors and one was probably due to back mutation. The suppressors segregated as single genes and were not linked to the mutation which they suppress. The instability of these so-called 'deteriorated' variants is discussed in relation to mitotic instability phenomena in A. nidulans. (orig.) [de
Directory of Open Access Journals (Sweden)
Kulkarni B
1995-04-01
Full Text Available Duplications of the alimentary tract are of a great rarity, particularly so in the rectum. Because of its rarity, the difficulty of making a correct diagnosis and of selection of proper approach for treatment, this entity bears a special significance. The present case report deals with a female newborn who presented with imperforate anus and a rectovestibular fistula and a mass prolapsing at the introitus. Complete excision of the mass was carried out through the perineal approach and the child then underwent, a PSARP for the correction of the rectal anomaly. Histology confirmed the mass to be a rectal duplication.
Alves, R N; Cardoso, J C R; Harboe, T; Martins, R S T; Manchado, M; Norberg, B; Power, D M
2017-05-15
Deiodinase 3 (Dio3) plays an essential role during early development in vertebrates by controlling tissue thyroid hormone (TH) availability. The Atlantic halibut (Hippoglossus hippoglossus) possesses duplicate dio3 genes (dio3a and dio3b). Expression analysis indicates that dio3b levels change in abocular skin during metamorphosis and this suggests that this enzyme is associated with the divergent development of larval skin to the juvenile phenotype. In larvae exposed to MMI, a chemical that inhibits TH production, expression of dio3b in ocular skin is significantly up-regulated suggesting that THs normally modulate this genes expression during this developmental event. The molecular basis for divergent dio3a and dio3b expression and responsiveness to MMI treatment is explained by the multiple conserved TREs in the proximal promoter region of teleost dio3b and their absence from the promoter of dio3a. We propose that the divergent expression of dio3 in ocular and abocular skin during halibut metamorphosis contributes to the asymmetric pigment development in response to THs. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Lei Zhong
2017-11-01
Full Text Available In contrast to other olfactory receptor families that exhibit frequent lineage-specific expansions, the vomeronasal type 1 receptor (V1R family exhibits a canonical six-member repertoire in teleosts. V1r1 and V1r2 are present in no more than one copy in all examined teleosts, including salmons, which are ancient polyploids, implying strict evolutionary constraints. However, recent polyploids have not been examined. Here, we identified a young allotetraploid lineage of weatherfishes and investigated their V1r1-V1r2 cluster. We found a novel pattern that the parental V1r1-V1r2 clusters had recombined in the tetraploid genome and that the recombinant was nearly fixed in the tetraploid population. Subsequent analyses suggested strong selective pressure, for both a new combination of paralogs and homogeneity among gene duplicates, acting on the V1r1-V1r2 pair.
Energy Technology Data Exchange (ETDEWEB)
Lingg, G; Nebel, G
1981-08-01
The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined.
A paralogous decoy protects Phytophthora sojae apoplastic effector PsXEG1 from a host inhibitor.
Ma, Zhenchuan; Zhu, Lin; Song, Tianqiao; Wang, Yang; Zhang, Qi; Xia, Yeqiang; Qiu, Min; Lin, Yachun; Li, Haiyang; Kong, Liang; Fang, Yufeng; Ye, Wenwu; Wang, Yan; Dong, Suomeng; Zheng, Xiaobo; Tyler, Brett M; Wang, Yuanchao
2017-02-17
The extracellular space (apoplast) of plant tissue represents a critical battleground between plants and attacking microbes. Here we show that a pathogen-secreted apoplastic xyloglucan-specific endoglucanase, PsXEG1, is a focus of this struggle in the Phytophthora sojae -soybean interaction. We show that soybean produces an apoplastic glucanase inhibitor protein, GmGIP1, that binds to PsXEG1 to block its contribution to virulence. P. sojae , however, secretes a paralogous PsXEG1-like protein, PsXLP1, that has lost enzyme activity but binds to GmGIP1 more tightly than does PsXEG1, thus freeing PsXEG1 to support P. sojae infection. The gene pair encoding PsXEG1 and PsXLP1 is conserved in many Phytophthora species, and the P. parasitica orthologs PpXEG1 and PpXLP1 have similar functions. Thus, this apoplastic decoy strategy may be widely used in Phytophthora pathosystems. Copyright © 2017, American Association for the Advancement of Science.
Harduin-Lepers, Anne; Petit, Daniel; Mollicone, Rosella; Delannoy, Philippe; Petit, Jean-Michel; Oriol, Rafael
2008-09-23
initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD) R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.
Directory of Open Access Journals (Sweden)
Petit Jean-Michel
2008-09-01
activities, in both invertebrates and vertebrates. The initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.
Refining discordant gene trees.
Górecki, Pawel; Eulenstein, Oliver
2014-01-01
Evolutionary studies are complicated by discordance between gene trees and the species tree in which they evolved. Dealing with discordant trees often relies on comparison costs between gene and species trees, including the well-established Robinson-Foulds, gene duplication, and deep coalescence costs. While these costs have provided credible results for binary rooted gene trees, corresponding cost definitions for non-binary unrooted gene trees, which are frequently occurring in practice, are challenged by biological realism. We propose a natural extension of the well-established costs for comparing unrooted and non-binary gene trees with rooted binary species trees using a binary refinement model. For the duplication cost we describe an efficient algorithm that is based on a linear time reduction and also computes an optimal rooted binary refinement of the given gene tree. Finally, we show that similar reductions lead to solutions for computing the deep coalescence and the Robinson-Foulds costs. Our binary refinement of Robinson-Foulds, gene duplication, and deep coalescence costs for unrooted and non-binary gene trees together with the linear time reductions provided here for computing these costs significantly extends the range of trees that can be incorporated into approaches dealing with discordance.
Adaptive evolution of threonine deaminase in plant defense against insect herbivores
Energy Technology Data Exchange (ETDEWEB)
Gonzales-Vigil, Eliana; Bianchetti, Christopher M.; Phillips, Jr., George N.; Howe, Gregg A. (MSU); (UW)
2011-11-07
Gene duplication is a major source of plant chemical diversity that mediates plant-herbivore interactions. There is little direct evidence, however, that novel chemical traits arising from gene duplication reduce herbivory. Higher plants use threonine deaminase (TD) to catalyze the dehydration of threonine (Thr) to {alpha}-ketobutyrate and ammonia as the committed step in the biosynthesis of isoleucine (Ile). Cultivated tomato and related Solanum species contain a duplicated TD paralog (TD2) that is coexpressed with a suite of genes involved in herbivore resistance. Analysis of TD2-deficient tomato lines showed that TD2 has a defensive function related to Thr catabolism in the gut of lepidopteran herbivores. During herbivory, the regulatory domain of TD2 is removed by proteolysis to generate a truncated protein (pTD2) that efficiently degrades Thr without being inhibited by Ile. We show that this proteolytic activation step occurs in the gut of lepidopteran but not coleopteran herbivores, and is catalyzed by a chymotrypsin-like protease of insect origin. Analysis of purified recombinant enzymes showed that TD2 is remarkably more resistant to proteolysis and high temperature than the ancestral TD1 isoform. The crystal structure of pTD2 provided evidence that electrostatic interactions constitute a stabilizing feature associated with adaptation of TD2 to the extreme environment of the lepidopteran gut. These findings demonstrate a role for gene duplication in the evolution of a plant defense that targets and co-opts herbivore digestive physiology.
Conservation of gene linkage in dispersed vertebrate NK homeobox clusters.
Wotton, Karl R; Weierud, Frida K; Juárez-Morales, José L; Alvares, Lúcia E; Dietrich, Susanne; Lewis, Katharine E
2009-10-01
Nk homeobox genes are important regulators of many different developmental processes including muscle, heart, central nervous system and sensory organ development. They are thought to have arisen as part of the ANTP megacluster, which also gave rise to Hox and ParaHox genes, and at least some NK genes remain tightly linked in all animals examined so far. The protostome-deuterostome ancestor probably contained a cluster of nine Nk genes: (Msx)-(Nk4/tinman)-(Nk3/bagpipe)-(Lbx/ladybird)-(Tlx/c15)-(Nk7)-(Nk6/hgtx)-(Nk1/slouch)-(Nk5/Hmx). Of these genes, only NKX2.6-NKX3.1, LBX1-TLX1 and LBX2-TLX2 remain tightly linked in humans. However, it is currently unclear whether this is unique to the human genome as we do not know which of these Nk genes are clustered in other vertebrates. This makes it difficult to assess whether the remaining linkages are due to selective pressures or because chance rearrangements have "missed" certain genes. In this paper, we identify all of the paralogs of these ancestrally clustered NK genes in several distinct vertebrates. We demonstrate that tight linkages of Lbx1-Tlx1, Lbx2-Tlx2 and Nkx3.1-Nkx2.6 have been widely maintained in both the ray-finned and lobe-finned fish lineages. Moreover, the recently duplicated Hmx2-Hmx3 genes are also tightly linked. Finally, we show that Lbx1-Tlx1 and Hmx2-Hmx3 are flanked by highly conserved noncoding elements, suggesting that shared regulatory regions may have resulted in evolutionary pressure to maintain these linkages. Consistent with this, these pairs of genes have overlapping expression domains. In contrast, Lbx2-Tlx2 and Nkx3.1-Nkx2.6, which do not seem to be coexpressed, are also not associated with conserved noncoding sequences, suggesting that an alternative mechanism may be responsible for the continued clustering of these genes.
International Nuclear Information System (INIS)
Lingg, G.; Nebel, G.
1981-01-01
The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined. (orig.) [de
DEFF Research Database (Denmark)
Signorini, Cinzia; De Felice, Claudio; Leoncini, Silvia
2016-01-01
Rett syndrome (RTT) and MECP2 duplication syndrome (MDS) are neurodevelopmental disorders caused by alterations in the methyl-CpG binding protein 2 (MECP2) gene expression. A relationship between MECP2 loss-of-function mutations and oxidative stress has been previously documented in RTT patients...... and murine models. To date, no data on oxidative stress have been reported for the MECP2 gain-of-function mutations in patients with MDS. In the present work, the pro-oxidant status and oxidative fatty acid damage in MDS was investigated (subjects n = 6) and compared to RTT (subjects n = 24) and healthy...... similar to those observed in RTT patients except for higher plasma F2-isoprostanes levels (P work shows unique data in patients affected by MDS. For the first...
Anterior colorectal duplication presenting as rectal prolapse.
Ramirez-Resendiz, Amador; Asz, Jose; Medina-Vega, F Antonio; Ortega-Salgado, J Arturo
2007-09-01
Duplications of the gastrointestinal (GI) tract are rare. Only 5% of them are rectal and there are very few reports of rectal prolapse (RP) caused by a duplication. An 11 month-old female presented with a RP caused by a blind-ended anterior tubular colorectal duplication. The duplication was successfully opened and connected to the normal rectum without complications. Although infrequent, a rectal duplication should be considered in the differential diagnosis of RP.
Xu, Xiu; Xu, Qiong; Zhang, Ying; Zhang, Xiaodi; Cheng, Tianlin; Wu, Bingbing; Ding, Yanhua; Lu, Ping; Zheng, Jingjing; Zhang, Min; Qiu, Zilong; Yu, Xiang
2012-08-21
Autistic spectrum disorders (ASDs) are a family of neurodevelopmental disorders with strong genetic components. Recent studies have shown that copy number variations in dosage sensitive genes can contribute significantly to these disorders. One such gene is the transcription factor MECP2, whose loss of function in females results in Rett syndrome, while its duplication in males results in developmental delay and autism. Here, we identified a Chinese family with two brothers both inheriting a 2.2 Mb MECP2-containing duplication (151,369,305 - 153,589,577) from their mother. In addition, both brothers also had a 213.7 kb duplication on Chromosome 2, inherited from their father. The older brother also carried a 48.4 kb duplication on Chromosome 2 inherited from the mother, and a 8.2 kb deletion at 11q13.5 inherited from the father. Based on the published literature, MECP2 is the most autism-associated gene among the identified CNVs. Consistently, the boys displayed clinical features in common with other patients carrying MECP2 duplications, including intellectual disability, autism, lack of speech, slight hypotonia and unsteadiness of movement. They also had slight dysmorphic features including a depressed nose bridge, large ears and midface hypoplasia. Interestingly, they did not exhibit other clinical features commonly observed in American-European patients with MECP2 duplication, including recurrent respiratory infections and epilepsy. To our knowledge, this is the first identification and characterization of Chinese Han patients with MECP2-containing duplications. Further cases are required to determine if the above described clinical differences are due to individual variations or related to the genetic background of the patients.
Duplication of SOX9 associated with 46,XX ovotesticular disorder of sex development.
López-Hernández, Berenice; Méndez, Juan Pablo; Coral-Vázquez, Ramón Mauricio; Benítez-Granados, Jesús; Zenteno, Juan Carlos; Villegas-Ruiz, Vanessa; Calzada-León, Raúl; Soderlund, Daniela; Canto, Patricia
2018-04-04
The purpose of the present study was to investigate whether ten unrelated SRY-negative individuals with this sex differentiation disorder presented a double dose of SOX9 as the cause of their disease. Ten unrelated SRY-negative 46,XX ovotesticular disorder of sexual development (DSD) subjects were molecularly studied. Multiplex-ligation dependent probe amplification (MLPA) and quantitative real-time PCR analysis (qRT-PCR) for SOX9 were performed. The MLPA analysis demonstrated that one patient presented a heterozygous duplication of the entire SOX9 coding region (above 1.3 value of peak ratio), as well as at least a ~ 483 kb upstream duplication. Moreover, no duplication of other SOX9 probes was observed corresponding to the region between -1007 and -1500 kb upstream. A qRT-PCR analysis showed a duplication of at least -581 kb upstream and ~1.63 kb of the coding region that encompasses exon 3. The limits of the duplication were mapped approximately from ~71539762 to 72122741 of Chr17. No molecular abnormalities were found in the remaining nine patients. This study is thought to be the first report regarding a duplication of SOX9 that is associated with the presence of 46,XX ovotesticular DSD, encompassing at least -581 kb upstream, and the almost entire coding region of the gene. Copyright © 2018 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.
Genes and proteins of Escherichia coli K-12.
Riley, M
1998-01-01
GenProtEC is a database of Escherichia coli genes and their gene products, classified by type of function and physiological role and with citations to the literature for each. Also present are data on sequence similarities among E.coli proteins, representing groups of paralogous genes, with PAM values, percent identity of amino acids, length of alignment and percent aligned. GenProtEC can be accessed at the URL http://www.mbl.edu/html/ecoli.html
Yin, Guangjun; Xu, Hongliang; Xiao, Shuyang; Qin, Yajuan; Li, Yaxuan; Yan, Yueming; Hu, Yingkao
2013-10-03
WRKY genes encode one of the most abundant groups of transcription factors in higher plants, and its members regulate important biological process such as growth, development, and responses to biotic and abiotic stresses. Although the soybean genome sequence has been published, functional studies on soybean genes still lag behind those of other species. We identified a total of 133 WRKY members in the soybean genome. According to structural features of their encoded proteins and to the phylogenetic tree, the soybean WRKY family could be classified into three groups (groups I, II, and III). A majority of WRKY genes (76.7%; 102 of 133) were segmentally duplicated and 13.5% (18 of 133) of the genes were tandemly duplicated. This pattern was not apparent in Arabidopsis or rice. The transcriptome atlas revealed notable differential expression in either transcript abundance or in expression patterns under normal growth conditions, which indicated wide functional divergence in this family. Furthermore, some critical amino acids were detected using DIVERGE v2.0 in specific comparisons, suggesting that these sites have contributed to functional divergence among groups or subgroups. In addition, site model and branch-site model analyses of positive Darwinian selection (PDS) showed that different selection regimes could have affected the evolution of these groups. Sites with high probabilities of having been under PDS were found in groups I, II c, II e, and III. Together, these results contribute to a detailed understanding of the molecular evolution of the WRKY gene family in soybean. In this work, all the WRKY genes, which were generated mainly through segmental duplication, were identified in the soybean genome. Moreover, differential expression and functional divergence of the duplicated WRKY genes were two major features of this family throughout their evolutionary history. Positive selection analysis revealed that the different groups have different evolutionary rates
Decoding Synteny Blocks and Large-Scale Duplications in Mammalian and Plant Genomes
Peng, Qian; Alekseyev, Max A.; Tesler, Glenn; Pevzner, Pavel A.
The existing synteny block reconstruction algorithms use anchors (e.g., orthologous genes) shared over all genomes to construct the synteny blocks for multiple genomes. This approach, while efficient for a few genomes, cannot be scaled to address the need to construct synteny blocks in many mammalian genomes that are currently being sequenced. The problem is that the number of anchors shared among all genomes quickly decreases with the increase in the number of genomes. Another problem is that many genomes (plant genomes in particular) had extensive duplications, which makes decoding of genomic architecture and rearrangement analysis in plants difficult. The existing synteny block generation algorithms in plants do not address the issue of generating non-overlapping synteny blocks suitable for analyzing rearrangements and evolution history of duplications. We present a new algorithm based on the A-Bruijn graph framework that overcomes these difficulties and provides a unified approach to synteny block reconstruction for multiple genomes, and for genomes with large duplications.
Arashida, Ryo; Kakizawa, Shigeyuki; Hoshi, Ayaka; Ishii, Yoshiko; Jung, Hee-Young; Kagiwada, Satoshi; Yamaji, Yasuyuki; Oshima, Kenro; Namba, Shigetou
2008-04-01
Phytoplasmas are phloem-limited plant pathogens that are transmitted by insect vectors and are associated with diseases in hundreds of plant species. Despite their small sizes, phytoplasma genomes have repeat-rich sequences, which are due to several genes that are encoded as multiple copies. These multiple genes exist in a gene cluster, the potential mobile unit (PMU). PMUs are present at several distinct regions in the phytoplasma genome. The multicopy genes encoded by PMUs (herein named mobile unit genes [MUGs]) and similar genes elsewhere in the genome (herein named fundamental genes [FUGs]) are likely to have the same function based on their annotations. In this manuscript we show evidence that MUGs and FUGs do not cluster together within the same clade. Each MUG is in a cluster with a short branch length, suggesting that MUGs are recently diverged paralogs, whereas the origin of FUGs is different from that of MUGs. We also compared the genome structures around the lplA gene in two derivative lines of the 'Candidatus Phytoplasma asteris' OY strain, the severe-symptom line W (OY-W) and the mild-symptom line M (OY-M). The gene organizations of the nucleotide sequences upstream of the lplA genes of OY-W and OY-M were dramatically different. The tra5 insertion sequence, an element of PMUs, was found only in this region in OY-W. These results suggest that transposition of entire PMUs and PMU sections has occurred frequently in the OY phytoplasma genome. The difference in the pathogenicities of OY-W and OY-M might be caused by the duplication and transposition of PMUs, followed by genome rearrangement.
Genomic organization of plant aminopropyl transferases.
Rodríguez-Kessler, Margarita; Delgado-Sánchez, Pablo; Rodríguez-Kessler, Gabriela Theresia; Moriguchi, Takaya; Jiménez-Bremont, Juan Francisco
2010-07-01
Aminopropyl transferases like spermidine synthase (SPDS; EC 2.5.1.16), spermine synthase and thermospermine synthase (SPMS, tSPMS; EC 2.5.1.22) belong to a class of widely distributed enzymes that use decarboxylated S-adenosylmethionine as an aminopropyl donor and putrescine or spermidine as an amino acceptor to form in that order spermidine, spermine or thermospermine. We describe the analysis of plant genomic sequences encoding SPDS, SPMS, tSPMS and PMT (putrescine N-methyltransferase; EC 2.1.1.53). Genome organization (including exon size, gain and loss, as well as intron number, size, loss, retention, placement and phase, and the presence of transposons) of plant aminopropyl transferase genes were compared between the genomic sequences of SPDS, SPMS and tSPMS from Zea mays, Oryza sativa, Malus x domestica, Populus trichocarpa, Arabidopsis thaliana and Physcomitrella patens. In addition, the genomic organization of plant PMT genes, proposed to be derived from SPDS during the evolution of alkaloid metabolism, is illustrated. Herein, a particular conservation and arrangement of exon and intron sequences between plant SPDS, SPMS and PMT genes that clearly differs with that of ACL5 genes, is shown. The possible acquisition of the plant SPMS exon II and, in particular exon XI in the monocot SPMS genes, is a remarkable feature that allows their differentiation from SPDS genes. In accordance with our in silico analysis, functional complementation experiments of the maize ZmSPMS1 enzyme (previously considered to be SPDS) in yeast demonstrated its spermine synthase activity. Another significant aspect is the conservation of intron sequences among SPDS and PMT paralogs. In addition the existence of microsynteny among some SPDS paralogs, especially in P. trichocarpa and A. thaliana, supports duplication events of plant SPDS genes. Based in our analysis, we hypothesize that SPMS genes appeared with the divergence of vascular plants by a processes of gene duplication and the
Brand, Cara L; Larracuente, Amanda M; Presgraves, Daven C
2015-05-01
Meiotic drive elements are a special class of evolutionarily "selfish genes" that subvert Mendelian segregation to gain preferential transmission at the expense of homologous loci. Many drive elements appear to be maintained in populations as stable polymorphisms, their equilibrium frequencies determined by the balance between drive (increasing frequency) and selection (decreasing frequency). Here we show that a classic, seemingly balanced, drive system is instead characterized by frequent evolutionary turnover giving rise to dynamic, rather than stable, equilibrium frequencies. The autosomal Segregation Distorter (SD) system of the fruit fly Drosophila melanogaster is a selfish coadapted meiotic drive gene complex in which the major driver corresponds to a partial duplication of the gene Ran-GTPase activating protein (RanGAP). SD chromosomes segregate at similar, low frequencies of 1-5% in natural populations worldwide, consistent with a balanced polymorphism. Surprisingly, our population genetic analyses reveal evidence for parallel, independent selective sweeps of different SD chromosomes in populations on different continents. These findings suggest that, rather than persisting at a single stable equilibrium, SD chromosomes turn over frequently within populations. © 2015 The Author(s). Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.
Cep63 and cep152 cooperate to ensure centriole duplication.
Directory of Open Access Journals (Sweden)
Nicola J Brown
Full Text Available Centrosomes consist of two centrioles embedded in pericentriolar material and function as the main microtubule organising centres in dividing animal cells. They ensure proper formation and orientation of the mitotic spindle and are therefore essential for the maintenance of genome stability. Centrosome function is crucial during embryonic development, highlighted by the discovery of mutations in genes encoding centrosome or spindle pole proteins that cause autosomal recessive primary microcephaly, including Cep63 and Cep152. In this study we show that Cep63 functions to ensure that centriole duplication occurs reliably in dividing mammalian cells. We show that the interaction between Cep63 and Cep152 can occur independently of centrosome localisation and that the two proteins are dependent on one another for centrosomal localisation. Further, both mouse and human Cep63 and Cep152 cooperate to ensure efficient centriole duplication by promoting the accumulation of essential centriole duplication factors upstream of SAS-6 recruitment and procentriole formation. These observations describe the requirement for Cep63 in maintaining centriole number in dividing mammalian cells and further establish the order of events in centriole formation.
Juntheikki-Palovaara, Inka; Tähtiharju, Sari; Lan, Tianying; Broholm, Suvi K; Rijpkema, Anneke S; Ruonala, Raili; Kale, Liga; Albert, Victor A; Teeri, Teemu H; Elomaa, Paula
2014-09-01
The complex inflorescences (capitula) of Asteraceae consist of different types of flowers. In Gerbera hybrida (gerbera), the peripheral ray flowers are bilaterally symmetrical and lack functional stamens while the central disc flowers are more radially symmetrical and hermaphroditic. Proteins of the CYC2 subclade of the CYC/TB1-like TCP domain transcription factors have been recruited several times independently for parallel evolution of bilaterally symmetrical flowers in various angiosperm plant lineages, and have also been shown to regulate flower-type identity in Asteraceae. The CYC2 subclade genes in gerbera show largely overlapping gene expression patterns. At the level of single flowers, their expression domain in petals shows a spatial shift from the dorsal pattern known so far in species with bilaterally symmetrical flowers, suggesting that this change in expression may have evolved after the origin of Asteraceae. Functional analysis indicates that GhCYC2, GhCYC3 and GhCYC4 mediate positional information at the proximal-distal axis of the inflorescence, leading to differentiation of ray flowers, but that they also regulate ray flower petal growth by affecting cell proliferation until the final size and shape of the petals is reached. Moreover, our data show functional diversification for the GhCYC5 gene. Ectopic activation of GhCYC5 increases flower density in the inflorescence, suggesting that GhCYC5 may promote the flower initiation rate during expansion of the capitulum. Our data thus indicate that modification of the ancestral network of TCP factors has, through gene duplications, led to the establishment of new expression domains and to functional diversification. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
Predicting genome-wide redundancy using machine learning
Directory of Open Access Journals (Sweden)
Shasha Dennis E
2010-11-01
Full Text Available Abstract Background Gene duplication can lead to genetic redundancy, which masks the function of mutated genes in genetic analyses. Methods to increase sensitivity in identifying genetic redundancy can improve the efficiency of reverse genetics and lend insights into the evolutionary outcomes of gene duplication. Machine learning techniques are well suited to classifying gene family members into redundant and non-redundant gene pairs in model species where sufficient genetic and genomic data is available, such as Arabidopsis thaliana, the test case used here. Results Machine learning techniques that combine multiple attributes led to a dramatic improvement in predicting genetic redundancy over single trait classifiers alone, such as BLAST E-values or expression correlation. In withholding analysis, one of the methods used here, Support Vector Machines, was two-fold more precise than single attribute classifiers, reaching a level where the majority of redundant calls were correctly labeled. Using this higher confidence in identifying redundancy, machine learning predicts that about half of all genes in Arabidopsis showed the signature of predicted redundancy with at least one but typically less than three other family members. Interestingly, a large proportion of predicted redundant gene pairs were relatively old duplications (e.g., Ks > 1, suggesting that redundancy is stable over long evolutionary periods. Conclusions Machine learning predicts that most genes will have a functionally redundant paralog but will exhibit redundancy with relatively few genes within a family. The predictions and gene pair attributes for Arabidopsis provide a new resource for research in genetics and genome evolution. These techniques can now be applied to other organisms.
Pathogenomic inference of virulence-associated genes in Leptospira interrogans.
Directory of Open Access Journals (Sweden)
Jason S Lehmann
Full Text Available Leptospirosis is a globally important, neglected zoonotic infection caused by spirochetes of the genus Leptospira. Since genetic transformation remains technically limited for pathogenic Leptospira, a systems biology pathogenomic approach was used to infer leptospiral virulence genes by whole genome comparison of culture-attenuated Leptospira interrogans serovar Lai with its virulent, isogenic parent. Among the 11 pathogen-specific protein-coding genes in which non-synonymous mutations were found, a putative soluble adenylate cyclase with host cell cAMP-elevating activity, and two members of a previously unstudied ∼15 member paralogous gene family of unknown function were identified. This gene family was also uniquely found in the alpha-proteobacteria Bartonella bacilliformis and Bartonella australis that are geographically restricted to the Andes and Australia, respectively. How the pathogenic Leptospira and these two Bartonella species came to share this expanded gene family remains an evolutionary mystery. In vivo expression analyses demonstrated up-regulation of 10/11 Leptospira genes identified in the attenuation screen, and profound in vivo, tissue-specific up-regulation by members of the paralogous gene family, suggesting a direct role in virulence and host-pathogen interactions. The pathogenomic experimental design here is generalizable as a functional systems biology approach to studying bacterial pathogenesis and virulence and should encourage similar experimental studies of other pathogens.
Directory of Open Access Journals (Sweden)
Xu Xiu
2012-08-01
Full Text Available Abstract Background Autistic spectrum disorders (ASDs are a family of neurodevelopmental disorders with strong genetic components. Recent studies have shown that copy number variations in dosage sensitive genes can contribute significantly to these disorders. One such gene is the transcription factor MECP2, whose loss of function in females results in Rett syndrome, while its duplication in males results in developmental delay and autism. Case presentation Here, we identified a Chinese family with two brothers both inheriting a 2.2 Mb MECP2-containing duplication (151,369,305 – 153,589,577 from their mother. In addition, both brothers also had a 213.7 kb duplication on Chromosome 2, inherited from their father. The older brother also carried a 48.4 kb duplication on Chromosome 2 inherited from the mother, and a 8.2 kb deletion at 11q13.5 inherited from the father. Based on the published literature, MECP2 is the most autism-associated gene among the identified CNVs. Consistently, the boys displayed clinical features in common with other patients carrying MECP2 duplications, including intellectual disability, autism, lack of speech, slight hypotonia and unsteadiness of movement. They also had slight dysmorphic features including a depressed nose bridge, large ears and midface hypoplasia. Interestingly, they did not exhibit other clinical features commonly observed in American-European patients with MECP2 duplication, including recurrent respiratory infections and epilepsy. Conclusions To our knowledge, this is the first identification and characterization of Chinese Han patients with MECP2-containing duplications. Further cases are required to determine if the above described clinical differences are due to individual variations or related to the genetic background of the patients.
Ye, Jun-jie; Ma, Li; Yang, Li-juan; Wang, Jin-huan; Wang, Yue-li; Guo, Hai; Gong, Ning; Nie, Wen-hui; Zhao, Shu-hua
2013-09-01
There are many reports on associations between spermatogenesis and partial azoospermia factor c (AZFc) deletions as well as duplications; however, results are conflicting, possibly due to differences in methodology and ethnic background. The purpose of this study is to investigate the association of AZFc polymorphisms and male infertility in the Yi ethnic population, residents within Yunnan Province, China. A total of 224 infertile patients and 153 fertile subjects were selected in the Yi ethnic population. The study was performed by sequence-tagged site plus/minus (STS+/-) analysis followed by gene dosage and gene copy definition analysis. Y haplotypes of 215 cases and 115 controls were defined by 12 binary markers using single nucleotide polymorphism on Y chromosome (Y-SNP) multiplex assays based on single base primer extension technology. The distribution of Y haplotypes was not significantly different between the case and control groups. The frequencies of both gr/gr (7.6% vs. 8.5%) and b2/b3 (6.3% vs. 8.5%) deletions do not show significant differences. Similarly, single nucleotide variant (SNV) analysis shows no significant difference of gene copy definition between the cases and controls. However, the frequency of partial duplications in the infertile group (4.0%) is significantly higher than that in the control group (0.7%). Further, we found a case with sY1206 deletion which had two CDY1 copies but removed half of DAZ genes. Our results show that male infertility is associated with partial AZFc duplications, but neither gr/gr nor b2/b3 deletions, suggesting that partial AZFc duplications rather than deletions are risk factors for male infertility in Chinese-Yi population.
Meiotic UV-sensitive mutant that causes deletion of duplications in neurospora
International Nuclear Information System (INIS)
Newmeyer, D.; Galeazzi, D.R.
1978-01-01
The meiotic-3 (mei-3) mutant of Neurospora crassa has several effects: (1) when homozygous, it almost completely blocks meiosis and ascospore formation, (2) it is sensitive to uv, (3) its growth is inhibited by histidine, and (4) it increases the instability of nontandem duplications. This was shown for duplications produced by five different rearrangements and was demonstrated by two different criteria. The effects on meiosis and duplication instability are expressed strongly at 25 0 ; the effects on sensitivity to uv and to histidine are expressed strongly at 38.5 0 but only slightly at 25 0 . Nevertheless, all four effects were shown to be due to a single gene. Mei-3 is not allelic with previously reported uv-sensitive mutants. Two other results were obtained that are not necessarily due to mei-3: (1) a cross involving mei-3 produced a new unlinked meiotic mutant, mei-4, which is not sensitive to uv or histidine, and (2) a burst of several new mutants occurred in a different mei-3 stock, including a partial revertant to mei-3. Mei-3 has previously been shown to cause frequent complete loss of a terminal duplicate segment, beginning exactly at the original rearrangement breakpoint. Possible mechanisms are discussed by which a uv-sensitive mutant could cause such precise deletions
Dietary and flight energetic adaptations in a salivary gland transcriptome of an insectivorous bat.
Directory of Open Access Journals (Sweden)
Carleton J Phillips
Full Text Available We hypothesized that evolution of salivary gland secretory proteome has been important in adaptation to insectivory, the most common dietary strategy among Chiroptera. A submandibular salivary gland (SMG transcriptome was sequenced for the little brown bat, Myotis lucifugus. The likely secretory proteome of 23 genes included seven (RETNLB, PSAP, CLU, APOE, LCN2, C3, CEL related to M. lucifugus insectivorous diet and metabolism. Six of the secretory proteins probably are endocrine, whereas one (CEL most likely is exocrine. The encoded proteins are associated with lipid hydrolysis, regulation of lipid metabolism, lipid transport, and insulin resistance. They are capable of processing exogenous lipids for flight metabolism while foraging. Salivary carboxyl ester lipase (CEL is thought to hydrolyze insect lipophorins, which probably are absorbed across the gastric mucosa during feeding. The other six proteins are predicted either to maintain these lipids at high blood concentrations or to facilitate transport and uptake by flight muscles. Expression of these seven genes and coordinated secretion from a single organ is novel to this insectivorous bat, and apparently has evolved through instances of gene duplication, gene recruitment, and nucleotide selection. Four of the recruited genes are single-copy in the Myotis genome, whereas three have undergone duplication(s with two of these genes exhibiting evolutionary 'bursts' of duplication resulting in multiple paralogs. Evidence for episodic directional selection was found for six of seven genes, reinforcing the conclusion that the recruited genes have important roles in adaptation to insectivory and the metabolic demands of flight. Intragenic frequencies of mobile- element-like sequences differed from frequencies in the whole M. lucifugus genome. Differences among recruited genes imply separate evolutionary trajectories and that adaptation was not a single, coordinated event.
Govindaraj, Lekha; Gupta, Tania; Esvaran, Vijaya Gowri; Awasthi, Arvind Kumar; Ponnuvel, Kangayam M
2016-04-01
Sugar transporters play an essential role in controlling carbohydrate transport and are responsible for mediating the movement of sugars into cells. These genes exist as large multigene families within the insect genome. In insects, sugar transporters not only have a role in sugar transport, but may also act as receptors for virus entry. Genome-wide annotation of silkworm Bombyx mori (B. mori) revealed 100 putative sugar transporter (BmST) genes exists as a large multigene family and were classified into 11 sub families, through phylogenetic analysis. Chromosomes 27, 26 and 20 were found to possess the highest number of BmST paralogous genes, harboring 22, 7 and 6 genes, respectively. These genes occurred in clusters exhibiting the phenomenon of tandem gene duplication. The ovary, silk gland, hemocytes, midgut and malphigian tubules were the different tissues/cells enriched with BmST gene expression. The BmST gene BGIBMGA001498 had maximum EST transcripts of 134 and expressed exclusively in the malphigian tubule. The expression of EST transcripts of the BmST clustered genes on chromosome 27 was distributed in various tissues like testis, ovary, silk gland, malphigian tubule, maxillary galea, prothoracic gland, epidermis, fat body and midgut. Three sugar transporter genes (BmST) were constitutively expressed in the susceptible race and were down regulated upon BmNPV infection at 12h post infection (hpi). The expression pattern of these three genes was validated through real-time PCR in the midgut tissues at different time intervals from 0 to 30hpi. In the susceptible B. mori race, expression of sugar transporter genes was constitutively expressed making the host succumb to viral infection. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Glen Peter
2009-12-01
Full Text Available Abstract Background In recent years, the relaxin family of signaling molecules has been shown to play diverse roles in mammalian physiology, but little is known about its diversity or physiology in teleosts, an infraclass of the bony fishes comprising ~ 50% of all extant vertebrates. In this paper, 32 relaxin family sequences were obtained by searching genomic and cDNA databases from eight teleost species; phylogenetic, molecular evolutionary, and syntenic data analyses were conducted to understand the relationship and differential patterns of evolution of relaxin family genes in teleosts compared with mammals. Additionally, real-time quantitative PCR was used to confirm and assess the tissues of expression of five relaxin family genes in Danio rerio and in situ hybridization used to assess the site-specific expression of the insulin 3-like gene in D. rerio testis. Results Up to six relaxin family genes were identified in each teleost species. Comparative syntenic mapping revealed that fish possess two paralogous copies of human RLN3, which we call rln3a and rln3b, an orthologue of human RLN2, rln, two paralogous copies of human INSL5, insl5a and insl5b, and an orthologue of human INSL3, insl3. Molecular evolutionary analyses indicated that: rln3a, rln3b and rln are under strong evolutionary constraint, that insl3 has been subject to moderate rates of sequence evolution with two amino acids in insl3/INSL3 showing evidence of positively selection, and that insl5b exhibits a higher rate of sequence evolution than its paralogue insl5a suggesting that it may have been neo-functionalized after the teleost whole genome duplication. Quantitative PCR analyses in D. rerio indicated that rln3a and rln3b are expressed in brain, insl3 is highly expressed in gonads, and that there was low expression of both insl5 genes in adult zebrafish. Finally, in situ hybridization of insl3 in D. rerio testes showed highly specific hybridization to interstitial Leydig
Biliary tract duplication cyst with gastric heterotopia
Energy Technology Data Exchange (ETDEWEB)
Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.
1988-05-01
Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst.
Biliary tract duplication cyst with gastric heterotopia
International Nuclear Information System (INIS)
Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.
1988-01-01
Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst. (orig.)
The centriole duplication cycle
Fırat-Karalar, Elif Nur; Stearns, Tim
2014-01-01
Centrosomes are the main microtubule-organizing centre of animal cells and are important for many critical cellular and developmental processes from cell polarization to cell division. At the core of the centrosome are centrioles, which recruit pericentriolar material to form the centrosome and act as basal bodies to nucleate formation of cilia and flagella. Defects in centriole structure, function and number are associated with a variety of human diseases, including cancer, brain diseases and ciliopathies. In this review, we discuss recent advances in our understanding of how new centrioles are assembled and how centriole number is controlled. We propose a general model for centriole duplication control in which cooperative binding of duplication factors defines a centriole ‘origin of duplication’ that initiates duplication, and passage through mitosis effects changes that license the centriole for a new round of duplication in the next cell cycle. We also focus on variations on the general theme in which many centrioles are created in a single cell cycle, including the specialized structures associated with these variations, the deuterosome in animal cells and the blepharoplast in lower plant cells. PMID:25047614
Current incidence of duplicate publication in otolaryngology.
Cheung, Veronique Wan Fook; Lam, Gilbert O A; Wang, Yun Fan; Chadha, Neil K
2014-03-01
Duplicate publication--deemed highly unethical--is the reproduction of substantial content in another article by the same authors. In 1999, Rosenthal et al. identified an 8.5% incidence of duplicate articles in two otolaryngology journals. We explored the current incidence in three otolaryngology journals in North America and Europe. Retrospective literature review. Index articles in 2008 in Archives of Otolaryngology-Head and Neck Surgery, Laryngoscope, and Clinical Otolaryngology were searched using MEDLINE. Potential duplicate publications in 2006 through 2010 were identified using the first, second, and last authors' names. Three authors independently investigated suspected duplicate publications--classifying them by degree of duplication. Of 358 index articles screened, 75 (20.9%) had 119 potential duplicates from 2006 to 2010. Full review of these 119 potential duplicates revealed a total of 40 articles with some form of redundancy (33.6% of the potential duplicates) involving 27 index articles (7.5% of 358 index articles); one (0.8%) "dual" publication (identical or nearly identical data and conclusions to the index article); three (2.5%) "suspected" dual publications (less than 50% new data and same conclusions); and 36 (30.3%) publications with "salami-slicing" (portion of the index article data repeated) were obtained. Further analysis compared the likelihood of duplicate publication by study source and subspecialty within otolaryngology. The incidence of duplicate publication has not significantly changed over 10 years. "Salami-slicing" was a concerning practice, with no cross-referencing in 61% of these cases. Detecting and eliminating redundant publications is a laborious task, but it is essential in upholding the journal quality and research integrity. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.
Evaluating ortholog prediction algorithms in a yeast model clade.
Directory of Open Access Journals (Sweden)
Leonidas Salichos
Full Text Available BACKGROUND: Accurate identification of orthologs is crucial for evolutionary studies and for functional annotation. Several algorithms have been developed for ortholog delineation, but so far, manually curated genome-scale biological databases of orthologous genes for algorithm evaluation have been lacking. We evaluated four popular ortholog prediction algorithms (MultiParanoid; and OrthoMCL; RBH: Reciprocal Best Hit; RSD: Reciprocal Smallest Distance; the last two extended into clustering algorithms cRBH and cRSD, respectively, so that they can predict orthologs across multiple taxa against a set of 2,723 groups of high-quality curated orthologs from 6 Saccharomycete yeasts in the Yeast Gene Order Browser. RESULTS: Examination of sensitivity [TP/(TP+FN], specificity [TN/(TN+FP], and accuracy [(TP+TN/(TP+TN+FP+FN] across a broad parameter range showed that cRBH was the most accurate and specific algorithm, whereas OrthoMCL was the most sensitive. Evaluation of the algorithms across a varying number of species showed that cRBH had the highest accuracy and lowest false discovery rate [FP/(FP+TP], followed by cRSD. Of the six species in our set, three descended from an ancestor that underwent whole genome duplication. Subsequent differential duplicate loss events in the three descendants resulted in distinct classes of gene loss patterns, including cases where the genes retained in the three descendants are paralogs, constituting 'traps' for ortholog prediction algorithms. We found that the false discovery rate of all algorithms dramatically increased in these traps. CONCLUSIONS: These results suggest that simple algorithms, like cRBH, may be better ortholog predictors than more complex ones (e.g., OrthoMCL and MultiParanoid for evolutionary and functional genomics studies where the objective is the accurate inference of single-copy orthologs (e.g., molecular phylogenetics, but that all algorithms fail to accurately predict orthologs when paralogy
Energy Technology Data Exchange (ETDEWEB)
Volkov, Oleg A.; Kinch, Lisa; Ariagno, Carson; Deng, Xiaoyi; Zhong, Shihua; Grishin, Nick; Tomchick, Diana R.; Chen, Zhe; Phillips, Margaret A.
2016-12-15
Catalytically inactive enzyme paralogs occur in many genomes. Some regulate their active counterparts but the structural principles of this regulation remain largely unknown. We report X-ray structures of
Directory of Open Access Journals (Sweden)
Volker U Schwartze
2014-08-01
Full Text Available Lichtheimia species are the second most important cause of mucormycosis in Europe. To provide broader insights into the molecular basis of the pathogenicity-associated traits of the basal Mucorales, we report the full genome sequence of L. corymbifera and compared it to the genome of Rhizopus oryzae, the most common cause of mucormycosis worldwide. The genome assembly encompasses 33.6 MB and 12,379 protein-coding genes. This study reveals four major differences of the L. corymbifera genome to R. oryzae: (i the presence of an highly elevated number of gene duplications which are unlike R. oryzae not due to whole genome duplication (WGD, (ii despite the relatively high incidence of introns, alternative splicing (AS is not frequently observed for the generation of paralogs and in response to stress, (iii the content of repetitive elements is strikingly low (<5%, (iv L. corymbifera is typically haploid. Novel virulence factors were identified which may be involved in the regulation of the adaptation to iron-limitation, e.g. LCor01340.1 encoding a putative siderophore transporter and LCor00410.1 involved in the siderophore metabolism. Genes encoding the transcription factors LCor08192.1 and LCor01236.1, which are similar to GATA type regulators and to calcineurin regulated CRZ1, respectively, indicating an involvement of the calcineurin pathway in the adaption to iron limitation. Genes encoding MADS-box transcription factors are elevated up to 11 copies compared to the 1-4 copies usually found in other fungi. More findings are: (i lower content of tRNAs, but unique codons in L. corymbifera, (ii Over 25% of the proteins are apparently specific for L. corymbifera. (iii L. corymbifera contains only 2/3 of the proteases (known to be essential virulence factors in comparison to R. oryzae. On the other hand, the number of secreted proteases, however, is roughly twice as high as in R. oryzae.
Baker, Katie; Bayer, Micha; Cook, Nicola; Dreißig, Steven; Dhillon, Taniya; Russell, Joanne; Hedley, Pete E; Morris, Jenny; Ramsay, Luke; Colas, Isabelle; Waugh, Robbie; Steffenson, Brian; Milne, Iain; Stephen, Gordon; Marshall, David; Flavell, Andrew J
2014-01-01
The low-recombining pericentromeric region of the barley genome contains roughly a quarter of the genes of the species, embedded in low-recombining DNA that is rich in repeats and repressive chromatin signatures. We have investigated the effects of pericentromeric region residency upon the expression, diversity and evolution of these genes. We observe no significant difference in average transcript level or developmental RNA specificity between the barley pericentromeric region and the rest of the genome. In contrast, all of the evolutionary parameters studied here show evidence of compromised gene evolution in this region. First, genes within the pericentromeric region of wild barley show reduced diversity and significantly weakened purifying selection compared with the rest of the genome. Second, gene duplicates (ohnolog pairs) derived from the cereal whole-genome duplication event ca. 60MYa have been completely eliminated from the barley pericentromeric region. Third, local gene duplication in the pericentromeric region is reduced by 29% relative to the rest of the genome. Thus, the pericentromeric region of barley is a permissive environment for gene expression but has restricted gene evolution in a sizeable fraction of barley's genes. PMID:24947331
Genome-wide identification and evolution of the PIN-FORMED (PIN) gene family in Glycine max.
Liu, Yuan; Wei, Haichao
2017-07-01
Soybean (Glycine max) is one of the most important crop plants. Wild and cultivated soybean varieties have significant differences worth further investigation, such as plant morphology, seed size, and seed coat development; these characters may be related to auxin biology. The PIN gene family encodes essential transport proteins in cell-to-cell auxin transport, but little research on soybean PIN genes (GmPIN genes) has been done, especially with respect to the evolution and differences between wild and cultivated soybean. In this study, we retrieved 23 GmPIN genes from the latest updated G. max genome database; six GmPIN protein sequences were changed compared with the previous database. Based on the Plant Genome Duplication Database, 18 GmPIN genes have been involved in segment duplication. Three pairs of GmPIN genes arose after the second soybean genome duplication, and six occurred after the first genome duplication. The duplicated GmPIN genes retained similar expression patterns. All the duplicated GmPIN genes experienced purifying selection (K a /K s genome sequence of 17 wild and 14 cultivated soybean varieties. Our research provides useful and comprehensive basic information for understanding GmPIN genes.
Iacovazzo, Donato; Caswell, Richard; Bunce, Benjamin; Jose, Sian; Yuan, Bo; Hernández-Ramírez, Laura C; Kapur, Sonal; Caimari, Francisca; Evanson, Jane; Ferraù, Francesco; Dang, Mary N; Gabrovska, Plamena; Larkin, Sarah J; Ansorge, Olaf; Rodd, Celia; Vance, Mary L; Ramírez-Renteria, Claudia; Mercado, Moisés; Goldstone, Anthony P; Buchfelder, Michael; Burren, Christine P; Gurlek, Alper; Dutta, Pinaki; Choong, Catherine S; Cheetham, Timothy; Trivellin, Giampaolo; Stratakis, Constantine A; Lopes, Maria-Beatriz; Grossman, Ashley B; Trouillas, Jacqueline; Lupski, James R; Ellard, Sian; Sampson, Julian R; Roncaroli, Federico; Korbonits, Márta
2016-06-01
Non-syndromic pituitary gigantism can result from AIP mutations or the recently identified Xq26.3 microduplication causing X-linked acrogigantism (XLAG). Within Xq26.3, GPR101 is believed to be the causative gene, and the c.924G > C (p.E308D) variant in this orphan G protein-coupled receptor has been suggested to play a role in the pathogenesis of acromegaly.We studied 153 patients (58 females and 95 males) with pituitary gigantism. AIP mutation-negative cases were screened for GPR101 duplication through copy number variation droplet digital PCR and high-density aCGH. The genetic, clinical and histopathological features of XLAG patients were studied in detail. 395 peripheral blood and 193 pituitary tumor DNA samples from acromegaly patients were tested for GPR101 variants.We identified 12 patients (10 females and 2 males; 7.8 %) with XLAG. In one subject, the duplicated region only contained GPR101, but not the other three genes in found to be duplicated in the previously reported patients, defining a new smallest region of overlap of duplications. While females presented with germline mutations, the two male patients harbored the mutation in a mosaic state. Nine patients had pituitary adenomas, while three had hyperplasia. The comparison of the features of XLAG, AIP-positive and GPR101&AIP-negative patients revealed significant differences in sex distribution, age at onset, height, prolactin co-secretion and histological features. The pathological features of XLAG-related adenomas were remarkably similar. These tumors had a sinusoidal and lobular architecture. Sparsely and densely granulated somatotrophs were admixed with lactotrophs; follicle-like structures and calcifications were commonly observed. Patients with sporadic of familial acromegaly did not have an increased prevalence of the c.924G > C (p.E308D) GPR101 variant compared to public databases.In conclusion, XLAG can result from germline or somatic duplication of GPR101. Duplication of GPR101
Directory of Open Access Journals (Sweden)
Thomas B Duguet
2016-07-01
Full Text Available Helminth parasites rely on fast-synaptic transmission in their neuromusculature to experience the outside world and respond to it. Acetylcholine plays a pivotal role in this and its receptors are targeted by a wide variety of both natural and synthetic compounds used in human health and for the control of parasitic disease. The model, Caenorhabditis elegans is characterized by a large number of acetylcholine receptor subunit genes, a feature shared across the nematodes. This dynamic family is characterized by both gene duplication and loss between species. The pentameric levamisole-sensitive acetylcholine receptor has been characterized from C. elegans, comprised of five different subunits. More recently, cognate receptors have been reconstituted from multiple parasitic nematodes that are found to vary in subunit composition. In order to understand the implications of receptor composition change and the origins of potentially novel drug targets, we investigated a specific example of subunit duplication based on analysis of genome data for 25 species from the 50 helminth genome initiative. We found multiple independent duplications of the unc-29, acetylcholine receptor subunit, where codon substitution rate analysis identified positive, directional selection acting on amino acid positions associated with subunit assembly. Characterization of four gene copies from a model parasitic nematode, Haemonchus contortus, demonstrated that each copy has acquired unique functional characteristics based on phenotype rescue of transgenic C. elegans and electrophysiology of receptors reconstituted in Xenopus oocytes. We found evidence that a specific incompatibility has evolved for two subunits co-expressed in muscle. We demonstrated that functional divergence of acetylcholine receptors, driven by directional selection, can occur more rapidly than previously thought and may be mediated by alteration of receptor assembly. This phenomenon is common among the
Peng, Ji-Bin
2011-01-01
TRPV5 and TRPV6 are unique members of the TRP super family. They are highly selective for Ca(2+) ions with multiple layers of Ca(2+)-dependent inactivation mechanisms, expressed at the apical membrane of Ca(2+) transporting epithelia, and robustly responsive to 1,25-dihydroxivitamin D(3). These features are well suited for their roles as Ca(2+) entry channels in the first step of transcellular Ca(2+) transport pathways, which are involved in intestinal absorption, renal reabsorption of Ca(2+), placental transfer of Ca(2+) to fetus, and many other processes. While TRPV6 is more broadly expressed in a variety of tissues such as esophagus, stomach, small intestine, colon, kidney, placenta, pancreas, prostate, uterus, salivary gland, and sweat gland, TRPV5 expression is relatively restricted to the distal convoluted tubule and connecting tubule of the kidney. There is only one TRPV6-like gene in fish and birds in comparison to both TRPV5 and TRPV6 genes in mammals, indicating TRPV5 gene was likely generated from duplication of TRPV6 gene during the evolution of mammals to meet the needs of complex renal function. TRPV5 and TRPV6 are subjected to vigorous regulations under physiological, pathological, and therapeutic conditions. The elevated TRPV6 level in malignant tumors such as prostate and breast cancers makes it a potential therapeutic target. TRPV6, and to a lesser extent TRPV5, exhibit unusually high levels of single nucleotide polymorphisms (SNPs) in African populations as compared to other populations, indicating TRPV6 gene was under selective pressure during or after humans migrated out of Africa. The SNPs of TRPV6 and TRPV5 likely contribute to the Ca(2+) conservation mechanisms in African populations.
Grossoehme, Nicholas; Kehl-Fie, Thomas E.; Ma, Zhen; Adams, Keith W.; Cowart, Darin M.; Scott, Robert A.; Skaar, Eric P.; Giedroc, David P.
2011-01-01
All strains of Staphylococcus aureus encode a putative copper-sensitive operon repressor (CsoR) and one other CsoR-like protein of unknown function. We show here that NWMN_1991 encodes a bona fide Cu(I)-inducible CsoR of a genetically unlinked copA-copZ copper resistance operon in S. aureus strain Newman. In contrast, an unannotated open reading frame found between NWMN_0027 and NWMN_0026 (denoted NWMN_0026.5) encodes a CsoR-like regulator that represses expression of adjacent genes by binding specifically to a pair of canonical operator sites positioned in the NWMN_0027–0026.5 intergenic region. Inspection of these regulated genes suggests a role in assimilation of inorganic sulfur from thiosulfate and vectorial sulfur transfer, and we designate NWMN_0026.5 as CstR (CsoR-like sulfur transferase repressor). Expression analysis demonstrates that CsoR and CstR control their respective regulons in response to distinct stimuli with no overlap in vivo. Unlike CsoR, CstR does not form a stable complex with Cu(I); operator binding is instead inhibited by oxidation of the intersubunit cysteine pair to a mixture of disulfide and trisulfide linkages by a likely metabolite of thiosulfate assimilation, sulfite. CsoR is unreactive toward sulfite under the same conditions. We conclude that CsoR and CstR are paralogs in S. aureus that function in the same cytoplasm to control distinct physiological processes. PMID:21339296
Grossoehme, Nicholas; Kehl-Fie, Thomas E; Ma, Zhen; Adams, Keith W; Cowart, Darin M; Scott, Robert A; Skaar, Eric P; Giedroc, David P
2011-04-15
All strains of Staphylococcus aureus encode a putative copper-sensitive operon repressor (CsoR) and one other CsoR-like protein of unknown function. We show here that NWMN_1991 encodes a bona fide Cu(I)-inducible CsoR of a genetically unlinked copA-copZ copper resistance operon in S. aureus strain Newman. In contrast, an unannotated open reading frame found between NWMN_0027 and NWMN_0026 (denoted NWMN_0026.5) encodes a CsoR-like regulator that represses expression of adjacent genes by binding specifically to a pair of canonical operator sites positioned in the NWMN_0027-0026.5 intergenic region. Inspection of these regulated genes suggests a role in assimilation of inorganic sulfur from thiosulfate and vectorial sulfur transfer, and we designate NWMN_0026.5 as CstR (CsoR-like sulfur transferase repressor). Expression analysis demonstrates that CsoR and CstR control their respective regulons in response to distinct stimuli with no overlap in vivo. Unlike CsoR, CstR does not form a stable complex with Cu(I); operator binding is instead inhibited by oxidation of the intersubunit cysteine pair to a mixture of disulfide and trisulfide linkages by a likely metabolite of thiosulfate assimilation, sulfite. CsoR is unreactive toward sulfite under the same conditions. We conclude that CsoR and CstR are paralogs in S. aureus that function in the same cytoplasm to control distinct physiological processes.
The biocontrol agent, Trichoderma virens, has the ability to protect plants from pathogens by eliciting plant defense responses, involvement in mycoparasitism, or secreting antagonistic secondary metabolites. SM1, an elicitor of induced systemic resistance (ISR), was found to have three paralogs wi...
Hominoid chromosomal rearrangements on 17q map to complex regions of segmental duplication.
Cardone, Maria Francesca; Jiang, Zhaoshi; D'Addabbo, Pietro; Archidiacono, Nicoletta; Rocchi, Mariano; Eichler, Evan E; Ventura, Mario
2008-01-01
Chromosomal rearrangements, such as translocations and inversions, are recurrent phenomena during evolution, and both of them are involved in reproductive isolation and speciation. To better understand the molecular basis of chromosome rearrangements and their part in karyotype evolution, we have investigated the history of human chromosome 17 by comparative fluorescence in situ hybridization (FISH) and sequence analysis. Human bacterial artificial chromosome/p1 artificial chromosome probes spanning the length of chromosome 17 were used in FISH experiments on great apes, Old World monkeys and New World monkeys to study the evolutionary history of this chromosome. We observed that the macaque marker order represents the ancestral organization. Human, chimpanzee and gorilla homologous chromosomes differ by a paracentric inversion that occurred specifically in the Homo sapiens/Pan troglodytes/Gorilla gorilla ancestor. Detailed analyses of the paracentric inversion revealed that the breakpoints mapped to two regions syntenic to human 17q12/21 and 17q23, both rich in segmental duplications. Sequence analyses of the human and macaque organization suggest that the duplication events occurred in the catarrhine ancestor with the duplication blocks continuing to duplicate or undergo gene conversion during evolution of the hominoid lineage. We propose that the presence of these duplicons has mediated the inversion in the H. sapiens/P. troglodytes/G. gorilla ancestor. Recently, the same duplication blocks have been shown to be polymorphic in the human population and to be involved in triggering microdeletion and duplication in human. These results further support a model where genomic architecture has a direct role in both rearrangement involved in karyotype evolution and genomic instability in human.
Hensels, G. W.; Janssen, E. A.; Hoogendijk, J. E.; Valentijn, L. J.; Baas, F.; Bolhuis, P. A.
1993-01-01
Charcot-Marie-Tooth disease type 1 (CMT1) is a hereditary motor and sensory neuropathy. The autosomal dominant subtype is often linked with a large duplication on chromosome 17p11.2. The gene encoding the peripheral myelin protein PMP 22 (the critical gene in this subtype of CMT1) is located within
Colonic duplication in an adult
International Nuclear Information System (INIS)
Baro, P.; Dario Casas, J.; Sanchez, D.
1988-01-01
A case of colonic duplication that was diagnosed radiologically in an adult is reported. A long duplicated segment below the normal transverse colon, with a wide anastomosis at the hepatic flexure level, was observed on barium enema. The rarity of this anomaly unassociated with other malformations is emphasized. (orig.)
Clinical Fact of Rectal Duplication with gastric heterotopy | Atmani ...
African Journals Online (AJOL)
Enteric duplication could occur through the entire alimentary tract. A case of rectal duplication cyst with heterotopic gastric mucosa in a chid is described. MRI scan is shown useful in the diagnosis of the duplication. The treatment is the complete local resection of the rectal duplication. Keywords: duplication, rectal, MRI, ...
International Nuclear Information System (INIS)
Holowiecki, Andrew; O'Shields, Britton; Jenny, Matthew J.
2016-01-01
While heme is an important cofactor for numerous proteins, it is highly toxic in its unbound form and can perpetuate the formation of reactive oxygen species. Heme oxygenase enzymes (HMOX1 and HMOX2) degrade heme into biliverdin and carbon monoxide, with biliverdin subsequently being converted to bilirubin by biliverdin reductase (BVRa or BVRb). As a result of the teleost-specific genome duplication event, zebrafish have paralogs of hmox1 (hmox1a and hmox1b) and hmox2 (hmox2a and hmox2b). Expression of all four hmox paralogs and two bvr isoforms were measured in adult tissues (gill, brain and liver) and sexually dimorphic differences were observed, most notably in the basal expression of hmox1a, hmox2a, hmox2b and bvrb in liver samples. hmox1a, hmox2a and hmox2b were significantly induced in male liver tissues in response to 96 h cadmium exposure (20 μM). hmox2a and hmox2b were significantly induced in male brain samples, but only hmox2a was significantly reduced in male gill samples in response to the 96 h cadmium exposure. hmox paralogs displayed significantly different levels of basal expression in most adult tissues, as well as during zebrafish development (24 to 120 hpf). Furthermore, hmox1a, hmox1b and bvrb were significantly induced in zebrafish eleutheroembryos in response to multiple pro-oxidants (cadmium, hemin and tert-butylhydroquinone). Knockdown of Nrf2a, a transcriptional regulator of hmox1a, was demonstrated to inhibit the Cd-mediated induction of hmox1b and bvrb. These results demonstrate distinct mechanisms of hmox and bvr transcriptional regulation in zebrafish, providing initial evidence of the partitioning of function of the hmox paralogs. - Highlights: • hmox1a, hmox2a, hmox2b and bvrb are sexually dimorphic in expression. • hmox paralogs were induced in adult tissues by cadmium exposure. • hmox1a, hmox1b and bvrb were induced by multiple pro-oxidants zebrafish embryos. • Differential expression of zebrafish hmox paralogs suggest
Energy Technology Data Exchange (ETDEWEB)
Holowiecki, Andrew [Department of Biological Sciences, University of Alabama, Tuscaloosa, AL 35487 (United States); Molecular Cardiovascular Biology Division and Heart Institute, Cincinnati Children' s Research Foundation, Cincinnati, OH (United States); O' Shields, Britton [Department of Biological Sciences, University of Alabama, Tuscaloosa, AL 35487 (United States); Jenny, Matthew J., E-mail: mjjenny@ua.edu [Department of Biological Sciences, University of Alabama, Tuscaloosa, AL 35487 (United States)
2016-11-15
While heme is an important cofactor for numerous proteins, it is highly toxic in its unbound form and can perpetuate the formation of reactive oxygen species. Heme oxygenase enzymes (HMOX1 and HMOX2) degrade heme into biliverdin and carbon monoxide, with biliverdin subsequently being converted to bilirubin by biliverdin reductase (BVRa or BVRb). As a result of the teleost-specific genome duplication event, zebrafish have paralogs of hmox1 (hmox1a and hmox1b) and hmox2 (hmox2a and hmox2b). Expression of all four hmox paralogs and two bvr isoforms were measured in adult tissues (gill, brain and liver) and sexually dimorphic differences were observed, most notably in the basal expression of hmox1a, hmox2a, hmox2b and bvrb in liver samples. hmox1a, hmox2a and hmox2b were significantly induced in male liver tissues in response to 96 h cadmium exposure (20 μM). hmox2a and hmox2b were significantly induced in male brain samples, but only hmox2a was significantly reduced in male gill samples in response to the 96 h cadmium exposure. hmox paralogs displayed significantly different levels of basal expression in most adult tissues, as well as during zebrafish development (24 to 120 hpf). Furthermore, hmox1a, hmox1b and bvrb were significantly induced in zebrafish eleutheroembryos in response to multiple pro-oxidants (cadmium, hemin and tert-butylhydroquinone). Knockdown of Nrf2a, a transcriptional regulator of hmox1a, was demonstrated to inhibit the Cd-mediated induction of hmox1b and bvrb. These results demonstrate distinct mechanisms of hmox and bvr transcriptional regulation in zebrafish, providing initial evidence of the partitioning of function of the hmox paralogs. - Highlights: • hmox1a, hmox2a, hmox2b and bvrb are sexually dimorphic in expression. • hmox paralogs were induced in adult tissues by cadmium exposure. • hmox1a, hmox1b and bvrb were induced by multiple pro-oxidants zebrafish embryos. • Differential expression of zebrafish hmox paralogs suggest
Noncommunicating Isolated Enteric Duplication Cyst in the ...
African Journals Online (AJOL)
Noncommunicating isolated enteric duplications in the abdomen are an extremely rare variant of enteric duplications with their own blood supply. We report a case of a noncommunicating isolated ileal duplication in a 10-month-old boy. He was admitted because of severe abdominal distension and developed irritability ...
DEFF Research Database (Denmark)
Erdogan, F; Belloso, J M; Gabau, E
2008-01-01
deletions or duplications elsewhere in the genome. The main clinical features of the patient are microcephaly and congenital heart disease, which are likely to be caused by dosage effect of one or several genes in the duplicated region. Similar phenotypes have been found in other patients with 10q11-q22...
Kang, Sung-Hwan; Atallah, Osama O; Sun, Yong-Duo; Folimonova, Svetlana Y
2018-01-15
Viruses from the family Closteroviridae show an example of intra-genome duplications of more than one gene. In addition to the hallmark coat protein gene duplication, several members possess a tandem duplication of papain-like leader proteases. In this study, we demonstrate that domains encoding the L1 and L2 proteases in the Citrus tristeza virus genome underwent a significant functional divergence at the RNA and protein levels. We show that the L1 protease is crucial for viral accumulation and establishment of initial infection, whereas its coding region is vital for virus transport. On the other hand, the second protease is indispensable for virus infection of its natural citrus host, suggesting that L2 has evolved an important adaptive function that mediates virus interaction with the woody host. Copyright © 2017 Elsevier Inc. All rights reserved.
Laparoscopic excision of a newborn rectal duplication cyst.
Hartin, Charles W; Lau, Stanley T; Escobar, Mauricio A; Glick, Philip L
2008-08-01
Congenital rectal duplication cyst is a rare entity treated with surgical excision. Without treatment, a rectal duplication cyst may cause a variety of complications, most notably, transforming into a malignancy. We report on a 7-week-old girl who was found to have a rectal duplication cyst. The rectal duplication cyst was successfully excised laparoscopically. Rectal duplication cysts are rare alimentary tract anomalies generally discovered during childhood. Complications include symptoms arising from the cyst and the possibility of malignant degeneration. They are typically managed by surgical excision.
Our experience with unusual gastrointestinal tract duplications in infants
Directory of Open Access Journals (Sweden)
Bilal Mirza
2014-01-01
Full Text Available Background: Classical duplications may present along any part of gastrointestinal tract (GIT from mouth to anus. Atypical or unusual rare varieties of GIT duplications may also occur, but with different anatomical features. Materials and Methods: We reviewed our 5-year record (February 2008-January 2013 to describe clinical profile of unusual GIT duplications in neonates and small infants. Results: Three patients with atypical variety of GIT duplications were managed in our department during this tenure. Two were females and one male. Age was ranged between 11 days and 2 months. All patients presented with massive abdominal distension causing respiratory embarrassment in two of them. In all patients, the pre-operative differential diagnoses also included GIT duplication cysts. Computerized tomography (CT scan showed single huge cyst in one and multiple cysts in two patients. In one patient the CT scan also depicted a thoracic cyst in relation to posterior mediastinum. At operation, one patient had colonic tubular duplication cyst along with another isolated duplication cyst, the second case had a tubular duplication cyst of ileum with its segmental dilatation, and in the third case two isolated duplications were found. Duplication cysts were excised along with mucosal stripping in one patient, cyst excision and intestinal resection and anastomosis in one patient, and only cysts excision in one. All patients did well post-operatively. Conclusion: We presented unusual GIT duplications. These duplications are managed on similar lines as classical duplications with good prognosis when dealt early.
Directory of Open Access Journals (Sweden)
M Febin Farook
Full Text Available Childhood neurodevelopmental disorders like Angelman syndrome and autism may be the result of underlying defects in neuronal plasticity and ongoing problems with synaptic signaling. Some of these defects may be due to abnormal monoamine levels in different regions of the brain. Ube3a, a gene that causes Angelman syndrome (AS when maternally deleted and is associated with autism when maternally duplicated has recently been shown to regulate monoamine synthesis in the Drosophila brain. Therefore, we examined monoamine levels in striatum, ventral midbrain, frontal cerebral cortex, cerebellar cortex and hippocampus in Ube3a deficient and Ube3a duplication animals. We found that serotonin (5HT, a monoamine affected in autism, was elevated in the striatum and cortex of AS mice. Dopamine levels were almost uniformly elevated compared to control littermates in the striatum, midbrain and frontal cortex regardless of genotype in Ube3a deficient and Ube3a duplication animals. In the duplication 15q autism mouse model, paternal but not maternal duplication animals showed a decrease in 5HT levels when compared to their wild type littermates, in accordance with previously published data. However, maternal duplication animals show no significant changes in 5HT levels throughout the brain. These abnormal monoamine levels could be responsible for many of the behavioral abnormalities observed in both AS and autism, but further investigation is required to determine if any of these changes are purely dependent on Ube3a levels in the brain.
Virts, Elizabeth L; Jankowska, Anna; Mackay, Craig; Glaas, Marcel F; Wiek, Constanze; Kelich, Stephanie L; Lottmann, Nadine; Kennedy, Felicia M; Marchal, Christophe; Lehnert, Erik; Scharf, Rüdiger E; Dufour, Carlo; Lanciotti, Marina; Farruggia, Piero; Santoro, Alessandra; Savasan, Süreyya; Scheckenbach, Kathrin; Schipper, Jörg; Wagenmann, Martin; Lewis, Todd; Leffak, Michael; Farlow, Janice L; Foroud, Tatiana M; Honisch, Ellen; Niederacher, Dieter; Chakraborty, Sujata C; Vance, Gail H; Pruss, Dmitry; Timms, Kirsten M; Lanchbury, Jerry S; Alpi, Arno F; Hanenberg, Helmut
2015-09-15
Fanconi anemia (FA) is a rare inherited disorder clinically characterized by congenital malformations, progressive bone marrow failure and cancer susceptibility. At the cellular level, FA is associated with hypersensitivity to DNA-crosslinking genotoxins. Eight of 17 known FA genes assemble the FA E3 ligase complex, which catalyzes monoubiquitination of FANCD2 and is essential for replicative DNA crosslink repair. Here, we identify the first FA patient with biallelic germline mutations in the ubiquitin E2 conjugase UBE2T. Both mutations were aluY-mediated: a paternal deletion and maternal duplication of exons 2-6. These loss-of-function mutations in UBE2T induced a cellular phenotype similar to biallelic defects in early FA genes with the absence of FANCD2 monoubiquitination. The maternal duplication produced a mutant mRNA that could encode a functional protein but was degraded by nonsense-mediated mRNA decay. In the patient's hematopoietic stem cells, the maternal allele with the duplication of exons 2-6 spontaneously reverted to a wild-type allele by monoallelic recombination at the duplicated aluY repeat, thereby preventing bone marrow failure. Analysis of germline DNA of 814 normal individuals and 850 breast cancer patients for deletion or duplication of UBE2T exons 2-6 identified the deletion in only two controls, suggesting aluY-mediated recombinations within the UBE2T locus are rare and not associated with an increased breast cancer risk. Finally, a loss-of-function germline mutation in UBE2T was detected in a high-risk breast cancer patient with wild-type BRCA1/2. Cumulatively, we identified UBE2T as a bona fide FA gene (FANCT) that also may be a rare cancer susceptibility gene. © The Author 2015. Published by Oxford University Press.
Directory of Open Access Journals (Sweden)
Preeti Arya
Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K
2014-01-01
Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.
Gene Dosage Analysis in a Clinical Environment: Gene-Targeted Microarrays as the Platform-of-Choice
Directory of Open Access Journals (Sweden)
Donald R. Love
2013-03-01
Full Text Available The role of gene deletion and duplication in the aetiology of disease has become increasingly evident over the last decade. In addition to the classical deletion/duplication disorders diagnosed using molecular techniques, such as Duchenne Muscular Dystrophy and Charcot-Marie-Tooth Neuropathy Type 1A, the significance of partial or whole gene deletions in the pathogenesis of a large number single-gene disorders is becoming more apparent. A variety of dosage analysis methods are available to the diagnostic laboratory but the widespread application of many of these techniques is limited by the expense of the kits/reagents and restrictive targeting to a particular gene or portion of a gene. These limitations are particularly important in the context of a small diagnostic laboratory with modest sample throughput. We have developed a gene-targeted, custom-designed comparative genomic hybridisation (CGH array that allows twelve clinical samples to be interrogated simultaneously for exonic deletions/duplications within any gene (or panel of genes on the array. We report here on the use of the array in the analysis of a series of clinical samples processed by our laboratory over a twelve-month period. The array has proven itself to be robust, flexible and highly suited to the diagnostic environment.
Ai, Chenbing; Liang, Yuting; Miao, Bo; Chen, Miao; Zeng, Weimin; Qiu, Guanzhou
2018-07-01
Iron-oxidizing Acidithiobacillus spp. are applied worldwide in biomining industry to extract metals from sulfide minerals. They derive energy for survival through Fe 2+ oxidation and generate Fe 3+ for the dissolution of sulfide minerals. However, molecular mechanisms of their iron oxidation still remain elusive. A novel two-cytochrome-encoding gene cluster (named tce gene cluster) encoding a high-molecular-weight cytochrome c (AFE_1428) and a c 4 -type cytochrome c 552 (AFE_1429) in A. ferrooxidans ATCC 23270 was first identified in this study. Bioinformatic analysis together with transcriptional study showed that AFE_1428 and AFE_1429 were the corresponding paralog of Cyc2 (AFE_3153) and Cyc1 (AFE_3152) which were encoded by the extensively studied rus operon and had been proven involving in ferrous iron oxidation. Both AFE_1428 and AFE_1429 contained signal peptide and the classic heme-binding motif(s) as their corresponding paralog. The modeled structure of AFE_1429 showed high resemblance to Cyc1. AFE_1428 and AFE_1429 were preferentially transcribed as their corresponding paralogs in the presence of ferrous iron as sole energy source as compared with sulfur. The tce gene cluster is highly conserved in the genomes of four phylogenetic-related A. ferrooxidans strains that were originally isolated from different sites separated with huge geographical distance, which further implies the importance of this gene cluster. Collectively, AFE_1428 and AFE_1429 involve in Fe 2+ oxidation like their corresponding paralog by integrating with the metalloproteins encoded by rus operon. This study provides novel insights into the Fe 2+ oxidation mechanism in Fe 2+ -oxidizing A. ferrooxidans ssp.
Sharp, Andrew J; Hansen, Sierra; Selzer, Rebecca R; Cheng, Ze; Regan, Regina; Hurst, Jane A; Stewart, Helen; Price, Sue M; Blair, Edward; Hennekam, Raoul C; Fitzpatrick, Carrie A; Segraves, Rick; Richmond, Todd A; Guiver, Cheryl; Albertson, Donna G; Pinkel, Daniel; Eis, Peggy S; Schwartz, Stuart; Knight, Samantha J L; Eichler, Evan E
2006-09-01
Genomic disorders are characterized by the presence of flanking segmental duplications that predispose these regions to recurrent rearrangement. Based on the duplication architecture of the genome, we investigated 130 regions that we hypothesized as candidates for previously undescribed genomic disorders. We tested 290 individuals with mental retardation by BAC array comparative genomic hybridization and identified 16 pathogenic rearrangements, including de novo microdeletions of 17q21.31 found in four individuals. Using oligonucleotide arrays, we refined the breakpoints of this microdeletion, defining a 478-kb critical region containing six genes that were deleted in all four individuals. We mapped the breakpoints of this deletion and of four other pathogenic rearrangements in 1q21.1, 15q13, 15q24 and 17q12 to flanking segmental duplications, suggesting that these are also sites of recurrent rearrangement. In common with the 17q21.31 deletion, these breakpoint regions are sites of copy number polymorphism in controls, indicating that these may be inherently unstable genomic regions.