WorldWideScience

Sample records for duplicated paralogous genes

  1. Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Mara Sangiovanni

    2013-12-01

    Full Text Available Arabidopsis thaliana became the model organism for plant studies because of its small diploid genome, rapid lifecycle and short adult size. Its genome was the first among plants to be sequenced, becoming the reference in plant genomics. However, the Arabidopsis genome is characterized by an inherently complex organization, since it has undergone ancient whole genome duplications, followed by gene reduction, diploidization events and extended rearrangements, which relocated and split up the retained portions. These events, together with probable chromosome reductions, dramatically increased the genome complexity, limiting its role as a reference. The identification of paralogs and single copy genes within a highly duplicated genome is a prerequisite to understand its organization and evolution and to improve its exploitation in comparative genomics. This is still controversial, even in the widely studied Arabidopsis genome. This is also due to the lack of a reference bioinformatics pipeline that could exhaustively identify paralogs and singleton genes. We describe here a complete computational strategy to detect both duplicated and single copy genes in a genome, discussing all the methodological issues that may strongly affect the results, their quality and their reliability. This approach was used to analyze the organization of Arabidopsis nuclear protein coding genes, and besides classifying computationally defined paralogs into networks and single copy genes into different classes, it unraveled further intriguing aspects concerning the genome annotation and the gene relationships in this reference plant species. Since our results may be useful for comparative genomics and genome functional analyses, we organized a dedicated web interface to make them accessible to the scientific community.

  2. Purifying selection acts on coding and non-coding sequences of paralogous genes in Arabidopsis thaliana.

    Science.gov (United States)

    Hoffmann, Robert D; Palmgren, Michael

    2016-06-13

    Whole-genome duplications in the ancestors of many diverse species provided the genetic material for evolutionary novelty. Several models explain the retention of paralogous genes. However, how these models are reflected in the evolution of coding and non-coding sequences of paralogous genes is unknown. Here, we analyzed the coding and non-coding sequences of paralogous genes in Arabidopsis thaliana and compared these sequences with those of orthologous genes in Arabidopsis lyrata. Paralogs with lower expression than their duplicate had more nonsynonymous substitutions, were more likely to fractionate, and exhibited less similar expression patterns with their orthologs in the other species. Also, lower-expressed genes had greater tissue specificity. Orthologous conserved non-coding sequences in the promoters, introns, and 3' untranslated regions were less abundant at lower-expressed genes compared to their higher-expressed paralogs. A gene ontology (GO) term enrichment analysis showed that paralogs with similar expression levels were enriched in GO terms related to ribosomes, whereas paralogs with different expression levels were enriched in terms associated with stress responses. Loss of conserved non-coding sequences in one gene of a paralogous gene pair correlates with reduced expression levels that are more tissue specific. Together with increased mutation rates in the coding sequences, this suggests that similar forces of purifying selection act on coding and non-coding sequences. We propose that coding and non-coding sequences evolve concurrently following gene duplication.

  3. Paralogous Genes as a Tool to Study the Regulation of Gene Expression

    DEFF Research Database (Denmark)

    Hoffmann, Robert D

    The genomes of plants are marked by reoccurring events of whole-genome duplication. These events are major contributors to speciation and provide the genetic material for organisms to evolve ever greater complexity. Duplicated genes, referred to as paralogs, may be retained because they acquired...... regions. These results suggest that a concurrent purifying selection acts on coding and non-coding sequences of paralogous genes in A. thaliana. Mutational analyses of the promoters from a paralogous gene pair were performed in transgenic A. thaliana plants. The results revealed a 170-bp long DNA sequence...... that forms a bifunctional cis-regulatory module; it represses gene expression in the sporophyte while activating it in pollen. This finding is important for many aspects of gene regulation and the transcriptional changes underlying gametophyte development. In conclusion, the presented thesis suggests that...

  4. Gene conversion homogenizes the CMT1A paralogous repeats

    Directory of Open Access Journals (Sweden)

    Hurles Matthew E

    2001-12-01

    Full Text Available Abstract Background Non-allelic homologous recombination between paralogous repeats is increasingly being recognized as a major mechanism causing both pathogenic microdeletions and duplications, and structural polymorphism in the human genome. It has recently been shown empirically that gene conversion can homogenize such repeats, resulting in longer stretches of absolute identity that may increase the rate of non-allelic homologous recombination. Results Here, a statistical test to detect gene conversion between pairs of non-coding sequences is presented. It is shown that the 24 kb Charcot-Marie-Tooth type 1A paralogous repeats (CMT1A-REPs exhibit the imprint of gene conversion processes whilst control orthologous sequences do not. In addition, Monte Carlo simulations of the evolutionary divergence of the CMT1A-REPs, incorporating two alternative models for gene conversion, generate repeats that are statistically indistinguishable from the observed repeats. Bounds are placed on the rate of these conversion processes, with central values of 1.3 × 10-4 and 5.1 × 10-5 per generation for the alternative models. Conclusions This evidence presented here suggests that gene conversion may have played an important role in the evolution of the CMT1A-REP paralogous repeats. The rates of these processes are such that it is probable that homogenized CMT1A-REPs are polymorphic within modern populations. Gene conversion processes are similarly likely to play an important role in the evolution of other segmental duplications and may influence the rate of non-allelic homologous recombination between them.

  5. Gene duplications in prokaryotes can be associated with environmental adaptation.

    Science.gov (United States)

    Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn

    2010-10-20

    Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate

  6. Gene duplications in prokaryotes can be associated with environmental adaptation

    Directory of Open Access Journals (Sweden)

    Lempicki Richard A

    2010-10-01

    Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive

  7. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  8. Reconstructing the Evolutionary History of Paralogous APETALA1/FRUITFULL-Like Genes in Grasses (Poaceae)

    Science.gov (United States)

    Preston, Jill C.; Kellogg, Elizabeth A.

    2006-01-01

    Gene duplication is an important mechanism for the generation of evolutionary novelty. Paralogous genes that are not silenced may evolve new functions (neofunctionalization) that will alter the developmental outcome of preexisting genetic pathways, partition ancestral functions (subfunctionalization) into divergent developmental modules, or function redundantly. Functional divergence can occur by changes in the spatio-temporal patterns of gene expression and/or by changes in the activities of their protein products. We reconstructed the evolutionary history of two paralogous monocot MADS-box transcription factors, FUL1 and FUL2, and determined the evolution of sequence and gene expression in grass AP1/FUL-like genes. Monocot AP1/FUL-like genes duplicated at the base of Poaceae and codon substitutions occurred under relaxed selection mostly along the branch leading to FUL2. Following the duplication, FUL1 was apparently lost from early diverging taxa, a pattern consistent with major changes in grass floral morphology. Overlapping gene expression patterns in leaves and spikelets indicate that FUL1 and FUL2 probably share some redundant functions, but that FUL2 may have become temporally restricted under partial subfunctionalization to particular stages of floret development. These data have allowed us to reconstruct the history of AP1/FUL-like genes in Poaceae and to hypothesize a role for this gene duplication in the evolution of the grass spikelet. PMID:16816429

  9. The odds of duplicate gene persistence after polyploidization

    Directory of Open Access Journals (Sweden)

    Chain Frédéric JJ

    2011-12-01

    Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.

  10. Molecular cytogenetic differentiation of paralogs of Hox paralogs in duplicated and re-diploidized genome of the North American paddlefish (Polyodon spathula)

    Czech Academy of Sciences Publication Activity Database

    Symonová, Radka; Havelka, M.; Amemiya, C. T.; Howell, M. W.; Kořínková, Tereza; Flajšhans, M.; Gela, D.; Ráb, Petr

    2017-01-01

    Roč. 18, č. 1 (2017), č. článku 19. ISSN 1471-2156 R&D Projects: GA ČR GA14-02940S; GA MŠk EF15_003/0000460 Institutional support: RVO:67985904 Keywords : hoxA/D paralogs mapping * sturgeon whole genome duplication * ancient fish genome * rediploidization Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 2.266, year: 2016

  11. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  12. The natural history of class I primate alcohol dehydrogenases includes gene duplication, gene loss, and gene conversion.

    Directory of Open Access Journals (Sweden)

    Matthew A Carrigan

    Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates

  13. Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization

    Directory of Open Access Journals (Sweden)

    Xi-Yin Wang

    2011-01-01

    Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.

  14. FUNCTIONAL SPECIALIZATION OF DUPLICATED FLAVONOID BIOSYNTHESIS GENES IN WHEAT

    Directory of Open Access Journals (Sweden)

    Khlestkina E.

    2012-08-01

    Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.

  15. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  16. Aldehyde Dehydrogenase Gene Superfamily in Populus: Organization and Expression Divergence between Paralogous Gene Pairs.

    Directory of Open Access Journals (Sweden)

    Feng-Xia Tian

    Full Text Available Aldehyde dehydrogenases (ALDHs constitute a superfamily of NAD(P+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.

  17. Aldehyde Dehydrogenase Gene Superfamily in Populus: Organization and Expression Divergence between Paralogous Gene Pairs.

    Science.gov (United States)

    Tian, Feng-Xia; Zang, Jian-Lei; Wang, Tan; Xie, Yu-Li; Zhang, Jin; Hu, Jian-Jun

    2015-01-01

    Aldehyde dehydrogenases (ALDHs) constitute a superfamily of NAD(P)+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.

  18. Domain duplication, divergence, and loss events in vertebrate Msx paralogs reveal phylogenomically informed disease markers.

    Science.gov (United States)

    Finnerty, John R; Mazza, Maureen E; Jezewski, Peter A

    2009-01-20

    Msx originated early in animal evolution and is implicated in human genetic disorders. To reconstruct the functional evolution of Msx and inform the study of human mutations, we analyzed the phylogeny and synteny of 46 metazoan Msx proteins and tracked the duplication, diversification and loss of conserved motifs. Vertebrate Msx sequences sort into distinct Msx1, Msx2 and Msx3 clades. The sister-group relationship between MSX1 and MSX2 reflects their derivation from the 4p/5q chromosomal paralogon, a derivative of the original "MetaHox" cluster. We demonstrate physical linkage between Msx and other MetaHox genes (Hmx, NK1, Emx) in a cnidarian. Seven conserved domains, including two Groucho repression domains (N- and C-terminal), were present in the ancestral Msx. In cnidarians, the Groucho domains are highly similar. In vertebrate Msx1, the N-terminal Groucho domain is conserved, while the C-terminal domain diverged substantially, implying a novel function. In vertebrate Msx2 and Msx3, the C-terminal domain was lost. MSX1 mutations associated with ectodermal dysplasia or orofacial clefting disorders map to conserved domains in a non-random fashion. Msx originated from a MetaHox ancestor that also gave rise to Tlx, Demox, NK, and possibly EHGbox, Hox and ParaHox genes. Duplication, divergence or loss of domains played a central role in the functional evolution of Msx. Duplicated domains allow pleiotropically expressed proteins to evolve new functions without disrupting existing interaction networks. Human missense sequence variants reside within evolutionarily conserved domains, likely disrupting protein function. This phylogenomic evaluation of candidate disease markers will inform clinical and functional studies.

  19. Domain duplication, divergence, and loss events in vertebrate Msx paralogs reveal phylogenomically informed disease markers

    Directory of Open Access Journals (Sweden)

    Finnerty John R

    2009-01-01

    Full Text Available Abstract Background Msx originated early in animal evolution and is implicated in human genetic disorders. To reconstruct the functional evolution of Msx and inform the study of human mutations, we analyzed the phylogeny and synteny of 46 metazoan Msx proteins and tracked the duplication, diversification and loss of conserved motifs. Results Vertebrate Msx sequences sort into distinct Msx1, Msx2 and Msx3 clades. The sister-group relationship between MSX1 and MSX2 reflects their derivation from the 4p/5q chromosomal paralogon, a derivative of the original "MetaHox" cluster. We demonstrate physical linkage between Msx and other MetaHox genes (Hmx, NK1, Emx in a cnidarian. Seven conserved domains, including two Groucho repression domains (N- and C-terminal, were present in the ancestral Msx. In cnidarians, the Groucho domains are highly similar. In vertebrate Msx1, the N-terminal Groucho domain is conserved, while the C-terminal domain diverged substantially, implying a novel function. In vertebrate Msx2 and Msx3, the C-terminal domain was lost. MSX1 mutations associated with ectodermal dysplasia or orofacial clefting disorders map to conserved domains in a non-random fashion. Conclusion Msx originated from a MetaHox ancestor that also gave rise to Tlx, Demox, NK, and possibly EHGbox, Hox and ParaHox genes. Duplication, divergence or loss of domains played a central role in the functional evolution of Msx. Duplicated domains allow pleiotropically expressed proteins to evolve new functions without disrupting existing interaction networks. Human missense sequence variants reside within evolutionarily conserved domains, likely disrupting protein function. This phylogenomic evaluation of candidate disease markers will inform clinical and functional studies.

  20. Characterization of paralogous protein families in rice

    Directory of Open Access Journals (Sweden)

    Zhu Wei

    2008-02-01

    Full Text Available Abstract Background High gene numbers in plant genomes reflect polyploidy and major gene duplication events. Oryza sativa, cultivated rice, is a diploid monocotyledonous species with a ~390 Mb genome that has undergone segmental duplication of a substantial portion of its genome. This, coupled with other genetic events such as tandem duplications, has resulted in a substantial number of its genes, and resulting proteins, occurring in paralogous families. Results Using a computational pipeline that utilizes Pfam and novel protein domains, we characterized paralogous families in rice and compared these with paralogous families in the model dicotyledonous diploid species, Arabidopsis thaliana. Arabidopsis, which has undergone genome duplication as well, has a substantially smaller genome (~120 Mb and gene complement compared to rice. Overall, 53% and 68% of the non-transposable element-related rice and Arabidopsis proteins could be classified into paralogous protein families, respectively. Singleton and paralogous family genes differed substantially in their likelihood of encoding a protein of known or putative function; 26% and 66% of singleton genes compared to 73% and 96% of the paralogous family genes encode a known or putative protein in rice and Arabidopsis, respectively. Furthermore, a major skew in the distribution of specific gene function was observed; a total of 17 Gene Ontology categories in both rice and Arabidopsis were statistically significant in their differential distribution between paralogous family and singleton proteins. In contrast to mammalian organisms, we found that duplicated genes in rice and Arabidopsis tend to have more alternative splice forms. Using data from Massively Parallel Signature Sequencing, we show that a significant portion of the duplicated genes in rice show divergent expression although a correlation between sequence divergence and correlation of expression could be seen in very young genes. Conclusion

  1. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa

    2010-01-01

    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  2. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Transcriptional start site turnover in the evolution of bacterial paralogous genes - the pelE-pelD virulence genes in Dickeya.

    Science.gov (United States)

    Duprey, Alexandre; Nasser, William; Léonard, Simon; Brochier-Armanet, Céline; Reverchon, Sylvie

    2016-11-01

    After a gene duplication event, the resulting paralogous genes frequently acquire distinct expression profiles, roles, and/or functions but the underlying mechanisms are poorly understood. While transcription start site (TSS) turnover, i.e., the repositioning of the TSS during evolution, is widespread in eukaryotes, it is less documented in bacteria. Using pelD and pelE, two closely related paralogous genes encoding key virulence factors in Dickeya, a gamma proteobacterial genus of phytopathogens, we show that pelE has been selected as an initiator of bacterial aggression, while pelD acts at a later stage, thanks to modifications in the transcriptional regulation of these two genes. This expression change is linked to a few mutations that caused a shift in the position of the pelETSS and the rapid divergence in the regulation of these genes after their duplication. Genomic surveys detected additional examples of putative turnovers in other bacteria. This first report of TSS shifting in bacteria suggests that this mechanism could play a major role in paralogous genes fixation in prokaryotes. © 2016 Federation of European Biochemical Societies.

  4. The duplicated genes database: identification and functional annotation of co-localised duplicated genes across genomes.

    Directory of Open Access Journals (Sweden)

    Marion Ouedraogo

    Full Text Available BACKGROUND: There has been a surge in studies linking genome structure and gene expression, with special focus on duplicated genes. Although initially duplicated from the same sequence, duplicated genes can diverge strongly over evolution and take on different functions or regulated expression. However, information on the function and expression of duplicated genes remains sparse. Identifying groups of duplicated genes in different genomes and characterizing their expression and function would therefore be of great interest to the research community. The 'Duplicated Genes Database' (DGD was developed for this purpose. METHODOLOGY: Nine species were included in the DGD. For each species, BLAST analyses were conducted on peptide sequences corresponding to the genes mapped on a same chromosome. Groups of duplicated genes were defined based on these pairwise BLAST comparisons and the genomic location of the genes. For each group, Pearson correlations between gene expression data and semantic similarities between functional GO annotations were also computed when the relevant information was available. CONCLUSIONS: The Duplicated Gene Database provides a list of co-localised and duplicated genes for several species with the available gene co-expression level and semantic similarity value of functional annotation. Adding these data to the groups of duplicated genes provides biological information that can prove useful to gene expression analyses. The Duplicated Gene Database can be freely accessed through the DGD website at http://dgd.genouest.org.

  5. Processes of fungal proteome evolution and gain of function: gene duplication and domain rearrangement

    International Nuclear Information System (INIS)

    Cohen-Gihon, Inbar; Nussinov, Ruth; Sharan, Roded

    2011-01-01

    During evolution, organisms have gained functional complexity mainly by modifying and improving existing functioning systems rather than creating new ones ab initio. Here we explore the interplay between two processes which during evolution have had major roles in the acquisition of new functions: gene duplication and protein domain rearrangements. We consider four possible evolutionary scenarios: gene families that have undergone none of these event types; only gene duplication; only domain rearrangement, or both events. We characterize each of the four evolutionary scenarios by functional attributes. Our analysis of ten fungal genomes indicates that at least for the fungi clade, species significantly appear to gain complexity by gene duplication accompanied by the expansion of existing domain architectures via rearrangements. We show that paralogs gaining new domain architectures via duplication tend to adopt new functions compared to paralogs that preserve their domain architectures. We conclude that evolution of protein families through gene duplication and domain rearrangement is correlated with their functional properties. We suggest that in general, new functions are acquired via the integration of gene duplication and domain rearrangements rather than each process acting independently

  6. Age distribution of human gene families shows significant roles of both large- and small-scale duplications in vertebrate evolution.

    Science.gov (United States)

    Gu, Xun; Wang, Yufeng; Gu, Jianying

    2002-06-01

    The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.

  7. Host Mitochondrial Association Evolved in the Human Parasite Toxoplasma gondii via Neofunctionalization of a Gene Duplicate.

    Science.gov (United States)

    Adomako-Ankomah, Yaw; English, Elizabeth D; Danielson, Jeffrey J; Pernas, Lena F; Parker, Michelle L; Boulanger, Martin J; Dubey, Jitender P; Boyle, Jon P

    2016-05-01

    In Toxoplasma gondii, an intracellular parasite of humans and other animals, host mitochondrial association (HMA) is driven by a gene family that encodes multiple mitochondrial association factor 1 (MAF1) proteins. However, the importance of MAF1 gene duplication in the evolution of HMA is not understood, nor is the impact of HMA on parasite biology. Here we used within- and between-species comparative analysis to determine that the MAF1 locus is duplicated in T. gondii and its nearest extant relative Hammondia hammondi, but not another close relative, Neospora caninum Using cross-species complementation, we determined that the MAF1 locus harbors multiple distinct paralogs that differ in their ability to mediate HMA, and that only T. gondii and H. hammondi harbor HMA(+) paralogs. Additionally, we found that exogenous expression of an HMA(+) paralog in T. gondii strains that do not normally exhibit HMA provides a competitive advantage over their wild-type counterparts during a mouse infection. These data indicate that HMA likely evolved by neofunctionalization of a duplicate MAF1 copy in the common ancestor of T. gondii and H. hammondi, and that the neofunctionalized gene duplicate is selectively advantageous. Copyright © 2016 by the Genetics Society of America.

  8. Three neuropeptide Y receptor genes in the spiny dogfish, Squalus acanthias, support en bloc duplications in early vertebrate evolution.

    Science.gov (United States)

    Salaneck, Erik; Ardell, David H; Larson, Earl T; Larhammar, Dan

    2003-08-01

    It has been debated whether the increase in gene number during early vertebrate evolution was due to multiple independent gene duplications or synchronous duplications of many genes. We describe here the cloning of three neuropeptide Y (NPY) receptor genes belonging to the Y1 subfamily in the spiny dogfish, Squalus acanthias, a cartilaginous fish. The three genes are orthologs of the mammalian subtypes Y1, Y4, and Y6, which are located in paralogous gene regions on different chromosomes in mammals. Thus, these genes arose by duplications of a chromosome region before the radiation of gnathostomes (jawed vertebrates). Estimates of duplication times from linearized trees together with evidence from other gene families supports two rounds of chromosome duplications or tetraploidizations early in vertebrate evolution. The anatomical distribution of mRNA was determined by reverse-transcriptase PCR and was found to differ from mammals, suggesting differential functional diversification of the new gene copies during the radiation of the vertebrate classes.

  9. Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia.

    Science.gov (United States)

    Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C

    2010-02-01

    The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.

  10. Did androgen-binding protein paralogs undergo neo- and/or Subfunctionalization as the Abp gene region expanded in the mouse genome?

    Science.gov (United States)

    Karn, Robert C; Chung, Amanda G; Laukaitis, Christina M

    2014-01-01

    The Androgen-binding protein (Abp) region of the mouse genome contains 30 Abpa genes encoding alpha subunits and 34 Abpbg genes encoding betagamma subunits, their products forming dimers composed of an alpha and a betagamma subunit. We endeavored to determine how many Abp genes are expressed as proteins in tears and saliva, and as transcripts in the exocrine glands producing them. Using standard PCR, we amplified Abp transcripts from cDNA libraries of C57BL/6 mice and found fifteen Abp gene transcripts in the lacrimal gland and five in the submandibular gland. Proteomic analyses identified proteins corresponding to eleven of the lacrimal gland transcripts, all of them different from the three salivary ABPs reported previously. Our qPCR results showed that five of the six transcripts that lacked corresponding proteins are expressed at very low levels compared to those transcripts with proteins. We found 1) no overlap in the repertoires of expressed Abp paralogs in lacrimal gland/tears and salivary glands/saliva; 2) substantial sex-limited expression of lacrimal gland/tear expressed-paralogs in males but no sex-limited expression in females; and 3) that the lacrimal gland/tear expressed-paralogs are found exclusively in ancestral clades 1, 2 and 3 of the five clades described previously while the salivary glands/saliva expressed-paralogs are found only in clade 5. The number of instances of extremely low levels of transcription without corresponding protein production in paralogs specific to tears and saliva suggested the role of subfunctionalization, a derived condition wherein genes that may have been expressed highly in both glands ancestrally were down-regulated subsequent to duplication. Thus, evidence for subfunctionalization can be seen in our data and we argue that the partitioning of paralog expression between lacrimal and salivary glands that we report here occurred as the result of adaptive evolution.

  11. Local synteny and codon usage contribute to asymmetric sequence divergence of Saccharomyces cerevisiae gene duplicates

    Directory of Open Access Journals (Sweden)

    Bergthorsson Ulfar

    2011-09-01

    Full Text Available Abstract Background Duplicated genes frequently experience asymmetric rates of sequence evolution. Relaxed selective constraints and positive selection have both been invoked to explain the observation that one paralog within a gene-duplicate pair exhibits an accelerated rate of sequence evolution. In the majority of studies where asymmetric divergence has been established, there is no indication as to which gene copy, ancestral or derived, is evolving more rapidly. In this study we investigated the effect of local synteny (gene-neighborhood conservation and codon usage on the sequence evolution of gene duplicates in the S. cerevisiae genome. We further distinguish the gene duplicates into those that originated from a whole-genome duplication (WGD event (ohnologs versus small-scale duplications (SSD to determine if there exist any differences in their patterns of sequence evolution. Results For SSD pairs, the derived copy evolves faster than the ancestral copy. However, there is no relationship between rate asymmetry and synteny conservation (ancestral-like versus derived-like in ohnologs. mRNA abundance and optimal codon usage as measured by the CAI is lower in the derived SSD copies relative to ancestral paralogs. Moreover, in the case of ohnologs, the faster-evolving copy has lower CAI and lowered expression. Conclusions Together, these results suggest that relaxation of selection for codon usage and gene expression contribute to rate asymmetry in the evolution of duplicated genes and that in SSD pairs, the relaxation of selection stems from the loss of ancestral regulatory information in the derived copy.

  12. Gene conversion and DNA sequence polymorphism in the sex-determination gene fog-2 and its paralog ftr-1 in Caenorhabditis elegans.

    Science.gov (United States)

    Rane, Hallie S; Smith, Jessica M; Bergthorsson, Ulfar; Katju, Vaishali

    2010-07-01

    Gene conversion, a form of concerted evolution, bears enormous potential to shape the trajectory of sequence and functional divergence of gene paralogs subsequent to duplication events. fog-2, a sex-determination gene unique to Caenorhabditis elegans and implicated in the origin of hermaphroditism in this species, resulted from the duplication of ftr-1, an upstream gene of unknown function. Synonymous sequence divergence in regions of fog-2 and ftr-1 (excluding recent gene conversion tracts) suggests that the duplication occurred 46 million generations ago. Gene conversion between fog-2 and ftr-1 was previously discovered in experimental fog-2 knockout lines of C. elegans, whereby hermaphroditism was restored in mutant obligately outcrossing male-female populations. We analyzed DNA-sequence variation in fog-2 and ftr-1 within 40 isolates of C. elegans from diverse geographic locations in order to evaluate the contribution of gene conversion to genetic variation in the two gene paralogs. The analysis shows that gene conversion contributes significantly to DNA-sequence diversity in fog-2 and ftr-1 (22% and 34%, respectively) and may have the potential to alter sexual phenotypes in natural populations. A radical amino acid change in a conserved region of the F-box domain of fog-2 was found in natural isolates of C. elegans with significantly lower fecundity. We hypothesize that the lowered fecundity is due to reduced masculinization and less sperm production and that amino acid replacement substitutions and gene conversion in fog-2 may contribute significantly to variation in the degree of inbreeding and outcrossing in natural populations.

  13. Investigating the effect of paralogs on microarray gene-set analysis

    LENUS (Irish Health Repository)

    Faure, Andre J

    2011-01-24

    Abstract Background In order to interpret the results obtained from a microarray experiment, researchers often shift focus from analysis of individual differentially expressed genes to analyses of sets of genes. These gene-set analysis (GSA) methods use previously accumulated biological knowledge to group genes into sets and then aim to rank these gene sets in a way that reflects their relative importance in the experimental situation in question. We suspect that the presence of paralogs affects the ability of GSA methods to accurately identify the most important sets of genes for subsequent research. Results We show that paralogs, which typically have high sequence identity and similar molecular functions, also exhibit high correlation in their expression patterns. We investigate this correlation as a potential confounding factor common to current GSA methods using Indygene http:\\/\\/www.cbio.uct.ac.za\\/indygene, a web tool that reduces a supplied list of genes so that it includes no pairwise paralogy relationships above a specified sequence similarity threshold. We use the tool to reanalyse previously published microarray datasets and determine the potential utility of accounting for the presence of paralogs. Conclusions The Indygene tool efficiently removes paralogy relationships from a given dataset and we found that such a reduction, performed prior to GSA, has the ability to generate significantly different results that often represent novel and plausible biological hypotheses. This was demonstrated for three different GSA approaches when applied to the reanalysis of previously published microarray datasets and suggests that the redundancy and non-independence of paralogs is an important consideration when dealing with GSA methodologies.

  14. The Creatine Transporter Gene Paralogous at 16p11.2 Is Expressed in Human Brain

    Directory of Open Access Journals (Sweden)

    Nadia Bayou

    2008-01-01

    We report on the clinical, cytogenetic, and molecular findings in a boy with autism carrying a de novo translocation t(7;16(p22.1;p11.2. The chromosome 16 breakpoint disrupts the paralogous SLC6A8 gene also called SLC6A10 or CT2. Predicted translation of exons and RT-PCR analysis reveal specific expression of the creatine transporter paralogous in testis and brain. Several studies reported on the role of X-linked creatine transporter mutations in individuals with mental retardation, with or without autism. The existence of disruption in SLC6A8 paralogous gene associated with idiopathic autism suggests that this gene may be involved in the autistic phenotype in our patient.

  15. Paralogous SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes differentially regulate leaf initiation and reproductive phase change in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C

    2016-02-01

    Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.

  16. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

    Science.gov (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

    2015-12-01

    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  17. Neofunctionalization of Duplicated P450 Genes Drives the Evolution of Insecticide Resistance in the Brown Planthopper.

    Science.gov (United States)

    Zimmer, Christoph T; Garrood, William T; Singh, Kumar Saurabh; Randall, Emma; Lueke, Bettina; Gutbrod, Oliver; Matthiesen, Svend; Kohler, Maxie; Nauen, Ralf; Davies, T G Emyr; Bass, Chris

    2018-01-22

    Gene duplication is a major source of genetic variation that has been shown to underpin the evolution of a wide range of adaptive traits [1, 2]. For example, duplication or amplification of genes encoding detoxification enzymes has been shown to play an important role in the evolution of insecticide resistance [3-5]. In this context, gene duplication performs an adaptive function as a result of its effects on gene dosage and not as a source of functional novelty [3, 6-8]. Here, we show that duplication and neofunctionalization of a cytochrome P450, CYP6ER1, led to the evolution of insecticide resistance in the brown planthopper. Considerable genetic variation was observed in the coding sequence of CYP6ER1 in populations of brown planthopper collected from across Asia, but just two sequence variants are highly overexpressed in resistant strains and metabolize imidacloprid. Both variants are characterized by profound amino-acid alterations in substrate recognition sites, and the introduction of these mutations into a susceptible P450 sequence is sufficient to confer resistance. CYP6ER1 is duplicated in resistant strains with individuals carrying paralogs with and without the gain-of-function mutations. Despite numerical parity in the genome, the susceptible and mutant copies exhibit marked asymmetry in their expression with the resistant paralogs overexpressed. In the primary resistance-conferring CYP6ER1 variant, this results from an extended region of novel sequence upstream of the gene that provides enhanced expression. Our findings illustrate the versatility of gene duplication in providing opportunities for functional and regulatory innovation during the evolution of an adaptive trait. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.

    Directory of Open Access Journals (Sweden)

    Nemanja Vukašinović

    Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.

  19. A crucial role of paralogous β-defensin genes in the Chinese alligator innate immune system revealed by the first determination of a Crocodilia defensin cluster.

    Science.gov (United States)

    Tang, Ke-Yi; Wang, Xin; Wan, Qiu-Hong; Fang, Sheng-Guo

    2018-04-01

    The β-defensin, one of the antimicrobial peptides (AMPs), is a significant component of the innate immune with a broad range of antimicrobial activities. Differing from the widely-studied mammals and birds, limited information about β-defensins has been reported in reptiles, especially in crocodilians. As a same ancient species as dinosaurs and the most endangered species of 23 crocodilians, the survival of Chinese alligator (Alligator sinensis) means a powerful immune system and possible involvement of AMPs in its immune resistance. In this study, we identified 20 novel Alligator sinensisβ-defensin genes (AsBDs) from a 390 kb region using bioinformatic and experimental approaches, and successfully distinguished six orthologous AsBDs to birds and nine paralogous AsBDs undergoing gene duplication events. The amino acid alignment shows that the AsBD paralogs, like α-defensins, encode a significantly longer pro-piece comparing with the orthologs. The calculation of non-synonymous (d N ) and synonymous (d S ) substitutions in the mature peptide reveals that the AsBD paralogs experience a significantly higher selective pressure (d N /d S ) than the orthologs, but a similar evolutionary force to α-defensins. The gene expression result indicates that the AsBD paralogs have a significantly higher expression level than the orthologos in gastrointestinal tract where the host is vulnerable to enteric pathogenic bacteria, as observed in α-defensins. These three pieces of evidence demonstrate that the AsBD paralogs do play an important role in maintaining long-term survival of this endangered reptile. Thus, this survey of AsBDs on the genomic structure, evolutionary characteristics, and expression pattern provides a genetic and immunological foundation for further investigating their antimicrobial function and alternative antibiotics potentiality. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  1. Biological consequences of ancient gene acquisition and duplication in the large genome soil bacterium, ""solibacter usitatus"" strain Ellin6076

    Energy Technology Data Exchange (ETDEWEB)

    Challacombe, Jean F [Los Alamos National Laboratory; Eichorst, Stephanie A [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Kuske, Cheryl R [Los Alamos National Laboratory; Hauser, Loren [ORNL; Land, Miriam [ORNL

    2009-01-01

    Bacterial genome sizes range from ca. 0.5 to 10Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Sequenced genomes of strains in the phylum Acidobacteria revealed that 'Solibacter usistatus' strain Ellin6076 harbors a 9.9 Mb genome. This large genome appears to have arisen by horizontal gene transfer via ancient bacteriophage and plasmid-mediated transduction, as well as widespread small-scale gene duplications. This has resulted in an increased number of paralogs that are potentially ecologically important (ecoparalogs). Low amino acid sequence identities among functional group members and lack of conserved gene order and orientation in the regions containing similar groups of paralogs suggest that most of the paralogs were not the result of recent duplication events. The genome sizes of cultured subdivision 1 and 3 strains in the phylum Acidobacteria were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 1 were estimated to have smaller genome sizes ranging from ca. 2.0 to 4.8 Mb, whereas members of subdivision 3 had slightly larger genomes, from ca. 5.8 to 9.9 Mb. It is hypothesized that the large genome of strain Ellin6076 encodes traits that provide a selective metabolic, defensive and regulatory advantage in the variable soil environment.

  2. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  3. Chromosome structures: reduction of certain problems with unequal gene content and gene paralogs to integer linear programming.

    Science.gov (United States)

    Lyubetsky, Vassily; Gershgorin, Roman; Gorbunov, Konstantin

    2017-12-06

    Chromosome structure is a very limited model of the genome including the information about its chromosomes such as their linear or circular organization, the order of genes on them, and the DNA strand encoding a gene. Gene lengths, nucleotide composition, and intergenic regions are ignored. Although highly incomplete, such structure can be used in many cases, e.g., to reconstruct phylogeny and evolutionary events, to identify gene synteny, regulatory elements and promoters (considering highly conserved elements), etc. Three problems are considered; all assume unequal gene content and the presence of gene paralogs. The distance problem is to determine the minimum number of operations required to transform one chromosome structure into another and the corresponding transformation itself including the identification of paralogs in two structures. We use the DCJ model which is one of the most studied combinatorial rearrangement models. Double-, sesqui-, and single-operations as well as deletion and insertion of a chromosome region are considered in the model; the single ones comprise cut and join. In the reconstruction problem, a phylogenetic tree with chromosome structures in the leaves is given. It is necessary to assign the structures to inner nodes of the tree to minimize the sum of distances between terminal structures of each edge and to identify the mutual paralogs in a fairly large set of structures. A linear algorithm is known for the distance problem without paralogs, while the presence of paralogs makes it NP-hard. If paralogs are allowed but the insertion and deletion operations are missing (and special constraints are imposed), the reduction of the distance problem to integer linear programming is known. Apparently, the reconstruction problem is NP-hard even in the absence of paralogs. The problem of contigs is to find the optimal arrangements for each given set of contigs, which also includes the mutual identification of paralogs. We proved that these

  4. Early vertebrate chromosome duplications and the evolution of the neuropeptide Y receptor gene regions

    Directory of Open Access Journals (Sweden)

    Brenner Sydney

    2008-06-01

    Full Text Available Abstract Background One of the many gene families that expanded in early vertebrate evolution is the neuropeptide (NPY receptor family of G-protein coupled receptors. Earlier work by our lab suggested that several of the NPY receptor genes found in extant vertebrates resulted from two genome duplications before the origin of jawed vertebrates (gnathostomes and one additional genome duplication in the actinopterygian lineage, based on their location on chromosomes sharing several gene families. In this study we have investigated, in five vertebrate genomes, 45 gene families with members close to the NPY receptor genes in the compact genomes of the teleost fishes Tetraodon nigroviridis and Takifugu rubripes. These correspond to Homo sapiens chromosomes 4, 5, 8 and 10. Results Chromosome regions with conserved synteny were identified and confirmed by phylogenetic analyses in H. sapiens, M. musculus, D. rerio, T. rubripes and T. nigroviridis. 26 gene families, including the NPY receptor genes, (plus 3 described recently by other labs showed a tree topology consistent with duplications in early vertebrate evolution and in the actinopterygian lineage, thereby supporting expansion through block duplications. Eight gene families had complications that precluded analysis (such as short sequence length or variable number of repeated domains and another eight families did not support block duplications (because the paralogs in these families seem to have originated in another time window than the proposed genome duplication events. RT-PCR carried out with several tissues in T. rubripes revealed that all five NPY receptors were expressed in the brain and subtypes Y2, Y4 and Y8 were also expressed in peripheral organs. Conclusion We conclude that the phylogenetic analyses and chromosomal locations of these gene families support duplications of large blocks of genes or even entire chromosomes. Thus, these results are consistent with two early vertebrate

  5. Effect of Duplicate Genes on Mouse Genetic Robustness: An Update

    Directory of Open Access Journals (Sweden)

    Zhixi Su

    2014-01-01

    Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.

  6. Exon duplications in the ATP7A gene

    DEFF Research Database (Denmark)

    Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko

    2011-01-01

    the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...

  7. Functional requirements driving the gene duplication in 12 Drosophila species.

    Science.gov (United States)

    Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui

    2013-08-15

    Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.

  8. Specific duplication and dorsoventrally asymmetric expression patterns of Cycloidea-like genes in zygomorphic species of Ranunculaceae.

    Science.gov (United States)

    Jabbour, Florian; Cossard, Guillaume; Le Guilloux, Martine; Sannier, Julie; Nadot, Sophie; Damerval, Catherine

    2014-01-01

    Floral bilateral symmetry (zygomorphy) has evolved several times independently in angiosperms from radially symmetrical (actinomorphic) ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc) have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like) lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.

  9. Specific duplication and dorsoventrally asymmetric expression patterns of Cycloidea-like genes in zygomorphic species of Ranunculaceae.

    Directory of Open Access Journals (Sweden)

    Florian Jabbour

    Full Text Available Floral bilateral symmetry (zygomorphy has evolved several times independently in angiosperms from radially symmetrical (actinomorphic ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.

  10. Origin of a function by tandem gene duplication limits the evolutionary capability of its sister copy.

    Science.gov (United States)

    Hasselmann, Martin; Lechner, Sarah; Schulte, Christina; Beye, Martin

    2010-07-27

    The most remarkable outcome of a gene duplication event is the evolution of a novel function. Little information exists on how the rise of a novel function affects the evolution of its paralogous sister gene copy, however. We studied the evolution of the feminizer (fem) gene from which the gene complementary sex determiner (csd) recently derived by tandem duplication within the honey bee (Apis) lineage. Previous studies showed that fem retained its sex determination function, whereas the rise of csd established a new primary signal of sex determination. We observed a specific reduction of nonsynonymous to synonymous substitution ratios in Apis to non-Apis fem. We found a contrasting pattern at two other genetically linked genes, suggesting that hitchhiking effects to csd, the locus under balancing selection, is not the cause of this evolutionary pattern. We also excluded higher synonymous substitution rates by relative rate testing. These results imply that stronger purifying selection is operating at the fem gene in the presence of csd. We propose that csd's new function interferes with the function of Fem protein, resulting in molecular constraints and limited evolvability of fem in the Apis lineage. Elevated silent nucleotide polymorphism in fem relative to the genome-wide average suggests that genetic linkage to the csd gene maintained more nucleotide variation in today's population. Our findings provide evidence that csd functionally and genetically interferes with fem, suggesting that a newly evolved gene and its functions can limit the evolutionary capability of other genes in the genome.

  11. Gene duplication, loss and selection in the evolution of saxitoxin biosynthesis in alveolates.

    Science.gov (United States)

    Murray, Shauna A; Diwan, Rutuja; Orr, Russell J S; Kohli, Gurjeet S; John, Uwe

    2015-11-01

    A group of marine dinoflagellates (Alveolata, Eukaryota), consisting of ∼10 species of the genus Alexandrium, Gymnodinium catenatum and Pyrodinium bahamense, produce the toxin saxitoxin and its analogues (STX), which can accumulate in shellfish, leading to ecosystem and human health impacts. The genes, sxt, putatively involved in STX biosynthesis, have recently been identified, however, the evolution of these genes within dinoflagellates is not clear. There are two reasons for this: uncertainty over the phylogeny of dinoflagellates; and that the sxt genes of many species of Alexandrium and other dinoflagellate genera are not known. Here, we determined the phylogeny of STX-producing and other dinoflagellates based on a concatenated eight-gene alignment. We determined the presence, diversity and phylogeny of sxtA, domains A1 and A4 and sxtG in 52 strains of Alexandrium, and a further 43 species of dinoflagellates and thirteen other alveolates. We confirmed the presence and high sequence conservation of sxtA, domain A4, in 40 strains (35 Alexandrium, 1 Pyrodinium, 4 Gymnodinium) of 8 species of STX-producing dinoflagellates, and absence from non-producing species. We found three paralogs of sxtA, domain A1, and a widespread distribution of sxtA1 in non-STX producing dinoflagellates, indicating duplication events in the evolution of this gene. One paralog, clade 2, of sxtA1 may be particularly related to STX biosynthesis. Similarly, sxtG appears to be generally restricted to STX-producing species, while three amidinotransferase gene paralogs were found in dinoflagellates. We investigated the role of positive (diversifying) selection following duplication in sxtA1 and sxtG, and found negative selection in clades of sxtG and sxtA1, clade 2, suggesting they were functionally constrained. Significant episodic diversifying selection was found in some strains in clade 3 of sxtA1, a clade that may not be involved in STX biosynthesis, indicating pressure for diversification

  12. Expression of paralogous SEP-, FUL-, AG- and STK-like MADS-box genes in wild-type and peloric Phalaenopsis flowers.

    Directory of Open Access Journals (Sweden)

    Roberta eAcri-Nunes-Miranda

    2014-03-01

    Full Text Available The diverse flowers of Orchidaceae are the result of several major morphological transitions, among them the most studied is the differentiation of the inner median tepal into the labellum, a perianth organ key in pollinator attraction. Type A peloria lacking stamens and with ectopic labella in place of inner lateral tepals are useful for testing models on the genes specifying these organs by comparing their patterns of expression between wild-type and peloric flowers. Previous studies focused on DEFICIENS and GLOBOSA-like MADS-box genes because of their conserved role in perianth and stamen development. The ‘orchid code’ model summarizes this work and shows in Orchidaceae there are four paralogous lineages of DEFICIENS/AP3-like genes differentially expressed in each floral whorl. Experimental tests of this model showed the conserved, higher expression of genes from two specific DEF-like gene lineages is associated with labellum development. The present study tests whether eight MADS-box candidate SEP-, FUL-, AG- and STK-like genes have been specifically duplicated in the Orchidaceae and are also differentially expressed in association with the distinct flower organs of Phalaenopsis hyb. Athens. The gene trees indicate orchid-specific duplications. In a way analogous to what is observed in labellum-specific DEF-like genes, a two-fold increase in the expression of SEP3-like gene PhaMADS7 was measured in the labellum-like inner lateral tepals of peloric flowers. The overlap between SEP3-like and DEF-like genes suggests both are associated with labellum specification and similar positional cues determine their domains of expression. In contrast, the uniform messenger levels of FUL-like genes suggest they are involved in the development of all organs and their expression in the ovary suggests cell differentiation starts before pollination. As previously reported AG-like and STK-like are exclusively expressed in gynostemium and ovary, however no

  13. Maintenance and Loss of Duplicated Genes by Dosage Subfunctionalization.

    Science.gov (United States)

    Gout, Jean-Francois; Lynch, Michael

    2015-08-01

    Whole-genome duplications (WGDs) have contributed to gene-repertoire enrichment in many eukaryotic lineages. However, most duplicated genes are eventually lost and it is still unclear why some duplicated genes are evolutionary successful whereas others quickly turn to pseudogenes. Here, we show that dosage constraints are major factors opposing post-WGD gene loss in several Paramecium species that share a common ancestral WGD. We propose a model where a majority of WGD-derived duplicates preserve their ancestral function and are retained to produce enough of the proteins performing this same ancestral function. Under this model, the expression level of individual duplicated genes can evolve neutrally as long as they maintain a roughly constant summed expression, and this allows random genetic drift toward uneven contributions of the two copies to total expression. Our analysis suggests that once a high level of imbalance is reached, which can require substantial lengths of time, the copy with the lowest expression level contributes a small enough fraction of the total expression that selection no longer opposes its loss. Extension of our analysis to yeast species sharing a common ancestral WGD yields similar results, suggesting that duplicated-gene retention for dosage constraints followed by divergence in expression level and eventual deterministic gene loss might be a universal feature of post-WGD evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.

    Science.gov (United States)

    Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet

    2016-02-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.

  15. Expression of paralogous SEP-, FUL-, AG- and STK-like MADS-box genes in wild-type and peloric Phalaenopsis flowers.

    Science.gov (United States)

    Acri-Nunes-Miranda, Roberta; Mondragón-Palomino, Mariana

    2014-01-01

    The diverse flowers of Orchidaceae are the result of several major morphological transitions, among them the most studied is the differentiation of the inner median tepal into the labellum, a perianth organ key in pollinator attraction. Type A peloria lacking stamens and with ectopic labella in place of inner lateral tepals are useful for testing models on the genes specifying these organs by comparing their patterns of expression between wild-type and peloric flowers. Previous studies focused on DEFICIENS- and GLOBOSA-like MADS-box genes because of their conserved role in perianth and stamen development. The "orchid code" model summarizes this work and shows in Orchidaceae there are four paralogous lineages of DEFICIENS/AP3-like genes differentially expressed in each floral whorl. Experimental tests of this model showed the conserved, higher expression of genes from two specific DEF-like gene lineages is associated with labellum development. The present study tests whether eight MADS-box candidate SEP-, FUL-, AG-, and STK-like genes have been specifically duplicated in the Orchidaceae and are also differentially expressed in association with the distinct flower organs of Phalaenopsis hyb. "Athens." The gene trees indicate orchid-specific duplications. In a way analogous to what is observed in labellum-specific DEF-like genes, a two-fold increase in the expression of SEP3-like gene PhaMADS7 was measured in the labellum-like inner lateral tepals of peloric flowers. The overlap between SEP3-like and DEF-like genes suggests both are associated with labellum specification and similar positional cues determine their domains of expression. In contrast, the uniform messenger levels of FUL-like genes suggest they are involved in the development of all organs and their expression in the ovary suggests cell differentiation starts before pollination. As previously reported AG-like and STK-like genes are exclusively expressed in gynostemium and ovary, however no evidence for

  16. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN

    Science.gov (United States)

    Li, Zhen; Van de Peer, Yves; De Smet, Riet

    2016-01-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215

  17. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  18. Clusters of ancestrally related genes that show paralogy in whole or in part are a major feature of the genomes of humans and other species.

    Directory of Open Access Journals (Sweden)

    Michael B Walker

    Full Text Available Arrangements of genes along chromosomes are a product of evolutionary processes, and we can expect that preferable arrangements will prevail over the span of evolutionary time, often being reflected in the non-random clustering of structurally and/or functionally related genes. Such non-random arrangements can arise by two distinct evolutionary processes: duplications of DNA sequences that give rise to clusters of genes sharing both sequence similarity and common sequence features and the migration together of genes related by function, but not by common descent. To provide a background for distinguishing between the two, which is important for future efforts to unravel the evolutionary processes involved, we here provide a description of the extent to which ancestrally related genes are found in proximity.Towards this purpose, we combined information from five genomic datasets, InterPro, SCOP, PANTHER, Ensembl protein families, and Ensembl gene paralogs. The results are provided in publicly available datasets (http://cgd.jax.org/datasets/clustering/paraclustering.shtml describing the extent to which ancestrally related genes are in proximity beyond what is expected by chance (i.e. form paraclusters in the human and nine other vertebrate genomes, as well as the D. melanogaster, C. elegans, A. thaliana, and S. cerevisiae genomes. With the exception of Saccharomyces, paraclusters are a common feature of the genomes we examined. In the human genome they are estimated to include at least 22% of all protein coding genes. Paraclusters are far more prevalent among some gene families than others, are highly species or clade specific and can evolve rapidly, sometimes in response to environmental cues. Altogether, they account for a large portion of the functional clustering previously reported in several genomes.

  19. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    International Nuclear Information System (INIS)

    Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.

    2009-01-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  20. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    Energy Technology Data Exchange (ETDEWEB)

    Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)

    2009-10-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.

  1. Similar but not the same: insights into the evolutionary history of paralogous sex-determining genes of the dwarf honey bee Apis florea.

    Science.gov (United States)

    Biewer, M; Lechner, S; Hasselmann, M

    2016-01-01

    Studying the fate of duplicated genes provides informative insight into the evolutionary plasticity of biological pathways to which they belong. In the paralogous sex-determining genes complementary sex determiner (csd) and feminizer (fem) of honey bee species (genus Apis), only heterozygous csd initiates female development. Here, the full-length coding sequences of the genes csd and fem of the phylogenetically basal dwarf honey bee Apis florea are characterized. Compared with other Apis species, remarkable evolutionary changes in the formation and localization of a protein-interacting (coiled-coil) motif and in the amino acids coding for the csd characteristic hypervariable region (HVR) are observed. Furthermore, functionally different csd alleles were isolated as genomic fragments from a random population sample. In the predicted potential specifying domain (PSD), a high ratio of πN/πS=1.6 indicated positive selection, whereas signs of balancing selection, commonly found in other Apis species, are missing. Low nucleotide diversity on synonymous and genome-wide, non-coding sites as well as site frequency analyses indicated a strong impact of genetic drift in A. florea, likely linked to its biology. Along the evolutionary trajectory of ~30 million years of csd evolution, episodic diversifying selection seems to have acted differently among distinct Apis branches. Consistently low amino-acid differences within the PSD among pairs of functional heterozygous csd alleles indicate that the HVR is the most important region for determining allele specificity. We propose that in the early history of the lineage-specific fem duplication giving rise to csd in Apis, A. florea csd stands as a remarkable example for the plasticity of initial sex-determining signals.

  2. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  3. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...

  4. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

    Science.gov (United States)

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

    2016-10-13

    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  5. Recombination facilitates neofunctionalization of duplicate genes via originalization

    Directory of Open Access Journals (Sweden)

    Huang Ren

    2010-06-01

    Full Text Available Abstract Background Recently originalization was proposed to be an effective way of duplicate-gene preservation, in which recombination provokes the high frequency of original (or wild-type allele on both duplicated loci. Because the high frequency of wild-type allele might drive the arising and accumulating of advantageous mutation, it is hypothesized that recombination might enlarge the probability of neofunctionalization (Pneo of duplicate genes. In this article this hypothesis has been tested theoretically. Results Results show that through originalization recombination might not only shorten mean time to neofunctionalizaiton, but also enlarge Pneo. Conclusions Therefore, recombination might facilitate neofunctionalization via originalization. Several extensive applications of these results on genomic evolution have been discussed: 1. Time to nonfunctionalization can be much longer than a few million generations expected before; 2. Homogenization on duplicated loci results from not only gene conversion, but also originalization; 3. Although the rate of advantageous mutation is much small compared with that of degenerative mutation, Pneo cannot be expected to be small.

  6. Gene duplication, tissue-specific gene expression and sexual conflict in stalk-eyed flies (Diopsidae).

    Science.gov (United States)

    Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S

    2012-08-19

    Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.

  7. Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes.

    Science.gov (United States)

    Ndika, Joseph D T; Lusink, Vera; Beaubrun, Claudine; Kanhai, Warsha; Martinez-Munoz, Cristina; Jakobs, Cornelis; Salomons, Gajja S

    2014-01-10

    Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8-SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5'flanking sequence and its entire 3'UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5'flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5'flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first

  8. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2009-07-01

    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  9. Gene Duplication Leads to Altered Membrane Topology of a Cytochrome P450 Enzyme in Seed Plants.

    Science.gov (United States)

    Renault, Hugues; De Marothy, Minttu; Jonasson, Gabriella; Lara, Patricia; Nelson, David R; Nilsson, IngMarie; André, François; von Heijne, Gunnar; Werck-Reichhart, Danièle

    2017-08-01

    Evolution of the phenolic metabolism was critical for the transition of plants from water to land. A cytochrome P450, CYP73, with cinnamate 4-hydroxylase (C4H) activity, catalyzes the first plant-specific and rate-limiting step in this pathway. The CYP73 gene is absent from green algae, and first detected in bryophytes. A CYP73 duplication occurred in the ancestor of seed plants and was retained in Taxaceae and most angiosperms. In spite of a clear divergence in primary sequence, both paralogs can fulfill comparable cinnamate hydroxylase roles both in vitro and in vivo. One of them seems dedicated to the biosynthesis of lignin precursors. Its N-terminus forms a single membrane spanning helix and its properties and length are highly constrained. The second is characterized by an elongated and variable N-terminus, reminiscent of ancestral CYP73s. Using as proxies the Brachypodium distachyon proteins, we show that the elongation of the N-terminus does not result in an altered subcellular localization, but in a distinct membrane topology. Insertion in the membrane of endoplasmic reticulum via a double-spanning open hairpin structure allows reorientation to the lumen of the catalytic domain of the protein. In agreement with participation to a different functional unit and supramolecular organization, the protein displays modified heme proximal surface. These data suggest the evolution of divergent C4H enzymes feeding different branches of the phenolic network in seed plants. It shows that specialization required for retention of gene duplicates may result from altered protein topology rather than change in enzyme activity. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.

    Science.gov (United States)

    Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M

    2017-08-01

    Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

  11. Teleost Fish-Specific Preferential Retention of Pigmentation Gene-Containing Families After Whole Genome Duplications in Vertebrates

    Science.gov (United States)

    Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas

    2018-01-01

    Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177

  12. Differential retention of metabolic genes following whole-genome duplication.

    Science.gov (United States)

    Gout, Jean-François; Duret, Laurent; Kahn, Daniel

    2009-05-01

    Classical studies in Metabolic Control Theory have shown that metabolic fluxes usually exhibit little sensitivity to changes in individual enzyme activity, yet remain sensitive to global changes of all enzymes in a pathway. Therefore, little selective pressure is expected on the dosage or expression of individual metabolic genes, yet entire pathways should still be constrained. However, a direct estimate of this selective pressure had not been evaluated. Whole-genome duplications (WGDs) offer a good opportunity to address this question by analyzing the fates of metabolic genes during the massive gene losses that follow. Here, we take advantage of the successive rounds of WGD that occurred in the Paramecium lineage. We show that metabolic genes exhibit different gene retention patterns than nonmetabolic genes. Contrary to what was expected for individual genes, metabolic genes appeared more retained than other genes after the recent WGD, which was best explained by selection for gene expression operating on entire pathways. Metabolic genes also tend to be less retained when present at high copy number before WGD, contrary to other genes that show a positive correlation between gene retention and preduplication copy number. This is rationalized on the basis of the classical concave relationship relating metabolic fluxes with enzyme expression.

  13. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  14. A salmonid EST genomic study: genes, duplications, phylogeny and microarrays

    Directory of Open Access Journals (Sweden)

    Brahmbhatt Sonal

    2008-11-01

    Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is

  15. Novel male-biased expression in paralogs of the aphid slimfast nutrient amino acid transporter expansion

    Directory of Open Access Journals (Sweden)

    Nathanson Lubov

    2011-09-01

    Full Text Available Abstract Background A major goal of molecular evolutionary biology is to understand the fate and consequences of duplicated genes. In this context, aphids are intriguing because the newly sequenced pea aphid genome harbors an extraordinary number of lineage-specific gene duplications relative to other insect genomes. Though many of their duplicated genes may be involved in their complex life cycle, duplications in nutrient amino acid transporters appear to be associated rather with their essential amino acid poor diet and the intracellular symbiosis aphids rely on to compensate for dietary deficits. Past work has shown that some duplicated amino acid transporters are highly expressed in the specialized cells housing the symbionts, including a paralog of an aphid-specific expansion homologous to the Drosophila gene slimfast. Previous data provide evidence that these bacteriocyte-expressed transporters mediate amino acid exchange between aphids and their symbionts. Results We report that some nutrient amino acid transporters show male-biased expression. Male-biased expression characterizes three paralogs in the aphid-specific slimfast expansion, and the male-biased expression is conserved across two aphid species for at least two paralogs. One of the male-biased paralogs has additionally experienced an accelerated rate of non-synonymous substitutions. Conclusions This is the first study to document male-biased slimfast expression. Our data suggest that the male-biased aphid slimfast paralogs diverged from their ancestral function to fill a functional role in males. Furthermore, our results provide evidence that members of the slimfast expansion are maintained in the aphid genome not only for the previously hypothesized role in mediating amino acid exchange between the symbiotic partners, but also for sex-specific roles.

  16. Genome Mutational and Transcriptional Hotspots Are Traps for Duplicated Genes and Sources of Adaptations.

    Science.gov (United States)

    Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina

    2017-05-01

    Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. Profiling of gene duplication patterns of sequenced teleost genomes: evidence for rapid lineage-specific genome expansion mediated by recent tandem duplications.

    Science.gov (United States)

    Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang

    2012-06-15

    Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication

  18. On Computing Breakpoint Distances for Genomes with Duplicate Genes.

    Science.gov (United States)

    Shao, Mingfu; Moret, Bernard M E

    2017-06-01

    A fundamental problem in comparative genomics is to compute the distance between two genomes in terms of its higher level organization (given by genes or syntenic blocks). For two genomes without duplicate genes, we can easily define (and almost always efficiently compute) a variety of distance measures, but the problem is NP-hard under most models when genomes contain duplicate genes. To tackle duplicate genes, three formulations (exemplar, maximum matching, and any matching) have been proposed, all of which aim to build a matching between homologous genes so as to minimize some distance measure. Of the many distance measures, the breakpoint distance (the number of nonconserved adjacencies) was the first one to be studied and remains of significant interest because of its simplicity and model-free property. The three breakpoint distance problems corresponding to the three formulations have been widely studied. Although we provided last year a solution for the exemplar problem that runs very fast on full genomes, computing optimal solutions for the other two problems has remained challenging. In this article, we describe very fast, exact algorithms for these two problems. Our algorithms rely on a compact integer-linear program that we further simplify by developing an algorithm to remove variables, based on new results on the structure of adjacencies and matchings. Through extensive experiments using both simulations and biological data sets, we show that our algorithms run very fast (in seconds) on mammalian genomes and scale well beyond. We also apply these algorithms (as well as the classic orthology tool MSOAR) to create orthology assignment, then compare their quality in terms of both accuracy and coverage. We find that our algorithm for the "any matching" formulation significantly outperforms other methods in terms of accuracy while achieving nearly maximum coverage.

  19. Evolutionary diversification of plant shikimate kinase gene duplicates.

    Directory of Open Access Journals (Sweden)

    Geoffrey Fucile

    2008-12-01

    Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.

  20. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu

    2016-09-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.

  1. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes1[OPEN

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu

    2016-01-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883

  2. STRIDE: Species Tree Root Inference from Gene Duplication Events.

    Science.gov (United States)

    Emms, David M; Kelly, Steven

    2017-12-01

    The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

    Directory of Open Access Journals (Sweden)

    Gadagkar Sudhindra R

    2010-04-01

    Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions

  4. Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion

    Directory of Open Access Journals (Sweden)

    Jeffrey A. Fawcett

    2011-02-01

    Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.

  5. Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene

    Directory of Open Access Journals (Sweden)

    Shomron Noam

    2007-11-01

    Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.

  6. Duplication and Diversification of the Hypoxia-Inducible IGFBP-1 Gene in Zebrafish

    DEFF Research Database (Denmark)

    Kamei, Hiroyasu; Lu, Ling; Jiao, Shuang

    2008-01-01

    Background: Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenabilit...

  7. Duplication and independent selection of cell-wall invertase genes GIF1 and OsCIN1 during rice evolution and domestication

    Directory of Open Access Journals (Sweden)

    Ge Song

    2010-04-01

    Full Text Available Abstract Background Various evolutionary models have been proposed to interpret the fate of paralogous duplicates, which provides substrates on which evolution selection could act. In particular, domestication, as a special selection, has played important role in crop cultivation with divergence of many genes controlling important agronomic traits. Recent studies have indicated that a pair of duplicate genes was often sub-functionalized from their ancestral functions held by the parental genes. We previously demonstrated that the rice cell-wall invertase (CWI gene GIF1 that plays an important role in the grain-filling process was most likely subjected to domestication selection in the promoter region. Here, we report that GIF1 and another CWI gene OsCIN1 constitute a pair of duplicate genes with differentiated expression and function through independent selection. Results Through synteny analysis, we show that GIF1 and another cell-wall invertase gene OsCIN1 were paralogues derived from a segmental duplication originated during genome duplication of grasses. Results based on analyses of population genetics and gene phylogenetic tree of 25 cultivars and 25 wild rice sequences demonstrated that OsCIN1 was also artificially selected during rice domestication with a fixed mutation in the coding region, in contrast to GIF1 that was selected in the promoter region. GIF1 and OsCIN1 have evolved into different expression patterns and probable different kinetics parameters of enzymatic activity with the latter displaying less enzymatic activity. Overexpression of GIF1 and OsCIN1 also resulted in different phenotypes, suggesting that OsCIN1 might regulate other unrecognized biological process. Conclusion How gene duplication and divergence contribute to genetic novelty and morphological adaptation has been an interesting issue to geneticists and biologists. Our discovery that the duplicated pair of GIF1 and OsCIN1 has experienced sub

  8. Rooting phylogenies using gene duplications: an empirical example from the bees (Apoidea).

    Science.gov (United States)

    Brady, Seán G; Litman, Jessica R; Danforth, Bryan N

    2011-09-01

    The placement of the root node in a phylogeny is fundamental to characterizing evolutionary relationships. The root node of bee phylogeny remains unclear despite considerable previous attention. In order to test alternative hypotheses for the location of the root node in bees, we used the F1 and F2 paralogs of elongation factor 1-alpha (EF-1α) to compare the tree topologies that result when using outgroup versus paralogous rooting. Fifty-two taxa representing each of the seven bee families were sequenced for both copies of EF-1α. Two datasets were analyzed. In the first (the "concatenated" dataset), the F1 and F2 copies for each species were concatenated and the tree was rooted using appropriate outgroups (sphecid and crabronid wasps). In the second dataset (the "duplicated" dataset), the F1 and F2 copies were aligned to each another and each copy for all taxa were treated as separate terminals. In this dataset, the root was placed between the F1 and F2 copies (e.g., paralog rooting). Bayesian analyses demonstrate that the outgroup rooting approach outperforms paralog rooting, recovering deeper clades and showing stronger support for groups well established by both morphological and other molecular data. Sequence characteristics of the two copies were compared at the amino acid level, but little evidence was found to suggest that one copy is more functionally conserved. Although neither approach yields an unambiguous root to the tree, both approaches strongly indicate that the root of bee phylogeny does not fall near Colletidae, as has been previously proposed. We discuss paralog rooting as a general strategy and why this approach performs relatively poorly with our particular dataset. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. Functional studies of heading date-related gene TaPRR73, a paralog of Ppd1 in common wheat

    Directory of Open Access Journals (Sweden)

    Wenping eZhang

    2016-06-01

    Full Text Available Photoperiod response-related genes play a crucial role in duration of the plant growth. In this study, we focused on TaPRR73, a paralog of Green Revolution gene Ppd1 (TaPRR37. We found that overexpression of the truncated TaPRR73 form lacking part of the N-terminal PR domain in transgenic rice promoted heading under long day conditions. Association analysis in common wheat verified that TaPRR73 was an important agronomic photoperiod response gene that significantly affected heading date and plant height; expression analysis proved that specific alleles of TaPRR73-A1 had highly expressed levels in earlier heading lines; the distribution of haplotypes indicated that one of these alleles had been selected in breeding programs. Our results demonstrated that TaPRR73 contributed to regulation of heading date in wheat and could be useful in wheat breeding and in broadening adaptation of the crop to new regions.

  10. On the Use of Gene Ontology Annotations to Assess Functional Similarity among Orthologs and Paralogs: A Short Report.

    Directory of Open Access Journals (Sweden)

    Paul D Thomas

    Full Text Available A recent paper (Nehrt et al., PLoS Comput. Biol. 7:e1002073, 2011 has proposed a metric for the "functional similarity" between two genes that uses only the Gene Ontology (GO annotations directly derived from published experimental results. Applying this metric, the authors concluded that paralogous genes within the mouse genome or the human genome are more functionally similar on average than orthologous genes between these genomes, an unexpected result with broad implications if true. We suggest, based on both theoretical and empirical considerations, that this proposed metric should not be interpreted as a functional similarity, and therefore cannot be used to support any conclusions about the "ortholog conjecture" (or, more properly, the "ortholog functional conservation hypothesis". First, we reexamine the case studies presented by Nehrt et al. as examples of orthologs with divergent functions, and come to a very different conclusion: they actually exemplify how GO annotations for orthologous genes provide complementary information about conserved biological functions. We then show that there is a global ascertainment bias in the experiment-based GO annotations for human and mouse genes: particular types of experiments tend to be performed in different model organisms. We conclude that the reported statistical differences in annotations between pairs of orthologous genes do not reflect differences in biological function, but rather complementarity in experimental approaches. Our results underscore two general considerations for researchers proposing novel types of analysis based on the GO: 1 that GO annotations are often incomplete, potentially in a biased manner, and subject to an "open world assumption" (absence of an annotation does not imply absence of a function, and 2 that conclusions drawn from a novel, large-scale GO analysis should whenever possible be supported by careful, in-depth examination of examples, to help ensure the

  11. Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants

    OpenAIRE

    Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong

    2010-01-01

    Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

  12. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes.

    Science.gov (United States)

    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich

    2004-03-01

    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix-loop-helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks emerging through single-gene duplications, the dominant importance of molecular modularity in the bottom-up construction of complex biological entities, and the convergent evolution of networks.

  13. Duplication of the dystroglycan gene in most branches of teleost fish

    Directory of Open Access Journals (Sweden)

    Giardina Bruno

    2007-05-01

    Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details

  14. Are duplicated genes responsible for anthracnose resistance in common bean?

    Science.gov (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  15. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  16. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  17. The evolution and appearance of C3 duplications in fish originate an exclusive teleost c3 gene form with anti-inflammatory activity.

    Directory of Open Access Journals (Sweden)

    Gabriel Forn-Cuní

    Full Text Available The complement system acts as a first line of defense and promotes organism homeostasis by modulating the fates of diverse physiological processes. Multiple copies of component genes have been previously identified in fish, suggesting a key role for this system in aquatic organisms. Herein, we confirm the presence of three different previously reported complement c3 genes (c3.1, c3.2, c3.3 and identify five additional c3 genes (c3.4, c3.5, c3.6, c3.7, c3.8 in the zebrafish genome. Additionally, we evaluate the mRNA expression levels of the different c3 genes during ontogeny and in different tissues under steady-state and inflammatory conditions. Furthermore, while reconciling the phylogenetic tree with the fish species tree, we uncovered an event of c3 duplication common to all teleost fishes that gave rise to an exclusive c3 paralog (c3.7 and c3.8. These paralogs showed a distinct ability to regulate neutrophil migration in response to injury compared with the other c3 genes and may play a role in maintaining the balance between inflammatory and homeostatic processes in zebrafish.

  18. Recurrent Gene Duplication Leads to Diverse Repertoires of Centromeric Histones in Drosophila Species.

    Science.gov (United States)

    Kursel, Lisa E; Malik, Harmit S

    2017-06-01

    Despite their essential role in the process of chromosome segregation in most eukaryotes, centromeric histones show remarkable evolutionary lability. Not only have they been lost in multiple insect lineages, but they have also undergone gene duplication in multiple plant lineages. Based on detailed study of a handful of model organisms including Drosophila melanogaster, centromeric histone duplication is considered to be rare in animals. Using a detailed phylogenomic study, we find that Cid, the centromeric histone gene, has undergone at least four independent gene duplications during Drosophila evolution. We find duplicate Cid genes in D. eugracilis (Cid2), in the montium species subgroup (Cid3, Cid4) and in the entire Drosophila subgenus (Cid5). We show that Cid3, Cid4, and Cid5 all localize to centromeres in their respective species. Some Cid duplicates are primarily expressed in the male germline. With rare exceptions, Cid duplicates have been strictly retained after birth, suggesting that they perform nonredundant centromeric functions, independent from the ancestral Cid. Indeed, each duplicate encodes a distinct N-terminal tail, which may provide the basis for distinct protein-protein interactions. Finally, we show some Cid duplicates evolve under positive selection whereas others do not. Taken together, our results support the hypothesis that Drosophila Cid duplicates have subfunctionalized. Thus, these gene duplications provide an unprecedented opportunity to dissect the multiple roles of centromeric histones. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Comparative inference of duplicated genes produced by polyploidization in soybean genome.

    Science.gov (United States)

    Yang, Yanmei; Wang, Jinpeng; Di, Jianyong

    2013-01-01

    Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.

  20. Evolution of vertebrate central nervous system is accompanied by novel expression changes of duplicate genes.

    Science.gov (United States)

    Chen, Yuan; Ding, Yun; Zhang, Zuming; Wang, Wen; Chen, Jun-Yuan; Ueno, Naoto; Mao, Bingyu

    2011-12-20

    The evolution of the central nervous system (CNS) is one of the most striking changes during the transition from invertebrates to vertebrates. As a major source of genetic novelties, gene duplication might play an important role in the functional innovation of vertebrate CNS. In this study, we focused on a group of CNS-biased genes that duplicated during early vertebrate evolution. We investigated the tempo-spatial expression patterns of 33 duplicate gene families and their orthologs during the embryonic development of the vertebrate Xenopus laevis and the cephalochordate Brachiostoma belcheri. Almost all the identified duplicate genes are differentially expressed in the CNS in Xenopus embryos, and more than 50% and 30% duplicate genes are expressed in the telencephalon and mid-hindbrain boundary, respectively, which are mostly considered as two innovations in the vertebrate CNS. Interestingly, more than 50% of the amphioxus orthologs do not show apparent expression in the CNS in amphioxus embryos as detected by in situ hybridization, indicating that some of the vertebrate CNS-biased duplicate genes might arise from non-CNS genes in invertebrates. Our data accentuate the functional contribution of gene duplication in the CNS evolution of vertebrate and uncover an invertebrate non-CNS history for some vertebrate CNS-biased duplicate genes. Copyright © 2011. Published by Elsevier Ltd.

  1. Selective Constraints on Coding Sequences of Nervous System Genes Are a Major Determinant of Duplicate Gene Retention in Vertebrates.

    Science.gov (United States)

    Roux, Julien; Liu, Jialin; Robinson-Rechavi, Marc

    2017-11-01

    The evolutionary history of vertebrates is marked by three ancient whole-genome duplications: two successive rounds in the ancestor of vertebrates, and a third one specific to teleost fishes. Biased loss of most duplicates enriched the genome for specific genes, such as slow evolving genes, but this selective retention process is not well understood. To understand what drives the long-term preservation of duplicate genes, we characterized duplicated genes in terms of their expression patterns. We used a new method of expression enrichment analysis, TopAnat, applied to in situ hybridization data from thousands of genes from zebrafish and mouse. We showed that the presence of expression in the nervous system is a good predictor of a higher rate of retention of duplicate genes after whole-genome duplication. Further analyses suggest that purifying selection against the toxic effects of misfolded or misinteracting proteins, which is particularly strong in nonrenewing neural tissues, likely constrains the evolution of coding sequences of nervous system genes, leading indirectly to the preservation of duplicate genes after whole-genome duplication. Whole-genome duplications thus greatly contributed to the expansion of the toolkit of genes available for the evolution of profound novelties of the nervous system at the base of the vertebrate radiation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

    Science.gov (United States)

    Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

    2016-01-01

    Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

  3. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Yi-Li Li

    2017-11-01

    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  4. COGNITIVE ENDOPHENOTYPES OF MODERN AND EXTINCT HOMININS ASSOCIATED WITH NTNG GENE PARALOGS

    OpenAIRE

    Itohara, Shigeyoshi; Hashimoto, Ryota; Polygalov, Denis; Mchugh, Thomas; Zhang, Qi; Prosselkov, Pavel; Kazutaka, Ohi; Takeda, Masatoshi

    2016-01-01

    A pair of vertebrate-specific and brain-expressed pre-synaptic genes, NTNG1 and NTNG2, contributes to the Intellectual Quotient (IQ) test scores in a complementary manner. Single nucleotide polymorphisms (SNPs) of NTNG1 are associated with attenuated verbal comprehension (VC) or processing speed (PS) while NTNG2 SNPs affect working memory (WM) and perceptual organization (PO), forming cognitive endophenotypes in healthy and schizophrenia (SCZ)-affected human subjects. Regions of interest (ROI...

  5. Gene duplication and divergence affecting drug content in Cannabis sativa.

    Science.gov (United States)

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David

    2015-12-01

    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  6. Don't throw the baby out with the bathwater: identifying and mapping paralogs in salmonids.

    Science.gov (United States)

    Dufresne, France

    2016-01-01

    Many eukaryotic genomes contain a large fraction of gene duplicates (or paralogs) as a result of ancient or recent whole-genome duplications (Ohno 1970; Jaillon et al. 2004; Kellis et al. 2004). Identifying paralogs with NGS data is a pervasive problem in both ancient polyploids and neopolyploids. Likewise, paralogs are often treated as a nuisance that has to be detected and removed (Everett et al. 2012). In this issue of Molecular Ecology Resources, Waples et al. (2015) show that exclusion might not be necessary and how we may miss out on important genomic information in doing so. They present a novel statistical approach to detect paralogs based on the segregation of RAD loci in haploid offspring and test their method by constructing linkage maps with and without these duplicated loci in chum salmon, Oncorhynchus keta (Fig.1). Their linkage map including the resolved paralogs shows that these are mostly located in the distal regions of several linkage groups. Particularly intriguing is their finding that these homoeologous regions appear impoverished in transposable elements (TE). Given the role that TE play in genome remodelling, it is noteworthy that these elements are of low abundance in regions showing residual tetrasomic inheritance. This raises the question whether re-diploidization is constrained in these regions and whether they might have a role to play in salmonid speciation. This study provides an original approach to identifying duplicated loci in species with a pedigree, as well as providing a dense linkage map for chum salmon, and interesting insights into the retention of gene duplicates in an ancient polyploid. © 2015 John Wiley & Sons Ltd.

  7. Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes.

    Science.gov (United States)

    Biedler, James K; Tu, Zhijian

    2010-07-08

    The maternal zygotic transition marks the time at which transcription from the zygotic genome is initiated and a subset of maternal RNAs are progressively degraded in the developing embryo. A number of early zygotic genes have been identified in Drosophila melanogaster and comparisons to sequenced mosquito genomes suggest that some of these early zygotic genes such as bottleneck are fast-evolving or subject to turnover in dipteran insects. One objective of this study is to identify early zygotic genes from the yellow fever mosquito Aedes aegypti to study their evolution. We are also interested in obtaining early zygotic promoters that will direct transgene expression in the early embryo as part of a Medea gene drive system. Two novel early zygotic kinesin light chain genes we call AaKLC2.1 and AaKLC2.2 were identified by transcriptome sequencing of Aedes aegypti embryos at various time points. These two genes have 98% nucleotide and amino acid identity in their coding regions and show transcription confined to the early zygotic stage according to gene-specific RT-PCR analysis. These AaKLC2 genes have a paralogous gene (AaKLC1) in Ae. aegypti. Phylogenetic inference shows that an ortholog to the AaKLC2 genes is only found in the sequenced genome of Culex quinquefasciatus. In contrast, AaKLC1 gene orthologs are found in all three sequenced mosquito species including Anopheles gambiae. There is only one KLC gene in D. melanogaster and other sequenced holometabolous insects that appears to be similar to AaKLC1. Unlike AaKLC2, AaKLC1 is expressed in all life stages and tissues tested, which is consistent with the expression pattern of the An. gambiae and D. melanogaster KLC genes. Phylogenetic inference also suggests that AaKLC2 genes and their likely C. quinquefasciatus ortholog are fast-evolving genes relative to the highly conserved AaKLC1-like paralogs. Embryonic injection of a luciferase reporter under the control of a 1 kb fragment upstream of the AaKLC2.1 start

  8. Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes

    Directory of Open Access Journals (Sweden)

    Tu Zhijian

    2010-07-01

    Full Text Available Abstract Background The maternal zygotic transition marks the time at which transcription from the zygotic genome is initiated and a subset of maternal RNAs are progressively degraded in the developing embryo. A number of early zygotic genes have been identified in Drosophila melanogaster and comparisons to sequenced mosquito genomes suggest that some of these early zygotic genes such as bottleneck are fast-evolving or subject to turnover in dipteran insects. One objective of this study is to identify early zygotic genes from the yellow fever mosquito Aedes aegypti to study their evolution. We are also interested in obtaining early zygotic promoters that will direct transgene expression in the early embryo as part of a Medea gene drive system. Results Two novel early zygotic kinesin light chain genes we call AaKLC2.1 and AaKLC2.2 were identified by transcriptome sequencing of Aedes aegypti embryos at various time points. These two genes have 98% nucleotide and amino acid identity in their coding regions and show transcription confined to the early zygotic stage according to gene-specific RT-PCR analysis. These AaKLC2 genes have a paralogous gene (AaKLC1 in Ae. aegypti. Phylogenetic inference shows that an ortholog to the AaKLC2 genes is only found in the sequenced genome of Culex quinquefasciatus. In contrast, AaKLC1 gene orthologs are found in all three sequenced mosquito species including Anopheles gambiae. There is only one KLC gene in D. melanogaster and other sequenced holometabolous insects that appears to be similar to AaKLC1. Unlike AaKLC2, AaKLC1 is expressed in all life stages and tissues tested, which is consistent with the expression pattern of the An. gambiae and D. melanogaster KLC genes. Phylogenetic inference also suggests that AaKLC2 genes and their likely C. quinquefasciatus ortholog are fast-evolving genes relative to the highly conserved AaKLC1-like paralogs. Embryonic injection of a luciferase reporter under the control of a

  9. Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster

    Directory of Open Access Journals (Sweden)

    Jakobek Judy L

    2007-07-01

    Full Text Available Abstract Background The biosynthesis of aflatoxin (AF involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST and O-methylsterigmatocystin (OMST, the respective penultimate and ultimate precursors of AF. Although these precursors are chemically and structurally very similar, their accumulation differs at the species level for Aspergilli. Notable examples are A. nidulans that synthesizes only ST, A. flavus that makes predominantly AF, and A. parasiticus that generally produces either AF or OMST. Whether these differences are important in the evolutionary/ecological processes of species adaptation and diversification is unknown. Equally unknown are the specific genomic mechanisms responsible for ordering and clustering of genes in the AF pathway of Aspergillus. Results To elucidate the mechanisms that have driven formation of these clusters, we performed systematic searches of aflatoxin cluster homologs across five Aspergillus genomes. We found a high level of gene duplication and identified seven modules consisting of highly correlated gene pairs (aflA/aflB, aflR/aflS, aflX/aflY, aflF/aflE, aflT/aflQ, aflC/aflW, and aflG/aflL. With the exception of A. nomius, contrasts of mean Ka/Ks values across all cluster genes showed significant differences in selective pressure between section Flavi and non-section Flavi species. A. nomius mean Ka/Ks values were more similar to partial clusters in A. fumigatus and A. terreus. Overall, mean Ka/Ks values were significantly higher for section Flavi than for non-section Flavi species. Conclusion Our results implicate several genomic mechanisms in the evolution of ST, OMST and AF cluster genes. Gene modules may arise from duplications of a single gene, whereby the function of the pre-duplication gene is retained in the copy (aflF/aflE or the copies may partition the ancestral function (aflA/aflB. In some gene modules, the

  10. Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.

    Science.gov (United States)

    Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J

    2016-11-04

    Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types

  11. Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes

    Science.gov (United States)

    Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.

    2011-01-01

    vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289

  12. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes

    OpenAIRE

    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich

    2004-01-01

    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix–loop–helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks e...

  13. Genetic diversity and natural selection of Plasmodium knowlesi merozoite surface protein 1 paralog gene in Malaysia.

    Science.gov (United States)

    Ahmed, Md Atique; Fauzi, Muh; Han, Eun-Taek

    2018-03-14

    Human infections due to the monkey malaria parasite Plasmodium knowlesi is on the rise in most Southeast Asian countries specifically Malaysia. The C-terminal 19 kDa domain of PvMSP1P is a potential vaccine candidate, however, no study has been conducted in the orthologous gene of P. knowlesi. This study investigates level of polymorphisms, haplotypes and natural selection of full-length pkmsp1p in clinical samples from Malaysia. A total of 36 full-length pkmsp1p sequences along with the reference H-strain and 40 C-terminal pkmsp1p sequences from clinical isolates of Malaysia were downloaded from published genomes. Genetic diversity, polymorphism, haplotype and natural selection were determined using DnaSP 5.10 and MEGA 5.0 software. Genealogical relationships were determined using haplotype network tree in NETWORK software v5.0. Population genetic differentiation index (F ST ) and population structure of parasite was determined using Arlequin v3.5 and STRUCTURE v2.3.4 software. Comparison of 36 full-length pkmsp1p sequences along with the H-strain identified 339 SNPs (175 non-synonymous and 164 synonymous substitutions). The nucleotide diversity across the full-length gene was low compared to its ortholog pvmsp1p. The nucleotide diversity was higher toward the N-terminal domains (pkmsp1p-83 and 30) compared to the C-terminal domains (pkmsp1p-38, 33 and 19). Phylogenetic analysis of full-length genes identified 2 distinct clusters of P. knowlesi from Malaysian Borneo. The 40 pkmsp1p-19 sequences showed low polymorphisms with 16 polymorphisms leading to 18 haplotypes. In total there were 10 synonymous and 6 non-synonymous substitutions and 12 cysteine residues were intact within the two EGF domains. Evidence of strong purifying selection was observed within the full-length sequences as well in all the domains. Shared haplotypes of 40 pkmsp1p-19 were identified within Malaysian Borneo haplotypes. This study is the first to report on the genetic diversity and natural

  14. Prevalent Role of Gene Features in Determining Evolutionary Fates of Whole-Genome Duplication Duplicated Genes in Flowering Plants1[W][OA

    Science.gov (United States)

    Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi

    2013-01-01

    The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833

  15. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong

    2009-11-01

    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  16. Phylogenetic reconstruction of orthology, paralogy, and conserved synteny for dog and human.

    Science.gov (United States)

    Goodstadt, Leo; Ponting, Chris P

    2006-09-29

    Accurate predictions of orthology and paralogy relationships are necessary to infer human molecular function from experiments in model organisms. Previous genome-scale approaches to predicting these relationships have been limited by their use of protein similarity and their failure to take into account multiple splicing events and gene prediction errors. We have developed PhyOP, a new phylogenetic orthology prediction pipeline based on synonymous rate estimates, which accurately predicts orthology and paralogy relationships for transcripts, genes, exons, or genomic segments between closely related genomes. We were able to identify orthologue relationships to human genes for 93% of all dog genes from Ensembl. Among 1:1 orthologues, the alignments covered a median of 97.4% of protein sequences, and 92% of orthologues shared essentially identical gene structures. PhyOP accurately recapitulated genomic maps of conserved synteny. Benchmarking against predictions from Ensembl and Inparanoid showed that PhyOP is more accurate, especially in its predictions of paralogy. Nearly half (46%) of PhyOP paralogy predictions are unique. Using PhyOP to investigate orthologues and paralogues in the human and dog genomes, we found that the human assembly contains 3-fold more gene duplications than the dog. Species-specific duplicate genes, or "in-paralogues," are generally shorter and have fewer exons than 1:1 orthologues, which is consistent with selective constraints and mutation biases based on the sizes of duplicated genes. In-paralogues have experienced elevated amino acid and synonymous nucleotide substitution rates. Duplicates possess similar biological functions for either the dog or human lineages. Having accounted for 2,954 likely pseudogenes and gene fragments, and after separating 346 erroneously merged genes, we estimated that the human genome encodes a minimum of 19,700 protein-coding genes, similar to the gene count of nematode worms. PhyOP is a fast and robust

  17. Phylogenetic reconstruction of orthology, paralogy, and conserved synteny for dog and human.

    Directory of Open Access Journals (Sweden)

    Leo Goodstadt

    2006-09-01

    Full Text Available Accurate predictions of orthology and paralogy relationships are necessary to infer human molecular function from experiments in model organisms. Previous genome-scale approaches to predicting these relationships have been limited by their use of protein similarity and their failure to take into account multiple splicing events and gene prediction errors. We have developed PhyOP, a new phylogenetic orthology prediction pipeline based on synonymous rate estimates, which accurately predicts orthology and paralogy relationships for transcripts, genes, exons, or genomic segments between closely related genomes. We were able to identify orthologue relationships to human genes for 93% of all dog genes from Ensembl. Among 1:1 orthologues, the alignments covered a median of 97.4% of protein sequences, and 92% of orthologues shared essentially identical gene structures. PhyOP accurately recapitulated genomic maps of conserved synteny. Benchmarking against predictions from Ensembl and Inparanoid showed that PhyOP is more accurate, especially in its predictions of paralogy. Nearly half (46% of PhyOP paralogy predictions are unique. Using PhyOP to investigate orthologues and paralogues in the human and dog genomes, we found that the human assembly contains 3-fold more gene duplications than the dog. Species-specific duplicate genes, or "in-paralogues," are generally shorter and have fewer exons than 1:1 orthologues, which is consistent with selective constraints and mutation biases based on the sizes of duplicated genes. In-paralogues have experienced elevated amino acid and synonymous nucleotide substitution rates. Duplicates possess similar biological functions for either the dog or human lineages. Having accounted for 2,954 likely pseudogenes and gene fragments, and after separating 346 erroneously merged genes, we estimated that the human genome encodes a minimum of 19,700 protein-coding genes, similar to the gene count of nematode worms. PhyOP is a

  18. Highly divergent 18S rRNA gene paralogs in a Cryptosporidium genotype from eastern chipmunks (Tamias striatus)

    Czech Academy of Sciences Publication Activity Database

    Stenger, B.L.S.; Clark, M.E.; Kváč, Martin; Khan, E.; Giddings, C.W.; Dyer, N.W.; Schultz, J.L.; McEvoy, J.M.

    2015-01-01

    Roč. 32, JUN 2015 (2015), s. 113-123 ISSN 1567-1348 R&D Projects: GA MŠk(CZ) LH11061 Institutional support: RVO:60077344 Keywords : Cryptosporidium * Paralogy * 18S rRNA * 18S rDNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 2.591, year: 2015

  19. Genome-wide identification and comparative expression analysis reveal a rapid expansion and functional divergence of duplicated genes in the WRKY gene family of cabbage, Brassica oleracea var. capitata.

    Science.gov (United States)

    Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi

    2015-02-15

    WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. The prevalence of gene duplications and their ancient origin in Rhodobacter sphaeroides 2.4.1

    Directory of Open Access Journals (Sweden)

    Cho Hyuk

    2010-12-01

    Full Text Available Abstract Background Rhodobacter sphaeroides 2.4.1 is a metabolically versatile organism that belongs to α-3 subdivision of Proteobacteria. The present study was to identify the extent, history, and role of gene duplications in R. sphaeroides 2.4.1, an organism that possesses two chromosomes. Results A protein similarity search (BLASTP identified 1247 orfs (~29.4% of the total protein coding orfs that are present in 2 or more copies, 37.5% (234 gene-pairs of which exist in duplicate copies. The distribution of the duplicate gene-pairs in all Clusters of Orthologous Groups (COGs differed significantly when compared to the COG distribution across the whole genome. Location plots revealed clusters of gene duplications that possessed the same COG classification. Phylogenetic analyses were performed to determine a tree topology predicting either a Type-A or Type-B phylogenetic relationship. A Type-A phylogenetic relationship shows that a copy of the protein-pair matches more with an ortholog from a species closely related to R. sphaeroides while a Type-B relationship predicts the highest match between both copies of the R. sphaeroides protein-pair. The results revealed that ~77% of the proteins exhibited a Type-A phylogenetic relationship demonstrating the ancient origin of these gene duplications. Additional analyses on three other strains of R. sphaeroides revealed varying levels of gene loss and retention in these strains. Also, analyses on common gene pairs among the four strains revealed that these genes experience similar functional constraints and undergo purifying selection. Conclusions Although the results suggest that the level of gene duplication in organisms with complex genome structuring (more than one chromosome seems to be not markedly different from that in organisms with only a single chromosome, these duplications may have aided in genome reorganization in this group of eubacteria prior to the formation of R. sphaeroides as gene

  1. Restriction and Recruitment—Gene Duplication and the Origin and Evolution of Snake Venom Toxins

    Science.gov (United States)

    Hargreaves, Adam D.; Swain, Martin T.; Hegarty, Matthew J.; Logan, Darren W.; Mulley, John F.

    2014-01-01

    Snake venom has been hypothesized to have originated and diversified through a process that involves duplication of genes encoding body proteins with subsequent recruitment of the copy to the venom gland, where natural selection acts to develop or increase toxicity. However, gene duplication is known to be a rare event in vertebrate genomes, and the recruitment of duplicated genes to a novel expression domain (neofunctionalization) is an even rarer process that requires the evolution of novel combinations of transcription factor binding sites in upstream regulatory regions. Therefore, although this hypothesis concerning the evolution of snake venom is very unlikely and should be regarded with caution, it is nonetheless often assumed to be established fact, hindering research into the true origins of snake venom toxins. To critically evaluate this hypothesis, we have generated transcriptomic data for body tissues and salivary and venom glands from five species of venomous and nonvenomous reptiles. Our comparative transcriptomic analysis of these data reveals that snake venom does not evolve through the hypothesized process of duplication and recruitment of genes encoding body proteins. Indeed, our results show that many proposed venom toxins are in fact expressed in a wide variety of body tissues, including the salivary gland of nonvenomous reptiles and that these genes have therefore been restricted to the venom gland following duplication, not recruited. Thus, snake venom evolves through the duplication and subfunctionalization of genes encoding existing salivary proteins. These results highlight the danger of the elegant and intuitive “just-so story” in evolutionary biology. PMID:25079342

  2. The enrichment of TATA box and the scarcity of depleted proximal nucleosome in the promoters of duplicated yeast genes.

    Science.gov (United States)

    Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A

    2010-01-01

    Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.

  3. An exceptional horizontal gene transfer in plastids: gene replacement by a distant bacterial paralog and evidence that haptophyte and cryptophyte plastids are sisters

    Directory of Open Access Journals (Sweden)

    Palmer Jeffrey D

    2006-09-01

    Full Text Available Abstract Background Horizontal gene transfer (HGT to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts, where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and

  4. An exceptional horizontal gene transfer in plastids: gene replacement by a distant bacterial paralog and evidence that haptophyte and cryptophyte plastids are sisters

    Science.gov (United States)

    Rice, Danny W; Palmer, Jeffrey D

    2006-01-01

    Background Horizontal gene transfer (HGT) to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts), where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and cryptophyte plastids to the

  5. Computational Identification of the Paralogs and Orthologs of Human Cytochrome P450 Superfamily and the Implication in Drug Discovery

    Directory of Open Access Journals (Sweden)

    Shu-Ting Pan

    2016-06-01

    Full Text Available The human cytochrome P450 (CYP superfamily consisting of 57 functional genes is the most important group of Phase I drug metabolizing enzymes that oxidize a large number of xenobiotics and endogenous compounds, including therapeutic drugs and environmental toxicants. The CYP superfamily has been shown to expand itself through gene duplication, and some of them become pseudogenes due to gene mutations. Orthologs and paralogs are homologous genes resulting from speciation or duplication, respectively. To explore the evolutionary and functional relationships of human CYPs, we conducted this bioinformatic study to identify their corresponding paralogs, homologs, and orthologs. The functional implications and implications in drug discovery and evolutionary biology were then discussed. GeneCards and Ensembl were used to identify the paralogs of human CYPs. We have used a panel of online databases to identify the orthologs of human CYP genes: NCBI, Ensembl Compara, GeneCards, OMA (“Orthologous MAtrix” Browser, PATHER, TreeFam, EggNOG, and Roundup. The results show that each human CYP has various numbers of paralogs and orthologs using GeneCards and Ensembl. For example, the paralogs of CYP2A6 include CYP2A7, 2A13, 2B6, 2C8, 2C9, 2C18, 2C19, 2D6, 2E1, 2F1, 2J2, 2R1, 2S1, 2U1, and 2W1; CYP11A1 has 6 paralogs including CYP11B1, 11B2, 24A1, 27A1, 27B1, and 27C1; CYP51A1 has only three paralogs: CYP26A1, 26B1, and 26C1; while CYP20A1 has no paralog. The majority of human CYPs are well conserved from plants, amphibians, fishes, or mammals to humans due to their important functions in physiology and xenobiotic disposition. The data from different approaches are also cross-validated and validated when experimental data are available. These findings facilitate our understanding of the evolutionary relationships and functional implications of the human CYP superfamily in drug discovery.

  6. Properties of Sequence Conservation in Upstream Regulatory and Protein Coding Sequences among Paralogs in Arabidopsis thaliana

    Science.gov (United States)

    Richardson, Dale N.; Wiehe, Thomas

    Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.

  7. Horizontal transfer, not duplication, drives the expansion of protein families in prokaryotes.

    Directory of Open Access Journals (Sweden)

    Todd J Treangen

    2011-01-01

    Full Text Available Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus, average-sized genomes (Bacillus, Enterobacteriaceae, and large genomes (Pseudomonas, Bradyrhizobiaceae to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes--xenologs--persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes--paralogs--are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein-protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families.

  8. Evolution dynamics of a model for gene duplication under adaptive conflict

    Science.gov (United States)

    Ancliff, Mark; Park, Jeong-Man

    2014-06-01

    We present and solve the dynamics of a model for gene duplication showing escape from adaptive conflict. We use a Crow-Kimura quasispecies model of evolution where the fitness landscape is a function of Hamming distances from two reference sequences, which are assumed to optimize two different gene functions, to describe the dynamics of a mixed population of individuals with single and double copies of a pleiotropic gene. The evolution equations are solved through a spin coherent state path integral, and we find two phases: one is an escape from an adaptive conflict phase, where each copy of a duplicated gene evolves toward subfunctionalization, and the other is a duplication loss of function phase, where one copy maintains its pleiotropic form and the other copy undergoes neutral mutation. The phase is determined by a competition between the fitness benefits of subfunctionalization and the greater mutational load associated with maintaining two gene copies. In the escape phase, we find a dynamics of an initial population of single gene sequences only which escape adaptive conflict through gene duplication and find that there are two time regimes: until a time t* single gene sequences dominate, and after t* double gene sequences outgrow single gene sequences. The time t* is identified as the time necessary for subfunctionalization to evolve and spread throughout the double gene sequences, and we show that there is an optimum mutation rate which minimizes this time scale.

  9. Identification of Ohnolog Genes Originating from Whole Genome Duplication in Early Vertebrates, Based on Synteny Comparison across Multiple Genomes.

    Science.gov (United States)

    Singh, Param Priya; Arora, Jatin; Isambert, Hervé

    2015-07-01

    Whole genome duplications (WGD) have now been firmly established in all major eukaryotic kingdoms. In particular, all vertebrates descend from two rounds of WGDs, that occurred in their jawless ancestor some 500 MY ago. Paralogs retained from WGD, also coined 'ohnologs' after Susumu Ohno, have been shown to be typically associated with development, signaling and gene regulation. Ohnologs, which amount to about 20 to 35% of genes in the human genome, have also been shown to be prone to dominant deleterious mutations and frequently implicated in cancer and genetic diseases. Hence, identifying ohnologs is central to better understand the evolution of vertebrates and their susceptibility to genetic diseases. Early computational analyses to identify vertebrate ohnologs relied on content-based synteny comparisons between the human genome and a single invertebrate outgroup genome or within the human genome itself. These approaches are thus limited by lineage specific rearrangements in individual genomes. We report, in this study, the identification of vertebrate ohnologs based on the quantitative assessment and integration of synteny conservation between six amniote vertebrates and six invertebrate outgroups. Such a synteny comparison across multiple genomes is shown to enhance the statistical power of ohnolog identification in vertebrates compared to earlier approaches, by overcoming lineage specific genome rearrangements. Ohnolog gene families can be browsed and downloaded for three statistical confidence levels or recompiled for specific, user-defined, significance criteria at http://ohnologs.curie.fr/. In the light of the importance of WGD on the genetic makeup of vertebrates, our analysis provides a useful resource for researchers interested in gaining further insights on vertebrate evolution and genetic diseases.

  10. A survey of innovation through duplication in the reduced genomes of twelve parasites.

    Directory of Open Access Journals (Sweden)

    Jeremy D DeBarry

    Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that

  11. Functional evolution of a multigene family: orthologous and paralogous pheromone receptor genes in the turnip moth, Agrotis segetum.

    Directory of Open Access Journals (Sweden)

    Dan-Dan Zhang

    Full Text Available Lepidopteran pheromone receptors (PRs, for which orthologies are evident among closely related species, provide an intriguing example of gene family evolution in terms of how new functions may arise. However, only a limited number of PRs have been functionally characterized so far and thus evolutionary scenarios suffer from elements of speculation. In this study we investigated the turnip moth Agrotis segetum, in which female moths produce a mixture of chemically related pheromone components that elicit specific responses from receptor cells on male antennae. We cloned nine A. segetum PR genes and the Orco gene by degenerate primer based RT-PCR. The nine PR genes, named as AsegOR1 and AsegOR3-10, fall into four distinct orthologous clusters of known lepidopteran PRs, of which one contains six paralogues. The paralogues are under relaxed selective pressure, contrasting with the purifying selection on other clusters. We identified the receptors AsegOR9, AsegOR4 and AsegOR5, specific for the respective homologous pheromone components (Z-5-decenyl, (Z-7-dodecenyl and (Z-9-tetradecenyl acetates, by two-electrode voltage clamp recording from Xenopus laevis oocytes co-expressing Orco and each PR candidate. These receptors occur in three different orthologous clusters. We also found that the six paralogues with high sequence similarity vary dramatically in ligand selectivity and sensitivity. Different from AsegOR9, AsegOR6 showed a relatively large response to the behavioural antagonist (Z-5-decenol, and a small response to (Z-5-decenyl acetate. AsegOR1 was broadly tuned, but most responsive to (Z-5-decenyl acetate, (Z-7-dodecenyl acetate and the behavioural antagonist (Z-8-dodecenyl acetate. AsegOR8 and AsegOR7, which differ from AsegOR6 and AsegOR1 by 7 and 10 aa respectively, showed much lower sensitivities. AsegOR10 showed only small responses to all the tested compounds. These results suggest that new receptors arise through gene duplication, and

  12. Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures

    Directory of Open Access Journals (Sweden)

    Kesterson Robert A

    2003-04-01

    Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.

  13. Differential transcriptional modulation of duplicated fatty acid-binding protein genes by dietary fatty acids in zebrafish (Danio rerio: evidence for subfunctionalization or neofunctionalization of duplicated genes

    Directory of Open Access Journals (Sweden)

    Denovan-Wright Eileen M

    2009-09-01

    Full Text Available Abstract Background In the Duplication-Degeneration-Complementation (DDC model, subfunctionalization and neofunctionalization have been proposed as important processes driving the retention of duplicated genes in the genome. These processes are thought to occur by gain or loss of regulatory elements in the promoters of duplicated genes. We tested the DDC model by determining the transcriptional induction of fatty acid-binding proteins (Fabps genes by dietary fatty acids (FAs in zebrafish. We chose zebrafish for this study for two reasons: extensive bioinformatics resources are available for zebrafish at zfin.org and zebrafish contains many duplicated genes owing to a whole genome duplication event that occurred early in the ray-finned fish lineage approximately 230-400 million years ago. Adult zebrafish were fed diets containing either fish oil (12% lipid, rich in highly unsaturated fatty acid, sunflower oil (12% lipid, rich in linoleic acid, linseed oil (12% lipid, rich in linolenic acid, or low fat (4% lipid, low fat diet for 10 weeks. FA profiles and the steady-state levels of fabp mRNA and heterogeneous nuclear RNA in intestine, liver, muscle and brain of zebrafish were determined. Result FA profiles assayed by gas chromatography differed in the intestine, brain, muscle and liver depending on diet. The steady-state level of mRNA for three sets of duplicated genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, and fabp11a/fabp11b, was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. In brain, the steady-state level of fabp7b mRNAs was induced in fish fed the linoleic acid-rich diet; in intestine, the transcript level of fabp1b.1 and fabp7b were elevated in fish fed the linolenic acid-rich diet; in liver, the level of fabp7a mRNAs was elevated in fish fed the low fat diet; and in muscle, the level of fabp7a and fabp11a mRNAs were elevated in fish fed the linolenic acid-rich or the low fat diets. In all cases

  14. Independent Origin and Global Distribution of Distinct Plasmodium vivax Duffy Binding Protein Gene Duplications.

    Directory of Open Access Journals (Sweden)

    Jessica B Hostetler

    2016-10-01

    Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.

  15. Rapid sequence divergence rates in the 5 prime regulatory regions of young Drosophila melanogaster duplicate gene pairs

    Directory of Open Access Journals (Sweden)

    Michael H. Kohn

    2008-01-01

    Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.

  16. On the Complexity of Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

    Science.gov (United States)

    Kordi, Misagh; Bansal, Mukul S

    2017-01-01

    Duplication-Transfer-Loss (DTL) reconciliation has emerged as a powerful technique for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation takes as input a gene family phylogeny and the corresponding species phylogeny, and reconciles the two by postulating speciation, gene duplication, horizontal gene transfer, and gene loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. However, gene trees are frequently non-binary. With such non-binary gene trees, the reconciliation problem seeks to find a binary resolution of the gene tree that minimizes the reconciliation cost. Given the prevalence of non-binary gene trees, many efficient algorithms have been developed for this problem in the context of the simpler Duplication-Loss (DL) reconciliation model. Yet, no efficient algorithms exist for DTL reconciliation with non-binary gene trees and the complexity of the problem remains unknown. In this work, we resolve this open question by showing that the problem is, in fact, NP-hard. Our reduction applies to both the dated and undated formulations of DTL reconciliation. By resolving this long-standing open problem, this work will spur the development of both exact and heuristic algorithms for this important problem.

  17. Duplication and relocation of the functional DPY19L2 gene within low copy repeats

    Directory of Open Access Journals (Sweden)

    Cheung Joseph

    2006-03-01

    Full Text Available Abstract Background Low copy repeats (LCRs are thought to play an important role in recent gene evolution, especially when they facilitate gene duplications. Duplicate genes are fundamental to adaptive evolution, providing substrates for the development of new or shared gene functions. Moreover, silencing of duplicate genes can have an indirect effect on adaptive evolution by causing genomic relocation of functional genes. These changes are theorized to have been a major factor in speciation. Results Here we present a novel example showing functional gene relocation within a LCR. We characterize the genomic structure and gene content of eight related LCRs on human Chromosomes 7 and 12. Two members of a novel transmembrane gene family, DPY19L, were identified in these regions, along with six transcribed pseudogenes. One of these genes, DPY19L2, is found on Chromosome 12 and is not syntenic with its mouse orthologue. Instead, the human locus syntenic to mouse Dpy19l2 contains a pseudogene, DPY19L2P1. This indicates that the ancestral copy of this gene has been silenced, while the descendant copy has remained active. Thus, the functional copy of this gene has been relocated to a new genomic locus. We then describe the expansion and evolution of the DPY19L gene family from a single gene found in invertebrate animals. Ancient duplications have led to multiple homologues in different lineages, with three in fish, frogs and birds and four in mammals. Conclusion Our results show that the DPY19L family has expanded throughout the vertebrate lineage and has undergone recent primate-specific evolution within LCRs.

  18. Duplication and diversification of the hypoxia-inducible IGFBP-1 gene in zebrafish.

    Directory of Open Access Journals (Sweden)

    Hiroyasu Kamei

    2008-08-01

    Full Text Available Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenability to genetic and experimental manipulation and because it possess a large number of duplicated genes.We report the identification and characterization of two hypoxia-inducible genes in zebrafish that are co-ortholgs of human IGF binding protein-1 (IGFBP-1. IGFBP-1 is a secreted protein that binds to IGF and modulates IGF actions in somatic growth, development, and aging. Like their human and mouse counterparts, in adult zebrafish igfbp-1a and igfbp-1b are exclusively expressed in the liver. During embryogenesis, the two genes are expressed in overlapping spatial domains but with distinct temporal patterns. While zebrafish IGFBP-1a mRNA was easily detected throughout embryogenesis, IGFBP-1b mRNA was detectable only in advanced stages. Hypoxia induces igfbp-1a expression in early embryogenesis, but induces the igfbp-1b expression later in embryogenesis. Both IGFBP-1a and -b are capable of IGF binding, but IGFBP-1b has much lower affinities for IGF-I and -II because of greater dissociation rates. Overexpression of IGFBP-1a and -1b in zebrafish embryos caused significant decreases in growth and developmental rates. When tested in cultured zebrafish embryonic cells, IGFBP-1a and -1b both inhibited IGF-1-induced cell proliferation but the activity of IGFBP-1b was significantly weaker.These results indicate subfunction partitioning of the duplicated IGFBP-1 genes at the levels of gene expression, physiological regulation, protein structure, and biological actions. The duplicated IGFBP-1 may provide additional flexibility in fine-tuning IGF signaling activities under hypoxia and other catabolic conditions.

  19. Gene Duplication and Gene Expression Changes Play a Role in the Evolution of Candidate Pollen Feeding Genes in Heliconius Butterflies.

    Science.gov (United States)

    Smith, Gilbert; Macias-Muñoz, Aide; Briscoe, Adriana D

    2016-09-02

    Heliconius possess a unique ability among butterflies to feed on pollen. Pollen feeding significantly extends their lifespan, and is thought to have been important to the diversification of the genus. We used RNA sequencing to examine feeding-related gene expression in the mouthparts of four species of Heliconius and one nonpollen feeding species, Eueides isabella We hypothesized that genes involved in morphology and protein metabolism might be upregulated in Heliconius because they have longer proboscides than Eueides, and because pollen contains more protein than nectar. Using de novo transcriptome assemblies, we tested these hypotheses by comparing gene expression in mouthparts against antennae and legs. We first looked for genes upregulated in mouthparts across all five species and discovered several hundred genes, many of which had functional annotations involving metabolism of proteins (cocoonase), lipids, and carbohydrates. We then looked specifically within Heliconius where we found eleven common upregulated genes with roles in morphology (CPR cuticle proteins), behavior (takeout-like), and metabolism (luciferase-like). Closer examination of these candidates revealed that cocoonase underwent several duplications along the lineage leading to heliconiine butterflies, including two Heliconius-specific duplications. Luciferase-like genes also underwent duplication within lepidopterans, and upregulation in Heliconius mouthparts. Reverse-transcription PCR confirmed that three cocoonases, a peptidase, and one luciferase-like gene are expressed in the proboscis with little to no expression in labial palps and salivary glands. Our results suggest pollen feeding, like other dietary specializations, was likely facilitated by adaptive expansions of preexisting genes-and that the butterfly proboscis is involved in digestive enzyme production. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G

    2014-01-01

    Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  1. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Directory of Open Access Journals (Sweden)

    Jill C Preston

    Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  2. Zebrafish IGF genes: gene duplication, conservation and divergence, and novel roles in midline and notochord development.

    Directory of Open Access Journals (Sweden)

    Shuming Zou

    Full Text Available Insulin-like growth factors (IGFs are key regulators of development, growth, and longevity. In most vertebrate species including humans, there is one IGF-1 gene and one IGF-2 gene. Here we report the identification and functional characterization of 4 distinct IGF genes (termed as igf-1a, -1b, -2a, and -2b in zebrafish. These genes encode 4 structurally distinct and functional IGF peptides. IGF-1a and IGF-2a mRNAs were detected in multiple tissues in adult fish. IGF-1b mRNA was detected only in the gonad and IGF-2b mRNA only in the liver. Functional analysis showed that all 4 IGFs caused similar developmental defects but with different potencies. Many of these embryos had fully or partially duplicated notochords, suggesting that an excess of IGF signaling causes defects in the midline formation and an expansion of the notochord. IGF-2a, the most potent IGF, was analyzed in depth. IGF-2a expression caused defects in the midline formation and expansion of the notochord but it did not alter the anterior neural patterning. These results not only provide new insights into the functional conservation and divergence of the multiple igf genes but also reveal a novel role of IGF signaling in midline formation and notochord development in a vertebrate model.

  3. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    ers were developed, and the 1990s, when genome sequenc- ing became ... transposed gene copies have been maintained in the human genome over the past 63 ..... competent artificial chromosome (TAC) libraries as the pri- mary substrates ...

  4. Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals.

    Science.gov (United States)

    Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C

    2008-02-12

    The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.

  5. Segmental Duplication, Microinversion, and Gene Loss Associated with a Complex Inversion Breakpoint Region in Drosophila

    Science.gov (United States)

    Calvete, Oriol; González, Josefa; Betrán, Esther; Ruiz, Alfredo

    2012-01-01

    Chromosomal inversions are usually portrayed as simple two-breakpoint rearrangements changing gene order but not gene number or structure. However, increasing evidence suggests that inversion breakpoints may often have a complex structure and entail gene duplications with potential functional consequences. Here, we used a combination of different techniques to investigate the breakpoint structure and the functional consequences of a complex rearrangement fixed in Drosophila buzzatii and comprising two tandemly arranged inversions sharing the middle breakpoint: 2m and 2n. By comparing the sequence in the breakpoint regions between D. buzzatii (inverted chromosome) and D. mojavensis (noninverted chromosome), we corroborate the breakpoint reuse at the molecular level and infer that inversion 2m was associated with a duplication of a ∼13 kb segment and likely generated by staggered breaks plus repair by nonhomologous end joining. The duplicated segment contained the gene CG4673, involved in nuclear transport, and its two nested genes CG5071 and CG5079. Interestingly, we found that other than the inversion and the associated duplication, both breakpoints suffered additional rearrangements, that is, the proximal breakpoint experienced a microinversion event associated at both ends with a 121-bp long duplication that contains a promoter. As a consequence of all these different rearrangements, CG5079 has been lost from the genome, CG5071 is now a single copy nonnested gene, and CG4673 has a transcript ∼9 kb shorter and seems to have acquired a more complex gene regulation. Our results illustrate the complex effects of chromosomal rearrangements and highlight the need of complementing genomic approaches with detailed sequence-level and functional analyses of breakpoint regions if we are to fully understand genome structure, function, and evolutionary dynamics. PMID:22328714

  6. Exact Algorithms for Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

    Science.gov (United States)

    Kordi, Misagh; Bansal, Mukul S

    2017-06-01

    Duplication-Transfer-Loss (DTL) reconciliation is a powerful method for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation seeks to reconcile gene trees with species trees by postulating speciation, duplication, transfer, and loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. In practice, however, gene trees are often non-binary due to uncertainty in the gene tree topologies, and DTL reconciliation with non-binary gene trees is known to be NP-hard. In this paper, we present the first exact algorithms for DTL reconciliation with non-binary gene trees. Specifically, we (i) show that the DTL reconciliation problem for non-binary gene trees is fixed-parameter tractable in the maximum degree of the gene tree, (ii) present an exponential-time, but in-practice efficient, algorithm to track and enumerate all optimal binary resolutions of a non-binary input gene tree, and (iii) apply our algorithms to a large empirical data set of over 4700 gene trees from 100 species to study the impact of gene tree uncertainty on DTL-reconciliation and to demonstrate the applicability and utility of our algorithms. The new techniques and algorithms introduced in this paper will help biologists avoid incorrect evolutionary inferences caused by gene tree uncertainty.

  7. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

    1996-07-01

    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  8. Orthology and paralogy constraints: satisfiability and consistency

    OpenAIRE

    Lafond, Manuel; El-Mabrouk, Nadia

    2014-01-01

    Background A variety of methods based on sequence similarity, reconciliation, synteny or functional characteristics, can be used to infer orthology and paralogy relations between genes of a given gene family   G . But is a given set   C of orthology/paralogy constraints possible, i.e., can they simultaneously co-exist in an evolutionary history for   G ? While previous studies have focused on full sets of constraints, here we consider the general case where   C does not necessarily involve a ...

  9. Multiplex Ligation-dependent Probe Amplification Identification of Deletions and Duplications of the Duchenne Muscular Dystrophy Gene in Taiwanese Subjects

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2007-05-01

    Conclusion: MLPA was proven to be a powerful tool for the detection of DMD gene deletions and duplications in male patients and female carriers. There was a relatively lower frequency of deletion and a higher frequency of duplication of DMD gene in this population compared to previous reports.

  10. Ascorbate peroxidase-related (APx-R) is not a duplicable gene.

    Science.gov (United States)

    Dunand, Christophe; Mathé, Catherine; Lazzarotto, Fernanda; Margis, Rogério; Margis-Pinheiro, Marcia

    2011-12-01

    Phylogenetic, genomic and functional analyses have allowed the identification of a new class of putative heme peroxidases, so called APx-R (APx-Related). These new class, mainly present in the green lineage (including green algae and land plants), can also be detected in other unicellular chloroplastic organisms. Except for recent polyploid organisms, only single-copy of APx-R gene was detected in each genome, suggesting that the majority of the APx-R extra-copies were lost after chromosomal or segmental duplications. In a similar way, most APx-R co-expressed genes in Arabidopsis genome do not have conserved extra-copies after chromosomal duplications and are predicted to be localized in organelles, as are the APx-R. The member of this gene network can be considered as unique gene, well conserved through the evolution due to a strong negative selection pressure and a low evolution rate. © 2011 Landes Bioscience

  11. A single enhancer regulating the differential expression of duplicated red-sensitive opsin genes in zebrafish.

    Directory of Open Access Journals (Sweden)

    Taro Tsujimura

    2010-12-01

    Full Text Available A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC clones encompassing the two genes and identified a 0.6-kb "LWS-activating region" (LAR upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins.

  12. Polytomy refinement for the correction of dubious duplications in gene trees.

    Science.gov (United States)

    Lafond, Manuel; Chauve, Cedric; Dondi, Riccardo; El-Mabrouk, Nadia

    2014-09-01

    Large-scale methods for inferring gene trees are error-prone. Correcting gene trees for weakly supported features often results in non-binary trees, i.e. trees with polytomies, thus raising the natural question of refining such polytomies into binary trees. A feature pointing toward potential errors in gene trees are duplications that are not supported by the presence of multiple gene copies. We introduce the problem of refining polytomies in a gene tree while minimizing the number of created non-apparent duplications in the resulting tree. We show that this problem can be described as a graph-theoretical optimization problem. We provide a bounded heuristic with guaranteed optimality for well-characterized instances. We apply our algorithm to a set of ray-finned fish gene trees from the Ensembl database to illustrate its ability to correct dubious duplications. The C++ source code for the algorithms and simulations described in the article are available at http://www-ens.iro.umontreal.ca/~lafonman/software.php. Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press.

  13. Targeted Exon Skipping to Correct Exon Duplications in the Dystrophin Gene

    Directory of Open Access Journals (Sweden)

    Kane L Greer

    2014-01-01

    Full Text Available Duchenne muscular dystrophy is a severe muscle-wasting disease caused by mutations in the dystrophin gene that ablate functional protein expression. Although exonic deletions are the most common Duchenne muscular dystrophy lesion, duplications account for 10–15% of reported disease-causing mutations, and exon 2 is the most commonly duplicated exon. Here, we describe the in vitro evaluation of phosphorodiamidate morpholino oligomers coupled to a cell-penetrating peptide and 2′-O-methyl phosphorothioate oligonucleotides, using three distinct strategies to reframe the dystrophin transcript in patient cells carrying an exon 2 duplication. Differences in exon-skipping efficiencies in vitro were observed between oligomer analogues of the same sequence, with the phosphorodiamidate morpholino oligomer coupled to a cell-penetrating peptide proving the most effective. Differences in exon 2 excision efficiency between normal and exon 2 duplication cells, were apparent, indicating that exon context influences oligomer-induced splice switching. Skipping of a single copy of exon 2 was induced in the cells carrying an exon 2 duplication, the simplest strategy to restore the reading frame and generate a normal dystrophin transcript. In contrast, multiexon skipping of exons 2–7 to generate a Becker muscular dystrophy-like dystrophin transcript was more challenging and could only be induced efficiently with the phosphorodiamidate morpholino oligomer chemistry.

  14. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Science.gov (United States)

    Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.

  15. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Directory of Open Access Journals (Sweden)

    Olga V Popova

    Full Text Available Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida and Pycnophyes kielensis (Allomalorhagida. Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even

  16. Microevolution of Duplications and Deletions and Their Impact on Gene Expression in the Nematode Pristionchus pacificus.

    Directory of Open Access Journals (Sweden)

    Praveen Baskaran

    Full Text Available The evolution of diversity across the animal kingdom has been accompanied by tremendous gene loss and gain. While comparative genomics has been fruitful to characterize differences in gene content across highly diverged species, little is known about the microevolution of structural variations that cause these differences in the first place. In order to investigate the genomic impact of structural variations, we made use of genomic and transcriptomic data from the nematode Pristionchus pacificus, which has been established as a satellite model to Caenorhabditis elegans for comparative biology. We exploit the fact that P. pacificus is a highly diverse species for which various genomic data including the draft genome of a sister species P. exspectatus is available. Based on resequencing coverage data for two natural isolates we identified large (> 2 kb deletions and duplications relative to the reference strain. By restriction to completely syntenic regions between P. pacificus and P. exspectatus, we were able to polarize the comparison and to assess the impact of structural variations on expression levels. We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. Further investigating expression of individual copies at sites that segregate between the duplicates, we found in the majority of cases only one of the copies to be expressed. Nevertheless, we still find that certain gene classes are strongly depleted in deletions as well as duplications, suggesting evolutionary constraint acting on synteny. In summary, our results are consistent with a model, where most structural variations are either deleterious or neutral and provide first insights into the microevolution of structural variations in the P. pacificus genome.

  17. Concomitant duplications of opioid peptide and receptor genes before the origin of jawed vertebrates.

    Directory of Open Access Journals (Sweden)

    Görel Sundström

    Full Text Available BACKGROUND: The opioid system is involved in reward and pain mechanisms and consists in mammals of four receptors and several peptides. The peptides are derived from four prepropeptide genes, PENK, PDYN, PNOC and POMC, encoding enkephalins, dynorphins, orphanin/nociceptin and beta-endorphin, respectively. Previously we have described how two rounds of genome doubling (2R before the origin of jawed vertebrates formed the receptor family. METHODOLOGY/PRINCIPAL FINDINGS: Opioid peptide gene family members were investigated using a combination of sequence-based phylogeny and chromosomal locations of the peptide genes in various vertebrates. Several adjacent gene families were investigated similarly. The results show that the ancestral peptide gene gave rise to two additional copies in the genome doublings. The fourth member was generated by a local gene duplication, as the genes encoding POMC and PNOC are located on the same chromosome in the chicken genome and all three teleost genomes that we have studied. A translocation has disrupted this synteny in mammals. The PDYN gene seems to have been lost in chicken, but not in zebra finch. Duplicates of some peptide genes have arisen in the teleost fishes. Within the prepropeptide precursors, peptides have been lost or gained in different lineages. CONCLUSIONS/SIGNIFICANCE: The ancestral peptide and receptor genes were located on the same chromosome and were thus duplicated concomitantly. However, subsequently genetic linkage has been lost. In conclusion, the system of opioid peptides and receptors was largely formed by the genome doublings that took place early in vertebrate evolution.

  18. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Science.gov (United States)

    Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-07-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  19. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Directory of Open Access Journals (Sweden)

    Philippe Ganot

    2011-07-01

    Full Text Available Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion, which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones or aposymbiotic (also called bleached A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm. A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both

  20. The evolution of pepsinogen C genes in vertebrates: duplication, loss and functional diversification.

    Directory of Open Access Journals (Sweden)

    Luís Filipe Costa Castro

    Full Text Available BACKGROUND: Aspartic proteases comprise a large group of enzymes involved in peptide proteolysis. This collection includes prominent enzymes globally categorized as pepsins, which are derived from pepsinogen precursors. Pepsins are involved in gastric digestion, a hallmark of vertebrate physiology. An important member among the pepsinogens is pepsinogen C (Pgc. A particular aspect of Pgc is its apparent single copy status, which contrasts with the numerous gene copies found for example in pepsinogen A (Pga. Although gene sequences with similarity to Pgc have been described in some vertebrate groups, no exhaustive evolutionary framework has been considered so far. METHODOLOGY/PRINCIPAL FINDINGS: By combining phylogenetics and genomic analysis, we find an unexpected Pgc diversity in the vertebrate sub-phylum. We were able to reconstruct gene duplication timings relative to the divergence of major vertebrate clades. Before tetrapod divergence, a single Pgc gene tandemly expanded to produce two gene lineages (Pgbc and Pgc2. These have been differentially retained in various classes. Accordingly, we find Pgc2 in sauropsids, amphibians and marsupials, but not in eutherian mammals. Pgbc was retained in amphibians, but duplicated in the ancestor of amniotes giving rise to Pgb and Pgc1. The latter was retained in mammals and probably in reptiles and marsupials but not in birds. Pgb was kept in all of the amniote clade with independent episodes of loss in some mammalian species. Lineage specific expansions of Pgc2 and Pgbc have also occurred in marsupials and amphibians respectively. We find that teleost and tetrapod Pgc genes reside in distinct genomic regions hinting at a possible translocation. CONCLUSIONS: We conclude that the repertoire of Pgc genes is larger than previously reported, and that tandem duplications have modelled the history of Pgc genes. We hypothesize that gene expansion lead to functional divergence in tetrapods, coincident with the

  1. Orthology and paralogy constraints: satisfiability and consistency.

    Science.gov (United States)

    Lafond, Manuel; El-Mabrouk, Nadia

    2014-01-01

    A variety of methods based on sequence similarity, reconciliation, synteny or functional characteristics, can be used to infer orthology and paralogy relations between genes of a given gene family  G. But is a given set  C of orthology/paralogy constraints possible, i.e., can they simultaneously co-exist in an evolutionary history for  G? While previous studies have focused on full sets of constraints, here we consider the general case where  C does not necessarily involve a constraint for each pair of genes. The problem is subdivided in two parts: (1) Is  C satisfiable, i.e. can we find an event-labeled gene tree G inducing  C? (2) Is there such a G which is consistent, i.e., such that all displayed triplet phylogenies are included in a species tree? Previous results on the Graph sandwich problem can be used to answer to (1), and we provide polynomial-time algorithms for satisfiability and consistency with a given species tree. We also describe a new polynomial-time algorithm for the case of consistency with an unknown species tree and full knowledge of pairwise orthology/paralogy relationships, as well as a branch-and-bound algorithm in the case when unknown relations are present. We show that our algorithms can be used in combination with ProteinOrtho, a sequence similarity-based orthology detection tool, to extract a set of robust orthology/paralogy relationships.

  2. Two Rounds of Whole Genome Duplication in the AncestralVertebrate

    Energy Technology Data Exchange (ETDEWEB)

    Dehal, Paramvir; Boore, Jeffrey L.

    2005-04-12

    The hypothesis that the relatively large and complex vertebrate genome was created by two ancient, whole genome duplications has been hotly debated, but remains unresolved. We reconstructed the evolutionary relationships of all gene families from the complete gene sets of a tunicate, fish, mouse, and human, then determined when each gene duplicated relative to the evolutionary tree of the organisms. We confirmed the results of earlier studies that there remains little signal of these events in numbers of duplicated genes, gene tree topology, or the number of genes per multigene family. However, when we plotted the genomic map positions of only the subset of paralogous genes that were duplicated prior to the fish-tetrapod split, their global physical organization provides unmistakable evidence of two distinct genome duplication events early in vertebrate evolution indicated by clear patterns of 4-way paralogous regions covering a large part of the human genome. Our results highlight the potential for these large-scale genomic events to have driven the evolutionary success of the vertebrate lineage.

  3. Simulating evolution of protein complexes through gene duplication and co-option.

    Science.gov (United States)

    Haarsma, Loren; Nelesen, Serita; VanAndel, Ethan; Lamine, James; VandeHaar, Peter

    2016-06-21

    We present a model of the evolution of protein complexes with novel functions through gene duplication, mutation, and co-option. Under a wide variety of input parameters, digital organisms evolve complexes of 2-5 bound proteins which have novel functions but whose component proteins are not independently functional. Evolution of complexes with novel functions happens more quickly as gene duplication rates increase, point mutation rates increase, protein complex functional probability increases, protein complex functional strength increases, and protein family size decreases. Evolution of complexity is inhibited when the metabolic costs of making proteins exceeds the fitness gain of having functional proteins, or when point mutation rates get so large the functional proteins undergo deleterious mutations faster than new functional complexes can evolve. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. A gene duplication led to specialized gamma-aminobutyrate and beta-alanine aminotransferase in yeast

    DEFF Research Database (Denmark)

    Andersen, Gorm; Andersen, Birgit; Dobritzsch, D.

    2007-01-01

    and related yeasts have two different genes/enzymes to apparently 'distinguish' between the two reactions in a single cell. It is likely that upon duplication similar to 200 million years ago, a specialized Uga1p evolved into a 'novel' transaminase enzyme with broader substrate specificity.......In humans, beta-alanine (BAL) and the neurotransmitter gamma-aminobutyrate (GABA) are transaminated by a single aminotransferase enzyme. Apparently, yeast originally also had a single enzyme, but the corresponding gene was duplicated in the Saccharomyces kluyveri lineage. SkUGA1 encodes a homologue...... to characterize the substrate specificity and kinetic parameters of the four enzymes. It was found that the cofactor pyridoxal 5'-phosphate is needed for enzymatic activity and alpha-ketoglutarate, and not pyruvate, as the amino group acceptor. SkPyd4p preferentially uses BAL as the amino group donor (V...

  5. Approximating the edit distance for genomes with duplicate genes under DCJ, insertion and deletion

    Directory of Open Access Journals (Sweden)

    Shao Mingfu

    2012-12-01

    Full Text Available Abstract Computing the edit distance between two genomes under certain operations is a basic problem in the study of genome evolution. The double-cut-and-join (DCJ model has formed the basis for most algorithmic research on rearrangements over the last few years. The edit distance under the DCJ model can be easily computed for genomes without duplicate genes. In this paper, we study the edit distance for genomes with duplicate genes under a model that includes DCJ operations, insertions and deletions. We prove that computing the edit distance is equivalent to finding the optimal cycle decomposition of the corresponding adjacency graph, and give an approximation algorithm with an approximation ratio of 1.5 + ∈.

  6. Hypertension and Biliary Ductopenia in a Patient with Duplication of Exon 6 of the Gene

    Directory of Open Access Journals (Sweden)

    J. Uberos

    2012-01-01

    Full Text Available We describe a neonatal patient with biliary ductopenia featuring duplication of exon 6 of the JAG1 gene. Facial alterations were observed, consisting of a prominent forehead, sunken eyes, upward slanting palpebral fissures, hypertelorism, flat nasal root and prominent chin. From birth, these were accompanied by the development of haematuria and renal failure and by renal Doppler findings indicative of peripheral renal artery stenosis. JAG1 gene mutations on chromosome 20 have been associated with various anomalies, including biliary cholestasis, vertebral abnormalities, eye disorders, heart defects and facial dysmorphia. This syndrome, first described by Alagille, is an infrequent congenital disorder caused by a dominant autosomal inheritance with variable expressivity. Anatomopathological effects include the destruction and disappearance of hepatic bile ducts (ductopenia. The duplication of exon 6 of JAG1 has not previously been described as an alteration related to the Alagille syndrome with peripheral renal artery stenosis.

  7. Duplication of 7q36.3 encompassing the Sonic Hedgehog (SHH) gene is associated with congenital muscular hypertrophy

    DEFF Research Database (Denmark)

    Kristensen, Lone Krøldrup; Kjaergaard, S; Kirchhoff, Marianne

    2012-01-01

    with muscular hypertrophy and mildly retarded psychomotor development. Array-CGH identified a small duplication of 7q36.3 including the Sonic Hedgehog (SHH) gene in both the aborted foetus and the live born male sib. Neither of the parents carried the 7q36.3 duplication. The consequences of overexpression...

  8. Sox genes in grass carp (Ctenopharyngodon idella with their implications for genome duplication and evolution

    Directory of Open Access Journals (Sweden)

    Tong Jingou

    2006-11-01

    Full Text Available Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella, one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes has two co-orthologs in grass carp, and the duplication of Sox4 and Sox11 occurred before the divergence of grass carp and zebrafish, which support the "fish-specific whole-genome duplication" theory. An estimation for the origin of grass carp based on the molecular clock using Sox1, Sox3 and Sox11 genes as markers indicates that grass carp (subfamily Leuciscinae and zebrafish (subfamily Danioninae diverged approximately 60 million years ago. The potential uses of Sox genes as markers in revealing the evolutionary history of grass carp are discussed.

  9. Dose effect of the uvsA+ gene product in duplication strains of Aspergillus nidulans

    International Nuclear Information System (INIS)

    Majerfeld, I.H.; Roper, J.A.

    1978-01-01

    Strains of Aspergillus nidulans which carry a particular segment of chromosome I in duplicate - one segment in normal position, the other translocated to chromosome II - are more resistant to uv light than are strains with a balanced haploid genome. A double dose of the uvsA + allele, carried on the duplicate segment, determines this enhanced resistance; this is shown by the descending order of resistance of duplication haploids uvsA + /uvsA + , uvsA1/uvsA + and uvsA1/uvsA1. An unbalanced diploid with three doses of the uvsA + allele also shows greater resistance than a balanced uvsA + //uvsA + diploid. However, in balanced diploids the uvsA1 allele appears to be completely recessive; uvsA + //uvsA + and uvsA + //uvsA1 diploids produce indistinguishable survival curves after uv irradiation. Thus, the uvsA + gene product is not rate-limiting in repair processes in strains with a balanced genome. The rate-limiting effect observed in these unbalanced strains presumably reflects an interaction of the uvsA + product and other functions determined by the rest of the genome. Duplication haploids and normal haploids lose photorepairable lesions at similar rates. This observation may be interpreted to indicate that differences in survival are not due to differences in the efficiency of excision of uv-induced pyrimidime dimers

  10. Molecular evolution of a Y chromosome to autosome gene duplication in Drosophila.

    Science.gov (United States)

    Dyer, Kelly A; White, Brooke E; Bray, Michael J; Piqué, Daniel G; Betancourt, Andrea J

    2011-03-01

    In contrast to the rest of the genome, the Y chromosome is restricted to males and lacks recombination. As a result, Y chromosomes are unable to respond efficiently to selection, and newly formed Y chromosomes degenerate until few genes remain. The rapid loss of genes from newly formed Y chromosomes has been well studied, but gene loss from highly degenerate Y chromosomes has only recently received attention. Here, we identify and characterize a Y to autosome duplication of the male fertility gene kl-5 that occurred during the evolution of the testacea group species of Drosophila. The duplication was likely DNA based, as other Y-linked genes remain on the Y chromosome, the locations of introns are conserved, and expression analyses suggest that regulatory elements remain linked. Genetic mapping reveals that the autosomal copy of kl-5 resides on the dot chromosome, a tiny autosome with strongly suppressed recombination. Molecular evolutionary analyses show that autosomal copies of kl-5 have reduced polymorphism and little recombination. Importantly, the rate of protein evolution of kl-5 has increased significantly in lineages where it is on the dot versus Y linked. Further analyses suggest this pattern is a consequence of relaxed purifying selection, rather than adaptive evolution. Thus, although the initial fixation of the kl-5 duplication may have been advantageous, slightly deleterious mutations have accumulated in the dot-linked copies of kl-5 faster than in the Y-linked copies. Because the dot chromosome contains seven times more genes than the Y and is exposed to selection in both males and females, these results suggest that the dot suffers the deleterious effects of genetic linkage to more selective targets compared with the Y chromosome. Thus, a highly degenerate Y chromosome may not be the worst environment in the genome, as is generally thought, but may in fact be protected from the accumulation of deleterious mutations relative to other nonrecombining

  11. Selection Signatures in the First Exon of Paralogous Receptor Kinase Genes from the Sym2 Region of the Pisum sativum L. Genome

    Directory of Open Access Journals (Sweden)

    Anton S. Sulima

    2017-11-01

    Full Text Available During the initial step of the symbiosis between legumes (Fabaceae and nitrogen-fixing bacteria (rhizobia, the bacterial signal molecule known as the Nod factor (nodulation factor is recognized by plant LysM motif-containing receptor-like kinases (LysM-RLKs. The fifth chromosome of barrel medic (Medicago truncatula Gaertn. contains a cluster of paralogous LysM-RLK genes, one of which is known to participate in symbiosis. In the syntenic region of the pea (Pisum sativum L. genome, three genes have been identified: PsK1 and PsSym37, two symbiosis-related LysM-RLK genes with known sequences, and the unsequenced PsSym2 gene which presumably encodes a LysM-RLK and is associated with increased selectivity to certain Nod factors. In this work, we identified a new gene encoding a LysM-RLK, designated as PsLykX, within the Sym2 genomic region. We sequenced the first exons (corresponding to the protein receptor domain of PsSym37, PsK1, and PsLykX from a large set of pea genotypes of diverse origin. The nucleotide diversity of these fragments was estimated and groups of haplotypes for each gene were revealed. Footprints of selection pressure were detected via comparative analyses of SNP distribution across the first exons of these genes and their homologs MtLYK2, MtLYK3, and MtLYK4 from M. truncatula retrieved from the Medicago Hapmap project. Despite the remarkable similarity among all the studied genes, they exhibited contrasting selection signatures, possibly pointing to diversification of their functions. Signatures of balancing selection were found in LysM1-encoding parts of PsSym37 and PsK1, suggesting that the diversity of these parts may be important for pea LysM-RLKs. The first exons of PsSym37 and PsK1 displayed signatures of purifying selection, as well as MtLYK2 of M. truncatula. Evidence of positive selection affecting primarily LysM domains was found in all three investigated M. truncatula genes, as well as in the pea gene PsLykX. The data

  12. Paralogous gene analysis reveals a highly enantioselective 1,2-O-isopropylideneglycerol caprylate esterase of Bacillus subtilis

    NARCIS (Netherlands)

    Droge, MJ; Bos, R; Quax, WJ

    Carboxylesterase NP of Bacillus subtilis Thai 1-8, characterized in 1992 as a very enantioselective (S)-naproxen esterase, was found to show no enantiopreference towards (S)-1,2-O-isopropylideneglycerol (IPG) esters. The ybfK gene was identified by the B. subtilis genome project as an unknown gene

  13. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  14. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  15. Divergent Evolutionary Patterns of NAC Transcription Factors Are Associated with Diversification and Gene Duplications in Angiosperm

    Directory of Open Access Journals (Sweden)

    Xiaoli Jin

    2017-06-01

    Full Text Available NAC (NAM/ATAF/CUC proteins constitute one of the biggest plant-specific transcription factor (TF families and have crucial roles in diverse developmental programs during plant growth. Phylogenetic analyses have revealed both conserved and lineage-specific NAC subfamilies, among which various origins and distinct features were observed. It is reasonable to hypothesize that there should be divergent evolutionary patterns of NAC TFs both between dicots and monocots, and among NAC subfamilies. In this study, we compared the gene duplication and loss, evolutionary rate, and selective pattern among non-lineage specific NAC subfamilies, as well as those between dicots and monocots, through genome-wide analyses of sequence and functional data in six dicot and five grass lineages. The number of genes gained in the dicot lineages was much larger than that in the grass lineages, while fewer gene losses were observed in the grass than that in the dicots. We revealed (1 uneven constitution of Clusters of Orthologous Groups (COGs and contrasting birth/death rates among subfamilies, and (2 two distinct evolutionary scenarios of NAC TFs between dicots and grasses. Our results demonstrated that relaxed selection, resulting from concerted gene duplications, may have permitted substitutions responsible for functional divergence of NAC genes into new lineages. The underlying mechanism of distinct evolutionary fates of NAC TFs shed lights on how evolutionary divergence contributes to differences in establishing NAC gene subfamilies and thus impacts the distinct features between dicots and grasses.

  16. GENE-dosage effects on fitness in recent adaptive duplications: ace-1 in the mosquito Culex pipiens.

    Science.gov (United States)

    Labbé, Pierrick; Milesi, Pascal; Yébakima, André; Pasteur, Nicole; Weill, Mylène; Lenormand, Thomas

    2014-07-01

    Gene duplications have long been advocated to contribute to the evolution of new functions. The role of selection in their early spread is more controversial. Unless duplications are favored for a direct benefit of increased expression, they are likely detrimental. In this article, we investigated the case of duplications favored because they combine already functionally divergent alleles. Their gene-dosage/fitness relations are poorly known because selection may operate on both overall expression and duplicates relative dosage. Using the well-documented case of Culex pipiens resistance to insecticides, we compared strains with various ace-1 allele combinations, including two duplicated alleles carrying both susceptible and resistant copies. The overall protein activity was nearly additive, but, surprisingly, fitness correlated better with the relative proportion of susceptible and resistant copies rather than any absolute measure of activity. Gene dosage is thus crucial, duplications stabilizing a "heterozygote" phenotype. It corroborates the view that these were favored because they fix a permanent heterosis, thereby solving the irreducible trade-off between resistance and synaptic transmission. Moreover, we showed that the contrasted successes of the two duplicated alleles in natural populations depend on genetic changes unrelated to ace-1, confirming the probable implication of recessive sublethal mutations linked to structural rearrangements in some duplications. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  17. Clinical and molecular characterization of duplications encompassing the human SHOX gene reveal a variable effect on stature.

    Science.gov (United States)

    Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert

    2009-07-01

    Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.

  18. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  19. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

    Science.gov (United States)

    Harding, Tommy; Roger, Andrew J.; Simpson, Alastair G. B.

    2017-01-01

    The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles) grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones), ion homeostasis (e.g., Na+/H+ transporter), metabolism and transport of lipids (e.g., sterol biosynthetic genes), carbohydrate metabolism (e.g., glycosidases), and signal transduction pathways (e.g., transcription factors). A significantly high proportion (43%) of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs), as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like membrane

  20. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

    Directory of Open Access Journals (Sweden)

    Tommy Harding

    2017-05-01

    Full Text Available The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones, ion homeostasis (e.g., Na+/H+ transporter, metabolism and transport of lipids (e.g., sterol biosynthetic genes, carbohydrate metabolism (e.g., glycosidases, and signal transduction pathways (e.g., transcription factors. A significantly high proportion (43% of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs, as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like

  1. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  2. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  3. Differential contributions to the transcriptome of duplicated genes in response to abiotic stresses in natural and synthetic polyploids.

    Science.gov (United States)

    Dong, Shaowei; Adams, Keith L

    2011-06-01

    Polyploidy has occurred throughout plant evolution and can result in considerable changes to gene expression when it takes place and over evolutionary time. Little is known about the effects of abiotic stress conditions on duplicate gene expression patterns in polyploid plants. We examined the expression patterns of 60 duplicated genes in leaves, roots and cotyledons of allotetraploid Gossypium hirsutum in response to five abiotic stress treatments (heat, cold, drought, high salt and water submersion) using single-strand conformation polymorphism assays, and 20 genes in a synthetic allotetraploid. Over 70% of the genes showed stress-induced changes in the relative expression levels of the duplicates under one or more stress treatments with frequent variability among treatments. Twelve pairs showed opposite changes in expression levels in response to different abiotic stress treatments. Stress-induced expression changes occurred in the synthetic allopolyploid, but there was little correspondence in patterns between the natural and synthetic polyploids. Our results indicate that abiotic stress conditions can have considerable effects on duplicate gene expression in a polyploid, with the effects varying by gene, stress and organ type. Differential expression in response to environmental stresses may be a factor in the preservation of some duplicated genes in polyploids. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  4. Gene duplication and fragmentation in the zebra finch major histocompatibility complex.

    Science.gov (United States)

    Balakrishnan, Christopher N; Ekblom, Robert; Völker, Martin; Westerdahl, Helena; Godinez, Ricardo; Kotkiewicz, Holly; Burt, David W; Graves, Tina; Griffin, Darren K; Warren, Wesley C; Edwards, Scott V

    2010-04-01

    Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC) has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC) sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH) evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving chromosomal fission, gene duplication and translocation in the

  5. Expression response of duplicated metallothionein 3 gene to copper stress in Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Nevrtalová, Eva; Baloun, Jiří; Hudzieczek, Vojtěch; Čegan, Radim; Vyskot, Boris; Doležel, Jaroslav; Šafář, Jan; Milde, D.; Hobza, Roman

    2014-01-01

    Roč. 251, č. 6 (2014), s. 1427-1439 ISSN 0033-183X R&D Projects: GA ČR(CZ) GAP501/12/2220; GA ČR(CZ) GBP501/12/G090; GA ČR(CZ) GP13-34962P; GA ČR(CZ) GA522/09/0083 Institutional support: RVO:68081707 Keywords : Copper * Gene duplication * Metallothionein Subject RIV: BO - Biophysics; EF - Botanics (UEB-Q) Impact factor: 2.651, year: 2014

  6. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  7. Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

    Science.gov (United States)

    Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

    2012-11-02

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

  8. Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

    Science.gov (United States)

    Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

    2012-01-01

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

  9. Hox paralog group 2 genes control the migration of mouse pontine neurons through slit-robo signaling.

    Directory of Open Access Journals (Sweden)

    Marc J Geisen

    2008-06-01

    Full Text Available The pontine neurons (PN represent a major source of mossy fiber projections to the cerebellum. During mouse hindbrain development, PN migrate tangentially and sequentially along both the anteroposterior (AP and dorsoventral (DV axes. Unlike DV migration, which is controlled by the Netrin-1/Dcc attractive pathway, little is known about the molecular mechanisms guiding PN migration along the AP axis. Here, we show that Hoxa2 and Hoxb2 are required both intrinsically and extrinsically to maintain normal AP migration of subsets of PN, by preventing their premature ventral attraction towards the midline. Moreover, the migration defects observed in Hoxa2 and Hoxb2 mutant mice were phenocopied in compound Robo1;Robo2, Slit1;Slit2, and Robo2;Slit2 knockout animals, indicating that these guidance molecules act downstream of Hox genes to control PN migration. Indeed, using chromatin immunoprecipitation assays, we further demonstrated that Robo2 is a direct target of Hoxa2 in vivo and that maintenance of high Robo and Slit expression levels was impaired in Hoxa2 mutant mice. Lastly, the analysis of Phox2b-deficient mice indicated that the facial motor nucleus is a major Slit signaling source required to prevent premature ventral migration of PN. These findings provide novel insights into the molecular control of neuronal migration from transcription factor to regulation of guidance receptor and ligand expression. Specifically, they address the question of how exposure to multiple guidance cues along the AP and DV axes is regulated at the transcriptional level and in turn translated into stereotyped migratory responses during tangential migration of neurons in the developing mammalian brain.

  10. Expression and phylogenetic analyses reveal paralogous lineages of putatively classical and non-classical MHC-I genes in three sparrow species (Passer).

    Science.gov (United States)

    Drews, Anna; Strandh, Maria; Råberg, Lars; Westerdahl, Helena

    2017-06-26

    The Major Histocompatibility Complex (MHC) plays a central role in immunity and has been given considerable attention by evolutionary ecologists due to its associations with fitness-related traits. Songbirds have unusually high numbers of MHC class I (MHC-I) genes, but it is not known whether all are expressed and equally important for immune function. Classical MHC-I genes are highly expressed, polymorphic and present peptides to T-cells whereas non-classical MHC-I genes have lower expression, are more monomorphic and do not present peptides to T-cells. To get a better understanding of the highly duplicated MHC genes in songbirds, we studied gene expression in a phylogenetic framework in three species of sparrows (house sparrow, tree sparrow and Spanish sparrow), using high-throughput sequencing. We hypothesize that sparrows could have classical and non-classical genes, as previously indicated though never tested using gene expression. The phylogenetic analyses reveal two distinct types of MHC-I alleles among the three sparrow species, one with high and one with low level of polymorphism, thus resembling classical and non-classical genes, respectively. All individuals had both types of alleles, but there was copy number variation both within and among the sparrow species. However, the number of highly polymorphic alleles that were expressed did not vary between species, suggesting that the structural genomic variation is counterbalanced by conserved gene expression. Overall, 50% of the MHC-I alleles were expressed in sparrows. Expression of the highly polymorphic alleles was very variable, whereas the alleles with low polymorphism had uniformly low expression. Interestingly, within an individual only one or two alleles from the polymorphic genes were highly expressed, indicating that only a single copy of these is highly expressed. Taken together, the phylogenetic reconstruction and the analyses of expression suggest that sparrows have both classical and non

  11. An ace-1 gene duplication resorbs the fitness cost associated with resistance in Anopheles gambiae, the main malaria mosquito.

    Science.gov (United States)

    Assogba, Benoît S; Djogbénou, Luc S; Milesi, Pascal; Berthomieu, Arnaud; Perez, Julie; Ayala, Diego; Chandre, Fabrice; Makoutodé, Michel; Labbé, Pierrick; Weill, Mylène

    2015-10-05

    Widespread resistance to pyrethroids threatens malaria control in Africa. Consequently, several countries switched to carbamates and organophophates insecticides for indoor residual spraying. However, a mutation in the ace-1 gene conferring resistance to these compounds (ace-1(R) allele), is already present. Furthermore, a duplicated allele (ace-1(D)) recently appeared; characterizing its selective advantage is mandatory to evaluate the threat. Our data revealed that a unique duplication event, pairing a susceptible and a resistant copy of the ace-1 gene spread through West Africa. Further investigations revealed that, while ace-1(D) confers less resistance than ace-1(R), the high fitness cost associated with ace-1(R) is almost completely suppressed by the duplication for all traits studied. ace-1 duplication thus represents a permanent heterozygote phenotype, selected, and thus spreading, due to the mosaic nature of mosquito control. It provides malaria mosquito with a new evolutionary path that could hamper resistance management.

  12. Gene duplication and adaptive evolution of digestive proteases in Drosophila arizonae female reproductive tracts.

    Directory of Open Access Journals (Sweden)

    Erin S Kelleher

    2007-08-01

    Full Text Available It frequently has been postulated that intersexual coevolution between the male ejaculate and the female reproductive tract is a driving force in the rapid evolution of reproductive proteins. The dearth of research on female tracts, however, presents a major obstacle to empirical tests of this hypothesis. Here, we employ a comparative EST approach to identify 241 candidate female reproductive proteins in Drosophila arizonae, a repleta group species in which physiological ejaculate-female coevolution has been documented. Thirty-one of these proteins exhibit elevated amino acid substitution rates, making them candidates for molecular coevolution with the male ejaculate. Strikingly, we also discovered 12 unique digestive proteases whose expression is specific to the D. arizonae lower female reproductive tract. These enzymes belong to classes most commonly found in the gastrointestinal tracts of a diverse array of organisms. We show that these proteases are associated with recent, lineage-specific gene duplications in the Drosophila repleta species group, and exhibit strong signatures of positive selection. Observation of adaptive evolution in several female reproductive tract proteins indicates they are active players in the evolution of reproductive tract interactions. Additionally, pervasive gene duplication, adaptive evolution, and rapid acquisition of a novel digestive function by the female reproductive tract points to a novel coevolutionary mechanism of ejaculate-female interaction.

  13. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  14. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

    2012-01-01

    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  15. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  16. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  17. Gene duplication and fragmentation in the zebra finch major histocompatibility complex

    Directory of Open Access Journals (Sweden)

    Burt David W

    2010-04-01

    Full Text Available Abstract Background Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. Results The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. Conclusion The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving

  18. Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

    International Nuclear Information System (INIS)

    Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja; Tan, Qihua; Jochumsen, Kirsten; Fritzner, Niels; Brusgaard, Klaus; Dahlgaard, Jesper; Kruse, Torben A.

    2006-01-01

    The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips was three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation

  19. XX male sex reversal with genital abnormalities associated with a de novo SOX3 gene duplication.

    Science.gov (United States)

    Moalem, Sharon; Babul-Hirji, Riyana; Stavropolous, Dmitri J; Wherrett, Diane; Bägli, Darius J; Thomas, Paul; Chitayat, David

    2012-07-01

    Differentiation of the bipotential gonad into testis is initiated by the Y chromosome-linked gene SRY (Sex-determining Region Y) through upregulation of its autosomal direct target gene SOX9 (Sry-related HMG box-containing gene 9). Sequence and chromosome homology studies have shown that SRY most probably evolved from SOX3, which in humans is located at Xq27.1. Mutations causing SOX3 loss-of-function do not affect the sex determination in mice or humans. However, transgenic mouse studies have shown that ectopic expression of Sox3 in the bipotential gonad results in upregulation of Sox9, resulting in testicular induction and XX male sex reversal. However, the mechanism by which these rearrangements cause sex reversal and the frequency with which they are associated with disorders of sex development remains unclear. Rearrangements of the SOX3 locus were identified recently in three cases of human XX male sex reversal. We report on a case of XX male sex reversal associated with a novel de novo duplication of the SOX3 gene. These data provide additional evidence that SOX3 gain-of-function in the XX bipotential gonad causes XX male sex reversal and further support the hypothesis that SOX3 is the evolutionary antecedent of SRY. Copyright © 2012 Wiley Periodicals, Inc.

  20. Resolution and reconciliation of non-binary gene trees with transfers, duplications and losses.

    Science.gov (United States)

    Jacox, Edwin; Weller, Mathias; Tannier, Eric; Scornavacca, Celine

    2017-04-01

    Gene trees reconstructed from sequence alignments contain poorly supported branches when the phylogenetic signal in the sequences is insufficient to determine them all. When a species tree is available, the signal of gains and losses of genes can be used to correctly resolve the unsupported parts of the gene history. However finding a most parsimonious binary resolution of a non-binary tree obtained by contracting the unsupported branches is NP-hard if transfer events are considered as possible gene scale events, in addition to gene origination, duplication and loss. We propose an exact, parameterized algorithm to solve this problem in single-exponential time, where the parameter is the number of connected branches of the gene tree that show low support from the sequence alignment or, equivalently, the maximum number of children of any node of the gene tree once the low-support branches have been collapsed. This improves on the best known algorithm by an exponential factor. We propose a way to choose among optimal solutions based on the available information. We show the usability of this principle on several simulated and biological datasets. The results are comparable in quality to several other tested methods having similar goals, but our approach provides a lower running time and a guarantee that the produced solution is optimal. Our algorithm has been integrated into the ecceTERA phylogeny package, available at http://mbb.univ-montp2.fr/MBB/download_sources/16__ecceTERA and which can be run online at http://mbb.univ-montp2.fr/MBB/subsection/softExec.php?soft=eccetera . celine.scornavacca@umontpellier.fr. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  1. Functional analysis of duplicated Symbiosis Receptor Kinase (SymRK) genes during nodulation and mycorrhizal infection in soybean (Glycine max).

    Science.gov (United States)

    Indrasumunar, Arief; Wilde, Julia; Hayashi, Satomi; Li, Dongxue; Gresshoff, Peter M

    2015-03-15

    Association between legumes and rhizobia results in the formation of root nodules, where symbiotic nitrogen fixation occurs. The early stages of this association involve a complex of signalling events between the host and microsymbiont. Several genes dealing with early signal transduction have been cloned, and one of them encodes the leucine-rich repeat (LRR) receptor kinase (SymRK; also termed NORK). The Symbiosis Receptor Kinase gene is required by legumes to establish a root endosymbiosis with Rhizobium bacteria as well as mycorrhizal fungi. Using degenerate primer and BAC sequencing, we cloned duplicated SymRK homeologues in soybean called GmSymRKα and GmSymRKβ. These duplicated genes have high similarity of nucleotide (96%) and amino acid sequence (95%). Sequence analysis predicted a malectin-like domain within the extracellular domain of both genes. Several putative cis-acting elements were found in promoter regions of GmSymRKα and GmSymRKβ, suggesting a participation in lateral root development, cell division and peribacteroid membrane formation. The mutant of SymRK genes is not available in soybean; therefore, to know the functions of these genes, RNA interference (RNAi) of these duplicated genes was performed. For this purpose, RNAi construct of each gene was generated and introduced into the soybean genome by Agrobacterium rhizogenes-mediated hairy root transformation. RNAi of GmSymRKβ gene resulted in an increased reduction of nodulation and mycorrhizal infection than RNAi of GmSymRKα, suggesting it has the major activity of the duplicated gene pair. The results from the important crop legume soybean confirm the joint phenotypic action of GmSymRK genes in both mycorrhizal and rhizobial infection seen in model legumes. Copyright © 2015 Elsevier GmbH. All rights reserved.

  2. Paralog-Specific Patterns of Structural Disorder and Phosphorylation in the Vertebrate SH3-SH2-Tyrosine Kinase Protein Family.

    Science.gov (United States)

    Dos Santos, Helena G; Siltberg-Liberles, Jessica

    2016-09-19

    One of the largest multigene families in Metazoa are the tyrosine kinases (TKs). These are important multifunctional proteins that have evolved as dynamic switches that perform tyrosine phosphorylation and other noncatalytic activities regulated by various allosteric mechanisms. TKs interact with each other and with other molecules, ultimately activating and inhibiting different signaling pathways. TKs are implicated in cancer and almost 30 FDA-approved TK inhibitors are available. However, specific binding is a challenge when targeting an active site that has been conserved in multiple protein paralogs for millions of years. A cassette domain (CD) containing SH3-SH2-Tyrosine Kinase domains reoccurs in vertebrate nonreceptor TKs. Although part of the CD function is shared between TKs, it also presents TK specific features. Here, the evolutionary dynamics of sequence, structure, and phosphorylation across the CD in 17 TK paralogs have been investigated in a large-scale study. We establish that TKs often have ortholog-specific structural disorder and phosphorylation patterns, while secondary structure elements, as expected, are highly conserved. Further, domain-specific differences are at play. Notably, we found the catalytic domain to fluctuate more in certain secondary structure elements than the regulatory domains. By elucidating how different properties evolve after gene duplications and which properties are specifically conserved within orthologs, the mechanistic understanding of protein evolution is enriched and regions supposedly critical for functional divergence across paralogs are highlighted. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Duplications of the neuropeptide receptor gene VIPR2 confer significant risk for schizophrenia.

    LENUS (Irish Health Repository)

    Vacic, Vladimir

    2011-03-24

    Rare copy number variants (CNVs) have a prominent role in the aetiology of schizophrenia and other neuropsychiatric disorders. Substantial risk for schizophrenia is conferred by large (>500-kilobase) CNVs at several loci, including microdeletions at 1q21.1 (ref. 2), 3q29 (ref. 3), 15q13.3 (ref. 2) and 22q11.2 (ref. 4) and microduplication at 16p11.2 (ref. 5). However, these CNVs collectively account for a small fraction (2-4%) of cases, and the relevant genes and neurobiological mechanisms are not well understood. Here we performed a large two-stage genome-wide scan of rare CNVs and report the significant association of copy number gains at chromosome 7q36.3 with schizophrenia. Microduplications with variable breakpoints occurred within a 362-kilobase region and were detected in 29 of 8,290 (0.35%) patients versus 2 of 7,431 (0.03%) controls in the combined sample. All duplications overlapped or were located within 89 kilobases upstream of the vasoactive intestinal peptide receptor gene VIPR2. VIPR2 transcription and cyclic-AMP signalling were significantly increased in cultured lymphocytes from patients with microduplications of 7q36.3. These findings implicate altered vasoactive intestinal peptide signalling in the pathogenesis of schizophrenia and indicate the VPAC2 receptor as a potential target for the development of new antipsychotic drugs.

  4. Mirror-image duplication of the primary axis and heart in Xenopus embryos by the overexpression of Msx-1 gene.

    Science.gov (United States)

    Chen, Y; Solursh, M

    1995-10-01

    The Msx-1 gene (formerly known as Hox-7) is a member of a discrete subclass of homeobox-containing genes. Examination of the expression pattern of Msx-1 in murine and avian embryos suggests that this gene may be involved in the regionalization of the medio-lateral axis during earlier development. We have examined the possible functions of Xenopus Msx-1 during early Xenopus embryonic development by overexpression of the Msx-1 gene. Overexpression of Msx-1 causes a left-right mirror-image duplication of primary axial structures, including notochord, neural tube, somites, suckers, and foregut. The embryonic developing heart is also mirror-image duplicated, including looping directions and polarity. These results indicate that Msx-1 may be involved in the mesoderm formation as well as left-right patterning in the early Xenopus embryonic development.

  5. Segmental duplications and evolutionary acquisition of UV damage response in the SPATA31 gene family of primates and humans.

    Science.gov (United States)

    Bekpen, Cemalettin; Künzel, Sven; Xie, Chen; Eaaswarkhanth, Muthukrishnan; Lin, Yen-Lung; Gokcumen, Omer; Akdis, Cezmi A; Tautz, Diethard

    2017-03-06

    Segmental duplications are an abundant source for novel gene functions and evolutionary adaptations. This mechanism of generating novelty was very active during the evolution of primates particularly in the human lineage. Here, we characterize the evolution and function of the SPATA31 gene family (former designation FAM75A), which was previously shown to be among the gene families with the strongest signal of positive selection in hominoids. The mouse homologue for this gene family is a single copy gene expressed during spermatogenesis. We show that in primates, the SPATA31 gene duplicated into SPATA31A and SPATA31C types and broadened the expression into many tissues. Each type became further segmentally duplicated in the line towards humans with the largest number of full-length copies found for SPATA31A in humans. Copy number estimates of SPATA31A based on digital PCR show an average of 7.5 with a range of 5-11 copies per diploid genome among human individuals. The primate SPATA31 genes also acquired new protein domains that suggest an involvement in UV response and DNA repair. We generated antibodies and show that the protein is re-localized from the nucleolus to the whole nucleus upon UV-irradiation suggesting a UV damage response. We used CRISPR/Cas mediated mutagenesis to knockout copies of the gene in human primary fibroblast cells. We find that cell lines with reduced functional copies as well as naturally occurring low copy number HFF cells show enhanced sensitivity towards UV-irradiation. The acquisition of new SPATA31 protein functions and its broadening of expression may be related to the evolution of the diurnal life style in primates that required a higher UV tolerance. The increased segmental duplications in hominoids as well as its fast evolution suggest the acquisition of further specific functions particularly in humans.

  6. Cumulative Impact of Polychlorinated Biphenyl and Large Chromosomal Duplications on DNA Methylation, Chromatin, and Expression of Autism Candidate Genes.

    Science.gov (United States)

    Dunaway, Keith W; Islam, M Saharul; Coulson, Rochelle L; Lopez, S Jesse; Vogel Ciernia, Annie; Chu, Roy G; Yasui, Dag H; Pessah, Isaac N; Lott, Paul; Mordaunt, Charles; Meguro-Horike, Makiko; Horike, Shin-Ichi; Korf, Ian; LaSalle, Janine M

    2016-12-13

    Rare variants enriched for functions in chromatin regulation and neuronal synapses have been linked to autism. How chromatin and DNA methylation interact with environmental exposures at synaptic genes in autism etiologies is currently unclear. Using whole-genome bisulfite sequencing in brain tissue and a neuronal cell culture model carrying a 15q11.2-q13.3 maternal duplication, we find that significant global DNA hypomethylation is enriched over autism candidate genes and affects gene expression. The cumulative effect of multiple chromosomal duplications and exposure to the pervasive persistent organic pollutant PCB 95 altered methylation of more than 1,000 genes. Hypomethylated genes were enriched for H2A.Z, increased maternal UBE3A in Dup15q corresponded to reduced levels of RING1B, and bivalently modified H2A.Z was altered by PCB 95 and duplication. These results demonstrate the compounding effects of genetic and environmental insults on the neuronal methylome that converge upon dysregulation of chromatin and synaptic genes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  7. North Carolina macular dystrophy (MCDR1) caused by a novel tandem duplication of the PRDM13 gene.

    Science.gov (United States)

    Bowne, Sara J; Sullivan, Lori S; Wheaton, Dianna K; Locke, Kirsten G; Jones, Kaylie D; Koboldt, Daniel C; Fulton, Robert S; Wilson, Richard K; Blanton, Susan H; Birch, David G; Daiger, Stephen P

    2016-01-01

    To identify the underlying cause of disease in a large family with North Carolina macular dystrophy (NCMD). A large four-generation family (RFS355) with an autosomal dominant form of NCMD was ascertained. Family members underwent comprehensive visual function evaluations. Blood or saliva from six affected family members and three unaffected spouses was collected and DNA tested for linkage to the MCDR1 locus on chromosome 6q12. Three affected family members and two unaffected spouses underwent whole exome sequencing (WES) and subsequently, custom capture of the linkage region followed by next-generation sequencing (NGS). Standard PCR and dideoxy sequencing were used to further characterize the mutation. Of the 12 eyes examined in six affected individuals, all but two had Gass grade 3 macular degeneration features. Large central excavation of the retinal and choroid layers, referred to as a macular caldera, was seen in an age-independent manner in the grade 3 eyes. The calderas are unique to affected individuals with MCDR1. Genome-wide linkage mapping and haplotype analysis of markers from the chromosome 6q region were consistent with linkage to the MCDR1 locus. Whole exome sequencing and custom-capture NGS failed to reveal any rare coding variants segregating with the phenotype. Analysis of the custom-capture NGS sequencing data for copy number variants uncovered a tandem duplication of approximately 60 kb on chromosome 6q. This region contains two genes, CCNC and PRDM13 . The duplication creates a partial copy of CCNC and a complete copy of PRDM13 . The duplication was found in all affected members of the family and is not present in any unaffected members. The duplication was not seen in 200 ethnically matched normal chromosomes. The cause of disease in the original family with MCDR1 and several others has been recently reported to be dysregulation of the PRDM13 gene, caused by either single base substitutions in a DNase 1 hypersensitive site upstream of the CCNC

  8. Microbial Evolution: Xenology (Apparently) Trumps Paralogy.

    Science.gov (United States)

    Eme, Laura; Doolittle, W Ford

    2016-11-21

    Within-genome gene duplication is generally considered the source of extra copies when higher dosage is required and a starting point for evolution of new function. A new study suggests that horizontal gene transfer can appear to play both roles. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Expression Pattern Similarities Support the Prediction of Orthologs Retaining Common Functions after Gene Duplication Events1[OPEN

    Science.gov (United States)

    Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.

    2016-01-01

    The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025

  10. Comparative analysis of NBS-LRR genes and their response to Aspergillus flavus in Arachis.

    Directory of Open Access Journals (Sweden)

    Hui Song

    Full Text Available Studies have demonstrated that nucleotide-binding site-leucine-rich repeat (NBS-LRR genes respond to pathogen attack in plants. Characterization of NBS-LRR genes in peanut is not well documented. The newly released whole genome sequences of Arachis duranensis and Arachis ipaënsis have allowed a global analysis of this important gene family in peanut to be conducted. In this study, we identified 393 (AdNBS and 437 (AiNBS NBS-LRR genes from A. duranensis and A. ipaënsis, respectively, using bioinformatics approaches. Full-length sequences of 278 AdNBS and 303 AiNBS were identified. Fifty-one orthologous, four AdNBS paralogous, and six AiNBS paralogous gene pairs were predicted. All paralogous gene pairs were located in the same chromosomes, indicating that tandem duplication was the most likely mechanism forming these paralogs. The paralogs mainly underwent purifying selection, but most LRR 8 domains underwent positive selection. More gene clusters were found in A. ipaënsis than in A. duranensis, possibly owing to tandem duplication events occurring more frequently in A. ipaënsis. The expression profile of NBS-LRR genes was different between A. duranensis and A. hypogaea after Aspergillus flavus infection. The up-regulated expression of NBS-LRR in A. duranensis was continuous, while these genes responded to the pathogen temporally in A. hypogaea.

  11. New insights into the nutritional regulation of gluconeogenesis in carnivorous rainbow trout (Oncorhynchus mykiss): a gene duplication trail.

    Science.gov (United States)

    Marandel, Lucie; Seiliez, Iban; Véron, Vincent; Skiba-Cassy, Sandrine; Panserat, Stéphane

    2015-07-01

    The rainbow trout (Oncorhynchus mykiss) is considered to be a strictly carnivorous fish species that is metabolically adapted for high catabolism of proteins and low utilization of dietary carbohydrates. This species consequently has a "glucose-intolerant" phenotype manifested by persistent hyperglycemia when fed a high-carbohydrate diet. Gluconeogenesis in adult fish is also poorly, if ever, regulated by carbohydrates, suggesting that this metabolic pathway is involved in this specific phenotype. In this study, we hypothesized that the fate of duplicated genes after the salmonid-specific 4th whole genome duplication (Ss4R) may have led to adaptive innovation and that their study might provide new elements to enhance our understanding of gluconeogenesis and poor dietary carbohydrate use in this species. Our evolutionary analysis of gluconeogenic genes revealed that pck1, pck2, fbp1a, and g6pca were retained as singletons after Ss4r, while g6pcb1, g6pcb2, and fbp1b ohnolog pairs were maintained. For all genes, duplication may have led to sub- or neofunctionalization. Expression profiles suggest that the gluconeogenesis pathway remained active in trout fed a no-carbohydrate diet. When trout were fed a high-carbohydrate diet (30%), most of the gluconeogenic genes were non- or downregulated, except for g6pbc2 ohnologs, whose RNA levels were surprisingly increased. This study demonstrates that Ss4R in trout involved adaptive innovation via gene duplication and via the outcome of the resulting ohnologs. Indeed, maintenance of ohnologous g6pcb2 pair may contribute in a significant way to the glucose-intolerant phenotype of trout and may partially explain its poor use of dietary carbohydrates. Copyright © 2015 the American Physiological Society.

  12. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template.

    Science.gov (United States)

    Gouran, Hossein; Chakraborty, Sandeep; Rao, Basuthkar J; Asgeirsson, Bjarni; Dandekar, Abhaya

    2014-01-01

    Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC), implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF). In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

  13. Evolutionary history of glucose-6-phosphatase encoding genes in vertebrate lineages: towards a better understanding of the functions of multiple duplicates.

    Science.gov (United States)

    Marandel, Lucie; Panserat, Stéphane; Plagnes-Juan, Elisabeth; Arbenoits, Eva; Soengas, José Luis; Bobe, Julien

    2017-05-02

    Glucose-6-phosphate (G6pc) is a key enzyme involved in the regulation of the glucose homeostasis. The present study aims at revisiting and clarifying the evolutionary history of g6pc genes in vertebrates. g6pc duplications happened by successive rounds of whole genome duplication that occurred during vertebrate evolution. g6pc duplicated before or around Osteichthyes/Chondrichthyes radiation, giving rise to g6pca and g6pcb as a consequence of the second vertebrate whole genome duplication. g6pca was lost after this duplication in Sarcopterygii whereas both g6pca and g6pcb then duplicated as a consequence of the teleost-specific whole genome duplication. One g6pca duplicate was lost after this duplication in teleosts. Similarly one g6pcb2 duplicate was lost at least in the ancestor of percomorpha. The analysis of the evolution of spatial expression patterns of g6pc genes in vertebrates showed that all g6pc were mainly expressed in intestine and liver whereas teleost-specific g6pcb2 genes were mainly and surprisingly expressed in brain and heart. g6pcb2b, one gene previously hypothesised to be involved in the glucose intolerant phenotype in trout, was unexpectedly up-regulated (as it was in liver) by carbohydrates in trout telencephalon without showing significant changes in other brain regions. This up-regulation is in striking contrast with expected glucosensing mechanisms suggesting that its positive response to glucose relates to specific unknown processes in this brain area. Our results suggested that the fixation and the divergence of g6pc duplicated genes during vertebrates' evolution may lead to adaptive novelty and probably to the emergence of novel phenotypes related to glucose homeostasis.

  14. Sphingolipid base modifying enzymes in sunflower (Helianthus annuus): cloning and characterization of a C4-hydroxylase gene and a new paralogous Δ8-desaturase gene.

    Science.gov (United States)

    Moreno-Pérez, Antonio J; Martínez-Force, Enrique; Garcés, Rafael; Salas, Joaquín J

    2011-05-15

    Sphingolipids are components of plant cell membranes that participate in the regulation of important physiological processes. Unlike their animal counterparts, plant sphingolipids are characterized by high levels of base C4-hydroxylation. Moreover, desaturation at the Δ8 position predominates over the Δ4 desaturation typically found in animal sphingolipids. These modifications are due to the action of C4-hydroxylases and Δ8-long chain base desaturases, and they are important for complex sphingolipids finally becoming functional. The long chain bases of sunflower sphingolipids have high levels of hydroxylated and unsaturated moieties. Here, a C4-long chain base hydroxylase was functionally characterized in sunflower plant, an enzyme that could complement the sur2Δ mutation when heterologously expressed in this yeast mutant deficient in hydroxylation. This hydroxylase was ubiquitously expressed in sunflower, with the highest levels found in the developing cotyledons. In addition, we identified a new Δ8-long base chain desaturase gene that displays strong homology to a previously reported desaturase gene. This desaturase was also expressed in yeast and was able to change the long chain base composition of the transformed host. We studied the expression of this desaturase and compared it with that of the other isoform described in sunflower. The desaturase form studied in this paper displayed higher expression levels in developing seeds. Copyright © 2010 Elsevier GmbH. All rights reserved.

  15. FGFR3 gene mutation plus GRB10 gene duplication in a patient with achondroplasia plus growth delay with prenatal onset.

    Science.gov (United States)

    Yuan, Haiming; Huang, Linhuan; Hu, Xizi; Li, Qian; Sun, Xiaofang; Xie, Yingjun; Kong, Shu; Wang, Xiaoman

    2016-07-02

    Achondroplasia is a well-defined and common bone dysplasia. Genotype- and phenotype-level correlations have been found between the clinical symptoms of achondroplasia and achondroplasia-specific FGFR3 mutations. A 2-year-old boy with clinical features consistent with achondroplasia and Silver-Russell syndrome-like symptoms was found to carry a mutation in the fibroblast growth factor receptor-3 (FGFR3) gene at c.1138G > A (p.Gly380Arg) and a de novo 574 kb duplication at chromosome 7p12.1 that involved the entire growth-factor receptor bound protein 10 (GRB10) gene. Using quantitative real-time PCR analysis, GRB10 was over-expressed, and, using enzyme-linked immunosorbent assays for IGF1 and IGF-binding protein-3 (IGFBP3), we found that IGF1 and IGFBP3 were low-expressed in this patient. We demonstrate that a combination of uncommon, rare and exceptional molecular defects related to the molecular bases of particular birth defects can be analyzed and diagnosed to potentially explain the observed variability in the combination of molecular defects.

  16. The chimeric gene CHRFAM7A, a partial duplication of the CHRNA7 gene, is a dominant negative regulator of α7*nAChR function.

    Science.gov (United States)

    Araud, Tanguy; Graw, Sharon; Berger, Ralph; Lee, Michael; Neveu, Estele; Bertrand, Daniel; Leonard, Sherry

    2011-10-15

    The human α7 neuronal nicotinic acetylcholine receptor gene (CHRNA7) is a candidate gene for schizophrenia and an important drug target for cognitive deficits in the disorder. Activation of the α7*nAChR, results in opening of the channel and entry of mono- and divalent cations, including Ca(2+), that presynaptically participates to neurotransmitter release and postsynaptically to down-stream changes in gene expression. Schizophrenic patients have low levels of α7*nAChR, as measured by binding of the ligand [(125)I]-α-bungarotoxin (I-BTX). The structure of the gene, CHRNA7, is complex. During evolution, CHRNA7 was partially duplicated as a chimeric gene (CHRFAM7A), which is expressed in the human brain and elsewhere in the body. The association between a 2bp deletion in CHRFAM7A and schizophrenia suggested that this duplicate gene might contribute to cognitive impairment. To examine the putative contribution of CHRFAM7A on receptor function, co-expression of α7 and the duplicate genes was carried out in cell lines and Xenopus oocytes. Expression of the duplicate alone yielded protein expression but no functional receptor and co-expression with α7 caused a significant reduction of the amplitude of the ACh-evoked currents. Reduced current amplitude was not correlated with a reduction of I-BTX binding, suggesting the presence of non-functional (ACh-silent) receptors. This hypothesis is supported by a larger increase of the ACh-evoked current by the allosteric modulator 1-(5-chloro-2,4-dimethoxy-phenyl)-3-(5-methyl-isoxazol-3-yl)-urea (PNU-120596) in cells expressing the duplicate than in the control. These results suggest that CHRFAM7A acts as a dominant negative modulator of CHRNA7 function and is critical for receptor regulation in humans. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Positive selection and ancient duplications in the evolution of class B floral homeotic genes of orchids and grasses

    Directory of Open Access Journals (Sweden)

    Koch Marcus A

    2009-04-01

    Full Text Available Abstract Background Positive selection is recognized as the prevalence of nonsynonymous over synonymous substitutions in a gene. Models of the functional evolution of duplicated genes consider neofunctionalization as key to the retention of paralogues. For instance, duplicate transcription factors are specifically retained in plant and animal genomes and both positive selection and transcriptional divergence appear to have played a role in their diversification. However, the relative impact of these two factors has not been systematically evaluated. Class B MADS-box genes, comprising DEF-like and GLO-like genes, encode developmental transcription factors essential for establishment of perianth and male organ identity in the flowers of angiosperms. Here, we contrast the role of positive selection and the known divergence in expression patterns of genes encoding class B-like MADS-box transcription factors from monocots, with emphasis on the family Orchidaceae and the order Poales. Although in the monocots these two groups are highly diverse and have a strongly canalized floral morphology, there is no information on the role of positive selection in the evolution of their distinctive flower morphologies. Published research shows that in Poales, class B-like genes are expressed in stamens and in lodicules, the perianth organs whose identity might also be specified by class B-like genes, like the identity of the inner tepals of their lily-like relatives. In orchids, however, the number and pattern of expression of class B-like genes have greatly diverged. Results The DEF-like genes from Orchidaceae form four well-supported, ancient clades of orthologues. In contrast, orchid GLO-like genes form a single clade of ancient orthologues and recent paralogues. DEF-like genes from orchid clade 2 (OMADS3-like genes are under less stringent purifying selection than the other orchid DEF-like and GLO-like genes. In comparison with orchids, purifying selection

  18. Rapid genome reshaping by multiple-gene loss after whole-genome duplication in teleost fish suggested by mathematical modeling

    Science.gov (United States)

    Sato, Yukuto; Tsukamoto, Katsumi; Nishida, Mutsumi

    2015-01-01

    Whole-genome duplication (WGD) is believed to be a significant source of major evolutionary innovation. Redundant genes resulting from WGD are thought to be lost or acquire new functions. However, the rates of gene loss and thus temporal process of genome reshaping after WGD remain unclear. The WGD shared by all teleost fish, one-half of all jawed vertebrates, was more recent than the two ancient WGDs that occurred before the origin of jawed vertebrates, and thus lends itself to analysis of gene loss and genome reshaping. Using a newly developed orthology identification pipeline, we inferred the post–teleost-specific WGD evolutionary histories of 6,892 protein-coding genes from nine phylogenetically representative teleost genomes on a time-calibrated tree. We found that rapid gene loss did occur in the first 60 My, with a loss of more than 70–80% of duplicated genes, and produced similar genomic gene arrangements within teleosts in that relatively short time. Mathematical modeling suggests that rapid gene loss occurred mainly by events involving simultaneous loss of multiple genes. We found that the subsequent 250 My were characterized by slow and steady loss of individual genes. Our pipeline also identified about 1,100 shared single-copy genes that are inferred to have become singletons before the divergence of clupeocephalan teleosts. Therefore, our comparative genome analysis suggests that rapid gene loss just after the WGD reshaped teleost genomes before the major divergence, and provides a useful set of marker genes for future phylogenetic analysis. PMID:26578810

  19. Insights into three whole-genome duplications gleaned from the Paramecium caudatum genome sequence.

    Science.gov (United States)

    McGrath, Casey L; Gout, Jean-Francois; Doak, Thomas G; Yanagi, Akira; Lynch, Michael

    2014-08-01

    Paramecium has long been a model eukaryote. The sequence of the Paramecium tetraurelia genome reveals a history of three successive whole-genome duplications (WGDs), and the sequences of P. biaurelia and P. sexaurelia suggest that these WGDs are shared by all members of the aurelia species complex. Here, we present the genome sequence of P. caudatum, a species closely related to the P. aurelia species group. P. caudatum shares only the most ancient of the three WGDs with the aurelia complex. We found that P. caudatum maintains twice as many paralogs from this early event as the P. aurelia species, suggesting that post-WGD gene retention is influenced by subsequent WGDs and supporting the importance of selection for dosage in gene retention. The availability of P. caudatum as an outgroup allows an expanded analysis of the aurelia intermediate and recent WGD events. Both the Guanine+Cytosine (GC) content and the expression level of preduplication genes are significant predictors of duplicate retention. We find widespread asymmetrical evolution among aurelia paralogs, which is likely caused by gradual pseudogenization rather than by neofunctionalization. Finally, cases of divergent resolution of intermediate WGD duplicates between aurelia species implicate this process acts as an ongoing reinforcement mechanism of reproductive isolation long after a WGD event. Copyright © 2014 by the Genetics Society of America.

  20. An ancient history of gene duplications, fusions and losses in the evolution of APOBEC3 mutators in mammals

    Science.gov (United States)

    2012-01-01

    Background The APOBEC3 (A3) genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals) already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure. PMID:22640020

  1. Zebrafish brd2a and brd2b are paralogous members of the bromodomain-ET (BET family of transcriptional coregulators that show structural and expression divergence

    Directory of Open Access Journals (Sweden)

    Bee Katharine J

    2008-04-01

    Full Text Available Abstract Background Brd2 belongs to the bromodomain-extraterminal domain (BET family of transcriptional co-regulators, and functions as a pivotal histone-directed recruitment scaffold in chromatin modification complexes affecting signal-dependent transcription. Brd2 facilitates expression of genes promoting proliferation and is implicated in apoptosis and in egg maturation and meiotic competence in mammals; it is also a susceptibility gene for juvenile myoclonic epilepsy (JME in humans. The brd2 ortholog in Drosophila is a maternal effect, embryonic lethal gene that regulates several homeotic loci, including Ultrabithorax. Despite its importance, there are few systematic studies of Brd2 developmental expression in any organism. To help elucidate both conserved and novel gene functions, we cloned and characterized expression of brd2 cDNAs in zebrafish, a vertebrate system useful for genetic analysis of development and disease, and for study of the evolution of gene families and functional diversity in chordates. Results We identify cDNAs representing two paralogous brd2 loci in zebrafish, brd2a on chromosome 19 and brd2b on chromosome 16. By sequence similarity, syntenic and phylogenetic analyses, we present evidence for structural divergence of brd2 after gene duplication in fishes. brd2 paralogs show potential for modular domain combinations, and exhibit distinct RNA expression patterns throughout development. RNA in situ hybridizations in oocytes and embryos implicate brd2a and brd2b as maternal effect genes involved in egg polarity and egg to embryo transition, and as zygotic genes important for development of the vertebrate nervous system and for morphogenesis and differentiation of the digestive tract. Patterns of brd2 developmental expression in zebrafish are consistent with its proposed role in Homeobox gene regulation. Conclusion Expression profiles of zebrafish brd2 paralogs support a role in vertebrate developmental patterning and

  2. Duplication of the IGFBP-2 gene in teleost fish: protein structure and functionality conservation and gene expression divergence.

    Directory of Open Access Journals (Sweden)

    Jianfeng Zhou

    growth and development primarily by binding to and inhibiting IGF actions in vivo. The duplicated IGFBP-2 genes may provide additional flexibility in the regulation of IGF activities.

  3. Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

    Directory of Open Access Journals (Sweden)

    Giao Ngoc Nguyen

    2017-08-01

    Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

  4. The house spider genome reveals an ancient whole-genome duplication during arachnid evolution.

    Science.gov (United States)

    Schwager, Evelyn E; Sharma, Prashant P; Clarke, Thomas; Leite, Daniel J; Wierschin, Torsten; Pechmann, Matthias; Akiyama-Oda, Yasuko; Esposito, Lauren; Bechsgaard, Jesper; Bilde, Trine; Buffry, Alexandra D; Chao, Hsu; Dinh, Huyen; Doddapaneni, HarshaVardhan; Dugan, Shannon; Eibner, Cornelius; Extavour, Cassandra G; Funch, Peter; Garb, Jessica; Gonzalez, Luis B; Gonzalez, Vanessa L; Griffiths-Jones, Sam; Han, Yi; Hayashi, Cheryl; Hilbrant, Maarten; Hughes, Daniel S T; Janssen, Ralf; Lee, Sandra L; Maeso, Ignacio; Murali, Shwetha C; Muzny, Donna M; Nunes da Fonseca, Rodrigo; Paese, Christian L B; Qu, Jiaxin; Ronshaugen, Matthew; Schomburg, Christoph; Schönauer, Anna; Stollewerk, Angelika; Torres-Oliva, Montserrat; Turetzek, Natascha; Vanthournout, Bram; Werren, John H; Wolff, Carsten; Worley, Kim C; Bucher, Gregor; Gibbs, Richard A; Coddington, Jonathan; Oda, Hiroki; Stanke, Mario; Ayoub, Nadia A; Prpic, Nikola-Michael; Flot, Jean-François; Posnien, Nico; Richards, Stephen; McGregor, Alistair P

    2017-07-31

    The duplication of genes can occur through various mechanisms and is thought to make a major contribution to the evolutionary diversification of organisms. There is increasing evidence for a large-scale duplication of genes in some chelicerate lineages including two rounds of whole genome duplication (WGD) in horseshoe crabs. To investigate this further, we sequenced and analyzed the genome of the common house spider Parasteatoda tepidariorum. We found pervasive duplication of both coding and non-coding genes in this spider, including two clusters of Hox genes. Analysis of synteny conservation across the P. tepidariorum genome suggests that there has been an ancient WGD in spiders. Comparison with the genomes of other chelicerates, including that of the newly sequenced bark scorpion Centruroides sculpturatus, suggests that this event occurred in the common ancestor of spiders and scorpions, and is probably independent of the WGDs in horseshoe crabs. Furthermore, characterization of the sequence and expression of the Hox paralogs in P. tepidariorum suggests that many have been subject to neo-functionalization and/or sub-functionalization since their duplication. Our results reveal that spiders and scorpions are likely the descendants of a polyploid ancestor that lived more than 450 MYA. Given the extensive morphological diversity and ecological adaptations found among these animals, rivaling those of vertebrates, our study of the ancient WGD event in Arachnopulmonata provides a new comparative platform to explore common and divergent evolutionary outcomes of polyploidization events across eukaryotes.

  5. Gene duplications and losses among vertebrate deoxyribonucleoside kinases of the non-TK1 Family

    DEFF Research Database (Denmark)

    Mutahir, Zeeshan; Christiansen, Louise Slot; Clausen, Anders R.

    2016-01-01

    , among vertebrates only four mammalian dNKs have been studied for their substrate specificity and kinetic properties. However, some vertebrates, such as fish, frogs, and birds, apparently possess a duplicated homolog of deoxycytidine kinase (dCK). In this study, we characterized a family of d...... substrate specificities and subcellular localization are likely the drivers behind the evolution of vertebrate dNKs...

  6. Divergence of the bZIP Gene Family in Strawberry, Peach, and Apple Suggests Multiple Modes of Gene Evolution after Duplication

    Directory of Open Access Journals (Sweden)

    Xiao-Long Wang

    2015-01-01

    Full Text Available The basic leucine zipper (bZIP transcription factors are the most diverse members of dimerizing transcription factors. In the present study, 50, 116, and 47 bZIP genes were identified in Malus domestica (apple, Prunus persica (peach, and Fragaria vesca (strawberry, respectively. Species-specific duplication was the main contributor to the large number of bZIPs observed in apple. After WGD in apple genome, orthologous bZIP genes corresponding to strawberry on duplicated regions in apple genome were retained. However, in peach ancestor, these syntenic regions were quickly lost or deleted. Maybe the positive selection contributed to the expansion of clade S to adapt to the development and environment stresses. In addition, purifying selection was mainly responsible for bZIP sequence-specific DNA binding. The analysis of orthologous pairs between chromosomes indicates that these orthologs derived from one gene duplication located on one of the nine ancient chromosomes in the Rosaceae. The comparative analysis of bZIP genes in three species provides information on the evolutionary fate of bZIP genes in apple and peach after they diverged from strawberry.

  7. An ancient duplication of exon 5 in the Snap25 gene is required for complex neuronal development/function.

    Directory of Open Access Journals (Sweden)

    Jenny U Johansson

    2008-11-01

    Full Text Available Alternative splicing is an evolutionary innovation to create functionally diverse proteins from a limited number of genes. SNAP-25 plays a central role in neuroexocytosis by bridging synaptic vesicles to the plasma membrane during regulated exocytosis. The SNAP-25 polypeptide is encoded by a single copy gene, but in higher vertebrates a duplication of exon 5 has resulted in two mutually exclusive splice variants, SNAP-25a and SNAP-25b. To address a potential physiological difference between the two SNAP-25 proteins, we generated gene targeted SNAP-25b deficient mouse mutants by replacing the SNAP-25b specific exon with a second SNAP-25a equivalent. Elimination of SNAP-25b expression resulted in developmental defects, spontaneous seizures, and impaired short-term synaptic plasticity. In adult mutants, morphological changes in hippocampus and drastically altered neuropeptide expression were accompanied by severe impairment of spatial learning. We conclude that the ancient exon duplication in the Snap25 gene provides additional SNAP-25-function required for complex neuronal processes in higher eukaryotes.

  8. A new resource for characterizing X-linked genes in Drosophila melanogaster: systematic coverage and subdivision of the X chromosome with nested, Y-linked duplications.

    Science.gov (United States)

    Cook, R Kimberley; Deal, Megan E; Deal, Jennifer A; Garton, Russell D; Brown, C Adam; Ward, Megan E; Andrade, Rachel S; Spana, Eric P; Kaufman, Thomas C; Cook, Kevin R

    2010-12-01

    Interchromosomal duplications are especially important for the study of X-linked genes. Males inheriting a mutation in a vital X-linked gene cannot survive unless there is a wild-type copy of the gene duplicated elsewhere in the genome. Rescuing the lethality of an X-linked mutation with a duplication allows the mutation to be used experimentally in complementation tests and other genetic crosses and it maps the mutated gene to a defined chromosomal region. Duplications can also be used to screen for dosage-dependent enhancers and suppressors of mutant phenotypes as a way to identify genes involved in the same biological process. We describe an ongoing project in Drosophila melanogaster to generate comprehensive coverage and extensive breakpoint subdivision of the X chromosome with megabase-scale X segments borne on Y chromosomes. The in vivo method involves the creation of X inversions on attached-XY chromosomes by FLP-FRT site-specific recombination technology followed by irradiation to induce large internal X deletions. The resulting chromosomes consist of the X tip, a medial X segment placed near the tip by an inversion, and a full Y. A nested set of medial duplicated segments is derived from each inversion precursor. We have constructed a set of inversions on attached-XY chromosomes that enable us to isolate nested duplicated segments from all X regions. To date, our screens have provided a minimum of 78% X coverage with duplication breakpoints spaced a median of nine genes apart. These duplication chromosomes will be valuable resources for rescuing and mapping X-linked mutations and identifying dosage-dependent modifiers of mutant phenotypes.

  9. Dissecting a Hidden Gene Duplication: The Arabidopsis thaliana SEC10 Locus

    Czech Academy of Sciences Publication Activity Database

    Vukašinović, Nemanja; Cvrčková, F.; Eliáš, M.; Cole, R.; Fowler, J.E.; Žárský, Viktor; Synek, Lukáš

    2014-01-01

    Roč. 9, č. 4 (2014) E-ISSN 1932-6203 R&D Projects: GA ČR GPP501/11/P853; GA ČR(CZ) GAP305/11/1629 Grant - others:GA MŠk ME10033 Institutional support: RVO:61389030 Keywords : WHOLE-GENOME * ARABIDOPSIS-THALIANA * RECENT SEGMENTAL DUPLICATIONS Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.234, year: 2014

  10. Whole-gene positive selection, elevated synonymous substitution rates, duplication, and indel evolution of the chloroplast clpP1 gene.

    Directory of Open Access Journals (Sweden)

    Per Erixon

    Full Text Available BACKGROUND: Synonymous DNA substitution rates in the plant chloroplast genome are generally relatively slow and lineage dependent. Non-synonymous rates are usually even slower due to purifying selection acting on the genes. Positive selection is expected to speed up non-synonymous substitution rates, whereas synonymous rates are expected to be unaffected. Until recently, positive selection has seldom been observed in chloroplast genes, and large-scale structural rearrangements leading to gene duplications are hitherto supposed to be rare. METHODOLOGY/PRINCIPLE FINDINGS: We found high substitution rates in the exons of the plastid clpP1 gene in Oenothera (the Evening Primrose family and three separate lineages in the tribe Sileneae (Caryophyllaceae, the Carnation family. Introns have been lost in some of the lineages, but where present, the intron sequences have substitution rates similar to those found in other introns of their genomes. The elevated substitution rates of clpP1 are associated with statistically significant whole-gene positive selection in three branches of the phylogeny. In two of the lineages we found multiple copies of the gene. Neighboring genes present in the duplicated fragments do not show signs of elevated substitution rates or positive selection. Although non-synonymous substitutions account for most of the increase in substitution rates, synonymous rates are also markedly elevated in some lineages. Whereas plant clpP1 genes experiencing negative (purifying selection are characterized by having very conserved lengths, genes under positive selection often have large insertions of more or less repetitive amino acid sequence motifs. CONCLUSIONS/SIGNIFICANCE: We found positive selection of the clpP1 gene in various plant lineages to correlated with repeated duplication of the clpP1 gene and surrounding regions, repetitive amino acid sequences, and increase in synonymous substitution rates. The present study sheds light on the

  11. RANGER-DTL 2.0: Rigorous Reconstruction of Gene-Family Evolution by Duplication, Transfer, and Loss.

    Science.gov (United States)

    Bansal, Mukul S; Kellis, Manolis; Kordi, Misagh; Kundu, Soumya

    2018-04-24

    RANGER-DTL 2.0 is a software program for inferring gene family evolution using Duplication-Transfer-Loss reconciliation. This new software is highly scalable and easy to use, and offers many new features not currently available in any other reconciliation program. RANGER-DTL 2.0 has a particular focus on reconciliation accuracy and can account for many sources of reconciliation uncertainty including uncertain gene tree rooting, gene tree topological uncertainty, multiple optimal reconciliations, and alternative event cost assignments. RANGER-DTL 2.0 is open-source and written in C ++ and Python. Pre-compiled executables, source code (open-source under GNU GPL), and a detailed manual are freely available from http://compbio.engr.uconn.edu/software/RANGER-DTL/. mukul.bansal@uconn.edu.

  12. Selection shaped the evolution of mouse androgen-binding protein (ABP) function and promoted the duplication of Abp genes.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2014-08-01

    In the present article, we summarize two aspects of our work on mouse ABP (androgen-binding protein): (i) the sexual selection function producing incipient reinforcement on the European house mouse hybrid zone, and (ii) the mechanism behind the dramatic expansion of the Abp gene region in the mouse genome. Selection unifies these two components, although the ways in which selection has acted differ. At the functional level, strong positive selection has acted on key sites on the surface of one face of the ABP dimer, possibly to influence binding to a receptor. A different kind of selection has apparently driven the recent and rapid expansion of the gene region, probably by increasing the amount of Abp transcript, in one or both of two ways. We have shown previously that groups of Abp genes behave as LCRs (low-copy repeats), duplicating as relatively large blocks of genes by NAHR (non-allelic homologous recombination). The second type of selection involves the close link between the accumulation of L1 elements and the expansion of the Abp gene family by NAHR. It is probably predicated on an initial selection for increased transcription of existing Abp genes and/or an increase in Abp gene number providing more transcriptional sites. Either or both could increase initial transcript production, a quantitative change similar to increasing the volume of a radio transmission. In closing, we also provide a note on Abp gene nomenclature.

  13. Identification of a rare 17p13.3 duplication including the BHLHA9 and YWHAE genes in a family with developmental delay and behavioural problems

    Directory of Open Access Journals (Sweden)

    Capra Valeria

    2012-10-01

    Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.

  14. Gene Duplication of the zebrafish kit ligand and partitioning of melanocyte development functions to kit ligand a.

    Directory of Open Access Journals (Sweden)

    Keith A Hultman

    2007-01-01

    Full Text Available The retention of particular genes after the whole genome duplication in zebrafish has given insights into how genes may evolve through partitioning of ancestral functions. We examine the partitioning of expression patterns and functions of two zebrafish kit ligands, kit ligand a (kitla and kit ligand b (kitlb, and discuss their possible coevolution with the duplicated zebrafish kit receptors (kita and kitb. In situ hybridizations show that kitla mRNA is expressed in the trunk adjacent to the notochord in the middle of each somite during stages of melanocyte migration and later expressed in the skin, when the receptor is required for melanocyte survival. kitla is also expressed in other regions complementary to kita receptor expression, including the pineal gland, tail bud, and ear. In contrast, kitlb mRNA is expressed in brain ventricles, ear, and cardinal vein plexus, in regions generally not complementary to either zebrafish kit receptor ortholog. However, like kitla, kitlb is expressed in the skin during stages consistent with melanocyte survival. Thus, it appears that kita and kitla have maintained congruent expression patterns, while kitb and kitlb have evolved divergent expression patterns. We demonstrate the interaction of kita and kitla by morpholino knockdown analysis. kitla morphants, but not kitlb morphants, phenocopy the null allele of kita, with defects for both melanocyte migration and survival. Furthermore, kitla morpholino, but not kitlb morpholino, interacts genetically with a sensitized allele of kita, confirming that kitla is the functional ligand to kita. Last, we examine kitla overexpression in embryos, which results in hyperpigmentation caused by an increase in the number and size of melanocytes. This hyperpigmentation is dependent on kita function. We conclude that following genome duplication, kita and kitla have maintained their receptor-ligand relationship, coevolved complementary expression patterns, and that

  15. Genomic Anatomy of a Premier Major Histocompatibility Complex Paralogous Region on Chromosome 1q21–q22

    Science.gov (United States)

    Shiina, Takashi; Ando, Asako; Suto, Yumiko; Kasai, Fumio; Shigenari, Atsuko; Takishima, Nobusada; Kikkawa, Eri; Iwata, Kyoko; Kuwano, Yuko; Kitamura, Yuka; Matsuzawa, Yumiko; Sano, Kazumi; Nogami, Masahiro; Kawata, Hisako; Li, Suyun; Fukuzumi, Yasuhito; Yamazaki, Masaaki; Tashiro, Hiroyuki; Tamiya, Gen; Kohda, Atsushi; Okumura, Katsuzumi; Ikemura, Toshimichi; Soeda, Eiichi; Mizuki, Nobuhisa; Kimura, Minoru; Bahram, Seiamak; Inoko, Hidetoshi

    2001-01-01

    Human chromosomes 1q21–q25, 6p21.3–22.2, 9q33–q34, and 19p13.1–p13.4 carry clusters of paralogous loci, to date best defined by the flagship 6p MHC region. They have presumably been created by two rounds of large-scale genomic duplications around the time of vertebrate emergence. Phylogenetically, the 1q21–25 region seems most closely related to the 6p21.3 MHC region, as it is only the MHC paralogous region that includes bona fide MHC class I genes, the CD1 and MR1 loci. Here, to clarify the genomic structure of this model MHC paralogous region as well as to gain insight into the evolutionary dynamics of the entire quadriplication process, a detailed analysis of a critical 1.7 megabase (Mb) region was performed. To this end, a composite, deep, YAC, BAC, and PAC contig encompassing all five CD1 genes and linking the centromeric +P5 locus to the telomeric KRTC7 locus was constructed. Within this contig a 1.1-Mb BAC and PAC core segment joining CD1D to FCER1A was fully sequenced and thoroughly analyzed. This led to the mapping of a total of 41 genes (12 expressed genes, 12 possibly expressed genes, and 17 pseudogenes), among which 31 were novel. The latter include 20 olfactory receptor (OR) genes, 9 of which are potentially expressed. Importantly, CD1, SPTA1, OR, and FCERIA belong to multigene families, which have paralogues in the other three regions. Furthermore, it is noteworthy that 12 of the 13 expressed genes in the 1q21–q22 region around the CD1 loci are immunologically relevant. In addition to CD1A-E, these include SPTA1, MNDA, IFI-16, AIM2, BL1A, FY and FCERIA. This functional convergence of structurally unrelated genes is reminiscent of the 6p MHC region, and perhaps represents the emergence of yet another antigen presentation gene cluster, in this case dedicated to lipid/glycolipid antigens rather than antigen-derived peptides. [The nucleotide sequence data reported in this paper have been submitted to the DDBJ, EMBL, and GenBank databases under

  16. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Science.gov (United States)

    Martínez-Alberola, Fernando; Del Campo, Eva M; Lázaro-Gimeno, David; Mezquita-Claramonte, Sergio; Molins, Arantxa; Mateu-Andrés, Isabel; Pedrola-Monfort, Joan; Casano, Leonardo M; Barreno, Eva

    2013-01-01

    Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt) in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  17. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Directory of Open Access Journals (Sweden)

    Fernando Martínez-Alberola

    Full Text Available Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  18. Characterization of two catalase-peroxidase-encoding genes in Fusarium verticillioides reveals differential responses to in vitro versus in planta oxidative challenges

    Science.gov (United States)

    Catalase/peroxidases (KatGs) are a superfamily of reactive oxygen species (ROS)-degrading enzymes believed to be horizontally acquired by ancient Ascomycota from bacteria. Subsequent gene duplication resulted in two KatG paralogs in ascomycetes: the widely distributed intracellular KatG1 group, and ...

  19. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

    Science.gov (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

    2016-01-01

    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  20. A case report: Becker muscular dystrophy presenting with epilepsy and dysgnosia induced by duplication mutation of Dystrophin gene.

    Science.gov (United States)

    Miao, Jing; Feng, Jia-Chun; Zhu, Dan; Yu, Xue-Fan

    2016-12-12

    Becker muscular dystrophy (BMD), a genetic disorder of X-linked recessive inheritance, typically presents with gradually progressive muscle weakness. The condition is caused by mutations of Dystrophin gene located at Xp21.2. Epilepsy is an infrequent manifestation of BMD, while cases of BMD with dysgnosia are extremely rare. We describe a 9-year-old boy with BMD, who presented with epilepsy and dysgnosia. Serum creatine kinase level was markedly elevated (3665 U/L). Wechsler intelligence tests showed a low intelligence quotient (IQ = 65). Electromyogram showed slight myogenic changes and skeletal muscle biopsy revealed muscular dystrophy. Immunohistochemical staining showed partial positivity of sarcolemma for dystrophin-N. Multiplex ligation-dependent probe amplification revealed a duplication mutation in exons 37-44 in the Dystrophin gene. The present case report helps to better understand the clinical and genetic features of BMD.

  1. Genomic evidence of gene duplication and adaptive evolution of Toll like receptors (TLR2 and TLR4) in reptiles.

    Science.gov (United States)

    Shang, Shuai; Zhong, Huaming; Wu, Xiaoyang; Wei, Qinguo; Zhang, Huanxin; Chen, Jun; Chen, Yao; Tang, Xuexi; Zhang, Honghai

    2018-04-01

    Toll-like receptors (TLRs) encoded by the TLR multigene family play an important role in initial pathogen recognition in vertebrates. Among the TLRs, TLR2 and TLR4 may be of particular importance to reptiles. In order to study the evolutionary patterns and structural characteristics of TLRs, we explored the available genomes of several representative members of reptiles. 25 TLR2 genes and 19 TLR4 genes from reptiles were obtained in this study. Phylogenetic results showed that the TLR2 gene duplication occurred in several species. Evolutionary analysis by at least two methods identified 30 and 13 common positively selected codons in TLR2 and TLR4, respectively. Most positively selected sites of TLR2 and TLR4 were located in the Leucine-rich repeat (LRRs). Branch model analysis showed that TLR2 genes were under different evolutionary forces in reptiles, while the TLR4 genes showed no significant selection pressure. The different evolutionary adaptation of TLR2 and TLR4 among the reptiles might be due to their different function in recognizing bacteria. Overall, we explored the structure and evolution of TLR2 and TLR4 genes in reptiles for the first time. Our study revealed valuable information regarding TLR2 and TLR4 in reptiles, and provided novel insights into the conservation concern of natural populations. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. A case report of two male siblings with autism and duplication of Xq13-q21, a region including three genes predisposing for autism.

    Science.gov (United States)

    Wentz, Elisabet; Vujic, Mihailo; Kärrstedt, Ewa-Lotta; Erlandsson, Anna; Gillberg, Christopher

    2014-05-01

    Autism spectrum disorder, severe behaviour problems and duplication of the Xq12 to Xq13 region have recently been described in three male relatives. To describe the psychiatric comorbidity and dysmorphic features, including craniosynostosis, of two male siblings with autism and duplication of the Xq13 to Xq21 region, and attempt to narrow down the number of duplicated genes proposed to be leading to global developmental delay and autism. We performed DNA sequencing of certain exons of the TWIST1 gene, the FGFR2 gene and the FGFR3 gene. We also performed microarray analysis of the DNA. In addition to autism, the two male siblings exhibited severe learning disability, self-injurious behaviour, temper tantrums and hyperactivity, and had no communicative language. Chromosomal analyses were normal. Neither of the two siblings showed mutations of the sequenced exons known to produce craniosynostosis. The microarray analysis detected an extra copy of a region on the long arm of chromosome X, chromosome band Xq13.1-q21.1. Comparison of our two cases with previously described patients allowed us to identify three genes predisposing for autism in the duplicated chromosomal region. Sagittal craniosynostosis is also a new finding linked to the duplication.

  3. Deletion/duplication mutation screening of TP53 gene in patients with transitional cell carcinoma of urinary bladder using multiplex ligation-dependent probe amplification.

    Science.gov (United States)

    Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba

    2016-02-01

    Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  4. Parameters of proteome evolution from histograms of amino-acid sequence identities of paralogous proteins

    Directory of Open Access Journals (Sweden)

    Yan Koon-Kiu

    2007-11-01

    Full Text Available Abstract Background The evolution of the full repertoire of proteins encoded in a given genome is mostly driven by gene duplications, deletions, and sequence modifications of existing proteins. Indirect information about relative rates and other intrinsic parameters of these three basic processes is contained in the proteome-wide distribution of sequence identities of pairs of paralogous proteins. Results We introduce a simple mathematical framework based on a stochastic birth-and-death model that allows one to extract some of this information and apply it to the set of all pairs of paralogous proteins in H. pylori, E. coli, S. cerevisiae, C. elegans, D. melanogaster, and H. sapiens. It was found that the histogram of sequence identities p generated by an all-to-all alignment of all protein sequences encoded in a genome is well fitted with a power-law form ~ p-γ with the value of the exponent γ around 4 for the majority of organisms used in this study. This implies that the intra-protein variability of substitution rates is best described by the Gamma-distribution with the exponent α ≈ 0.33. Different features of the shape of such histograms allow us to quantify the ratio between the genome-wide average deletion/duplication rates and the amino-acid substitution rate. Conclusion We separately measure the short-term ("raw" duplication and deletion rates rdup∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsgaKjabbwha1jabbchaWbqaaiabgEHiQaaaaaa@3283@, rdel∗ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGacaGaaiaabeqaaeqabiWaaaGcbaGaemOCai3aa0baaSqaaiabbsga

  5. Tandem duplication of 11p12-p13 in a child with borderline development delay and eye abnormalities: dose effect of the PAX6 gene product?

    NARCIS (Netherlands)

    Aalfs, C. M.; Fantes, J. A.; Wenniger-Prick, L. J.; Sluijter, S.; Hennekam, R. C.; van Heyningen, V.; Hoovers, J. M.

    1997-01-01

    We report on a girl with a duplication of chromosome band 11p12-->13, which includes the Wilms tumor gene (WT1) and the aniridia gene (PAX6). The girl had borderline developmental delay, mild facial anomalies, and eye abnormalities. Eye findings were also present in most of the 11 other published

  6. Plasticity and innovation of regulatory mechanisms underlying seed oil content mediated by duplicated genes in the palaeopolyploid soybean.

    Science.gov (United States)

    Zhang, Dajian; Zhao, Meixia; Li, Shuai; Sun, Lianjun; Wang, Weidong; Cai, Chunmei; Dierking, Emily C; Ma, Jianxin

    2017-06-01

    Many plants have undergone whole genome duplication (WGD). However, how regulatory networks underlying a particular trait are reshaped in polyploids has not been experimentally investigated. Here we show that the regulatory pathways modulating seed oil content, which involve WRINKLED1 (WRI1), LEAFY COTYLEDON1 (LEC1), and LEC2 in Arabidopsis, have been modified in the palaeopolyploid soybean. Such modifications include functional reduction of GmWRI1b of the GmWRI1a/GmWRI1b homoeologous pair relevant to WRI1, complementary non-allelic dosage effects of the GmLEC1a/GmLEC1b homoeologous pair relevant to LEC1, pseudogenization of the singleton GmLEC2 relevant to LEC2, and the rise of the LEC2-like function of GmABI3b, contrasting to its homoeolog GmABI3a, which maintains the ABSCISIC ACID INSENSITIVE 3 (ABI3)-like function in modulating seed maturation and dormancy. The function of GmABI3b in modulating seed oil biosynthesis was fulfilled by direct binding to a RY (CATGCA) cis-regulatory element in the GmWRI1a promoter, which was absent in the GmWRI1b promoter, resulting in reduction of the GmWRI1b expression. Nevertheless, the three regulators each exhibited similar intensities of purifying selection to their respective duplicates since these pairs were formed by a WGD event that is proposed to have occurred approximately 13 million years ago (mya), suggesting that the differentiation in spatiotemporal expression between the duplicated genes is more likely to be the outcome of neutral variation in regulatory sequences. This study thus exemplifies the plasticity, dynamics, and novelty of regulatory networks mediated by WGD. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  7. Study of duplication 24bp of ARX gene among patients presenting a Mental Retardation with a syndromic and non syndromic forms

    International Nuclear Information System (INIS)

    Essouissi, Imen

    2006-01-01

    Mental Retardation (MR) is the most frequent handicap. It touches 3% of the general population. The genetic causes of this handicap account for 40% of these cases. ARX gene (Aristaless related homeobox gene) belongs to the family of the genes homeobox located in Xp22.1. It is considered as the most frequently muted gene after the FMR1 gene. It is implicated in various forms of syndromic and nonsyndromic MR. Several types of mutation were identified on the level of this gene, including deletions/insertions, duplications, missense and nonsense mutations, responsible for a wide spectrum of phenotypes. The goal of this work is to seek the most frequent change of gene ARX: duplication 24pb (at the origin of an expansion of the field poly has protein ARX in the position 144-155AA) among Tunisian boys presenting in particular family forms of non specific MR, sporadic forms of non specific MR like certain patients presenting a West syndrome.To prove the duplication of 24 Pb, we used in this work the Pcr technique. The change of duplication 24pb was not found in our series, this could be explained by the low number of cases family studied (38 families) and by the absence of connection studies accusing a mode of transmission related to X chromosome in particular for the sporadic cases. (Author)

  8. Sox genes in grass carp (Ctenopharyngodon idella) with their implications for genome duplication and evolution

    OpenAIRE

    Zhong , Lei; Yu , Xiaomu; Tong , Jingou

    2006-01-01

    Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella), one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes h...

  9. Enteric Duplication.

    Science.gov (United States)

    Jeziorczak, Paul M; Warner, Brad W

    2018-03-01

    Enteric duplications have been described throughout the entire gastrointestinal tract. The usual perinatal presentation is an abdominal mass. Duplications associated with the foregut have associated respiratory symptoms, whereas duplications in the midgut and hindgut can present with obstructive symptoms, perforation, nausea, emesis, hemorrhage, or be asymptomatic, and identified as an incidental finding. These are differentiated from other cystic lesions by the presence of a normal gastrointestinal mucosal epithelium. Enteric duplications are located on the mesenteric side of the native structures and are often singular with tubular or cystic characteristics. Management of enteric duplications often requires operative intervention with preservation of the native blood supply and intestine. These procedures are usually very well tolerated with low morbidity.

  10. The zebrafish genome: a review and msx gene case study.

    Science.gov (United States)

    Postlethwait, J H

    2006-01-01

    Zebrafish is one of several important teleost models for understanding principles of vertebrate developmental, molecular, organismal, genetic, evolutionary, and genomic biology. Efficient investigation of the molecular genetic basis of induced mutations depends on knowledge of the zebrafish genome. Principles of zebrafish genomic analysis, including gene mapping, ortholog identification, conservation of syntenies, genome duplication, and evolution of duplicate gene function are discussed here using as a case study the zebrafish msxa, msxb, msxc, msxd, and msxe genes, which together constitute zebrafish orthologs of tetrapod Msx1, Msx2, and Msx3. Genomic analysis suggests orthologs for this difficult to understand group of paralogs.

  11. Single-copy genes define a conserved order between rice and wheat for understanding differences caused by duplication, deletion, and transposition of genes.

    Science.gov (United States)

    Singh, Nagendra K; Dalal, Vivek; Batra, Kamlesh; Singh, Binay K; Chitra, G; Singh, Archana; Ghazi, Irfan A; Yadav, Mahavir; Pandit, Awadhesh; Dixit, Rekha; Singh, Pradeep K; Singh, Harvinder; Koundal, Kirpa R; Gaikwad, Kishor; Mohapatra, Trilochan; Sharma, Tilak R

    2007-01-01

    The high-quality rice genome sequence is serving as a reference for comparative genome analysis in crop plants, especially cereals. However, early comparisons with bread wheat showed complex patterns of conserved synteny (gene content) and colinearity (gene order). Here, we show the presence of ancient duplicated segments in the progenitor of wheat, which were first identified in the rice genome. We also show that single-copy (SC) rice genes, those representing unique matches with wheat expressed sequence tag (EST) unigene contigs in the whole rice genome, show more than twice the proportion of genes mapping to syntenic wheat chromosome as compared to the multicopy (MC) or duplicated rice genes. While 58.7% of the 1,244 mapped SC rice genes were located in single syntenic wheat chromosome groups, the remaining 41.3% were distributed randomly to the other six non-syntenic wheat groups. This could only be explained by a background dispersal of genes in the genome through transposition or other unknown mechanism. The breakdown of rice-wheat synteny due to such transpositions was much greater near the wheat centromeres. Furthermore, the SC rice genes revealed a conserved primordial gene order that gives clues to the origin of rice and wheat chromosomes from a common ancestor through polyploidy, aneuploidy, centromeric fusions, and translocations. Apart from the bin-mapped wheat EST contigs, we also compared 56,298 predicted rice genes with 39,813 wheat EST contigs assembled from 409,765 EST sequences and identified 7,241 SC rice gene homologs of wheat. Based on the conserved colinearity of 1,063 mapped SC rice genes across the bins of individual wheat chromosomes, we predicted the wheat bin location of 6,178 unmapped SC rice gene homologs and validated the location of 213 of these in the telomeric bins of 21 wheat chromosomes with 35.4% initial success. This opens up the possibility of directed mapping of a large number of conserved SC rice gene homologs in wheat

  12. Decoding the Divergent Subcellular Location of Two Highly Similar Paralogous LEA Proteins

    Directory of Open Access Journals (Sweden)

    Marie-Hélène Avelange-Macherel

    2018-05-01

    Full Text Available Many mitochondrial proteins are synthesized as precursors in the cytosol with an N-terminal mitochondrial targeting sequence (MTS which is cleaved off upon import. Although much is known about import mechanisms and MTS structural features, the variability of MTS still hampers robust sub-cellular software predictions. Here, we took advantage of two paralogous late embryogenesis abundant proteins (LEA from Arabidopsis with different subcellular locations to investigate structural determinants of mitochondrial import and gain insight into the evolution of the LEA genes. LEA38 and LEA2 are short proteins of the LEA_3 family, which are very similar along their whole sequence, but LEA38 is targeted to mitochondria while LEA2 is cytosolic. Differences in the N-terminal protein sequences were used to generate a series of mutated LEA2 which were expressed as GFP-fusion proteins in leaf protoplasts. By combining three types of mutation (substitution, charge inversion, and segment replacement, we were able to redirect the mutated LEA2 to mitochondria. Analysis of the effect of the mutations and determination of the LEA38 MTS cleavage site highlighted important structural features within and beyond the MTS. Overall, these results provide an explanation for the likely loss of mitochondrial location after duplication of the ancestral gene.

  13. The YsrS Paralog DygS Has the Capacity To Activate Expression of the Yersinia enterocolitica Ysa Type III Secretion System.

    Science.gov (United States)

    Walker, Kimberly A; Griggs, Lauren A; Obrist, Markus; Bode, Addys; Summers, R Patrick; Miller, Virginia L

    2016-06-15

    The Yersinia enterocolitica Ysa type III secretion system (T3SS) is associated with intracellular survival, and, like other characterized T3SSs, it is tightly controlled. Expression of the ysa genes is only detected following growth at low temperatures (26°C) and in high concentrations of sodium chloride (290 mM) in the medium. The YsrSTR phosphorelay (PR) system is required for ysa expression and likely responds to NaCl. During our investigations into the Ysr PR system, we discovered that genes YE3578 and YE3579 are remarkably similar to ysrR and ysrS, respectively, and are probably a consequence of a gene duplication event. The amino acid differences between YE3578 and ysrR are primarily clustered into two short regions. The differences between YE3579 and ysrS are nearly all located in the periplasmic sensing domain; the cytoplasmic domains are 98% identical. We investigated whether these paralogs were capable of activating ysa gene expression. We found that the sensor paralog, named DygS, is capable of compensating for loss of ysrS, but the response regulator paralog, DygR, cannot complement a ysrR gene deletion. In addition, YsrR, but not DygR, interacts with the histidine phosphorelay protein YsrT. Thus, DygS likely activates ysa gene expression in response to a signal other than NaCl and provides an example of a phosphorelay system in which two sensor kinases feed into the same regulatory pathway. All organisms need mechanisms to promote survival in changing environments. Prokaryotic phosphorelay systems are minimally comprised of a histidine kinase (HK) that senses an extracellular stimulus and a response regulator (RR) but can contain three or more proteins. Through gene duplication, a unique hybrid HK was created. We show that, while the hybrid appears to retain all of the phosphorelay functions, it responds to a different signal than the original. Both HKs transmit the signal to the same RR, which activates a promoter that transcribes a set of genes

  14. Yeast Interspecies Comparative Proteomics Reveals Divergence in Expression Profiles and Provides Insights into Proteome Resource Allocation and Evolutionary Roles of Gene Duplication*

    Science.gov (United States)

    Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke

    2016-01-01

    Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under

  15. Evolution of trappin genes in mammals

    Directory of Open Access Journals (Sweden)

    Furutani Yutaka

    2010-01-01

    Full Text Available Abstract Background Trappin is a multifunctional host-defense peptide that has antiproteolytic, antiinflammatory, and antimicrobial activities. The numbers and compositions of trappin paralogs vary among mammalian species: human and sheep have a single trappin-2 gene; mouse and rat have no trappin gene; pig and cow have multiple trappin genes; and guinea pig has a trappin gene and two other derivativegenes. Independent duplications of trappin genes in pig and cow were observed recently after the species were separated. To determine whether these trappin gene duplications are restricted only to certain mammalian lineages, we analyzed recently-developed genome databases for the presence of duplicate trappin genes. Results The database analyses revealed that: 1 duplicated trappin multigenes were found recently in the nine-banded armadillo; 2 duplicated two trappin genes had been found in the Afrotherian species (elephant, tenrec, and hyrax since ancient days; 3 a single trappin-2 gene was found in various eutherians species; and 4 no typical trappin gene has been found in chicken, zebra finch, and opossum. Bayesian analysis estimated the date of the duplication of trappin genes in the Afrotheria, guinea pig, armadillo, cow, and pig to be 244, 35, 11, 13, and 3 million-years ago, respectively. The coding regions of trappin multigenes of almadillo, bovine, and pig evolved much faster than the noncoding exons, introns, and the flanking regions, showing that these genes have undergone accelerated evolution, and positive Darwinian selection was observed in pig-specific trappin paralogs. Conclusion These results suggest that trappin is an eutherian-specific molecule and eutherian genomes have the potential to form trappin multigenes.

  16. The fate of the duplicated androgen receptor in fishes: a late neofunctionalization event?

    Directory of Open Access Journals (Sweden)

    Haendler Bernard

    2008-12-01

    Full Text Available Abstract Background Based on the observation of an increased number of paralogous genes in teleost fishes compared with other vertebrates and on the conserved synteny between duplicated copies, it has been shown that a whole genome duplication (WGD occurred during the evolution of Actinopterygian fish. Comparative phylogenetic dating of this duplication event suggests that it occurred early on, specifically in teleosts. It has been proposed that this event might have facilitated the evolutionary radiation and the phenotypic diversification of the teleost fish, notably by allowing the sub- or neo-functionalization of many duplicated genes. Results In this paper, we studied in a wide range of Actinopterygians the duplication and fate of the androgen receptor (AR, NR3C4, a nuclear receptor known to play a key role in sex-determination in vertebrates. The pattern of AR gene duplication is consistent with an early WGD event: it has been duplicated into two genes AR-A and AR-B after the split of the Acipenseriformes from the lineage leading to teleost fish but before the divergence of Osteoglossiformes. Genomic and syntenic analyses in addition to lack of PCR amplification show that one of the duplicated copies, AR-B, was lost in several basal Clupeocephala such as Cypriniformes (including the model species zebrafish, Siluriformes, Characiformes and Salmoniformes. Interestingly, we also found that, in basal teleost fish (Osteoglossiformes and Anguilliformes, the two copies remain very similar, whereas, specifically in Percomorphs, one of the copies, AR-B, has accumulated substitutions in both the ligand binding domain (LBD and the DNA binding domain (DBD. Conclusion The comparison of the mutations present in these divergent AR-B with those known in human to be implicated in complete, partial or mild androgen insensitivity syndrome suggests that the existence of two distinct AR duplicates may be correlated to specific functional differences that may be

  17. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Origin, evolution, and population genetics of the selfish Segregation Distorter gene duplication in European and African populations of Drosophila melanogaster.

    Science.gov (United States)

    Brand, Cara L; Larracuente, Amanda M; Presgraves, Daven C

    2015-05-01

    Meiotic drive elements are a special class of evolutionarily "selfish genes" that subvert Mendelian segregation to gain preferential transmission at the expense of homologous loci. Many drive elements appear to be maintained in populations as stable polymorphisms, their equilibrium frequencies determined by the balance between drive (increasing frequency) and selection (decreasing frequency). Here we show that a classic, seemingly balanced, drive system is instead characterized by frequent evolutionary turnover giving rise to dynamic, rather than stable, equilibrium frequencies. The autosomal Segregation Distorter (SD) system of the fruit fly Drosophila melanogaster is a selfish coadapted meiotic drive gene complex in which the major driver corresponds to a partial duplication of the gene Ran-GTPase activating protein (RanGAP). SD chromosomes segregate at similar, low frequencies of 1-5% in natural populations worldwide, consistent with a balanced polymorphism. Surprisingly, our population genetic analyses reveal evidence for parallel, independent selective sweeps of different SD chromosomes in populations on different continents. These findings suggest that, rather than persisting at a single stable equilibrium, SD chromosomes turn over frequently within populations. © 2015 The Author(s). Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.

  19. TRPV5 and TRPV6 in transcellular Ca(2+) transport: regulation, gene duplication, and polymorphisms in African populations.

    Science.gov (United States)

    Peng, Ji-Bin

    2011-01-01

    TRPV5 and TRPV6 are unique members of the TRP super family. They are highly selective for Ca(2+) ions with multiple layers of Ca(2+)-dependent inactivation mechanisms, expressed at the apical membrane of Ca(2+) transporting epithelia, and robustly responsive to 1,25-dihydroxivitamin D(3). These features are well suited for their roles as Ca(2+) entry channels in the first step of transcellular Ca(2+) transport pathways, which are involved in intestinal absorption, renal reabsorption of Ca(2+), placental transfer of Ca(2+) to fetus, and many other processes. While TRPV6 is more broadly expressed in a variety of tissues such as esophagus, stomach, small intestine, colon, kidney, placenta, pancreas, prostate, uterus, salivary gland, and sweat gland, TRPV5 expression is relatively restricted to the distal convoluted tubule and connecting tubule of the kidney. There is only one TRPV6-like gene in fish and birds in comparison to both TRPV5 and TRPV6 genes in mammals, indicating TRPV5 gene was likely generated from duplication of TRPV6 gene during the evolution of mammals to meet the needs of complex renal function. TRPV5 and TRPV6 are subjected to vigorous regulations under physiological, pathological, and therapeutic conditions. The elevated TRPV6 level in malignant tumors such as prostate and breast cancers makes it a potential therapeutic target. TRPV6, and to a lesser extent TRPV5, exhibit unusually high levels of single nucleotide polymorphisms (SNPs) in African populations as compared to other populations, indicating TRPV6 gene was under selective pressure during or after humans migrated out of Africa. The SNPs of TRPV6 and TRPV5 likely contribute to the Ca(2+) conservation mechanisms in African populations.

  20. Reverse genetic characterization of two paralogous acetoacetyl CoA thiolase genes in Arabidopsis reveals their importance in plant growth and development

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Huanan; Song, Zhihong; Nikolau, Basil J.

    2012-03-31

    Acetoacetyl CoA thiolase (AACT, EC 2.3.1.9) catalyzes the condensation of two acetyl CoA molecules to form acetoacetyl CoA. Two AACT‐encoding genes, At5g47720 (AACT1) and At5g48230 (AACT2), were functionally identified in the Arabidopsis genome by direct enzymological assays and functional expression in yeast. Promoter::GUS fusion experiments indicated that AACT1 is primarily expressed in the vascular system and AACT2 is highly expressed in root tips, young leaves, top stems and anthers. Characterization of T‐DNA insertion mutant alleles at each AACT locus established that AACT2 function is required for embryogenesis and for normal male gamete transmission. In contrast, plants lacking AACT1 function are completely viable and show no apparent growth phenotypes, indicating that AACT1 is functionally redundant with respect to AACT2 function. RNAi lines that express reduced levels of AACT2 show pleiotropic phenotypes, including reduced apical dominance, elongated life span and flowering duration, sterility, dwarfing, reduced seed yield and shorter root length. Microscopic analysis reveals that the reduced stature is caused by a reduction in cell size and fewer cells, and male sterility is caused by loss of the pollen coat and premature degeneration of the tapetal cells. Biochemical analyses established that the roots of AACT2 RNAi plants show quantitative and qualitative alterations in phytosterol profiles. These phenotypes and biochemical alterations are reversed when AACT2 RNAi plants are grown in the presence of mevalonate, which is consistent with the role of AACT2 in generating the bulk of the acetoacetyl CoA precursor required for the cytosol‐localized, mevalonate‐derived isoprenoid biosynthetic pathway.

  1. Tissue-specific differential induction of duplicated fatty acid-binding protein genes by the peroxisome proliferator, clofibrate, in zebrafish (Danio rerio

    Directory of Open Access Journals (Sweden)

    Venkatachalam Ananda B

    2012-07-01

    Full Text Available Abstract Background Force, Lynch and Conery proposed the duplication-degeneration-complementation (DDC model in which partitioning of ancestral functions (subfunctionalization and acquisition of novel functions (neofunctionalization were the two primary mechanisms for the retention of duplicated genes. The DDC model was tested by analyzing the transcriptional induction of the duplicated fatty acid-binding protein (fabp genes by clofibrate in zebrafish. Clofibrate is a specific ligand of the peroxisome proliferator-activated receptor (PPAR; it activates PPAR which then binds to a peroxisome proliferator response element (PPRE to induce the transcriptional initiation of genes primarily involved in lipid homeostasis. Zebrafish was chosen as our model organism as it has many duplicated genes owing to a whole genome duplication (WGD event that occurred ~230-400 million years ago in the teleost fish lineage. We assayed the steady-state levels of fabp mRNA and heterogeneous nuclear RNA (hnRNA transcripts in liver, intestine, muscle, brain and heart for four sets of duplicated fabp genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, fabp10a/fabp10b and fabp11a/fabp11b in zebrafish fed different concentrations of clofibrate. Result Electron microscopy showed an increase in the number of peroxisomes and mitochondria in liver and heart, respectively, in zebrafish fed clofibrate. Clofibrate also increased the steady-state level of acox1 mRNA and hnRNA transcripts in different tissues, a gene with a functional PPRE. These results demonstrate that zebrafish is responsive to clofibrate, unlike some other fishes. The levels of fabp mRNA and hnRNA transcripts for the four sets of duplicated fabp genes was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. The level of hnRNA coded by a gene is an indirect estimate of the rate of transcriptional initiation of that gene. Clofibrate increased the steady-state level of fabp mRNAs and hn

  2. Duplicate editorial on duplicate publication.

    Science.gov (United States)

    Corson, Stephen L; Decherney, Alan H

    2005-04-01

    The authors define and discuss the various forms taken by duplicate publications, and provide suggested remedies to help authors, editors, reviewers, and readers avoid this form of internal plagiarism.

  3. Duplication of Dio3 genes in teleost fish and their divergent expression in skin during flatfish metamorphosis.

    Science.gov (United States)

    Alves, R N; Cardoso, J C R; Harboe, T; Martins, R S T; Manchado, M; Norberg, B; Power, D M

    2017-05-15

    Deiodinase 3 (Dio3) plays an essential role during early development in vertebrates by controlling tissue thyroid hormone (TH) availability. The Atlantic halibut (Hippoglossus hippoglossus) possesses duplicate dio3 genes (dio3a and dio3b). Expression analysis indicates that dio3b levels change in abocular skin during metamorphosis and this suggests that this enzyme is associated with the divergent development of larval skin to the juvenile phenotype. In larvae exposed to MMI, a chemical that inhibits TH production, expression of dio3b in ocular skin is significantly up-regulated suggesting that THs normally modulate this genes expression during this developmental event. The molecular basis for divergent dio3a and dio3b expression and responsiveness to MMI treatment is explained by the multiple conserved TREs in the proximal promoter region of teleost dio3b and their absence from the promoter of dio3a. We propose that the divergent expression of dio3 in ocular and abocular skin during halibut metamorphosis contributes to the asymmetric pigment development in response to THs. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Functional diversification of duplicated CYC2 clade genes in regulation of inflorescence development in Gerbera hybrida (Asteraceae).

    Science.gov (United States)

    Juntheikki-Palovaara, Inka; Tähtiharju, Sari; Lan, Tianying; Broholm, Suvi K; Rijpkema, Anneke S; Ruonala, Raili; Kale, Liga; Albert, Victor A; Teeri, Teemu H; Elomaa, Paula

    2014-09-01

    The complex inflorescences (capitula) of Asteraceae consist of different types of flowers. In Gerbera hybrida (gerbera), the peripheral ray flowers are bilaterally symmetrical and lack functional stamens while the central disc flowers are more radially symmetrical and hermaphroditic. Proteins of the CYC2 subclade of the CYC/TB1-like TCP domain transcription factors have been recruited several times independently for parallel evolution of bilaterally symmetrical flowers in various angiosperm plant lineages, and have also been shown to regulate flower-type identity in Asteraceae. The CYC2 subclade genes in gerbera show largely overlapping gene expression patterns. At the level of single flowers, their expression domain in petals shows a spatial shift from the dorsal pattern known so far in species with bilaterally symmetrical flowers, suggesting that this change in expression may have evolved after the origin of Asteraceae. Functional analysis indicates that GhCYC2, GhCYC3 and GhCYC4 mediate positional information at the proximal-distal axis of the inflorescence, leading to differentiation of ray flowers, but that they also regulate ray flower petal growth by affecting cell proliferation until the final size and shape of the petals is reached. Moreover, our data show functional diversification for the GhCYC5 gene. Ectopic activation of GhCYC5 increases flower density in the inflorescence, suggesting that GhCYC5 may promote the flower initiation rate during expansion of the capitulum. Our data thus indicate that modification of the ancestral network of TCP factors has, through gene duplications, led to the establishment of new expression domains and to functional diversification. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  5. Gene fusions with lacZ by duplication insertion in the radioresistant bacterium Deinococcus radiodurans

    International Nuclear Information System (INIS)

    Lennon, E.; Minton, K.W.

    1990-01-01

    Deinococcus radiodurans is the most-studied species of a eubacterial family characterized by extreme resistance to DNA damage. We have focused on developing molecular biological techniques to investigate the genetics of this organism. We report construction of lacZ gene fusions by a method involving both in vitro splicing and the natural transformation of D. radiodurans. Numerous fusion strains were identified by expression of beta-galactosidase. Among these fusion strains, several were inducible by exposure to the DNA-damaging agent mitomycin C, and four of the inducible fusion constructs were cloned in Escherichia coli. Hybridization studies indicate that one of the damage-inducible genes contains a sequence reiterated throughout the D. radiodurans chromosome. Survival measurements show that two of the fusion strains have increased sensitivity to mitomycin C, suggesting that the fusions within these strains inactivate repair functions

  6. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals

    OpenAIRE

    Popova, Olga V.; Mikhailov, Kirill V.; Nikitin, Mikhail A.; Logacheva, Maria D.; Penin, Aleksey A.; Muntyan, Maria S.; Kedrova, Olga S.; Petrov, Nikolai B.; Panchin, Yuri V.; Aleoshin, Vladimir V.

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the earl...

  7. Population Level Purifying Selection and Gene Expression Shape Subgenome Evolution in Maize.

    Science.gov (United States)

    Pophaly, Saurabh D; Tellier, Aurélien

    2015-12-01

    The maize ancestor experienced a recent whole-genome duplication (WGD) followed by gene erosion which generated two subgenomes, the dominant subgenome (maize1) experiencing fewer deletions than maize2. We take advantage of available extensive polymorphism and gene expression data in maize to study purifying selection and gene expression divergence between WGD retained paralog pairs. We first report a strong correlation in nucleotide diversity between duplicate pairs, except for upstream regions. We then show that maize1 genes are under stronger purifying selection than maize2. WGD retained genes have higher gene dosage and biased Gene Ontologies consistent with previous studies. The relative gene expression of paralogs across tissues demonstrates that 98% of duplicate pairs have either subfunctionalized in a tissuewise manner or have diverged consistently in their expression thereby preventing functional complementation. Tissuewise subfunctionalization seems to be a hallmark of transcription factors, whereas consistent repression occurs for macromolecular complexes. We show that dominant gene expression is a strong determinant of the strength of purifying selection, explaining the inferred stronger negative selection on maize1 genes. We propose a novel expression-based classification of duplicates which is more robust to explain observed polymorphism patterns than the subgenome location. Finally, upstream regions of repressed genes exhibit an enrichment in transposable elements which indicates a possible mechanism for expression divergence. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Rectal duplication.

    Directory of Open Access Journals (Sweden)

    Kulkarni B

    1995-04-01

    Full Text Available Duplications of the alimentary tract are of a great rarity, particularly so in the rectum. Because of its rarity, the difficulty of making a correct diagnosis and of selection of proper approach for treatment, this entity bears a special significance. The present case report deals with a female newborn who presented with imperforate anus and a rectovestibular fistula and a mass prolapsing at the introitus. Complete excision of the mass was carried out through the perineal approach and the child then underwent, a PSARP for the correction of the rectal anomaly. Histology confirmed the mass to be a rectal duplication.

  9. A search for RNA insertions and NS3 gene duplication in the genome of cytopathic isolates of bovine viral diarrhea virus

    Directory of Open Access Journals (Sweden)

    V.L. Quadros

    2006-07-01

    Full Text Available Calves born persistently infected with non-cytopathic bovine viral diarrhea virus (ncpBVDV frequently develop a fatal gastroenteric illness called mucosal disease. Both the original virus (ncpBVDV and an antigenically identical but cytopathic virus (cpBVDV can be isolated from animals affected by mucosal disease. Cytopathic BVDVs originate from their ncp counterparts by diverse genetic mechanisms, all leading to the expression of the non-structural polypeptide NS3 as a discrete protein. In contrast, ncpBVDVs express only the large precursor polypeptide, NS2-3, which contains the NS3 sequence within its carboxy-terminal half. We report here the investigation of the mechanism leading to NS3 expression in 41 cpBVDV isolates. An RT-PCR strategy was employed to detect RNA insertions within the NS2-3 gene and/or duplication of the NS3 gene, two common mechanisms of NS3 expression. RT-PCR amplification revealed insertions in the NS2-3 gene of three cp isolates, with the inserts being similar in size to that present in the cpBVDV NADL strain. Sequencing of one such insert revealed a 296-nucleotide sequence with a central core of 270 nucleotides coding for an amino acid sequence highly homologous (98% to the NADL insert, a sequence corresponding to part of the cellular J-Domain gene. One cpBVDV isolate contained a duplication of the NS3 gene downstream from the original locus. In contrast, no detectable NS2-3 insertions or NS3 gene duplications were observed in the genome of 37 cp isolates. These results demonstrate that processing of NS2-3 without bulk mRNA insertions or NS3 gene duplications seems to be a frequent mechanism leading to NS3 expression and BVDV cytopathology.

  10. A false single nucleotide polymorphism generated by gene duplication compromises meat traceability.

    Science.gov (United States)

    Sanz, Arianne; Ordovás, Laura; Zaragoza, Pilar; Sanz, Albina; de Blas, Ignacio; Rodellar, Clementina

    2012-07-01

    Controlling meat traceability using SNPs is an effective method of ensuring food safety. We have analyzed several SNPs to create a panel for bovine genetic identification and traceability studies. One of these was the transversion g.329C>T (Genbank accession no. AJ496781) on the cytochrome P450 17A1 gene, which has been included in previously published panels. Using minisequencing reactions, we have tested 701 samples belonging to eight Spanish cattle breeds. Surprisingly, an excess of heterozygotes was detected, implying an extreme departure from Hardy-Weinberg equilibrium (PT SNP is a false positive polymorphism, which allows us to explain the inflated heterozygotic value. We recommend that this ambiguous SNP, as well as other polymorphisms located in this region, should not be used in identification, traceability or disease association studies. Annotation of these false SNPs should improve association studies and avoid misinterpretations. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Gallbladder duplication

    Directory of Open Access Journals (Sweden)

    Yagan Pillay

    2015-01-01

    Conclusion: Duplication of the gallbladder is a rare congenital abnormality, which requires special attention to the biliary ductal and arterial anatomy. Laparoscopic cholecystectomy with intraoperative cholangiography is the appropriate treatment in a symptomatic gallbladder. The removal of an asymptomatic double gallbladder remains controversial.

  12. RNA-Mediated Gene Duplication and Retroposons: Retrogenes, LINEs, SINEs, and Sequence Specificity

    Science.gov (United States)

    2013-01-01

    A substantial number of “retrogenes” that are derived from the mRNA of various intron-containing genes have been reported. A class of mammalian retroposons, long interspersed element-1 (LINE1, L1), has been shown to be involved in the reverse transcription of retrogenes (or processed pseudogenes) and non-autonomous short interspersed elements (SINEs). The 3′-end sequences of various SINEs originated from a corresponding LINE. As the 3′-untranslated regions of several LINEs are essential for retroposition, these LINEs presumably require “stringent” recognition of the 3′-end sequence of the RNA template. However, the 3′-ends of mammalian L1s do not exhibit any similarity to SINEs, except for the presence of 3′-poly(A) repeats. Since the 3′-poly(A) repeats of L1 and Alu SINE are critical for their retroposition, L1 probably recognizes the poly(A) repeats, thereby mobilizing not only Alu SINE but also cytosolic mRNA. Many flowering plants only harbor L1-clade LINEs and a significant number of SINEs with poly(A) repeats, but no homology to the LINEs. Moreover, processed pseudogenes have also been found in flowering plants. I propose that the ancestral L1-clade LINE in the common ancestor of green plants may have recognized a specific RNA template, with stringent recognition then becoming relaxed during the course of plant evolution. PMID:23984183

  13. Genetic variability of human respiratory syncytial virus A strains circulating in Ontario: a novel genotype with a 72 nucleotide G gene duplication.

    Directory of Open Access Journals (Sweden)

    Alireza Eshaghi

    Full Text Available Human respiratory syncytial virus (HRSV is the main cause of acute lower respiratory infections in children under 2 years of age and causes repeated infections throughout life. We investigated the genetic variability of RSV-A circulating in Ontario during 2010-2011 winter season by sequencing and phylogenetic analysis of the G glycoprotein gene.Among the 201 consecutive RSV isolates studied, RSV-A (55.7% was more commonly observed than RSV-B (42.3%. 59.8% and 90.1% of RSV-A infections were among children ≤12 months and ≤5 years old, respectively. On phylogenetic analysis of the second hypervariable region of the 112 RSV-A strains, 110 (98.2% clustered within or adjacent to the NA1 genotype; two isolates were GA5 genotype. Eleven (10% NA1-related isolates clustered together phylogenetically as a novel RSV-A genotype, named ON1, containing a 72 nucleotide duplication in the C-terminal region of the attachment (G glycoprotein. The predicted polypeptide is lengthened by 24 amino acids and includes a23 amino acid duplication. Using RNA secondary structural software, a possible mechanism of duplication occurrence was derived. The 23 amino acid ON1 G gene duplication results in a repeat of 7 potential O-glycosylation sites including three O-linked sugar acceptors at residues 270, 275, and 283. Using Phylogenetic Analysis by Maximum Likelihood analysis, a total of 19 positively selected sites were observed among Ontario NA1 isolates; six were found to be codons which reverted to the previous state observed in the prototype RSV-A2 strain. The tendency of codon regression in the G-ectodomain may infer a decreased avidity of antibody to the current circulating strains. Further work is needed to document and further understand the emergence, virulence, pathogenicity and transmissibility of this novel RSV-A genotype with a72 nucleotide G gene duplication.

  14. The impact of paralogy on phylogenomic studies - a case study on annelid relationships.

    Directory of Open Access Journals (Sweden)

    Torsten H Struck

    Full Text Available Phylogenomic studies based on hundreds of genes derived from expressed sequence tags libraries are increasingly used to reveal the phylogeny of taxa. A prerequisite for these studies is the assignment of genes into clusters of orthologous sequences. Sophisticated methods of orthology prediction are used in such analyses, but it is rarely assessed whether paralogous sequences have been erroneously grouped together as orthologous sequences after the prediction, and whether this had an impact on the phylogenetic reconstruction using a super-matrix approach. Herein, I tested the impact of paralogous sequences on the reconstruction of annelid relationships based on phylogenomic datasets. Using single-partition analyses, screening for bootstrap support, blast searches and pruning of sequences in the supermatrix, wrongly assigned paralogous sequences were found in eight partitions and the placement of five taxa (the annelids Owenia, Scoloplos, Sthenelais and Eurythoe and the nemertean Cerebratulus including the robust bootstrap support could be attributed to the presence of paralogous sequences in two partitions. Excluding these sequences resulted in a different, weaker supported placement for these taxa. Moreover, the analyses revealed that paralogous sequences impacted the reconstruction when only a single taxon represented a previously supported higher taxon such as a polychaete family. One possibility of a priori detection of wrongly assigned paralogous sequences could combine 1 a screening of single-partition analyses based on criteria such as nodal support or internal branch length with 2 blast searches of suspicious cases as presented herein. Also possible are a posteriori approaches in which support for specific clades is investigated by comparing alternative hypotheses based on differences in per-site likelihoods. Increasing the sizes of EST libraries will also decrease the likelihood of wrongly assigned paralogous sequences, and in the case

  15. Transcriptome analysis reveals the time of the fourth round of genome duplication in common carp (Cyprinus carpio)

    Science.gov (United States)

    2012-01-01

    Background Common carp (Cyprinus carpio) is thought to have undergone one extra round of genome duplication compared to zebrafish. Transcriptome analysis has been used to study the existence and timing of genome duplication in species for which genome sequences are incomplete. Large-scale transcriptome data for the common carp genome should help reveal the timing of the additional duplication event. Results We have sequenced the transcriptome of common carp using 454 pyrosequencing. After assembling the 454 contigs and the published common carp sequences together, we obtained 49,669 contigs and identified genes using homology searches and an ab initio method. We identified 4,651 orthologous pairs between common carp and zebrafish and found 129,984 paralogous pairs within the common carp. An estimation of the synonymous substitution rate in the orthologous pairs indicated that common carp and zebrafish diverged 120 million years ago (MYA). We identified one round of genome duplication in common carp and estimated that it had occurred 5.6 to 11.3 MYA. In zebrafish, no genome duplication event after speciation was observed, suggesting that, compared to zebrafish, common carp had undergone an additional genome duplication event. We annotated the common carp contigs with Gene Ontology terms and KEGG pathways. Compared with zebrafish gene annotations, we found that a set of biological processes and pathways were enriched in common carp. Conclusions The assembled contigs helped us to estimate the time of the fourth-round of genome duplication in common carp. The resource that we have built as part of this study will help advance functional genomics and genome annotation studies in the future. PMID:22424280

  16. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

    Science.gov (United States)

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

    2014-05-01

    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.

  17. Duplication and diversification of the LEAFY HULL STERILE1 and Oryza sativa MADS5 SEPALLATA lineages in graminoid Poales

    Directory of Open Access Journals (Sweden)

    Christensen Ashley R

    2012-02-01

    Full Text Available Abstract Background Gene duplication and the subsequent divergence in function of the resulting paralogs via subfunctionalization and/or neofunctionalization is hypothesized to have played a major role in the evolution of plant form. The LEAFY HULL STERILE1 (LHS1 SEPALLATA (SEP genes have been linked with the origin and diversification of the grass spikelet, but it is uncertain 1 when the duplication event that produced the LHS1 clade and its paralogous lineage Oryza sativa MADS5 (OSM5 occurred, and 2 how changes in gene structure and/or expression might have contributed to subfunctionalization and/or neofunctionalization in the two lineages. Methods Phylogenetic relationships among 84 SEP genes were estimated using Bayesian methods. RNA expression patterns were inferred using in situ hybridization. The patterns of protein sequence and RNA expression evolution were reconstructed using maximum parsimony (MP and maximum likelihood (ML methods, respectively. Results Phylogenetic analyses mapped the LHS1/OSM5 duplication event to the base of the grass family. MP character reconstructions estimated a change from cytosine to thymine in the first codon position of the first amino acid after the Zea mays MADS3 (ZMM3 domain converted a glutamine to a stop codon in the OSM5 ancestor following the LHS1/OSM5 duplication event. RNA expression analyses of OSM5 co-orthologs in Avena sativa, Chasmanthium latifolium, Hordeum vulgare, Pennisetum glaucum, and Sorghum bicolor followed by ML reconstructions of these data and previously published analyses estimated a complex pattern of gain and loss of LHS1 and OSM5 expression in different floral organs and different flowers within the spikelet or inflorescence. Conclusions Previous authors have reported that rice OSM5 and LHS1 proteins have different interaction partners indicating that the truncation of OSM5 following the LHS1/OSM5 duplication event has resulted in both partitioned and potentially novel gene

  18. Comparative genomic analysis reveals occurrence of genetic recombination in virulent Cryptosporidium hominis subtypes and telomeric gene duplications in Cryptosporidium parvum.

    Science.gov (United States)

    Guo, Yaqiong; Tang, Kevin; Rowe, Lori A; Li, Na; Roellig, Dawn M; Knipe, Kristine; Frace, Michael; Yang, Chunfu; Feng, Yaoyu; Xiao, Lihua

    2015-04-18

    Cryptosporidium hominis is a dominant species for human cryptosporidiosis. Within the species, IbA10G2 is the most virulent subtype responsible for all C. hominis-associated outbreaks in Europe and Australia, and is a dominant outbreak subtype in the United States. In recent yearsIaA28R4 is becoming a major new subtype in the United States. In this study, we sequenced the genomes of two field specimens from each of the two subtypes and conducted a comparative genomic analysis of the obtained sequences with those from the only fully sequenced Cryptosporidium parvum genome. Altogether, 8.59-9.05 Mb of Cryptosporidium sequences in 45-767 assembled contigs were obtained from the four specimens, representing 94.36-99.47% coverage of the expected genome. These genomes had complete synteny in gene organization and 96.86-97.0% and 99.72-99.83% nucleotide sequence similarities to the published genomes of C. parvum and C. hominis, respectively. Several major insertions and deletions were seen between C. hominis and C. parvum genomes, involving mostly members of multicopy gene families near telomeres. The four C. hominis genomes were highly similar to each other and divergent from the reference IaA25R3 genome in some highly polymorphic regions. Major sequence differences among the four specimens sequenced in this study were in the 5' and 3' ends of chromosome 6 and the gp60 region, largely the result of genetic recombination. The sequence similarity among specimens of the two dominant outbreak subtypes and genetic recombination in chromosome 6, especially around the putative virulence determinant gp60 region, suggest that genetic recombination plays a potential role in the emergence of hyper-transmissible C. hominis subtypes. The high sequence conservation between C. parvum and C. hominis genomes and significant differences in copy numbers of MEDLE family secreted proteins and insulinase-like proteases indicate that telomeric gene duplications could potentially contribute to

  19. Identifying pathogenicity of human variants via paralog-based yeast complementation.

    Directory of Open Access Journals (Sweden)

    Fan Yang

    2017-05-01

    Full Text Available To better understand the health implications of personal genomes, we now face a largely unmet challenge to identify functional variants within disease-associated genes. Functional variants can be identified by trans-species complementation, e.g., by failure to rescue a yeast strain bearing a mutation in an orthologous human gene. Although orthologous complementation assays are powerful predictors of pathogenic variation, they are available for only a few percent of human disease genes. Here we systematically examine the question of whether complementation assays based on paralogy relationships can expand the number of human disease genes with functional variant detection assays. We tested over 1,000 paralogous human-yeast gene pairs for complementation, yielding 34 complementation relationships, of which 33 (97% were novel. We found that paralog-based assays identified disease variants with success on par with that of orthology-based assays. Combining all homology-based assay results, we found that complementation can often identify pathogenic variants outside the homologous sequence region, presumably because of global effects on protein folding or stability. Within our search space, paralogy-based complementation more than doubled the number of human disease genes with a yeast-based complementation assay for disease variation.

  20. Recombination and evolution of duplicate control regions in the mitochondrial genome of the Asian big-headed turtle, Platysternon megacephalum.

    Directory of Open Access Journals (Sweden)

    Chenfei Zheng

    Full Text Available Complete mitochondrial (mt genome sequences with duplicate control regions (CRs have been detected in various animal species. In Testudines, duplicate mtCRs have been reported in the mtDNA of the Asian big-headed turtle, Platysternon megacephalum, which has three living subspecies. However, the evolutionary pattern of these CRs remains unclear. In this study, we report the completed sequences of duplicate CRs from 20 individuals belonging to three subspecies of this turtle and discuss the micro-evolutionary analysis of the evolution of duplicate CRs. Genetic distances calculated with MEGA 4.1 using the complete duplicate CR sequences revealed that within turtle subspecies, genetic distances between orthologous copies from different individuals were 0.63% for CR1 and 1.2% for CR2app:addword:respectively, and the average distance between paralogous copies of CR1 and CR2 was 4.8%. Phylogenetic relationships were reconstructed from the CR sequences, excluding the variable number of tandem repeats (VNTRs at the 3' end using three methods: neighbor-joining, maximum likelihood algorithm, and Bayesian inference. These data show that any two CRs within individuals were more genetically distant from orthologous genes in different individuals within the same subspecies. This suggests independent evolution of the two mtCRs within each P. megacephalum subspecies. Reconstruction of separate phylogenetic trees using different CR components (TAS, CD, CSB, and VNTRs suggested the role of recombination in the evolution of duplicate CRs. Consequently, recombination events were detected using RDP software with break points at ≈290 bp and ≈1,080 bp. Based on these results, we hypothesize that duplicate CRs in P. megacephalum originated from heterological ancestral recombination of mtDNA. Subsequent recombination could have resulted in homogenization during independent evolutionary events, thus maintaining the functions of duplicate CRs in the mtDNA of P

  1. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Energy Technology Data Exchange (ETDEWEB)

    Pejcha, Robert; Ludwig, Martha L. (Michigan)

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  2. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    International Nuclear Information System (INIS)

    Pejcha, Robert; Ludwig, Martha L.

    2005-01-01

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα) 8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys) 3 Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E · Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  3. Cobalamin-independent methionine synthase (MetE: a face-to-face double barrel that evolved by gene duplication.

    Directory of Open Access Journals (Sweden)

    Robert Pejchal

    2005-02-01

    Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  4. Insertional translocation leading to a 4q13 duplication including the EPHA5 gene in two siblings with attention-deficit hyperactivity disorder.

    Science.gov (United States)

    Matoso, Eunice; Melo, Joana B; Ferreira, Susana I; Jardim, Ana; Castelo, Teresa M; Weise, Anja; Carreira, Isabel M

    2013-08-01

    An insertional translocation (IT) can result in pure segmental aneusomy for the inserted genomic segment allowing to define a more accurate clinical phenotype. Here, we report on two siblings sharing an unbalanced IT inherited from the mother with a history of learning difficulty. An 8-year-old girl with developmental delay, speech disability, and attention-deficit hyperactivity disorder (ADHD), showed by GTG banding analysis a subtle interstitial alteration in 21q21. Oligonucleotide array comparative genomic hybridization (array-CGH) analysis showed a 4q13.1-q13.3 duplication spanning 8.6 Mb. Fluorescence in situ hybridization (FISH) with bacterial artificial chromosome (BAC) clones confirmed the rearrangement, a der(21)ins(21;4)(q21;q13.1q13.3). The duplication described involves 50 RefSeq genes including the EPHA5 gene that encodes for the EphA5 receptor involved in embryonic development of the brain and also in synaptic remodeling and plasticity thought to underlie learning and memory. The same rearrangement was observed in a younger brother with behavioral problems and also exhibiting ADHD. ADHD is among the most heritable of neuropsychiatric disorders. There are few reports of patients with duplications involving the proximal region of 4q and a mild phenotype. To the best of our knowledge this is the first report of a duplication restricted to band 4q13. This abnormality could be easily missed in children who have nonspecific cognitive impairment. The presence of this behavioral disorder in the two siblings reinforces the hypothesis that the region involved could include genes involved in ADHD. Copyright © 2013 Wiley Periodicals, Inc.

  5. Lineage-specific expansion and loss of tyrosinase genes across platyhelminths and their induction profiles in the carcinogenic oriental liver fluke, Clonorchis sinensis.

    Science.gov (United States)

    Kim, Seon-Hee; Bae, Young-An

    2017-09-01

    Tyrosinase provides an essential activity during egg production in diverse platyhelminths by mediating sclerotization of eggshells. In this study, we investigated the genomic and evolutionary features of tyrosinases in parasitic platyhelminths whose genomic information is available. A pair of paralogous tyrosinases was detected in most trematodes, whereas they were lost in cyclophyllidean cestodes. A pseudophyllidean cestode displaying egg biology similar to that of trematodes possessed an orthologous gene. Interestingly, one of the paralogous tyrosinases appeared to have been multiplied into three copies in Clonorchis sinensis and Opisthorchis viverrini. In addition, a fifth tyrosinase gene that was minimally transcribed through all developmental stages was further detected in these opisthorchiid genomes. Phylogenetic analyses demonstrated that the tyrosinase gene has undergone duplication at least three times in platyhelminths. The additional opisthorchiid gene arose from the first duplication. A paralogous copy generated from these gene duplications, except for the last one, seemed to be lost in the major neodermatans lineages. In C. sinensis, tyrosinase gene expressions were initiated following sexual maturation and the levels were significantly enhanced by the presence of O2 and bile. Taken together, our data suggest that tyrosinase has evolved lineage-specifically across platyhelminths related to its copy number and induction mechanism.

  6. Using paleogenomics to study the evolution of gene families: origin and duplication history of the relaxin family hormones and their receptors.

    Directory of Open Access Journals (Sweden)

    Sergey Yegorov

    Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of

  7. Assessment and Reconstruction of Novel HSP90 Genes: Duplications, Gains and Losses in Fungal and Animal Lineages

    Czech Academy of Sciences Publication Activity Database

    Pantzartzi, Chrysoula; Drosopoulou, E.; Scouras, Z.

    2013-01-01

    Roč. 8, č. 9 (2013), s. 1-11 E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:68378050 Keywords : Hsp90s * Fungi * duplication events Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.534, year: 2013

  8. Delineation of a new chromosome 20q11.2 duplication syndrome including the ASXL1 gene

    DEFF Research Database (Denmark)

    Avila, Magali; Kirchhoff, Eva Maria; Marle, Nathalie

    2013-01-01

    We report on three males with de novo overlapping 7.5, 9.8, and 10 Mb duplication of chromosome 20q11.2. Together with another patient previously published in the literature with overlapping 20q11 microduplication, we show that such patients display common clinical features including metopic ridg...

  9. Prevalence and spectrum of large deletions or duplications in the major long QT syndrome-susceptibility genes and implications for long QT syndrome genetic testing.

    Science.gov (United States)

    Tester, David J; Benton, Amber J; Train, Laura; Deal, Barbara; Baudhuin, Linnea M; Ackerman, Michael J

    2010-10-15

    Long QT syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for 3 cardiac ion channel α-subunits (LQT1 to LQT3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. We set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes in unrelated patients who were mutation negative after point mutation analysis of LQT1- to LQT12-susceptibility genes. Forty-two unrelated, clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification, a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA multiplex ligation-dependent probe amplification LQTS kit from MRC-Holland was used to analyze the 3 major LQTS-associated genes, KCNQ1, KCNH2, and SCN5A, and the 2 minor genes, KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2 of 42 unrelated patients (4.8%, confidence interval 1.7 to 11). A deletion of KCNQ1 exon 3 was identified in a 10-year-old Caucasian boy with a corrected QT duration of 660 ms, a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17-year-old Caucasian girl with a corrected QT duration of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, because nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. Copyright © 2010 Elsevier Inc. All rights reserved.

  10. Structure and vascular tissue expression of duplicated TERMINAL EAR1-like paralogues in poplar.

    Science.gov (United States)

    Charon, Céline; Vivancos, Julien; Mazubert, Christelle; Paquet, Nicolas; Pilate, Gilles; Dron, Michel

    2010-02-01

    TERMINAL EAR1-like (TEL) genes encode putative RNA-binding proteins only found in land plants. Previous studies suggested that they may regulate tissue and organ initiation in Poaceae. Two TEL genes were identified in both Populus trichocarpa and the hybrid aspen Populus tremula x P. alba, named, respectively, PoptrTEL1-2 and PtaTEL1-2. The analysis of the organisation around the PoptrTEL genes in the P. trichocarpa genome and the estimation of the synonymous substitution rate for PtaTEL1-2 genes indicate that the paralogous link between these two Populus TEL genes probably results from the Salicoid large-scale gene-duplication event. Phylogenetic analyses confirmed their orthology link with the other TEL genes. The expression pattern of both PtaTEL genes appeared to be restricted to the mother cells of the plant body: leaf founder cells, leaf primordia, axillary buds and root differentiating tissues, as well as to mother cells of vascular tissues. Most interestingly, PtaTEL1-2 transcripts were found in differentiating cells of secondary xylem and phloem, but probably not in the cambium itself. Taken together, these results indicate specific expression of the TEL genes in differentiating cells controlling tissue and organ development in Populus (and other Angiosperm species).

  11. A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3

    Directory of Open Access Journals (Sweden)

    Stefanie Lehner

    2018-02-01

    Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.

  12. Differential paralog divergence modulates genome evolution across yeast species.

    Directory of Open Access Journals (Sweden)

    Monica R Sanchez

    2017-02-01

    Full Text Available Evolutionary outcomes depend not only on the selective forces acting upon a species, but also on the genetic background. However, large timescales and uncertain historical selection pressures can make it difficult to discern such important background differences between species. Experimental evolution is one tool to compare evolutionary potential of known genotypes in a controlled environment. Here we utilized a highly reproducible evolutionary adaptation in Saccharomyces cerevisiae to investigate whether experimental evolution of other yeast species would select for similar adaptive mutations. We evolved populations of S. cerevisiae, S. paradoxus, S. mikatae, S. uvarum, and interspecific hybrids between S. uvarum and S. cerevisiae for ~200-500 generations in sulfate-limited continuous culture. Wild-type S. cerevisiae cultures invariably amplify the high affinity sulfate transporter gene, SUL1. However, while amplification of the SUL1 locus was detected in S. paradoxus and S. mikatae populations, S. uvarum cultures instead selected for amplification of the paralog, SUL2. We measured the relative fitness of strains bearing deletions and amplifications of both SUL genes from different species, confirming that, converse to S. cerevisiae, S. uvarum SUL2 contributes more to fitness in sulfate limitation than S. uvarum SUL1. By measuring the fitness and gene expression of chimeric promoter-ORF constructs, we were able to delineate the cause of this differential fitness effect primarily to the promoter of S. uvarum SUL1. Our data show evidence of differential sub-functionalization among the sulfate transporters across Saccharomyces species through recent changes in noncoding sequence. Furthermore, these results show a clear example of how such background differences due to paralog divergence can drive changes in genome evolution.

  13. Intron-exon organization of the active human protein S gene PS. alpha. and its pseudogene PS. beta. : Duplication and silencing during primate evolution

    Energy Technology Data Exchange (ETDEWEB)

    Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.; Bertina, R.M. (University Hospital, Leiden (Netherlands))

    1990-08-28

    The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing of an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.

  14. A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4 Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle.

    Directory of Open Access Journals (Sweden)

    Bertram Brenig

    Full Text Available Aristaless-like homeobox 4 (ALX4 gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA and 289 White Galloway (WGA cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed.

  15. The genomic distribution of intraspecific and interspecific sequence divergence of human segmental duplications relative to human/chimpanzee chromosomal rearrangements

    Directory of Open Access Journals (Sweden)

    Eichler Evan E

    2008-08-01

    Full Text Available Abstract Background It has been suggested that chromosomal rearrangements harbor the molecular footprint of the biological phenomena which they induce, in the form, for instance, of changes in the sequence divergence rates of linked genes. So far, all the studies of these potential associations have focused on the relationship between structural changes and the rates of evolution of single-copy DNA and have tried to exclude segmental duplications (SDs. This is paradoxical, since SDs are one of the primary forces driving the evolution of structure and function in our genomes and have been linked not only with novel genes acquiring new functions, but also with overall higher DNA sequence divergence and major chromosomal rearrangements. Results Here we take the opposite view and focus on SDs. We analyze several of the features of SDs, including the rates of intraspecific divergence between paralogous copies of human SDs and of interspecific divergence between human SDs and chimpanzee DNA. We study how divergence measures relate to chromosomal rearrangements, while considering other factors that affect evolutionary rates in single copy DNA. Conclusion We find that interspecific SD divergence behaves similarly to divergence of single-copy DNA. In contrast, old and recent paralogous copies of SDs do present different patterns of intraspecific divergence. Also, we show that some relatively recent SDs accumulate in regions that carry inversions in sister lineages.

  16. Characterization of the interferon genes in homozygous rainbow trout reveals two novel genes, alternate splicing and differential regulation of duplicated genes

    Science.gov (United States)

    Purcell, M.K.; Laing, K.J.; Woodson, J.C.; Thorgaard, G.H.; Hansen, J.D.

    2009-01-01

    The genes encoding the type I and type II interferons (IFNs) have previously been identified in rainbow trout and their proteins partially characterized. These previous studies reported a single type II IFN (rtIFN-??) and three rainbow trout type I IFN genes that are classified into either group I (rtIFN1, rtIFN2) or group II (rtIFN3). In this present study, we report the identification of a novel IFN-?? gene (rtIFN-??2) and a novel type I group II IFN (rtIFN4) in homozygous rainbow trout and predict that additional IFN genes or pseudogenes exist in the rainbow trout genome. Additionally, we provide evidence that short and long forms of rtIFN1 are actively and differentially transcribed in homozygous trout, and likely arose due to alternate splicing of the first exon. Quantitative reverse transcriptase PCR (qRT-PCR) assays were developed to systematically profile all of the rainbow trout IFN transcripts, with high specificity at an individual gene level, in na??ve fish and after stimulation with virus or viral-related molecules. Cloned PCR products were used to ensure the specificity of the qRT-PCR assays and as absolute standards to assess transcript abundance of each gene. All IFN genes were modulated in response to Infectious hematopoietic necrosis virus (IHNV), a DNA vaccine based on the IHNV glycoprotein, and poly I:C. The most inducible of the type I IFN genes, by all stimuli tested, were rtIFN3 and the short transcript form of rtIFN1. Gene expression of rtIFN-??1 and rtIFN-??2 was highly up-regulated by IHNV infection and DNA vaccination but rtIFN-??2 was induced to a greater magnitude. The specificity of the qRT-PCR assays reported here will be useful for future studies aimed at identifying which cells produce IFNs at early time points after infection. ?? 2008 Elsevier Ltd.

  17. Evolutionary history and functional divergence of the cytochrome P450 gene superfamily between Arabidopsis thaliana and Brassica species uncover effects of whole genome and tandem duplications.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Wang, Linhai; Dossa, Komivi; Zhang, Xiurong; Ke, Tao; Liao, Boshou

    2017-09-18

    The cytochrome P450 monooxygenase (P450) superfamily is involved in the biosynthesis of various primary and secondary metabolites. However, little is known about the effects of whole genome duplication (WGD) and tandem duplication (TD) events on the evolutionary history and functional divergence of P450s in Brassica after splitting from a common ancestor with Arabidopsis thaliana. Using Hidden Markov Model search and manual curation, we detected that Brassica species have nearly 1.4-fold as many P450 members as A. thaliana. Most P450s in A. thaliana and Brassica species were located on pseudo-chromosomes. The inferred phylogeny indicated that all P450s were clustered into two different subgroups. Analysis of WGD event revealed that different P450 gene families had appeared after evolutionary events of species. For the TD event analyses, the P450s from TD events in Brassica species can be divided into ancient and recent parts. Our comparison of influence of WGD and TD events on the P450 gene superfamily between A. thaliana and Brassica species indicated that the family-specific evolution in the Brassica lineage can be attributed to both WGD and TD, whereas WGD was recognized as the major mechanism for the recent evolution of the P450 super gene family. Expression analysis of P450s from A. thaliana and Brassica species indicated that WGD-type P450s showed the same expression pattern but completely different expression with TD-type P450s across different tissues in Brassica species. Selection force analysis suggested that P450 orthologous gene pairs between A. thaliana and Brassica species underwent negative selection, but no significant differences were found between P450 orthologous gene pairs in A. thaliana-B. rapa and A. thaliana-B. oleracea lineages, as well as in different subgenomes in B. rapa or B. oleracea compared with A. thaliana. This study is the first to investigate the effects of WGD and TD on the evolutionary history and functional divergence of P450

  18. Genome Wide Identification, Evolutionary, and Expression Analysis of VQ Genes from Two Pyrus Species.

    Science.gov (United States)

    Cao, Yunpeng; Meng, Dandan; Abdullah, Muhammad; Jin, Qing; Lin, Yi; Cai, Yongping

    2018-04-23

    The VQ motif-containing gene, a member of the plant-specific genes, is involved in the plant developmental process and various stress responses. The VQ motif-containing gene family has been studied in several plants, such as rice ( Oryza sativa ), maize ( Zea mays ), and Arabidopsis ( Arabidopsis thaliana ). However, no systematic study has been performed in Pyrus species, which have important economic value. In our study, we identified 41 and 28 VQ motif-containing genes in Pyrus bretschneideri and Pyrus communis , respectively. Phylogenetic trees were calculated using A. thaliana and O. sativa VQ motif-containing genes as a template, allowing us to categorize these genes into nine subfamilies. Thirty-two and eight paralogous of VQ motif-containing genes were found in P. bretschneideri and P. communis , respectively, showing that the VQ motif-containing genes had a more remarkable expansion in P. bretschneideri than in P. communis . A total of 31 orthologous pairs were identified from the P. bretschneideri and P. communis VQ motif-containing genes. Additionally, among the paralogs, we found that these duplication gene pairs probably derived from segmental duplication/whole-genome duplication (WGD) events in the genomes of P. bretschneideri and P. communis , respectively. The gene expression profiles in both P. bretschneideri and P. communis fruits suggested functional redundancy for some orthologous gene pairs derived from a common ancestry, and sub-functionalization or neo-functionalization for some of them. Our study provided the first systematic evolutionary analysis of the VQ motif-containing genes in Pyrus , and highlighted the diversification and duplication of VQ motif-containing genes in both P. bretschneideri and P. communis .

  19. Finding all sorting tandem duplication random loss operations

    DEFF Research Database (Denmark)

    Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang

    2011-01-01

    A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...

  20. Expression of embryonic hemoglobin genes in mice heterozygous for α-thalassemia or β-duplication traits and in mice heterozygous for both traits

    International Nuclear Information System (INIS)

    Popp, R.A.; Marsh, C.L.; Skow, L.C.

    1981-01-01

    Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous α-thalassemic embryos, expression of EI (x 2 y 2 ) and EII (α 2 y 2 ) is deficient because the x- and α-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- and α-globin genes indicates that these genes must be closely linked. Reduced x- and α-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y 4 hemoglobin also appears in β-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and β-globin genes. In double heterozygotes, which have a single functional allele of x- and α-globin genes and three functional alleles of y- and β-globin genes, synthesis of α and non-α chains is severely imbalanced and half of the total hemoglobin is y 4 . Mouse y 4 has a high affinity for oxygen, P 50 of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues

  1. Life-threatening Arrhythmias in a Becker Muscular Dystrophy Family due to the Duplication of Exons 3-4 of the Dystrophin Gene.

    Science.gov (United States)

    Ishizaki, Masatoshi; Fujimoto, Akiko; Ueyama, Hidetsugu; Nishida, Yasuto; Imamura, Shigehiro; Uchino, Makoto; Ando, Yukio

    2015-01-01

    We herein present a report of three patients with Becker muscular dystrophy in the same family who developed complete atrioventricular block or ventricular tachycardia with severe cardiomyopathy. Our cases became unable to walk in their teens, and were introduced to mechanical ventilation due to respiratory muscle weakness in their twenties and thirties. In all three cases, a medical device such as a permanent cardiac pacemaker or an implantable cardiac defibrillator was considered to be necessary. The duplication of exons 3-4 in the dystrophin gene was detected in two of the patients. In patients with Becker muscular dystrophy, complete atrioventricular block or ventricular tachycardia within a family has rarely been reported. Thus attention should be paid to the possibility of severe arrhythmias in the severe phenotype of Becker muscular dystrophy.

  2. Evolution of the vertebrate insulin receptor substrate (Irs) gene family.

    Science.gov (United States)

    Al-Salam, Ahmad; Irwin, David M

    2017-06-23

    Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.

  3. Genome-wide identification, phylogenetic classification, and exon-intron structure characterisation of the tubulin and actin genes in flax (Linum usitatissimum).

    Science.gov (United States)

    Pydiura, Nikolay; Pirko, Yaroslav; Galinousky, Dmitry; Postovoitova, Anastasiia; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav

    2018-06-08

    Flax (Linum usitatissimum L.) is a valuable food and fiber crop cultivated for its quality fiber and seed oil. α-, β-, γ-tubulins and actins are the main structural proteins of the cytoskeleton. α- and γ-tubulin and actin genes have not been characterized yet in the flax genome. In this study, we have identified 6 α-tubulin genes, 13 β-tubulin genes, 2 γ-tubulin genes, and 15 actin genes in the flax genome and analysed the phylogenetic relationships between flax and A. thaliana tubulin and actin genes. Six α-tubulin genes are represented by 3 paralogous pairs, among 13 β-tubulin genes 7 different isotypes can be distinguished, 6 of which are encoded by two paralogous genes each. γ-tubulin is represented by a paralogous pair of genes one of which may be not functional. Fifteen actin genes represent 7 paralogous pairs - 7 actin isotypes and a sequentially duplicated copy of one of the genes of one of the isotypes. Exon-intron structure analysis has shown intron length polymorphism within the β-tubulin genes and intron number variation among the α-tubulin gene: 3 or 4 introns are found in two or four genes, respectively. Intron positioning occurs at conservative sites, as observed in numerous other plant species. Flax actin genes show both intron length polymorphisms and variation in the number of intron that may be 2 or 3. These data will be useful to support further studies on the specificity, functioning, regulation and evolution of the flax cytoskeleton proteins. This article is protected by copyright. All rights reserved.

  4. Conservation, duplication, and loss of the Tor signaling pathway in the fungal kingdom

    Directory of Open Access Journals (Sweden)

    Heitman Joseph

    2010-09-01

    Full Text Available Abstract Background The nutrient-sensing Tor pathway governs cell growth and is conserved in nearly all eukaryotic organisms from unicellular yeasts to multicellular organisms, including humans. Tor is the target of the immunosuppressive drug rapamycin, which in complex with the prolyl isomerase FKBP12 inhibits Tor functions. Rapamycin is a gold standard drug for organ transplant recipients that was approved by the FDA in 1999 and is finding additional clinical indications as a chemotherapeutic and antiproliferative agent. Capitalizing on the plethora of recently sequenced genomes we have conducted comparative genomic studies to annotate the Tor pathway throughout the fungal kingdom and related unicellular opisthokonts, including Monosiga brevicollis, Salpingoeca rosetta, and Capsaspora owczarzaki. Results Interestingly, the Tor signaling cascade is absent in three microsporidian species with available genome sequences, the only known instance of a eukaryotic group lacking this conserved pathway. The microsporidia are obligate intracellular pathogens with highly reduced genomes, and we hypothesize that they lost the Tor pathway as they adapted and streamlined their genomes for intracellular growth in a nutrient-rich environment. Two TOR paralogs are present in several fungal species as a result of either a whole genome duplication or independent gene/segmental duplication events. One such event was identified in the amphibian pathogen Batrachochytrium dendrobatidis, a chytrid responsible for worldwide global amphibian declines and extinctions. Conclusions The repeated independent duplications of the TOR gene in the fungal kingdom might reflect selective pressure acting upon this kinase that populates two proteinaceous complexes with different cellular roles. These comparative genomic analyses illustrate the evolutionary trajectory of a central nutrient-sensing cascade that enables diverse eukaryotic organisms to respond to their natural

  5. Six subgroups and extensive recent duplications characterize the evolution of the eukaryotic tubulin protein family.

    Science.gov (United States)

    Findeisen, Peggy; Mühlhausen, Stefanie; Dempewolf, Silke; Hertzog, Jonny; Zietlow, Alexander; Carlomagno, Teresa; Kollmar, Martin

    2014-08-27

    Tubulins belong to the most abundant proteins in eukaryotes providing the backbone for many cellular substructures like the mitotic and meiotic spindles, the intracellular cytoskeletal network, and the axonemes of cilia and flagella. Homologs have even been reported for archaea and bacteria. However, a taxonomically broad and whole-genome-based analysis of the tubulin protein family has never been performed, and thus, the number of subfamilies, their taxonomic distribution, and the exact grouping of the supposed archaeal and bacterial homologs are unknown. Here, we present the analysis of 3,524 tubulins from 504 species. The tubulins formed six major subfamilies, α to ζ. Species of all major kingdoms of the eukaryotes encode members of these subfamilies implying that they must have already been present in the last common eukaryotic ancestor. The proposed archaeal homologs grouped together with the bacterial TubZ proteins as sister clade to the FtsZ proteins indicating that tubulins are unique to eukaryotes. Most species contained α- and/or β-tubulin gene duplicates resulting from recent branch- and species-specific duplication events. This shows that tubulins cannot be used for constructing species phylogenies without resolving their ortholog-paralog relationships. The many gene duplicates and also the independent loss of the δ-, ε-, or ζ-tubulins, which have been shown to be part of the triplet microtubules in basal bodies, suggest that tubulins can functionally substitute each other. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  6. Role of the duplicated CCAAT box region in γ-globin gene regulation and hereditary persistence of fetal haemoglobin.

    NARCIS (Netherlands)

    A. Ronchi (Antonella); M. Berry (Meera); S. Raguz (Selina); A.M.A. Imam (Ali); N. Yannoutsos (Nikos); S. Ottolenghi (Sergio); F.G. Grosveld (Frank); N.O. Dillon (Niall)

    1996-01-01

    textabstractHereditary persistence of fetal haemoglobin (HPFH) is a clinically important condition in which a change in the developmental specificity of the gamma-globin genes results in varying levels of expression of fetal haemoglobin in the adult. The condition is benign and can significantly

  7. MECP2 Duplication Syndrome

    DEFF Research Database (Denmark)

    Signorini, Cinzia; De Felice, Claudio; Leoncini, Silvia

    2016-01-01

    Rett syndrome (RTT) and MECP2 duplication syndrome (MDS) are neurodevelopmental disorders caused by alterations in the methyl-CpG binding protein 2 (MECP2) gene expression. A relationship between MECP2 loss-of-function mutations and oxidative stress has been previously documented in RTT patients...... and murine models. To date, no data on oxidative stress have been reported for the MECP2 gain-of-function mutations in patients with MDS. In the present work, the pro-oxidant status and oxidative fatty acid damage in MDS was investigated (subjects n = 6) and compared to RTT (subjects n = 24) and healthy...... similar to those observed in RTT patients except for higher plasma F2-isoprostanes levels (P work shows unique data in patients affected by MDS. For the first...

  8. Disease association with two Helicobacter pylori duplicate outer membrane protein genes, homB and homA.

    Science.gov (United States)

    Oleastro, Monica; Cordeiro, Rita; Yamaoka, Yoshio; Queiroz, Dulciene; Mégraud, Francis; Monteiro, Lurdes; Ménard, Armelle

    2009-06-22

    homB encodes a Helicobacter pylori outer membrane protein. This gene was previously associated with peptic ulcer disease (PUD) and was shown to induce activation of interleukin-8 secretion in vitro, as well as contributing to bacterial adherence. Its 90%-similar gene, homA, was previously correlated with gastritis. The present study aimed to evaluate the gastric disease association with homB and homA, as well as with the H. pylori virulence factors cagA, babA and vacA, in 415 H. pylori strains isolated from patients from East Asian and Western countries. The correlation among these genotypes was also evaluated. Both homB and homA genes were heterogeneously distributed worldwide, with a marked difference between East Asian and Western strains. In Western strains (n = 234, 124 PUD and 110 non-ulcer dyspepsia (NUD), homB, cagA and vacA s1 were all significantly associated with PUD (p = 0.025, p = 0.014, p = 0.039, respectively), and homA was closely correlated with NUD (p = 0.072). In East Asian strains (n = 138, 73 PUD and 65 NUD), homB was found more frequently than homA, and none of these genes was associated with the clinical outcome. Overall, homB was associated with the presence of cagA (p = 0.043) and vacA s1 (p homA was found more frequently in cagA-negative (p = 0.062) and vacA s2 (p homA copy number were observed, with a clear geographical specificity, suggesting an involvement of these genes in host adaptation. A correlation between the homB two-copy genotype and PUD was also observed, emphasizing the role of homB in the virulence of the strain. The global results suggest that homB and homA contribute to the determination of clinical outcome.

  9. Tracking the evolution of a cold stress associated gene family in cold tolerant grasses

    DEFF Research Database (Denmark)

    Sandve, Simen R; Rudi, Heidi; Asp, Torben

    2008-01-01

    to the repeat motifs of the IRI-domain in cold tolerant grasses. Finally we show that the LRR-domain of carrot and grass IRI proteins both share homology to an Arabidopsis thaliana LRR-trans membrane protein kinase (LRR-TPK). Conclusion The diverse IRI-like genes identified in this study tell a tale...... of a complex evolutionary history including birth of an ice binding domain, a burst of gene duplication events after cold tolerant grasses radiated from rice, protein domain structure differentiation between paralogs, and sub- and/or neofunctionalisation of IRI-like proteins. From our sequence analysis we...

  10. Startling mosaicism of the Y-chromosome and tandem duplication of the SRY and DAZ genes in patients with Turner Syndrome.

    Directory of Open Access Journals (Sweden)

    Sanjay Premi

    Full Text Available Presence of the human Y-chromosome in females with Turner Syndrome (TS enhances the risk of development of gonadoblastoma besides causing several other phenotypic abnormalities. In the present study, we have analyzed the Y chromosome in 15 clinically diagnosed Turner Syndrome (TS patients and detected high level of mosaicisms ranging from 45,XO:46,XY = 100:0% in 4; 45,XO:46,XY:46XX = 4:94:2 in 8; and 45,XO:46,XY:46XX = 50:30:20 cells in 3 TS patients, unlike previous reports showing 5-8% cells with Y- material. Also, no ring, marker or di-centric Y was observed in any of the cases. Of the two TS patients having intact Y chromosome in >85% cells, one was exceptionally tall. Both the patients were positive for SRY, DAZ, CDY1, DBY, UTY and AZFa, b and c specific STSs. Real Time PCR and FISH demonstrated tandem duplication/multiplication of the SRY and DAZ genes. At sequence level, the SRY was normal in 8 TS patients while the remaining 7 showed either absence of this gene or known and novel mutations within and outside of the HMG box. SNV/SFV analysis showed normal four copies of the DAZ genes in these 8 patients. All the TS patients showed aplastic uterus with no ovaries and no symptom of gonadoblastoma. Present study demonstrates new types of polymorphisms indicating that no two TS patients have identical genotype-phenotype. Thus, a comprehensive analysis of more number of samples is warranted to uncover consensus on the loci affected, to be able to use them as potential diagnostic markers.

  11. Duplicated Gephyrin Genes Showing Distinct Tissue Distribution and Alternative Splicing Patterns Mediate Molybdenum Cofactor Biosynthesis, Glycine Receptor Clustering, and Escape Behavior in Zebrafish*

    Science.gov (United States)

    Ogino, Kazutoyo; Ramsden, Sarah L.; Keib, Natalie; Schwarz, Günter; Harvey, Robert J.; Hirata, Hiromi

    2011-01-01

    Gephyrin mediates the postsynaptic clustering of glycine receptors (GlyRs) and GABAA receptors at inhibitory synapses and molybdenum-dependent enzyme (molybdoenzyme) activity in non-neuronal tissues. Gephyrin knock-out mice show a phenotype resembling both defective glycinergic transmission and molybdenum cofactor (Moco) deficiency and die within 1 day of birth due to starvation and dyspnea resulting from deficits in motor and respiratory networks, respectively. To address whether gephyrin function is conserved among vertebrates and whether gephyrin deficiency affects molybdoenzyme activity and motor development, we cloned and characterized zebrafish gephyrin genes. We report here that zebrafish have two gephyrin genes, gphna and gphnb. The former is expressed in all tissues and has both C3 and C4 cassette exons, and the latter is expressed predominantly in the brain and spinal cord and harbors only C4 cassette exons. We confirmed that all of the gphna and gphnb splicing isoforms have Moco synthetic activity. Antisense morpholino knockdown of either gphna or gphnb alone did not disturb synaptic clusters of GlyRs in the spinal cord and did not affect touch-evoked escape behaviors. However, on knockdown of both gphna and gphnb, embryos showed impairments in GlyR clustering in the spinal cord and, as a consequence, demonstrated touch-evoked startle response behavior by contracting antagonistic muscles simultaneously, instead of displaying early coiling and late swimming behaviors, which are executed by side-to-side muscle contractions. These data indicate that duplicated gephyrin genes mediate Moco biosynthesis and control postsynaptic clustering of GlyRs, thereby mediating key escape behaviors in zebrafish. PMID:20843816

  12. Roles of ATR1 paralogs YMR279c and YOR378w in boron stress tolerance

    International Nuclear Information System (INIS)

    Bozdag, Gonensin Ozan; Uluisik, Irem; Gulculer, Gulce Sila; Karakaya, Huseyin C.; Koc, Ahmet

    2011-01-01

    Highlights: → ATR1 paralog YMR279c plays role in boron detoxification. → YMR279c overexpression lowers cytoplasmic boron levels. → ATR1 paralog YOR378w has no roles in boron stress response. -- Abstract: Boron is a necessary nutrient for plants and animals, however excess of it causes toxicity. Previously, Atr1 and Arabidopsis Bor1 homolog were identified as the boron efflux pump in yeast, which lower the cytosolic boron concentration and help cells to survive in the presence of toxic amount of boron. In this study, we analyzed ATR1 paralogs, YMR279c and YOR378w, to understand whether they participate in boron stress tolerance in yeast. Even though these genes share homology with ATR1, neither their deletion rendered cells boron sensitive nor their expression was significantly upregulated by boron treatment. However, expression of YMR279, but not YOR378w, from the constitutive GAPDH promoter on a high copy plasmid provided remarkable boron resistance by decreasing intracellular boron levels. Thus our results suggest the presence of a third boron exporter, YMR279c, which functions similar to ATR1 and provides boron resistance in yeast.

  13. Myxococcus xanthus DK1622 Coordinates Expressions of the Duplicate groEL and Single groES Genes for Synergistic Functions of GroELs and GroES

    Directory of Open Access Journals (Sweden)

    Yue-zhong Li

    2017-04-01

    Full Text Available Chaperonin GroEL (Cpn60 requires cofactor GroES (Cpn10 for protein refolding in bacteria that possess single groEL and groES genes in a bicistronic groESL operon. Among 4,861 completely-sequenced prokaryotic genomes, 884 possess duplicate groEL genes and 770 possess groEL genes with no neighboring groES. It is unclear whether stand-alone groEL requires groES in order to function and, if required, how duplicate groEL genes and unequal groES genes balance their expressions. In Myxococcus xanthus DK1622, we determined that, while duplicate groELs were alternatively deletable, the single groES that clusters with groEL1 was essential for cell survival. Either GroEL1 or GroEL2 required interactions with GroES for in vitro and in vivo functions. Deletion of groEL1 or groEL2 resulted in decreased expressions of both groEL and groES; and ectopic complementation of groEL recovered not only the groEL but also groES expressions. The addition of an extra groES gene upstream groEL2 to form a bicistronic operon had almost no influence on groES expression and the cell survival rate, whereas over-expression of groES using a self-replicating plasmid simultaneously increased the groEL expressions. The results indicated that M. xanthus DK1622 cells coordinate expressions of the duplicate groEL and single groES genes for synergistic functions of GroELs and GroES. We proposed a potential regulation mechanism for the expression coordination.

  14. Ancestral genomic duplication of the insulin gene in tilapia: An analysis of possible implications for clinical islet xenotransplantation using donor islets from transgenic tilapia expressing a humanized insulin gene.

    Science.gov (United States)

    Hrytsenko, Olga; Pohajdak, Bill; Wright, James R

    2016-07-03

    Tilapia, a teleost fish, have multiple large anatomically discrete islets which are easy to harvest, and when transplanted into diabetic murine recipients, provide normoglycemia and mammalian-like glucose tolerance profiles. Tilapia insulin differs structurally from human insulin which could preclude their use as islet donors for xenotransplantation. Therefore, we produced transgenic tilapia with islets expressing a humanized insulin gene. It is now known that fish genomes may possess an ancestral duplication and so tilapia may have a second insulin gene. Therefore, we cloned, sequenced, and characterized the tilapia insulin 2 transcript and found that its expression is negligible in islets, is not islet-specific, and would not likely need to be silenced in our transgenic fish.

  15. Comparing genomes with rearrangements and segmental duplications.

    Science.gov (United States)

    Shao, Mingfu; Moret, Bernard M E

    2015-06-15

    Large-scale evolutionary events such as genomic rearrange.ments and segmental duplications form an important part of the evolution of genomes and are widely studied from both biological and computational perspectives. A basic computational problem is to infer these events in the evolutionary history for given modern genomes, a task for which many algorithms have been proposed under various constraints. Algorithms that can handle both rearrangements and content-modifying events such as duplications and losses remain few and limited in their applicability. We study the comparison of two genomes under a model including general rearrangements (through double-cut-and-join) and segmental duplications. We formulate the comparison as an optimization problem and describe an exact algorithm to solve it by using an integer linear program. We also devise a sufficient condition and an efficient algorithm to identify optimal substructures, which can simplify the problem while preserving optimality. Using the optimal substructures with the integer linear program (ILP) formulation yields a practical and exact algorithm to solve the problem. We then apply our algorithm to assign in-paralogs and orthologs (a necessary step in handling duplications) and compare its performance with that of the state-of-the-art method MSOAR, using both simulations and real data. On simulated datasets, our method outperforms MSOAR by a significant margin, and on five well-annotated species, MSOAR achieves high accuracy, yet our method performs slightly better on each of the 10 pairwise comparisons. http://lcbb.epfl.ch/softwares/coser. © The Author 2015. Published by Oxford University Press.

  16. Evolution of the paralogous hap and iga genes in Haemophilus influenzae: evidence for a conserved hap pseudogene associated with microcolony formation in the recently diverged Haemophilus aegyptius and H. influenzae biogroup aegyptius

    DEFF Research Database (Denmark)

    Kilian, Mogens; Poulsen, Knud; Lomholt, Hans Bredsted

    2002-01-01

    genetic polymorphism and pronounced mosaic-like patterns in both genes, but no evidence of intrastrain recombination between the two genes. A conserved hap pseudogene was present in all strains of H. aegyptius and H. influenzae biogroup aegyptius, each of which constituted distinct subpopulations...... on conjunctival cells, previously termed microcolony formation. The fact that individual hap pseudogenes differed from the ancestral sequence by zero to two positions within a 1.5 kb stretch suggests that the silencing event happened approximately 2000-11,000 years ago. Divergence of H. aegyptius and H...

  17. Duplication and concerted evolution of MiSp-encoding genes underlie the material properties of minor ampullate silks of cobweb weaving spiders.

    Science.gov (United States)

    Vienneau-Hathaway, Jannelle M; Brassfield, Elizabeth R; Lane, Amanda Kelly; Collin, Matthew A; Correa-Garhwal, Sandra M; Clarke, Thomas H; Schwager, Evelyn E; Garb, Jessica E; Hayashi, Cheryl Y; Ayoub, Nadia A

    2017-03-14

    Orb-web weaving spiders and their relatives use multiple types of task-specific silks. The majority of spider silk studies have focused on the ultra-tough dragline silk synthesized in major ampullate glands, but other silk types have impressive material properties. For instance, minor ampullate silks of orb-web weaving spiders are as tough as draglines, due to their higher extensibility despite lower strength. Differences in material properties between silk types result from differences in their component proteins, particularly members of the spidroin (spider fibroin) gene family. However, the extent to which variation in material properties within a single silk type can be explained by variation in spidroin sequences is unknown. Here, we compare the minor ampullate spidroins (MiSp) of orb-weavers and cobweb weavers. Orb-web weavers use minor ampullate silk to form the auxiliary spiral of the orb-web while cobweb weavers use it to wrap prey, suggesting that selection pressures on minor ampullate spidroins (MiSp) may differ between the two groups. We report complete or nearly complete MiSp sequences from five cobweb weaving spider species and measure material properties of minor ampullate silks in a subset of these species. We also compare MiSp sequences and silk properties of our cobweb weavers to published data for orb-web weavers. We demonstrate that all our cobweb weavers possess multiple MiSp loci and that one locus is more highly expressed in at least two species. We also find that the proportion of β-spiral-forming amino acid motifs in MiSp positively correlates with minor ampullate silk extensibility across orb-web and cobweb weavers. MiSp sequences vary dramatically within and among spider species, and have likely been subject to multiple rounds of gene duplication and concerted evolution, which have contributed to the diverse material properties of minor ampullate silks. Our sequences also provide templates for recombinant silk proteins with tailored

  18. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia) gene family: tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes.

    Science.gov (United States)

    Harduin-Lepers, Anne; Petit, Daniel; Mollicone, Rosella; Delannoy, Philippe; Petit, Jean-Michel; Oriol, Rafael

    2008-09-23

    initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD) R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.

  19. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia gene family: Tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes

    Directory of Open Access Journals (Sweden)

    Petit Jean-Michel

    2008-09-01

    activities, in both invertebrates and vertebrates. The initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.

  20. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template [v1; ref status: indexed, http://f1000r.es/48i

    Directory of Open Access Journals (Sweden)

    Hossein Gouran

    2014-09-01

    Full Text Available Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC, implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF. In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

  1. Duplication of the oesophagus

    International Nuclear Information System (INIS)

    Lingg, G.; Nebel, G.

    1981-01-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined. (orig.) [de

  2. Duplication of the oesophagus

    Energy Technology Data Exchange (ETDEWEB)

    Lingg, G; Nebel, G

    1981-08-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined.

  3. Duplication in DNA Sequences

    Science.gov (United States)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  4. Function of Rad51 paralogs in eukaryotic homologous recombinational repair

    International Nuclear Information System (INIS)

    Liu, N.; Skowronek, K.

    2003-01-01

    Full text: Homologous recombinational repair (HRR) is an important mechanism for maintaining genetic integrity and cancer prevention by accurately repair of DNA double strand breaks induced by environmental insults or occurred in DNA replication. A critical step in HRR is the polymerization of Rad51 on single stranded DNA to form nuclear protein filaments, the later conduct DNA strand paring and exchange between homologous strands. A number of proteins, including replication protein A (RPA), Rad52 and Rad51 paralogs, are suggested to modulate or facilitate the process of Rad51 filament formation. Five Rad51 paralogs, namely XRCC2, XRCC3, Rad51B, Rad51C and Rad51D have been identified in eucaryotic cells. These proteins show distant protein sequence identity to Rad51, to yeast Rad51 paralogs (Rad55 and Rad57) and to each other. Hamster or chicken mutants of Rad51 paralogs exhibit hypersensitivity to a variety of DNA damaging agents, especially cross-linking agents, and are defective in assembly of Rad51 onto HRR site after DNA damage. Recent data from our and other labs showed that Rad51 paralogs constitute two distinct complexes in cell extracts, one contains XRCC2, Rad51B, Rad51C and Rad51D, and the other contains Rad51C and XRCC3. Rad51C is involved in both complexes. Our results also showed that XRCC3-Rad51C complex interacts with Rad51 in vivo. Furthermore, overexpression of Rad52 can partially suppress the hypersensitivity of XRCC2 mutant irs1 to ionizing radiation and corrected the defects in Rad51 focus formation. These results suggest that XRCC2 and other Rad51 paralogs play a mediator function to Rad51 in the early stage of HRR

  5. Neofunctionalization of Duplicated Tic40 Genes Caused a Gain-of-Function Variation Related to Male Fertility in Brassica oleracea Lineages1[W][OPEN

    Science.gov (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf

    2014-01-01

    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. PMID:25185122

  6. Neofunctionalization of duplicated Tic40 genes caused a gain-of-function variation related to male fertility in Brassica oleracea lineages.

    Science.gov (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf

    2014-11-01

    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. © 2014 American Society of Plant Biologists. All Rights Reserved.

  7. Gene duplication and neo-functionalization in the evolutionary and functional divergence of the metazoan copper transporters Ctr1 and Ctr2.

    Science.gov (United States)

    Logeman, Brandon L; Wood, L Kent; Lee, Jaekwon; Thiele, Dennis J

    2017-07-07

    Copper is an essential element for proper organismal development and is involved in a range of processes, including oxidative phosphorylation, neuropeptide biogenesis, and connective tissue maturation. The copper transporter (Ctr) family of integral membrane proteins is ubiquitously found in eukaryotes and mediates the high-affinity transport of Cu + across both the plasma membrane and endomembranes. Although mammalian Ctr1 functions as a Cu + transporter for Cu acquisition and is essential for embryonic development, a homologous protein, Ctr2, has been proposed to function as a low-affinity Cu transporter, a lysosomal Cu exporter, or a regulator of Ctr1 activity, but its functional and evolutionary relationship to Ctr1 is unclear. Here we report a biochemical, genetic, and phylogenetic comparison of metazoan Ctr1 and Ctr2, suggesting that Ctr2 arose over 550 million years ago as a result of a gene duplication event followed by loss of Cu + transport activity. Using a random mutagenesis and growth selection approach, we identified amino acid substitutions in human and mouse Ctr2 proteins that support copper-dependent growth in yeast and enhance copper accumulation in Ctr1 -/- mouse embryonic fibroblasts. These mutations revert Ctr2 to a more ancestral Ctr1-like state while maintaining endogenous functions, such as stimulating Ctr1 cleavage. We suggest key structural aspects of metazoan Ctr1 and Ctr2 that discriminate between their biological roles, providing mechanistic insights into the evolutionary, biochemical, and functional relationships between these two related proteins. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. An enhanced method for sequence walking and paralog mining: TOPO® Vector-Ligation PCR

    Directory of Open Access Journals (Sweden)

    Davis Thomas M

    2010-03-01

    Full Text Available Abstract Background Although technological advances allow for the economical acquisition of whole genome sequences, many organisms' genomes remain unsequenced, and fully sequenced genomes may contain gaps. Researchers reliant upon partial genomic or heterologous sequence information require methods for obtaining unknown sequences from loci of interest. Various PCR based techniques are available for sequence walking - i.e., the acquisition of unknown DNA sequence adjacent to known sequence. Many such methods require rigid, elaborate protocols and/or impose narrowly confined options in the choice of restriction enzymes for necessary genomic digests. We describe a new method, TOPO® Vector-Ligation PCR (or TVL-PCR that innovatively integrates available tools and familiar concepts to offer advantages as a means of both targeted sequence walking and paralog mining. Findings TVL-PCR exploits the ligation efficiency of the pCR®4-TOPO® (Invitrogen, Carlsbad, California vector system to capture fragments of unknown sequence by creating chimeric molecules containing defined priming sites at both ends. Initially, restriction enzyme-digested genomic DNA is end-repaired to create 3' adenosine overhangs and is then ligated to pCR4-TOPO vectors. The ligation product pool is used directly as a template for nested PCR, using specific primers to target orthologous sequences, or degenerate primers to enable capture of paralogous gene family members. We demonstrated the efficacy of this method by capturing entire coding and partial promoter sequences of several strawberry Superman-like genes. Conclusions TVL-PCR is a convenient and efficient method for DNA sequence walking and paralog mining that is applicable to any organism for which relevant DNA sequence is available as a basis for primer design.

  9. Evolutionary genomics and adaptive evolution of the Hedgehog gene family (Shh, Ihh and Dhh in vertebrates.

    Directory of Open Access Journals (Sweden)

    Joana Pereira

    Full Text Available The Hedgehog (Hh gene family codes for a class of secreted proteins composed of two active domains that act as signalling molecules during embryo development, namely for the development of the nervous and skeletal systems and the formation of the testis cord. While only one Hh gene is found typically in invertebrate genomes, most vertebrates species have three (Sonic hedgehog--Shh; Indian hedgehog--Ihh; and Desert hedgehog--Dhh, each with different expression patterns and functions, which likely helped promote the increasing complexity of vertebrates and their successful diversification. In this study, we used comparative genomic and adaptive evolutionary analyses to characterize the evolution of the Hh genes in vertebrates following the two major whole genome duplication (WGD events. To overcome the lack of Hh-coding sequences on avian publicly available databases, we used an extensive dataset of 45 avian and three non-avian reptilian genomes to show that birds have all three Hh paralogs. We find suggestions that following the WGD events, vertebrate Hh paralogous genes evolved independently within similar linkage groups and under different evolutionary rates, especially within the catalytic domain. The structural regions around the ion-binding site were identified to be under positive selection in the signaling domain. These findings contrast with those observed in invertebrates, where different lineages that experienced gene duplication retained similar selective constraints in the Hh orthologs. Our results provide new insights on the evolutionary history of the Hh gene family, the functional roles of these paralogs in vertebrate species, and on the location of mutational hotspots.

  10. Evolutionary genomics and adaptive evolution of the Hedgehog gene family (Shh, Ihh and Dhh) in vertebrates.

    Science.gov (United States)

    Pereira, Joana; Johnson, Warren E; O'Brien, Stephen J; Jarvis, Erich D; Zhang, Guojie; Gilbert, M Thomas P; Vasconcelos, Vitor; Antunes, Agostinho

    2014-01-01

    The Hedgehog (Hh) gene family codes for a class of secreted proteins composed of two active domains that act as signalling molecules during embryo development, namely for the development of the nervous and skeletal systems and the formation of the testis cord. While only one Hh gene is found typically in invertebrate genomes, most vertebrates species have three (Sonic hedgehog--Shh; Indian hedgehog--Ihh; and Desert hedgehog--Dhh), each with different expression patterns and functions, which likely helped promote the increasing complexity of vertebrates and their successful diversification. In this study, we used comparative genomic and adaptive evolutionary analyses to characterize the evolution of the Hh genes in vertebrates following the two major whole genome duplication (WGD) events. To overcome the lack of Hh-coding sequences on avian publicly available databases, we used an extensive dataset of 45 avian and three non-avian reptilian genomes to show that birds have all three Hh paralogs. We find suggestions that following the WGD events, vertebrate Hh paralogous genes evolved independently within similar linkage groups and under different evolutionary rates, especially within the catalytic domain. The structural regions around the ion-binding site were identified to be under positive selection in the signaling domain. These findings contrast with those observed in invertebrates, where different lineages that experienced gene duplication retained similar selective constraints in the Hh orthologs. Our results provide new insights on the evolutionary history of the Hh gene family, the functional roles of these paralogs in vertebrate species, and on the location of mutational hotspots.

  11. The impact of genome triplication on tandem gene evolution in Brassica rapa

    Directory of Open Access Journals (Sweden)

    Lu eFang

    2012-11-01

    Full Text Available Whole genome duplication (WGD and tandem duplication (TD are both important modes of gene expansion. However, how whole genome duplication influences tandemly duplicated genes is not well studied. We used Brassica rapa, which has undergone an additional genome triplication (WGT and shares a common ancestor with Arabidopsis thaliana, Arabidopsis lyrata and Thellungiella parvula, to investigate the impact of genome triplication on tandem gene evolution. We identified 2,137, 1,569, 1,751 and 1,135 tandem gene arrays in B. rapa, A. thaliana, A. lyrata and T. parvula respectively. Among them, 414 conserved tandem arrays are shared by the 3 species without WGT, which were also considered as existing in the diploid ancestor of B. rapa. Thus, after genome triplication, B. rapa should have 1,242 tandem arrays according to the 414 conserved tandems. Here, we found 400 out of the 414 tandems had at least one syntenic ortholog in the genome of B. rapa. Furthermore, 294 out of the 400 shared syntenic orthologs maintain tandem arrays (more than one gene for each syntenic hit in B. rapa. For the 294 tandem arrays, we obtained 426 copies of syntenic paralogous tandems in the triplicated genome of B. rapa. In this study, we demonstrated that tandem arrays in B. rapa were dramatically fractionated after WGT when compared either to non-tandem genes in the B. rapa genome or to the tandem arrays in closely related species that have not experienced a recent whole-genome polyploidization event.

  12. Typewriting: Toward Duplicating Success

    Science.gov (United States)

    Orsborn, Karen J.

    1977-01-01

    A description of two projects (secretarial handbook and memo pad and personalized stationery) for use in teaching the duplication process that will capture the interests of students in an advanced typewriting class. (HD)

  13. Elusive Origins of the Extra Genes in Aspergillus oryzae

    Science.gov (United States)

    Khaldi, Nora; Wolfe, Kenneth H.

    2008-01-01

    The genome sequence of Aspergillus oryzae revealed unexpectedly that this species has approximately 20% more genes than its congeneric species A. nidulans and A. fumigatus. Where did these extra genes come from? Here, we evaluate several possible causes of the elevated gene number. Many gene families are expanded in A. oryzae relative to A. nidulans and A. fumigatus, but we find no evidence of ancient whole-genome duplication or other segmental duplications, either in A. oryzae or in the common ancestor of the genus Aspergillus. We show that the presence of divergent pairs of paralogs is a feature peculiar to A. oryzae and is not shared with A. nidulans or A. fumigatus. In phylogenetic trees that include paralog pairs from A. oryzae, we frequently find that one of the genes in a pair from A. oryzae has the expected orthologous relationship with A. nidulans, A. fumigatus and other species in the subphylum Eurotiomycetes, whereas the other A. oryzae gene falls outside this clade but still within the Ascomycota. We identified 456 such gene pairs in A. oryzae. Further phylogenetic analysis did not however indicate a single consistent evolutionary origin for the divergent members of these pairs. Approximately one-third of them showed phylogenies that are suggestive of horizontal gene transfer (HGT) from Sordariomycete species, and these genes are closer together in the A. oryzae genome than expected by chance, but no unique Sordariomycete donor species was identifiable. The postulated HGTs from Sordariomycetes still leave the majority of extra A. oryzae genes unaccounted for. One possible explanation for our observations is that A. oryzae might have been the recipient of many separate HGT events from diverse donors. PMID:18725939

  14. Elusive origins of the extra genes in Aspergillus oryzae.

    Directory of Open Access Journals (Sweden)

    Nora Khaldi

    Full Text Available The genome sequence of Aspergillus oryzae revealed unexpectedly that this species has approximately 20% more genes than its congeneric species A. nidulans and A. fumigatus. Where did these extra genes come from? Here, we evaluate several possible causes of the elevated gene number. Many gene families are expanded in A. oryzae relative to A. nidulans and A. fumigatus, but we find no evidence of ancient whole-genome duplication or other segmental duplications, either in A. oryzae or in the common ancestor of the genus Aspergillus. We show that the presence of divergent pairs of paralogs is a feature peculiar to A. oryzae and is not shared with A. nidulans or A. fumigatus. In phylogenetic trees that include paralog pairs from A. oryzae, we frequently find that one of the genes in a pair from A. oryzae has the expected orthologous relationship with A. nidulans, A. fumigatus and other species in the subphylum Eurotiomycetes, whereas the other A. oryzae gene falls outside this clade but still within the Ascomycota. We identified 456 such gene pairs in A. oryzae. Further phylogenetic analysis did not however indicate a single consistent evolutionary origin for the divergent members of these pairs. Approximately one-third of them showed phylogenies that are suggestive of horizontal gene transfer (HGT from Sordariomycete species, and these genes are closer together in the A. oryzae genome than expected by chance, but no unique Sordariomycete donor species was identifiable. The postulated HGTs from Sordariomycetes still leave the majority of extra A. oryzae genes unaccounted for. One possible explanation for our observations is that A. oryzae might have been the recipient of many separate HGT events from diverse donors.

  15. Enteric and rectal duplications and duplication cysts in the adult.

    Science.gov (United States)

    Simsek, Abdurrahman; Zeybek, Nazif; Yagci, Gokhan; Kaymakcioglu, Nihat; Tas, Huseyin; Saglam, Mutlu; Cetiner, Sadettin

    2005-03-01

    Alimentary tract duplication and duplication cysts are rare congenital malformations. The ileum is the most frequently affected site. However, alimentary tract duplication and duplication cysts can occur at any point along the gastrointestinal tract. Early diagnosis and prompt surgical treatment is the best way to prevent associated morbidity. This article presents the cases of three patients admitted to Gulhane Military Medical Academy with signs of acute abdomen, intra-abdominal mass and chronic abdominal pain. These patients were found to have enteric duplication, duplication cyst and/or retro-rectal cyst. The literature on alimentary tract duplications is reviewed.

  16. The zebrafish maternal-effect gene cellular atoll encodes the centriolar component sas-6 and defects in its paternal function promote whole genome duplication.

    Science.gov (United States)

    Yabe, Taijiro; Ge, Xiaoyan; Pelegri, Francisco

    2007-12-01

    A female-sterile zebrafish maternal-effect mutation in cellular atoll (cea) results in defects in the initiation of cell division starting at the second cell division cycle. This phenomenon is caused by defects in centrosome duplication, which in turn affect the formation of a bipolar spindle. We show that cea encodes the centriolar coiled-coil protein Sas-6, and that zebrafish Cea/Sas-6 protein localizes to centrosomes. cea also has a genetic paternal contribution, which when mutated results in an arrested first cell division followed by normal cleavage. Our data supports the idea that, in zebrafish, paternally inherited centrosomes are required for the first cell division while maternally derived factors are required for centrosomal duplication and cell divisions in subsequent cell cycles. DNA synthesis ensues in the absence of centrosome duplication, and the one-cycle delay in the first cell division caused by cea mutant sperm leads to whole genome duplication. We discuss the potential implications of these findings with regards to the origin of polyploidization in animal species. In addition, the uncoupling of developmental time and cell division count caused by the cea mutation suggests the presence of a time window, normally corresponding to the first two cell cycles, which is permissive for germ plasm recruitment.

  17. Cloning and characterization of two duplicated interleukin-17A/F2 genes in common carp (Cyprinus carpio L.): Transcripts expression and bioactivity of recombinant IL-17A/F2.

    Science.gov (United States)

    Li, Hongxia; Yu, Juhua; Li, Jianlin; Tang, Yongkai; Yu, Fan; Zhou, Jie; Yu, Wenjuan

    2016-04-01

    Interleukin-17 (IL-17) plays an important role in inflammation and host defense in mammals. In this study, we identified two duplicated IL-17A/F2 genes in the common carp (Cyprinus carpio) (ccIL-17A/F2a and ccIL-17A/F2b), putative encoded proteins contain 140 amino acids (aa) with conserved IL-17 family motifs. Expression analysis revealed high constitutive expression of ccIL-17A/F2s in mucosal tissues, including gill, skin and intestine, their expression could be induced by Aeromonas hydrophila, suggesting a potential role in mucosal immunity. Recombinant ccIL-17A/F2a protein (rccIL-17A/F2a) produced in Escherichia coli could induce the expression of proinflammatory cytokines (IL-1β) and the antimicrobial peptides S100A1, S100A10a and S100A10b in the primary kidney in a dose- and time-dependent manner. Above findings suggest that ccIL-17A/F2 plays an important role in both proinflammatory and innate immunity. Two duplicated ccIL-17A/F2s showed different expression level with ccIL-17A/F2a higher than b, comparison of two 5' regulatory regions indicated the length from anticipated promoter to transcriptional start site (TSS) and putative transcription factor binding site (TFBS) were different. Promoter activity of ccIL-17A/F2a was 2.5 times of ccIL-17A/F2b which consistent with expression results of two genes. These suggest mutations in 5'regulatory region contributed to the differentiation of duplicated genes. To our knowledge, this is the first report to analyze 5'regulatory region of piscine IL-17 family genes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Combining phylogenetic and syntenic analyses for understanding the evolution of TCP ECE genes in eudicots.

    Directory of Open Access Journals (Sweden)

    Hélène L Citerne

    Full Text Available TCP ECE genes encode transcription factors which have received much attention for their repeated recruitment in the control of floral symmetry in core eudicots, and more recently in monocots. Major duplications of TCP ECE genes have been described in core eudicots, but the evolutionary history of this gene family is unknown in basal eudicots. Reconstructing the phylogeny of ECE genes in basal eudicots will help set a framework for understanding the functional evolution of these genes. TCP ECE genes were sequenced in all major lineages of basal eudicots and Gunnera which belongs to the sister clade to all other core eudicots. We show that in these lineages they have a complex evolutionary history with repeated duplications. We estimate the timing of the two major duplications already identified in the core eudicots within a timeframe before the divergence of Gunnera and after the divergence of Proteales. We also use a synteny-based approach to examine the extent to which the expansion of TCP ECE genes in diverse eudicot lineages may be due to genome-wide duplications. The three major core-eudicot specific clades share a number of collinear genes, and their common evolutionary history may have originated at the γ event. Genomic comparisons in Arabidopsis thaliana and Solanumlycopersicum highlight their separate polyploid origin, with syntenic fragments with and without TCP ECE genes showing differential gene loss and genomic rearrangements. Comparison between recently available genomes from two basal eudicots Aquilegiacoerulea and Nelumbonucifera suggests that the two TCP ECE paralogs in these species are also derived from large-scale duplications. TCP ECE loci from basal eudicots share many features with the three main core eudicot loci, and allow us to infer the makeup of the ancestral eudicot locus.

  19. A conserved segmental duplication within ELA.

    Science.gov (United States)

    Brinkmeyer-Langford, C L; Murphy, W J; Childers, C P; Skow, L C

    2010-12-01

    The assembled genomic sequence of the horse major histocompatibility complex (MHC) (equine lymphocyte antigen, ELA) is very similar to the homologous human HLA, with the notable exception of a large segmental duplication at the boundary of ELA class I and class III that is absent in HLA. The segmental duplication consists of a ∼ 710 kb region of at least 11 repeated blocks: 10 blocks each contain an MHC class I-like sequence and the helicase domain portion of a BAT1-like sequence, and the remaining unit contains the full-length BAT1 gene. Similar genomic features were found in other Perissodactyls, indicating an ancient origin, which is consistent with phylogenetic analyses. Reverse-transcriptase PCR (RT-PCR) of mRNA from peripheral white blood cells of healthy and chronically or acutely infected horses detected transcription from predicted open reading frames in several of the duplicated blocks. This duplication is not present in the sequenced MHCs of most other mammals, although a similar feature at the same relative position is present in the feline MHC (FLA). Striking sequence conservation throughout Perissodactyl evolution is consistent with a functional role for at least some of the genes included within this segmental duplication. © 2010 The Authors, Journal compilation © 2010 Stichting International Foundation for Animal Genetics.

  20. Horizontal gene transfer and the evolution of transcriptionalregulation in Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Dehal, Paramvir S.; Arkin, Adam P.

    2007-12-20

    Background: Most bacterial genes were acquired by horizontalgene transfer from other bacteria instead of being inherited bycontinuous vertical descent from an ancient ancestor}. To understand howthe regulation of these {acquired} genes evolved, we examined theevolutionary histories of transcription factors and of regulatoryinteractions from the model bacterium Escherichia coli K12. Results:Although most transcription factors have paralogs, these usually arose byhorizontal gene transfer rather than by duplication within the E. colilineage, as previously believed. In general, most neighbor regulators --regulators that are adjacent to genes that they regulate -- were acquiredby horizontal gene transfer, while most global regulators evolvedvertically within the gamma-Proteobacteria. Neighbor regulators wereoften acquired together with the adjacent operon that they regulate, sothe proximity might be maintained by repeated transfers (like "selfishoperons"). Many of the as-yet-uncharacterized (putative) regulators havealso been acquired together with adjacent genes, so we predict that theseare neighbor regulators as well. When we analyzed the histories ofregulatory interactions, we found that the evolution of regulation byduplication was rare, and surprisingly, many of the regulatoryinteractions that are shared between paralogs result from convergentevolution. Another surprise was that horizontally transferred genes aremore likely than other genes to be regulated by multiple regulators, andmost of this complex regulation probably evolved after the transfer.Conclusions: Our results highlight the rapid evolution of niche-specificgene regulation in bacteria.

  1. The centriole duplication cycle

    Science.gov (United States)

    Fırat-Karalar, Elif Nur; Stearns, Tim

    2014-01-01

    Centrosomes are the main microtubule-organizing centre of animal cells and are important for many critical cellular and developmental processes from cell polarization to cell division. At the core of the centrosome are centrioles, which recruit pericentriolar material to form the centrosome and act as basal bodies to nucleate formation of cilia and flagella. Defects in centriole structure, function and number are associated with a variety of human diseases, including cancer, brain diseases and ciliopathies. In this review, we discuss recent advances in our understanding of how new centrioles are assembled and how centriole number is controlled. We propose a general model for centriole duplication control in which cooperative binding of duplication factors defines a centriole ‘origin of duplication’ that initiates duplication, and passage through mitosis effects changes that license the centriole for a new round of duplication in the next cell cycle. We also focus on variations on the general theme in which many centrioles are created in a single cell cycle, including the specialized structures associated with these variations, the deuterosome in animal cells and the blepharoplast in lower plant cells. PMID:25047614

  2. Comparative sequence analysis of nitrogen fixation-related genes in six legumes

    Directory of Open Access Journals (Sweden)

    Dong Hyun eKim

    2013-08-01

    Full Text Available Legumes play an important role as food and forage crops in international agriculture especially in developing countries. Legumes have a unique biological process called nitrogen fixation (NF by which they convert atmospheric nitrogen to ammonia. Although legume genomes have undergone polyploidization, duplication and divergence, NF-related genes, because of their essential functional role for legumes, might have remained conserved. To understand the relationship of divergence and evolutionary processes in legumes, this study analyzes orthologs and paralogs for selected 20 NF-related genes by using comparative genomic approaches in six legumes i.e. Medicago truncatula (Mt, Cicer arietinum, Lotus japonicus, Cajanus cajan (Cc, Phaseolus vulgaris (Pv and Glycine max (Gm. Subsequently, sequence distances, numbers of synonymous substitutions per synonymous site (Ks and nonsynonymous substitutions per nonsynonymous site (Ka between orthologs and paralogs were calculated and compared across legumes. These analyses suggest the closest relationship between Gm and Cc and the farthest distance between Mt and Pv in 6 legumes. Ks proportional plots clearly showed ancient genome duplication in all legumes, whole genome duplication event in Gm and also speciation pattern in different legumes. This study also reported some interesting observations e.g. no peak at Ks 0.4 in Gm-Gm, location of two independent genes next to each other in Mt and low Ks values for outparalogs for three genes as compared to other 12 genes. In summary, this study underlines the importance of NF-related genes and provides important insights in genome organization and evolutionary aspects of six legume species analyzed.

  3. Paralogs hnRNP L and hnRNP LL exhibit overlapping but distinct RNA binding constraints.

    Directory of Open Access Journals (Sweden)

    Sarah A Smith

    Full Text Available HnRNP (heterogeneous nuclear ribonucleoprotein proteins are a large family of RNA-binding proteins that regulate numerous aspects of RNA processing. Interestingly, several paralogous pairs of hnRNPs exist that exhibit similar RNA-binding specificity to one another, yet have non-redundant functional targets in vivo. In this study we systematically investigate the possibility that the paralogs hnRNP L and hnRNP LL have distinct RNA binding determinants that may underlie their lack of functional redundancy. Using a combination of RNAcompete and native gel analysis we find that while both hnRNP L and hnRNP LL preferentially bind sequences that contain repeated CA dinucleotides, these proteins differ in their requirement for the spacing of the CAs. Specifically, hnRNP LL has a more stringent requirement for a two nucleotide space between CA repeats than does hnRNP L, resulting in hnRNP L binding more promiscuously than does hnRNP LL. Importantly, this differential requirement for the spacing of CA dinucleotides explains the previously observed differences in the sensitivity of hnRNP L and LL to mutations within the CD45 gene. We suggest that overlapping but divergent RNA-binding preferences, as we show here for hnRNP L and hnRNP LL, may be commonplace among other hnRNP paralogs.

  4. Petal-specific subfunctionalization of an APETALA3 paralog in the Ranunculales and its implications for petal evolution.

    Science.gov (United States)

    Sharma, Bharti; Guo, Chunce; Kong, Hongzhi; Kramer, Elena M

    2011-08-01

    • The petals of the lower eudicot family Ranunculaceae are thought to have been derived many times independently from stamens. However, investigation of the genetic basis of their identity has suggested an alternative hypothesis: that they share a commonly inherited petal identity program. This theory is based on the fact that an ancient paralogous lineage of APETALA3 (AP3) in the Ranunculaceae appears to have a conserved, petal-specific expression pattern. • Here, we have used a combination of approaches, including RNAi, comparative gene expression and molecular evolutionary studies, to understand the function of this petal-specific AP3 lineage. • Functional analysis of the Aquilegia locus AqAP3-3 has demonstrated that the paralog is required for petal identity with little contribution to the identity of the other floral organs. Expanded expression studies and analyses of molecular evolutionary patterns provide further evidence that orthologs of AqAP3-3 are primarily expressed in petals and are under higher purifying selection across the family than the other AP3 paralogs. • Taken together, these findings suggest that the AqAP3-3 lineage underwent progressive subfunctionalization within the order Ranunculales, ultimately yielding a specific role in petal identity that has probably been conserved, in stark contrast with the multiple independent origins predicted by botanical theories. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  5. Sorting by Cuts, Joins, and Whole Chromosome Duplications.

    Science.gov (United States)

    Zeira, Ron; Shamir, Ron

    2017-02-01

    Genome rearrangement problems have been extensively studied due to their importance in biology. Most studied models assumed a single copy per gene. However, in reality, duplicated genes are common, most notably in cancer. In this study, we make a step toward handling duplicated genes by considering a model that allows the atomic operations of cut, join, and whole chromosome duplication. Given two linear genomes, [Formula: see text] with one copy per gene and [Formula: see text] with two copies per gene, we give a linear time algorithm for computing a shortest sequence of operations transforming [Formula: see text] into [Formula: see text] such that all intermediate genomes are linear. We also show that computing an optimal sequence with fewest duplications is NP-hard.

  6. Craniofacial duplication (diprosopus).

    Science.gov (United States)

    Turpin, I M; Furnas, D W; Amlie, R N

    1981-02-01

    No congenital malformation in infants is more profound than anterior craniofacial duplication. The precise term for this rare anomaly is diprosopus, referring to a fetus with a single trunk, normal limbs, and varying degrees of facial duplication. A search of the world literature produced only 16 cases of diprosopus since 1864. Despite the rarity of this anomaly, three such infants were born in the Southern California area during the past year, making this the largest reported series to date. The three infants were born with two distinctly formed faces. Each had four separate eyes, two mouths, two noses, and two ears with a primitive ear or sinus tract at the plane of fusion. In addition, multiple congenital aberrations existed which involved a variety of internal organs. The pathogenesis of diprosopus is not well understood, but environmental stress early in embryologic development has been suggested as a possible factor. The apparent mechanism is a slowing of pregastrulation oxidation with resultant focal developmental arrests.

  7. Centrioles: duplicating precariously.

    Science.gov (United States)

    Pelletier, Laurence

    2007-09-04

    To assemble a mitotic spindle and accurately segregate chromosomes to progeny, a cell needs to precisely regulate its centrosome number, a feat largely accomplished through the tight control of centriole duplication. Recent work showing that the overexpression of centriolar proteins can lead to the formation of multiple centrioles in the absence of pre-existing centrioles challenges the idea that it is a self-replicating organelle.

  8. Rectal duplication: a case report.

    Science.gov (United States)

    Didden, K; Masereel, B; Geyskens, P

    2013-01-01

    Gastrointestinal tract duplications are uncommon congenital abnormalities, that may occur anywhere along the alimentary tract. Most frequently they occur at the level of the small bowel tract and are symptomatic before the age of two. In our case we report the history of a 68-years old women with a colon duplication, especially a rectal duplication. This is very exceptional.

  9. Embryonic duplications in sheep.

    Science.gov (United States)

    Dennis, S M

    1975-02-01

    Twenty-seven embryonic duplications were examined during a 3-year investigation into the causes of perinatal lamb mortality. Twenty of the 27 were anomalous twins with 19 being conjoined (diplopagus 9 and heteropagus 10). The various duplications were: haloacardius acephalus 1, diprosopus 2, dicephalus 2, dipypus 3, diprosopus dipygus 1, syncephalus dipygus 1, pygopagus parasiticus 1, heteropagus dipygus 3, melodidymus 6, polyury 4, penile duplication 2, and bilateral otognathia 1. Four lambs were living and the time of death of the others was: parturient 8, and post-parturient 15. Average dry weight of the lambs was 3.35 kg (range 1.59 to 5.45 kg). Breed distribution was: Merino 77.8%, Crossbred 14.8%, Dorset Horn 3.7%, and Corriedale 3.7%. The caudal region was involved in 10 of the conjoined twins (52.6%), anterior region in 7 (36.9%), and both anterior and caudal regions in 2 (10.5%). Associated defects were present in 70.4% of the 27 lambs, the most common being atresia ani.

  10. The sequence and analysis of duplication rich human chromosome 16

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-08-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  11. The Sequence and Analysis of Duplication Rich Human Chromosome 16

    Science.gov (United States)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

    2004-01-01

    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  12. SPOCS: Software for Predicting and Visualizing Orthology/Paralogy Relationships Among Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Curtis, Darren S.; Phillips, Aaron R.; Callister, Stephen J.; Conlan, Sean; McCue, Lee Ann

    2013-10-15

    At the rate that prokaryotic genomes can now be generated, comparative genomics studies require a flexible method for quickly and accurately predicting orthologs among the rapidly changing set of genomes available. SPOCS implements a graph-based ortholog prediction method to generate a simple tab-delimited table of orthologs and in addition, html files that provide a visualization of the predicted ortholog/paralog relationships to which gene/protein expression metadata may be overlaid. AVAILABILITY AND IMPLEMENTATION: A SPOCS web application is freely available at http://cbb.pnnl.gov/portal/tools/spocs.html. Source code for Linux systems is also freely available under an open source license at http://cbb.pnnl.gov/portal/software/spocs.html; the Boost C++ libraries and BLAST are required.

  13. Roquin Paralogs Differentially Regulate Functional NKT Cell Subsets.

    Science.gov (United States)

    Drees, Christoph; Vahl, J Christoph; Bortoluzzi, Sabrina; Heger, Klaus D; Fischer, Julius C; Wunderlich, F Thomas; Peschel, Christian; Schmidt-Supprian, Marc

    2017-04-01

    NKT cells represent a small subset of glycolipid-recognizing T cells that are heavily implicated in human allergic, autoimmune, and malignant diseases. In the thymus, precursor cells recognize self-glycolipids by virtue of their semi-invariant TCR, which triggers NKT cell lineage commitment and maturation. During their development, NKT cells are polarized into the NKT1, NKT2, and NKT17 subsets, defined through their cytokine-secretion patterns and the expression of key transcription factors. However, we have largely ignored how the differentiation into the NKT cell subsets is regulated. In this article, we describe the mRNA-binding Roquin-1 and -2 proteins as central regulators of murine NKT cell fate decisions. In the thymus, T cell-specific ablation of the Roquin paralogs leads to a dramatic expansion of NKT17 cells, whereas peripheral mature NKT cells are essentially absent. Roquin-1/2-deficient NKT17 cells show exaggerated lineage-specific expression of nearly all NKT17-defining proteins tested. We show through mixed bone marrow chimera experiments that NKT17 polarization is mediated through cell-intrinsic mechanisms early during NKT cell development. In contrast, the loss of peripheral NKT cells is due to cell-extrinsic factors. Surprisingly, Roquin paralog-deficient NKT cells are, in striking contrast to conventional T cells, compromised in their ability to secrete cytokines. Altogether, we show that Roquin paralogs regulate the development and function of NKT cell subsets in the thymus and periphery. Copyright © 2017 by The American Association of Immunologists, Inc.

  14. NIF-type iron-sulfur cluster assembly system is duplicated and distributed in the mitochondria and cytosol of Mastigamoeba balamuthi.

    Science.gov (United States)

    Nývltová, Eva; Šuták, Robert; Harant, Karel; Šedinová, Miroslava; Hrdy, Ivan; Paces, Jan; Vlček, Čestmír; Tachezy, Jan

    2013-04-30

    In most eukaryotes, the mitochondrion is the main organelle for the formation of iron-sulfur (FeS) clusters. This function is mediated through the iron-sulfur cluster assembly machinery, which was inherited from the α-proteobacterial ancestor of mitochondria. In Archamoebae, including pathogenic Entamoeba histolytica and free-living Mastigamoeba balamuthi, the complex iron-sulfur cluster machinery has been replaced by an ε-proteobacterial nitrogen fixation (NIF) system consisting of two components: NifS (cysteine desulfurase) and NifU (scaffold protein). However, the cellular localization of the NIF system and the involvement of mitochondria in archamoebal FeS assembly are controversial. Here, we show that the genes for both NIF components are duplicated within the M. balamuthi genome. One paralog of each protein contains an amino-terminal extension that targets proteins to mitochondria (NifS-M and NifU-M), and the second paralog lacks a targeting signal, thereby reflecting the cytosolic form of the NIF machinery (NifS-C and NifU-C). The dual localization of the NIF system corresponds to the presence of FeS proteins in both cellular compartments, including detectable hydrogenase activity in Mastigamoeba cytosol and mitochondria. In contrast, E. histolytica possesses only single genes encoding NifS and NifU, respectively, and there is no evidence for the presence of the NIF machinery in its reduced mitochondria. Thus, M. balamuthi is unique among eukaryotes in that its FeS cluster formation is mediated through two most likely independent NIF machineries present in two cellular compartments.

  15. Haplotype Detection from Next-Generation Sequencing in High-Ploidy-Level Species: 45S rDNA Gene Copies in the Hexaploid Spartina maritima

    Czech Academy of Sciences Publication Activity Database

    Boutte, J.; Aliaga, B.; Lima, O.; de Carvalho, J.F.; Ainouche, A.; Macas, Jiří; Rousseau-Gueutin, M.; Coriton, O.; Ainouche, M.; Salmon, A.

    2016-01-01

    Roč. 6, č. 1 (2016), s. 29-40 ISSN 2160-1836 Institutional support: RVO:60077344 Keywords : poaceae * duplication * paralogy * bioinformatics * polyploidy Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.861, year: 2016

  16. Genetics Home Reference: 7q11.23 duplication syndrome

    Science.gov (United States)

    ... Duplication Syndrome. 2015 Nov 25. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Ledbetter N, Mefford HC, Smith RJH, Stephens K, editors. GeneReviews® [Internet]. Seattle (WA): ...

  17. Craniofacial duplication: a case report.

    Science.gov (United States)

    Suryawanshi, Pradeep; Deshpande, Mandar; Verma, Nitin; Mahendrakar, Vivek; Mahendrakar, Sandhya

    2013-09-01

    A craniofacial duplication or diprosopus is an unusual variant of conjoined twinning. The reported incidence is one in 180,000-15 million births and 35 cases have been reported till date. The phenotype is wide, with the partial duplication of a few facial structures to complete dicephalus. A complete duplication is associated with a high incidence of anomalies in the central nervous system, cardiovascular system, gastrointestinal system and the respiratory system, whereas no major anomalies are found in the infants with a partial duplication. A term baby with the features of a craniofacial duplication has been described, with the proposed theories on embryogenesis and a brief review of the literature.

  18. Rectal duplication with sciatic hernia.

    Science.gov (United States)

    Nosek, Marzena; Golonka, Anna; Kalińska-Lipert, Anita; Nachulewicz, Paweł

    2015-07-01

    Rectal duplications represent 5% of all duplications in the alimentary tract, and they are very rarely diagnosed during the neonatal period. The authors present the method of investigation and the results of surgical treatment of a full-term neonate with a sciatic hernia containing a rectal duplication. The procedure started with three-port laparoscopy, but excision of the tubular duplication of the rectum was possible only by a transanal endorectal pull-through approach. The sciatic hernia was closed, and plastic sutures on the buttock finished the procedure. The coincidence of sciatic hernia with rectal duplication is extremely rare, and the method of treatment depends exclusively on the anatomical conditions.

  19. Evolution of the vertebrate Pax4/6 class of genes with focus on its novel member, the Pax10 gene.

    Science.gov (United States)

    Feiner, Nathalie; Meyer, Axel; Kuraku, Shigehiro

    2014-06-19

    The members of the paired box (Pax) family regulate key developmental pathways in many metazoans as tissue-specific transcription factors. Vertebrate genomes typically possess nine Pax genes (Pax1-9), which are derived from four proto-Pax genes in the vertebrate ancestor that were later expanded through the so-called two-round (2R) whole-genome duplication. A recent study proposed that pax6a genes of a subset of teleost fishes (namely, acanthopterygians) are remnants of a paralog generated in the 2R genome duplication, to be renamed pax6.3, and reported one more group of vertebrate Pax genes (Pax6.2), most closely related to the Pax4/6 class. We propose to designate this new member Pax10 instead and reconstruct the evolutionary history of the Pax4/6/10 class with solid phylogenetic evidence. Our synteny analysis showed that Pax4, -6, and -10 originated in the 2R genome duplications early in vertebrate evolution. The phylogenetic analyses of relationships between teleost pax6a and other Pax4, -6, and -10 genes, however, do not support the proposed hypothesis of an ancient origin of the acanthopterygian pax6a genes in the 2R genome duplication. Instead, we confirmed the traditional scenario that the acanthopterygian pax6a is derived from the more recent teleost-specific genome duplication. Notably, Pax6 is present in all vertebrates surveyed to date, whereas Pax4 and -10 were lost multiple times in independent vertebrate lineages, likely because of their restricted expression patterns: Among Pax6-positive domains, Pax10 has retained expression in the adult retina alone, which we documented through in situ hybridization and quantitative reverse transcription polymerase chain reaction experiments on zebrafish, Xenopus, and anole lizard. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Whole Genome and Tandem Duplicate Retention facilitated Glucosinolate Pathway Diversification in the Mustard Family.

    NARCIS (Netherlands)

    Hofberger, J.A.; Lyons, E.; Edger, P.P.; Pires, J.C.; Schranz, M.E.

    2013-01-01

    Plants share a common history of successive whole genome duplication (WGD) events retaining genomic patterns of duplicate gene copies (ohnologs) organized in conserved syntenic blocks. Duplication was often proposed to affect the origin of novel traits during evolution. However, genetic evidence

  1. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    NARCIS (Netherlands)

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes.

  2. Annelid Distal-less/Dlx duplications reveal varied post-duplication fates

    Directory of Open Access Journals (Sweden)

    Korchagina Natalia

    2011-08-01

    Full Text Available Abstract Background Dlx (Distal-less genes have various developmental roles and are widespread throughout the animal kingdom, usually occurring as single copy genes in non-chordates and as multiple copies in most chordate genomes. While the genomic arrangement and function of these genes is well known in vertebrates and arthropods, information about Dlx genes in other organisms is scarce. We investigate the presence of Dlx genes in several annelid species and examine Dlx gene expression in the polychaete Pomatoceros lamarckii. Results Two Dlx genes are present in P. lamarckii, Capitella teleta and Helobdella robusta. The C. teleta Dlx genes are closely linked in an inverted tail-to-tail orientation, reminiscent of the arrangement of vertebrate Dlx pairs, and gene conversion appears to have had a role in their evolution. The H. robusta Dlx genes, however, are not on the same genomic scaffold and display divergent sequences, while, if the P. lamarckii genes are linked in a tail-to-tail orientation they are a minimum of 41 kilobases apart and show no sign of gene conversion. No expression in P. lamarckii appendage development has been observed, which conflicts with the supposed conserved role of these genes in animal appendage development. These Dlx duplications do not appear to be annelid-wide, as the polychaete Platynereis dumerilii likely possesses only one Dlx gene. Conclusions On the basis of the currently accepted annelid phylogeny, we hypothesise that one Dlx duplication occurred in the annelid lineage after the divergence of P. dumerilii from the other lineages and these duplicates then had varied evolutionary fates in different species. We also propose that the ancestral role of Dlx genes is not related to appendage development.

  3. The lipoxygenase gene family: a genomic fossil of shared polyploidy between Glycine max and Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Choi Beom-Soon

    2008-12-01

    Full Text Available Abstract Background Soybean lipoxygenases (Lxs play important roles in plant resistance and in conferring the distinct bean flavor. Lxs comprise a multi-gene family that includes GmLx1, GmLx2 and GmLx3, and many of these genes have been characterized. We were interested in investigating the relationship between the soybean lipoxygenase isozymes from an evolutionary perspective, since soybean has undergone two rounds of polyploidy. Here we report the tetrad genome structure of soybean Lx regions produced by ancient and recent polyploidy. Also, comparative genomics with Medicago truncatula was performed to estimate Lxs in the common ancestor of soybean and Medicago. Results Two Lx regions in Medicago truncatula showing synteny with soybean were analyzed. Differential evolutionary rates between soybean and Medicago were observed and the median Ks values of Mt-Mt, Gm-Mt, and Gm-Gm paralogs were determined to be 0.75, 0.62, and 0.46, respectively. Thus the comparison of Gm-Mt paralogs (Ks = 0.62 and Gm-Mt orthologs (Ks = 0.45 supports the ancient duplication of Lx regions in the common ancestor prior to the Medicago-Glycine split. After speciation, no Lx regions generated by another polyploidy were identified in Medicago. Instead tandem duplication of Lx genes was observed. On the other hand, a lineage-specific duplication occurred in soybean resulting in two pairs of Lx regions. Each pair of soybean regions was co-orthologous to one Lx region in Medicago. A total of 34 Lx genes (15 MtLxs and 19 GmLxs were divided into two groups by phylogenetic analysis. Our study shows that the Lx gene family evolved from two distinct Lx genes in the most recent common ancestor. Conclusion This study analyzed two pairs of Lx regions generated by two rounds of polyploidy in soybean. Each pair of soybean homeologous regions is co-orthologous to one region of Medicago, demonstrating the quartet structure of the soybean genome. Differential evolutionary rates between

  4. Duplicated middle cerebral artery

    Science.gov (United States)

    Perez, Jesus; Machado, Calixto; Scherle, Claudio; Hierro, Daniel

    2009-01-01

    Duplicated middle cerebral artery (DMCA) is an anomalous vessel arising from the internal carotid artery. The incidence DMCA is relatively law, and an association between this anomaly and cerebral aneurysms has been documented. There is a controversy whether DMCA may have perforating arteries. This is an important fact to consider in aneurysm surgery. We report the case of a 34-year-old black woman who suffered a subarachnoid hemorrhage and the angiography a left DMCA, and an aneurysm in an inferior branch of the main MCA. The DMCA and the MCA had perforating arteries. The aneurysm was clipped without complications. The observation of perforating arteries in our patient confirms that the DMCA may have perforating arteries. This is very important to be considered in cerebral aneurysms surgery. Moreover, the DMCA may potentially serve as a collateral blood supply to the MCA territory in cases of MCA occlusion. PMID:22140405

  5. Duplication at Xq28 involving IKBKG is associated with progressive macrocephaly, recurrent infections, ectodermal dysplasia, benign tumors, and neuropathy

    NARCIS (Netherlands)

    Asbeck, E. Van; Ramalingam, A.; Dvorak, C.; Chen, T.J.; Morava, E.

    2014-01-01

    Duplications on Xq28 are common, although quite variable in size, but usually include the MECP2 gene. Here, we present a patient with a unique, small, 167-kb duplication at Xq28, not including MECP2. The most important gene in the duplicated region was IKBKG, mutations in which can cause a variety

  6. Sibling rivalry among paralogs promotes evolution of the human brain.

    Science.gov (United States)

    Tyler-Smith, Chris; Xue, Yali

    2012-05-11

    Geneticists have long sought to identify the genetic changes that made us human, but pinpointing the functionally relevant changes has been challenging. Two papers in this issue suggest that partial duplication of SRGAP2, producing an incomplete protein that antagonizes the original, contributed to human brain evolution. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Colonic duplication in an adult

    International Nuclear Information System (INIS)

    Baro, P.; Dario Casas, J.; Sanchez, D.

    1988-01-01

    A case of colonic duplication that was diagnosed radiologically in an adult is reported. A long duplicated segment below the normal transverse colon, with a wide anastomosis at the hepatic flexure level, was observed on barium enema. The rarity of this anomaly unassociated with other malformations is emphasized. (orig.)

  8. Complete colonic duplication in children.

    Science.gov (United States)

    Khaleghnejad Tabari, Ahmad; Mirshemirani, Alireza; Khaleghnejad Tabari, Nasibeh

    2012-01-01

    Complete colonic duplication is a very rare congenital anomaly that may have different presentations according to its location and size. Complete colonic duplication can occur in 15% of gastrointestinal duplication. We report two cases of complete colonic duplications, and their characteristics. We present two patients with complete colonic duplication with different types and presentations. Case 1: A 2- year old boy presented to the clinic with abdominal protrusion, difficulty to defecate, chronic constipation and mucosal prolaps covered bulging (rectocele) since he was 6 months old. The patient had palpable pelvic mass with doughy consistency. Rectal exam confirmed perirectal mass with soft consistency. The patient underwent a surgical operation that had total tubular colorectal duplication with one blind end and was treated with simple fenestration of distal end, and was discharged without complication. After two years follow up, he had normal defecation and good weight gain. Case 2: A 2 -day old infant was referred with imperforate anus and complete duplication of recto-sigmoid colon, diphallus, double bladder, and hypospadiasis. After clinical and paraclinical investigations, he underwent operations in several stages in different periods, and was discharged without complications. After four years follow up, he led a normal life. The patients with complete duplication have to be examined carefully because of the high incidence of other systemic anomalies. Treatment includes simple resection of distal common wall, fenestration, and repair other associated anomalies.

  9. Genome-Wide Identification and Functional Analysis of the Calcineurin B-like Protein and Calcineurin B-like Protein-Interacting Protein Kinase Gene Families in Turnip (Brassica rapa var. rapa

    Directory of Open Access Journals (Sweden)

    Xin Yin

    2017-07-01

    Full Text Available The calcineurin B-like protein (CBL–CBL-interacting protein kinase (CIPK complex has been identified as a primary component in calcium sensors that perceives various stress signals. Turnip (Brassica rapa var. rapa has been widely cultivated in the Qinghai–Tibet Plateau for a century as a food crop of worldwide economic significance. These CBL–CIPK complexes have been demonstrated to play crucial roles in plant response to various environmental stresses. However, no report is available on the genome-wide characterization of these two gene families in turnip. In the present study, 19 and 51 members of the BrrCBL and BrrCIPK genes, respectively, are first identified in turnip and phylogenetically grouped into three and two distinct clusters, respectively. The expansion of these two gene families is mainly attributable to segmental duplication. Moreover, the differences in expression patterns in quantitative real-time PCR, as well as interaction profiles in the yeast two-hybrid assay, suggest the functional divergence of paralog genes during long-term evolution in turnip. Overexpressing and complement lines in Arabidopsis reveal that BrrCBL9.2 improves, but BrrCBL9.1 does not affect, salt tolerance in Arabidopsis. Thus, the expansion of the BrrCBL and BrrCIPK gene families enables the functional differentiation and evolution of some new gene functions of paralog genes. These paralog genes then play prominent roles in turnip's adaptation to the adverse environment of the Qinghai–Tibet Plateau. Overall, the study results contribute to our understanding of the functions of the CBL–CIPK complex and provide basis for selecting appropriate genes for the in-depth functional studies of BrrCBL–BrrCIPK in turnip.

  10. Successive increases in the resistance of Drosophila to viral infection through a transposon insertion followed by a Duplication.

    Directory of Open Access Journals (Sweden)

    Michael M Magwire

    2011-10-01

    Full Text Available To understand the molecular basis of how hosts evolve resistance to their parasites, we have investigated the genes that cause variation in the susceptibility of Drosophila melanogaster to viral infection. Using a host-specific pathogen of D. melanogaster called the sigma virus (Rhabdoviridae, we mapped a major-effect polymorphism to a region containing two paralogous genes called CHKov1 and CHKov2. In a panel of inbred fly lines, we found that a transposable element insertion in the protein coding sequence of CHKov1 is associated with increased resistance to infection. Previous research has shown that this insertion results in a truncated messenger RNA that encodes a far shorter protein than the susceptible allele. This resistant allele has rapidly increased in frequency under directional selection and is now the commonest form of the gene in natural populations. Using genetic mapping and site-specific recombination, we identified a third genotype with considerably greater resistance that is currently rare in the wild. In these flies there have been two duplications, resulting in three copies of both the truncated allele of CHKov1 and CHKov2 (one of which is also truncated. Remarkably, the truncated allele of CHKov1 has previously been found to confer resistance to organophosphate insecticides. As estimates of the age of this allele predate the use of insecticides, it is likely that this allele initially functioned as a defence against viruses and fortuitously "pre-adapted" flies to insecticides. These results demonstrate that strong selection by parasites for increased host resistance can result in major genetic changes and rapid shifts in allele frequencies; and, contrary to the prevailing view that resistance to pathogens can be a costly trait to evolve, the pleiotropic effects of these changes can have unexpected benefits.

  11. Molecular characterization of BrMYB28 and BrMYB29 paralogous transcription factors involved in the regulation of aliphatic glucosinolate profiles in Brassica rapa ssp. pekinensis.

    Science.gov (United States)

    Baskar, Venkidasamy; Park, Se Won

    2015-07-01

    Glucosinolates (GSL) are one of the major secondary metabolites of the Brassicaceae family. In the present study, we aim at characterizing the multiple paralogs of aliphatic GSL regulators, such as BrMYB28 and BrMYB29 genes in Brassica rapa ssp. pekinensis, by quantitative real-time PCR (qRT-PCR) analysis in different tissues and at various developmental stages. An overlapping gene expression pattern between the BrMYBs as well as their downstream genes (DSGs) was found at different developmental stages. Among the BrMYB28 and BrMYB29 paralogous genes, the BrMYB28.3 and BrMYB29.1 genes were dominantly expressed in most of the developmental stages, compared to the other paralogs of the BrMYB genes. Furthermore, the differential expression pattern of the BrMYBs was observed under various stress treatments. Interestingly, BrMYB28.2 showed the least expression in most developmental stages, while its expression was remarkably high in different stress conditions. More specifically, the BrMYB28.2, BrMYB28.3, and BrMYB29.1 genes were highly responsive to various abiotic and biotic stresses, further indicating their possible role in stress tolerance. Moreover, the in silico cis motif analysis in the upstream regulatory regions of BrMYBs showed the presence of various putative stress-specific motifs, which further indicated their responsiveness to biotic and abiotic stresses. These observations suggest that the dominantly expressed BrMYBs, both in different developmental stages and under various stress treatments (BrMYB28.3 and BrMYB29.1), may be potential candidate genes for altering the GSL level through genetic modification studies in B. rapa ssp. pekinensis. Copyright © 2015. Published by Elsevier SAS.

  12. Ionizing radiation-induced foci formation of mammalian Rad51 and Rad54 depends on the Rad51 paralogs, but not on Rad52

    International Nuclear Information System (INIS)

    Veelen, Lieneke R. van; Essers, Jeroen; Rakt, Mandy W.M.M. van de; Odijk, Hanny; Pastink, Albert; Zdzienicka, MaIgorzata Z.; Paulusma, Coen C.; Kanaar, Roland

    2005-01-01

    Homologous recombination is of major importance for the prevention of genomic instability during chromosome duplication and repair of DNA damage, especially double-strand breaks. Biochemical experiments have revealed that during the process of homologous recombination the RAD52 group proteins, including Rad51, Rad52 and Rad54, are involved in an essential step: formation of a joint molecule between the broken DNA and the intact repair template. Accessory proteins for this reaction include the Rad51 paralogs and BRCA2. The significance of homologous recombination for the cell is underscored by the evolutionary conservation of the Rad51, Rad52 and Rad54 proteins from yeast to humans. Upon treatment of cells with ionizing radiation, the RAD52 group proteins accumulate at the sites of DNA damage into so-called foci. For the yeast Saccharomyces cerevisiae, foci formation of Rad51 and Rad54 is abrogated in the absence of Rad52, while Rad51 foci formation does occur in the absence of the Rad51 paralog Rad55. By contrast, we show here that in mammalian cells, Rad52 is not required for foci formation of Rad51 and Rad54. Furthermore, radiation-induced foci formation of Rad51 and Rad54 is impaired in all Rad51 paralog and BRCA2 mutant cell lines tested, while Rad52 foci formation is not influenced by a mutation in any of these recombination proteins. Despite their evolutionary conservation and biochemical similarities, S. cerevisiae and mammalian Rad52 appear to differentially contribute to the DNA-damage response

  13. Genome-Wide Distribution, Organisation and Functional Characterization of Disease Resistance and Defence Response Genes across Rice Species

    Science.gov (United States)

    Singh, Sangeeta; Chand, Suresh; Singh, N. K.; Sharma, Tilak Raj

    2015-01-01

    The resistance (R) genes and defense response (DR) genes have become very important resources for the development of disease resistant cultivars. In the present investigation, genome-wide identification, expression, phylogenetic and synteny analysis was done for R and DR-genes across three species of rice viz: Oryza sativa ssp indica cv 93-11, Oryza sativa ssp japonica and wild rice species, Oryza brachyantha. We used the in silico approach to identify and map 786 R -genes and 167 DR-genes, 672 R-genes and 142 DR-genes, 251 R-genes and 86 DR-genes in the japonica, indica and O. brachyanth a genomes, respectively. Our analysis showed that 60.5% and 55.6% of the R-genes are tandemly repeated within clusters and distributed over all the rice chromosomes in indica and japonica genomes, respectively. The phylogenetic analysis along with motif distribution shows high degree of conservation of R- and DR-genes in clusters. In silico expression analysis of R-genes and DR-genes showed more than 85% were expressed genes showing corresponding EST matches in the databases. This study gave special emphasis on mechanisms of gene evolution and duplication for R and DR genes across species. Analysis of paralogs across rice species indicated 17% and 4.38% R-genes, 29% and 11.63% DR-genes duplication in indica and Oryza brachyantha, as compared to 20% and 26% duplication of R-genes and DR-genes in japonica respectively. We found that during the course of duplication only 9.5% of R- and DR-genes changed their function and rest of the genes have maintained their identity. Syntenic relationship across three genomes inferred that more orthology is shared between indica and japonica genomes as compared to brachyantha genome. Genome wide identification of R-genes and DR-genes in the rice genome will help in allele mining and functional validation of these genes, and to understand molecular mechanism of disease resistance and their evolution in rice and related species. PMID:25902056

  14. A second corticotropin-releasing hormone gene (CRH2) is conserved across vertebrate classes and expressed in the hindbrain of a basal neopterygian fish, the spotted gar (Lepisosteus oculatus).

    Science.gov (United States)

    Grone, Brian P; Maruska, Karen P

    2015-05-01

    To investigate the origins of the vertebrate stress-response system, we searched sequenced vertebrate genomes for genes resembling corticotropin-releasing hormone (CRH). We found that vertebrate genomes possess, in addition to CRH, another gene that resembles CRH in sequence and syntenic environment. This paralogous gene was previously identified only in the elephant shark (a holocephalan), but we find it also in marsupials, monotremes, lizards, turtles, birds, and fishes. We examined the relationship of this second vertebrate CRH gene, which we name CRH2, to CRH1 (previously known as CRH) and urocortin1/urotensin1 (UCN1/UTS1) in primitive fishes, teleosts, and tetrapods. The paralogs CRH1 and CRH2 likely evolved via duplication of CRH during a whole-genome duplication early in the vertebrate lineage. CRH2 was subsequently lost in both teleost fishes and eutherian mammals but retained in other lineages. To determine where CRH2 is expressed relative to CRH1 and UTS1, we used in situ hybridization on brain tissue from spotted gar (Lepisosteus oculatus), a neopterygian fish closely related to teleosts. In situ hybridization revealed widespread distribution of both crh1 and uts1 in the brain. Expression of crh2 was restricted to the putative secondary gustatory/secondary visceral nucleus, which also expressed calcitonin-related polypeptide alpha (calca), a marker of parabrachial nucleus in mammals. Thus, the evolutionary history of CRH2 includes restricted expression in the brain, sequence changes, and gene loss, likely reflecting release of selective constraints following whole-genome duplication. The discovery of CRH2 opens many new possibilities for understanding the diverse functions of the CRH family of peptides across vertebrates. © 2015 Wiley Periodicals, Inc.

  15. p53 protects against genome instability following centriole duplication failure

    Science.gov (United States)

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  16. The duplication 17p13.3 phenotype

    DEFF Research Database (Denmark)

    Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica

    2013-01-01

    . Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....

  17. Two duplicated chicken-type lysozyme genes in disc abalone Haliotis discus discus: molecular aspects in relevance to structure, genomic organization, mRNA expression and bacteriolytic function.

    Science.gov (United States)

    Umasuthan, Navaneethaiyer; Bathige, S D N K; Kasthuri, Saranya Revathy; Wan, Qiang; Whang, Ilson; Lee, Jehee

    2013-08-01

    Lysozymes are crucial antibacterial proteins that are associated with catalytic cleavage of peptidoglycan and subsequent bacteriolysis. The present study describes the identification of two lysozyme genes from disc abalone Haliotis discus discus and their characterization at sequence-, genomic-, transcriptional- and functional-levels. Two cDNAs and BAC clones bearing lysozyme genes were isolated from abalone transcriptome and BAC genomic libraries, respectively and sequences were determined. Corresponding deduced amino acid sequences harbored a chicken-type lysozyme (LysC) family profile and exhibited conserved characteristics of LysC family members including active residues (Glu and Asp) and GS(S/T)DYGIFQINS motif suggested that they are LysC counterparts in disc abalone and designated as abLysC1 and abLysC2. While abLysC1 represented the homolog recently reported in Ezo abalone [1], abLysC2 shared significant identity with LysC homologs. Unlike other vertebrate LysCs, coding sequence of abLysCs were distributed within five exons interrupted by four introns. Both abLysCs revealed a broader mRNA distribution with highest levels in mantle (abLysC1) and hepatopancreas (abLysC2) suggesting their likely main role in defense and digestion, respectively. Investigation of temporal transcriptional profiles post-LPS and -pathogen challenges revealed induced-responses of abLysCs in gills and hemocytes. The in vitro muramidase activity of purified recombinant (r) abLysCs proteins was evaluated, and findings indicated that they are active in acidic pH range (3.5-6.5) and over a broad temperature range (20-60 °C) and influenced by ionic strength. When the antibacterial spectra of (r)abLysCs were examined, they displayed differential activities against both Gram positive and Gram negative strains providing evidence for their involvement in bacteriolytic function in abalone physiology. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. In silico reversal of repeat-induced point mutation (RIP identifies the origins of repeat families and uncovers obscured duplicated genes

    Directory of Open Access Journals (Sweden)

    Hane James K

    2010-11-01

    Full Text Available Abstract Background Repeat-induced point mutation (RIP is a fungal genome defence mechanism guarding against transposon invasion. RIP mutates the sequence of repeated DNA and over time renders the affected regions unrecognisable by similarity search tools such as BLAST. Results DeRIP is a new software tool developed to predict the original sequence of a RIP-mutated region prior to the occurrence of RIP. In this study, we apply deRIP to the genome of the wheat pathogen Stagonospora nodorum SN15 and predict the origin of several previously uncharacterised classes of repetitive DNA. Conclusions Five new classes of transposon repeats and four classes of endogenous gene repeats were identified after deRIP. The deRIP process is a new tool for fungal genomics that facilitates the identification and understanding of the role and origin of fungal repetitive DNA. DeRIP is open-source and is available as part of the RIPCAL suite at http://www.sourceforge.net/projects/ripcal.

  19. Human GW182 Paralogs Are the Central Organizers for RNA-Mediated Control of Transcription.

    Science.gov (United States)

    Hicks, Jessica A; Li, Liande; Matsui, Masayuki; Chu, Yongjun; Volkov, Oleg; Johnson, Krystal C; Corey, David R

    2017-08-15

    In the cytoplasm, small RNAs can control mammalian translation by regulating the stability of mRNA. In the nucleus, small RNAs can also control transcription and splicing. The mechanisms for RNA-mediated nuclear regulation are not understood and remain controversial, hindering the effective application of nuclear RNAi and investigation of its natural regulatory roles. Here, we reveal that the human GW182 paralogs TNRC6A/B/C are central organizing factors critical to RNA-mediated transcriptional activation. Mass spectrometry of purified nuclear lysates followed by experimental validation demonstrates that TNRC6A interacts with proteins involved in protein degradation, RNAi, the CCR4-NOT complex, the mediator complex, and histone-modifying complexes. Functional analysis implicates TNRC6A, NAT10, MED14, and WDR5 in RNA-mediated transcriptional activation. These findings describe protein complexes capable of bridging RNA-mediated sequence-specific recognition of noncoding RNA transcripts with the regulation of gene transcription. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  20. A paralogous decoy protects Phytophthora sojae apoplastic effector PsXEG1 from a host inhibitor.

    Science.gov (United States)

    Ma, Zhenchuan; Zhu, Lin; Song, Tianqiao; Wang, Yang; Zhang, Qi; Xia, Yeqiang; Qiu, Min; Lin, Yachun; Li, Haiyang; Kong, Liang; Fang, Yufeng; Ye, Wenwu; Wang, Yan; Dong, Suomeng; Zheng, Xiaobo; Tyler, Brett M; Wang, Yuanchao

    2017-02-17

    The extracellular space (apoplast) of plant tissue represents a critical battleground between plants and attacking microbes. Here we show that a pathogen-secreted apoplastic xyloglucan-specific endoglucanase, PsXEG1, is a focus of this struggle in the Phytophthora sojae -soybean interaction. We show that soybean produces an apoplastic glucanase inhibitor protein, GmGIP1, that binds to PsXEG1 to block its contribution to virulence. P. sojae , however, secretes a paralogous PsXEG1-like protein, PsXLP1, that has lost enzyme activity but binds to GmGIP1 more tightly than does PsXEG1, thus freeing PsXEG1 to support P. sojae infection. The gene pair encoding PsXEG1 and PsXLP1 is conserved in many Phytophthora species, and the P. parasitica orthologs PpXEG1 and PpXLP1 have similar functions. Thus, this apoplastic decoy strategy may be widely used in Phytophthora pathosystems. Copyright © 2017, American Association for the Advancement of Science.

  1. Diversification of Transcriptional Regulation Determines Subfunctionalization of Paralogous Branched Chain Aminotransferases in the Yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    González, James; López, Geovani; Argueta, Stefany; Escalera-Fanjul, Ximena; El Hafidi, Mohammed; Campero-Basaldua, Carlos; Strauss, Joseph; Riego-Ruiz, Lina; González, Alicia

    2017-11-01

    Saccharomyces cerevisiae harbors BAT1 and BAT2 paralogous genes that encode branched chain aminotransferases and have opposed expression profiles and physiological roles . Accordingly, in primary nitrogen sources such as glutamine, BAT1 expression is induced, supporting Bat1-dependent valine-isoleucine-leucine (VIL) biosynthesis, while BAT2 expression is repressed. Conversely, in the presence of VIL as the sole nitrogen source, BAT1 expression is hindered while that of BAT2 is activated, resulting in Bat2-dependent VIL catabolism. The presented results confirm that BAT1 expression is determined by transcriptional activation through the action of the Leu3-α-isopropylmalate (α-IPM) active isoform, and uncovers the existence of a novel α-IPM biosynthetic pathway operating in a put3 Δ mutant grown on VIL, through Bat2-Leu2-Leu1 consecutive action. The classic α-IPM biosynthetic route operates in glutamine through the action of the leucine-sensitive α-IPM synthases. The presented results also show that BAT2 repression in glutamine can be alleviated in a ure2 Δ mutant or through Gcn4-dependent transcriptional activation. Thus, when S. cerevisiae is grown on glutamine, VIL biosynthesis is predominant and is preferentially achieved through BAT1 ; while on VIL as the sole nitrogen source, catabolism prevails and is mainly afforded by BAT2 . Copyright © 2017 by the Genetics Society of America.

  2. Bacterial niche-specific genome expansion is coupled with highly frequent gene disruptions in deep-sea sediments

    KAUST Repository

    Wang, Yong; Yang, Jiang Ke; Lee, On On; Li, Tie Gang; Al-Suwailem, Abdulaziz M.; Danchin, Antoine; Qian, Pei-Yuan

    2011-01-01

    The complexity and dynamics of microbial metagenomes may be evaluated by genome size, gene duplication and the disruption rate between lineages. In this study, we pyrosequenced the metagenomes of microbes obtained from the brine and sediment of a deep-sea brine pool in the Red Sea to explore the possible genomic adaptations of the microbes in response to environmental changes. The microbes from the brine and sediments (both surface and deep layers) of the Atlantis II Deep brine pool had similar communities whereas the effective genome size varied from 7.4 Mb in the brine to more than 9 Mb in the sediment. This genome expansion in the sediment samples was due to gene duplication as evidenced by enrichment of the homologs. The duplicated genes were highly disrupted, on average by 47.6% and 70% for the surface and deep layers of the Atlantis II Deep sediment samples, respectively. The disruptive effects appeared to be mainly due to point mutations and frameshifts. In contrast, the homologs from the Atlantis II Deep brine sample were highly conserved and they maintained relatively small copy numbers. Likely, the adaptation of the microbes in the sediments was coupled with pseudogenizations and possibly functional diversifications of the paralogs in the expanded genomes. The maintenance of the pseudogenes in the large genomes is discussed. © 2011 Wang et al.

  3. Bacterial niche-specific genome expansion is coupled with highly frequent gene disruptions in deep-sea sediments

    KAUST Repository

    Wang, Yong

    2011-12-21

    The complexity and dynamics of microbial metagenomes may be evaluated by genome size, gene duplication and the disruption rate between lineages. In this study, we pyrosequenced the metagenomes of microbes obtained from the brine and sediment of a deep-sea brine pool in the Red Sea to explore the possible genomic adaptations of the microbes in response to environmental changes. The microbes from the brine and sediments (both surface and deep layers) of the Atlantis II Deep brine pool had similar communities whereas the effective genome size varied from 7.4 Mb in the brine to more than 9 Mb in the sediment. This genome expansion in the sediment samples was due to gene duplication as evidenced by enrichment of the homologs. The duplicated genes were highly disrupted, on average by 47.6% and 70% for the surface and deep layers of the Atlantis II Deep sediment samples, respectively. The disruptive effects appeared to be mainly due to point mutations and frameshifts. In contrast, the homologs from the Atlantis II Deep brine sample were highly conserved and they maintained relatively small copy numbers. Likely, the adaptation of the microbes in the sediments was coupled with pseudogenizations and possibly functional diversifications of the paralogs in the expanded genomes. The maintenance of the pseudogenes in the large genomes is discussed. © 2011 Wang et al.

  4. Bacterial niche-specific genome expansion is coupled with highly frequent gene disruptions in deep-sea sediments.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available The complexity and dynamics of microbial metagenomes may be evaluated by genome size, gene duplication and the disruption rate between lineages. In this study, we pyrosequenced the metagenomes of microbes obtained from the brine and sediment of a deep-sea brine pool in the Red Sea to explore the possible genomic adaptations of the microbes in response to environmental changes. The microbes from the brine and sediments (both surface and deep layers of the Atlantis II Deep brine pool had similar communities whereas the effective genome size varied from 7.4 Mb in the brine to more than 9 Mb in the sediment. This genome expansion in the sediment samples was due to gene duplication as evidenced by enrichment of the homologs. The duplicated genes were highly disrupted, on average by 47.6% and 70% for the surface and deep layers of the Atlantis II Deep sediment samples, respectively. The disruptive effects appeared to be mainly due to point mutations and frameshifts. In contrast, the homologs from the Atlantis II Deep brine sample were highly conserved and they maintained relatively small copy numbers. Likely, the adaptation of the microbes in the sediments was coupled with pseudogenizations and possibly functional diversifications of the paralogs in the expanded genomes. The maintenance of the pseudogenes in the large genomes is discussed.

  5. Molecular and functional characterization of seven Na+/K+-ATPase β subunit paralogs in Senegalese sole (Solea senegalensis Kaup, 1858).

    Science.gov (United States)

    Armesto, Paula; Infante, Carlos; Cousin, Xavier; Ponce, Marian; Manchado, Manuel

    2015-04-01

    In the present work, seven genes encoding Na(+),K(+)-ATPase (NKA) β-subunits in the teleost Solea senegalensis are described for the first time. Sequence analysis of the predicted polypeptides revealed a high degree of conservation with those of other vertebrate species and maintenance of important motifs involved in structure and function. Phylogenetic analysis clustered the seven genes into four main clades: β1 (atp1b1a and atp1b1b), β2 (atp1b2a and atp1b2b), β3 (atp1b3a and atp1b3b) and β4 (atp1b4). In juveniles, all paralogous transcripts were detected in the nine tissues examined albeit with different expression patterns. The most ubiquitous expressed gene was atp1b1a whereas atp1b1b was mainly detected in osmoregulatory organs (gill, kidney and intestine), and atp1b2a, atp1b2b, atp1b3a, atp1b3b and atp1b4 in brain. An expression analysis in three brain regions and pituitary revealed that β1-type transcripts were more abundant in pituitary than the other β paralogs with slight differences between brain regions. Quantification of mRNA abundance in gills after a salinity challenge showed an activation of atp1b1a and atp1b1b at high salinity water (60 ppt) and atp1b3a and atp1b3b in response to low salinity (5 ppt). Transcriptional analysis during larval development showed specific expression patterns for each paralog. Moreover, no differences in the expression profiles between larvae cultivated at 10 and 35 ppt were observed except for atp1b4 with higher mRNA levels at 10 than 35 ppt at 18 days post hatch. Whole-mount in situ hybridization analysis revealed that atp1b1b was mainly localized in gut, pronephric tubule, gill, otic vesicle, and chordacentrum of newly hatched larvae. All these data suggest distinct roles of NKA β subunits in tissues, during development and osmoregulation with β1 subunits involved in the adaptation to hyperosmotic conditions and β3 subunits to hypoosmotic environments. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Identification of the gene for Nance-Horan syndrome (NHS).

    Science.gov (United States)

    Brooks, S P; Ebenezer, N D; Poopalasundaram, S; Lehmann, O J; Moore, A T; Hardcastle, A J

    2004-10-01

    The disease intervals for Nance-Horan syndrome (NHS [MIM 302350]) and X linked congenital cataract (CXN) overlap on Xp22. To identify the gene or genes responsible for these diseases. Families with NHS were ascertained. The refined locus for CXN was used to focus the search for candidate genes, which were screened by polymerase chain reaction and direct sequencing of potential exons and intron-exon splice sites. Genomic structures and homologies were determined using bioinformatics. Expression studies were undertaken using specific exonic primers to amplify human fetal cDNA and mouse RNA. A novel gene NHS, with no known function, was identified as causative for NHS. Protein truncating mutations were detected in all three NHS pedigrees, but no mutation was identified in a CXN family, raising the possibility that NHS and CXN may not be allelic. The NHS gene forms a new gene family with a closely related novel gene NHS-Like1 (NHSL1). NHS and NHSL1 lie in paralogous duplicated chromosomal intervals on Xp22 and 6q24, and NHSL1 is more broadly expressed than NHS in human fetal tissues. This study reports the independent identification of the gene causative for Nance-Horan syndrome and extends the number of mutations identified.

  7. Anterior colorectal duplication presenting as rectal prolapse.

    Science.gov (United States)

    Ramirez-Resendiz, Amador; Asz, Jose; Medina-Vega, F Antonio; Ortega-Salgado, J Arturo

    2007-09-01

    Duplications of the gastrointestinal (GI) tract are rare. Only 5% of them are rectal and there are very few reports of rectal prolapse (RP) caused by a duplication. An 11 month-old female presented with a RP caused by a blind-ended anterior tubular colorectal duplication. The duplication was successfully opened and connected to the normal rectum without complications. Although infrequent, a rectal duplication should be considered in the differential diagnosis of RP.

  8. Duplicate retention in signalling proteins and constraints from network dynamics.

    Science.gov (United States)

    Soyer, O S; Creevey, C J

    2010-11-01

    Duplications are a major driving force behind evolution. Most duplicates are believed to fix through genetic drift, but it is not clear whether this process affects all duplications equally or whether there are certain gene families that are expected to show neutral expansions under certain circumstances. Here, we analyse the neutrality of duplications in different functional classes of signalling proteins based on their effects on response dynamics. We find that duplications involving intermediary proteins in a signalling network are neutral more often than those involving receptors. Although the fraction of neutral duplications in all functional classes increase with decreasing population size and selective pressure on dynamics, this effect is most pronounced for receptors, indicating a possible expansion of receptors in species with small population size. In line with such an expectation, we found a statistically significant increase in the number of receptors as a fraction of genome size in eukaryotes compared with prokaryotes. Although not confirmative, these results indicate that neutral processes can be a significant factor in shaping signalling networks and affect proteins from different functional classes differently. © 2010 The Authors. Journal Compilation © 2010 European Society For Evolutionary Biology.

  9. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    OpenAIRE

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  10. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    OpenAIRE

    Thomas D Cuypers; Paulien Hogeweg

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  11. External cystic rectal duplication: an unusual presentation of rectal duplication cyst.

    Science.gov (United States)

    Karaman, I; Karaman, A; Arda, N; Cakmak, O

    2007-11-01

    Duplications of gastrointestinal tract are rare anomalies, and rectal duplications account for five percent of the alimentary tract duplications. We present an unusual case of rectal duplication, which was located externally in a newborn female, and discuss the types of distal hindgut duplications.

  12. Control of Copper Resistance and Inorganic Sulfur Metabolism by Paralogous Regulators in Staphylococcus aureus*

    Science.gov (United States)

    Grossoehme, Nicholas; Kehl-Fie, Thomas E.; Ma, Zhen; Adams, Keith W.; Cowart, Darin M.; Scott, Robert A.; Skaar, Eric P.; Giedroc, David P.

    2011-01-01

    All strains of Staphylococcus aureus encode a putative copper-sensitive operon repressor (CsoR) and one other CsoR-like protein of unknown function. We show here that NWMN_1991 encodes a bona fide Cu(I)-inducible CsoR of a genetically unlinked copA-copZ copper resistance operon in S. aureus strain Newman. In contrast, an unannotated open reading frame found between NWMN_0027 and NWMN_0026 (denoted NWMN_0026.5) encodes a CsoR-like regulator that represses expression of adjacent genes by binding specifically to a pair of canonical operator sites positioned in the NWMN_0027–0026.5 intergenic region. Inspection of these regulated genes suggests a role in assimilation of inorganic sulfur from thiosulfate and vectorial sulfur transfer, and we designate NWMN_0026.5 as CstR (CsoR-like sulfur transferase repressor). Expression analysis demonstrates that CsoR and CstR control their respective regulons in response to distinct stimuli with no overlap in vivo. Unlike CsoR, CstR does not form a stable complex with Cu(I); operator binding is instead inhibited by oxidation of the intersubunit cysteine pair to a mixture of disulfide and trisulfide linkages by a likely metabolite of thiosulfate assimilation, sulfite. CsoR is unreactive toward sulfite under the same conditions. We conclude that CsoR and CstR are paralogs in S. aureus that function in the same cytoplasm to control distinct physiological processes. PMID:21339296

  13. Control of copper resistance and inorganic sulfur metabolism by paralogous regulators in Staphylococcus aureus.

    Science.gov (United States)

    Grossoehme, Nicholas; Kehl-Fie, Thomas E; Ma, Zhen; Adams, Keith W; Cowart, Darin M; Scott, Robert A; Skaar, Eric P; Giedroc, David P

    2011-04-15

    All strains of Staphylococcus aureus encode a putative copper-sensitive operon repressor (CsoR) and one other CsoR-like protein of unknown function. We show here that NWMN_1991 encodes a bona fide Cu(I)-inducible CsoR of a genetically unlinked copA-copZ copper resistance operon in S. aureus strain Newman. In contrast, an unannotated open reading frame found between NWMN_0027 and NWMN_0026 (denoted NWMN_0026.5) encodes a CsoR-like regulator that represses expression of adjacent genes by binding specifically to a pair of canonical operator sites positioned in the NWMN_0027-0026.5 intergenic region. Inspection of these regulated genes suggests a role in assimilation of inorganic sulfur from thiosulfate and vectorial sulfur transfer, and we designate NWMN_0026.5 as CstR (CsoR-like sulfur transferase repressor). Expression analysis demonstrates that CsoR and CstR control their respective regulons in response to distinct stimuli with no overlap in vivo. Unlike CsoR, CstR does not form a stable complex with Cu(I); operator binding is instead inhibited by oxidation of the intersubunit cysteine pair to a mixture of disulfide and trisulfide linkages by a likely metabolite of thiosulfate assimilation, sulfite. CsoR is unreactive toward sulfite under the same conditions. We conclude that CsoR and CstR are paralogs in S. aureus that function in the same cytoplasm to control distinct physiological processes.

  14. Intragenic duplication: a novel mutational mechanism in hereditary pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, Maiken T; Geisz, Andrea; Brusgaard, Klaus

    2011-01-01

    In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide of cationic...

  15. The hidden duplication past of the plant pathogen Phytophthora and its consequences for infection

    Directory of Open Access Journals (Sweden)

    Martens Cindy

    2010-06-01

    Full Text Available Abstract Background Oomycetes of the genus Phytophthora are pathogens that infect a wide range of plant species. For dicot hosts such as tomato, potato and soybean, Phytophthora is even the most important pathogen. Previous analyses of Phytophthora genomes uncovered many genes, large gene families and large genome sizes that can partially be explained by significant repeat expansion patterns. Results Analysis of the complete genomes of three different Phytophthora species, using a newly developed approach, unveiled a large number of small duplicated blocks, mainly consisting of two or three consecutive genes. Further analysis of these duplicated genes and comparison with the known gene and genome duplication history of ten other eukaryotes including parasites, algae, plants, fungi, vertebrates and invertebrates, suggests that the ancestor of P. infestans, P. sojae and P. ramorum most likely underwent a whole genome duplication (WGD. Genes that have survived in duplicate are mainly genes that are known to be preferentially retained following WGDs, but also genes important for pathogenicity and infection of the different hosts seem to have been retained in excess. As a result, the WGD might have contributed to the evolutionary and pathogenic success of Phytophthora. Conclusions The fact that we find many small blocks of duplicated genes indicates that the genomes of Phytophthora species have been heavily rearranged following the WGD. Most likely, the high repeat content in these genomes have played an important role in this rearrangement process. As a consequence, the paucity of retained larger duplicated blocks has greatly complicated previous attempts to detect remnants of a large-scale duplication event in Phytophthora. However, as we show here, our newly developed strategy to identify very small duplicated blocks might be a useful approach to uncover ancient polyploidy events, in particular for heavily rearranged genomes.

  16. Radiological findings of male urethral duplication associated with bladder duplication: case report

    International Nuclear Information System (INIS)

    Kim, Hyoung Jung; Lim, Joo Won; Lee, Dong Ho; Ko, Young Tae

    2004-01-01

    Urethral duplication or accessory urethra is a rare congenital anomaly. Even rarer, is its association with bladder duplication. We report a case of urethral duplication associated with bladder duplication in a seven-year-old boy who underwent retrograde urethrography, sonography and magnetic resonance (MR) imaging. WhiIe retrograde urethrography can demonstrate the extent of the duplicated urethra, MR imaging and sonography can provide detailed information on the anatomy of the adjacent tissues as well as urethral duplication

  17. Evaluation of contrast in duplicated radiographs

    International Nuclear Information System (INIS)

    Thunthy, K.H.; Weinberg, R.

    1982-01-01

    This investigation evaluated changes in the contrast of duplicated radiographs made at different ultraviolet light exposures. Increasing ultraviolet light exposure had different effects on the duplicates of originals of different background densities. When correctly exposed, a duplicate radiograph enhanced contrast. When originals had the same contrast but different background densities, their duplicates did not have the same contrast. It was not possible to duplicate accurately all the different contrasts measured on an original. It was possible, however, to produce duplicates with all contrasts greater than those of the original

  18. Targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae.

    Science.gov (United States)

    Takahashi, Tadashi; Sato, Atsushi; Ogawa, Masahiro; Hanya, Yoshiki; Oguma, Tetsuya

    2014-08-01

    We describe here the first successful construction of a targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae. The targeted tandem chromosomal duplication was achieved by using strains that had a 5'-deleted pyrG upstream of the region targeted for tandem chromosomal duplication and a 3'-deleted pyrG downstream of the target region. Consequently,strains bearing a 210-kb targeted tandem chromosomal duplication near the centromeric region of chromosome 8 and strains bearing a targeted tandem chromosomal duplication of a 700-kb region of chromosome 2 were successfully constructed. The strains bearing the tandem chromosomal duplication were efficiently obtained from the regenerated protoplast of the parental strains. However, the generation of the chromosomal duplication did not depend on the introduction of double-stranded breaks(DSBs) by I-SceI. The chromosomal duplications of these strains were stably maintained after five generations of culture under nonselective conditions. The strains bearing the tandem chromosomal duplication in the 700-kb region of chromosome 2 showed highly increased protease activity in solid-state culture, indicating that the duplication of large chromosomal segments could be a useful new breeding technology and gene analysis method.

  19. Regulation of gill claudin paralogs by salinity, cortisol and prolactin in Mozambique tilapia (Oreochromis mossambicus).

    Science.gov (United States)

    Tipsmark, Christian K; Breves, Jason P; Rabeneck, D Brett; Trubitt, Rebecca T; Lerner, Darren T; Grau, E Gordon

    2016-09-01

    In euryhaline teleosts, reorganization of gill tight junctions during salinity acclimation involves dynamic expression of specific claudin (Cldn) paralogs. We identified four transcripts encoding Cldn tight junction proteins in the tilapia gill transcriptome: cldn10c, cldn10e, cldn28a and cldn30. A tissue distribution experiment found cldn10c and cldn10e expression levels in the gill to be 100-fold higher than any other tissues examined. cldn28a and cldn30 levels in the gill were 10-fold greater than levels in other tissues. Expression of these genes in Mozambique tilapia was examined during acclimation to fresh water (FW), seawater (SW), and in response to hormone treatments. Transfer of tilapia from FW to SW elevated cldn10c and cldn10e, while cldn28a and cldn30 were stimulated following transfer from SW to FW. In hypophysectomized tilapia transferred to FW, pituitary extirpation induced reduced expression of cldn10c, cldn10e and cldn28a; these effects were mitigated equally by either prolactin or cortisol replacement. In vitro experiments with gill filaments showed that cortisol stimulated expression of all four cldns examined, suggesting a direct action of cortisol in situ. Our data indicate that elevated cldn10c and cldn10e expression is important during acclimation of tilapia to SW possibly by conferring ion specific paracellular permeability. On the other hand, expression of cldn28a and cldn30 appears to contribute to reorganization of branchial epithelium during FW acclimation. Hormone treatment experiments showed that particular FW- and SW-induced cldns are controlled by cortisol and prolactin. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Facial duplication: case, review, and embryogenesis.

    Science.gov (United States)

    Barr, M

    1982-04-01

    The craniofacial anatomy of an infant with facial duplication is described. There were four eyes, two noses, two maxillae, and one mandible. Anterior to the single pituitary the brain was duplicated and there was bilateral arhinencephaly. Portions of the brain were extruded into a large frontal encephalocele. Cases of symmetrical facial duplication reported in the literature range from two complete faces on a single head (diprosopus) to simple nasal duplication. The variety of patterns of duplication suggests that the doubling of facial components arises in several different ways: Forking of the notochord, duplication of the prosencephalon, duplication of the olfactory placodes, and duplication of maxillary and/or mandibular growth centers around the margins of the stomatodeal plate. Among reported cases, the female:male ratio is 2:1.

  1. Biliary tract duplication cyst with gastric heterotopia

    Energy Technology Data Exchange (ETDEWEB)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.

    1988-05-01

    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst.

  2. Biliary tract duplication cyst with gastric heterotopia

    International Nuclear Information System (INIS)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.

    1988-01-01

    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst. (orig.)

  3. Preliminary experiments of electronic duplication

    International Nuclear Information System (INIS)

    Fay, Bernard

    1974-01-01

    Systems of electron sputtering (at the unit scale) use as master mask a photocathode with localized emitting zones. Emitted electrons are accelerated and focussed on a silicon substrate covered with an electrosensitive resin. The very high definition associated with electron masking is obtained whatever the complexity of the master mask is, for a printing duration of the order of the minute. This is a duplication method without any contact that prevents the master mask from any mechanical erosion. Alignment of the successive masks is obtained from an electric signal directly usable through an automatic alignment system. Experiments using the apparatus for reproducing masks through an electronic image or ''electronic duplicator'' developed in Thomson-CSF Laboratory at Corbeville, are presented [fr

  4. Noncommunicating Isolated Enteric Duplication Cyst in the ...

    African Journals Online (AJOL)

    Noncommunicating isolated enteric duplications in the abdomen are an extremely rare variant of enteric duplications with their own blood supply. We report a case of a noncommunicating isolated ileal duplication in a 10-month-old boy. He was admitted because of severe abdominal distension and developed irritability ...

  5. A paralog of the proteinaceous elicitor sm1 affects colonization of maize roots by Trichoderma virens

    Science.gov (United States)

    The biocontrol agent, Trichoderma virens, has the ability to protect plants from pathogens by eliciting plant defense responses, involvement in mycoparasitism, or secreting antagonistic secondary metabolites. SM1, an elicitor of induced systemic resistance (ISR), was found to have three paralogs wi...

  6. A Theory of Utility Conditionals: Paralogical Reasoning from Decision-Theoretic Leakage

    Science.gov (United States)

    Bonnefon, Jean-Francois

    2009-01-01

    Many "if p, then q" conditionals have decision-theoretic features, such as antecedents or consequents that relate to the utility functions of various agents. These decision-theoretic features leak into reasoning processes, resulting in various paralogical conclusions. The theory of utility conditionals offers a unified account of the various forms…

  7. Functional Conservation and Divergence of daf-22 Paralogs in Pristionchus pacificus Dauer Development.

    Science.gov (United States)

    Markov, Gabriel V; Meyer, Jan M; Panda, Oishika; Artyukhin, Alexander B; Claaßen, Marc; Witte, Hanh; Schroeder, Frank C; Sommer, Ralf J

    2016-10-01

    Small-molecule signaling in nematode dauer formation has emerged as a major model to study chemical communication in development and evolution. Developmental arrest as nonfeeding and stress-resistant dauer larvae represents the major survival and dispersal strategy. Detailed studies in Caenorhabditis elegans and Pristionchus pacificus revealed that small-molecule communication changes rapidly in evolution resulting in extreme structural diversity of small-molecule compounds. In C. elegans, a blend of ascarosides constitutes the dauer pheromone, whereas the P. pacificus dauer pheromone includes additional paratosides and integrates building blocks from diverse primary metabolic pathways. Despite this complexity of small-molecule structures and functions, little is known about the biosynthesis of small molecules in nematodes outside C. elegans Here, we show that the genes encoding enzymes of the peroxisomal β-oxidation pathway involved in small-molecule biosynthesis evolve rapidly, including gene duplications and domain switching. The thiolase daf-22, the most downstream factor in C. elegans peroxisomal β-oxidation, has duplicated in P. pacificus, resulting in Ppa-daf-22.1, which still contains the sterol-carrier-protein (SCP) domain that was lost in C. elegans daf-22, and Ppa-daf-22.2. Using the CRISPR/Cas9 system, we induced mutations in both P. pacificus daf-22 genes and identified an unexpected complexity of functional conservation and divergence. Under well-fed conditions, ascaroside biosynthesis proceeds exclusively via Ppa-daf-22.1 In contrast, starvation conditions induce Ppa-daf-22.2 activity, resulting in the production of a specific subset of ascarosides. Gene expression studies indicate a reciprocal up-regulation of both Ppa-daf-22 genes, which is, however, independent of starvation. Thus, our study reveals an unexpected functional complexity of dauer development and evolution. © The Author 2016. Published by Oxford University Press on behalf of the

  8. Structural and binding properties of two paralogous fatty acid binding proteins of Taenia solium metacestode.

    Directory of Open Access Journals (Sweden)

    Seon-Hee Kim

    Full Text Available BACKGROUND: Fatty acid (FA binding proteins (FABPs of helminths are implicated in acquisition and utilization of host-derived hydrophobic substances, as well as in signaling and cellular interactions. We previously demonstrated that secretory hydrophobic ligand binding proteins (HLBPs of Taenia solium metacestode (TsM, a causative agent of neurocysticercosis (NC, shuttle FAs in the surrounding host tissues and inwardly transport the FAs across the parasite syncytial membrane. However, the protein molecules responsible for the intracellular trafficking and assimilation of FAs have remained elusive. METHODOLOGY/PRINCIPAL FINDINGS: We isolated two novel TsMFABP genes (TsMFABP1 and TsMFABP2, which encoded 133- and 136-amino acid polypeptides with predicted molecular masses of 14.3 and 14.8 kDa, respectively. They shared 45% sequence identity with each other and 15-95% with other related-members. Homology modeling demonstrated a characteristic β-barrel composed of 10 anti-parallel β-strands and two α-helices. TsMFABP2 harbored two additional loops between β-strands two and three, and β-strands six and seven, respectively. TsMFABP1 was secreted into cyst fluid and surrounding environments, whereas TsMFABP2 was intracellularly confined. Partially purified native proteins migrated to 15 kDa with different isoelectric points of 9.2 (TsMFABP1 and 8.4 (TsMFABP2. Both native and recombinant proteins bound to 11-([5-dimethylaminonaphthalene-1-sulfonyl]aminoundecannoic acid, dansyl-DL-α-amino-caprylic acid, cis-parinaric acid and retinol, which were competitively inhibited by oleic acid. TsMFABP1 exhibited high affinity toward FA analogs. TsMFABPs showed weak binding activity to retinol, but TsMFABP2 showed relatively high affinity. Isolation of two distinct genes from an individual genome strongly suggested their paralogous nature. Abundant expression of TsMFABP1 and TsMFABP2 in the canal region of worm matched well with the histological distributions

  9. The evolutionary history of the SAL1 gene family in eutherian mammals

    Directory of Open Access Journals (Sweden)

    Callebaut Isabelle

    2011-05-01

    Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.

  10. Narrow, duplicated internal auditory canal

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, T. [Servico de Neurorradiologia, Hospital Garcia de Orta, Avenida Torrado da Silva, 2801-951, Almada (Portugal); Shayestehfar, B. [Department of Radiology, UCLA Oliveview School of Medicine, Los Angeles, California (United States); Lufkin, R. [Department of Radiology, UCLA School of Medicine, Los Angeles, California (United States)

    2003-05-01

    A narrow internal auditory canal (IAC) constitutes a relative contraindication to cochlear implantation because it is associated with aplasia or hypoplasia of the vestibulocochlear nerve or its cochlear branch. We report an unusual case of a narrow, duplicated IAC, divided by a bony septum into a superior relatively large portion and an inferior stenotic portion, in which we could identify only the facial nerve. This case adds support to the association between a narrow IAC and aplasia or hypoplasia of the vestibulocochlear nerve. The normal facial nerve argues against the hypothesis that the narrow IAC is the result of a primary bony defect which inhibits the growth of the vestibulocochlear nerve. (orig.)

  11. Conservation of σ28-Dependent Non-Coding RNA Paralogs and Predicted σ54-Dependent Targets in Thermophilic Campylobacter Species.

    Directory of Open Access Journals (Sweden)

    My Thanh Le

    Full Text Available Assembly of flagella requires strict hierarchical and temporal control via flagellar sigma and anti-sigma factors, regulatory proteins and the assembly complex itself, but to date non-coding RNAs (ncRNAs have not been described to regulate genes directly involved in flagellar assembly. In this study we have investigated the possible role of two ncRNA paralogs (CjNC1, CjNC4 in flagellar assembly and gene regulation of the diarrhoeal pathogen Campylobacter jejuni. CjNC1 and CjNC4 are 37/44 nt identical and predicted to target the 5' untranslated region (5' UTR of genes transcribed from the flagellar sigma factor σ54. Orthologs of the σ54-dependent 5' UTRs and ncRNAs are present in the genomes of other thermophilic Campylobacter species, and transcription of CjNC1 and CNC4 is dependent on the flagellar sigma factor σ28. Surprisingly, inactivation and overexpression of CjNC1 and CjNC4 did not affect growth, motility or flagella-associated phenotypes such as autoagglutination. However, CjNC1 and CjNC4 were able to mediate sequence-dependent, but Hfq-independent, partial repression of fluorescence of predicted target 5' UTRs in an Escherichia coli-based GFP reporter gene system. This hints towards a subtle role for the CjNC1 and CjNC4 ncRNAs in post-transcriptional gene regulation in thermophilic Campylobacter species, and suggests that the currently used phenotypic methodologies are insufficiently sensitive to detect such subtle phenotypes. The lack of a role of Hfq in the E. coli GFP-based system indicates that the CjNC1 and CjNC4 ncRNAs may mediate post-transcriptional gene regulation in ways that do not conform to the paradigms obtained from the Enterobacteriaceae.

  12. Conservation of σ28-Dependent Non-Coding RNA Paralogs and Predicted σ54-Dependent Targets in Thermophilic Campylobacter Species

    Science.gov (United States)

    Le, My Thanh; van Veldhuizen, Mart; Porcelli, Ida; Bongaerts, Roy J.; Gaskin, Duncan J. H.; Pearson, Bruce M.; van Vliet, Arnoud H. M.

    2015-01-01

    Assembly of flagella requires strict hierarchical and temporal control via flagellar sigma and anti-sigma factors, regulatory proteins and the assembly complex itself, but to date non-coding RNAs (ncRNAs) have not been described to regulate genes directly involved in flagellar assembly. In this study we have investigated the possible role of two ncRNA paralogs (CjNC1, CjNC4) in flagellar assembly and gene regulation of the diarrhoeal pathogen Campylobacter jejuni. CjNC1 and CjNC4 are 37/44 nt identical and predicted to target the 5' untranslated region (5' UTR) of genes transcribed from the flagellar sigma factor σ54. Orthologs of the σ54-dependent 5' UTRs and ncRNAs are present in the genomes of other thermophilic Campylobacter species, and transcription of CjNC1 and CNC4 is dependent on the flagellar sigma factor σ28. Surprisingly, inactivation and overexpression of CjNC1 and CjNC4 did not affect growth, motility or flagella-associated phenotypes such as autoagglutination. However, CjNC1 and CjNC4 were able to mediate sequence-dependent, but Hfq-independent, partial repression of fluorescence of predicted target 5' UTRs in an Escherichia coli-based GFP reporter gene system. This hints towards a subtle role for the CjNC1 and CjNC4 ncRNAs in post-transcriptional gene regulation in thermophilic Campylobacter species, and suggests that the currently used phenotypic methodologies are insufficiently sensitive to detect such subtle phenotypes. The lack of a role of Hfq in the E. coli GFP-based system indicates that the CjNC1 and CjNC4 ncRNAs may mediate post-transcriptional gene regulation in ways that do not conform to the paradigms obtained from the Enterobacteriaceae. PMID:26512728

  13. Expression Pattern of Two Paralogs Encoding Cinnamyl Alcohol Dehydrogenases in Arabidopsis. Isolation and Characterization of the Corresponding Mutants1

    Science.gov (United States)

    Sibout, Richard; Eudes, Aymerick; Pollet, Brigitte; Goujon, Thomas; Mila, Isabelle; Granier, Fabienne; Séguin, Armand; Lapierre, Catherine; Jouanin, Lise

    2003-01-01

    Studying Arabidopsis mutants of the phenylpropanoid pathway has unraveled several biosynthetic steps of monolignol synthesis. Most of the genes leading to monolignol synthesis have been characterized recently in this herbaceous plant, except those encoding cinnamyl alcohol dehydrogenase (CAD). We have used the complete sequencing of the Arabidopsis genome to highlight a new view of the complete CAD gene family. Among nine AtCAD genes, we have identified the two distinct paralogs AtCAD-C and AtCAD-D, which share 75% identity and are likely to be involved in lignin biosynthesis in other plants. Northern, semiquantitative restriction fragment-length polymorphism-reverse transcriptase-polymerase chain reaction and western analysis revealed that AtCAD-C and AtCAD-D mRNA and protein ratios were organ dependent. Promoter activities of both genes are high in fibers and in xylem bundles. However, AtCAD-C displayed a larger range of sites of expression than AtCAD-D. Arabidopsis null mutants (Atcad-D and Atcad-C) corresponding to both genes were isolated. CAD activities were drastically reduced in both mutants, with a higher impact on sinapyl alcohol dehydrogenase activity (6% and 38% of residual sinapyl alcohol dehydrogenase activities for Atcad-D and Atcad-C, respectively). Only Atcad-D showed a slight reduction in Klason lignin content and displayed modifications of lignin structure with a significant reduced proportion of conventional S lignin units in both stems and roots, together with the incorporation of sinapaldehyde structures ether linked at Cβ. These results argue for a substantial role of AtCAD-D in lignification, and more specifically in the biosynthesis of sinapyl alcohol, the precursor of S lignin units. PMID:12805615

  14. Expression pattern of two paralogs encoding cinnamyl alcohol dehydrogenases in Arabidopsis. Isolation and characterization of the corresponding mutants.

    Science.gov (United States)

    Sibout, Richard; Eudes, Aymerick; Pollet, Brigitte; Goujon, Thomas; Mila, Isabelle; Granier, Fabienne; Séguin, Armand; Lapierre, Catherine; Jouanin, Lise

    2003-06-01

    Studying Arabidopsis mutants of the phenylpropanoid pathway has unraveled several biosynthetic steps of monolignol synthesis. Most of the genes leading to monolignol synthesis have been characterized recently in this herbaceous plant, except those encoding cinnamyl alcohol dehydrogenase (CAD). We have used the complete sequencing of the Arabidopsis genome to highlight a new view of the complete CAD gene family. Among nine AtCAD genes, we have identified the two distinct paralogs AtCAD-C and AtCAD-D, which share 75% identity and are likely to be involved in lignin biosynthesis in other plants. Northern, semiquantitative restriction fragment-length polymorphism-reverse transcriptase-polymerase chain reaction and western analysis revealed that AtCAD-C and AtCAD-D mRNA and protein ratios were organ dependent. Promoter activities of both genes are high in fibers and in xylem bundles. However, AtCAD-C displayed a larger range of sites of expression than AtCAD-D. Arabidopsis null mutants (Atcad-D and Atcad-C) corresponding to both genes were isolated. CAD activities were drastically reduced in both mutants, with a higher impact on sinapyl alcohol dehydrogenase activity (6% and 38% of residual sinapyl alcohol dehydrogenase activities for Atcad-D and Atcad-C, respectively). Only Atcad-D showed a slight reduction in Klason lignin content and displayed modifications of lignin structure with a significant reduced proportion of conventional S lignin units in both stems and roots, together with the incorporation of sinapaldehyde structures ether linked at Cbeta. These results argue for a substantial role of AtCAD-D in lignification, and more specifically in the biosynthesis of sinapyl alcohol, the precursor of S lignin units.

  15. Homoeologous Recombination of the V1r1-V1r2 Gene Cluster of Pheromone Receptors in an Allotetraploid Lineage of Teleosts

    Directory of Open Access Journals (Sweden)

    Lei Zhong

    2017-11-01

    Full Text Available In contrast to other olfactory receptor families that exhibit frequent lineage-specific expansions, the vomeronasal type 1 receptor (V1R family exhibits a canonical six-member repertoire in teleosts. V1r1 and V1r2 are present in no more than one copy in all examined teleosts, including salmons, which are ancient polyploids, implying strict evolutionary constraints. However, recent polyploids have not been examined. Here, we identified a young allotetraploid lineage of weatherfishes and investigated their V1r1-V1r2 cluster. We found a novel pattern that the parental V1r1-V1r2 clusters had recombined in the tetraploid genome and that the recombinant was nearly fixed in the tetraploid population. Subsequent analyses suggested strong selective pressure, for both a new combination of paralogs and homogeneity among gene duplicates, acting on the V1r1-V1r2 pair.

  16. WD-repeat instability and diversification of the Podospora anserina hnwd non-self recognition gene family.

    Science.gov (United States)

    Chevanne, Damien; Saupe, Sven J; Clavé, Corinne; Paoletti, Mathieu

    2010-05-06

    Genes involved in non-self recognition and host defence are typically capable of rapid diversification and exploit specialized genetic mechanism to that end. Fungi display a non-self recognition phenomenon termed heterokaryon incompatibility that operates when cells of unlike genotype fuse and leads to the cell death of the fusion cell. In the fungus Podospora anserina, three genes controlling this allorecognition process het-d, het-e and het-r are paralogs belonging to the same hnwd gene family. HNWD proteins are STAND proteins (signal transduction NTPase with multiple domains) that display a WD-repeat domain controlling recognition specificity. Based on genomic sequence analysis of different P. anserina isolates, it was established that repeat regions of all members of the gene family are extremely polymorphic and undergoing concerted evolution arguing for frequent recombination within and between family members. Herein, we directly analyzed the genetic instability and diversification of this allorecognition gene family. We have constituted a collection of 143 spontaneous mutants of the het-R (HNWD2) and het-E (hnwd5) genes with altered recognition specificities. The vast majority of the mutants present rearrangements in the repeat arrays with deletions, duplications and other modifications as well as creation of novel repeat unit variants. We investigate the extreme genetic instability of these genes and provide a direct illustration of the diversification strategy of this eukaryotic allorecognition gene family.

  17. Insights into the Prunus-Specific S-RNase-Based Self-Incompatibility System from a Genome-Wide Analysis of the Evolutionary Radiation of S Locus-Related F-box Genes.

    Science.gov (United States)

    Akagi, Takashi; Henry, Isabelle M; Morimoto, Takuya; Tao, Ryutaro

    2016-06-01

    Self-incompatibility (SI) is an important plant reproduction mechanism that facilitates the maintenance of genetic diversity within species. Three plant families, the Solanaceae, Rosaceae and Plantaginaceae, share an S-RNase-based gametophytic SI (GSI) system that involves a single S-RNase as the pistil S determinant and several F-box genes as pollen S determinants that act via non-self-recognition. Previous evidence has suggested a specific self-recognition mechanism in Prunus (Rosaceae), raising questions about the generality of the S-RNase-based GSI system. We investigated the evolution of the pollen S determinant by comparing the sequences of the Prunus S haplotype-specific F-box gene (SFB) with those of its orthologs in other angiosperm genomes. Our results indicate that the Prunus SFB does not cluster with the pollen S of other plants and diverged early after the establishment of the Eudicots. Our results further indicate multiple F-box gene duplication events, specifically in the Rosaceae family, and suggest that the Prunus SFB gene originated in a recent Prunus-specific gene duplication event. Transcriptomic and evolutionary analyses of the Prunus S paralogs are consistent with the establishment of a Prunus-specific SI system, and the possibility of subfunctionalization differentiating the newly generated SFB from the original pollen S determinant. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  18. The detection of large deletions or duplications in genomic DNA.

    Science.gov (United States)

    Armour, J A L; Barton, D E; Cockburn, D J; Taylor, G R

    2002-11-01

    While methods for the detection of point mutations and small insertions or deletions in genomic DNA are well established, the detection of larger (>100 bp) genomic duplications or deletions can be more difficult. Most mutation scanning methods use PCR as a first step, but the subsequent analyses are usually qualitative rather than quantitative. Gene dosage methods based on PCR need to be quantitative (i.e., they should report molar quantities of starting material) or semi-quantitative (i.e., they should report gene dosage relative to an internal standard). Without some sort of quantitation, heterozygous deletions and duplications may be overlooked and therefore be under-ascertained. Gene dosage methods provide the additional benefit of reporting allele drop-out in the PCR. This could impact on SNP surveys, where large-scale genotyping may miss null alleles. Here we review recent developments in techniques for the detection of this type of mutation and compare their relative strengths and weaknesses. We emphasize that comprehensive mutation analysis should include scanning for large insertions and deletions and duplications. Copyright 2002 Wiley-Liss, Inc.

  19. Characterization of the past and current duplication activities in the human 22q11.2 region

    Directory of Open Access Journals (Sweden)

    Morrow Bernice

    2011-01-01

    Full Text Available Abstract Background Segmental duplications (SDs on 22q11.2 (LCR22, serve as substrates for meiotic non-allelic homologous recombination (NAHR events resulting in several clinically significant genomic disorders. Results To understand the duplication activity leading to the complicated SD structure of this region, we have applied the A-Bruijn graph algorithm to decompose the 22q11.2 SDs to 523 fundamental duplication sequences, termed subunits. Cross-species syntenic analysis of primate genomes demonstrates that many of these LCR22 subunits emerged very recently, especially those implicated in human genomic disorders. Some subunits have expanded more actively than others, and young Alu SINEs, are associated much more frequently with duplicated sequences that have undergone active expansion, confirming their role in mediating recombination events. Many copy number variations (CNVs exist on 22q11.2, some flanked by SDs. Interestingly, two chromosome breakpoints for 13 CNVs (mean length 65 kb are located in paralogous subunits, providing direct evidence that SD subunits could contribute to CNV formation. Sequence analysis of PACs or BACs identified extra CNVs, specifically, 10 insertions and 18 deletions within 22q11.2; four were more than 10 kb in size and most contained young AluYs at their breakpoints. Conclusions Our study indicates that AluYs are implicated in the past and current duplication events, and moreover suggests that DNA rearrangements in 22q11.2 genomic disorders perhaps do not occur randomly but involve both actively expanded duplication subunits and Alu elements.

  20. MSOAR 2.0: Incorporating tandem duplications into ortholog assignment based on genome rearrangement

    Directory of Open Access Journals (Sweden)

    Zhang Liqing

    2010-01-01

    Full Text Available Abstract Background Ortholog assignment is a critical and fundamental problem in comparative genomics, since orthologs are considered to be functional counterparts in different species and can be used to infer molecular functions of one species from those of other species. MSOAR is a recently developed high-throughput system for assigning one-to-one orthologs between closely related species on a genome scale. It attempts to reconstruct the evolutionary history of input genomes in terms of genome rearrangement and gene duplication events. It assumes that a gene duplication event inserts a duplicated gene into the genome of interest at a random location (i.e., the random duplication model. However, in practice, biologists believe that genes are often duplicated by tandem duplications, where a duplicated gene is located next to the original copy (i.e., the tandem duplication model. Results In this paper, we develop MSOAR 2.0, an improved system for one-to-one ortholog assignment. For a pair of input genomes, the system first focuses on the tandemly duplicated genes of each genome and tries to identify among them those that were duplicated after the speciation (i.e., the so-called inparalogs, using a simple phylogenetic tree reconciliation method. For each such set of tandemly duplicated inparalogs, all but one gene will be deleted from the concerned genome (because they cannot possibly appear in any one-to-one ortholog pairs, and MSOAR is invoked. Using both simulated and real data experiments, we show that MSOAR 2.0 is able to achieve a better sensitivity and specificity than MSOAR. In comparison with the well-known genome-scale ortholog assignment tool InParanoid, Ensembl ortholog database, and the orthology information extracted from the well-known whole-genome multiple alignment program MultiZ, MSOAR 2.0 shows the highest sensitivity. Although the specificity of MSOAR 2.0 is slightly worse than that of InParanoid in the real data experiments

  1. Interaction of fish aryl hydrocarbon receptor paralogs (AHR1 and AHR2) with the retinoblastoma protein

    Energy Technology Data Exchange (ETDEWEB)

    Merson, Rebeka R., E-mail: rmerson@ric.edu [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Biology Department, Rhode Island College, 500 Mt. Pleasant Ave., Providence, RI 02908 (United States); Karchner, Sibel I.; Hahn, Mark E. [Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States)

    2009-08-13

    The aryl hydrocarbon receptor (AHR) mediates the toxic effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and related compounds. In some mammalian cell lines, TCDD induces G1 cell cycle arrest, which depends on an interaction between the AHR and the retinoblastoma tumor suppressor (RB). Mammals possess one AHR, whereas fishes possess two or more AHR paralogs that differ in the domains important for AHR-RB interactions in mammals. To test the hypothesis that fish AHR paralogs differ in their ability to interact with RB, we cloned RB cDNA from Atlantic killifish, Fundulus heteroclitus, and studied the interactions of killifish RB protein with killifish AHR1 and AHR2. In coimmunoprecipitation experiments, in vitro-expressed killifish RB coprecipitated with both AHR1 and AHR2. Consistent with these results, both killifish AHR1 and AHR2 interacted with RB in mammalian two-hybrid assays. These results suggest that both fish AHR1 and AHR2 paralogs may have the potential to influence cell proliferation through interactions with RB.

  2. "Tandem duplication-random loss" is not a real feature of oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Zhang Guofan

    2009-02-01

    Full Text Available Abstract Duplications and rearrangements of coding genes are major themes in the evolution of mitochondrial genomes, bearing important consequences in the function of mitochondria and the fitness of organisms. Yu et al. (BMC Genomics 2008, 9:477 reported the complete mt genome sequence of the oyster Crassostrea hongkongensis (16,475 bp and found that a DNA segment containing four tRNA genes (trnK1, trnC, trnQ1 and trnN, a duplicated (rrnS and a split rRNA gene (rrnL5' was absent compared with that of two other Crassostrea species. It was suggested that the absence was a novel case of "tandem duplication-random loss" with evolutionary significance. We independently sequenced the complete mt genome of three C. hongkongensis individuals, all of which were 18,622 bp and contained the segment that was missing in Yu et al.'s sequence. Further, we designed primers, verified sequences and demonstrated that the sequence loss in Yu et al.'s study was an artifact caused by placing primers in a duplicated region. The duplication and split of ribosomal RNA genes are unique for Crassostrea oysters and not lost in C. hongkongensis. Our study highlights the need for caution when amplifying and sequencing through duplicated regions of the genome.

  3. A family history of DUX4: phylogenetic analysis of DUXA, B, C and Duxbl reveals the ancestral DUX gene

    Directory of Open Access Journals (Sweden)

    Hewitt Jane E

    2010-11-01

    Full Text Available Abstract Background DUX4 is causally involved in the molecular pathogenesis of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD. It has previously been proposed to have arisen by retrotransposition of DUXC, one of four known intron-containing DUX genes. Here, we investigate the evolutionary history of this multi-member double-homeobox gene family in eutherian mammals. Results Our analysis of the DUX family shows the distribution of different homologues across the mammalian class, including events of secondary loss. Phylogenetic comparison, analysis of gene structures and information from syntenic regions confirm the paralogous relationship of Duxbl and DUXB and characterize their relationship with DUXA and DUXC. We further identify Duxbl pseudogene orthologues in primates. A survey of non-mammalian genomes identified a single-homeobox gene (sDUX as a likely representative homologue of the mammalian DUX ancestor before the homeobox duplication. Based on the gene structure maps, we suggest a possible mechanism for the generation of the DUX gene structure. Conclusions Our study underlines how secondary loss of orthologues can obscure the true ancestry of individual gene family members. Their relationships should be considered when interpreting the relevance of functional data from DUX4 homologues such as Dux and Duxbl to FSHD.

  4. MLL duplication in a pediatric patient with B-cell lymphoblastic lymphoma.

    Science.gov (United States)

    Mater, David Van; Goodman, Barbara K; Wang, Endi; Gaca, Ana M; Wechsler, Daniel S

    2012-04-01

    Lymphoblastic lymphoma is the second most common type of non-Hodgkin lymphoma seen in children. Approximately, 90% of lymphoblastic lymphomas arise from T cells, with the remaining 10% being B-cell-lineage derived. Although T-cell lymphoblastic lymphoma most frequently occurs in the anterior mediastinum (thymus), B-cell lymphoblastic lymphoma (B-LBL) predominates in extranodal sites such as skin and bone. Here, we describe a pediatric B-LBL patient who presented with extensive abdominal involvement and whose lymphoma cells displayed segmental duplication of the mixed lineage leukemia (MLL) gene. MLL duplication/amplification has been described primarily in acute myeloid leukemia and myelodysplastic syndrome with no published reports of discrete MLL duplication/amplification events in B-LBL. The MLL gene duplication noted in this case may represent a novel mechanism for tumorigenesis in B-LBL.

  5. Bilateral duplication of the internal auditory canal

    Internation