WorldWideScience

Sample records for duplicate gene copies

  1. Duplication and relocation of the functional DPY19L2 gene within low copy repeats

    Directory of Open Access Journals (Sweden)

    Cheung Joseph

    2006-03-01

    Full Text Available Abstract Background Low copy repeats (LCRs are thought to play an important role in recent gene evolution, especially when they facilitate gene duplications. Duplicate genes are fundamental to adaptive evolution, providing substrates for the development of new or shared gene functions. Moreover, silencing of duplicate genes can have an indirect effect on adaptive evolution by causing genomic relocation of functional genes. These changes are theorized to have been a major factor in speciation. Results Here we present a novel example showing functional gene relocation within a LCR. We characterize the genomic structure and gene content of eight related LCRs on human Chromosomes 7 and 12. Two members of a novel transmembrane gene family, DPY19L, were identified in these regions, along with six transcribed pseudogenes. One of these genes, DPY19L2, is found on Chromosome 12 and is not syntenic with its mouse orthologue. Instead, the human locus syntenic to mouse Dpy19l2 contains a pseudogene, DPY19L2P1. This indicates that the ancestral copy of this gene has been silenced, while the descendant copy has remained active. Thus, the functional copy of this gene has been relocated to a new genomic locus. We then describe the expansion and evolution of the DPY19L gene family from a single gene found in invertebrate animals. Ancient duplications have led to multiple homologues in different lineages, with three in fish, frogs and birds and four in mammals. Conclusion Our results show that the DPY19L family has expanded throughout the vertebrate lineage and has undergone recent primate-specific evolution within LCRs.

  2. Origin of a function by tandem gene duplication limits the evolutionary capability of its sister copy.

    Science.gov (United States)

    Hasselmann, Martin; Lechner, Sarah; Schulte, Christina; Beye, Martin

    2010-07-27

    The most remarkable outcome of a gene duplication event is the evolution of a novel function. Little information exists on how the rise of a novel function affects the evolution of its paralogous sister gene copy, however. We studied the evolution of the feminizer (fem) gene from which the gene complementary sex determiner (csd) recently derived by tandem duplication within the honey bee (Apis) lineage. Previous studies showed that fem retained its sex determination function, whereas the rise of csd established a new primary signal of sex determination. We observed a specific reduction of nonsynonymous to synonymous substitution ratios in Apis to non-Apis fem. We found a contrasting pattern at two other genetically linked genes, suggesting that hitchhiking effects to csd, the locus under balancing selection, is not the cause of this evolutionary pattern. We also excluded higher synonymous substitution rates by relative rate testing. These results imply that stronger purifying selection is operating at the fem gene in the presence of csd. We propose that csd's new function interferes with the function of Fem protein, resulting in molecular constraints and limited evolvability of fem in the Apis lineage. Elevated silent nucleotide polymorphism in fem relative to the genome-wide average suggests that genetic linkage to the csd gene maintained more nucleotide variation in today's population. Our findings provide evidence that csd functionally and genetically interferes with fem, suggesting that a newly evolved gene and its functions can limit the evolutionary capability of other genes in the genome.

  3. Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Mara Sangiovanni

    2013-12-01

    Full Text Available Arabidopsis thaliana became the model organism for plant studies because of its small diploid genome, rapid lifecycle and short adult size. Its genome was the first among plants to be sequenced, becoming the reference in plant genomics. However, the Arabidopsis genome is characterized by an inherently complex organization, since it has undergone ancient whole genome duplications, followed by gene reduction, diploidization events and extended rearrangements, which relocated and split up the retained portions. These events, together with probable chromosome reductions, dramatically increased the genome complexity, limiting its role as a reference. The identification of paralogs and single copy genes within a highly duplicated genome is a prerequisite to understand its organization and evolution and to improve its exploitation in comparative genomics. This is still controversial, even in the widely studied Arabidopsis genome. This is also due to the lack of a reference bioinformatics pipeline that could exhaustively identify paralogs and singleton genes. We describe here a complete computational strategy to detect both duplicated and single copy genes in a genome, discussing all the methodological issues that may strongly affect the results, their quality and their reliability. This approach was used to analyze the organization of Arabidopsis nuclear protein coding genes, and besides classifying computationally defined paralogs into networks and single copy genes into different classes, it unraveled further intriguing aspects concerning the genome annotation and the gene relationships in this reference plant species. Since our results may be useful for comparative genomics and genome functional analyses, we organized a dedicated web interface to make them accessible to the scientific community.

  4. Single-copy genes define a conserved order between rice and wheat for understanding differences caused by duplication, deletion, and transposition of genes.

    Science.gov (United States)

    Singh, Nagendra K; Dalal, Vivek; Batra, Kamlesh; Singh, Binay K; Chitra, G; Singh, Archana; Ghazi, Irfan A; Yadav, Mahavir; Pandit, Awadhesh; Dixit, Rekha; Singh, Pradeep K; Singh, Harvinder; Koundal, Kirpa R; Gaikwad, Kishor; Mohapatra, Trilochan; Sharma, Tilak R

    2007-01-01

    The high-quality rice genome sequence is serving as a reference for comparative genome analysis in crop plants, especially cereals. However, early comparisons with bread wheat showed complex patterns of conserved synteny (gene content) and colinearity (gene order). Here, we show the presence of ancient duplicated segments in the progenitor of wheat, which were first identified in the rice genome. We also show that single-copy (SC) rice genes, those representing unique matches with wheat expressed sequence tag (EST) unigene contigs in the whole rice genome, show more than twice the proportion of genes mapping to syntenic wheat chromosome as compared to the multicopy (MC) or duplicated rice genes. While 58.7% of the 1,244 mapped SC rice genes were located in single syntenic wheat chromosome groups, the remaining 41.3% were distributed randomly to the other six non-syntenic wheat groups. This could only be explained by a background dispersal of genes in the genome through transposition or other unknown mechanism. The breakdown of rice-wheat synteny due to such transpositions was much greater near the wheat centromeres. Furthermore, the SC rice genes revealed a conserved primordial gene order that gives clues to the origin of rice and wheat chromosomes from a common ancestor through polyploidy, aneuploidy, centromeric fusions, and translocations. Apart from the bin-mapped wheat EST contigs, we also compared 56,298 predicted rice genes with 39,813 wheat EST contigs assembled from 409,765 EST sequences and identified 7,241 SC rice gene homologs of wheat. Based on the conserved colinearity of 1,063 mapped SC rice genes across the bins of individual wheat chromosomes, we predicted the wheat bin location of 6,178 unmapped SC rice gene homologs and validated the location of 213 of these in the telomeric bins of 21 wheat chromosomes with 35.4% initial success. This opens up the possibility of directed mapping of a large number of conserved SC rice gene homologs in wheat

  5. The odds of duplicate gene persistence after polyploidization

    Directory of Open Access Journals (Sweden)

    Chain Frédéric JJ

    2011-12-01

    Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.

  6. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms.

    Science.gov (United States)

    Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet

    2016-02-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.

  7. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

    Science.gov (United States)

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

    2016-10-13

    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  8. FUNCTIONAL SPECIALIZATION OF DUPLICATED FLAVONOID BIOSYNTHESIS GENES IN WHEAT

    Directory of Open Access Journals (Sweden)

    Khlestkina E.

    2012-08-01

    Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.

  9. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN

    Science.gov (United States)

    Li, Zhen; Van de Peer, Yves; De Smet, Riet

    2016-01-01

    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215

  10. Maintenance and Loss of Duplicated Genes by Dosage Subfunctionalization.

    Science.gov (United States)

    Gout, Jean-Francois; Lynch, Michael

    2015-08-01

    Whole-genome duplications (WGDs) have contributed to gene-repertoire enrichment in many eukaryotic lineages. However, most duplicated genes are eventually lost and it is still unclear why some duplicated genes are evolutionary successful whereas others quickly turn to pseudogenes. Here, we show that dosage constraints are major factors opposing post-WGD gene loss in several Paramecium species that share a common ancestral WGD. We propose a model where a majority of WGD-derived duplicates preserve their ancestral function and are retained to produce enough of the proteins performing this same ancestral function. Under this model, the expression level of individual duplicated genes can evolve neutrally as long as they maintain a roughly constant summed expression, and this allows random genetic drift toward uneven contributions of the two copies to total expression. Our analysis suggests that once a high level of imbalance is reached, which can require substantial lengths of time, the copy with the lowest expression level contributes a small enough fraction of the total expression that selection no longer opposes its loss. Extension of our analysis to yeast species sharing a common ancestral WGD yields similar results, suggesting that duplicated-gene retention for dosage constraints followed by divergence in expression level and eventual deterministic gene loss might be a universal feature of post-WGD evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa

    2010-01-01

    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  12. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  13. Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene

    Directory of Open Access Journals (Sweden)

    Shomron Noam

    2007-11-01

    Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.

  14. Genome Mutational and Transcriptional Hotspots Are Traps for Duplicated Genes and Sources of Adaptations.

    Science.gov (United States)

    Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina

    2017-05-01

    Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. The duplicated genes database: identification and functional annotation of co-localised duplicated genes across genomes.

    Directory of Open Access Journals (Sweden)

    Marion Ouedraogo

    Full Text Available BACKGROUND: There has been a surge in studies linking genome structure and gene expression, with special focus on duplicated genes. Although initially duplicated from the same sequence, duplicated genes can diverge strongly over evolution and take on different functions or regulated expression. However, information on the function and expression of duplicated genes remains sparse. Identifying groups of duplicated genes in different genomes and characterizing their expression and function would therefore be of great interest to the research community. The 'Duplicated Genes Database' (DGD was developed for this purpose. METHODOLOGY: Nine species were included in the DGD. For each species, BLAST analyses were conducted on peptide sequences corresponding to the genes mapped on a same chromosome. Groups of duplicated genes were defined based on these pairwise BLAST comparisons and the genomic location of the genes. For each group, Pearson correlations between gene expression data and semantic similarities between functional GO annotations were also computed when the relevant information was available. CONCLUSIONS: The Duplicated Gene Database provides a list of co-localised and duplicated genes for several species with the available gene co-expression level and semantic similarity value of functional annotation. Adding these data to the groups of duplicated genes provides biological information that can prove useful to gene expression analyses. The Duplicated Gene Database can be freely accessed through the DGD website at http://dgd.genouest.org.

  16. 46 CFR Sec. 5 - Responsibility for duplicating copies of NSA-WORKSMALREP Contract.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Responsibility for duplicating copies of NSA-WORKSMALREP Contract. Sec. 5 Section 5 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION A-NATIONAL... INDIVIDUAL CONTRACT FOR MINOR REPAIRS-NSA-WORKSMALREP Sec. 5 Responsibility for duplicating copies of NSA...

  17. Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.

    Science.gov (United States)

    Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M

    2017-08-01

    Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

  18. Two sequence-ready contigs spanning the two copies of a 200-kb duplication on human 21q: partial sequence and polymorphisms.

    Science.gov (United States)

    Potier, M; Dutriaux, A; Orti, R; Groet, J; Gibelin, N; Karadima, G; Lutfalla, G; Lynn, A; Van Broeckhoven, C; Chakravarti, A; Petersen, M; Nizetic, D; Delabar, J; Rossier, J

    1998-08-01

    Physical mapping across a duplication can be a tour de force if the region is larger than the size of a bacterial clone. This was the case of the 170- to 275-kb duplication present on the long arm of chromosome 21 in normal human at 21q11.1 (proximal region) and at 21q22.1 (distal region), which we described previously. We have constructed sequence-ready contigs of the two copies of the duplication of which all the clones are genuine representatives of one copy or the other. This required the identification of four duplicon polymorphisms that are copy-specific and nonallelic variations in the sequence of the STSs. Thirteen STSs were mapped inside the duplicated region and 5 outside but close to the boundaries. Among these STSs 10 were end clones from YACs, PACs, or cosmids, and the average interval between two markers in the duplicated region was 16 kb. Eight PACs and cosmids showing minimal overlaps were selected in both copies of the duplication. Comparative sequence analysis along the duplication showed three single-basepair changes between the two copies over 659 bp sequenced (4 STSs), suggesting that the duplication is recent (less than 4 mya). Two CpG islands were located in the duplication, but no genes were identified after a 36-kb cosmid from the proximal copy of the duplication was sequenced. The homology of this chromosome 21 duplicated region with the pericentromeric regions of chromosomes 13, 2, and 18 suggests that the mechanism involved is probably similar to pericentromeric-directed mechanisms described in interchromosomal duplications. Copyright 1998 Academic Press.

  19. Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes

    Science.gov (United States)

    Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.

    2011-01-01

    vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289

  20. Differential retention of metabolic genes following whole-genome duplication.

    Science.gov (United States)

    Gout, Jean-François; Duret, Laurent; Kahn, Daniel

    2009-05-01

    Classical studies in Metabolic Control Theory have shown that metabolic fluxes usually exhibit little sensitivity to changes in individual enzyme activity, yet remain sensitive to global changes of all enzymes in a pathway. Therefore, little selective pressure is expected on the dosage or expression of individual metabolic genes, yet entire pathways should still be constrained. However, a direct estimate of this selective pressure had not been evaluated. Whole-genome duplications (WGDs) offer a good opportunity to address this question by analyzing the fates of metabolic genes during the massive gene losses that follow. Here, we take advantage of the successive rounds of WGD that occurred in the Paramecium lineage. We show that metabolic genes exhibit different gene retention patterns than nonmetabolic genes. Contrary to what was expected for individual genes, metabolic genes appeared more retained than other genes after the recent WGD, which was best explained by selection for gene expression operating on entire pathways. Metabolic genes also tend to be less retained when present at high copy number before WGD, contrary to other genes that show a positive correlation between gene retention and preduplication copy number. This is rationalized on the basis of the classical concave relationship relating metabolic fluxes with enzyme expression.

  1. Evolution dynamics of a model for gene duplication under adaptive conflict

    Science.gov (United States)

    Ancliff, Mark; Park, Jeong-Man

    2014-06-01

    We present and solve the dynamics of a model for gene duplication showing escape from adaptive conflict. We use a Crow-Kimura quasispecies model of evolution where the fitness landscape is a function of Hamming distances from two reference sequences, which are assumed to optimize two different gene functions, to describe the dynamics of a mixed population of individuals with single and double copies of a pleiotropic gene. The evolution equations are solved through a spin coherent state path integral, and we find two phases: one is an escape from an adaptive conflict phase, where each copy of a duplicated gene evolves toward subfunctionalization, and the other is a duplication loss of function phase, where one copy maintains its pleiotropic form and the other copy undergoes neutral mutation. The phase is determined by a competition between the fitness benefits of subfunctionalization and the greater mutational load associated with maintaining two gene copies. In the escape phase, we find a dynamics of an initial population of single gene sequences only which escape adaptive conflict through gene duplication and find that there are two time regimes: until a time t* single gene sequences dominate, and after t* double gene sequences outgrow single gene sequences. The time t* is identified as the time necessary for subfunctionalization to evolve and spread throughout the double gene sequences, and we show that there is an optimum mutation rate which minimizes this time scale.

  2. Local synteny and codon usage contribute to asymmetric sequence divergence of Saccharomyces cerevisiae gene duplicates

    Directory of Open Access Journals (Sweden)

    Bergthorsson Ulfar

    2011-09-01

    Full Text Available Abstract Background Duplicated genes frequently experience asymmetric rates of sequence evolution. Relaxed selective constraints and positive selection have both been invoked to explain the observation that one paralog within a gene-duplicate pair exhibits an accelerated rate of sequence evolution. In the majority of studies where asymmetric divergence has been established, there is no indication as to which gene copy, ancestral or derived, is evolving more rapidly. In this study we investigated the effect of local synteny (gene-neighborhood conservation and codon usage on the sequence evolution of gene duplicates in the S. cerevisiae genome. We further distinguish the gene duplicates into those that originated from a whole-genome duplication (WGD event (ohnologs versus small-scale duplications (SSD to determine if there exist any differences in their patterns of sequence evolution. Results For SSD pairs, the derived copy evolves faster than the ancestral copy. However, there is no relationship between rate asymmetry and synteny conservation (ancestral-like versus derived-like in ohnologs. mRNA abundance and optimal codon usage as measured by the CAI is lower in the derived SSD copies relative to ancestral paralogs. Moreover, in the case of ohnologs, the faster-evolving copy has lower CAI and lowered expression. Conclusions Together, these results suggest that relaxation of selection for codon usage and gene expression contribute to rate asymmetry in the evolution of duplicated genes and that in SSD pairs, the relaxation of selection stems from the loss of ancestral regulatory information in the derived copy.

  3. The prevalence of gene duplications and their ancient origin in Rhodobacter sphaeroides 2.4.1

    Directory of Open Access Journals (Sweden)

    Cho Hyuk

    2010-12-01

    Full Text Available Abstract Background Rhodobacter sphaeroides 2.4.1 is a metabolically versatile organism that belongs to α-3 subdivision of Proteobacteria. The present study was to identify the extent, history, and role of gene duplications in R. sphaeroides 2.4.1, an organism that possesses two chromosomes. Results A protein similarity search (BLASTP identified 1247 orfs (~29.4% of the total protein coding orfs that are present in 2 or more copies, 37.5% (234 gene-pairs of which exist in duplicate copies. The distribution of the duplicate gene-pairs in all Clusters of Orthologous Groups (COGs differed significantly when compared to the COG distribution across the whole genome. Location plots revealed clusters of gene duplications that possessed the same COG classification. Phylogenetic analyses were performed to determine a tree topology predicting either a Type-A or Type-B phylogenetic relationship. A Type-A phylogenetic relationship shows that a copy of the protein-pair matches more with an ortholog from a species closely related to R. sphaeroides while a Type-B relationship predicts the highest match between both copies of the R. sphaeroides protein-pair. The results revealed that ~77% of the proteins exhibited a Type-A phylogenetic relationship demonstrating the ancient origin of these gene duplications. Additional analyses on three other strains of R. sphaeroides revealed varying levels of gene loss and retention in these strains. Also, analyses on common gene pairs among the four strains revealed that these genes experience similar functional constraints and undergo purifying selection. Conclusions Although the results suggest that the level of gene duplication in organisms with complex genome structuring (more than one chromosome seems to be not markedly different from that in organisms with only a single chromosome, these duplications may have aided in genome reorganization in this group of eubacteria prior to the formation of R. sphaeroides as gene

  4. The enrichment of TATA box and the scarcity of depleted proximal nucleosome in the promoters of duplicated yeast genes.

    Science.gov (United States)

    Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A

    2010-01-01

    Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.

  5. Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures

    Directory of Open Access Journals (Sweden)

    Kesterson Robert A

    2003-04-01

    Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.

  6. Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster

    Directory of Open Access Journals (Sweden)

    Jakobek Judy L

    2007-07-01

    Full Text Available Abstract Background The biosynthesis of aflatoxin (AF involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST and O-methylsterigmatocystin (OMST, the respective penultimate and ultimate precursors of AF. Although these precursors are chemically and structurally very similar, their accumulation differs at the species level for Aspergilli. Notable examples are A. nidulans that synthesizes only ST, A. flavus that makes predominantly AF, and A. parasiticus that generally produces either AF or OMST. Whether these differences are important in the evolutionary/ecological processes of species adaptation and diversification is unknown. Equally unknown are the specific genomic mechanisms responsible for ordering and clustering of genes in the AF pathway of Aspergillus. Results To elucidate the mechanisms that have driven formation of these clusters, we performed systematic searches of aflatoxin cluster homologs across five Aspergillus genomes. We found a high level of gene duplication and identified seven modules consisting of highly correlated gene pairs (aflA/aflB, aflR/aflS, aflX/aflY, aflF/aflE, aflT/aflQ, aflC/aflW, and aflG/aflL. With the exception of A. nomius, contrasts of mean Ka/Ks values across all cluster genes showed significant differences in selective pressure between section Flavi and non-section Flavi species. A. nomius mean Ka/Ks values were more similar to partial clusters in A. fumigatus and A. terreus. Overall, mean Ka/Ks values were significantly higher for section Flavi than for non-section Flavi species. Conclusion Our results implicate several genomic mechanisms in the evolution of ST, OMST and AF cluster genes. Gene modules may arise from duplications of a single gene, whereby the function of the pre-duplication gene is retained in the copy (aflF/aflE or the copies may partition the ancestral function (aflA/aflB. In some gene modules, the

  7. Effect of Duplicate Genes on Mouse Genetic Robustness: An Update

    Directory of Open Access Journals (Sweden)

    Zhixi Su

    2014-01-01

    Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.

  8. Ascorbate peroxidase-related (APx-R) is not a duplicable gene.

    Science.gov (United States)

    Dunand, Christophe; Mathé, Catherine; Lazzarotto, Fernanda; Margis, Rogério; Margis-Pinheiro, Marcia

    2011-12-01

    Phylogenetic, genomic and functional analyses have allowed the identification of a new class of putative heme peroxidases, so called APx-R (APx-Related). These new class, mainly present in the green lineage (including green algae and land plants), can also be detected in other unicellular chloroplastic organisms. Except for recent polyploid organisms, only single-copy of APx-R gene was detected in each genome, suggesting that the majority of the APx-R extra-copies were lost after chromosomal or segmental duplications. In a similar way, most APx-R co-expressed genes in Arabidopsis genome do not have conserved extra-copies after chromosomal duplications and are predicted to be localized in organelles, as are the APx-R. The member of this gene network can be considered as unique gene, well conserved through the evolution due to a strong negative selection pressure and a low evolution rate. © 2011 Landes Bioscience

  9. Three neuropeptide Y receptor genes in the spiny dogfish, Squalus acanthias, support en bloc duplications in early vertebrate evolution.

    Science.gov (United States)

    Salaneck, Erik; Ardell, David H; Larson, Earl T; Larhammar, Dan

    2003-08-01

    It has been debated whether the increase in gene number during early vertebrate evolution was due to multiple independent gene duplications or synchronous duplications of many genes. We describe here the cloning of three neuropeptide Y (NPY) receptor genes belonging to the Y1 subfamily in the spiny dogfish, Squalus acanthias, a cartilaginous fish. The three genes are orthologs of the mammalian subtypes Y1, Y4, and Y6, which are located in paralogous gene regions on different chromosomes in mammals. Thus, these genes arose by duplications of a chromosome region before the radiation of gnathostomes (jawed vertebrates). Estimates of duplication times from linearized trees together with evidence from other gene families supports two rounds of chromosome duplications or tetraploidizations early in vertebrate evolution. The anatomical distribution of mRNA was determined by reverse-transcriptase PCR and was found to differ from mammals, suggesting differential functional diversification of the new gene copies during the radiation of the vertebrate classes.

  10. Exon duplications in the ATP7A gene

    DEFF Research Database (Denmark)

    Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko

    2011-01-01

    the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...

  11. Functional requirements driving the gene duplication in 12 Drosophila species.

    Science.gov (United States)

    Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui

    2013-08-15

    Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.

  12. Screening for common copy-number variants in cancer genes.

    Science.gov (United States)

    Tyson, Jess; Majerus, Tamsin M O; Walker, Susan; Armour, John A L

    2010-12-01

    For most cases of colorectal cancer that arise without a family history of the disease, it is proposed that an appreciable heritable component of predisposition is the result of contributions from many loci. Although progress has been made in identifying single nucleotide variants associated with colorectal cancer risk, the involvement of low-penetrance copy number variants is relatively unexplored. We have used multiplex amplifiable probe hybridization (MAPH) in a fourfold multiplex (QuadMAPH), positioned at an average resolution of one probe per 2 kb, to screen a total of 1.56 Mb of genomic DNA for copy number variants around the genes APC, AXIN1, BRCA1, BRCA2, CTNNB1, HRAS, MLH1, MSH2, and TP53. Two deletion events were detected, one upstream of MLH1 in a control individual and the other in APC in a colorectal cancer patient, but these do not seem to correspond to copy number polymorphisms with measurably high population frequencies. In summary, by means of our QuadMAPH assay, copy number measurement data were of sufficient resolution and accuracy to detect any copy number variants with high probability. However, this study has demonstrated a very low incidence of deletion and duplication variants within intronic and flanking regions of these nine genes, in both control individuals and colorectal cancer patients. Copyright © 2010 Elsevier Inc. All rights reserved.

  13. Restriction and Recruitment—Gene Duplication and the Origin and Evolution of Snake Venom Toxins

    Science.gov (United States)

    Hargreaves, Adam D.; Swain, Martin T.; Hegarty, Matthew J.; Logan, Darren W.; Mulley, John F.

    2014-01-01

    Snake venom has been hypothesized to have originated and diversified through a process that involves duplication of genes encoding body proteins with subsequent recruitment of the copy to the venom gland, where natural selection acts to develop or increase toxicity. However, gene duplication is known to be a rare event in vertebrate genomes, and the recruitment of duplicated genes to a novel expression domain (neofunctionalization) is an even rarer process that requires the evolution of novel combinations of transcription factor binding sites in upstream regulatory regions. Therefore, although this hypothesis concerning the evolution of snake venom is very unlikely and should be regarded with caution, it is nonetheless often assumed to be established fact, hindering research into the true origins of snake venom toxins. To critically evaluate this hypothesis, we have generated transcriptomic data for body tissues and salivary and venom glands from five species of venomous and nonvenomous reptiles. Our comparative transcriptomic analysis of these data reveals that snake venom does not evolve through the hypothesized process of duplication and recruitment of genes encoding body proteins. Indeed, our results show that many proposed venom toxins are in fact expressed in a wide variety of body tissues, including the salivary gland of nonvenomous reptiles and that these genes have therefore been restricted to the venom gland following duplication, not recruited. Thus, snake venom evolves through the duplication and subfunctionalization of genes encoding existing salivary proteins. These results highlight the danger of the elegant and intuitive “just-so story” in evolutionary biology. PMID:25079342

  14. Independent Origin and Global Distribution of Distinct Plasmodium vivax Duffy Binding Protein Gene Duplications.

    Directory of Open Access Journals (Sweden)

    Jessica B Hostetler

    2016-10-01

    Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.

  15. GENE-dosage effects on fitness in recent adaptive duplications: ace-1 in the mosquito Culex pipiens.

    Science.gov (United States)

    Labbé, Pierrick; Milesi, Pascal; Yébakima, André; Pasteur, Nicole; Weill, Mylène; Lenormand, Thomas

    2014-07-01

    Gene duplications have long been advocated to contribute to the evolution of new functions. The role of selection in their early spread is more controversial. Unless duplications are favored for a direct benefit of increased expression, they are likely detrimental. In this article, we investigated the case of duplications favored because they combine already functionally divergent alleles. Their gene-dosage/fitness relations are poorly known because selection may operate on both overall expression and duplicates relative dosage. Using the well-documented case of Culex pipiens resistance to insecticides, we compared strains with various ace-1 allele combinations, including two duplicated alleles carrying both susceptible and resistant copies. The overall protein activity was nearly additive, but, surprisingly, fitness correlated better with the relative proportion of susceptible and resistant copies rather than any absolute measure of activity. Gene dosage is thus crucial, duplications stabilizing a "heterozygote" phenotype. It corroborates the view that these were favored because they fix a permanent heterosis, thereby solving the irreducible trade-off between resistance and synaptic transmission. Moreover, we showed that the contrasted successes of the two duplicated alleles in natural populations depend on genetic changes unrelated to ace-1, confirming the probable implication of recessive sublethal mutations linked to structural rearrangements in some duplications. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  16. Molecular evolution of a Y chromosome to autosome gene duplication in Drosophila.

    Science.gov (United States)

    Dyer, Kelly A; White, Brooke E; Bray, Michael J; Piqué, Daniel G; Betancourt, Andrea J

    2011-03-01

    In contrast to the rest of the genome, the Y chromosome is restricted to males and lacks recombination. As a result, Y chromosomes are unable to respond efficiently to selection, and newly formed Y chromosomes degenerate until few genes remain. The rapid loss of genes from newly formed Y chromosomes has been well studied, but gene loss from highly degenerate Y chromosomes has only recently received attention. Here, we identify and characterize a Y to autosome duplication of the male fertility gene kl-5 that occurred during the evolution of the testacea group species of Drosophila. The duplication was likely DNA based, as other Y-linked genes remain on the Y chromosome, the locations of introns are conserved, and expression analyses suggest that regulatory elements remain linked. Genetic mapping reveals that the autosomal copy of kl-5 resides on the dot chromosome, a tiny autosome with strongly suppressed recombination. Molecular evolutionary analyses show that autosomal copies of kl-5 have reduced polymorphism and little recombination. Importantly, the rate of protein evolution of kl-5 has increased significantly in lineages where it is on the dot versus Y linked. Further analyses suggest this pattern is a consequence of relaxed purifying selection, rather than adaptive evolution. Thus, although the initial fixation of the kl-5 duplication may have been advantageous, slightly deleterious mutations have accumulated in the dot-linked copies of kl-5 faster than in the Y-linked copies. Because the dot chromosome contains seven times more genes than the Y and is exposed to selection in both males and females, these results suggest that the dot suffers the deleterious effects of genetic linkage to more selective targets compared with the Y chromosome. Thus, a highly degenerate Y chromosome may not be the worst environment in the genome, as is generally thought, but may in fact be protected from the accumulation of deleterious mutations relative to other nonrecombining

  17. Segmental duplications and evolutionary acquisition of UV damage response in the SPATA31 gene family of primates and humans.

    Science.gov (United States)

    Bekpen, Cemalettin; Künzel, Sven; Xie, Chen; Eaaswarkhanth, Muthukrishnan; Lin, Yen-Lung; Gokcumen, Omer; Akdis, Cezmi A; Tautz, Diethard

    2017-03-06

    Segmental duplications are an abundant source for novel gene functions and evolutionary adaptations. This mechanism of generating novelty was very active during the evolution of primates particularly in the human lineage. Here, we characterize the evolution and function of the SPATA31 gene family (former designation FAM75A), which was previously shown to be among the gene families with the strongest signal of positive selection in hominoids. The mouse homologue for this gene family is a single copy gene expressed during spermatogenesis. We show that in primates, the SPATA31 gene duplicated into SPATA31A and SPATA31C types and broadened the expression into many tissues. Each type became further segmentally duplicated in the line towards humans with the largest number of full-length copies found for SPATA31A in humans. Copy number estimates of SPATA31A based on digital PCR show an average of 7.5 with a range of 5-11 copies per diploid genome among human individuals. The primate SPATA31 genes also acquired new protein domains that suggest an involvement in UV response and DNA repair. We generated antibodies and show that the protein is re-localized from the nucleolus to the whole nucleus upon UV-irradiation suggesting a UV damage response. We used CRISPR/Cas mediated mutagenesis to knockout copies of the gene in human primary fibroblast cells. We find that cell lines with reduced functional copies as well as naturally occurring low copy number HFF cells show enhanced sensitivity towards UV-irradiation. The acquisition of new SPATA31 protein functions and its broadening of expression may be related to the evolution of the diurnal life style in primates that required a higher UV tolerance. The increased segmental duplications in hominoids as well as its fast evolution suggest the acquisition of further specific functions particularly in humans.

  18. Neofunctionalization of Duplicated P450 Genes Drives the Evolution of Insecticide Resistance in the Brown Planthopper.

    Science.gov (United States)

    Zimmer, Christoph T; Garrood, William T; Singh, Kumar Saurabh; Randall, Emma; Lueke, Bettina; Gutbrod, Oliver; Matthiesen, Svend; Kohler, Maxie; Nauen, Ralf; Davies, T G Emyr; Bass, Chris

    2018-01-22

    Gene duplication is a major source of genetic variation that has been shown to underpin the evolution of a wide range of adaptive traits [1, 2]. For example, duplication or amplification of genes encoding detoxification enzymes has been shown to play an important role in the evolution of insecticide resistance [3-5]. In this context, gene duplication performs an adaptive function as a result of its effects on gene dosage and not as a source of functional novelty [3, 6-8]. Here, we show that duplication and neofunctionalization of a cytochrome P450, CYP6ER1, led to the evolution of insecticide resistance in the brown planthopper. Considerable genetic variation was observed in the coding sequence of CYP6ER1 in populations of brown planthopper collected from across Asia, but just two sequence variants are highly overexpressed in resistant strains and metabolize imidacloprid. Both variants are characterized by profound amino-acid alterations in substrate recognition sites, and the introduction of these mutations into a susceptible P450 sequence is sufficient to confer resistance. CYP6ER1 is duplicated in resistant strains with individuals carrying paralogs with and without the gain-of-function mutations. Despite numerical parity in the genome, the susceptible and mutant copies exhibit marked asymmetry in their expression with the resistant paralogs overexpressed. In the primary resistance-conferring CYP6ER1 variant, this results from an extended region of novel sequence upstream of the gene that provides enhanced expression. Our findings illustrate the versatility of gene duplication in providing opportunities for functional and regulatory innovation during the evolution of an adaptive trait. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  20. Microevolution of Duplications and Deletions and Their Impact on Gene Expression in the Nematode Pristionchus pacificus.

    Directory of Open Access Journals (Sweden)

    Praveen Baskaran

    Full Text Available The evolution of diversity across the animal kingdom has been accompanied by tremendous gene loss and gain. While comparative genomics has been fruitful to characterize differences in gene content across highly diverged species, little is known about the microevolution of structural variations that cause these differences in the first place. In order to investigate the genomic impact of structural variations, we made use of genomic and transcriptomic data from the nematode Pristionchus pacificus, which has been established as a satellite model to Caenorhabditis elegans for comparative biology. We exploit the fact that P. pacificus is a highly diverse species for which various genomic data including the draft genome of a sister species P. exspectatus is available. Based on resequencing coverage data for two natural isolates we identified large (> 2 kb deletions and duplications relative to the reference strain. By restriction to completely syntenic regions between P. pacificus and P. exspectatus, we were able to polarize the comparison and to assess the impact of structural variations on expression levels. We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. Further investigating expression of individual copies at sites that segregate between the duplicates, we found in the majority of cases only one of the copies to be expressed. Nevertheless, we still find that certain gene classes are strongly depleted in deletions as well as duplications, suggesting evolutionary constraint acting on synteny. In summary, our results are consistent with a model, where most structural variations are either deleterious or neutral and provide first insights into the microevolution of structural variations in the P. pacificus genome.

  1. TTT and PIKK Complex Genes Reverted to Single Copy Following Polyploidization and Retain Function Despite Massive Retrotransposition in Maize.

    Science.gov (United States)

    Garcia, Nelson; Messing, Joachim

    2017-01-01

    The TEL2, TTI1, and TTI2 proteins are co-chaperones for heat shock protein 90 (HSP90) to regulate the protein folding and maturation of phosphatidylinositol 3-kinase-related kinases (PIKKs). Referred to as the TTT complex, the genes that encode them are highly conserved from man to maize. TTT complex and PIKK genes exist mostly as single copy genes in organisms where they have been characterized. Members of this interacting protein network in maize were identified and synteny analyses were performed to study their evolution. Similar to other species, there is only one copy of each of these genes in maize which was due to a loss of the duplicated copy created by ancient allotetraploidy. Moreover, the retained copies of the TTT complex and the PIKK genes tolerated extensive retrotransposon insertion in their introns that resulted in increased gene lengths and gene body methylation, without apparent effect in normal gene expression and function. The results raise an interesting question on whether the reversion to single copy was due to selection against deleterious unbalanced gene duplications between members of the complex as predicted by the gene balance hypothesis, or due to neutral loss of extra copies. Uneven alteration of dosage either by adding extra copies or modulating gene expression of complex members is being proposed as a means to investigate whether the data supports the gene balance hypothesis or not.

  2. TTT and PIKK Complex Genes Reverted to Single Copy Following Polyploidization and Retain Function Despite Massive Retrotransposition in Maize

    Directory of Open Access Journals (Sweden)

    Nelson Garcia

    2017-11-01

    Full Text Available The TEL2, TTI1, and TTI2 proteins are co-chaperones for heat shock protein 90 (HSP90 to regulate the protein folding and maturation of phosphatidylinositol 3-kinase-related kinases (PIKKs. Referred to as the TTT complex, the genes that encode them are highly conserved from man to maize. TTT complex and PIKK genes exist mostly as single copy genes in organisms where they have been characterized. Members of this interacting protein network in maize were identified and synteny analyses were performed to study their evolution. Similar to other species, there is only one copy of each of these genes in maize which was due to a loss of the duplicated copy created by ancient allotetraploidy. Moreover, the retained copies of the TTT complex and the PIKK genes tolerated extensive retrotransposon insertion in their introns that resulted in increased gene lengths and gene body methylation, without apparent effect in normal gene expression and function. The results raise an interesting question on whether the reversion to single copy was due to selection against deleterious unbalanced gene duplications between members of the complex as predicted by the gene balance hypothesis, or due to neutral loss of extra copies. Uneven alteration of dosage either by adding extra copies or modulating gene expression of complex members is being proposed as a means to investigate whether the data supports the gene balance hypothesis or not.

  3. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    ers were developed, and the 1990s, when genome sequenc- ing became ... transposed gene copies have been maintained in the human genome over the past 63 ..... competent artificial chromosome (TAC) libraries as the pri- mary substrates ...

  4. Segmental Duplication, Microinversion, and Gene Loss Associated with a Complex Inversion Breakpoint Region in Drosophila

    Science.gov (United States)

    Calvete, Oriol; González, Josefa; Betrán, Esther; Ruiz, Alfredo

    2012-01-01

    Chromosomal inversions are usually portrayed as simple two-breakpoint rearrangements changing gene order but not gene number or structure. However, increasing evidence suggests that inversion breakpoints may often have a complex structure and entail gene duplications with potential functional consequences. Here, we used a combination of different techniques to investigate the breakpoint structure and the functional consequences of a complex rearrangement fixed in Drosophila buzzatii and comprising two tandemly arranged inversions sharing the middle breakpoint: 2m and 2n. By comparing the sequence in the breakpoint regions between D. buzzatii (inverted chromosome) and D. mojavensis (noninverted chromosome), we corroborate the breakpoint reuse at the molecular level and infer that inversion 2m was associated with a duplication of a ∼13 kb segment and likely generated by staggered breaks plus repair by nonhomologous end joining. The duplicated segment contained the gene CG4673, involved in nuclear transport, and its two nested genes CG5071 and CG5079. Interestingly, we found that other than the inversion and the associated duplication, both breakpoints suffered additional rearrangements, that is, the proximal breakpoint experienced a microinversion event associated at both ends with a 121-bp long duplication that contains a promoter. As a consequence of all these different rearrangements, CG5079 has been lost from the genome, CG5071 is now a single copy nonnested gene, and CG4673 has a transcript ∼9 kb shorter and seems to have acquired a more complex gene regulation. Our results illustrate the complex effects of chromosomal rearrangements and highlight the need of complementing genomic approaches with detailed sequence-level and functional analyses of breakpoint regions if we are to fully understand genome structure, function, and evolutionary dynamics. PMID:22328714

  5. The evolution of pepsinogen C genes in vertebrates: duplication, loss and functional diversification.

    Directory of Open Access Journals (Sweden)

    Luís Filipe Costa Castro

    Full Text Available BACKGROUND: Aspartic proteases comprise a large group of enzymes involved in peptide proteolysis. This collection includes prominent enzymes globally categorized as pepsins, which are derived from pepsinogen precursors. Pepsins are involved in gastric digestion, a hallmark of vertebrate physiology. An important member among the pepsinogens is pepsinogen C (Pgc. A particular aspect of Pgc is its apparent single copy status, which contrasts with the numerous gene copies found for example in pepsinogen A (Pga. Although gene sequences with similarity to Pgc have been described in some vertebrate groups, no exhaustive evolutionary framework has been considered so far. METHODOLOGY/PRINCIPAL FINDINGS: By combining phylogenetics and genomic analysis, we find an unexpected Pgc diversity in the vertebrate sub-phylum. We were able to reconstruct gene duplication timings relative to the divergence of major vertebrate clades. Before tetrapod divergence, a single Pgc gene tandemly expanded to produce two gene lineages (Pgbc and Pgc2. These have been differentially retained in various classes. Accordingly, we find Pgc2 in sauropsids, amphibians and marsupials, but not in eutherian mammals. Pgbc was retained in amphibians, but duplicated in the ancestor of amniotes giving rise to Pgb and Pgc1. The latter was retained in mammals and probably in reptiles and marsupials but not in birds. Pgb was kept in all of the amniote clade with independent episodes of loss in some mammalian species. Lineage specific expansions of Pgc2 and Pgbc have also occurred in marsupials and amphibians respectively. We find that teleost and tetrapod Pgc genes reside in distinct genomic regions hinting at a possible translocation. CONCLUSIONS: We conclude that the repertoire of Pgc genes is larger than previously reported, and that tandem duplications have modelled the history of Pgc genes. We hypothesize that gene expansion lead to functional divergence in tetrapods, coincident with the

  6. Host Mitochondrial Association Evolved in the Human Parasite Toxoplasma gondii via Neofunctionalization of a Gene Duplicate.

    Science.gov (United States)

    Adomako-Ankomah, Yaw; English, Elizabeth D; Danielson, Jeffrey J; Pernas, Lena F; Parker, Michelle L; Boulanger, Martin J; Dubey, Jitender P; Boyle, Jon P

    2016-05-01

    In Toxoplasma gondii, an intracellular parasite of humans and other animals, host mitochondrial association (HMA) is driven by a gene family that encodes multiple mitochondrial association factor 1 (MAF1) proteins. However, the importance of MAF1 gene duplication in the evolution of HMA is not understood, nor is the impact of HMA on parasite biology. Here we used within- and between-species comparative analysis to determine that the MAF1 locus is duplicated in T. gondii and its nearest extant relative Hammondia hammondi, but not another close relative, Neospora caninum Using cross-species complementation, we determined that the MAF1 locus harbors multiple distinct paralogs that differ in their ability to mediate HMA, and that only T. gondii and H. hammondi harbor HMA(+) paralogs. Additionally, we found that exogenous expression of an HMA(+) paralog in T. gondii strains that do not normally exhibit HMA provides a competitive advantage over their wild-type counterparts during a mouse infection. These data indicate that HMA likely evolved by neofunctionalization of a duplicate MAF1 copy in the common ancestor of T. gondii and H. hammondi, and that the neofunctionalized gene duplicate is selectively advantageous. Copyright © 2016 by the Genetics Society of America.

  7. Polytomy refinement for the correction of dubious duplications in gene trees.

    Science.gov (United States)

    Lafond, Manuel; Chauve, Cedric; Dondi, Riccardo; El-Mabrouk, Nadia

    2014-09-01

    Large-scale methods for inferring gene trees are error-prone. Correcting gene trees for weakly supported features often results in non-binary trees, i.e. trees with polytomies, thus raising the natural question of refining such polytomies into binary trees. A feature pointing toward potential errors in gene trees are duplications that are not supported by the presence of multiple gene copies. We introduce the problem of refining polytomies in a gene tree while minimizing the number of created non-apparent duplications in the resulting tree. We show that this problem can be described as a graph-theoretical optimization problem. We provide a bounded heuristic with guaranteed optimality for well-characterized instances. We apply our algorithm to a set of ray-finned fish gene trees from the Ensembl database to illustrate its ability to correct dubious duplications. The C++ source code for the algorithms and simulations described in the article are available at http://www-ens.iro.umontreal.ca/~lafonman/software.php. Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press.

  8. Targeted Exon Skipping to Correct Exon Duplications in the Dystrophin Gene

    Directory of Open Access Journals (Sweden)

    Kane L Greer

    2014-01-01

    Full Text Available Duchenne muscular dystrophy is a severe muscle-wasting disease caused by mutations in the dystrophin gene that ablate functional protein expression. Although exonic deletions are the most common Duchenne muscular dystrophy lesion, duplications account for 10–15% of reported disease-causing mutations, and exon 2 is the most commonly duplicated exon. Here, we describe the in vitro evaluation of phosphorodiamidate morpholino oligomers coupled to a cell-penetrating peptide and 2′-O-methyl phosphorothioate oligonucleotides, using three distinct strategies to reframe the dystrophin transcript in patient cells carrying an exon 2 duplication. Differences in exon-skipping efficiencies in vitro were observed between oligomer analogues of the same sequence, with the phosphorodiamidate morpholino oligomer coupled to a cell-penetrating peptide proving the most effective. Differences in exon 2 excision efficiency between normal and exon 2 duplication cells, were apparent, indicating that exon context influences oligomer-induced splice switching. Skipping of a single copy of exon 2 was induced in the cells carrying an exon 2 duplication, the simplest strategy to restore the reading frame and generate a normal dystrophin transcript. In contrast, multiexon skipping of exons 2–7 to generate a Becker muscular dystrophy-like dystrophin transcript was more challenging and could only be induced efficiently with the phosphorodiamidate morpholino oligomer chemistry.

  9. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  10. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...

  11. An ace-1 gene duplication resorbs the fitness cost associated with resistance in Anopheles gambiae, the main malaria mosquito.

    Science.gov (United States)

    Assogba, Benoît S; Djogbénou, Luc S; Milesi, Pascal; Berthomieu, Arnaud; Perez, Julie; Ayala, Diego; Chandre, Fabrice; Makoutodé, Michel; Labbé, Pierrick; Weill, Mylène

    2015-10-05

    Widespread resistance to pyrethroids threatens malaria control in Africa. Consequently, several countries switched to carbamates and organophophates insecticides for indoor residual spraying. However, a mutation in the ace-1 gene conferring resistance to these compounds (ace-1(R) allele), is already present. Furthermore, a duplicated allele (ace-1(D)) recently appeared; characterizing its selective advantage is mandatory to evaluate the threat. Our data revealed that a unique duplication event, pairing a susceptible and a resistant copy of the ace-1 gene spread through West Africa. Further investigations revealed that, while ace-1(D) confers less resistance than ace-1(R), the high fitness cost associated with ace-1(R) is almost completely suppressed by the duplication for all traits studied. ace-1 duplication thus represents a permanent heterozygote phenotype, selected, and thus spreading, due to the mosaic nature of mosquito control. It provides malaria mosquito with a new evolutionary path that could hamper resistance management.

  12. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  13. Recombination facilitates neofunctionalization of duplicate genes via originalization

    Directory of Open Access Journals (Sweden)

    Huang Ren

    2010-06-01

    Full Text Available Abstract Background Recently originalization was proposed to be an effective way of duplicate-gene preservation, in which recombination provokes the high frequency of original (or wild-type allele on both duplicated loci. Because the high frequency of wild-type allele might drive the arising and accumulating of advantageous mutation, it is hypothesized that recombination might enlarge the probability of neofunctionalization (Pneo of duplicate genes. In this article this hypothesis has been tested theoretically. Results Results show that through originalization recombination might not only shorten mean time to neofunctionalizaiton, but also enlarge Pneo. Conclusions Therefore, recombination might facilitate neofunctionalization via originalization. Several extensive applications of these results on genomic evolution have been discussed: 1. Time to nonfunctionalization can be much longer than a few million generations expected before; 2. Homogenization on duplicated loci results from not only gene conversion, but also originalization; 3. Although the rate of advantageous mutation is much small compared with that of degenerative mutation, Pneo cannot be expected to be small.

  14. Gene duplication, tissue-specific gene expression and sexual conflict in stalk-eyed flies (Diopsidae).

    Science.gov (United States)

    Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S

    2012-08-19

    Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.

  15. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  16. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  17. Concomitant duplications of opioid peptide and receptor genes before the origin of jawed vertebrates.

    Directory of Open Access Journals (Sweden)

    Görel Sundström

    Full Text Available BACKGROUND: The opioid system is involved in reward and pain mechanisms and consists in mammals of four receptors and several peptides. The peptides are derived from four prepropeptide genes, PENK, PDYN, PNOC and POMC, encoding enkephalins, dynorphins, orphanin/nociceptin and beta-endorphin, respectively. Previously we have described how two rounds of genome doubling (2R before the origin of jawed vertebrates formed the receptor family. METHODOLOGY/PRINCIPAL FINDINGS: Opioid peptide gene family members were investigated using a combination of sequence-based phylogeny and chromosomal locations of the peptide genes in various vertebrates. Several adjacent gene families were investigated similarly. The results show that the ancestral peptide gene gave rise to two additional copies in the genome doublings. The fourth member was generated by a local gene duplication, as the genes encoding POMC and PNOC are located on the same chromosome in the chicken genome and all three teleost genomes that we have studied. A translocation has disrupted this synteny in mammals. The PDYN gene seems to have been lost in chicken, but not in zebra finch. Duplicates of some peptide genes have arisen in the teleost fishes. Within the prepropeptide precursors, peptides have been lost or gained in different lineages. CONCLUSIONS/SIGNIFICANCE: The ancestral peptide and receptor genes were located on the same chromosome and were thus duplicated concomitantly. However, subsequently genetic linkage has been lost. In conclusion, the system of opioid peptides and receptors was largely formed by the genome doublings that took place early in vertebrate evolution.

  18. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou

    2009-07-01

    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  19. Sox genes in grass carp (Ctenopharyngodon idella with their implications for genome duplication and evolution

    Directory of Open Access Journals (Sweden)

    Tong Jingou

    2006-11-01

    Full Text Available Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella, one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes has two co-orthologs in grass carp, and the duplication of Sox4 and Sox11 occurred before the divergence of grass carp and zebrafish, which support the "fish-specific whole-genome duplication" theory. An estimation for the origin of grass carp based on the molecular clock using Sox1, Sox3 and Sox11 genes as markers indicates that grass carp (subfamily Leuciscinae and zebrafish (subfamily Danioninae diverged approximately 60 million years ago. The potential uses of Sox genes as markers in revealing the evolutionary history of grass carp are discussed.

  20. Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization

    Directory of Open Access Journals (Sweden)

    Xi-Yin Wang

    2011-01-01

    Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.

  1. A salmonid EST genomic study: genes, duplications, phylogeny and microarrays

    Directory of Open Access Journals (Sweden)

    Brahmbhatt Sonal

    2008-11-01

    Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is

  2. Profiling of gene duplication patterns of sequenced teleost genomes: evidence for rapid lineage-specific genome expansion mediated by recent tandem duplications.

    Science.gov (United States)

    Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang

    2012-06-15

    Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication

  3. Gene duplications in prokaryotes can be associated with environmental adaptation.

    Science.gov (United States)

    Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn

    2010-10-20

    Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate

  4. Gene duplications in prokaryotes can be associated with environmental adaptation

    Directory of Open Access Journals (Sweden)

    Lempicki Richard A

    2010-10-01

    Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive

  5. On Computing Breakpoint Distances for Genomes with Duplicate Genes.

    Science.gov (United States)

    Shao, Mingfu; Moret, Bernard M E

    2017-06-01

    A fundamental problem in comparative genomics is to compute the distance between two genomes in terms of its higher level organization (given by genes or syntenic blocks). For two genomes without duplicate genes, we can easily define (and almost always efficiently compute) a variety of distance measures, but the problem is NP-hard under most models when genomes contain duplicate genes. To tackle duplicate genes, three formulations (exemplar, maximum matching, and any matching) have been proposed, all of which aim to build a matching between homologous genes so as to minimize some distance measure. Of the many distance measures, the breakpoint distance (the number of nonconserved adjacencies) was the first one to be studied and remains of significant interest because of its simplicity and model-free property. The three breakpoint distance problems corresponding to the three formulations have been widely studied. Although we provided last year a solution for the exemplar problem that runs very fast on full genomes, computing optimal solutions for the other two problems has remained challenging. In this article, we describe very fast, exact algorithms for these two problems. Our algorithms rely on a compact integer-linear program that we further simplify by developing an algorithm to remove variables, based on new results on the structure of adjacencies and matchings. Through extensive experiments using both simulations and biological data sets, we show that our algorithms run very fast (in seconds) on mammalian genomes and scale well beyond. We also apply these algorithms (as well as the classic orthology tool MSOAR) to create orthology assignment, then compare their quality in terms of both accuracy and coverage. We find that our algorithm for the "any matching" formulation significantly outperforms other methods in terms of accuracy while achieving nearly maximum coverage.

  6. Evolutionary diversification of plant shikimate kinase gene duplicates.

    Directory of Open Access Journals (Sweden)

    Geoffrey Fucile

    2008-12-01

    Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.

  7. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes.

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu

    2016-09-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.

  8. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes1[OPEN

    Science.gov (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu

    2016-01-01

    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883

  9. STRIDE: Species Tree Root Inference from Gene Duplication Events.

    Science.gov (United States)

    Emms, David M; Kelly, Steven

    2017-12-01

    The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion

    Directory of Open Access Journals (Sweden)

    Jeffrey A. Fawcett

    2011-02-01

    Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.

  11. The Orphan Gene dauerless Regulates Dauer Development and Intraspecific Competition in Nematodes by Copy Number Variation.

    Directory of Open Access Journals (Sweden)

    Melanie G Mayer

    2015-06-01

    Full Text Available Many nematodes form dauer larvae when exposed to unfavorable conditions, representing an example of phenotypic plasticity and a major survival and dispersal strategy. In Caenorhabditis elegans, the regulation of dauer induction is a model for pheromone, insulin, and steroid-hormone signaling. Recent studies in Pristionchus pacificus revealed substantial natural variation in various aspects of dauer development, i.e. pheromone production and sensing and dauer longevity and fitness. One intriguing example is a strain from Ohio, having extremely long-lived dauers associated with very high fitness and often forming the most dauers in response to other strains' pheromones, including the reference strain from California. While such examples have been suggested to represent intraspecific competition among strains, the molecular mechanisms underlying these dauer-associated patterns are currently unknown. We generated recombinant-inbred-lines between the Californian and Ohioan strains and used quantitative-trait-loci analysis to investigate the molecular mechanism determining natural variation in dauer development. Surprisingly, we discovered that the orphan gene dauerless controls dauer formation by copy number variation. The Ohioan strain has one dauerless copy causing high dauer formation, whereas the Californian strain has two copies, resulting in strongly reduced dauer formation. Transgenic animals expressing multiple copies do not form dauers. dauerless is exclusively expressed in CAN neurons, and both CAN ablation and dauerless mutations increase dauer formation. Strikingly, dauerless underwent several duplications and acts in parallel or downstream of steroid-hormone signaling but upstream of the nuclear-hormone-receptor daf-12. We identified the novel or fast-evolving gene dauerless as inhibitor of dauer development. Our findings reveal the importance of gene duplications and copy number variations for orphan gene function and suggest daf-12 as

  12. Inferring species trees from incongruent multi-copy gene trees using the Robinson-Foulds distance

    Science.gov (United States)

    2013-01-01

    Background Constructing species trees from multi-copy gene trees remains a challenging problem in phylogenetics. One difficulty is that the underlying genes can be incongruent due to evolutionary processes such as gene duplication and loss, deep coalescence, or lateral gene transfer. Gene tree estimation errors may further exacerbate the difficulties of species tree estimation. Results We present a new approach for inferring species trees from incongruent multi-copy gene trees that is based on a generalization of the Robinson-Foulds (RF) distance measure to multi-labeled trees (mul-trees). We prove that it is NP-hard to compute the RF distance between two mul-trees; however, it is easy to calculate this distance between a mul-tree and a singly-labeled species tree. Motivated by this, we formulate the RF problem for mul-trees (MulRF) as follows: Given a collection of multi-copy gene trees, find a singly-labeled species tree that minimizes the total RF distance from the input mul-trees. We develop and implement a fast SPR-based heuristic algorithm for the NP-hard MulRF problem. We compare the performance of the MulRF method (available at http://genome.cs.iastate.edu/CBL/MulRF/) with several gene tree parsimony approaches using gene tree simulations that incorporate gene tree error, gene duplications and losses, and/or lateral transfer. The MulRF method produces more accurate species trees than gene tree parsimony approaches. We also demonstrate that the MulRF method infers in minutes a credible plant species tree from a collection of nearly 2,000 gene trees. Conclusions Our new phylogenetic inference method, based on a generalized RF distance, makes it possible to quickly estimate species trees from large genomic data sets. Since the MulRF method, unlike gene tree parsimony, is based on a generic tree distance measure, it is appealing for analyses of genomic data sets, in which many processes such as deep coalescence, recombination, gene duplication and losses as

  13. Duplication and Diversification of the Hypoxia-Inducible IGFBP-1 Gene in Zebrafish

    DEFF Research Database (Denmark)

    Kamei, Hiroyasu; Lu, Ling; Jiao, Shuang

    2008-01-01

    Background: Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenabilit...

  14. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  15. North Carolina macular dystrophy (MCDR1) caused by a novel tandem duplication of the PRDM13 gene.

    Science.gov (United States)

    Bowne, Sara J; Sullivan, Lori S; Wheaton, Dianna K; Locke, Kirsten G; Jones, Kaylie D; Koboldt, Daniel C; Fulton, Robert S; Wilson, Richard K; Blanton, Susan H; Birch, David G; Daiger, Stephen P

    2016-01-01

    To identify the underlying cause of disease in a large family with North Carolina macular dystrophy (NCMD). A large four-generation family (RFS355) with an autosomal dominant form of NCMD was ascertained. Family members underwent comprehensive visual function evaluations. Blood or saliva from six affected family members and three unaffected spouses was collected and DNA tested for linkage to the MCDR1 locus on chromosome 6q12. Three affected family members and two unaffected spouses underwent whole exome sequencing (WES) and subsequently, custom capture of the linkage region followed by next-generation sequencing (NGS). Standard PCR and dideoxy sequencing were used to further characterize the mutation. Of the 12 eyes examined in six affected individuals, all but two had Gass grade 3 macular degeneration features. Large central excavation of the retinal and choroid layers, referred to as a macular caldera, was seen in an age-independent manner in the grade 3 eyes. The calderas are unique to affected individuals with MCDR1. Genome-wide linkage mapping and haplotype analysis of markers from the chromosome 6q region were consistent with linkage to the MCDR1 locus. Whole exome sequencing and custom-capture NGS failed to reveal any rare coding variants segregating with the phenotype. Analysis of the custom-capture NGS sequencing data for copy number variants uncovered a tandem duplication of approximately 60 kb on chromosome 6q. This region contains two genes, CCNC and PRDM13 . The duplication creates a partial copy of CCNC and a complete copy of PRDM13 . The duplication was found in all affected members of the family and is not present in any unaffected members. The duplication was not seen in 200 ethnically matched normal chromosomes. The cause of disease in the original family with MCDR1 and several others has been recently reported to be dysregulation of the PRDM13 gene, caused by either single base substitutions in a DNase 1 hypersensitive site upstream of the CCNC

  16. Microarray Analysis of Copy Number Variants on the Human Y Chromosome Reveals Novel and Frequent Duplications Overrepresented in Specific Haplogroups.

    Directory of Open Access Journals (Sweden)

    Martin M Johansson

    Full Text Available The human Y chromosome is almost always excluded from genome-wide investigations of copy number variants (CNVs due to its highly repetitive structure. This chromosome should not be forgotten, not only for its well-known relevance in male fertility, but also for its involvement in clinical phenotypes such as cancers, heart failure and sex specific effects on brain and behaviour.We analysed Y chromosome data from Affymetrix 6.0 SNP arrays and found that the signal intensities for most of 8179 SNP/CN probes in the male specific region (MSY discriminated between a male, background signals in a female and an isodicentric male containing a large deletion of the q-arm and a duplication of the p-arm of the Y chromosome. Therefore, this SNP/CN platform is suitable for identification of gain and loss of Y chromosome sequences. In a set of 1718 males, we found 25 different CNV patterns, many of which are novel. We confirmed some of these variants by PCR or qPCR. The total frequency of individuals with CNVs was 14.7%, including 9.5% with duplications, 4.5% with deletions and 0.7% exhibiting both. Hence, a novel observation is that the frequency of duplications was more than twice the frequency of deletions. Another striking result was that 10 of the 25 detected variants were significantly overrepresented in one or more haplogroups, demonstrating the importance to control for haplogroups in genome-wide investigations to avoid stratification. NO-M214(xM175 individuals presented the highest percentage (95% of CNVs. If they were not counted, 12.4% of the rest included CNVs, and the difference between duplications (8.9% and deletions (2.8% was even larger.Our results demonstrate that currently available genome-wide SNP platforms can be used to identify duplications and deletions in the human Y chromosome. Future association studies of the full spectrum of Y chromosome variants will demonstrate the potential involvement of gain or loss of Y chromosome sequence in

  17. Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants

    OpenAIRE

    Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong

    2010-01-01

    Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

  18. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes.

    Science.gov (United States)

    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich

    2004-03-01

    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix-loop-helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks emerging through single-gene duplications, the dominant importance of molecular modularity in the bottom-up construction of complex biological entities, and the convergent evolution of networks.

  19. Are duplicated genes responsible for anthracnose resistance in common bean?

    Science.gov (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

    2017-01-01

    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  20. Finding all sorting tandem duplication random loss operations

    DEFF Research Database (Denmark)

    Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang

    2011-01-01

    A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...

  1. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  2. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  3. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

    Science.gov (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

    2016-01-01

    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  4. Duplications of the neuropeptide receptor gene VIPR2 confer significant risk for schizophrenia.

    LENUS (Irish Health Repository)

    Vacic, Vladimir

    2011-03-24

    Rare copy number variants (CNVs) have a prominent role in the aetiology of schizophrenia and other neuropsychiatric disorders. Substantial risk for schizophrenia is conferred by large (>500-kilobase) CNVs at several loci, including microdeletions at 1q21.1 (ref. 2), 3q29 (ref. 3), 15q13.3 (ref. 2) and 22q11.2 (ref. 4) and microduplication at 16p11.2 (ref. 5). However, these CNVs collectively account for a small fraction (2-4%) of cases, and the relevant genes and neurobiological mechanisms are not well understood. Here we performed a large two-stage genome-wide scan of rare CNVs and report the significant association of copy number gains at chromosome 7q36.3 with schizophrenia. Microduplications with variable breakpoints occurred within a 362-kilobase region and were detected in 29 of 8,290 (0.35%) patients versus 2 of 7,431 (0.03%) controls in the combined sample. All duplications overlapped or were located within 89 kilobases upstream of the vasoactive intestinal peptide receptor gene VIPR2. VIPR2 transcription and cyclic-AMP signalling were significantly increased in cultured lymphocytes from patients with microduplications of 7q36.3. These findings implicate altered vasoactive intestinal peptide signalling in the pathogenesis of schizophrenia and indicate the VPAC2 receptor as a potential target for the development of new antipsychotic drugs.

  5. Recurrent Gene Duplication Leads to Diverse Repertoires of Centromeric Histones in Drosophila Species.

    Science.gov (United States)

    Kursel, Lisa E; Malik, Harmit S

    2017-06-01

    Despite their essential role in the process of chromosome segregation in most eukaryotes, centromeric histones show remarkable evolutionary lability. Not only have they been lost in multiple insect lineages, but they have also undergone gene duplication in multiple plant lineages. Based on detailed study of a handful of model organisms including Drosophila melanogaster, centromeric histone duplication is considered to be rare in animals. Using a detailed phylogenomic study, we find that Cid, the centromeric histone gene, has undergone at least four independent gene duplications during Drosophila evolution. We find duplicate Cid genes in D. eugracilis (Cid2), in the montium species subgroup (Cid3, Cid4) and in the entire Drosophila subgenus (Cid5). We show that Cid3, Cid4, and Cid5 all localize to centromeres in their respective species. Some Cid duplicates are primarily expressed in the male germline. With rare exceptions, Cid duplicates have been strictly retained after birth, suggesting that they perform nonredundant centromeric functions, independent from the ancestral Cid. Indeed, each duplicate encodes a distinct N-terminal tail, which may provide the basis for distinct protein-protein interactions. Finally, we show some Cid duplicates evolve under positive selection whereas others do not. Taken together, our results support the hypothesis that Drosophila Cid duplicates have subfunctionalized. Thus, these gene duplications provide an unprecedented opportunity to dissect the multiple roles of centromeric histones. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  6. Comparative inference of duplicated genes produced by polyploidization in soybean genome.

    Science.gov (United States)

    Yang, Yanmei; Wang, Jinpeng; Di, Jianyong

    2013-01-01

    Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.

  7. Copy number of the Adenomatous Polyposis Coli gene is not always neutral in sporadic colorectal cancers with loss of heterozygosity for the gene

    International Nuclear Information System (INIS)

    Zauber, Peter; Marotta, Stephen; Sabbath-Solitare, Marlene

    2016-01-01

    Changes in the number of alleles of a chromosome may have an impact upon gene expression. Loss of heterozygosity (LOH) indicates that one allele of a gene has been lost, and knowing the exact copy number of the gene would indicate whether duplication of the remaining allele has occurred. We were interested to determine the copy number of the Adenomatous Polyposis Coli (APC) gene in sporadic colorectal cancers with LOH. We selected 38 carcinomas with LOH for the APC gene region of chromosome 5, as determined by amplification of the CA repeat region within the D5S346 loci. The copy number status of APC was ascertained using the SALSA® MLPA® P043-B1 APC Kit. LOH for the DCC gene, KRAS gene mutation, and microsatellite instability were also evaluated for each tumor, utilizing standard polymerase chain reaction methods. No tumor demonstrated microsatellite instability. LOH of the DCC gene was also present in 33 of 36 (91.7 %) informative tumors. A KRAS gene mutation was present in 16 of the 38 (42.1 %) tumors. Twenty-four (63.2 %) of the tumors were copy number neutral, 10 (26.3 %) tumors demonstrated major loss, while two (5.3 %) showed partial loss. Two tumors (5.3 %) had copy number gain. Results of APC and DCC LOH, KRAS and microsatellite instability indicate our colorectal cancer cases were typical of sporadic cancers following the ‘chromosomal instability’ pathway. The majority of our colorectal carcinomas with LOH for APC gene are copy number neutral. However, one-third of our cases showed copy number loss, suggesting that duplication of the remaining allele is not required for the development of a colorectal carcinoma

  8. Copy number of the Adenomatous Polyposis Coli gene is not always neutral in sporadic colorectal cancers with loss of heterozygosity for the gene.

    Science.gov (United States)

    Zauber, Peter; Marotta, Stephen; Sabbath-Solitare, Marlene

    2016-03-12

    Changes in the number of alleles of a chromosome may have an impact upon gene expression. Loss of heterozygosity (LOH) indicates that one allele of a gene has been lost, and knowing the exact copy number of the gene would indicate whether duplication of the remaining allele has occurred. We were interested to determine the copy number of the Adenomatous Polyposis Coli (APC) gene in sporadic colorectal cancers with LOH. We selected 38 carcinomas with LOH for the APC gene region of chromosome 5, as determined by amplification of the CA repeat region within the D5S346 loci. The copy number status of APC was ascertained using the SALSA® MLPA® P043-B1 APC Kit. LOH for the DCC gene, KRAS gene mutation, and microsatellite instability were also evaluated for each tumor, utilizing standard polymerase chain reaction methods. No tumor demonstrated microsatellite instability. LOH of the DCC gene was also present in 33 of 36 (91.7%) informative tumors. A KRAS gene mutation was present in 16 of the 38 (42.1%) tumors. Twenty-four (63.2%) of the tumors were copy number neutral, 10 (26.3%) tumors demonstrated major loss, while two (5.3%) showed partial loss. Two tumors (5.3%) had copy number gain. Results of APC and DCC LOH, KRAS and microsatellite instability indicate our colorectal cancer cases were typical of sporadic cancers following the 'chromosomal instability' pathway. The majority of our colorectal carcinomas with LOH for APC gene are copy number neutral. However, one-third of our cases showed copy number loss, suggesting that duplication of the remaining allele is not required for the development of a colorectal carcinoma.

  9. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  10. Evolution of vertebrate central nervous system is accompanied by novel expression changes of duplicate genes.

    Science.gov (United States)

    Chen, Yuan; Ding, Yun; Zhang, Zuming; Wang, Wen; Chen, Jun-Yuan; Ueno, Naoto; Mao, Bingyu

    2011-12-20

    The evolution of the central nervous system (CNS) is one of the most striking changes during the transition from invertebrates to vertebrates. As a major source of genetic novelties, gene duplication might play an important role in the functional innovation of vertebrate CNS. In this study, we focused on a group of CNS-biased genes that duplicated during early vertebrate evolution. We investigated the tempo-spatial expression patterns of 33 duplicate gene families and their orthologs during the embryonic development of the vertebrate Xenopus laevis and the cephalochordate Brachiostoma belcheri. Almost all the identified duplicate genes are differentially expressed in the CNS in Xenopus embryos, and more than 50% and 30% duplicate genes are expressed in the telencephalon and mid-hindbrain boundary, respectively, which are mostly considered as two innovations in the vertebrate CNS. Interestingly, more than 50% of the amphioxus orthologs do not show apparent expression in the CNS in amphioxus embryos as detected by in situ hybridization, indicating that some of the vertebrate CNS-biased duplicate genes might arise from non-CNS genes in invertebrates. Our data accentuate the functional contribution of gene duplication in the CNS evolution of vertebrate and uncover an invertebrate non-CNS history for some vertebrate CNS-biased duplicate genes. Copyright © 2011. Published by Elsevier Ltd.

  11. Primers for Low-Copy Nuclear Genes in the Hawaiian Endemic Clermontia (Campanulaceae and Cross-Amplification in Lobelioideae

    Directory of Open Access Journals (Sweden)

    Yohan Pillon

    2013-06-01

    Full Text Available Premise of the study: Primers were developed to amplify 12 intron-less, low-copy nuclear genes in the Hawaiian genus Clermontia (Campanulaceae, a suspected tetraploid. Methods and Results: Data from a pooled 454 titanium run of the partial transcriptomes of seven Clermontia species were used to identify the loci of interest. Most loci were amplified and sequenced directly with success in a representative selection of lobeliads even though several of these loci turned out to be duplicated. Levels of variation were comparable to those observed in commonly used plastid and ribosomal markers. Conclusions: We found evidence of a genome duplication that likely predates the diversification of the Hawaiian lobeliads. Some genes nevertheless appear to be single-copy and should be useful for phylogenetic studies of Clermontia or the entire Lobelioideae subfamily.

  12. Selective Constraints on Coding Sequences of Nervous System Genes Are a Major Determinant of Duplicate Gene Retention in Vertebrates.

    Science.gov (United States)

    Roux, Julien; Liu, Jialin; Robinson-Rechavi, Marc

    2017-11-01

    The evolutionary history of vertebrates is marked by three ancient whole-genome duplications: two successive rounds in the ancestor of vertebrates, and a third one specific to teleost fishes. Biased loss of most duplicates enriched the genome for specific genes, such as slow evolving genes, but this selective retention process is not well understood. To understand what drives the long-term preservation of duplicate genes, we characterized duplicated genes in terms of their expression patterns. We used a new method of expression enrichment analysis, TopAnat, applied to in situ hybridization data from thousands of genes from zebrafish and mouse. We showed that the presence of expression in the nervous system is a good predictor of a higher rate of retention of duplicate genes after whole-genome duplication. Further analyses suggest that purifying selection against the toxic effects of misfolded or misinteracting proteins, which is particularly strong in nonrenewing neural tissues, likely constrains the evolution of coding sequences of nervous system genes, leading indirectly to the preservation of duplicate genes after whole-genome duplication. Whole-genome duplications thus greatly contributed to the expansion of the toolkit of genes available for the evolution of profound novelties of the nervous system at the base of the vertebrate radiation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  13. Duplication of the dystroglycan gene in most branches of teleost fish

    Directory of Open Access Journals (Sweden)

    Giardina Bruno

    2007-05-01

    Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details

  14. Gene duplication and divergence affecting drug content in Cannabis sativa.

    Science.gov (United States)

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David

    2015-12-01

    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  15. Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias.

    Science.gov (United States)

    Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J

    2016-11-04

    Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types

  16. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes

    OpenAIRE

    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich

    2004-01-01

    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix–loop–helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks e...

  17. Prevalent Role of Gene Features in Determining Evolutionary Fates of Whole-Genome Duplication Duplicated Genes in Flowering Plants1[W][OA

    Science.gov (United States)

    Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi

    2013-01-01

    The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833

  18. A new resource for characterizing X-linked genes in Drosophila melanogaster: systematic coverage and subdivision of the X chromosome with nested, Y-linked duplications.

    Science.gov (United States)

    Cook, R Kimberley; Deal, Megan E; Deal, Jennifer A; Garton, Russell D; Brown, C Adam; Ward, Megan E; Andrade, Rachel S; Spana, Eric P; Kaufman, Thomas C; Cook, Kevin R

    2010-12-01

    Interchromosomal duplications are especially important for the study of X-linked genes. Males inheriting a mutation in a vital X-linked gene cannot survive unless there is a wild-type copy of the gene duplicated elsewhere in the genome. Rescuing the lethality of an X-linked mutation with a duplication allows the mutation to be used experimentally in complementation tests and other genetic crosses and it maps the mutated gene to a defined chromosomal region. Duplications can also be used to screen for dosage-dependent enhancers and suppressors of mutant phenotypes as a way to identify genes involved in the same biological process. We describe an ongoing project in Drosophila melanogaster to generate comprehensive coverage and extensive breakpoint subdivision of the X chromosome with megabase-scale X segments borne on Y chromosomes. The in vivo method involves the creation of X inversions on attached-XY chromosomes by FLP-FRT site-specific recombination technology followed by irradiation to induce large internal X deletions. The resulting chromosomes consist of the X tip, a medial X segment placed near the tip by an inversion, and a full Y. A nested set of medial duplicated segments is derived from each inversion precursor. We have constructed a set of inversions on attached-XY chromosomes that enable us to isolate nested duplicated segments from all X regions. To date, our screens have provided a minimum of 78% X coverage with duplication breakpoints spaced a median of nine genes apart. These duplication chromosomes will be valuable resources for rescuing and mapping X-linked mutations and identifying dosage-dependent modifiers of mutant phenotypes.

  19. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis.

    Science.gov (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L

    2015-12-01

    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  20. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong

    2009-11-01

    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  1. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. The natural history of class I primate alcohol dehydrogenases includes gene duplication, gene loss, and gene conversion.

    Directory of Open Access Journals (Sweden)

    Matthew A Carrigan

    Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates

  3. Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

    Directory of Open Access Journals (Sweden)

    Gadagkar Sudhindra R

    2010-04-01

    Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions

  4. Rapid genome reshaping by multiple-gene loss after whole-genome duplication in teleost fish suggested by mathematical modeling

    Science.gov (United States)

    Sato, Yukuto; Tsukamoto, Katsumi; Nishida, Mutsumi

    2015-01-01

    Whole-genome duplication (WGD) is believed to be a significant source of major evolutionary innovation. Redundant genes resulting from WGD are thought to be lost or acquire new functions. However, the rates of gene loss and thus temporal process of genome reshaping after WGD remain unclear. The WGD shared by all teleost fish, one-half of all jawed vertebrates, was more recent than the two ancient WGDs that occurred before the origin of jawed vertebrates, and thus lends itself to analysis of gene loss and genome reshaping. Using a newly developed orthology identification pipeline, we inferred the post–teleost-specific WGD evolutionary histories of 6,892 protein-coding genes from nine phylogenetically representative teleost genomes on a time-calibrated tree. We found that rapid gene loss did occur in the first 60 My, with a loss of more than 70–80% of duplicated genes, and produced similar genomic gene arrangements within teleosts in that relatively short time. Mathematical modeling suggests that rapid gene loss occurred mainly by events involving simultaneous loss of multiple genes. We found that the subsequent 250 My were characterized by slow and steady loss of individual genes. Our pipeline also identified about 1,100 shared single-copy genes that are inferred to have become singletons before the divergence of clupeocephalan teleosts. Therefore, our comparative genome analysis suggests that rapid gene loss just after the WGD reshaped teleost genomes before the major divergence, and provides a useful set of marker genes for future phylogenetic analysis. PMID:26578810

  5. Diversity and population-genetic properties of copy number variations and multicopy genes in cattle

    Science.gov (United States)

    Bickhart, Derek M.; Xu, Lingyang; Hutchison, Jana L.; Cole, John B.; Null, Daniel J.; Schroeder, Steven G.; Song, Jiuzhou; Garcia, Jose Fernando; Sonstegard, Tad S.; Van Tassell, Curtis P.; Schnabel, Robert D.; Taylor, Jeremy F.; Lewin, Harris A.; Liu, George E.

    2016-01-01

    The diversity and population genetics of copy number variation (CNV) in domesticated animals are not well understood. In this study, we analysed 75 genomes of major taurine and indicine cattle breeds (including Angus, Brahman, Gir, Holstein, Jersey, Limousin, Nelore, and Romagnola), sequenced to 11-fold coverage to identify 1,853 non-redundant CNV regions. Supported by high validation rates in array comparative genomic hybridization (CGH) and qPCR experiments, these CNV regions accounted for 3.1% (87.5 Mb) of the cattle reference genome, representing a significant increase over previous estimates of the area of the genome that is copy number variable (∼2%). Further population genetics and evolutionary genomics analyses based on these CNVs revealed the population structures of the cattle taurine and indicine breeds and uncovered potential diversely selected CNVs near important functional genes, including AOX1, ASZ1, GAT, GLYAT, and KRTAP9-1. Additionally, 121 CNV gene regions were found to be either breed specific or differentially variable across breeds, such as RICTOR in dairy breeds and PNPLA3 in beef breeds. In contrast, clusters of the PRP and PAG genes were found to be duplicated in all sequenced animals, suggesting that subfunctionalization, neofunctionalization, or overdominance play roles in diversifying those fertility-related genes. These CNV results provide a new glimpse into the diverse selection histories of cattle breeds and a basis for correlating structural variation with complex traits in the future. PMID:27085184

  6. A case report of two male siblings with autism and duplication of Xq13-q21, a region including three genes predisposing for autism.

    Science.gov (United States)

    Wentz, Elisabet; Vujic, Mihailo; Kärrstedt, Ewa-Lotta; Erlandsson, Anna; Gillberg, Christopher

    2014-05-01

    Autism spectrum disorder, severe behaviour problems and duplication of the Xq12 to Xq13 region have recently been described in three male relatives. To describe the psychiatric comorbidity and dysmorphic features, including craniosynostosis, of two male siblings with autism and duplication of the Xq13 to Xq21 region, and attempt to narrow down the number of duplicated genes proposed to be leading to global developmental delay and autism. We performed DNA sequencing of certain exons of the TWIST1 gene, the FGFR2 gene and the FGFR3 gene. We also performed microarray analysis of the DNA. In addition to autism, the two male siblings exhibited severe learning disability, self-injurious behaviour, temper tantrums and hyperactivity, and had no communicative language. Chromosomal analyses were normal. Neither of the two siblings showed mutations of the sequenced exons known to produce craniosynostosis. The microarray analysis detected an extra copy of a region on the long arm of chromosome X, chromosome band Xq13.1-q21.1. Comparison of our two cases with previously described patients allowed us to identify three genes predisposing for autism in the duplicated chromosomal region. Sagittal craniosynostosis is also a new finding linked to the duplication.

  7. Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia.

    Science.gov (United States)

    Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C

    2010-02-01

    The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.

  8. Processes of fungal proteome evolution and gain of function: gene duplication and domain rearrangement

    International Nuclear Information System (INIS)

    Cohen-Gihon, Inbar; Nussinov, Ruth; Sharan, Roded

    2011-01-01

    During evolution, organisms have gained functional complexity mainly by modifying and improving existing functioning systems rather than creating new ones ab initio. Here we explore the interplay between two processes which during evolution have had major roles in the acquisition of new functions: gene duplication and protein domain rearrangements. We consider four possible evolutionary scenarios: gene families that have undergone none of these event types; only gene duplication; only domain rearrangement, or both events. We characterize each of the four evolutionary scenarios by functional attributes. Our analysis of ten fungal genomes indicates that at least for the fungi clade, species significantly appear to gain complexity by gene duplication accompanied by the expansion of existing domain architectures via rearrangements. We show that paralogs gaining new domain architectures via duplication tend to adopt new functions compared to paralogs that preserve their domain architectures. We conclude that evolution of protein families through gene duplication and domain rearrangement is correlated with their functional properties. We suggest that in general, new functions are acquired via the integration of gene duplication and domain rearrangements rather than each process acting independently

  9. 8q24 allelic imbalance and MYC gene copy number in primary prostate cancer.

    Science.gov (United States)

    Chen, H; Liu, W; Roberts, W; Hooker, S; Fedor, H; DeMarzo, A; Isaacs, W; Kittles, R A

    2010-09-01

    Four independent regions within 8q24 near the MYC gene are associated with risk for prostate cancer (Pca). Here, we investigated allelic imbalance (AI) at 8q24 risk variants and MYC gene DNA copy number (CN) in 27 primary Pcas. Heterozygotes were observed in 24 of 27 patients at one or more 8q24 markers and 27% of the loci exhibited AI in tumor DNA. The 8q24 risk alleles were preferentially favored in the tumors. Increased MYC gene CN was observed in 33% of tumors, and the co-existence of increased MYC gene CN with AI at risk loci was observed in 86% (P<0.004 exact binomial test) of the informative tumors. No AI was observed in tumors, which did not reveal increased MYC gene CN. Higher Gleason score was associated with tumors exhibiting AI (P=0.04) and also with increased MYC gene CN (P=0.02). Our results suggest that AI at 8q24 and increased MYC gene CN may both be related to high Gleason score in Pca. Our findings also suggest that these two somatic alterations may be due to the same preferential chromosomal duplication event during prostate tumorigenesis.

  10. An ancient duplication of exon 5 in the Snap25 gene is required for complex neuronal development/function.

    Directory of Open Access Journals (Sweden)

    Jenny U Johansson

    2008-11-01

    Full Text Available Alternative splicing is an evolutionary innovation to create functionally diverse proteins from a limited number of genes. SNAP-25 plays a central role in neuroexocytosis by bridging synaptic vesicles to the plasma membrane during regulated exocytosis. The SNAP-25 polypeptide is encoded by a single copy gene, but in higher vertebrates a duplication of exon 5 has resulted in two mutually exclusive splice variants, SNAP-25a and SNAP-25b. To address a potential physiological difference between the two SNAP-25 proteins, we generated gene targeted SNAP-25b deficient mouse mutants by replacing the SNAP-25b specific exon with a second SNAP-25a equivalent. Elimination of SNAP-25b expression resulted in developmental defects, spontaneous seizures, and impaired short-term synaptic plasticity. In adult mutants, morphological changes in hippocampus and drastically altered neuropeptide expression were accompanied by severe impairment of spatial learning. We conclude that the ancient exon duplication in the Snap25 gene provides additional SNAP-25-function required for complex neuronal processes in higher eukaryotes.

  11. Gene copy number variation throughout the Plasmodium falciparum genome

    Directory of Open Access Journals (Sweden)

    Stewart Lindsay B

    2009-08-01

    Full Text Available Abstract Background Gene copy number variation (CNV is responsible for several important phenotypes of the malaria parasite Plasmodium falciparum, including drug resistance, loss of infected erythrocyte cytoadherence and alteration of receptor usage for erythrocyte invasion. Despite the known effects of CNV, little is known about its extent throughout the genome. Results We performed a whole-genome survey of CNV genes in P. falciparum using comparative genome hybridisation of a diverse set of 16 laboratory culture-adapted isolates to a custom designed high density Affymetrix GeneChip array. Overall, 186 genes showed hybridisation signals consistent with deletion or amplification in one or more isolate. There is a strong association of CNV with gene length, genomic location, and low orthology to genes in other Plasmodium species. Sub-telomeric regions of all chromosomes are strongly associated with CNV genes independent from members of previously described multigene families. However, ~40% of CNV genes were located in more central regions of the chromosomes. Among the previously undescribed CNV genes, several that are of potential phenotypic relevance are identified. Conclusion CNV represents a major form of genetic variation within the P. falciparum genome; the distribution of gene features indicates the involvement of highly non-random mutational and selective processes. Additional studies should be directed at examining CNV in natural parasite populations to extend conclusions to clinical settings.

  12. Differential transcriptional modulation of duplicated fatty acid-binding protein genes by dietary fatty acids in zebrafish (Danio rerio: evidence for subfunctionalization or neofunctionalization of duplicated genes

    Directory of Open Access Journals (Sweden)

    Denovan-Wright Eileen M

    2009-09-01

    Full Text Available Abstract Background In the Duplication-Degeneration-Complementation (DDC model, subfunctionalization and neofunctionalization have been proposed as important processes driving the retention of duplicated genes in the genome. These processes are thought to occur by gain or loss of regulatory elements in the promoters of duplicated genes. We tested the DDC model by determining the transcriptional induction of fatty acid-binding proteins (Fabps genes by dietary fatty acids (FAs in zebrafish. We chose zebrafish for this study for two reasons: extensive bioinformatics resources are available for zebrafish at zfin.org and zebrafish contains many duplicated genes owing to a whole genome duplication event that occurred early in the ray-finned fish lineage approximately 230-400 million years ago. Adult zebrafish were fed diets containing either fish oil (12% lipid, rich in highly unsaturated fatty acid, sunflower oil (12% lipid, rich in linoleic acid, linseed oil (12% lipid, rich in linolenic acid, or low fat (4% lipid, low fat diet for 10 weeks. FA profiles and the steady-state levels of fabp mRNA and heterogeneous nuclear RNA in intestine, liver, muscle and brain of zebrafish were determined. Result FA profiles assayed by gas chromatography differed in the intestine, brain, muscle and liver depending on diet. The steady-state level of mRNA for three sets of duplicated genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, and fabp11a/fabp11b, was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. In brain, the steady-state level of fabp7b mRNAs was induced in fish fed the linoleic acid-rich diet; in intestine, the transcript level of fabp1b.1 and fabp7b were elevated in fish fed the linolenic acid-rich diet; in liver, the level of fabp7a mRNAs was elevated in fish fed the low fat diet; and in muscle, the level of fabp7a and fabp11a mRNAs were elevated in fish fed the linolenic acid-rich or the low fat diets. In all cases

  13. Phylogenomic approaches to common problems encountered in the analysis of low copy repeats: The sulfotransferase 1A gene family example

    Directory of Open Access Journals (Sweden)

    Benner Steven A

    2005-03-01

    Full Text Available Abstract Background Blocks of duplicated genomic DNA sequence longer than 1000 base pairs are known as low copy repeats (LCRs. Identified by their sequence similarity, LCRs are abundant in the human genome, and are interesting because they may represent recent adaptive events, or potential future adaptive opportunities within the human lineage. Sequence analysis tools are needed, however, to decide whether these interpretations are likely, whether a particular set of LCRs represents nearly neutral drift creating junk DNA, or whether the appearance of LCRs reflects assembly error. Here we investigate an LCR family containing the sulfotransferase (SULT 1A genes involved in drug metabolism, cancer, hormone regulation, and neurotransmitter biology as a first step for defining the problems that those tools must manage. Results Sequence analysis here identified a fourth sulfotransferase gene, which may be transcriptionally active, located on human chromosome 16. Four regions of genomic sequence containing the four human SULT1A paralogs defined a new LCR family. The stem hominoid SULT1A progenitor locus was identified by comparative genomics involving complete human and rodent genomes, and a draft chimpanzee genome. SULT1A expansion in hominoid genomes was followed by positive selection acting on specific protein sites. This episode of adaptive evolution appears to be responsible for the dopamine sulfonation function of some SULT enzymes. Each of the conclusions that this bioinformatic analysis generated using data that has uncertain reliability (such as that from the chimpanzee genome sequencing project has been confirmed experimentally or by a "finished" chromosome 16 assembly, both of which were published after the submission of this manuscript. Conclusion SULT1A genes expanded from one to four copies in hominoids during intra-chromosomal LCR duplications, including (apparently one after the divergence of chimpanzees and humans. Thus, LCRs may

  14. Selection shaped the evolution of mouse androgen-binding protein (ABP) function and promoted the duplication of Abp genes.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2014-08-01

    In the present article, we summarize two aspects of our work on mouse ABP (androgen-binding protein): (i) the sexual selection function producing incipient reinforcement on the European house mouse hybrid zone, and (ii) the mechanism behind the dramatic expansion of the Abp gene region in the mouse genome. Selection unifies these two components, although the ways in which selection has acted differ. At the functional level, strong positive selection has acted on key sites on the surface of one face of the ABP dimer, possibly to influence binding to a receptor. A different kind of selection has apparently driven the recent and rapid expansion of the gene region, probably by increasing the amount of Abp transcript, in one or both of two ways. We have shown previously that groups of Abp genes behave as LCRs (low-copy repeats), duplicating as relatively large blocks of genes by NAHR (non-allelic homologous recombination). The second type of selection involves the close link between the accumulation of L1 elements and the expansion of the Abp gene family by NAHR. It is probably predicated on an initial selection for increased transcription of existing Abp genes and/or an increase in Abp gene number providing more transcriptional sites. Either or both could increase initial transcript production, a quantitative change similar to increasing the volume of a radio transmission. In closing, we also provide a note on Abp gene nomenclature.

  15. Rapid sequence divergence rates in the 5 prime regulatory regions of young Drosophila melanogaster duplicate gene pairs

    Directory of Open Access Journals (Sweden)

    Michael H. Kohn

    2008-01-01

    Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.

  16. Whole-gene positive selection, elevated synonymous substitution rates, duplication, and indel evolution of the chloroplast clpP1 gene.

    Directory of Open Access Journals (Sweden)

    Per Erixon

    Full Text Available BACKGROUND: Synonymous DNA substitution rates in the plant chloroplast genome are generally relatively slow and lineage dependent. Non-synonymous rates are usually even slower due to purifying selection acting on the genes. Positive selection is expected to speed up non-synonymous substitution rates, whereas synonymous rates are expected to be unaffected. Until recently, positive selection has seldom been observed in chloroplast genes, and large-scale structural rearrangements leading to gene duplications are hitherto supposed to be rare. METHODOLOGY/PRINCIPLE FINDINGS: We found high substitution rates in the exons of the plastid clpP1 gene in Oenothera (the Evening Primrose family and three separate lineages in the tribe Sileneae (Caryophyllaceae, the Carnation family. Introns have been lost in some of the lineages, but where present, the intron sequences have substitution rates similar to those found in other introns of their genomes. The elevated substitution rates of clpP1 are associated with statistically significant whole-gene positive selection in three branches of the phylogeny. In two of the lineages we found multiple copies of the gene. Neighboring genes present in the duplicated fragments do not show signs of elevated substitution rates or positive selection. Although non-synonymous substitutions account for most of the increase in substitution rates, synonymous rates are also markedly elevated in some lineages. Whereas plant clpP1 genes experiencing negative (purifying selection are characterized by having very conserved lengths, genes under positive selection often have large insertions of more or less repetitive amino acid sequence motifs. CONCLUSIONS/SIGNIFICANCE: We found positive selection of the clpP1 gene in various plant lineages to correlated with repeated duplication of the clpP1 gene and surrounding regions, repetitive amino acid sequences, and increase in synonymous substitution rates. The present study sheds light on the

  17. On the Complexity of Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

    Science.gov (United States)

    Kordi, Misagh; Bansal, Mukul S

    2017-01-01

    Duplication-Transfer-Loss (DTL) reconciliation has emerged as a powerful technique for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation takes as input a gene family phylogeny and the corresponding species phylogeny, and reconciles the two by postulating speciation, gene duplication, horizontal gene transfer, and gene loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. However, gene trees are frequently non-binary. With such non-binary gene trees, the reconciliation problem seeks to find a binary resolution of the gene tree that minimizes the reconciliation cost. Given the prevalence of non-binary gene trees, many efficient algorithms have been developed for this problem in the context of the simpler Duplication-Loss (DL) reconciliation model. Yet, no efficient algorithms exist for DTL reconciliation with non-binary gene trees and the complexity of the problem remains unknown. In this work, we resolve this open question by showing that the problem is, in fact, NP-hard. Our reduction applies to both the dated and undated formulations of DTL reconciliation. By resolving this long-standing open problem, this work will spur the development of both exact and heuristic algorithms for this important problem.

  18. Duplication and diversification of the hypoxia-inducible IGFBP-1 gene in zebrafish.

    Directory of Open Access Journals (Sweden)

    Hiroyasu Kamei

    2008-08-01

    Full Text Available Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenability to genetic and experimental manipulation and because it possess a large number of duplicated genes.We report the identification and characterization of two hypoxia-inducible genes in zebrafish that are co-ortholgs of human IGF binding protein-1 (IGFBP-1. IGFBP-1 is a secreted protein that binds to IGF and modulates IGF actions in somatic growth, development, and aging. Like their human and mouse counterparts, in adult zebrafish igfbp-1a and igfbp-1b are exclusively expressed in the liver. During embryogenesis, the two genes are expressed in overlapping spatial domains but with distinct temporal patterns. While zebrafish IGFBP-1a mRNA was easily detected throughout embryogenesis, IGFBP-1b mRNA was detectable only in advanced stages. Hypoxia induces igfbp-1a expression in early embryogenesis, but induces the igfbp-1b expression later in embryogenesis. Both IGFBP-1a and -b are capable of IGF binding, but IGFBP-1b has much lower affinities for IGF-I and -II because of greater dissociation rates. Overexpression of IGFBP-1a and -1b in zebrafish embryos caused significant decreases in growth and developmental rates. When tested in cultured zebrafish embryonic cells, IGFBP-1a and -1b both inhibited IGF-1-induced cell proliferation but the activity of IGFBP-1b was significantly weaker.These results indicate subfunction partitioning of the duplicated IGFBP-1 genes at the levels of gene expression, physiological regulation, protein structure, and biological actions. The duplicated IGFBP-1 may provide additional flexibility in fine-tuning IGF signaling activities under hypoxia and other catabolic conditions.

  19. Gene Duplication and Gene Expression Changes Play a Role in the Evolution of Candidate Pollen Feeding Genes in Heliconius Butterflies.

    Science.gov (United States)

    Smith, Gilbert; Macias-Muñoz, Aide; Briscoe, Adriana D

    2016-09-02

    Heliconius possess a unique ability among butterflies to feed on pollen. Pollen feeding significantly extends their lifespan, and is thought to have been important to the diversification of the genus. We used RNA sequencing to examine feeding-related gene expression in the mouthparts of four species of Heliconius and one nonpollen feeding species, Eueides isabella We hypothesized that genes involved in morphology and protein metabolism might be upregulated in Heliconius because they have longer proboscides than Eueides, and because pollen contains more protein than nectar. Using de novo transcriptome assemblies, we tested these hypotheses by comparing gene expression in mouthparts against antennae and legs. We first looked for genes upregulated in mouthparts across all five species and discovered several hundred genes, many of which had functional annotations involving metabolism of proteins (cocoonase), lipids, and carbohydrates. We then looked specifically within Heliconius where we found eleven common upregulated genes with roles in morphology (CPR cuticle proteins), behavior (takeout-like), and metabolism (luciferase-like). Closer examination of these candidates revealed that cocoonase underwent several duplications along the lineage leading to heliconiine butterflies, including two Heliconius-specific duplications. Luciferase-like genes also underwent duplication within lepidopterans, and upregulation in Heliconius mouthparts. Reverse-transcription PCR confirmed that three cocoonases, a peptidase, and one luciferase-like gene are expressed in the proboscis with little to no expression in labial palps and salivary glands. Our results suggest pollen feeding, like other dietary specializations, was likely facilitated by adaptive expansions of preexisting genes-and that the butterfly proboscis is involved in digestive enzyme production. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  20. Age distribution of human gene families shows significant roles of both large- and small-scale duplications in vertebrate evolution.

    Science.gov (United States)

    Gu, Xun; Wang, Yufeng; Gu, Jianying

    2002-06-01

    The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.

  1. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G

    2014-01-01

    Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  2. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Directory of Open Access Journals (Sweden)

    Jill C Preston

    Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  3. Zebrafish IGF genes: gene duplication, conservation and divergence, and novel roles in midline and notochord development.

    Directory of Open Access Journals (Sweden)

    Shuming Zou

    Full Text Available Insulin-like growth factors (IGFs are key regulators of development, growth, and longevity. In most vertebrate species including humans, there is one IGF-1 gene and one IGF-2 gene. Here we report the identification and functional characterization of 4 distinct IGF genes (termed as igf-1a, -1b, -2a, and -2b in zebrafish. These genes encode 4 structurally distinct and functional IGF peptides. IGF-1a and IGF-2a mRNAs were detected in multiple tissues in adult fish. IGF-1b mRNA was detected only in the gonad and IGF-2b mRNA only in the liver. Functional analysis showed that all 4 IGFs caused similar developmental defects but with different potencies. Many of these embryos had fully or partially duplicated notochords, suggesting that an excess of IGF signaling causes defects in the midline formation and an expansion of the notochord. IGF-2a, the most potent IGF, was analyzed in depth. IGF-2a expression caused defects in the midline formation and expansion of the notochord but it did not alter the anterior neural patterning. These results not only provide new insights into the functional conservation and divergence of the multiple igf genes but also reveal a novel role of IGF signaling in midline formation and notochord development in a vertebrate model.

  4. Early vertebrate chromosome duplications and the evolution of the neuropeptide Y receptor gene regions

    Directory of Open Access Journals (Sweden)

    Brenner Sydney

    2008-06-01

    Full Text Available Abstract Background One of the many gene families that expanded in early vertebrate evolution is the neuropeptide (NPY receptor family of G-protein coupled receptors. Earlier work by our lab suggested that several of the NPY receptor genes found in extant vertebrates resulted from two genome duplications before the origin of jawed vertebrates (gnathostomes and one additional genome duplication in the actinopterygian lineage, based on their location on chromosomes sharing several gene families. In this study we have investigated, in five vertebrate genomes, 45 gene families with members close to the NPY receptor genes in the compact genomes of the teleost fishes Tetraodon nigroviridis and Takifugu rubripes. These correspond to Homo sapiens chromosomes 4, 5, 8 and 10. Results Chromosome regions with conserved synteny were identified and confirmed by phylogenetic analyses in H. sapiens, M. musculus, D. rerio, T. rubripes and T. nigroviridis. 26 gene families, including the NPY receptor genes, (plus 3 described recently by other labs showed a tree topology consistent with duplications in early vertebrate evolution and in the actinopterygian lineage, thereby supporting expansion through block duplications. Eight gene families had complications that precluded analysis (such as short sequence length or variable number of repeated domains and another eight families did not support block duplications (because the paralogs in these families seem to have originated in another time window than the proposed genome duplication events. RT-PCR carried out with several tissues in T. rubripes revealed that all five NPY receptors were expressed in the brain and subtypes Y2, Y4 and Y8 were also expressed in peripheral organs. Conclusion We conclude that the phylogenetic analyses and chromosomal locations of these gene families support duplications of large blocks of genes or even entire chromosomes. Thus, these results are consistent with two early vertebrate

  5. Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals.

    Science.gov (United States)

    Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C

    2008-02-12

    The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.

  6. Copy number variation in the region harboring SOX9 gene in dogs with testicular/ovotesticular disorder of sex development (78,XX; SRY-negative).

    Science.gov (United States)

    Marcinkowska-Swojak, Malgorzata; Szczerbal, Izabela; Pausch, Hubert; Nowacka-Woszuk, Joanna; Flisikowski, Krzysztof; Dzimira, Stanislaw; Nizanski, Wojciech; Payan-Carreira, Rita; Fries, Ruedi; Kozlowski, Piotr; Switonski, Marek

    2015-10-01

    Although the disorder of sex development in dogs with female karyotype (XX DSD) is quite common, its molecular basis is still unclear. Among mutations underlying XX DSD in mammals are duplication of a long sequence upstream of the SOX9 gene (RevSex) and duplication of the SOX9 gene (also observed in dogs). We performed a comparative analysis of 16 XX DSD and 30 control female dogs, using FISH and MLPA approaches. Our study was focused on a region harboring SOX9 and a region orthologous to the human RevSex (CanRevSex), which was located by in silico analysis downstream of SOX9. Two highly polymorphic copy number variable regions (CNVRs): CNVR1 upstream of SOX9 and CNVR2 encompassing CanRevSex were identified. Although none of the detected copy number variants were specific to either affected or control animals, we observed that the average number of copies in CNVR1 was higher in XX DSD. No copy variation of SOX9 was observed. Our extensive studies have excluded duplication of SOX9 as the common cause of XX DSD in analyzed samples. However, it remains possible that the causative mutation is hidden in highly polymorphic CNVR1.

  7. Sorting by Cuts, Joins, and Whole Chromosome Duplications.

    Science.gov (United States)

    Zeira, Ron; Shamir, Ron

    2017-02-01

    Genome rearrangement problems have been extensively studied due to their importance in biology. Most studied models assumed a single copy per gene. However, in reality, duplicated genes are common, most notably in cancer. In this study, we make a step toward handling duplicated genes by considering a model that allows the atomic operations of cut, join, and whole chromosome duplication. Given two linear genomes, [Formula: see text] with one copy per gene and [Formula: see text] with two copies per gene, we give a linear time algorithm for computing a shortest sequence of operations transforming [Formula: see text] into [Formula: see text] such that all intermediate genomes are linear. We also show that computing an optimal sequence with fewest duplications is NP-hard.

  8. Exact Algorithms for Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

    Science.gov (United States)

    Kordi, Misagh; Bansal, Mukul S

    2017-06-01

    Duplication-Transfer-Loss (DTL) reconciliation is a powerful method for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation seeks to reconcile gene trees with species trees by postulating speciation, duplication, transfer, and loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. In practice, however, gene trees are often non-binary due to uncertainty in the gene tree topologies, and DTL reconciliation with non-binary gene trees is known to be NP-hard. In this paper, we present the first exact algorithms for DTL reconciliation with non-binary gene trees. Specifically, we (i) show that the DTL reconciliation problem for non-binary gene trees is fixed-parameter tractable in the maximum degree of the gene tree, (ii) present an exponential-time, but in-practice efficient, algorithm to track and enumerate all optimal binary resolutions of a non-binary input gene tree, and (iii) apply our algorithms to a large empirical data set of over 4700 gene trees from 100 species to study the impact of gene tree uncertainty on DTL-reconciliation and to demonstrate the applicability and utility of our algorithms. The new techniques and algorithms introduced in this paper will help biologists avoid incorrect evolutionary inferences caused by gene tree uncertainty.

  9. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

    1996-07-01

    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  10. Rooting phylogenies using gene duplications: an empirical example from the bees (Apoidea).

    Science.gov (United States)

    Brady, Seán G; Litman, Jessica R; Danforth, Bryan N

    2011-09-01

    The placement of the root node in a phylogeny is fundamental to characterizing evolutionary relationships. The root node of bee phylogeny remains unclear despite considerable previous attention. In order to test alternative hypotheses for the location of the root node in bees, we used the F1 and F2 paralogs of elongation factor 1-alpha (EF-1α) to compare the tree topologies that result when using outgroup versus paralogous rooting. Fifty-two taxa representing each of the seven bee families were sequenced for both copies of EF-1α. Two datasets were analyzed. In the first (the "concatenated" dataset), the F1 and F2 copies for each species were concatenated and the tree was rooted using appropriate outgroups (sphecid and crabronid wasps). In the second dataset (the "duplicated" dataset), the F1 and F2 copies were aligned to each another and each copy for all taxa were treated as separate terminals. In this dataset, the root was placed between the F1 and F2 copies (e.g., paralog rooting). Bayesian analyses demonstrate that the outgroup rooting approach outperforms paralog rooting, recovering deeper clades and showing stronger support for groups well established by both morphological and other molecular data. Sequence characteristics of the two copies were compared at the amino acid level, but little evidence was found to suggest that one copy is more functionally conserved. Although neither approach yields an unambiguous root to the tree, both approaches strongly indicate that the root of bee phylogeny does not fall near Colletidae, as has been previously proposed. We discuss paralog rooting as a general strategy and why this approach performs relatively poorly with our particular dataset. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Whole Genome and Tandem Duplicate Retention facilitated Glucosinolate Pathway Diversification in the Mustard Family.

    NARCIS (Netherlands)

    Hofberger, J.A.; Lyons, E.; Edger, P.P.; Pires, J.C.; Schranz, M.E.

    2013-01-01

    Plants share a common history of successive whole genome duplication (WGD) events retaining genomic patterns of duplicate gene copies (ohnologs) organized in conserved syntenic blocks. Duplication was often proposed to affect the origin of novel traits during evolution. However, genetic evidence

  12. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    NARCIS (Netherlands)

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes.

  13. Supervised classification of combined copy number and gene expression data

    Directory of Open Access Journals (Sweden)

    Riccadonna S.

    2007-12-01

    Full Text Available In this paper we apply a predictive profiling method to genome copy number aberrations (CNA in combination with gene expression and clinical data to identify molecular patterns of cancer pathophysiology. Predictive models and optimal feature lists for the platforms are developed by a complete validation SVM-based machine learning system. Ranked list of genome CNA sites (assessed by comparative genomic hybridization arrays – aCGH and of differentially expressed genes (assessed by microarray profiling with Affy HG-U133A chips are computed and combined on a breast cancer dataset for the discrimination of Luminal/ ER+ (Lum/ER+ and Basal-like/ER- classes. Different encodings are developed and applied to the CNA data, and predictive variable selection is discussed. We analyze the combination of profiling information between the platforms, also considering the pathophysiological data. A specific subset of patients is identified that has a different response to classification by chromosomal gains and losses and by differentially expressed genes, corroborating the idea that genomic CNA can represent an independent source for tumor classification.

  14. Multiplex Ligation-dependent Probe Amplification Identification of Deletions and Duplications of the Duchenne Muscular Dystrophy Gene in Taiwanese Subjects

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2007-05-01

    Conclusion: MLPA was proven to be a powerful tool for the detection of DMD gene deletions and duplications in male patients and female carriers. There was a relatively lower frequency of deletion and a higher frequency of duplication of DMD gene in this population compared to previous reports.

  15. Autism genome-wide copy number variation reveals ubiquitin and neuronal genes.

    Science.gov (United States)

    Glessner, Joseph T; Wang, Kai; Cai, Guiqing; Korvatska, Olena; Kim, Cecilia E; Wood, Shawn; Zhang, Haitao; Estes, Annette; Brune, Camille W; Bradfield, Jonathan P; Imielinski, Marcin; Frackelton, Edward C; Reichert, Jennifer; Crawford, Emily L; Munson, Jeffrey; Sleiman, Patrick M A; Chiavacci, Rosetta; Annaiah, Kiran; Thomas, Kelly; Hou, Cuiping; Glaberson, Wendy; Flory, James; Otieno, Frederick; Garris, Maria; Soorya, Latha; Klei, Lambertus; Piven, Joseph; Meyer, Kacie J; Anagnostou, Evdokia; Sakurai, Takeshi; Game, Rachel M; Rudd, Danielle S; Zurawiecki, Danielle; McDougle, Christopher J; Davis, Lea K; Miller, Judith; Posey, David J; Michaels, Shana; Kolevzon, Alexander; Silverman, Jeremy M; Bernier, Raphael; Levy, Susan E; Schultz, Robert T; Dawson, Geraldine; Owley, Thomas; McMahon, William M; Wassink, Thomas H; Sweeney, John A; Nurnberger, John I; Coon, Hilary; Sutcliffe, James S; Minshew, Nancy J; Grant, Struan F A; Bucan, Maja; Cook, Edwin H; Buxbaum, Joseph D; Devlin, Bernie; Schellenberg, Gerard D; Hakonarson, Hakon

    2009-05-28

    Autism spectrum disorders (ASDs) are childhood neurodevelopmental disorders with complex genetic origins. Previous studies focusing on candidate genes or genomic regions have identified several copy number variations (CNVs) that are associated with an increased risk of ASDs. Here we present the results from a whole-genome CNV study on a cohort of 859 ASD cases and 1,409 healthy children of European ancestry who were genotyped with approximately 550,000 single nucleotide polymorphism markers, in an attempt to comprehensively identify CNVs conferring susceptibility to ASDs. Positive findings were evaluated in an independent cohort of 1,336 ASD cases and 1,110 controls of European ancestry. Besides previously reported ASD candidate genes, such as NRXN1 (ref. 10) and CNTN4 (refs 11, 12), several new susceptibility genes encoding neuronal cell-adhesion molecules, including NLGN1 and ASTN2, were enriched with CNVs in ASD cases compared to controls (P = 9.5 x 10(-3)). Furthermore, CNVs within or surrounding genes involved in the ubiquitin pathways, including UBE3A, PARK2, RFWD2 and FBXO40, were affected by CNVs not observed in controls (P = 3.3 x 10(-3)). We also identified duplications 55 kilobases upstream of complementary DNA AK123120 (P = 3.6 x 10(-6)). Although these variants may be individually rare, they target genes involved in neuronal cell-adhesion or ubiquitin degradation, indicating that these two important gene networks expressed within the central nervous system may contribute to the genetic susceptibility of ASD.

  16. Copy-number and gene dependency analysis reveals partial copy loss of wild-type SF3B1 as a novel cancer vulnerability. | Office of Cancer Genomics

    Science.gov (United States)

    Genomic instability is a hallmark of human cancer, and results in widespread somatic copy number alterations. We used a genome-scale shRNA viability screen in human cancer cell lines to systematically identify genes that are essential in the context of particular copy-number alterations (copy-number associated gene dependencies). The most enriched class of copy-number associated gene dependencies was CYCLOPS (Copy-number alterations Yielding Cancer Liabilities Owing to Partial losS) genes, and spliceosome components were the most prevalent.

  17. A single enhancer regulating the differential expression of duplicated red-sensitive opsin genes in zebrafish.

    Directory of Open Access Journals (Sweden)

    Taro Tsujimura

    2010-12-01

    Full Text Available A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC clones encompassing the two genes and identified a 0.6-kb "LWS-activating region" (LAR upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins.

  18. Rare Copy Number Variations in Adults with Tetralogy of Fallot Implicate Novel Risk Gene Pathways

    Science.gov (United States)

    Costain, Gregory; Merico, Daniele; Migita, Ohsuke; Liu, Ben; Yuen, Tracy; Rickaby, Jessica; Thiruvahindrapuram, Bhooma; Marshall, Christian R.; Scherer, Stephen W.; Bassett, Anne S.

    2012-01-01

    Structural genetic changes, especially copy number variants (CNVs), represent a major source of genetic variation contributing to human disease. Tetralogy of Fallot (TOF) is the most common form of cyanotic congenital heart disease, but to date little is known about the role of CNVs in the etiology of TOF. Using high-resolution genome-wide microarrays and stringent calling methods, we investigated rare CNVs in a prospectively recruited cohort of 433 unrelated adults with TOF and/or pulmonary atresia at a single centre. We excluded those with recognized syndromes, including 22q11.2 deletion syndrome. We identified candidate genes for TOF based on converging evidence between rare CNVs that overlapped the same gene in unrelated individuals and from pathway analyses comparing rare CNVs in TOF cases to those in epidemiologic controls. Even after excluding the 53 (10.7%) subjects with 22q11.2 deletions, we found that adults with TOF had a greater burden of large rare genic CNVs compared to controls (8.82% vs. 4.33%, p = 0.0117). Six loci showed evidence for recurrence in TOF or related congenital heart disease, including typical 1q21.1 duplications in four (1.18%) of 340 Caucasian probands. The rare CNVs implicated novel candidate genes of interest for TOF, including PLXNA2, a gene involved in semaphorin signaling. Independent pathway analyses highlighted developmental processes as potential contributors to the pathogenesis of TOF. These results indicate that individually rare CNVs are collectively significant contributors to the genetic burden of TOF. Further, the data provide new evidence for dosage sensitive genes in PLXNA2-semaphorin signaling and related developmental processes in human cardiovascular development, consistent with previous animal models. PMID:22912587

  19. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Science.gov (United States)

    Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.

  20. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Directory of Open Access Journals (Sweden)

    Olga V Popova

    Full Text Available Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida and Pycnophyes kielensis (Allomalorhagida. Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even

  1. Tissue-specific differential induction of duplicated fatty acid-binding protein genes by the peroxisome proliferator, clofibrate, in zebrafish (Danio rerio

    Directory of Open Access Journals (Sweden)

    Venkatachalam Ananda B

    2012-07-01

    RNAs for both the duplicated copies of fabp1a/fabp1b.1, and fabp7a/fabp7b, but in different tissues. Clofibrate also increased the steady-state level of fabp10a and fabp11a mRNAs and hnRNAs in liver, but not for fabp10b and fabp11b. Conclusion Some duplicated fabp genes have, most likely, retained PPREs, but induction by clofibrate is over-ridden by an, as yet, unknown tissue-specific mechanism(s. Regardless of the tissue-specific mechanism(s, transcriptional control of duplicated zebrafish fabp genes by clofibrate has markedly diverged since the WGD event.

  2. Specific duplication and dorsoventrally asymmetric expression patterns of Cycloidea-like genes in zygomorphic species of Ranunculaceae.

    Science.gov (United States)

    Jabbour, Florian; Cossard, Guillaume; Le Guilloux, Martine; Sannier, Julie; Nadot, Sophie; Damerval, Catherine

    2014-01-01

    Floral bilateral symmetry (zygomorphy) has evolved several times independently in angiosperms from radially symmetrical (actinomorphic) ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc) have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like) lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.

  3. Specific duplication and dorsoventrally asymmetric expression patterns of Cycloidea-like genes in zygomorphic species of Ranunculaceae.

    Directory of Open Access Journals (Sweden)

    Florian Jabbour

    Full Text Available Floral bilateral symmetry (zygomorphy has evolved several times independently in angiosperms from radially symmetrical (actinomorphic ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.

  4. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Science.gov (United States)

    Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile

    2011-07-01

    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  5. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Directory of Open Access Journals (Sweden)

    Philippe Ganot

    2011-07-01

    Full Text Available Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion, which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones or aposymbiotic (also called bleached A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm. A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both

  6. Analysis of Copy Number Variation in the Abp Gene Regions of Two House Mouse Subspecies Suggests Divergence during the Gene Family Expansions.

    Science.gov (United States)

    Pezer, Željka; Chung, Amanda G; Karn, Robert C; Laukaitis, Christina M

    2017-06-01

    The Androgen-binding protein ( Abp ) gene region of the mouse genome contains 64 genes, some encoding pheromones that influence assortative mating between mice from different subspecies. Using CNVnator and quantitative PCR, we explored copy number variation in this gene family in natural populations of Mus musculus domesticus ( Mmd ) and Mus musculus musculus ( Mmm ), two subspecies of house mice that form a narrow hybrid zone in Central Europe. We found that copy number variation in the center of the Abp gene region is very common in wild Mmd , primarily representing the presence/absence of the final duplications described for the mouse genome. Clustering of Mmd individuals based on this variation did not reflect their geographical origin, suggesting no population divergence in the Abp gene cluster. However, copy number variation patterns differ substantially between Mmd and other mouse taxa. Large blocks of Abp genes are absent in Mmm , Mus musculus castaneus and an outgroup, Mus spretus , although with differences in variation and breakpoint locations. Our analysis calls into question the reliance on a reference genome for interpreting the detailed organization of genes in taxa more distant from the Mmd reference genome. The polymorphic nature of the gene family expansion in all four taxa suggests that the number of Abp genes, especially in the central gene region, is not critical to the survival and reproduction of the mouse. However, Abp haplotypes of variable length may serve as a source of raw genetic material for new signals influencing reproductive communication and thus speciation of mice. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. Sox genes in grass carp (Ctenopharyngodon idella) with their implications for genome duplication and evolution

    OpenAIRE

    Zhong , Lei; Yu , Xiaomu; Tong , Jingou

    2006-01-01

    Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella), one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes h...

  8. Simulating evolution of protein complexes through gene duplication and co-option.

    Science.gov (United States)

    Haarsma, Loren; Nelesen, Serita; VanAndel, Ethan; Lamine, James; VandeHaar, Peter

    2016-06-21

    We present a model of the evolution of protein complexes with novel functions through gene duplication, mutation, and co-option. Under a wide variety of input parameters, digital organisms evolve complexes of 2-5 bound proteins which have novel functions but whose component proteins are not independently functional. Evolution of complexes with novel functions happens more quickly as gene duplication rates increase, point mutation rates increase, protein complex functional probability increases, protein complex functional strength increases, and protein family size decreases. Evolution of complexity is inhibited when the metabolic costs of making proteins exceeds the fitness gain of having functional proteins, or when point mutation rates get so large the functional proteins undergo deleterious mutations faster than new functional complexes can evolve. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. A gene duplication led to specialized gamma-aminobutyrate and beta-alanine aminotransferase in yeast

    DEFF Research Database (Denmark)

    Andersen, Gorm; Andersen, Birgit; Dobritzsch, D.

    2007-01-01

    and related yeasts have two different genes/enzymes to apparently 'distinguish' between the two reactions in a single cell. It is likely that upon duplication similar to 200 million years ago, a specialized Uga1p evolved into a 'novel' transaminase enzyme with broader substrate specificity.......In humans, beta-alanine (BAL) and the neurotransmitter gamma-aminobutyrate (GABA) are transaminated by a single aminotransferase enzyme. Apparently, yeast originally also had a single enzyme, but the corresponding gene was duplicated in the Saccharomyces kluyveri lineage. SkUGA1 encodes a homologue...... to characterize the substrate specificity and kinetic parameters of the four enzymes. It was found that the cofactor pyridoxal 5'-phosphate is needed for enzymatic activity and alpha-ketoglutarate, and not pyruvate, as the amino group acceptor. SkPyd4p preferentially uses BAL as the amino group donor (V...

  10. Approximating the edit distance for genomes with duplicate genes under DCJ, insertion and deletion

    Directory of Open Access Journals (Sweden)

    Shao Mingfu

    2012-12-01

    Full Text Available Abstract Computing the edit distance between two genomes under certain operations is a basic problem in the study of genome evolution. The double-cut-and-join (DCJ model has formed the basis for most algorithmic research on rearrangements over the last few years. The edit distance under the DCJ model can be easily computed for genomes without duplicate genes. In this paper, we study the edit distance for genomes with duplicate genes under a model that includes DCJ operations, insertions and deletions. We prove that computing the edit distance is equivalent to finding the optimal cycle decomposition of the corresponding adjacency graph, and give an approximation algorithm with an approximation ratio of 1.5 + ∈.

  11. Hypertension and Biliary Ductopenia in a Patient with Duplication of Exon 6 of the Gene

    Directory of Open Access Journals (Sweden)

    J. Uberos

    2012-01-01

    Full Text Available We describe a neonatal patient with biliary ductopenia featuring duplication of exon 6 of the JAG1 gene. Facial alterations were observed, consisting of a prominent forehead, sunken eyes, upward slanting palpebral fissures, hypertelorism, flat nasal root and prominent chin. From birth, these were accompanied by the development of haematuria and renal failure and by renal Doppler findings indicative of peripheral renal artery stenosis. JAG1 gene mutations on chromosome 20 have been associated with various anomalies, including biliary cholestasis, vertebral abnormalities, eye disorders, heart defects and facial dysmorphia. This syndrome, first described by Alagille, is an infrequent congenital disorder caused by a dominant autosomal inheritance with variable expressivity. Anatomopathological effects include the destruction and disappearance of hepatic bile ducts (ductopenia. The duplication of exon 6 of JAG1 has not previously been described as an alteration related to the Alagille syndrome with peripheral renal artery stenosis.

  12. Duplication of 7q36.3 encompassing the Sonic Hedgehog (SHH) gene is associated with congenital muscular hypertrophy

    DEFF Research Database (Denmark)

    Kristensen, Lone Krøldrup; Kjaergaard, S; Kirchhoff, Marianne

    2012-01-01

    with muscular hypertrophy and mildly retarded psychomotor development. Array-CGH identified a small duplication of 7q36.3 including the Sonic Hedgehog (SHH) gene in both the aborted foetus and the live born male sib. Neither of the parents carried the 7q36.3 duplication. The consequences of overexpression...

  13. Dose effect of the uvsA+ gene product in duplication strains of Aspergillus nidulans

    International Nuclear Information System (INIS)

    Majerfeld, I.H.; Roper, J.A.

    1978-01-01

    Strains of Aspergillus nidulans which carry a particular segment of chromosome I in duplicate - one segment in normal position, the other translocated to chromosome II - are more resistant to uv light than are strains with a balanced haploid genome. A double dose of the uvsA + allele, carried on the duplicate segment, determines this enhanced resistance; this is shown by the descending order of resistance of duplication haploids uvsA + /uvsA + , uvsA1/uvsA + and uvsA1/uvsA1. An unbalanced diploid with three doses of the uvsA + allele also shows greater resistance than a balanced uvsA + //uvsA + diploid. However, in balanced diploids the uvsA1 allele appears to be completely recessive; uvsA + //uvsA + and uvsA + //uvsA1 diploids produce indistinguishable survival curves after uv irradiation. Thus, the uvsA + gene product is not rate-limiting in repair processes in strains with a balanced genome. The rate-limiting effect observed in these unbalanced strains presumably reflects an interaction of the uvsA + product and other functions determined by the rest of the genome. Duplication haploids and normal haploids lose photorepairable lesions at similar rates. This observation may be interpreted to indicate that differences in survival are not due to differences in the efficiency of excision of uv-induced pyrimidime dimers

  14. Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.

    Directory of Open Access Journals (Sweden)

    Nemanja Vukašinović

    Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.

  15. Variations in CCL3L gene cluster sequence and non-specific gene copy numbers

    Directory of Open Access Journals (Sweden)

    Edberg Jeffrey C

    2010-03-01

    Full Text Available Abstract Background Copy number variations (CNVs of the gene CC chemokine ligand 3-like1 (CCL3L1 have been implicated in HIV-1 susceptibility, but the association has been inconsistent. CCL3L1 shares homology with a cluster of genes localized to chromosome 17q12, namely CCL3, CCL3L2, and, CCL3L3. These genes are involved in host defense and inflammatory processes. Several CNV assays have been developed for the CCL3L1 gene. Findings Through pairwise and multiple alignments of these genes, we have shown that the homology between these genes ranges from 50% to 99% in complete gene sequences and from 70-100% in the exonic regions, with CCL3L1 and CCL3L3 being identical. By use of MEGA 4 and BioEdit, we aligned sense primers, anti-sense primers, and probes used in several previously described assays against pre-multiple alignments of all four chemokine genes. Each set of probes and primers aligned and matched with overlapping sequences in at least two of the four genes, indicating that previously utilized RT-PCR based CNV assays are not specific for only CCL3L1. The four available assays measured median copies of 2 and 3-4 in European and African American, respectively. The concordance between the assays ranged from 0.44-0.83 suggesting individual discordant calls and inconsistencies with the assays from the expected gene coverage from the known sequence. Conclusions This indicates that some of the inconsistencies in the association studies could be due to assays that provide heterogenous results. Sequence information to determine CNV of the three genes separately would allow to test whether their association with the pathogenesis of a human disease or phenotype is affected by an individual gene or by a combination of these genes.

  16. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  17. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  18. Divergent Evolutionary Patterns of NAC Transcription Factors Are Associated with Diversification and Gene Duplications in Angiosperm

    Directory of Open Access Journals (Sweden)

    Xiaoli Jin

    2017-06-01

    Full Text Available NAC (NAM/ATAF/CUC proteins constitute one of the biggest plant-specific transcription factor (TF families and have crucial roles in diverse developmental programs during plant growth. Phylogenetic analyses have revealed both conserved and lineage-specific NAC subfamilies, among which various origins and distinct features were observed. It is reasonable to hypothesize that there should be divergent evolutionary patterns of NAC TFs both between dicots and monocots, and among NAC subfamilies. In this study, we compared the gene duplication and loss, evolutionary rate, and selective pattern among non-lineage specific NAC subfamilies, as well as those between dicots and monocots, through genome-wide analyses of sequence and functional data in six dicot and five grass lineages. The number of genes gained in the dicot lineages was much larger than that in the grass lineages, while fewer gene losses were observed in the grass than that in the dicots. We revealed (1 uneven constitution of Clusters of Orthologous Groups (COGs and contrasting birth/death rates among subfamilies, and (2 two distinct evolutionary scenarios of NAC TFs between dicots and grasses. Our results demonstrated that relaxed selection, resulting from concerted gene duplications, may have permitted substitutions responsible for functional divergence of NAC genes into new lineages. The underlying mechanism of distinct evolutionary fates of NAC TFs shed lights on how evolutionary divergence contributes to differences in establishing NAC gene subfamilies and thus impacts the distinct features between dicots and grasses.

  19. Rapid evolution and copy number variation of primate RHOXF2, an X-linked homeobox gene involved in male reproduction and possibly brain function.

    Science.gov (United States)

    Niu, Ao-lei; Wang, Yin-qiu; Zhang, Hui; Liao, Cheng-hong; Wang, Jin-kai; Zhang, Rui; Che, Jun; Su, Bing

    2011-10-12

    Homeobox genes are the key regulators during development, and they are in general highly conserved with only a few reported cases of rapid evolution. RHOXF2 is an X-linked homeobox gene in primates. It is highly expressed in the testicle and may play an important role in spermatogenesis. As male reproductive system is often the target of natural and/or sexual selection during evolution, in this study, we aim to dissect the pattern of molecular evolution of RHOXF2 in primates and its potential functional consequence. We studied sequences and copy number variation of RHOXF2 in humans and 16 nonhuman primate species as well as the expression patterns in human, chimpanzee, white-browed gibbon and rhesus macaque. The gene copy number analysis showed that there had been parallel gene duplications/losses in multiple primate lineages. Our evidence suggests that 11 nonhuman primate species have one RHOXF2 copy, and two copies are present in humans and four Old World monkey species, and at least 6 copies in chimpanzees. Further analysis indicated that the gene duplications in primates had likely been mediated by endogenous retrovirus (ERV) sequences flanking the gene regions. In striking contrast to non-human primates, humans appear to have homogenized their two RHOXF2 copies by the ERV-mediated non-allelic recombination mechanism. Coding sequence and phylogenetic analysis suggested multi-lineage strong positive selection on RHOXF2 during primate evolution, especially during the origins of humans and chimpanzees. All the 8 coding region polymorphic sites in human populations are non-synonymous, implying on-going selection. Gene expression analysis demonstrated that besides the preferential expression in the reproductive system, RHOXF2 is also expressed in the brain. The quantitative data suggests expression pattern divergence among primate species. RHOXF2 is a fast-evolving homeobox gene in primates. The rapid evolution and copy number changes of RHOXF2 had been driven by

  20. Rapid evolution and copy number variation of primate RHOXF2, an X-linked homeobox gene involved in male reproduction and possibly brain function

    Directory of Open Access Journals (Sweden)

    Zhang Rui

    2011-10-01

    Full Text Available Abstract Background Homeobox genes are the key regulators during development, and they are in general highly conserved with only a few reported cases of rapid evolution. RHOXF2 is an X-linked homeobox gene in primates. It is highly expressed in the testicle and may play an important role in spermatogenesis. As male reproductive system is often the target of natural and/or sexual selection during evolution, in this study, we aim to dissect the pattern of molecular evolution of RHOXF2 in primates and its potential functional consequence. Results We studied sequences and copy number variation of RHOXF2 in humans and 16 nonhuman primate species as well as the expression patterns in human, chimpanzee, white-browed gibbon and rhesus macaque. The gene copy number analysis showed that there had been parallel gene duplications/losses in multiple primate lineages. Our evidence suggests that 11 nonhuman primate species have one RHOXF2 copy, and two copies are present in humans and four Old World monkey species, and at least 6 copies in chimpanzees. Further analysis indicated that the gene duplications in primates had likely been mediated by endogenous retrovirus (ERV sequences flanking the gene regions. In striking contrast to non-human primates, humans appear to have homogenized their two RHOXF2 copies by the ERV-mediated non-allelic recombination mechanism. Coding sequence and phylogenetic analysis suggested multi-lineage strong positive selection on RHOXF2 during primate evolution, especially during the origins of humans and chimpanzees. All the 8 coding region polymorphic sites in human populations are non-synonymous, implying on-going selection. Gene expression analysis demonstrated that besides the preferential expression in the reproductive system, RHOXF2 is also expressed in the brain. The quantitative data suggests expression pattern divergence among primate species. Conclusions RHOXF2 is a fast-evolving homeobox gene in primates. The rapid

  1. Clinical and molecular characterization of duplications encompassing the human SHOX gene reveal a variable effect on stature.

    Science.gov (United States)

    Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert

    2009-07-01

    Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.

  2. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

    Science.gov (United States)

    Harding, Tommy; Roger, Andrew J.; Simpson, Alastair G. B.

    2017-01-01

    The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles) grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones), ion homeostasis (e.g., Na+/H+ transporter), metabolism and transport of lipids (e.g., sterol biosynthetic genes), carbohydrate metabolism (e.g., glycosidases), and signal transduction pathways (e.g., transcription factors). A significantly high proportion (43%) of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs), as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like membrane

  3. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

    Directory of Open Access Journals (Sweden)

    Tommy Harding

    2017-05-01

    Full Text Available The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones, ion homeostasis (e.g., Na+/H+ transporter, metabolism and transport of lipids (e.g., sterol biosynthetic genes, carbohydrate metabolism (e.g., glycosidases, and signal transduction pathways (e.g., transcription factors. A significantly high proportion (43% of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs, as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like

  4. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  5. Gene expression patterns of chicken neuregulin 3 in association with copy number variation and frameshift deletion.

    Science.gov (United States)

    Abe, Hideaki; Aoya, Daiki; Takeuchi, Hiro-Aki; Inoue-Murayama, Miho

    2017-07-21

    Neuregulin 3 (NRG3) plays a key role in central nervous system development and is a strong candidate for human mental disorders. Thus, genetic variation in NRG3 may have some impact on a variety of phenotypes in non-mammalian vertebrates. Recently, genome-wide screening for short insertions and deletions in chicken (Gallus gallus) genomes has provided useful information about structural variation in functionally important genes. NRG3 is one such gene that has a putative frameshift deletion in exon 2, resulting in premature termination of translation. Our aims were to characterize the structure of chicken NRG3 and to compare expression patterns between NRG3 isoforms. Depending on the presence or absence of the 2-bp deletion in chicken NRG3, 3 breeds (red junglefowl [RJF], Boris Brown [BB], and Hinai-jidori [HJ]) were genotyped using flanking primers. In the commercial breeds (BB and HJ), approximately 45% of individuals had at least one exon 2 allele with the 2-bp deletion, whereas there was no deletion allele in RJF. The lack of a homozygous mutant indicated the existence of duplicated NRG3 segments in the chicken genome. Indeed, highly conserved elements consisting of exon 1, intron 1, exon 2, and part of intron 2 were found in the reference RJF genome, and quantitative PCR detected copy number variation (CNV) between breeds as well as between individuals. The copy number of conserved elements was significantly higher in chicks harboring the 2-bp deletion in exon 2. We identified 7 novel transcript variants using total mRNA isolated from the amygdala. Novel isoforms were found to lack the exon 2 cassette, which probably harbored the premature termination codon. The relative transcription levels of the newly identified isoforms were almost the same between chick groups with and without the 2-bp deletion, while chicks with the deletion showed significant suppression of the expression of previously reported isoforms. A putative frameshift deletion and CNV in chicken

  6. Copy number variation of KIR genes influences HIV-1 control

    DEFF Research Database (Denmark)

    Pelak, Kimberly; Need, Anna C; Fellay, Jacques

    2011-01-01

    A genome-wide screen for large structural variants showed that a copy number variant (CNV) in the region encoding killer cell immunoglobulin-like receptors (KIR) associates with HIV-1 control as measured by plasma viral load at set point in individuals of European ancestry. This CNV encompasses t...

  7. Differential contributions to the transcriptome of duplicated genes in response to abiotic stresses in natural and synthetic polyploids.

    Science.gov (United States)

    Dong, Shaowei; Adams, Keith L

    2011-06-01

    Polyploidy has occurred throughout plant evolution and can result in considerable changes to gene expression when it takes place and over evolutionary time. Little is known about the effects of abiotic stress conditions on duplicate gene expression patterns in polyploid plants. We examined the expression patterns of 60 duplicated genes in leaves, roots and cotyledons of allotetraploid Gossypium hirsutum in response to five abiotic stress treatments (heat, cold, drought, high salt and water submersion) using single-strand conformation polymorphism assays, and 20 genes in a synthetic allotetraploid. Over 70% of the genes showed stress-induced changes in the relative expression levels of the duplicates under one or more stress treatments with frequent variability among treatments. Twelve pairs showed opposite changes in expression levels in response to different abiotic stress treatments. Stress-induced expression changes occurred in the synthetic allopolyploid, but there was little correspondence in patterns between the natural and synthetic polyploids. Our results indicate that abiotic stress conditions can have considerable effects on duplicate gene expression in a polyploid, with the effects varying by gene, stress and organ type. Differential expression in response to environmental stresses may be a factor in the preservation of some duplicated genes in polyploids. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  8. Gene duplication and fragmentation in the zebra finch major histocompatibility complex.

    Science.gov (United States)

    Balakrishnan, Christopher N; Ekblom, Robert; Völker, Martin; Westerdahl, Helena; Godinez, Ricardo; Kotkiewicz, Holly; Burt, David W; Graves, Tina; Griffin, Darren K; Warren, Wesley C; Edwards, Scott V

    2010-04-01

    Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC) has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC) sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH) evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving chromosomal fission, gene duplication and translocation in the

  9. Alteration of rRNA gene copy number and expression in patients ...

    African Journals Online (AJOL)

    Irina S. Kolesnikova

    2017-09-01

    Sep 1, 2017 ... Asia R. Shorina d, Alexander S. Graphodatsky a, Ekaterina M. Galanina b, Dmitry V. Yudkin a,b,* ... rRNA gene copy numbers on affected acrocentric chromosomes in .... estimated using MS Excel software (Microsoft, USA).

  10. Expression response of duplicated metallothionein 3 gene to copper stress in Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Nevrtalová, Eva; Baloun, Jiří; Hudzieczek, Vojtěch; Čegan, Radim; Vyskot, Boris; Doležel, Jaroslav; Šafář, Jan; Milde, D.; Hobza, Roman

    2014-01-01

    Roč. 251, č. 6 (2014), s. 1427-1439 ISSN 0033-183X R&D Projects: GA ČR(CZ) GAP501/12/2220; GA ČR(CZ) GBP501/12/G090; GA ČR(CZ) GP13-34962P; GA ČR(CZ) GA522/09/0083 Institutional support: RVO:68081707 Keywords : Copper * Gene duplication * Metallothionein Subject RIV: BO - Biophysics; EF - Botanics (UEB-Q) Impact factor: 2.651, year: 2014

  11. Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

    Science.gov (United States)

    Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

    2012-11-02

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

  12. Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

    Science.gov (United States)

    Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

    2012-01-01

    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

  13. Accurate measurement of gene copy number for human alpha-defensin DEFA1A3.

    Science.gov (United States)

    Khan, Fayeza F; Carpenter, Danielle; Mitchell, Laura; Mansouri, Omniah; Black, Holly A; Tyson, Jess; Armour, John A L

    2013-10-20

    Multi-allelic copy number variants include examples of extensive variation between individuals in the copy number of important genes, most notably genes involved in immune function. The definition of this variation, and analysis of its impact on function, has been hampered by the technical difficulty of large-scale but accurate typing of genomic copy number. The copy-variable alpha-defensin locus DEFA1A3 on human chromosome 8 commonly varies between 4 and 10 copies per diploid genome, and presents considerable challenges for accurate high-throughput typing. In this study, we developed two paralogue ratio tests and three allelic ratio measurements that, in combination, provide an accurate and scalable method for measurement of DEFA1A3 gene number. We combined information from different measurements in a maximum-likelihood framework which suggests that most samples can be assigned to an integer copy number with high confidence, and applied it to typing 589 unrelated European DNA samples. Typing the members of three-generation pedigrees provided further reassurance that correct integer copy numbers had been assigned. Our results have allowed us to discover that the SNP rs4300027 is strongly associated with DEFA1A3 gene copy number in European samples. We have developed an accurate and robust method for measurement of DEFA1A3 copy number. Interrogation of rs4300027 and associated SNPs in Genome-Wide Association Study SNP data provides no evidence that alpha-defensin copy number is a strong risk factor for phenotypes such as Crohn's disease, type I diabetes, HIV progression and multiple sclerosis.

  14. Genome-wide copy number variation study associates metabotropic glutamate receptor gene networks with attention deficit hyperactivity disorder

    Science.gov (United States)

    Elia, Josephine; Glessner, Joseph T; Wang, Kai; Takahashi, Nagahide; Shtir, Corina J; Hadley, Dexter; Sleiman, Patrick M A; Zhang, Haitao; Kim, Cecilia E; Robison, Reid; Lyon, Gholson J; Flory, James H; Bradfield, Jonathan P; Imielinski, Marcin; Hou, Cuiping; Frackelton, Edward C; Chiavacci, Rosetta M; Sakurai, Takeshi; Rabin, Cara; Middleton, Frank A; Thomas, Kelly A; Garris, Maria; Mentch, Frank; Freitag, Christine M; Steinhausen, Hans-Christoph; Todorov, Alexandre A; Reif, Andreas; Rothenberger, Aribert; Franke, Barbara; Mick, Eric O; Roeyers, Herbert; Buitelaar, Jan; Lesch, Klaus-Peter; Banaschewski, Tobias; Ebstein, Richard P; Mulas, Fernando; Oades, Robert D; Sergeant, Joseph; Sonuga-Barke, Edmund; Renner, Tobias J; Romanos, Marcel; Romanos, Jasmin; Warnke, Andreas; Walitza, Susanne; Meyer, Jobst; Pálmason, Haukur; Seitz, Christiane; Loo, Sandra K; Smalley, Susan L; Biederman, Joseph; Kent, Lindsey; Asherson, Philip; Anney, Richard J L; Gaynor, J William; Shaw, Philip; Devoto, Marcella; White, Peter S; Grant, Struan F A; Buxbaum, Joseph D; Rapoport, Judith L; Williams, Nigel M; Nelson, Stanley F; Faraone, Stephen V; Hakonarson, Hakon

    2014-01-01

    Attention deficit hyperactivity disorder (ADHD) is a common, heritable neuropsychiatric disorder of unknown etiology. We performed a whole-genome copy number variation (CNV) study on 1,013 cases with ADHD and 4,105 healthy children of European ancestry using 550,000 SNPs. We evaluated statistically significant findings in multiple independent cohorts, with a total of 2,493 cases with ADHD and 9,222 controls of European ancestry, using matched platforms. CNVs affecting metabotropic glutamate receptor genes were enriched across all cohorts (P = 2.1 × 10−9). We saw GRM5 (encoding glutamate receptor, metabotropic 5) deletions in ten cases and one control (P = 1.36 × 10−6). We saw GRM7 deletions in six cases, and we saw GRM8 deletions in eight cases and no controls. GRM1 was duplicated in eight cases. We experimentally validated the observed variants using quantitative RT-PCR. A gene network analysis showed that genes interacting with the genes in the GRM family are enriched for CNVs in ~10% of the cases (P = 4.38 × 10−10) after correction for occurrence in the controls. We identified rare recurrent CNVs affecting glutamatergic neurotransmission genes that were overrepresented in multiple ADHD cohorts. PMID:22138692

  15. Copy number variation of KIR genes influences HIV-1 control

    DEFF Research Database (Denmark)

    Pelak, Kimberly; Need, Anna C; Fellay, Jacques

    2011-01-01

    A genome-wide screen for large structural variants showed that a copy number variant (CNV) in the region encoding killer cell immunoglobulin-like receptors (KIR) associates with HIV-1 control as measured by plasma viral load at set point in individuals of European ancestry. This CNV encompasses...... the KIR3DL1-KIR3DS1 locus, encoding receptors that interact with specific HLA-Bw4 molecules to regulate the activation of lymphocyte subsets including natural killer (NK) cells. We quantified the number of copies of KIR3DS1 and KIR3DL1 in a large HIV-1 positive cohort, and showed that an increase in KIR3...... amounts of these activating and inhibitory KIR play a role in regulating the peripheral expansion of highly antiviral KIR3DS1+ NK cells, which may determine differences in HIV-1 control following infection....

  16. Integrative analysis of genome-wide gene copy number changes and gene expression in non-small cell lung cancer.

    Directory of Open Access Journals (Sweden)

    Verena Jabs

    Full Text Available Non-small cell lung cancer (NSCLC represents a genomically unstable cancer type with extensive copy number aberrations. The relationship of gene copy number alterations and subsequent mRNA levels has only fragmentarily been described. The aim of this study was to conduct a genome-wide analysis of gene copy number gains and corresponding gene expression levels in a clinically well annotated NSCLC patient cohort (n = 190 and their association with survival. While more than half of all analyzed gene copy number-gene expression pairs showed statistically significant correlations (10,296 of 18,756 genes, high correlations, with a correlation coefficient >0.7, were obtained only in a subset of 301 genes (1.6%, including KRAS, EGFR and MDM2. Higher correlation coefficients were associated with higher copy number and expression levels. Strong correlations were frequently based on few tumors with high copy number gains and correspondingly increased mRNA expression. Among the highly correlating genes, GO groups associated with posttranslational protein modifications were particularly frequent, including ubiquitination and neddylation. In a meta-analysis including 1,779 patients we found that survival associated genes were overrepresented among highly correlating genes (61 of the 301 highly correlating genes, FDR adjusted p<0.05. Among them are the chaperone CCT2, the core complex protein NUP107 and the ubiquitination and neddylation associated protein CAND1. In conclusion, in a comprehensive analysis we described a distinct set of highly correlating genes. These genes were found to be overrepresented among survival-associated genes based on gene expression in a large collection of publicly available datasets.

  17. Evolutionary changes in gene expression, coding sequence and copy-number at the Cyp6g1 locus contribute to resistance to multiple insecticides in Drosophila.

    Directory of Open Access Journals (Sweden)

    Thomas W R Harrop

    Full Text Available Widespread use of insecticides has led to insecticide resistance in many populations of insects. In some populations, resistance has evolved to multiple pesticides. In Drosophila melanogaster, resistance to multiple classes of insecticide is due to the overexpression of a single cytochrome P450 gene, Cyp6g1. Overexpression of Cyp6g1 appears to have evolved in parallel in Drosophila simulans, a sibling species of D. melanogaster, where it is also associated with insecticide resistance. However, it is not known whether the ability of the CYP6G1 enzyme to provide resistance to multiple insecticides evolved recently in D. melanogaster or if this function is present in all Drosophila species. Here we show that duplication of the Cyp6g1 gene occurred at least four times during the evolution of different Drosophila species, and the ability of CYP6G1 to confer resistance to multiple insecticides exists in D. melanogaster and D. simulans but not in Drosophila willistoni or Drosophila virilis. In D. virilis, which has multiple copies of Cyp6g1, one copy confers resistance to DDT and another to nitenpyram, suggesting that the divergence of protein sequence between copies subsequent to the duplication affected the activity of the enzyme. All orthologs tested conferred resistance to one or more insecticides, suggesting that CYP6G1 had the capacity to provide resistance to anthropogenic chemicals before they existed. Finally, we show that expression of Cyp6g1 in the Malpighian tubules, which contributes to DDT resistance in D. melanogaster, is specific to the D. melanogaster-D. simulans lineage. Our results suggest that a combination of gene duplication, regulatory changes and protein coding changes has taken place at the Cyp6g1 locus during evolution and this locus may play a role in providing resistance to different environmental toxins in different Drosophila species.

  18. Dynamic Copy Number Evolution of X- and Y-Linked Ampliconic Genes in Human Populations

    DEFF Research Database (Denmark)

    Lucotte, Elise A; Skov, Laurits; Jensen, Jacob Malte

    2018-01-01

    we explore the evolution of human X- and Y-linked ampliconic genes by investigating copy number variation (CNV) and coding variation between populations using the Simons Genome Diversity Project. We develop a method to assess CNVs using the read-depth on modified X and Y chromosome targets containing...... related Y haplogroups, that diversified less than 50,000 years ago. Moreover, X and Y-linked ampliconic genes seem to have a faster amplification dynamic than autosomal multicopy genes. Looking at expression data from another study, we also find that XY-linked ampliconic genes with extensive copy number...

  19. Gene duplication and adaptive evolution of digestive proteases in Drosophila arizonae female reproductive tracts.

    Directory of Open Access Journals (Sweden)

    Erin S Kelleher

    2007-08-01

    Full Text Available It frequently has been postulated that intersexual coevolution between the male ejaculate and the female reproductive tract is a driving force in the rapid evolution of reproductive proteins. The dearth of research on female tracts, however, presents a major obstacle to empirical tests of this hypothesis. Here, we employ a comparative EST approach to identify 241 candidate female reproductive proteins in Drosophila arizonae, a repleta group species in which physiological ejaculate-female coevolution has been documented. Thirty-one of these proteins exhibit elevated amino acid substitution rates, making them candidates for molecular coevolution with the male ejaculate. Strikingly, we also discovered 12 unique digestive proteases whose expression is specific to the D. arizonae lower female reproductive tract. These enzymes belong to classes most commonly found in the gastrointestinal tracts of a diverse array of organisms. We show that these proteases are associated with recent, lineage-specific gene duplications in the Drosophila repleta species group, and exhibit strong signatures of positive selection. Observation of adaptive evolution in several female reproductive tract proteins indicates they are active players in the evolution of reproductive tract interactions. Additionally, pervasive gene duplication, adaptive evolution, and rapid acquisition of a novel digestive function by the female reproductive tract points to a novel coevolutionary mechanism of ejaculate-female interaction.

  20. DR-Integrator: a new analytic tool for integrating DNA copy number and gene expression data.

    Science.gov (United States)

    Salari, Keyan; Tibshirani, Robert; Pollack, Jonathan R

    2010-02-01

    DNA copy number alterations (CNA) frequently underlie gene expression changes by increasing or decreasing gene dosage. However, only a subset of genes with altered dosage exhibit concordant changes in gene expression. This subset is likely to be enriched for oncogenes and tumor suppressor genes, and can be identified by integrating these two layers of genome-scale data. We introduce DNA/RNA-Integrator (DR-Integrator), a statistical software tool to perform integrative analyses on paired DNA copy number and gene expression data. DR-Integrator identifies genes with significant correlations between DNA copy number and gene expression, and implements a supervised analysis that captures genes with significant alterations in both DNA copy number and gene expression between two sample classes. DR-Integrator is freely available for non-commercial use from the Pollack Lab at http://pollacklab.stanford.edu/ and can be downloaded as a plug-in application to Microsoft Excel and as a package for the R statistical computing environment. The R package is available under the name 'DRI' at http://cran.r-project.org/. An example analysis using DR-Integrator is included as supplemental material. Supplementary data are available at Bioinformatics online.

  1. Selection of Suitable Endogenous Reference Genes for Relative Copy Number Detection in Sugarcane

    Directory of Open Access Journals (Sweden)

    Bantong Xue

    2014-05-01

    Full Text Available Transgene copy number has a great impact on the expression level and stability of exogenous gene in transgenic plants. Proper selection of endogenous reference genes is necessary for detection of genetic components in genetically modification (GM crops by quantitative real-time PCR (qPCR or by qualitative PCR approach, especially in sugarcane with polyploid and aneuploid genomic structure. qPCR technique has been widely accepted as an accurate, time-saving method on determination of copy numbers in transgenic plants and on detection of genetically modified plants to meet the regulatory and legislative requirement. In this study, to find a suitable endogenous reference gene and its real-time PCR assay for sugarcane (Saccharum spp. hybrids DNA content quantification, we evaluated a set of potential “single copy” genes including P4H, APRT, ENOL, CYC, TST and PRR, through qualitative PCR and absolute quantitative PCR. Based on copy number comparisons among different sugarcane genotypes, including five S. officinarum, one S. spontaneum and two S. spp. hybrids, these endogenous genes fell into three groups: ENOL-3—high copy number group, TST-1 and PRR-1—medium copy number group, P4H-1, APRT-2 and CYC-2—low copy number group. Among these tested genes, P4H, APRT and CYC were the most stable, while ENOL and TST were the least stable across different sugarcane genotypes. Therefore, three primer pairs of P4H-3, APRT-2 and CYC-2 were then selected as the suitable reference gene primer pairs for sugarcane. The test of multi-target reference genes revealed that the APRT gene was a specific amplicon, suggesting this gene is the most suitable to be used as an endogenous reference target for sugarcane DNA content quantification. These results should be helpful for establishing accurate and reliable qualitative and quantitative PCR analysis of GM sugarcane.

  2. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de

    2012-01-01

    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  3. Integrative analysis of copy number alteration and gene expression profiling in ovarian clear cell adenocarcinoma.

    Science.gov (United States)

    Sung, Chang Ohk; Choi, Chel Hun; Ko, Young-Hyeh; Ju, Hyunjeong; Choi, Yoon-La; Kim, Nyunsu; Kang, So Young; Ha, Sang Yun; Choi, Kyusam; Bae, Duk-Soo; Lee, Jeong-Won; Kim, Tae-Joong; Song, Sang Yong; Kim, Byoung-Gie

    2013-05-01

    Ovarian clear cell adenocarcinoma (Ov-CCA) is a distinctive subtype of ovarian epithelial carcinoma. In this study, we performed array comparative genomic hybridization (aCGH) and paired gene expression microarray of 19 fresh-frozen samples and conducted integrative analysis. For the copy number alterations, significantly amplified regions (false discovery rate [FDR] q genes demonstrating frequent copy number alterations (>25% of samples) that correlated with gene expression (FDR genes were mainly located on 8p11.21, 8p21.2-p21.3, 8q22.1, 8q24.3, 17q23.2-q23.3, 19p13.3, and 19p13.11. Among the regions, 8q24.3 was found to contain the most genes (30 of 94 genes) including PTK2. The 8q24.3 region was indicated as the most significant region, as supported by copy number, GISTIC, and integrative analysis. Pathway analysis using differentially expressed genes on 8q24.3 revealed several major nodes, including PTK2. In conclusion, we identified a set of 94 candidate genes with frequent copy number alterations that correlated with gene expression. Specific chromosomal alterations, such as the 8q24.3 gain containing PTK2, could be a therapeutic target in a subset of Ov-CCAs. Copyright © 2013. Published by Elsevier Inc.

  4. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  5. Dynamic changes in functional gene copy numbers and microbial communities during degradation of pyrene in soils

    International Nuclear Information System (INIS)

    Peng Jingjing; Cai Chao; Qiao Min; Li Hong; Zhu Yongguan

    2010-01-01

    This study investigates the dynamics of pyrene degradation rates, microbial communities, and functional gene copy numbers during the incubation of pyrene-spiked soils. Spiking pyrene to the soil was found to have negligible effects on the bacterial community present. Our results demonstrated that there was a significant difference in nidA gene copy numbers between sampling dates in QZ soil. Mycobacterium 16S rDNA clone libraries showed that more than 90% mycobacteria detected were closely related to fast-growing PAH-degrading Mycobacterium in pyrene-spiked soil, while other sequences related to slow-growing Mycobacterium were only detected in the control soil. It is suggested that nidA gene copy number and fast-growing PAH-degrading Mycobacterium could be used as indicators to predict pyrene contamination and its degradation activity in soils. - nidA gene and fast-growing PAH-degrading Mycobacterium can serve as indicators for pyrene contamination.

  6. Gene duplication and fragmentation in the zebra finch major histocompatibility complex

    Directory of Open Access Journals (Sweden)

    Burt David W

    2010-04-01

    Full Text Available Abstract Background Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. Results The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. Conclusion The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving

  7. Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

    International Nuclear Information System (INIS)

    Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja; Tan, Qihua; Jochumsen, Kirsten; Fritzner, Niels; Brusgaard, Klaus; Dahlgaard, Jesper; Kruse, Torben A.

    2006-01-01

    The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips was three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation

  8. TOP1 gene copy numbers are increased in cancers of the bile duct and pancreas

    DEFF Research Database (Denmark)

    Grunnet, Mie; Calatayud, Dan; Schultz, Nicolai Aa.

    2015-01-01

    ) poison. Top1 protein, TOP1 gene copy number and mRNA expression, respectively, have been proposed as predictive biomarkers of response to irinotecan in other cancers. Here we investigate the occurrence of TOP1 gene aberrations in cancers of the bile ducts and pancreas. Material and methods. TOP1...

  9. Gene duplication, loss and selection in the evolution of saxitoxin biosynthesis in alveolates.

    Science.gov (United States)

    Murray, Shauna A; Diwan, Rutuja; Orr, Russell J S; Kohli, Gurjeet S; John, Uwe

    2015-11-01

    A group of marine dinoflagellates (Alveolata, Eukaryota), consisting of ∼10 species of the genus Alexandrium, Gymnodinium catenatum and Pyrodinium bahamense, produce the toxin saxitoxin and its analogues (STX), which can accumulate in shellfish, leading to ecosystem and human health impacts. The genes, sxt, putatively involved in STX biosynthesis, have recently been identified, however, the evolution of these genes within dinoflagellates is not clear. There are two reasons for this: uncertainty over the phylogeny of dinoflagellates; and that the sxt genes of many species of Alexandrium and other dinoflagellate genera are not known. Here, we determined the phylogeny of STX-producing and other dinoflagellates based on a concatenated eight-gene alignment. We determined the presence, diversity and phylogeny of sxtA, domains A1 and A4 and sxtG in 52 strains of Alexandrium, and a further 43 species of dinoflagellates and thirteen other alveolates. We confirmed the presence and high sequence conservation of sxtA, domain A4, in 40 strains (35 Alexandrium, 1 Pyrodinium, 4 Gymnodinium) of 8 species of STX-producing dinoflagellates, and absence from non-producing species. We found three paralogs of sxtA, domain A1, and a widespread distribution of sxtA1 in non-STX producing dinoflagellates, indicating duplication events in the evolution of this gene. One paralog, clade 2, of sxtA1 may be particularly related to STX biosynthesis. Similarly, sxtG appears to be generally restricted to STX-producing species, while three amidinotransferase gene paralogs were found in dinoflagellates. We investigated the role of positive (diversifying) selection following duplication in sxtA1 and sxtG, and found negative selection in clades of sxtG and sxtA1, clade 2, suggesting they were functionally constrained. Significant episodic diversifying selection was found in some strains in clade 3 of sxtA1, a clade that may not be involved in STX biosynthesis, indicating pressure for diversification

  10. XX male sex reversal with genital abnormalities associated with a de novo SOX3 gene duplication.

    Science.gov (United States)

    Moalem, Sharon; Babul-Hirji, Riyana; Stavropolous, Dmitri J; Wherrett, Diane; Bägli, Darius J; Thomas, Paul; Chitayat, David

    2012-07-01

    Differentiation of the bipotential gonad into testis is initiated by the Y chromosome-linked gene SRY (Sex-determining Region Y) through upregulation of its autosomal direct target gene SOX9 (Sry-related HMG box-containing gene 9). Sequence and chromosome homology studies have shown that SRY most probably evolved from SOX3, which in humans is located at Xq27.1. Mutations causing SOX3 loss-of-function do not affect the sex determination in mice or humans. However, transgenic mouse studies have shown that ectopic expression of Sox3 in the bipotential gonad results in upregulation of Sox9, resulting in testicular induction and XX male sex reversal. However, the mechanism by which these rearrangements cause sex reversal and the frequency with which they are associated with disorders of sex development remains unclear. Rearrangements of the SOX3 locus were identified recently in three cases of human XX male sex reversal. We report on a case of XX male sex reversal associated with a novel de novo duplication of the SOX3 gene. These data provide additional evidence that SOX3 gain-of-function in the XX bipotential gonad causes XX male sex reversal and further support the hypothesis that SOX3 is the evolutionary antecedent of SRY. Copyright © 2012 Wiley Periodicals, Inc.

  11. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    International Nuclear Information System (INIS)

    Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.

    2009-01-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  12. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    Energy Technology Data Exchange (ETDEWEB)

    Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)

    2009-10-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.

  13. Resolution and reconciliation of non-binary gene trees with transfers, duplications and losses.

    Science.gov (United States)

    Jacox, Edwin; Weller, Mathias; Tannier, Eric; Scornavacca, Celine

    2017-04-01

    Gene trees reconstructed from sequence alignments contain poorly supported branches when the phylogenetic signal in the sequences is insufficient to determine them all. When a species tree is available, the signal of gains and losses of genes can be used to correctly resolve the unsupported parts of the gene history. However finding a most parsimonious binary resolution of a non-binary tree obtained by contracting the unsupported branches is NP-hard if transfer events are considered as possible gene scale events, in addition to gene origination, duplication and loss. We propose an exact, parameterized algorithm to solve this problem in single-exponential time, where the parameter is the number of connected branches of the gene tree that show low support from the sequence alignment or, equivalently, the maximum number of children of any node of the gene tree once the low-support branches have been collapsed. This improves on the best known algorithm by an exponential factor. We propose a way to choose among optimal solutions based on the available information. We show the usability of this principle on several simulated and biological datasets. The results are comparable in quality to several other tested methods having similar goals, but our approach provides a lower running time and a guarantee that the produced solution is optimal. Our algorithm has been integrated into the ecceTERA phylogeny package, available at http://mbb.univ-montp2.fr/MBB/download_sources/16__ecceTERA and which can be run online at http://mbb.univ-montp2.fr/MBB/subsection/softExec.php?soft=eccetera . celine.scornavacca@umontpellier.fr. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  14. Low AMY1 Gene Copy Number Is Associated with Increased Body Mass Index in Prepubertal Boys.

    Directory of Open Access Journals (Sweden)

    M Loredana Marcovecchio

    Full Text Available Genome-wide association studies have identified more than 60 single nucleotide polymorphisms associated with Body Mass Index (BMI. Additional genetic variants, such as copy number variations (CNV, have also been investigated in relation to BMI. Recently, the highly polymorphic CNV in the salivary amylase (AMY1 gene, encoding an enzyme implicated in the first step of starch digestion, has been associated with obesity in adults and children. We assessed the potential association between AMY1 copy number and a wide range of BMI in a population of Italian school-children.744 children (354 boys, 390 girls, mean age (±SD: 8.4±1.4years underwent anthropometric assessments (height, weight and collection of saliva samples for DNA extraction. AMY1 copies were evaluated by quantitative PCR.A significant increase of BMI z-score by decreasing AMY1 copy number was observed in boys (β: -0.117, p = 0.033, but not in girls. Similarly, waist circumference (β: -0.155, p = 0.003, adjusted for age was negatively influenced by AMY1 copy number in boys. Boys with 8 or more AMY1 copy numbers presented a significant lower BMI z-score (p = 0.04 and waist circumference (p = 0.01 when compared to boys with less than 8 copy numbers.In this pediatric-only, population-based study, a lower AMY1 copy number emerged to be associated with increased BMI in boys. These data confirm previous findings from adult studies and support a potential role of a higher copy number of the salivary AMY1 gene in protecting from excess weight gain.

  15. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Gene Duplication Leads to Altered Membrane Topology of a Cytochrome P450 Enzyme in Seed Plants.

    Science.gov (United States)

    Renault, Hugues; De Marothy, Minttu; Jonasson, Gabriella; Lara, Patricia; Nelson, David R; Nilsson, IngMarie; André, François; von Heijne, Gunnar; Werck-Reichhart, Danièle

    2017-08-01

    Evolution of the phenolic metabolism was critical for the transition of plants from water to land. A cytochrome P450, CYP73, with cinnamate 4-hydroxylase (C4H) activity, catalyzes the first plant-specific and rate-limiting step in this pathway. The CYP73 gene is absent from green algae, and first detected in bryophytes. A CYP73 duplication occurred in the ancestor of seed plants and was retained in Taxaceae and most angiosperms. In spite of a clear divergence in primary sequence, both paralogs can fulfill comparable cinnamate hydroxylase roles both in vitro and in vivo. One of them seems dedicated to the biosynthesis of lignin precursors. Its N-terminus forms a single membrane spanning helix and its properties and length are highly constrained. The second is characterized by an elongated and variable N-terminus, reminiscent of ancestral CYP73s. Using as proxies the Brachypodium distachyon proteins, we show that the elongation of the N-terminus does not result in an altered subcellular localization, but in a distinct membrane topology. Insertion in the membrane of endoplasmic reticulum via a double-spanning open hairpin structure allows reorientation to the lumen of the catalytic domain of the protein. In agreement with participation to a different functional unit and supramolecular organization, the protein displays modified heme proximal surface. These data suggest the evolution of divergent C4H enzymes feeding different branches of the phenolic network in seed plants. It shows that specialization required for retention of gene duplicates may result from altered protein topology rather than change in enzyme activity. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    OpenAIRE

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  18. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    OpenAIRE

    Thomas D Cuypers; Paulien Hogeweg

    2014-01-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  19. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  20. Functional analysis of duplicated Symbiosis Receptor Kinase (SymRK) genes during nodulation and mycorrhizal infection in soybean (Glycine max).

    Science.gov (United States)

    Indrasumunar, Arief; Wilde, Julia; Hayashi, Satomi; Li, Dongxue; Gresshoff, Peter M

    2015-03-15

    Association between legumes and rhizobia results in the formation of root nodules, where symbiotic nitrogen fixation occurs. The early stages of this association involve a complex of signalling events between the host and microsymbiont. Several genes dealing with early signal transduction have been cloned, and one of them encodes the leucine-rich repeat (LRR) receptor kinase (SymRK; also termed NORK). The Symbiosis Receptor Kinase gene is required by legumes to establish a root endosymbiosis with Rhizobium bacteria as well as mycorrhizal fungi. Using degenerate primer and BAC sequencing, we cloned duplicated SymRK homeologues in soybean called GmSymRKα and GmSymRKβ. These duplicated genes have high similarity of nucleotide (96%) and amino acid sequence (95%). Sequence analysis predicted a malectin-like domain within the extracellular domain of both genes. Several putative cis-acting elements were found in promoter regions of GmSymRKα and GmSymRKβ, suggesting a participation in lateral root development, cell division and peribacteroid membrane formation. The mutant of SymRK genes is not available in soybean; therefore, to know the functions of these genes, RNA interference (RNAi) of these duplicated genes was performed. For this purpose, RNAi construct of each gene was generated and introduced into the soybean genome by Agrobacterium rhizogenes-mediated hairy root transformation. RNAi of GmSymRKβ gene resulted in an increased reduction of nodulation and mycorrhizal infection than RNAi of GmSymRKα, suggesting it has the major activity of the duplicated gene pair. The results from the important crop legume soybean confirm the joint phenotypic action of GmSymRK genes in both mycorrhizal and rhizobial infection seen in model legumes. Copyright © 2015 Elsevier GmbH. All rights reserved.

  1. Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine.

    Science.gov (United States)

    Tang, Wei; Newton, Ronald J; Weidner, Douglas A

    2007-01-01

    An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.

  2. The evolution and appearance of C3 duplications in fish originate an exclusive teleost c3 gene form with anti-inflammatory activity.

    Directory of Open Access Journals (Sweden)

    Gabriel Forn-Cuní

    Full Text Available The complement system acts as a first line of defense and promotes organism homeostasis by modulating the fates of diverse physiological processes. Multiple copies of component genes have been previously identified in fish, suggesting a key role for this system in aquatic organisms. Herein, we confirm the presence of three different previously reported complement c3 genes (c3.1, c3.2, c3.3 and identify five additional c3 genes (c3.4, c3.5, c3.6, c3.7, c3.8 in the zebrafish genome. Additionally, we evaluate the mRNA expression levels of the different c3 genes during ontogeny and in different tissues under steady-state and inflammatory conditions. Furthermore, while reconciling the phylogenetic tree with the fish species tree, we uncovered an event of c3 duplication common to all teleost fishes that gave rise to an exclusive c3 paralog (c3.7 and c3.8. These paralogs showed a distinct ability to regulate neutrophil migration in response to injury compared with the other c3 genes and may play a role in maintaining the balance between inflammatory and homeostatic processes in zebrafish.

  3. Comparative genomic analysis reveals occurrence of genetic recombination in virulent Cryptosporidium hominis subtypes and telomeric gene duplications in Cryptosporidium parvum.

    Science.gov (United States)

    Guo, Yaqiong; Tang, Kevin; Rowe, Lori A; Li, Na; Roellig, Dawn M; Knipe, Kristine; Frace, Michael; Yang, Chunfu; Feng, Yaoyu; Xiao, Lihua

    2015-04-18

    Cryptosporidium hominis is a dominant species for human cryptosporidiosis. Within the species, IbA10G2 is the most virulent subtype responsible for all C. hominis-associated outbreaks in Europe and Australia, and is a dominant outbreak subtype in the United States. In recent yearsIaA28R4 is becoming a major new subtype in the United States. In this study, we sequenced the genomes of two field specimens from each of the two subtypes and conducted a comparative genomic analysis of the obtained sequences with those from the only fully sequenced Cryptosporidium parvum genome. Altogether, 8.59-9.05 Mb of Cryptosporidium sequences in 45-767 assembled contigs were obtained from the four specimens, representing 94.36-99.47% coverage of the expected genome. These genomes had complete synteny in gene organization and 96.86-97.0% and 99.72-99.83% nucleotide sequence similarities to the published genomes of C. parvum and C. hominis, respectively. Several major insertions and deletions were seen between C. hominis and C. parvum genomes, involving mostly members of multicopy gene families near telomeres. The four C. hominis genomes were highly similar to each other and divergent from the reference IaA25R3 genome in some highly polymorphic regions. Major sequence differences among the four specimens sequenced in this study were in the 5' and 3' ends of chromosome 6 and the gp60 region, largely the result of genetic recombination. The sequence similarity among specimens of the two dominant outbreak subtypes and genetic recombination in chromosome 6, especially around the putative virulence determinant gp60 region, suggest that genetic recombination plays a potential role in the emergence of hyper-transmissible C. hominis subtypes. The high sequence conservation between C. parvum and C. hominis genomes and significant differences in copy numbers of MEDLE family secreted proteins and insulinase-like proteases indicate that telomeric gene duplications could potentially contribute to

  4. Engineered promoters enable constant gene expression at any copy number in bacteria.

    Science.gov (United States)

    Segall-Shapiro, Thomas H; Sontag, Eduardo D; Voigt, Christopher A

    2018-04-01

    The internal environment of growing cells is variable and dynamic, making it difficult to introduce reliable parts, such as promoters, for genetic engineering. Here, we applied control-theoretic ideas to design promoters that maintained constant levels of expression at any copy number. Theory predicts that independence to copy number can be achieved by using an incoherent feedforward loop (iFFL) if the negative regulation is perfectly non-cooperative. We engineered iFFLs into Escherichia coli promoters using transcription-activator-like effectors (TALEs). These promoters had near-identical expression in different genome locations and plasmids, even when their copy number was perturbed by genomic mutations or changes in growth medium composition. We applied the stabilized promoters to show that a three-gene metabolic pathway to produce deoxychromoviridans could retain function without re-tuning when the stabilized-promoter-driven genes were moved from a plasmid into the genome.

  5. A survey of innovation through duplication in the reduced genomes of twelve parasites.

    Directory of Open Access Journals (Sweden)

    Jeremy D DeBarry

    Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that

  6. A sparse regulatory network of copy-number driven gene expression reveals putative breast cancer oncogenes.

    Science.gov (United States)

    Yuan, Yinyin; Curtis, Christina; Caldas, Carlos; Markowetz, Florian

    2012-01-01

    Copy number aberrations are recognized to be important in cancer as they may localize to regions harboring oncogenes or tumor suppressors. Such genomic alterations mediate phenotypic changes through their impact on expression. Both cis- and transacting alterations are important since they may help to elucidate putative cancer genes. However, amidst numerous passenger genes, trans-effects are less well studied due to the computational difficulty in detecting weak and sparse signals in the data, and yet may influence multiple genes on a global scale. We propose an integrative approach to learn a sparse interaction network of DNA copy-number regions with their downstream transcriptional targets in breast cancer. With respect to goodness of fit on both simulated and real data, the performance of sparse network inference is no worse than other state-of-the-art models but with the advantage of simultaneous feature selection and efficiency. The DNA-RNA interaction network helps to distinguish copy-number driven expression alterations from those that are copy-number independent. Further, our approach yields a quantitative copy-number dependency score, which distinguishes cis- versus trans-effects. When applied to a breast cancer data set, numerous expression profiles were impacted by cis-acting copy-number alterations, including several known oncogenes such as GRB7, ERBB2, and LSM1. Several trans-acting alterations were also identified, impacting genes such as ADAM2 and BAGE, which warrant further investigation. An R package named lol is available from www.markowetzlab.org/software/lol.html.

  7. Mirror-image duplication of the primary axis and heart in Xenopus embryos by the overexpression of Msx-1 gene.

    Science.gov (United States)

    Chen, Y; Solursh, M

    1995-10-01

    The Msx-1 gene (formerly known as Hox-7) is a member of a discrete subclass of homeobox-containing genes. Examination of the expression pattern of Msx-1 in murine and avian embryos suggests that this gene may be involved in the regionalization of the medio-lateral axis during earlier development. We have examined the possible functions of Xenopus Msx-1 during early Xenopus embryonic development by overexpression of the Msx-1 gene. Overexpression of Msx-1 causes a left-right mirror-image duplication of primary axial structures, including notochord, neural tube, somites, suckers, and foregut. The embryonic developing heart is also mirror-image duplicated, including looping directions and polarity. These results indicate that Msx-1 may be involved in the mesoderm formation as well as left-right patterning in the early Xenopus embryonic development.

  8. Nonparametric testing for DNA copy number induced differential mRNA gene expression

    NARCIS (Netherlands)

    van Wieringen, W.N.; van de Wiel, M.A.

    2009-01-01

    The central dogma of molecular biology relates DNA with mRNA. Array CGH measures DNA copy number and gene expression microarrays measure the amount of mRNA. Methods that integrate data from these two platforms may uncover meaningful biological relationships that further our understanding of cancer.

  9. RUBIC identifies driver genes by detecting recurrent DNA copy number breaks

    NARCIS (Netherlands)

    van Dyk, H.O.; Hoogstraat, M; ten Hoeve, J; Reinders, M.J.T.; Wessels, L.F.A.

    2016-01-01

    The frequent recurrence of copy number aberrations across tumour samples is a reliable hallmark of certain cancer driver genes. However, state-of-the-art algorithms for detecting recurrent aberrations fail to detect several known drivers. In this study, we propose RUBIC, an approach that detects

  10. Diversity in copy number and structure of a silkworm morphogenetic gene as a result of domestication.

    Science.gov (United States)

    Sakudoh, Takashi; Nakashima, Takeharu; Kuroki, Yoko; Fujiyama, Asao; Kohara, Yuji; Honda, Naoko; Fujimoto, Hirofumi; Shimada, Toru; Nakagaki, Masao; Banno, Yutaka; Tsuchida, Kozo

    2011-03-01

    The carotenoid-binding protein (CBP) of the domesticated silkworm, Bombyx mori, a major determinant of cocoon color, is likely to have been substantially influenced by domestication of this species. We analyzed the structure of the CBP gene in multiple strains of B. mori, in multiple individuals of the wild silkworm, B. mandarina (the putative wild ancestor of B. mori), and in a number of other lepidopterans. We found the CBP gene copy number in genomic DNA to vary widely among B. mori strains, ranging from 1 to 20. The copies of CBP are of several types, based on the presence of a retrotransposon or partial deletion of the coding sequence. In contrast to B. mori, B. mandarina was found to possess a single copy of CBP without the retrotransposon insertion, regardless of habitat. Several other lepidopterans were found to contain sequences homologous to CBP, revealing that this gene is evolutionarily conserved in the lepidopteran lineage. Thus, domestication can generate significant diversity of gene copy number and structure over a relatively short evolutionary time. © 2011 by the Genetics Society of America

  11. Dietary Variation and Evolution of Gene Copy Number among Dog Breeds.

    Directory of Open Access Journals (Sweden)

    Taylor Reiter

    Full Text Available Prolonged human interactions and artificial selection have influenced the genotypic and phenotypic diversity among dog breeds. Because humans and dogs occupy diverse habitats, ecological contexts have likely contributed to breed-specific positive selection. Prior to the advent of modern dog-feeding practices, there was likely substantial variation in dietary landscapes among disparate dog breeds. As such, we investigated one type of genetic variant, copy number variation, in three metabolic genes: glucokinase regulatory protein (GCKR, phytanol-CoA 2-hydroxylase (PHYH, and pancreatic α-amylase 2B (AMY2B. These genes code for proteins that are responsible for metabolizing dietary products that originate from distinctly different food types: sugar, meat, and starch, respectively. After surveying copy number variation among dogs with diverse dietary histories, we found no correlation between diet and positive selection in either GCKR or PHYH. Although it has been previously demonstrated that dogs experienced a copy number increase in AMY2B relative to wolves during or after the dog domestication process, we demonstrate that positive selection continued to act on amylase copy number in dog breeds that consumed starch-rich diets in time periods after domestication. Furthermore, we found that introgression with wolves is not responsible for deterioration of positive selection on AMY2B among diverse dog breeds. Together, this supports the hypothesis that the amylase copy number expansion is found universally in dogs.

  12. Cumulative Impact of Polychlorinated Biphenyl and Large Chromosomal Duplications on DNA Methylation, Chromatin, and Expression of Autism Candidate Genes.

    Science.gov (United States)

    Dunaway, Keith W; Islam, M Saharul; Coulson, Rochelle L; Lopez, S Jesse; Vogel Ciernia, Annie; Chu, Roy G; Yasui, Dag H; Pessah, Isaac N; Lott, Paul; Mordaunt, Charles; Meguro-Horike, Makiko; Horike, Shin-Ichi; Korf, Ian; LaSalle, Janine M

    2016-12-13

    Rare variants enriched for functions in chromatin regulation and neuronal synapses have been linked to autism. How chromatin and DNA methylation interact with environmental exposures at synaptic genes in autism etiologies is currently unclear. Using whole-genome bisulfite sequencing in brain tissue and a neuronal cell culture model carrying a 15q11.2-q13.3 maternal duplication, we find that significant global DNA hypomethylation is enriched over autism candidate genes and affects gene expression. The cumulative effect of multiple chromosomal duplications and exposure to the pervasive persistent organic pollutant PCB 95 altered methylation of more than 1,000 genes. Hypomethylated genes were enriched for H2A.Z, increased maternal UBE3A in Dup15q corresponded to reduced levels of RING1B, and bivalently modified H2A.Z was altered by PCB 95 and duplication. These results demonstrate the compounding effects of genetic and environmental insults on the neuronal methylome that converge upon dysregulation of chromatin and synaptic genes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  13. Biological consequences of ancient gene acquisition and duplication in the large genome soil bacterium, ""solibacter usitatus"" strain Ellin6076

    Energy Technology Data Exchange (ETDEWEB)

    Challacombe, Jean F [Los Alamos National Laboratory; Eichorst, Stephanie A [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Kuske, Cheryl R [Los Alamos National Laboratory; Hauser, Loren [ORNL; Land, Miriam [ORNL

    2009-01-01

    Bacterial genome sizes range from ca. 0.5 to 10Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Sequenced genomes of strains in the phylum Acidobacteria revealed that 'Solibacter usistatus' strain Ellin6076 harbors a 9.9 Mb genome. This large genome appears to have arisen by horizontal gene transfer via ancient bacteriophage and plasmid-mediated transduction, as well as widespread small-scale gene duplications. This has resulted in an increased number of paralogs that are potentially ecologically important (ecoparalogs). Low amino acid sequence identities among functional group members and lack of conserved gene order and orientation in the regions containing similar groups of paralogs suggest that most of the paralogs were not the result of recent duplication events. The genome sizes of cultured subdivision 1 and 3 strains in the phylum Acidobacteria were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 1 were estimated to have smaller genome sizes ranging from ca. 2.0 to 4.8 Mb, whereas members of subdivision 3 had slightly larger genomes, from ca. 5.8 to 9.9 Mb. It is hypothesized that the large genome of strain Ellin6076 encodes traits that provide a selective metabolic, defensive and regulatory advantage in the variable soil environment.

  14. Alpha-defensin DEFA1A3 gene copy number elevation in Danish Crohn's disease patients

    DEFF Research Database (Denmark)

    Jespersgaard, Cathrine; Fode, Peder; Dybdahl, Marianne

    2011-01-01

    BACKGROUND AND PURPOSE OF STUDY: Extensive copy number variation is observed for the DEFA1A3 gene encoding alpha-defensins 1-3. The objective of this study was to determine the involvement of alpha-defensins in colonic tissue from Crohn's disease (CD) patients and the possible genetic association...... of DEFA1A3 with CD. METHODS: Two-hundred and forty ethnic Danish CD patients were included in the study. Reverse transcriptase PCR assays determined DEFA1A3 expression in colonic tissue from a subset of patients. Immunohistochemical analysis identified alpha-defensin peptides in colonic tissue. Copy...

  15. Gene copy number reduction in the azoospermia factor c (AZFc) region and its effect on total motile sperm count

    NARCIS (Netherlands)

    Noordam, Michiel J.; Westerveld, G. Henrike; Hovingh, Suzanne E.; van Daalen, Saskia K. M.; Korver, Cindy M.; van der Veen, Fulco; van Pelt, Ans M. M.; Repping, Sjoerd

    2011-01-01

    The azoospermia factor c (AZFc) region harbors multi-copy genes that are expressed in the testis. Deletions of the AZFc region lead to reduced copy numbers of these genes. Four (partial) AZFc deletions have been described of which the b2/b4 and gr/gr deletions affect semen quality. In most studies,

  16. Copy Number Deletion Has Little Impact on Gene Expression Levels in Racehorses

    Directory of Open Access Journals (Sweden)

    Kyung-Do Park

    2014-09-01

    Full Text Available Copy number variations (CNVs, important genetic factors for study of human diseases, may have as large of an effect on phenotype as do single nucleotide polymorphisms. Indeed, it is widely accepted that CNVs are associated with differential disease susceptibility. However, the relationships between CNVs and gene expression have not been characterized in the horse. In this study, we investigated the effects of copy number deletion in the blood and muscle transcriptomes of Thoroughbred racing horses. We identified a total of 1,246 CNVs of deletion polymorphisms using DNA re-sequencing data from 18 Thoroughbred racing horses. To discover the tendencies between CNV status and gene expression levels, we extracted CNVs of four Thoroughbred racing horses of which RNA sequencing was available. We found that 252 pairs of CNVs and genes were associated in the four horse samples. We did not observe a clear and consistent relationship between the deletion status of CNVs and gene expression levels before and after exercise in blood and muscle. However, we found some pairs of CNVs and associated genes that indicated relationships with gene expression levels: a positive relationship with genes responsible for membrane structure or cytoskeleton and a negative relationship with genes involved in disease. This study will lead to conceptual advances in understanding the relationship between CNVs and global gene expression in the horse.

  17. Expression Pattern Similarities Support the Prediction of Orthologs Retaining Common Functions after Gene Duplication Events1[OPEN

    Science.gov (United States)

    Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.

    2016-01-01

    The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025

  18. Clinical Omics Analysis of Colorectal Cancer Incorporating Copy Number Aberrations and Gene Expression Data

    Directory of Open Access Journals (Sweden)

    Tsuyoshi Yoshida

    2010-07-01

    Full Text Available Background: Colorectal cancer (CRC is one of the most frequently occurring cancers in Japan, and thus a wide range of methods have been deployed to study the molecular mechanisms of CRC. In this study, we performed a comprehensive analysis of CRC, incorporating copy number aberration (CRC and gene expression data. For the last four years, we have been collecting data from CRC cases and organizing the information as an “omics” study by integrating many kinds of analysis into a single comprehensive investigation. In our previous studies, we had experienced difficulty in finding genes related to CRC, as we observed higher noise levels in the expression data than in the data for other cancers. Because chromosomal aberrations are often observed in CRC, here, we have performed a combination of CNA analysis and expression analysis in order to identify some new genes responsible for CRC. This study was performed as part of the Clinical Omics Database Project at Tokyo Medical and Dental University. The purpose of this study was to investigate the mechanism of genetic instability in CRC by this combination of expression analysis and CNA, and to establish a new method for the diagnosis and treatment of CRC. Materials and methods: Comprehensive gene expression analysis was performed on 79 CRC cases using an Affymetrix Gene Chip, and comprehensive CNA analysis was performed using an Affymetrix DNA Sty array. To avoid the contamination of cancer tissue with normal cells, laser micro-dissection was performed before DNA/RNA extraction. Data analysis was performed using original software written in the R language. Result: We observed a high percentage of CNA in colorectal cancer, including copy number gains at 7, 8q, 13 and 20q, and copy number losses at 8p, 17p and 18. Gene expression analysis provided many candidates for CRC-related genes, but their association with CRC did not reach the level of statistical significance. The combination of CNA and gene

  19. Duplication in DNA Sequences

    Science.gov (United States)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  20. New insights into the nutritional regulation of gluconeogenesis in carnivorous rainbow trout (Oncorhynchus mykiss): a gene duplication trail.

    Science.gov (United States)

    Marandel, Lucie; Seiliez, Iban; Véron, Vincent; Skiba-Cassy, Sandrine; Panserat, Stéphane

    2015-07-01

    The rainbow trout (Oncorhynchus mykiss) is considered to be a strictly carnivorous fish species that is metabolically adapted for high catabolism of proteins and low utilization of dietary carbohydrates. This species consequently has a "glucose-intolerant" phenotype manifested by persistent hyperglycemia when fed a high-carbohydrate diet. Gluconeogenesis in adult fish is also poorly, if ever, regulated by carbohydrates, suggesting that this metabolic pathway is involved in this specific phenotype. In this study, we hypothesized that the fate of duplicated genes after the salmonid-specific 4th whole genome duplication (Ss4R) may have led to adaptive innovation and that their study might provide new elements to enhance our understanding of gluconeogenesis and poor dietary carbohydrate use in this species. Our evolutionary analysis of gluconeogenic genes revealed that pck1, pck2, fbp1a, and g6pca were retained as singletons after Ss4r, while g6pcb1, g6pcb2, and fbp1b ohnolog pairs were maintained. For all genes, duplication may have led to sub- or neofunctionalization. Expression profiles suggest that the gluconeogenesis pathway remained active in trout fed a no-carbohydrate diet. When trout were fed a high-carbohydrate diet (30%), most of the gluconeogenic genes were non- or downregulated, except for g6pbc2 ohnologs, whose RNA levels were surprisingly increased. This study demonstrates that Ss4R in trout involved adaptive innovation via gene duplication and via the outcome of the resulting ohnologs. Indeed, maintenance of ohnologous g6pcb2 pair may contribute in a significant way to the glucose-intolerant phenotype of trout and may partially explain its poor use of dietary carbohydrates. Copyright © 2015 the American Physiological Society.

  1. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template.

    Science.gov (United States)

    Gouran, Hossein; Chakraborty, Sandeep; Rao, Basuthkar J; Asgeirsson, Bjarni; Dandekar, Abhaya

    2014-01-01

    Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC), implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF). In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

  2. Copy number variations in "classical" obesity candidate genes are not frequently associated with severe early-onset obesity in children.

    Science.gov (United States)

    Windholz, Jan; Kovacs, Peter; Schlicke, Marina; Franke, Christin; Mahajan, Anubha; Morris, Andrew P; Lemke, Johannes R; Klammt, Jürgen; Kiess, Wieland; Schöneberg, Torsten; Pfäffle, Roland; Körner, Antje

    2017-05-01

    Obesity is genetically heterogeneous and highly heritable, although polymorphisms explain the phenotype in only a small proportion of obese children. We investigated the presence of copy number variations (CNVs) in "classical" genes known to be associated with (monogenic) early-onset obesity in children. In 194 obese Caucasian children selected for early-onset and severe obesity from our obesity cohort we screened for deletions and/or duplications by multiplex ligation-dependent probe amplification reaction (MLPA). As we found one MLPA probe to interfere with a polymorphism in SIM1 we investigated its association with obesity and other phenotypic traits in our extended cohort of 2305 children. In the selected subset of most severely obese children, we did not find CNV with MLPA in POMC, LEP, LEPR, MC4R, MC3R or MC2R genes. However, one SIM1 probe located at exon 9 gave signals suggestive for SIM1 insufficiency in 52 patients. Polymerase chain reaction (PCR) analysis identified this as a false positive result due to interference with single nucleotide polymorphism (SNP) rs3734354/rs3734355. We, therefore, investigated for associations of this polymorphism with obesity and metabolic traits in our extended cohort. We found rs3734354/rs3734355 to be associated with body mass index-standard deviation score (BMI-SDS) (p = 0.003), but not with parameters of insulin metabolism, blood pressure or food intake. In our modest sample of severely obese children, we were unable to find CNVs in well-established monogenic obesity genes. Nevertheless, we found an association of rs3734354 in SIM1 with obesity of early-onset type in children, although not with obesity-related traits.

  3. Integrative analysis of copy number and gene expression data suggests novel pathogenetic mechanisms in primary myelofibrosis.

    Science.gov (United States)

    Salati, Simona; Zini, Roberta; Nuzzo, Simona; Guglielmelli, Paola; Pennucci, Valentina; Prudente, Zelia; Ruberti, Samantha; Rontauroli, Sebastiano; Norfo, Ruggiero; Bianchi, Elisa; Bogani, Costanza; Rotunno, Giada; Fanelli, Tiziana; Mannarelli, Carmela; Rosti, Vittorio; Salmoiraghi, Silvia; Pietra, Daniela; Ferrari, Sergio; Barosi, Giovanni; Rambaldi, Alessandro; Cazzola, Mario; Bicciato, Silvio; Tagliafico, Enrico; Vannucchi, Alessandro M; Manfredini, Rossella

    2016-04-01

    Primary myelofibrosis (PMF) is a Myeloproliferative Neoplasm (MPN) characterized by megakaryocyte hyperplasia, progressive bone marrow fibrosis, extramedullary hematopoiesis and transformation to Acute Myeloid Leukemia (AML). A number of phenotypic driver (JAK2, CALR, MPL) and additional subclonal mutations have been described in PMF, pointing to a complex genomic landscape. To discover novel genomic lesions that can contribute to disease phenotype and/or development, gene expression and copy number signals were integrated and several genomic abnormalities leading to a concordant alteration in gene expression levels were identified. In particular, copy number gain in the polyamine oxidase (PAOX) gene locus was accompanied by a coordinated transcriptional up-regulation in PMF patients. PAOX inhibition resulted in rapid cell death of PMF progenitor cells, while sparing normal cells, suggesting that PAOX inhibition could represent a therapeutic strategy to selectively target PMF cells without affecting normal hematopoietic cells' survival. Moreover, copy number loss in the chromatin modifier HMGXB4 gene correlates with a concomitant transcriptional down-regulation in PMF patients. Interestingly, silencing of HMGXB4 induces megakaryocyte differentiation, while inhibiting erythroid development, in human hematopoietic stem/progenitor cells. These results highlight a previously un-reported, yet potentially interesting role of HMGXB4 in the hematopoietic system and suggest that genomic and transcriptional imbalances of HMGXB4 could contribute to the aberrant expansion of the megakaryocytic lineage that characterizes PMF patients. © 2015 UICC.

  4. Evolutionary history of glucose-6-phosphatase encoding genes in vertebrate lineages: towards a better understanding of the functions of multiple duplicates.

    Science.gov (United States)

    Marandel, Lucie; Panserat, Stéphane; Plagnes-Juan, Elisabeth; Arbenoits, Eva; Soengas, José Luis; Bobe, Julien

    2017-05-02

    Glucose-6-phosphate (G6pc) is a key enzyme involved in the regulation of the glucose homeostasis. The present study aims at revisiting and clarifying the evolutionary history of g6pc genes in vertebrates. g6pc duplications happened by successive rounds of whole genome duplication that occurred during vertebrate evolution. g6pc duplicated before or around Osteichthyes/Chondrichthyes radiation, giving rise to g6pca and g6pcb as a consequence of the second vertebrate whole genome duplication. g6pca was lost after this duplication in Sarcopterygii whereas both g6pca and g6pcb then duplicated as a consequence of the teleost-specific whole genome duplication. One g6pca duplicate was lost after this duplication in teleosts. Similarly one g6pcb2 duplicate was lost at least in the ancestor of percomorpha. The analysis of the evolution of spatial expression patterns of g6pc genes in vertebrates showed that all g6pc were mainly expressed in intestine and liver whereas teleost-specific g6pcb2 genes were mainly and surprisingly expressed in brain and heart. g6pcb2b, one gene previously hypothesised to be involved in the glucose intolerant phenotype in trout, was unexpectedly up-regulated (as it was in liver) by carbohydrates in trout telencephalon without showing significant changes in other brain regions. This up-regulation is in striking contrast with expected glucosensing mechanisms suggesting that its positive response to glucose relates to specific unknown processes in this brain area. Our results suggested that the fixation and the divergence of g6pc duplicated genes during vertebrates' evolution may lead to adaptive novelty and probably to the emergence of novel phenotypes related to glucose homeostasis.

  5. FGFR3 gene mutation plus GRB10 gene duplication in a patient with achondroplasia plus growth delay with prenatal onset.

    Science.gov (United States)

    Yuan, Haiming; Huang, Linhuan; Hu, Xizi; Li, Qian; Sun, Xiaofang; Xie, Yingjun; Kong, Shu; Wang, Xiaoman

    2016-07-02

    Achondroplasia is a well-defined and common bone dysplasia. Genotype- and phenotype-level correlations have been found between the clinical symptoms of achondroplasia and achondroplasia-specific FGFR3 mutations. A 2-year-old boy with clinical features consistent with achondroplasia and Silver-Russell syndrome-like symptoms was found to carry a mutation in the fibroblast growth factor receptor-3 (FGFR3) gene at c.1138G > A (p.Gly380Arg) and a de novo 574 kb duplication at chromosome 7p12.1 that involved the entire growth-factor receptor bound protein 10 (GRB10) gene. Using quantitative real-time PCR analysis, GRB10 was over-expressed, and, using enzyme-linked immunosorbent assays for IGF1 and IGF-binding protein-3 (IGFBP3), we found that IGF1 and IGFBP3 were low-expressed in this patient. We demonstrate that a combination of uncommon, rare and exceptional molecular defects related to the molecular bases of particular birth defects can be analyzed and diagnosed to potentially explain the observed variability in the combination of molecular defects.

  6. iGC-an integrated analysis package of gene expression and copy number alteration.

    Science.gov (United States)

    Lai, Yi-Pin; Wang, Liang-Bo; Wang, Wei-An; Lai, Liang-Chuan; Tsai, Mong-Hsun; Lu, Tzu-Pin; Chuang, Eric Y

    2017-01-14

    With the advancement in high-throughput technologies, researchers can simultaneously investigate gene expression and copy number alteration (CNA) data from individual patients at a lower cost. Traditional analysis methods analyze each type of data individually and integrate their results using Venn diagrams. Challenges arise, however, when the results are irreproducible and inconsistent across multiple platforms. To address these issues, one possible approach is to concurrently analyze both gene expression profiling and CNAs in the same individual. We have developed an open-source R/Bioconductor package (iGC). Multiple input formats are supported and users can define their own criteria for identifying differentially expressed genes driven by CNAs. The analysis of two real microarray datasets demonstrated that the CNA-driven genes identified by the iGC package showed significantly higher Pearson correlation coefficients with their gene expression levels and copy numbers than those genes located in a genomic region with CNA. Compared with the Venn diagram approach, the iGC package showed better performance. The iGC package is effective and useful for identifying CNA-driven genes. By simultaneously considering both comparative genomic and transcriptomic data, it can provide better understanding of biological and medical questions. The iGC package's source code and manual are freely available at https://www.bioconductor.org/packages/release/bioc/html/iGC.html .

  7. Teleost Fish-Specific Preferential Retention of Pigmentation Gene-Containing Families After Whole Genome Duplications in Vertebrates

    Science.gov (United States)

    Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas

    2018-01-01

    Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177

  8. Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number.

    Science.gov (United States)

    Price, Ric N; Uhlemann, Anne-Catrin; Brockman, Alan; McGready, Rose; Ashley, Elizabeth; Phaipun, Lucy; Patel, Rina; Laing, Kenneth; Looareesuwan, Sornchai; White, Nicholas J; Nosten, François; Krishna, Sanjeev

    The borders of Thailand harbour the world's most multidrug resistant Plasmodium falciparum parasites. In 1984 mefloquine was introduced as treatment for uncomplicated falciparum malaria, but substantial resistance developed within 6 years. A combination of artesunate with mefloquine now cures more than 95% of acute infections. For both treatment regimens, the underlying mechanisms of resistance are not known. The relation between polymorphisms in the P falciparum multidrug resistant gene 1 (pfmdr1) and the in-vitro and in-vivo responses to mefloquine were assessed in 618 samples from patients with falciparum malaria studied prospectively over 12 years. pfmdr1 copy number was assessed by a robust real-time PCR assay. Single nucleotide polymorphisms of pfmdr1, P falciparum chloroquine resistance transporter gene (pfcrt) and P falciparum Ca2+ ATPase gene (pfATP6) were assessed by PCR-restriction fragment length polymorphism. Increased copy number of pfmdr1 was the most important determinant of in-vitro and in-vivo resistance to mefloquine, and also to reduced artesunate sensitivity in vitro. In a Cox regression model with control for known confounders, increased pfmdr1 copy number was associated with an attributable hazard ratio (AHR) for treatment failure of 6.3 (95% CI 2.9-13.8, p<0.001) after mefloquine monotherapy and 5.4 (2.0-14.6, p=0.001) after artesunate-mefloquine therapy. Single nucleotide polymorphisms in pfmdr1 were associated with increased mefloquine susceptibility in vitro, but not in vivo. Amplification in pfmdr1 is the main cause of resistance to mefloquine in falciparum malaria. Multidrug resistant P falciparum malaria is common in southeast Asia, but difficult to identify and treat. Genes that encode parasite transport proteins maybe involved in export of drugs and so cause resistance. In this study we show that increase in copy number of pfmdr1, a gene encoding a parasite transport protein, is the best overall predictor of treatment failure with

  9. The chimeric gene CHRFAM7A, a partial duplication of the CHRNA7 gene, is a dominant negative regulator of α7*nAChR function.

    Science.gov (United States)

    Araud, Tanguy; Graw, Sharon; Berger, Ralph; Lee, Michael; Neveu, Estele; Bertrand, Daniel; Leonard, Sherry

    2011-10-15

    The human α7 neuronal nicotinic acetylcholine receptor gene (CHRNA7) is a candidate gene for schizophrenia and an important drug target for cognitive deficits in the disorder. Activation of the α7*nAChR, results in opening of the channel and entry of mono- and divalent cations, including Ca(2+), that presynaptically participates to neurotransmitter release and postsynaptically to down-stream changes in gene expression. Schizophrenic patients have low levels of α7*nAChR, as measured by binding of the ligand [(125)I]-α-bungarotoxin (I-BTX). The structure of the gene, CHRNA7, is complex. During evolution, CHRNA7 was partially duplicated as a chimeric gene (CHRFAM7A), which is expressed in the human brain and elsewhere in the body. The association between a 2bp deletion in CHRFAM7A and schizophrenia suggested that this duplicate gene might contribute to cognitive impairment. To examine the putative contribution of CHRFAM7A on receptor function, co-expression of α7 and the duplicate genes was carried out in cell lines and Xenopus oocytes. Expression of the duplicate alone yielded protein expression but no functional receptor and co-expression with α7 caused a significant reduction of the amplitude of the ACh-evoked currents. Reduced current amplitude was not correlated with a reduction of I-BTX binding, suggesting the presence of non-functional (ACh-silent) receptors. This hypothesis is supported by a larger increase of the ACh-evoked current by the allosteric modulator 1-(5-chloro-2,4-dimethoxy-phenyl)-3-(5-methyl-isoxazol-3-yl)-urea (PNU-120596) in cells expressing the duplicate than in the control. These results suggest that CHRFAM7A acts as a dominant negative modulator of CHRNA7 function and is critical for receptor regulation in humans. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Positive selection and ancient duplications in the evolution of class B floral homeotic genes of orchids and grasses

    Directory of Open Access Journals (Sweden)

    Koch Marcus A

    2009-04-01

    Full Text Available Abstract Background Positive selection is recognized as the prevalence of nonsynonymous over synonymous substitutions in a gene. Models of the functional evolution of duplicated genes consider neofunctionalization as key to the retention of paralogues. For instance, duplicate transcription factors are specifically retained in plant and animal genomes and both positive selection and transcriptional divergence appear to have played a role in their diversification. However, the relative impact of these two factors has not been systematically evaluated. Class B MADS-box genes, comprising DEF-like and GLO-like genes, encode developmental transcription factors essential for establishment of perianth and male organ identity in the flowers of angiosperms. Here, we contrast the role of positive selection and the known divergence in expression patterns of genes encoding class B-like MADS-box transcription factors from monocots, with emphasis on the family Orchidaceae and the order Poales. Although in the monocots these two groups are highly diverse and have a strongly canalized floral morphology, there is no information on the role of positive selection in the evolution of their distinctive flower morphologies. Published research shows that in Poales, class B-like genes are expressed in stamens and in lodicules, the perianth organs whose identity might also be specified by class B-like genes, like the identity of the inner tepals of their lily-like relatives. In orchids, however, the number and pattern of expression of class B-like genes have greatly diverged. Results The DEF-like genes from Orchidaceae form four well-supported, ancient clades of orthologues. In contrast, orchid GLO-like genes form a single clade of ancient orthologues and recent paralogues. DEF-like genes from orchid clade 2 (OMADS3-like genes are under less stringent purifying selection than the other orchid DEF-like and GLO-like genes. In comparison with orchids, purifying selection

  11. An ancient history of gene duplications, fusions and losses in the evolution of APOBEC3 mutators in mammals

    Science.gov (United States)

    2012-01-01

    Background The APOBEC3 (A3) genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals) already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure. PMID:22640020

  12. Diversity in Copy Number and Structure of a Silkworm Morphogenetic Gene as a Result of Domestication

    OpenAIRE

    Sakudoh, Takashi; Nakashima, Takeharu; Kuroki, Yoko; Fujiyama, Asao; Kohara, Yuji; Honda, Naoko; Fujimoto, Hirofumi; Shimada, Toru; Nakagaki, Masao; Banno, Yutaka; Tsuchida, Kozo

    2011-01-01

    The carotenoid-binding protein (CBP) of the domesticated silkworm, Bombyx mori, a major determinant of cocoon color, is likely to have been substantially influenced by domestication of this species. We analyzed the structure of the CBP gene in multiple strains of B. mori, in multiple individuals of the wild silkworm, B. mandarina (the putative wild ancestor of B. mori), and in a number of other lepidopterans. We found the CBP gene copy number in genomic DNA to vary widely among B. mori strain...

  13. Allelic association, DNA resequencing and copy number variation at the metabotropic glutamate receptor GRM7 gene locus in bipolar disorder.

    Science.gov (United States)

    Kandaswamy, Radhika; McQuillin, Andrew; Curtis, David; Gurling, Hugh

    2014-06-01

    Genetic markers at the GRM7 gene have shown allelic association with bipolar disorder (BP) in several case-control samples including our own sample. In this report, we present results of resequencing the GRM7 gene in 32 bipolar samples and 32 random controls selected from 553 bipolar cases and 547 control samples (UCL1). Novel and potential etiological base pair changes discovered by resequencing were genotyped in the entire UCL case-control sample. We also report on the association between GRM7 and BP in a second sample of 593 patients and 642 controls (UCL2). The three most significantly associated SNPs in the original UCL1 BP GWAS sample were genotyped in the UCL2 sample, of which none were associated. After combining the genotype data for the two samples only two (rs1508724 and rs6769814) of the original three SNP markers remained significantly associated with BP. DNA sequencing revealed mutations in three cases which were absent in control subjects. A 3'-UTR SNP rs56173829 was found to be significantly associated with BP in the whole UCL sample (P = 0.035; OR = 0.482), the rare allele being less common in cases compared to controls. Bioinformatic analyses predicted a change in the centroid secondary structure of RNA and alterations in the miRNA binding sites for the mutated base of rs56173829. We also validated two deletions and a duplication within GRM7 using quantitative-PCR which provides further support for the pre-existing evidence that copy number variants at GRM7 may have a role in the etiology of BP. © 2014 The Authors. American Journal of Medical Genetics Part B: Neuropsychiatric Published by Wiley Periodicals, Inc.

  14. Duplication of the IGFBP-2 gene in teleost fish: protein structure and functionality conservation and gene expression divergence.

    Directory of Open Access Journals (Sweden)

    Jianfeng Zhou

    growth and development primarily by binding to and inhibiting IGF actions in vivo. The duplicated IGFBP-2 genes may provide additional flexibility in the regulation of IGF activities.

  15. Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

    Directory of Open Access Journals (Sweden)

    Giao Ngoc Nguyen

    2017-08-01

    Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

  16. Annelid Distal-less/Dlx duplications reveal varied post-duplication fates

    Directory of Open Access Journals (Sweden)

    Korchagina Natalia

    2011-08-01

    Full Text Available Abstract Background Dlx (Distal-less genes have various developmental roles and are widespread throughout the animal kingdom, usually occurring as single copy genes in non-chordates and as multiple copies in most chordate genomes. While the genomic arrangement and function of these genes is well known in vertebrates and arthropods, information about Dlx genes in other organisms is scarce. We investigate the presence of Dlx genes in several annelid species and examine Dlx gene expression in the polychaete Pomatoceros lamarckii. Results Two Dlx genes are present in P. lamarckii, Capitella teleta and Helobdella robusta. The C. teleta Dlx genes are closely linked in an inverted tail-to-tail orientation, reminiscent of the arrangement of vertebrate Dlx pairs, and gene conversion appears to have had a role in their evolution. The H. robusta Dlx genes, however, are not on the same genomic scaffold and display divergent sequences, while, if the P. lamarckii genes are linked in a tail-to-tail orientation they are a minimum of 41 kilobases apart and show no sign of gene conversion. No expression in P. lamarckii appendage development has been observed, which conflicts with the supposed conserved role of these genes in animal appendage development. These Dlx duplications do not appear to be annelid-wide, as the polychaete Platynereis dumerilii likely possesses only one Dlx gene. Conclusions On the basis of the currently accepted annelid phylogeny, we hypothesise that one Dlx duplication occurred in the annelid lineage after the divergence of P. dumerilii from the other lineages and these duplicates then had varied evolutionary fates in different species. We also propose that the ancestral role of Dlx genes is not related to appendage development.

  17. The positioning logic and copy number control of genes in bacteria under stress

    Science.gov (United States)

    Zhang, Qiucen; Austin, Robert; Vyawahare, Saurabh; Lau, Alexandra

    2013-03-01

    Escherichia coli (E. coli) cells when challenged with sublethal concentrations of the genotoxic antibiotic ciprofloxacin cease to divide and form long filaments which contain multiple bacterial chromosomes. These filaments are individual mesoscopic environmental niches which provide protection for a community of chromosomes (as opposed to cells) under mutagenic stress and can provide an evolutionary fitness advantage within the niche. We use comparative genomic hybridization to show that the mesoscopic niche evolves within 20 minutes of ciprofloxacin exposure via replication of multiple copies of genes expressing ATP dependent transporters. We show that this rapid genomic amplification is done in a time efficient manner via placement of the genes encoding the pumps near the origin of replication on the bacterial chromosome. The de-amplification of multiple copies back to the wild type number is a function of the duration is a function of the ciprofloxacin exposure duration: the longer the exposure, the slower the removal of the multiple copies. The project described was supported by the National Science Foundation and the National Cancer Institute

  18. Gene duplications and losses among vertebrate deoxyribonucleoside kinases of the non-TK1 Family

    DEFF Research Database (Denmark)

    Mutahir, Zeeshan; Christiansen, Louise Slot; Clausen, Anders R.

    2016-01-01

    , among vertebrates only four mammalian dNKs have been studied for their substrate specificity and kinetic properties. However, some vertebrates, such as fish, frogs, and birds, apparently possess a duplicated homolog of deoxycytidine kinase (dCK). In this study, we characterized a family of d...... substrate specificities and subcellular localization are likely the drivers behind the evolution of vertebrate dNKs...

  19. Systematic Prioritization and Integrative Analysis of Copy Number Variations in Schizophrenia Reveal Key Schizophrenia Susceptibility Genes

    Science.gov (United States)

    Luo, Xiongjian; Huang, Liang; Han, Leng; Luo, Zhenwu; Hu, Fang; Tieu, Roger; Gan, Lin

    2014-01-01

    Schizophrenia is a common mental disorder with high heritability and strong genetic heterogeneity. Common disease-common variants hypothesis predicts that schizophrenia is attributable in part to common genetic variants. However, recent studies have clearly demonstrated that copy number variations (CNVs) also play pivotal roles in schizophrenia susceptibility and explain a proportion of missing heritability. Though numerous CNVs have been identified, many of the regions affected by CNVs show poor overlapping among different studies, and it is not known whether the genes disrupted by CNVs contribute to the risk of schizophrenia. By using cumulative scoring, we systematically prioritized the genes affected by CNVs in schizophrenia. We identified 8 top genes that are frequently disrupted by CNVs, including NRXN1, CHRNA7, BCL9, CYFIP1, GJA8, NDE1, SNAP29, and GJA5. Integration of genes affected by CNVs with known schizophrenia susceptibility genes (from previous genetic linkage and association studies) reveals that many genes disrupted by CNVs are also associated with schizophrenia. Further protein-protein interaction (PPI) analysis indicates that protein products of genes affected by CNVs frequently interact with known schizophrenia-associated proteins. Finally, systematic integration of CNVs prioritization data with genetic association and PPI data identifies key schizophrenia candidate genes. Our results provide a global overview of genes impacted by CNVs in schizophrenia and reveal a densely interconnected molecular network of de novo CNVs in schizophrenia. Though the prioritized top genes represent promising schizophrenia risk genes, further work with different prioritization methods and independent samples is needed to confirm these findings. Nevertheless, the identified key candidate genes may have important roles in the pathogenesis of schizophrenia, and further functional characterization of these genes may provide pivotal targets for future therapeutics and

  20. Genome-wide gene copy number and expression analysis of primary gastric tumors and gastric cancer cell lines

    International Nuclear Information System (INIS)

    Junnila, Siina; Kokkola, Arto; Karjalainen-Lindsberg, Marja-Liisa; Puolakkainen, Pauli; Monni, Outi

    2010-01-01

    Gastric cancer is one of the most common malignancies worldwide and the second most common cause of cancer related death. Gene copy number alterations play an important role in the development of gastric cancer and a change in gene copy number is one of the main mechanisms for a cancer cell to control the expression of potential oncogenes and tumor suppressor genes. To highlight genes of potential biological and clinical relevance in gastric cancer, we carried out a systematic array-based survey of gene expression and copy number levels in primary gastric tumors and gastric cancer cell lines and validated the results using an affinity capture based transcript analysis (TRAC assay) and real-time qRT-PCR. Integrated microarray analysis revealed altogether 256 genes that were located in recurrent regions of gains or losses and had at least a 2-fold copy number- associated change in their gene expression. The expression levels of 13 of these genes, ALPK2, ASAP1, CEACAM5, CYP3A4, ENAH, ERBB2, HHIPL2, LTB4R, MMP9, PERLD1, PNMT, PTPRA, and OSMR, were validated in a total of 118 gastric samples using either the qRT-PCR or TRAC assay. All of these 13 genes were differentially expressed between cancerous samples and nonmalignant tissues (p < 0.05) and the association between copy number and gene expression changes was validated for nine (69.2%) of these genes (p < 0.05). In conclusion, integrated gene expression and copy number microarray analysis highlighted genes that may be critically important for gastric carcinogenesis. TRAC and qRT-PCR analyses validated the microarray results and therefore the role of these genes as potential biomarkers for gastric cancer

  1. Divergence of the bZIP Gene Family in Strawberry, Peach, and Apple Suggests Multiple Modes of Gene Evolution after Duplication

    Directory of Open Access Journals (Sweden)

    Xiao-Long Wang

    2015-01-01

    Full Text Available The basic leucine zipper (bZIP transcription factors are the most diverse members of dimerizing transcription factors. In the present study, 50, 116, and 47 bZIP genes were identified in Malus domestica (apple, Prunus persica (peach, and Fragaria vesca (strawberry, respectively. Species-specific duplication was the main contributor to the large number of bZIPs observed in apple. After WGD in apple genome, orthologous bZIP genes corresponding to strawberry on duplicated regions in apple genome were retained. However, in peach ancestor, these syntenic regions were quickly lost or deleted. Maybe the positive selection contributed to the expansion of clade S to adapt to the development and environment stresses. In addition, purifying selection was mainly responsible for bZIP sequence-specific DNA binding. The analysis of orthologous pairs between chromosomes indicates that these orthologs derived from one gene duplication located on one of the nine ancient chromosomes in the Rosaceae. The comparative analysis of bZIP genes in three species provides information on the evolutionary fate of bZIP genes in apple and peach after they diverged from strawberry.

  2. Association of variation in Fc gamma receptor 3B gene copy number with rheumatoid arthritis in Caucasian samples

    NARCIS (Netherlands)

    McKinney, Cushla; Fanciulli, Manuela; Merriman, Marilyn E.; Phipps-Green, Amanda; Alizadeh, Behrooz Z.; Koeleman, Bobby P. C.; Dalbeth, Nicola; Gow, Peter J.; Harrison, Andrew A.; Highton, John; Jones, Peter B.; Stamp, Lisa K.; Steer, Sophia; Barrera, Pilar; Coenen, Marieke J. H.; Franke, Barbara; van Riel, Piet L. C. M.; Vyse, Tim J.; Aitman, Tim J.; Radstake, Timothy R. D. J.; Merriman, Tony R.

    2010-01-01

    Objective There is increasing evidence that variation in gene copy number (CN) influences clinical phenotype. The low-affinity Fc gamma receptor 3B (FCGR3B) located in the FCGR gene cluster is a CN polymorphic gene involved in the recruitment to sites of inflammation and activation of

  3. Association of variation in Fcgamma receptor 3B gene copy number with rheumatoid arthritis in Caucasian samples.

    NARCIS (Netherlands)

    McKinney, C.; Fanciulli, M.; Merriman, M.E.; Phipps-Green, A.; Alizadeh, B.Z.; Koeleman, B.P.; Dalbeth, N.; Gow, P.J.; Harrison, A.A.; Highton, J.; Jones, P.B.; Stamp, L.K.; Steer, S.; Barrera, P.; Coenen, M.J.H.; Franke, B.; Riel, P.L.C.M. van; Vyse, T.J.; Aitman, T.J.; Radstake, T.R.D.J.; Merriman, T.R.

    2010-01-01

    OBJECTIVE: There is increasing evidence that variation in gene copy number (CN) influences clinical phenotype. The low-affinity Fcgamma receptor 3B (FCGR3B) located in the FCGR gene cluster is a CN polymorphic gene involved in the recruitment to sites of inflammation and activation of

  4. NDRG2 gene copy number is not altered in colorectal carcinoma

    DEFF Research Database (Denmark)

    Lorentzen, Anders Blomkild; Mitchelmore, Cathy

    2017-01-01

    AIM To investigate if the down-regulation of N-myc Downstream Regulated Gene 2 (NDRG2) expression in colorectal carcinoma (CRC) is due to loss of the NDRG2 allele(s). METHODS The following were investigated in the human colorectal cancer cell lines DLD-1, LoVo and SW-480: NDRG2 mRNA expression...... levels using quantitative reverse transcription-polymerase chain reaction (qRT-PCR); interaction of the MYC gene-regulatory protein with the NDRG2 promoter using chromatin immunoprecipitation; and NDRG2 promoter methylation using bisulfite sequencing. Furthermore, we performed qPCR to analyse the copy...... numbers of NDRG2 and MYC genes in the above three cell lines, 8 normal colorectal tissue samples and 40 CRC tissue samples. RESULTS As expected, NDRG2 mRNA levels were low in the three colorectal cancer cell lines, compared to normal colon. Endogenous MYC protein interacted with the NDRG2 core promoter...

  5. Population structuring of multi-copy, antigen-encoding genes in Plasmodium falciparum

    Science.gov (United States)

    Artzy-Randrup, Yael; Rorick, Mary M; Day, Karen; Chen, Donald; Dobson, Andrew P; Pascual, Mercedes

    2012-01-01

    The coexistence of multiple independently circulating strains in pathogen populations that undergo sexual recombination is a central question of epidemiology with profound implications for control. An agent-based model is developed that extends earlier ‘strain theory’ by addressing the var gene family of Plasmodium falciparum. The model explicitly considers the extensive diversity of multi-copy genes that undergo antigenic variation via sequential, mutually exclusive expression. It tracks the dynamics of all unique var repertoires in a population of hosts, and shows that even under high levels of sexual recombination, strain competition mediated through cross-immunity structures the parasite population into a subset of coexisting dominant repertoires of var genes whose degree of antigenic overlap depends on transmission intensity. Empirical comparison of patterns of genetic variation at antigenic and neutral sites supports this role for immune selection in structuring parasite diversity. DOI: http://dx.doi.org/10.7554/eLife.00093.001 PMID:23251784

  6. Mapping of single-copy genes by TSA-FISH in the codling moth, Cydia pomonella.

    Science.gov (United States)

    Carabajal Paladino, Leonela Z; Nguyen, Petr; Síchová, Jindra; Marec, František

    2014-01-01

    We work on the development of transgenic sexing strains in the codling moth, Cydia pomonella (Tortricidae), which would enable to produce male-only progeny for the population control of this pest using sterile insect technique (SIT). To facilitate this research, we have developed a number of cytogenetic and molecular tools, including a physical map of the codling moth Z chromosome using BAC-FISH (fluorescence in situ hybridization with bacterial artificial chromosome probes). However, chromosomal localization of unique, single-copy sequences such as a transgene cassette by conventional FISH remains challenging. In this study, we adapted a FISH protocol with tyramide signal amplification (TSA-FISH) for detection of single-copy genes in Lepidoptera. We tested the protocol with probes prepared from partial sequences of Z-linked genes in the codling moth. Using a modified TSA-FISH protocol we successfully mapped a partial sequence of the Acetylcholinesterase 1 (Ace-1) gene to the Z chromosome and confirmed thus its Z-linkage. A subsequent combination of BAC-FISH with BAC probes containing anticipated neighbouring Z-linked genes and TSA-FISH with the Ace-1 probe allowed the integration of Ace-1 in the physical map of the codling moth Z chromosome. We also developed a two-colour TSA-FISH protocol which enabled us simultaneous localization of two Z-linked genes, Ace-1 and Notch, to the expected regions of the Z chromosome. We showed that TSA-FISH represents a reliable technique for physical mapping of genes on chromosomes of moths and butterflies. Our results suggest that this technique can be combined with BAC-FISH and in the future used for physical localization of transgene cassettes on chromosomes of transgenic lines in the codling moth or other lepidopteran species. Furthermore, the developed protocol for two-colour TSA-FISH might become a powerful tool for synteny mapping in non-model organisms.

  7. [Abnormality of TOP2A expression and its gene copy number variations in neuroblastic tumors].

    Science.gov (United States)

    Chen, J M; Zhou, C J; Ma, X L; Guan, D D; Yang, L Y; Yue, P; Gong, L P

    2016-11-08

    Objective: To detect TOP2A protein expression and gene copy number alterations, and to analyze related clinical and pathological implications in pediatric neuroblastic tumors (NT). Methods: Immunohistochemistry was used to detect TOP2A protein expression. Fluorescence in situ hybridization (FISH) was used to detect numerical aberrations of TOP2A. Results: TOP2A protein was expressed in 59.1%(52/88) of cases, which was associated with differentiation ( P =0.006), Ki-67 index ( P INSS stages (Ⅲ and Ⅳ). As a target of the anthracycline-based adjuvant drugs, TOP2A test can be used to select patient with NT for the therapy.

  8. Dissecting a Hidden Gene Duplication: The Arabidopsis thaliana SEC10 Locus

    Czech Academy of Sciences Publication Activity Database

    Vukašinović, Nemanja; Cvrčková, F.; Eliáš, M.; Cole, R.; Fowler, J.E.; Žárský, Viktor; Synek, Lukáš

    2014-01-01

    Roč. 9, č. 4 (2014) E-ISSN 1932-6203 R&D Projects: GA ČR GPP501/11/P853; GA ČR(CZ) GAP305/11/1629 Grant - others:GA MŠk ME10033 Institutional support: RVO:61389030 Keywords : WHOLE-GENOME * ARABIDOPSIS-THALIANA * RECENT SEGMENTAL DUPLICATIONS Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.234, year: 2014

  9. RANGER-DTL 2.0: Rigorous Reconstruction of Gene-Family Evolution by Duplication, Transfer, and Loss.

    Science.gov (United States)

    Bansal, Mukul S; Kellis, Manolis; Kordi, Misagh; Kundu, Soumya

    2018-04-24

    RANGER-DTL 2.0 is a software program for inferring gene family evolution using Duplication-Transfer-Loss reconciliation. This new software is highly scalable and easy to use, and offers many new features not currently available in any other reconciliation program. RANGER-DTL 2.0 has a particular focus on reconciliation accuracy and can account for many sources of reconciliation uncertainty including uncertain gene tree rooting, gene tree topological uncertainty, multiple optimal reconciliations, and alternative event cost assignments. RANGER-DTL 2.0 is open-source and written in C ++ and Python. Pre-compiled executables, source code (open-source under GNU GPL), and a detailed manual are freely available from http://compbio.engr.uconn.edu/software/RANGER-DTL/. mukul.bansal@uconn.edu.

  10. An integrated analysis of miRNA and gene copy numbers in xenografts of Ewing's sarcoma

    Directory of Open Access Journals (Sweden)

    Mosakhani Neda

    2012-03-01

    Full Text Available Abstract Background Xenografts have been shown to provide a suitable source of tumor tissue for molecular analysis in the absence of primary tumor material. We utilized ES xenograft series for integrated microarray analyses to identify novel biomarkers. Method Microarray technology (array comparative genomic hybridization (aCGH and micro RNA arrays was used to screen and identify copy number changes and differentially expressed miRNAs of 34 and 14 passages, respectively. Incubated cells used for xenografting (Passage 0 were considered to represent the primary tumor. Four important differentially expressed miRNAs (miR-31, miR-31*, miR-145, miR-106 were selected for further validation by real time polymerase chain reaction (RT-PCR. Integrated analysis of aCGH and miRNA data was performed on 14 xenograft passages by bioinformatic methods. Results The most frequent losses and gains of DNA copy number were detected at 9p21.3, 16q and at 8, 15, 17q21.32-qter, 1q21.1-qter, respectively. The presence of these alterations was consistent in all tumor passages. aCGH profiles of xenograft passages of each series resembled their corresponding primary tumors (passage 0. MiR-21, miR-31, miR-31*, miR-106b, miR-145, miR-150*, miR-371-5p, miR-557 and miR-598 showed recurrently altered expression. These miRNAS were predicted to regulate many ES-associated genes, such as genes of the IGF1 pathway, EWSR1, FLI1 and their fusion gene (EWS-FLI1. Twenty differentially expressed miRNAs were pinpointed in regions carrying altered copy numbers. Conclusion In the present study, ES xenografts were successfully applied for integrated microarray analyses. Our findings showed expression changes of miRNAs that were predicted to regulate many ES associated genes, such as IGF1 pathway genes, FLI1, EWSR1, and the EWS-FLI1 fusion genes.

  11. Startling mosaicism of the Y-chromosome and tandem duplication of the SRY and DAZ genes in patients with Turner Syndrome.

    Directory of Open Access Journals (Sweden)

    Sanjay Premi

    Full Text Available Presence of the human Y-chromosome in females with Turner Syndrome (TS enhances the risk of development of gonadoblastoma besides causing several other phenotypic abnormalities. In the present study, we have analyzed the Y chromosome in 15 clinically diagnosed Turner Syndrome (TS patients and detected high level of mosaicisms ranging from 45,XO:46,XY = 100:0% in 4; 45,XO:46,XY:46XX = 4:94:2 in 8; and 45,XO:46,XY:46XX = 50:30:20 cells in 3 TS patients, unlike previous reports showing 5-8% cells with Y- material. Also, no ring, marker or di-centric Y was observed in any of the cases. Of the two TS patients having intact Y chromosome in >85% cells, one was exceptionally tall. Both the patients were positive for SRY, DAZ, CDY1, DBY, UTY and AZFa, b and c specific STSs. Real Time PCR and FISH demonstrated tandem duplication/multiplication of the SRY and DAZ genes. At sequence level, the SRY was normal in 8 TS patients while the remaining 7 showed either absence of this gene or known and novel mutations within and outside of the HMG box. SNV/SFV analysis showed normal four copies of the DAZ genes in these 8 patients. All the TS patients showed aplastic uterus with no ovaries and no symptom of gonadoblastoma. Present study demonstrates new types of polymorphisms indicating that no two TS patients have identical genotype-phenotype. Thus, a comprehensive analysis of more number of samples is warranted to uncover consensus on the loci affected, to be able to use them as potential diagnostic markers.

  12. Identification of a rare 17p13.3 duplication including the BHLHA9 and YWHAE genes in a family with developmental delay and behavioural problems

    Directory of Open Access Journals (Sweden)

    Capra Valeria

    2012-10-01

    Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.

  13. Bayesian model to detect phenotype-specific genes for copy number data

    Directory of Open Access Journals (Sweden)

    González Juan R

    2012-06-01

    Full Text Available Abstract Background An important question in genetic studies is to determine those genetic variants, in particular CNVs, that are specific to different groups of individuals. This could help in elucidating differences in disease predisposition and response to pharmaceutical treatments. We propose a Bayesian model designed to analyze thousands of copy number variants (CNVs where only few of them are expected to be associated with a specific phenotype. Results The model is illustrated by analyzing three major human groups belonging to HapMap data. We also show how the model can be used to determine specific CNVs related to response to treatment in patients diagnosed with ovarian cancer. The model is also extended to address the problem of how to adjust for confounding covariates (e.g., population stratification. Through a simulation study, we show that the proposed model outperforms other approaches that are typically used to analyze this data when analyzing common copy-number polymorphisms (CNPs or complex CNVs. We have developed an R package, called bayesGen, that implements the model and estimating algorithms. Conclusions Our proposed model is useful to discover specific genetic variants when different subgroups of individuals are analyzed. The model can address studies with or without control group. By integrating all data in a unique model we can obtain a list of genes that are associated with a given phenotype as well as a different list of genes that are shared among the different subtypes of cases.

  14. Gene Duplication of the zebrafish kit ligand and partitioning of melanocyte development functions to kit ligand a.

    Directory of Open Access Journals (Sweden)

    Keith A Hultman

    2007-01-01

    Full Text Available The retention of particular genes after the whole genome duplication in zebrafish has given insights into how genes may evolve through partitioning of ancestral functions. We examine the partitioning of expression patterns and functions of two zebrafish kit ligands, kit ligand a (kitla and kit ligand b (kitlb, and discuss their possible coevolution with the duplicated zebrafish kit receptors (kita and kitb. In situ hybridizations show that kitla mRNA is expressed in the trunk adjacent to the notochord in the middle of each somite during stages of melanocyte migration and later expressed in the skin, when the receptor is required for melanocyte survival. kitla is also expressed in other regions complementary to kita receptor expression, including the pineal gland, tail bud, and ear. In contrast, kitlb mRNA is expressed in brain ventricles, ear, and cardinal vein plexus, in regions generally not complementary to either zebrafish kit receptor ortholog. However, like kitla, kitlb is expressed in the skin during stages consistent with melanocyte survival. Thus, it appears that kita and kitla have maintained congruent expression patterns, while kitb and kitlb have evolved divergent expression patterns. We demonstrate the interaction of kita and kitla by morpholino knockdown analysis. kitla morphants, but not kitlb morphants, phenocopy the null allele of kita, with defects for both melanocyte migration and survival. Furthermore, kitla morpholino, but not kitlb morpholino, interacts genetically with a sensitized allele of kita, confirming that kitla is the functional ligand to kita. Last, we examine kitla overexpression in embryos, which results in hyperpigmentation caused by an increase in the number and size of melanocytes. This hyperpigmentation is dependent on kita function. We conclude that following genome duplication, kita and kitla have maintained their receptor-ligand relationship, coevolved complementary expression patterns, and that

  15. Duplication and independent selection of cell-wall invertase genes GIF1 and OsCIN1 during rice evolution and domestication

    Directory of Open Access Journals (Sweden)

    Ge Song

    2010-04-01

    Full Text Available Abstract Background Various evolutionary models have been proposed to interpret the fate of paralogous duplicates, which provides substrates on which evolution selection could act. In particular, domestication, as a special selection, has played important role in crop cultivation with divergence of many genes controlling important agronomic traits. Recent studies have indicated that a pair of duplicate genes was often sub-functionalized from their ancestral functions held by the parental genes. We previously demonstrated that the rice cell-wall invertase (CWI gene GIF1 that plays an important role in the grain-filling process was most likely subjected to domestication selection in the promoter region. Here, we report that GIF1 and another CWI gene OsCIN1 constitute a pair of duplicate genes with differentiated expression and function through independent selection. Results Through synteny analysis, we show that GIF1 and another cell-wall invertase gene OsCIN1 were paralogues derived from a segmental duplication originated during genome duplication of grasses. Results based on analyses of population genetics and gene phylogenetic tree of 25 cultivars and 25 wild rice sequences demonstrated that OsCIN1 was also artificially selected during rice domestication with a fixed mutation in the coding region, in contrast to GIF1 that was selected in the promoter region. GIF1 and OsCIN1 have evolved into different expression patterns and probable different kinetics parameters of enzymatic activity with the latter displaying less enzymatic activity. Overexpression of GIF1 and OsCIN1 also resulted in different phenotypes, suggesting that OsCIN1 might regulate other unrecognized biological process. Conclusion How gene duplication and divergence contribute to genetic novelty and morphological adaptation has been an interesting issue to geneticists and biologists. Our discovery that the duplicated pair of GIF1 and OsCIN1 has experienced sub

  16. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Science.gov (United States)

    Martínez-Alberola, Fernando; Del Campo, Eva M; Lázaro-Gimeno, David; Mezquita-Claramonte, Sergio; Molins, Arantxa; Mateu-Andrés, Isabel; Pedrola-Monfort, Joan; Casano, Leonardo M; Barreno, Eva

    2013-01-01

    Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt) in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  17. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Directory of Open Access Journals (Sweden)

    Fernando Martínez-Alberola

    Full Text Available Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  18. The DUB/USP17 deubiquitinating enzymes: A gene family within a tandemly repeated sequence, is also embedded within the copy number variable Beta-defensin cluster

    Directory of Open Access Journals (Sweden)

    Scott Christopher J

    2010-04-01

    Full Text Available Abstract Background The DUB/USP17 subfamily of deubiquitinating enzymes were originally identified as immediate early genes induced in response to cytokine stimulation in mice (DUB-1, DUB-1A, DUB-2, DUB-2A. Subsequently we have identified a number of human family members and shown that one of these (DUB-3 is also cytokine inducible. We originally showed that constitutive expression of DUB-3 can block cell proliferation and more recently we have demonstrated that this is due to its regulation of the ubiquitination and activity of the 'CAAX' box protease RCE1. Results Here we demonstrate that the human DUB/USP17 family members are found on both chromosome 4p16.1, within a block of tandem repeats, and on chromosome 8p23.1, embedded within the copy number variable beta-defensin cluster. In addition, we show that the multiple genes observed in humans and other distantly related mammals have arisen due to the independent expansion of an ancestral sequence within each species. However, it is also apparent when sequences from humans and the more closely related chimpanzee are compared, that duplication events have taken place prior to these species separating. Conclusions The observation that the DUB/USP17 genes, which can influence cell growth and survival, have evolved from an unstable ancestral sequence which has undergone multiple and varied duplications in the species examined marks this as a unique family. In addition, their presence within the beta-defensin repeat raises the question whether they may contribute to the influence of this repeat on immune related conditions.

  19. Beneficial effect of a high number of copies of salivary amylase AMY1 gene on obesity risk in Mexican children.

    Science.gov (United States)

    Mejía-Benítez, María A; Bonnefond, Amélie; Yengo, Loïc; Huyvaert, Marlène; Dechaume, Aurélie; Peralta-Romero, Jesús; Klünder-Klünder, Miguel; García Mena, Jaime; El-Sayed Moustafa, Julia S; Falchi, Mario; Cruz, Miguel; Froguel, Philippe

    2015-02-01

    Childhood obesity is a major public health problem in Mexico, affecting one in every three children. Genome-wide association studies identified genetic variants associated with childhood obesity, but a large missing heritability remains to be elucidated. We have recently shown a strong association between a highly polymorphic copy number variant encompassing the salivary amylase gene (AMY1 also known as AMY1A) and obesity in European and Asian adults. In the present study, we aimed to evaluate the association between AMY1 copy number and obesity in Mexican children. We evaluated the number of AMY1 copies in 597 Mexican children (293 obese children and 304 normal weight controls) through highly sensitive digital PCR. The effect of AMY1 copy number on obesity status was assessed using a logistic regression model adjusted for age and sex. We identified a marked effect of AMY1 copy number on reduced risk of obesity (OR per estimated copy 0.84, with the number of copies ranging from one to 16 in this population; p = 4.25 × 10(-6)). The global association between AMY1 copy number and reduced risk of obesity seemed to be mostly driven by the contribution of the highest AMY1 copy number. Strikingly, all children with >10 AMY1 copies were normal weight controls. Salivary amylase initiates the digestion of dietary starch, which is highly consumed in Mexico. Our current study suggests putative benefits of high number of AMY1 copies (and related production of salivary amylase) on energy metabolism in Mexican children.

  20. Parallel origins of duplications and the formation of pseudogenes in mitochondrial DNA from parthenogenetic lizards (Heteronotia binoei; Gekkonidae).

    Science.gov (United States)

    Zevering, C E; Moritz, C; Heideman, A; Sturm, R A

    1991-11-01

    Analysis of mitochondrial DNAs (mtDNAs) from parthenogenetic lizards of the Heteronotia binoei complex with restriction enzymes revealed an approximately 5-kb addition present in all 77 individuals. Cleavage site mapping suggested the presence of a direct tandem duplication spanning the 16S and 12S rRNA genes, the control region and most, if not all, of the gene for the subunit 1 of NADH dehydrogenase (ND1). The location of the duplication was confirmed by Southern hybridization. A restriction enzyme survey provided evidence for modifications to each copy of the duplicated sequence, including four large deletions. Each gene affected by a deletion was complemented by an intact version in the other copy of the sequence, although for one gene the functional copy was heteroplasmic for another deletion. Sequencing of a fragment from one copy of the duplication which encompassed the tRNA(leu)(UUR) and parts of the 16S rRNA and ND1 genes, revealed mutations expected to disrupt function. Thus, evolution subsequent to the duplication event has resulted in mitochondrial pseudogenes. The presence of duplications in all of these parthenogens, but not among representatives of their maternal sexual ancestors, suggests that the duplications arose in the parthenogenetic form. This provides the second instance in H. binoei of mtDNA duplication associated with the transition from sexual to parthenogenetic reproduction. The increased incidence of duplications in parthenogenetic lizards may be caused by errors in mtDNA replication due to either polyploidy or hybridity of their nuclear genomes.

  1. Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting | Office of Cancer Genomics

    Science.gov (United States)

    The CRISPR/Cas9 system enables genome editing and somatic cell genetic screens in mammalian cells. We performed genome-scale loss-of-function screens in 33 cancer cell lines to identify genes essential for proliferation/survival and found a strong correlation between increased gene copy number and decreased cell viability after genome editing. Within regions of copy-number gain, CRISPR/Cas9 targeting of both expressed and unexpressed genes, as well as intergenic loci, led to significantly decreased cell proliferation through induction of a G2 cell-cycle arrest.

  2. A case report: Becker muscular dystrophy presenting with epilepsy and dysgnosia induced by duplication mutation of Dystrophin gene.

    Science.gov (United States)

    Miao, Jing; Feng, Jia-Chun; Zhu, Dan; Yu, Xue-Fan

    2016-12-12

    Becker muscular dystrophy (BMD), a genetic disorder of X-linked recessive inheritance, typically presents with gradually progressive muscle weakness. The condition is caused by mutations of Dystrophin gene located at Xp21.2. Epilepsy is an infrequent manifestation of BMD, while cases of BMD with dysgnosia are extremely rare. We describe a 9-year-old boy with BMD, who presented with epilepsy and dysgnosia. Serum creatine kinase level was markedly elevated (3665 U/L). Wechsler intelligence tests showed a low intelligence quotient (IQ = 65). Electromyogram showed slight myogenic changes and skeletal muscle biopsy revealed muscular dystrophy. Immunohistochemical staining showed partial positivity of sarcolemma for dystrophin-N. Multiplex ligation-dependent probe amplification revealed a duplication mutation in exons 37-44 in the Dystrophin gene. The present case report helps to better understand the clinical and genetic features of BMD.

  3. Genomic evidence of gene duplication and adaptive evolution of Toll like receptors (TLR2 and TLR4) in reptiles.

    Science.gov (United States)

    Shang, Shuai; Zhong, Huaming; Wu, Xiaoyang; Wei, Qinguo; Zhang, Huanxin; Chen, Jun; Chen, Yao; Tang, Xuexi; Zhang, Honghai

    2018-04-01

    Toll-like receptors (TLRs) encoded by the TLR multigene family play an important role in initial pathogen recognition in vertebrates. Among the TLRs, TLR2 and TLR4 may be of particular importance to reptiles. In order to study the evolutionary patterns and structural characteristics of TLRs, we explored the available genomes of several representative members of reptiles. 25 TLR2 genes and 19 TLR4 genes from reptiles were obtained in this study. Phylogenetic results showed that the TLR2 gene duplication occurred in several species. Evolutionary analysis by at least two methods identified 30 and 13 common positively selected codons in TLR2 and TLR4, respectively. Most positively selected sites of TLR2 and TLR4 were located in the Leucine-rich repeat (LRRs). Branch model analysis showed that TLR2 genes were under different evolutionary forces in reptiles, while the TLR4 genes showed no significant selection pressure. The different evolutionary adaptation of TLR2 and TLR4 among the reptiles might be due to their different function in recognizing bacteria. Overall, we explored the structure and evolution of TLR2 and TLR4 genes in reptiles for the first time. Our study revealed valuable information regarding TLR2 and TLR4 in reptiles, and provided novel insights into the conservation concern of natural populations. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Deletion/duplication mutation screening of TP53 gene in patients with transitional cell carcinoma of urinary bladder using multiplex ligation-dependent probe amplification.

    Science.gov (United States)

    Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba

    2016-02-01

    Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  5. Target genes discovery through copy number alteration analysis in human hepatocellular carcinoma.

    Science.gov (United States)

    Gu, De-Leung; Chen, Yen-Hsieh; Shih, Jou-Ho; Lin, Chi-Hung; Jou, Yuh-Shan; Chen, Chian-Feng

    2013-12-21

    High-throughput short-read sequencing of exomes and whole cancer genomes in multiple human hepatocellular carcinoma (HCC) cohorts confirmed previously identified frequently mutated somatic genes, such as TP53, CTNNB1 and AXIN1, and identified several novel genes with moderate mutation frequencies, including ARID1A, ARID2, MLL, MLL2, MLL3, MLL4, IRF2, ATM, CDKN2A, FGF19, PIK3CA, RPS6KA3, JAK1, KEAP1, NFE2L2, C16orf62, LEPR, RAC2, and IL6ST. Functional classification of these mutated genes suggested that alterations in pathways participating in chromatin remodeling, Wnt/β-catenin signaling, JAK/STAT signaling, and oxidative stress play critical roles in HCC tumorigenesis. Nevertheless, because there are few druggable genes used in HCC therapy, the identification of new therapeutic targets through integrated genomic approaches remains an important task. Because a large amount of HCC genomic data genotyped by high density single nucleotide polymorphism arrays is deposited in the public domain, copy number alteration (CNA) analyses of these arrays is a cost-effective way to reveal target genes through profiling of recurrent and overlapping amplicons, homozygous deletions and potentially unbalanced chromosomal translocations accumulated during HCC progression. Moreover, integration of CNAs with other high-throughput genomic data, such as aberrantly coding transcriptomes and non-coding gene expression in human HCC tissues and rodent HCC models, provides lines of evidence that can be used to facilitate the identification of novel HCC target genes with the potential of improving the survival of HCC patients.

  6. Association between the SMN2 gene copy number and clinical characteristics of patients with spinal muscular atrophy with homozygous deletion of exon 7 of the SMN1 gene

    Directory of Open Access Journals (Sweden)

    Žarkov Marija

    2015-01-01

    Full Text Available Background/Aim. Spinal muscular atrophy (SMA is an autosomal recessive disease characterized by degeneration of alpha motor neurons in the spinal cord and the medulla oblongata, causing progressive muscle weakness and atrophy. The aim of this study was to determine association between the SMN2 gene copy number and disease phenotype in Serbian patients with SMA with homozygous deletion of exon 7 of the SMN1 gene. Methods. The patients were identified using regional Serbian hospital databases. Investigated clinical characteristics of the disease were: patients’ gender, age at disease onset, achieved and current developmental milestones, disease duration, current age, and the presence of the spinal deformities and joint contractures. The number of SMN1 and SMN2 gene copies was determined using real-time polymerase chain reaction (PCR. Results. Among 43 identified patients, 37 (86.0% showed homozygous deletion of SMN1 exon 7. One (2.7% of 37 patients had SMA type I with 3 SMN2 copies, 11 (29.7% patients had SMA type II with 3.1 ± 0.7 copies, 17 (45.9% patients had SMA type III with 3.7 ± 0.9 copies, while 8 (21.6% patients had SMA type IV with 4.2 ± 0.9 copies. There was a progressive increase in the SMN2 gene copy number from type II towards type IV (p < 0.05. A higher SMN2 gene copy number was associated with better current motor performance (p < 0.05. Conclusion. In the Serbian patients with SMA, a higher SMN2 gene copy number correlated with less severe disease phenotype. A possible effect of other phenotype modifiers should not be neglected.

  7. Sex bias in copy number variation of olfactory receptor gene family depends on ethnicity

    Directory of Open Access Journals (Sweden)

    Farideh eShadravan

    2013-03-01

    Full Text Available Gender plays a pivotal role in the human genetic identity and is also manifested in many genetic disorders particularly mental retardation. In this study its effect on copy number variation (CNV, known to cause genetic disorders was explored. As the olfactory receptor (OR repertoire comprises the largest human gene family, it was selected for this study, which was carried out within and between three populations, derived from 150 individuals from the 1000 Genome Project. Analysis of 3872 CNVs detected among 791 OR loci, in which 307 loci showed CNV, revealed the following novel findings: Sex bias in CNV was significantly more prevalent in uncommon than common CNV variants of OR pseudogenes, in which the male genome showed more CNVs; and in one-copy number loss compared to complete deletion of OR pseudogenes; both findings implying a more recent evolutionary role for gender. Sex bias in copy number gain was also detected. Another novel finding was that the observed six bias was largely dependent on ethnicity and was in general absent in East Asians. Using a CNV public database for sick children (ISCA the application of these findings for improving clinical molecular diagnostics is discussed by showing an example of sex bias in CNV among kids with autism. Additional clinical relevance is discussed, as the most polymorphic CNV-enriched OR cluster in the human genome, located on chr 15q11.2, is found near the PWS/AS bi-directionally imprinted region associated with two well-known mental retardation syndromes. As olfaction represents the primitive cognition in most mammals, arguably in competition with the development of a larger brain, the extensive retention of OR pseudogenes in females of this study, might point to a parent-of-origin indirect regulatory role for OR pseudogenes in the embryonic development of human brain. Thus any perturbation in the temporal regulation of olfactory system could lead to developmental delay disorders including

  8. Tandem duplication of 11p12-p13 in a child with borderline development delay and eye abnormalities: dose effect of the PAX6 gene product?

    NARCIS (Netherlands)

    Aalfs, C. M.; Fantes, J. A.; Wenniger-Prick, L. J.; Sluijter, S.; Hennekam, R. C.; van Heyningen, V.; Hoovers, J. M.

    1997-01-01

    We report on a girl with a duplication of chromosome band 11p12-->13, which includes the Wilms tumor gene (WT1) and the aniridia gene (PAX6). The girl had borderline developmental delay, mild facial anomalies, and eye abnormalities. Eye findings were also present in most of the 11 other published

  9. Plasticity and innovation of regulatory mechanisms underlying seed oil content mediated by duplicated genes in the palaeopolyploid soybean.

    Science.gov (United States)

    Zhang, Dajian; Zhao, Meixia; Li, Shuai; Sun, Lianjun; Wang, Weidong; Cai, Chunmei; Dierking, Emily C; Ma, Jianxin

    2017-06-01

    Many plants have undergone whole genome duplication (WGD). However, how regulatory networks underlying a particular trait are reshaped in polyploids has not been experimentally investigated. Here we show that the regulatory pathways modulating seed oil content, which involve WRINKLED1 (WRI1), LEAFY COTYLEDON1 (LEC1), and LEC2 in Arabidopsis, have been modified in the palaeopolyploid soybean. Such modifications include functional reduction of GmWRI1b of the GmWRI1a/GmWRI1b homoeologous pair relevant to WRI1, complementary non-allelic dosage effects of the GmLEC1a/GmLEC1b homoeologous pair relevant to LEC1, pseudogenization of the singleton GmLEC2 relevant to LEC2, and the rise of the LEC2-like function of GmABI3b, contrasting to its homoeolog GmABI3a, which maintains the ABSCISIC ACID INSENSITIVE 3 (ABI3)-like function in modulating seed maturation and dormancy. The function of GmABI3b in modulating seed oil biosynthesis was fulfilled by direct binding to a RY (CATGCA) cis-regulatory element in the GmWRI1a promoter, which was absent in the GmWRI1b promoter, resulting in reduction of the GmWRI1b expression. Nevertheless, the three regulators each exhibited similar intensities of purifying selection to their respective duplicates since these pairs were formed by a WGD event that is proposed to have occurred approximately 13 million years ago (mya), suggesting that the differentiation in spatiotemporal expression between the duplicated genes is more likely to be the outcome of neutral variation in regulatory sequences. This study thus exemplifies the plasticity, dynamics, and novelty of regulatory networks mediated by WGD. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  10. Selective regain of egfr gene copies in CD44+/CD24-/low breast cancer cellular model MDA-MB-468

    International Nuclear Information System (INIS)

    Agelopoulos, Konstantin; Buerger, Horst; Brandt, Burkhard; Greve, Burkhard; Schmidt, Hartmut; Pospisil, Heike; Kurtz, Stefan; Bartkowiak, Kai; Andreas, Antje; Wieczorek, Marek; Korsching, Eberhard

    2010-01-01

    Increased transcription of oncogenes like the epidermal growth factor receptor (EGFR) is frequently caused by amplification of the whole gene or at least of regulatory sequences. Aim of this study was to pinpoint mechanistic parameters occurring during egfr copy number gains leading to a stable EGFR overexpression and high sensitivity to extracellular signalling. A deeper understanding of those marker events might improve early diagnosis of cancer in suspect lesions, early detection of cancer progression and the prediction of egfr targeted therapies. The basal-like/stemness type breast cancer cell line subpopulation MDA-MB-468 CD44 high /CD24 -/low , carrying high egfr amplifications, was chosen as a model system in this study. Subclones of the heterogeneous cell line expressing low and high EGF receptor densities were isolated by cell sorting. Genomic profiling was carried out for these by means of SNP array profiling, qPCR and FISH. Cell cycle analysis was performed using the BrdU quenching technique. Low and high EGFR expressing MDA-MB-468 CD44 + /CD24 -/low subpopulations separated by cell sorting showed intermediate and high copy numbers of egfr, respectively. However, during cell culture an increase solely for egfr gene copy numbers in the intermediate subpopulation occurred. This shift was based on the formation of new cells which regained egfr gene copies. By two parametric cell cycle analysis clonal effects mediated through growth advantage of cells bearing higher egfr gene copy numbers could most likely be excluded for being the driving force. Subsequently, the detection of a fragile site distal to the egfr gene, sustaining uncapped telomere-less chromosomal ends, the ladder-like structure of the intrachromosomal egfr amplification and a broader range of egfr copy numbers support the assumption that dynamic chromosomal rearrangements, like breakage-fusion-bridge-cycles other than proliferation drive the gain of egfr copies. Progressive genome modulation

  11. Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes.

    Science.gov (United States)

    Biedler, James K; Tu, Zhijian

    2010-07-08

    codon shows promoter activity at least as early as 3 hours in the developing Ae. aegypti embryo. The AaKLC2.1 promoter activity reached ~1600 fold over the negative control at 5 hr after egg deposition. Transcriptome profiling by use of high throughput sequencing technologies has proven to be a valuable method for the identification and discovery of early and transient zygotic genes. The evolutionary investigation of the KLC gene family reveals that duplication is a source for the evolution of new genes that play a role in the dynamic process of early embryonic development. AaKLC2.1 may provide a promoter for early zygotic-specific transgene expression, which is a key component of the Medea gene drive system.

  12. Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes

    Directory of Open Access Journals (Sweden)

    Tu Zhijian

    2010-07-01

    1 kb fragment upstream of the AaKLC2.1 start codon shows promoter activity at least as early as 3 hours in the developing Ae. aegypti embryo. The AaKLC2.1 promoter activity reached ~1600 fold over the negative control at 5 hr after egg deposition. Conclusions Transcriptome profiling by use of high throughput sequencing technologies has proven to be a valuable method for the identification and discovery of early and transient zygotic genes. The evolutionary investigation of the KLC gene family reveals that duplication is a source for the evolution of new genes that play a role in the dynamic process of early embryonic development. AaKLC2.1 may provide a promoter for early zygotic-specific transgene expression, which is a key component of the Medea gene drive system.

  13. Allotetraploid origin and divergence in Eleusine (Chloridoideae, Poaceae): evidence from low-copy nuclear gene phylogenies and a plastid gene chronogram.

    Science.gov (United States)

    Liu, Qing; Triplett, Jimmy K; Wen, Jun; Peterson, Paul M

    2011-11-01

    Eleusine (Poaceae) is a small genus of the subfamily Chloridoideae exhibiting considerable morphological and ecological diversity in East Africa and the Americas. The interspecific phylogenetic relationships of Eleusine are investigated in order to identify its allotetraploid origin, and a chronogram is estimated to infer temporal relationships between palaeoenvironment changes and divergence of Eleusine in East Africa. Two low-copy nuclear (LCN) markers, Pepc4 and EF-1α, were analysed using parsimony, likelihood and Bayesian approaches. A chronogram of Eleusine was inferred from a combined data set of six plastid DNA markers (ndhA intron, ndhF, rps16-trnK, rps16 intron, rps3, and rpl32-trnL) using the Bayesian dating method. The monophyly of Eleusine is strongly supported by sequence data from two LCN markers. In the cpDNA phylogeny, three tetraploid species (E. africana, E. coracana and E. kigeziensis) share a common ancestor with the E. indica-E. tristachya clade, which is considered a source of maternal parents for allotetraploids. Two homoeologous loci are isolated from three tetraploid species in the Pepc4 phylogeny, and the maternal parents receive further support. The A-type EF-1α sequences possess three characters, i.e. a large number of variations of intron 2; clade E-A distantly diverged from clade E-B and other diploid species; and seven deletions in intron 2, implying a possible derivation through a gene duplication event. The crown age of Eleusine and the allotetraploid lineage are 3·89 million years ago (mya) and 1·40 mya, respectively. The molecular data support independent allotetraploid origins for E. kigeziensis and the E. africana-E. coracana clade. Both events may have involved diploids E. indica and E. tristachya as the maternal parents, but the paternal parents remain unidentified. The habitat-specific hypothesis is proposed to explain the divergence of Eleusine and its allotetraploid lineage.

  14. Study of duplication 24bp of ARX gene among patients presenting a Mental Retardation with a syndromic and non syndromic forms

    International Nuclear Information System (INIS)

    Essouissi, Imen

    2006-01-01

    Mental Retardation (MR) is the most frequent handicap. It touches 3% of the general population. The genetic causes of this handicap account for 40% of these cases. ARX gene (Aristaless related homeobox gene) belongs to the family of the genes homeobox located in Xp22.1. It is considered as the most frequently muted gene after the FMR1 gene. It is implicated in various forms of syndromic and nonsyndromic MR. Several types of mutation were identified on the level of this gene, including deletions/insertions, duplications, missense and nonsense mutations, responsible for a wide spectrum of phenotypes. The goal of this work is to seek the most frequent change of gene ARX: duplication 24pb (at the origin of an expansion of the field poly has protein ARX in the position 144-155AA) among Tunisian boys presenting in particular family forms of non specific MR, sporadic forms of non specific MR like certain patients presenting a West syndrome.To prove the duplication of 24 Pb, we used in this work the Pcr technique. The change of duplication 24pb was not found in our series, this could be explained by the low number of cases family studied (38 families) and by the absence of connection studies accusing a mode of transmission related to X chromosome in particular for the sporadic cases. (Author)

  15. Enteric Duplication.

    Science.gov (United States)

    Jeziorczak, Paul M; Warner, Brad W

    2018-03-01

    Enteric duplications have been described throughout the entire gastrointestinal tract. The usual perinatal presentation is an abdominal mass. Duplications associated with the foregut have associated respiratory symptoms, whereas duplications in the midgut and hindgut can present with obstructive symptoms, perforation, nausea, emesis, hemorrhage, or be asymptomatic, and identified as an incidental finding. These are differentiated from other cystic lesions by the presence of a normal gastrointestinal mucosal epithelium. Enteric duplications are located on the mesenteric side of the native structures and are often singular with tubular or cystic characteristics. Management of enteric duplications often requires operative intervention with preservation of the native blood supply and intestine. These procedures are usually very well tolerated with low morbidity.

  16. Clinical Relevance of Gene Copy Number Variation in Metastatic Clear Cell Renal Cell Carcinoma.

    Science.gov (United States)

    Nouhaud, François-Xavier; Blanchard, France; Sesboue, Richard; Flaman, Jean-Michel; Sabourin, Jean-Christophe; Pfister, Christian; Di Fiore, Frédéric

    2018-02-23

    Gene copy number variations (CNVs) have been reported to be frequent in renal cell carcinoma (RCC), with potential prognostic value for some. However, their clinical utility, especially to guide treatment of metastatic disease remains to be established. Our objectives were to assess CNVs on a panel of selected genes and determine their clinical relevance in patients who underwent treatment of metastatic RCC. The genetic assessment was performed on frozen tissue samples of clear cell metastatic RCC using quantitative multiplex polymerase chain reaction of short fluorescent fragment method to detect CNVs on a panel of 14 genes of interest. The comparison of the electropherogram obtained from both tumor and normal renal adjacent tissue allowed for CNV identification. The clinical, biologic, and survival characteristics were assessed for their associations with the most frequent CNVs. Fifty patients with clear cell metastatic RCC were included. The CNV rate was 21.4%. The loss of CDKN2A and PLG was associated with a higher tumor stage (P relevance, especially those located on CDKN2A, PLG, and ALDOB, in a homogeneous cohort of patients with clear cell metastatic RCC. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. MulRF: a software package for phylogenetic analysis using multi-copy gene trees.

    Science.gov (United States)

    Chaudhary, Ruchi; Fernández-Baca, David; Burleigh, John Gordon

    2015-02-01

    MulRF is a platform-independent software package for phylogenetic analysis using multi-copy gene trees. It seeks the species tree that minimizes the Robinson-Foulds (RF) distance to the input trees using a generalization of the RF distance to multi-labeled trees. The underlying generic tree distance measure and fast running time make MulRF useful for inferring phylogenies from large collections of gene trees, in which multiple evolutionary processes as well as phylogenetic error may contribute to gene tree discord. MulRF implements several features for customizing the species tree search and assessing the results, and it provides a user-friendly graphical user interface (GUI) with tree visualization. The species tree search is implemented in C++ and the GUI in Java Swing. MulRF's executable as well as sample datasets and manual are available at http://genome.cs.iastate.edu/CBL/MulRF/, and the source code is available at https://github.com/ruchiherself/MulRFRepo. ruchic@ufl.edu Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  18. Structure of the gene for human butyrylcholinesterase. Evidence for a single copy

    International Nuclear Information System (INIS)

    Arpagaus, M.; Kott, M.; Vatsis, K.P.; Bartels, C.F.; La Du, B.N.; Lockridge, O.

    1990-01-01

    The authors have isolated five genomic clones for human butyrylcholinesterase (BChE), using cDNA probes encoding the catalytic subunit of the hydrophilic tetramer. The BChE gene is at least 73 kb long and contains for exons. Exon 1 contains untranslated sequences and two potential translation initiation sites at codons -69 and -47. Exon 2 (1525 bp) contains 83% of the coding sequence for the mature protein, including the N-terminal and the active-site serine, and a third possible translation initiation site (likely functional), at codon -28. Exon 3 is 167 nucleotides long. Exon 4 (604 bp) codes for the C-terminus of the protein and the 3' untranslated region where two polyadenylation signals were identified. Intron 1 is 6.5 km long, and the minimal sizes of introns 2 and 3 are estimated to be 32 km each. Southern blot analysis of total human genomic DNA is in complete agreement with the gene structure established by restriction endonuclease mapping of the genomic clones: this strongly suggests that the BChE gene is present in a single copy

  19. Integrated analysis of gene expression, CpG island methylation, and gene copy number in breast cancer cells by deep sequencing.

    Directory of Open Access Journals (Sweden)

    Zhifu Sun

    Full Text Available We used deep sequencing technology to profile the transcriptome, gene copy number, and CpG island methylation status simultaneously in eight commonly used breast cell lines to develop a model for how these genomic features are integrated in estrogen receptor positive (ER+ and negative breast cancer. Total mRNA sequence, gene copy number, and genomic CpG island methylation were carried out using the Illumina Genome Analyzer. Sequences were mapped to the human genome to obtain digitized gene expression data, DNA copy number in reference to the non-tumor cell line (MCF10A, and methylation status of 21,570 CpG islands to identify differentially expressed genes that were correlated with methylation or copy number changes. These were evaluated in a dataset from 129 primary breast tumors. Gene expression in cell lines was dominated by ER-associated genes. ER+ and ER- cell lines formed two distinct, stable clusters, and 1,873 genes were differentially expressed in the two groups. Part of chromosome 8 was deleted in all ER- cells and part of chromosome 17 amplified in all ER+ cells. These loci encoded 30 genes that were overexpressed in ER+ cells; 9 of these genes were overexpressed in ER+ tumors. We identified 149 differentially expressed genes that exhibited differential methylation of one or more CpG islands within 5 kb of the 5' end of the gene and for which mRNA abundance was inversely correlated with CpG island methylation status. In primary tumors we identified 84 genes that appear to be robust components of the methylation signature that we identified in ER+ cell lines. Our analyses reveal a global pattern of differential CpG island methylation that contributes to the transcriptome landscape of ER+ and ER- breast cancer cells and tumors. The role of gene amplification/deletion appears to more modest, although several potentially significant genes appear to be regulated by copy number aberrations.

  20. Human PTCHD3 nulls: rare copy number and sequence variants suggest a non-essential gene

    Directory of Open Access Journals (Sweden)

    Lionel Anath C

    2011-03-01

    Full Text Available Abstract Background Copy number variations (CNVs can contribute to variable degrees of fitness and/or disease predisposition. Recent studies show that at least 1% of any given genome is copy number variable when compared to the human reference sequence assembly. Homozygous deletions (or CNV nulls that are found in the normal population are of particular interest because they may serve to define non-essential genes in human biology. Results In a genomic screen investigating CNV in Autism Spectrum Disorders (ASDs we detected a heterozygous deletion on chromosome 10p12.1, spanning the Patched-domain containing 3 (PTCHD3 gene, at a frequency of ~1.4% (6/427. This finding seemed interesting, given recent discoveries on the role of another Patched-domain containing gene (PTCHD1 in ASD. Screening of another 177 ASD probands yielded two additional heterozygous deletions bringing the frequency to 1.3% (8/604. The deletion was found at a frequency of ~0.73% (27/3,695 in combined control population from North America and Northern Europe predominately of European ancestry. Screening of the human genome diversity panel (HGDP-CEPH covering worldwide populations yielded deletions in 7/1,043 unrelated individuals and those detected were confined to individuals of European/Mediterranean/Middle Eastern ancestry. Breakpoint mapping yielded an identical 102,624 bp deletion in all cases and controls tested, suggesting a common ancestral event. Interestingly, this CNV occurs at a break of synteny between humans and mouse. Considering all data, however, no significant association of these rare PTCHD3 deletions with ASD was observed. Notwithstanding, our RNA expression studies detected PTCHD3 in several tissues, and a novel shorter isoform for PTCHD3 was characterized. Expression in transfected COS-7 cells showed PTCHD3 isoforms colocalize with calnexin in the endoplasmic reticulum. The presence of a patched (Ptc domain suggested a role for PTCHD3 in various biological

  1. Yeast Interspecies Comparative Proteomics Reveals Divergence in Expression Profiles and Provides Insights into Proteome Resource Allocation and Evolutionary Roles of Gene Duplication*

    Science.gov (United States)

    Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke

    2016-01-01

    Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under

  2. Heritable heading time variation in wheat lines with the same number of Ppd-B1 gene copies.

    Science.gov (United States)

    Ivaničová, Zuzana; Valárik, Miroslav; Pánková, Kateřina; Trávníčková, Martina; Doležel, Jaroslav; Šafář, Jan; Milec, Zbyněk

    2017-01-01

    The ability of plants to identify an optimal flowering time is critical for ensuring the production of viable seeds. The main environmental factors that influence the flowering time include the ambient temperature and day length. In wheat, the ability to assess the day length is controlled by photoperiod (Ppd) genes. Due to its allohexaploid nature, bread wheat carries the following three Ppd-1 genes: Ppd-A1, Ppd-B1 and Ppd-D1. While photoperiod (in)sensitivity controlled by Ppd-A1 and Ppd-D1 is mainly determined by sequence changes in the promoter region, the impact of the Ppd-B1 alleles on the heading time has been linked to changes in the copy numbers (and possibly their methylation status) and sequence changes in the promoter region. Here, we report that plants with the same number of Ppd-B1 copies may have different heading times. Differences were observed among F7 lines derived from crossing two spring hexaploid wheat varieties. Several lines carrying three copies of Ppd-B1 headed 16 days later than other plants in the population with the same number of gene copies. This effect was associated with changes in the gene expression level and methylation of the Ppd-B1 gene.

  3. Heritable heading time variation in wheat lines with the same number of Ppd-B1 gene copies.

    Directory of Open Access Journals (Sweden)

    Zuzana Ivaničová

    Full Text Available The ability of plants to identify an optimal flowering time is critical for ensuring the production of viable seeds. The main environmental factors that influence the flowering time include the ambient temperature and day length. In wheat, the ability to assess the day length is controlled by photoperiod (Ppd genes. Due to its allohexaploid nature, bread wheat carries the following three Ppd-1 genes: Ppd-A1, Ppd-B1 and Ppd-D1. While photoperiod (insensitivity controlled by Ppd-A1 and Ppd-D1 is mainly determined by sequence changes in the promoter region, the impact of the Ppd-B1 alleles on the heading time has been linked to changes in the copy numbers (and possibly their methylation status and sequence changes in the promoter region. Here, we report that plants with the same number of Ppd-B1 copies may have different heading times. Differences were observed among F7 lines derived from crossing two spring hexaploid wheat varieties. Several lines carrying three copies of Ppd-B1 headed 16 days later than other plants in the population with the same number of gene copies. This effect was associated with changes in the gene expression level and methylation of the Ppd-B1 gene.

  4. Origin, evolution, and population genetics of the selfish Segregation Distorter gene duplication in European and African populations of Drosophila melanogaster.

    Science.gov (United States)

    Brand, Cara L; Larracuente, Amanda M; Presgraves, Daven C

    2015-05-01

    Meiotic drive elements are a special class of evolutionarily "selfish genes" that subvert Mendelian segregation to gain preferential transmission at the expense of homologous loci. Many drive elements appear to be maintained in populations as stable polymorphisms, their equilibrium frequencies determined by the balance between drive (increasing frequency) and selection (decreasing frequency). Here we show that a classic, seemingly balanced, drive system is instead characterized by frequent evolutionary turnover giving rise to dynamic, rather than stable, equilibrium frequencies. The autosomal Segregation Distorter (SD) system of the fruit fly Drosophila melanogaster is a selfish coadapted meiotic drive gene complex in which the major driver corresponds to a partial duplication of the gene Ran-GTPase activating protein (RanGAP). SD chromosomes segregate at similar, low frequencies of 1-5% in natural populations worldwide, consistent with a balanced polymorphism. Surprisingly, our population genetic analyses reveal evidence for parallel, independent selective sweeps of different SD chromosomes in populations on different continents. These findings suggest that, rather than persisting at a single stable equilibrium, SD chromosomes turn over frequently within populations. © 2015 The Author(s). Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.

  5. Topoisomerase-1 and -2A gene copy numbers are elevated in mismatch repair-proficient colorectal cancers

    DEFF Research Database (Denmark)

    Sønderstrup, Ida Marie Heeholm; Nygård, Sune Boris; Poulsen, Tim Svenstrup

    2015-01-01

    to MMR status by immunohistochemical analysis using validated antibodies for MLH1, MLH2, MSH6 and PMS2, and information on TOP1, CEN20, TOP2A and CEN17 status was previously published for this cohort. RESULTS: The observed TOP1 gene copy numbers in the 36 CRC test cohort were significantly greater (p

  6. Phylogeny of the cycads based on multiple single copy nuclear genes: congruence of concatenation and species tree inference methods

    Science.gov (United States)

    Despite a recent new classification, a stable tree of life for the cycads has been elusive, particularly regarding resolution of Bowenia, Stangeria and Dioon. In this study we apply five single copy nuclear genes (SCNGs) to the phylogeny of the order Cycadales. We specifically aim to evaluate seve...

  7. TRPV5 and TRPV6 in transcellular Ca(2+) transport: regulation, gene duplication, and polymorphisms in African populations.

    Science.gov (United States)

    Peng, Ji-Bin

    2011-01-01

    TRPV5 and TRPV6 are unique members of the TRP super family. They are highly selective for Ca(2+) ions with multiple layers of Ca(2+)-dependent inactivation mechanisms, expressed at the apical membrane of Ca(2+) transporting epithelia, and robustly responsive to 1,25-dihydroxivitamin D(3). These features are well suited for their roles as Ca(2+) entry channels in the first step of transcellular Ca(2+) transport pathways, which are involved in intestinal absorption, renal reabsorption of Ca(2+), placental transfer of Ca(2+) to fetus, and many other processes. While TRPV6 is more broadly expressed in a variety of tissues such as esophagus, stomach, small intestine, colon, kidney, placenta, pancreas, prostate, uterus, salivary gland, and sweat gland, TRPV5 expression is relatively restricted to the distal convoluted tubule and connecting tubule of the kidney. There is only one TRPV6-like gene in fish and birds in comparison to both TRPV5 and TRPV6 genes in mammals, indicating TRPV5 gene was likely generated from duplication of TRPV6 gene during the evolution of mammals to meet the needs of complex renal function. TRPV5 and TRPV6 are subjected to vigorous regulations under physiological, pathological, and therapeutic conditions. The elevated TRPV6 level in malignant tumors such as prostate and breast cancers makes it a potential therapeutic target. TRPV6, and to a lesser extent TRPV5, exhibit unusually high levels of single nucleotide polymorphisms (SNPs) in African populations as compared to other populations, indicating TRPV6 gene was under selective pressure during or after humans migrated out of Africa. The SNPs of TRPV6 and TRPV5 likely contribute to the Ca(2+) conservation mechanisms in African populations.

  8. The fate of the duplicated androgen receptor in fishes: a late neofunctionalization event?

    Directory of Open Access Journals (Sweden)

    Haendler Bernard

    2008-12-01

    Full Text Available Abstract Background Based on the observation of an increased number of paralogous genes in teleost fishes compared with other vertebrates and on the conserved synteny between duplicated copies, it has been shown that a whole genome duplication (WGD occurred during the evolution of Actinopterygian fish. Comparative phylogenetic dating of this duplication event suggests that it occurred early on, specifically in teleosts. It has been proposed that this event might have facilitated the evolutionary radiation and the phenotypic diversification of the teleost fish, notably by allowing the sub- or neo-functionalization of many duplicated genes. Results In this paper, we studied in a wide range of Actinopterygians the duplication and fate of the androgen receptor (AR, NR3C4, a nuclear receptor known to play a key role in sex-determination in vertebrates. The pattern of AR gene duplication is consistent with an early WGD event: it has been duplicated into two genes AR-A and AR-B after the split of the Acipenseriformes from the lineage leading to teleost fish but before the divergence of Osteoglossiformes. Genomic and syntenic analyses in addition to lack of PCR amplification show that one of the duplicated copies, AR-B, was lost in several basal Clupeocephala such as Cypriniformes (including the model species zebrafish, Siluriformes, Characiformes and Salmoniformes. Interestingly, we also found that, in basal teleost fish (Osteoglossiformes and Anguilliformes, the two copies remain very similar, whereas, specifically in Percomorphs, one of the copies, AR-B, has accumulated substitutions in both the ligand binding domain (LBD and the DNA binding domain (DBD. Conclusion The comparison of the mutations present in these divergent AR-B with those known in human to be implicated in complete, partial or mild androgen insensitivity syndrome suggests that the existence of two distinct AR duplicates may be correlated to specific functional differences that may be

  9. Duplicate editorial on duplicate publication.

    Science.gov (United States)

    Corson, Stephen L; Decherney, Alan H

    2005-04-01

    The authors define and discuss the various forms taken by duplicate publications, and provide suggested remedies to help authors, editors, reviewers, and readers avoid this form of internal plagiarism.

  10. Associations of GBP2 gene copy number variations with growth traits and transcriptional expression in Chinese cattle.

    Science.gov (United States)

    Zhang, Gui-Min; Zheng, Li; He, Hua; Song, Cheng-Chuang; Zhang, Zi-Jing; Cao, Xiu-Kai; Lei, Chu-Zhao; Lan, Xian-Yong; Qi, Xing-Lei; Chen, Hong; Huang, Yong-Zhen

    2018-03-20

    Copy number variations (CNVs) recently have been recognized as another important genetic variability followed single nucleotide polymorphisms (SNPs). The guanylate binding protein 2 (GBP2) gene plays an important role in cell proliferation. This study was performed to determine the presence of GBP2 CNV (relative to Angus cattle) in 466 individuals representing six main cattle breeds from China, identify its relationship with growth, and explore the biological effects of gene expression. There were two CNV regions in the GBP2 gene, for three types, CNV1 loss type (relative to Angus cattle) was more frequent in XN than other breeds, and CNV2 loss type (relative to Angus cattle) was more frequent in XN and CDM than other breeds. Though the GBP2 gene copy number presented no correlation with the transcriptional expression of JX (P > .05), but the transcriptional expression in heart is higher than other tissues, and the copy number in muscles and fat of JX is higher than others breeds. Statistical analysis revealed that the GBP2 gene CNV1 and CNV2 were significantly associated with growth traits (P cattle breeds, and our results suggested that the CNVs in GBP2 gene may be considered markers for the molecular breeding of Chinese beef cattle. Copyright © 2018. Published by Elsevier B.V.

  11. Duplication of Dio3 genes in teleost fish and their divergent expression in skin during flatfish metamorphosis.

    Science.gov (United States)

    Alves, R N; Cardoso, J C R; Harboe, T; Martins, R S T; Manchado, M; Norberg, B; Power, D M

    2017-05-15

    Deiodinase 3 (Dio3) plays an essential role during early development in vertebrates by controlling tissue thyroid hormone (TH) availability. The Atlantic halibut (Hippoglossus hippoglossus) possesses duplicate dio3 genes (dio3a and dio3b). Expression analysis indicates that dio3b levels change in abocular skin during metamorphosis and this suggests that this enzyme is associated with the divergent development of larval skin to the juvenile phenotype. In larvae exposed to MMI, a chemical that inhibits TH production, expression of dio3b in ocular skin is significantly up-regulated suggesting that THs normally modulate this genes expression during this developmental event. The molecular basis for divergent dio3a and dio3b expression and responsiveness to MMI treatment is explained by the multiple conserved TREs in the proximal promoter region of teleost dio3b and their absence from the promoter of dio3a. We propose that the divergent expression of dio3 in ocular and abocular skin during halibut metamorphosis contributes to the asymmetric pigment development in response to THs. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Functional diversification of duplicated CYC2 clade genes in regulation of inflorescence development in Gerbera hybrida (Asteraceae).

    Science.gov (United States)

    Juntheikki-Palovaara, Inka; Tähtiharju, Sari; Lan, Tianying; Broholm, Suvi K; Rijpkema, Anneke S; Ruonala, Raili; Kale, Liga; Albert, Victor A; Teeri, Teemu H; Elomaa, Paula

    2014-09-01

    The complex inflorescences (capitula) of Asteraceae consist of different types of flowers. In Gerbera hybrida (gerbera), the peripheral ray flowers are bilaterally symmetrical and lack functional stamens while the central disc flowers are more radially symmetrical and hermaphroditic. Proteins of the CYC2 subclade of the CYC/TB1-like TCP domain transcription factors have been recruited several times independently for parallel evolution of bilaterally symmetrical flowers in various angiosperm plant lineages, and have also been shown to regulate flower-type identity in Asteraceae. The CYC2 subclade genes in gerbera show largely overlapping gene expression patterns. At the level of single flowers, their expression domain in petals shows a spatial shift from the dorsal pattern known so far in species with bilaterally symmetrical flowers, suggesting that this change in expression may have evolved after the origin of Asteraceae. Functional analysis indicates that GhCYC2, GhCYC3 and GhCYC4 mediate positional information at the proximal-distal axis of the inflorescence, leading to differentiation of ray flowers, but that they also regulate ray flower petal growth by affecting cell proliferation until the final size and shape of the petals is reached. Moreover, our data show functional diversification for the GhCYC5 gene. Ectopic activation of GhCYC5 increases flower density in the inflorescence, suggesting that GhCYC5 may promote the flower initiation rate during expansion of the capitulum. Our data thus indicate that modification of the ancestral network of TCP factors has, through gene duplications, led to the establishment of new expression domains and to functional diversification. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  13. Gene fusions with lacZ by duplication insertion in the radioresistant bacterium Deinococcus radiodurans

    International Nuclear Information System (INIS)

    Lennon, E.; Minton, K.W.

    1990-01-01

    Deinococcus radiodurans is the most-studied species of a eubacterial family characterized by extreme resistance to DNA damage. We have focused on developing molecular biological techniques to investigate the genetics of this organism. We report construction of lacZ gene fusions by a method involving both in vitro splicing and the natural transformation of D. radiodurans. Numerous fusion strains were identified by expression of beta-galactosidase. Among these fusion strains, several were inducible by exposure to the DNA-damaging agent mitomycin C, and four of the inducible fusion constructs were cloned in Escherichia coli. Hybridization studies indicate that one of the damage-inducible genes contains a sequence reiterated throughout the D. radiodurans chromosome. Survival measurements show that two of the fusion strains have increased sensitivity to mitomycin C, suggesting that the fusions within these strains inactivate repair functions

  14. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals

    OpenAIRE

    Popova, Olga V.; Mikhailov, Kirill V.; Nikitin, Mikhail A.; Logacheva, Maria D.; Penin, Aleksey A.; Muntyan, Maria S.; Kedrova, Olga S.; Petrov, Nikolai B.; Panchin, Yuri V.; Aleoshin, Vladimir V.

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the earl...

  15. Use of next-generation sequencing to detect LDLR gene copy number variation in familial hypercholesterolemia.

    Science.gov (United States)

    Iacocca, Michael A; Wang, Jian; Dron, Jacqueline S; Robinson, John F; McIntyre, Adam D; Cao, Henian; Hegele, Robert A

    2017-11-01

    Familial hypercholesterolemia (FH) is a heritable condition of severely elevated LDL cholesterol, caused predominantly by autosomal codominant mutations in the LDL receptor gene ( LDLR ). In providing a molecular diagnosis for FH, the current procedure often includes targeted next-generation sequencing (NGS) panels for the detection of small-scale DNA variants, followed by multiplex ligation-dependent probe amplification (MLPA) in LDLR for the detection of whole-exon copy number variants (CNVs). The latter is essential because ∼10% of FH cases are attributed to CNVs in LDLR ; accounting for them decreases false negative findings. Here, we determined the potential of replacing MLPA with bioinformatic analysis applied to NGS data, which uses depth-of-coverage analysis as its principal method to identify whole-exon CNV events. In analysis of 388 FH patient samples, there was 100% concordance in LDLR CNV detection between these two methods: 38 reported CNVs identified by MLPA were also successfully detected by our NGS method, while 350 samples negative for CNVs by MLPA were also negative by NGS. This result suggests that MLPA can be removed from the routine diagnostic screening for FH, significantly reducing associated costs, resources, and analysis time, while promoting more widespread assessment of this important class of mutations across diagnostic laboratories. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.

  16. Disease association with two Helicobacter pylori duplicate outer membrane protein genes, homB and homA.

    Science.gov (United States)

    Oleastro, Monica; Cordeiro, Rita; Yamaoka, Yoshio; Queiroz, Dulciene; Mégraud, Francis; Monteiro, Lurdes; Ménard, Armelle

    2009-06-22

    homB encodes a Helicobacter pylori outer membrane protein. This gene was previously associated with peptic ulcer disease (PUD) and was shown to induce activation of interleukin-8 secretion in vitro, as well as contributing to bacterial adherence. Its 90%-similar gene, homA, was previously correlated with gastritis. The present study aimed to evaluate the gastric disease association with homB and homA, as well as with the H. pylori virulence factors cagA, babA and vacA, in 415 H. pylori strains isolated from patients from East Asian and Western countries. The correlation among these genotypes was also evaluated. Both homB and homA genes were heterogeneously distributed worldwide, with a marked difference between East Asian and Western strains. In Western strains (n = 234, 124 PUD and 110 non-ulcer dyspepsia (NUD), homB, cagA and vacA s1 were all significantly associated with PUD (p = 0.025, p = 0.014, p = 0.039, respectively), and homA was closely correlated with NUD (p = 0.072). In East Asian strains (n = 138, 73 PUD and 65 NUD), homB was found more frequently than homA, and none of these genes was associated with the clinical outcome. Overall, homB was associated with the presence of cagA (p = 0.043) and vacA s1 (p homA was found more frequently in cagA-negative (p = 0.062) and vacA s2 (p homA copy number were observed, with a clear geographical specificity, suggesting an involvement of these genes in host adaptation. A correlation between the homB two-copy genotype and PUD was also observed, emphasizing the role of homB in the virulence of the strain. The global results suggest that homB and homA contribute to the determination of clinical outcome.

  17. Comparative analyses of microbial structures and gene copy numbers in the anaerobic digestion of various types of sewage sludge.

    Science.gov (United States)

    Hidaka, Taira; Tsushima, Ikuo; Tsumori, Jun

    2018-04-01

    Anaerobic co-digestion of various sewage sludges is a promising approach for greater recovery of energy, but the process is more complicated than mono-digestion of sewage sludge. The applicability of microbial structure analyses and gene quantification to understand microbial conditions was evaluated. The results show that information from gene analyses is useful in managing anaerobic co-digestion and damaged microbes in addition to conventional parameters like total solids, pH and biogas production. Total bacterial 16S rRNA gene copy numbers are the most useful tools for evaluating unstable anaerobic digestion of sewage sludge, rather than mcrA and total archaeal 16S rRNA gene copy numbers, and high-throughput sequencing. First order decay rates of gene copy numbers during pH failure were higher than typical decay rates of microbes in stable operation. The sequencing analyses, including multidimensional scaling, showed very different microbial structure shifts, but the results were not consistent. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Rectal duplication.

    Directory of Open Access Journals (Sweden)

    Kulkarni B

    1995-04-01

    Full Text Available Duplications of the alimentary tract are of a great rarity, particularly so in the rectum. Because of its rarity, the difficulty of making a correct diagnosis and of selection of proper approach for treatment, this entity bears a special significance. The present case report deals with a female newborn who presented with imperforate anus and a rectovestibular fistula and a mass prolapsing at the introitus. Complete excision of the mass was carried out through the perineal approach and the child then underwent, a PSARP for the correction of the rectal anomaly. Histology confirmed the mass to be a rectal duplication.

  19. Identification of Ohnolog Genes Originating from Whole Genome Duplication in Early Vertebrates, Based on Synteny Comparison across Multiple Genomes.

    Science.gov (United States)

    Singh, Param Priya; Arora, Jatin; Isambert, Hervé

    2015-07-01

    Whole genome duplications (WGD) have now been firmly established in all major eukaryotic kingdoms. In particular, all vertebrates descend from two rounds of WGDs, that occurred in their jawless ancestor some 500 MY ago. Paralogs retained from WGD, also coined 'ohnologs' after Susumu Ohno, have been shown to be typically associated with development, signaling and gene regulation. Ohnologs, which amount to about 20 to 35% of genes in the human genome, have also been shown to be prone to dominant deleterious mutations and frequently implicated in cancer and genetic diseases. Hence, identifying ohnologs is central to better understand the evolution of vertebrates and their susceptibility to genetic diseases. Early computational analyses to identify vertebrate ohnologs relied on content-based synteny comparisons between the human genome and a single invertebrate outgroup genome or within the human genome itself. These approaches are thus limited by lineage specific rearrangements in individual genomes. We report, in this study, the identification of vertebrate ohnologs based on the quantitative assessment and integration of synteny conservation between six amniote vertebrates and six invertebrate outgroups. Such a synteny comparison across multiple genomes is shown to enhance the statistical power of ohnolog identification in vertebrates compared to earlier approaches, by overcoming lineage specific genome rearrangements. Ohnolog gene families can be browsed and downloaded for three statistical confidence levels or recompiled for specific, user-defined, significance criteria at http://ohnologs.curie.fr/. In the light of the importance of WGD on the genetic makeup of vertebrates, our analysis provides a useful resource for researchers interested in gaining further insights on vertebrate evolution and genetic diseases.

  20. A search for RNA insertions and NS3 gene duplication in the genome of cytopathic isolates of bovine viral diarrhea virus

    Directory of Open Access Journals (Sweden)

    V.L. Quadros

    2006-07-01

    Full Text Available Calves born persistently infected with non-cytopathic bovine viral diarrhea virus (ncpBVDV frequently develop a fatal gastroenteric illness called mucosal disease. Both the original virus (ncpBVDV and an antigenically identical but cytopathic virus (cpBVDV can be isolated from animals affected by mucosal disease. Cytopathic BVDVs originate from their ncp counterparts by diverse genetic mechanisms, all leading to the expression of the non-structural polypeptide NS3 as a discrete protein. In contrast, ncpBVDVs express only the large precursor polypeptide, NS2-3, which contains the NS3 sequence within its carboxy-terminal half. We report here the investigation of the mechanism leading to NS3 expression in 41 cpBVDV isolates. An RT-PCR strategy was employed to detect RNA insertions within the NS2-3 gene and/or duplication of the NS3 gene, two common mechanisms of NS3 expression. RT-PCR amplification revealed insertions in the NS2-3 gene of three cp isolates, with the inserts being similar in size to that present in the cpBVDV NADL strain. Sequencing of one such insert revealed a 296-nucleotide sequence with a central core of 270 nucleotides coding for an amino acid sequence highly homologous (98% to the NADL insert, a sequence corresponding to part of the cellular J-Domain gene. One cpBVDV isolate contained a duplication of the NS3 gene downstream from the original locus. In contrast, no detectable NS2-3 insertions or NS3 gene duplications were observed in the genome of 37 cp isolates. These results demonstrate that processing of NS2-3 without bulk mRNA insertions or NS3 gene duplications seems to be a frequent mechanism leading to NS3 expression and BVDV cytopathology.

  1. A false single nucleotide polymorphism generated by gene duplication compromises meat traceability.

    Science.gov (United States)

    Sanz, Arianne; Ordovás, Laura; Zaragoza, Pilar; Sanz, Albina; de Blas, Ignacio; Rodellar, Clementina

    2012-07-01

    Controlling meat traceability using SNPs is an effective method of ensuring food safety. We have analyzed several SNPs to create a panel for bovine genetic identification and traceability studies. One of these was the transversion g.329C>T (Genbank accession no. AJ496781) on the cytochrome P450 17A1 gene, which has been included in previously published panels. Using minisequencing reactions, we have tested 701 samples belonging to eight Spanish cattle breeds. Surprisingly, an excess of heterozygotes was detected, implying an extreme departure from Hardy-Weinberg equilibrium (PT SNP is a false positive polymorphism, which allows us to explain the inflated heterozygotic value. We recommend that this ambiguous SNP, as well as other polymorphisms located in this region, should not be used in identification, traceability or disease association studies. Annotation of these false SNPs should improve association studies and avoid misinterpretations. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Detection of copy number variants reveals association of cilia genes with neural tube defects.

    Directory of Open Access Journals (Sweden)

    Xiaoli Chen

    Full Text Available BACKGROUND: Neural tube defects (NTDs are one of the most common birth defects caused by a combination of genetic and environmental factors. Currently, little is known about the genetic basis of NTDs although up to 70% of human NTDs were reported to be attributed to genetic factors. Here we performed genome-wide copy number variants (CNVs detection in a cohort of Chinese NTD patients in order to exam the potential role of CNVs in the pathogenesis of NTDs. METHODS: The genomic DNA from eighty-five NTD cases and seventy-five matched normal controls were subjected for whole genome CNVs analysis. Non-DGV (the Database of Genomic Variants CNVs from each group were further analyzed for their associations with NTDs. Gene content in non-DGV CNVs as well as participating pathways were examined. RESULTS: Fifty-five and twenty-six non-DGV CNVs were detected in cases and controls respectively. Among them, forty and nineteen CNVs involve genes (genic CNV. Significantly more non-DGV CNVs and non-DGV genic CNVs were detected in NTD patients than in control (41.2% vs. 25.3%, p<0.05 and 37.6% vs. 20%, p<0.05. Non-DGV genic CNVs are associated with a 2.65-fold increased risk for NTDs (95% CI: 1.24-5.87. Interestingly, there are 41 cilia genes involved in non-DGV CNVs from NTD patients which is significantly enriched in cases compared with that in controls (24.7% vs. 9.3%, p<0.05, corresponding with a 3.19-fold increased risk for NTDs (95% CI: 1.27-8.01. Pathway analyses further suggested that two ciliogenesis pathways, tight junction and protein kinase A signaling, are top canonical pathways implicated in NTD-specific CNVs, and these two novel pathways interact with known NTD pathways. CONCLUSIONS: Evidence from the genome-wide CNV study suggests that genic CNVs, particularly ciliogenic CNVs are associated with NTDs and two ciliogenesis pathways, tight junction and protein kinase A signaling, are potential pathways involved in NTD pathogenesis.

  3. Gallbladder duplication

    Directory of Open Access Journals (Sweden)

    Yagan Pillay

    2015-01-01

    Conclusion: Duplication of the gallbladder is a rare congenital abnormality, which requires special attention to the biliary ductal and arterial anatomy. Laparoscopic cholecystectomy with intraoperative cholangiography is the appropriate treatment in a symptomatic gallbladder. The removal of an asymptomatic double gallbladder remains controversial.

  4. Detection of single-copy functional genes in prokaryotic cells by two-pass TSA-FISH with polynucleotide probes.

    Science.gov (United States)

    Kawakami, Shuji; Hasegawa, Takuya; Imachi, Hiroyuki; Yamaguchi, Takashi; Harada, Hideki; Ohashi, Akiyoshi; Kubota, Kengo

    2012-02-01

    In situ detection of functional genes with single-cell resolution is currently of interest to microbiologists. Here, we developed a two-pass tyramide signal amplification (TSA)-fluorescence in situ hybridization (FISH) protocol with PCR-derived polynucleotide probes for the detection of single-copy genes in prokaryotic cells. The mcrA gene and the apsA gene in methanogens and sulfate-reducing bacteria, respectively, were targeted. The protocol showed bright fluorescence with a good signal-to-noise ratio and achieved a high efficiency of detection (>98%). The discrimination threshold was approximately 82-89% sequence identity. Microorganisms possessing the mcrA or apsA gene in anaerobic sludge samples were successfully detected by two-pass TSA-FISH with polynucleotide probes. The developed protocol is useful for identifying single microbial cells based on functional gene sequences. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. RNA-Mediated Gene Duplication and Retroposons: Retrogenes, LINEs, SINEs, and Sequence Specificity

    Science.gov (United States)

    2013-01-01

    A substantial number of “retrogenes” that are derived from the mRNA of various intron-containing genes have been reported. A class of mammalian retroposons, long interspersed element-1 (LINE1, L1), has been shown to be involved in the reverse transcription of retrogenes (or processed pseudogenes) and non-autonomous short interspersed elements (SINEs). The 3′-end sequences of various SINEs originated from a corresponding LINE. As the 3′-untranslated regions of several LINEs are essential for retroposition, these LINEs presumably require “stringent” recognition of the 3′-end sequence of the RNA template. However, the 3′-ends of mammalian L1s do not exhibit any similarity to SINEs, except for the presence of 3′-poly(A) repeats. Since the 3′-poly(A) repeats of L1 and Alu SINE are critical for their retroposition, L1 probably recognizes the poly(A) repeats, thereby mobilizing not only Alu SINE but also cytosolic mRNA. Many flowering plants only harbor L1-clade LINEs and a significant number of SINEs with poly(A) repeats, but no homology to the LINEs. Moreover, processed pseudogenes have also been found in flowering plants. I propose that the ancestral L1-clade LINE in the common ancestor of green plants may have recognized a specific RNA template, with stringent recognition then becoming relaxed during the course of plant evolution. PMID:23984183

  6. A Meta-Analysis of Multiple Matched Copy Number and Transcriptomics Data Sets for Inferring Gene Regulatory Relationships

    Science.gov (United States)

    Newton, Richard; Wernisch, Lorenz

    2014-01-01

    Inferring gene regulatory relationships from observational data is challenging. Manipulation and intervention is often required to unravel causal relationships unambiguously. However, gene copy number changes, as they frequently occur in cancer cells, might be considered natural manipulation experiments on gene expression. An increasing number of data sets on matched array comparative genomic hybridisation and transcriptomics experiments from a variety of cancer pathologies are becoming publicly available. Here we explore the potential of a meta-analysis of thirty such data sets. The aim of our analysis was to assess the potential of in silico inference of trans-acting gene regulatory relationships from this type of data. We found sufficient correlation signal in the data to infer gene regulatory relationships, with interesting similarities between data sets. A number of genes had highly correlated copy number and expression changes in many of the data sets and we present predicted potential trans-acted regulatory relationships for each of these genes. The study also investigates to what extent heterogeneity between cell types and between pathologies determines the number of statistically significant predictions available from a meta-analysis of experiments. PMID:25148247

  7. Single-copy nuclear genes resolve the phylogeny of the holometabolous insects

    Directory of Open Access Journals (Sweden)

    Bertone Matthew A

    2009-06-01

    Full Text Available Abstract Background Evolutionary relationships among the 11 extant orders of insects that undergo complete metamorphosis, called Holometabola, remain either unresolved or contentious, but are extremely important as a context for accurate comparative biology of insect model organisms. The most phylogenetically enigmatic holometabolan insects are Strepsiptera or twisted wing parasites, whose evolutionary relationship to any other insect order is unconfirmed. They have been controversially proposed as the closest relatives of the flies, based on rDNA, and a possible homeotic transformation in the common ancestor of both groups that would make the reduced forewings of Strepsiptera homologous to the reduced hindwings of Diptera. Here we present evidence from nucleotide sequences of six single-copy nuclear protein coding genes used to reconstruct phylogenetic relationships and estimate evolutionary divergence times for all holometabolan orders. Results Our results strongly support Hymenoptera as the earliest branching holometabolan lineage, the monophyly of the extant orders, including the fleas, and traditionally recognized groupings of Neuropteroidea and Mecopterida. Most significantly, we find strong support for a close relationship between Coleoptera (beetles and Strepsiptera, a previously proposed, but analytically controversial relationship. Exploratory analyses reveal that this relationship cannot be explained by long-branch attraction or other systematic biases. Bayesian divergence times analysis, with reference to specific fossil constraints, places the origin of Holometabola in the Carboniferous (355 Ma, a date significantly older than previous paleontological and morphological phylogenetic reconstructions. The origin and diversification of most extant insect orders began in the Triassic, but flourished in the Jurassic, with multiple adaptive radiations producing the astounding diversity of insect species for which these groups are so well

  8. Genetic variability of human respiratory syncytial virus A strains circulating in Ontario: a novel genotype with a 72 nucleotide G gene duplication.

    Directory of Open Access Journals (Sweden)

    Alireza Eshaghi

    Full Text Available Human respiratory syncytial virus (HRSV is the main cause of acute lower respiratory infections in children under 2 years of age and causes repeated infections throughout life. We investigated the genetic variability of RSV-A circulating in Ontario during 2010-2011 winter season by sequencing and phylogenetic analysis of the G glycoprotein gene.Among the 201 consecutive RSV isolates studied, RSV-A (55.7% was more commonly observed than RSV-B (42.3%. 59.8% and 90.1% of RSV-A infections were among children ≤12 months and ≤5 years old, respectively. On phylogenetic analysis of the second hypervariable region of the 112 RSV-A strains, 110 (98.2% clustered within or adjacent to the NA1 genotype; two isolates were GA5 genotype. Eleven (10% NA1-related isolates clustered together phylogenetically as a novel RSV-A genotype, named ON1, containing a 72 nucleotide duplication in the C-terminal region of the attachment (G glycoprotein. The predicted polypeptide is lengthened by 24 amino acids and includes a23 amino acid duplication. Using RNA secondary structural software, a possible mechanism of duplication occurrence was derived. The 23 amino acid ON1 G gene duplication results in a repeat of 7 potential O-glycosylation sites including three O-linked sugar acceptors at residues 270, 275, and 283. Using Phylogenetic Analysis by Maximum Likelihood analysis, a total of 19 positively selected sites were observed among Ontario NA1 isolates; six were found to be codons which reverted to the previous state observed in the prototype RSV-A2 strain. The tendency of codon regression in the G-ectodomain may infer a decreased avidity of antibody to the current circulating strains. Further work is needed to document and further understand the emergence, virulence, pathogenicity and transmissibility of this novel RSV-A genotype with a72 nucleotide G gene duplication.

  9. Investigation of Copy Number Variation in Children with Conotruncal Heart Defects

    International Nuclear Information System (INIS)

    Campos, Carla Marques Rondon; Zanardo, Evelin Aline; Dutra, Roberta Lelis; Kulikowski, Leslie Domenici; Kim, Chong Ae

    2015-01-01

    Congenital heart defects (CHD) are the most prevalent group of structural abnormalities at birth and one of the main causes of infant morbidity and mortality. Studies have shown a contribution of the copy number variation in the genesis of cardiac malformations. Investigate gene copy number variation (CNV) in children with conotruncal heart defect. Multiplex ligation-dependent probe amplification (MLPA) was performed in 39 patients with conotruncal heart defect. Clinical and laboratory assessments were conducted in all patients. The parents of the probands who presented abnormal findings were also investigated. Gene copy number variation was detected in 7/39 patients: 22q11.2 deletion, 22q11.2 duplication, 15q11.2 duplication, 20p12.2 duplication, 19p deletion, 15q and 8p23.2 duplication with 10p12.31 duplication. The clinical characteristics were consistent with those reported in the literature associated with the encountered microdeletion/microduplication. None of these changes was inherited from the parents. Our results demonstrate that the technique of MLPA is useful in the investigation of microdeletions and microduplications in conotruncal congenital heart defects. Early diagnosis of the copy number variation in patients with congenital heart defect assists in the prevention of morbidity and decreased mortality in these patients

  10. Investigation of Copy Number Variation in Children with Conotruncal Heart Defects

    Directory of Open Access Journals (Sweden)

    Carla Marques Rondon Campos

    2015-01-01

    Full Text Available Background: Congenital heart defects (CHD are the most prevalent group of structural abnormalities at birth and one of the main causes of infant morbidity and mortality. Studies have shown a contribution of the copy number variation in the genesis of cardiac malformations. Objectives: Investigate gene copy number variation (CNV in children with conotruncal heart defect. Methods: Multiplex ligation-dependent probe amplification (MLPA was performed in 39 patients with conotruncal heart defect. Clinical and laboratory assessments were conducted in all patients. The parents of the probands who presented abnormal findings were also investigated. Results: Gene copy number variation was detected in 7/39 patients: 22q11.2 deletion, 22q11.2 duplication, 15q11.2 duplication, 20p12.2 duplication, 19p deletion, 15q and 8p23.2 duplication with 10p12.31 duplication. The clinical characteristics were consistent with those reported in the literature associated with the encountered microdeletion/microduplication. None of these changes was inherited from the parents. Conclusions: Our results demonstrate that the technique of MLPA is useful in the investigation of microdeletions and microduplications in conotruncal congenital heart defects. Early diagnosis of the copy number variation in patients with congenital heart defect assists in the prevention of morbidity and decreased mortality in these patients.

  11. Investigation of Copy Number Variation in Children with Conotruncal Heart Defects

    Energy Technology Data Exchange (ETDEWEB)

    Campos, Carla Marques Rondon, E-mail: carlamcampos@uol.com.br [Universidade Federal de Mato Grosso, Cuiabá, MT (Brazil); Zanardo, Evelin Aline; Dutra, Roberta Lelis [Departamento de Patologia - Laboratório de Citogenômica - LIM 03 - Universidade de São Paulo, São Paulo, SP (Brazil); Kulikowski, Leslie Domenici [Universidade de São Paulo, São Paulo, SP (Brazil); Departamento de Patologia - Laboratório de Citogenômica - LIM 03 - Universidade de São Paulo, São Paulo, SP (Brazil); Kim, Chong Ae [Universidade de São Paulo, São Paulo, SP (Brazil)

    2015-01-15

    Congenital heart defects (CHD) are the most prevalent group of structural abnormalities at birth and one of the main causes of infant morbidity and mortality. Studies have shown a contribution of the copy number variation in the genesis of cardiac malformations. Investigate gene copy number variation (CNV) in children with conotruncal heart defect. Multiplex ligation-dependent probe amplification (MLPA) was performed in 39 patients with conotruncal heart defect. Clinical and laboratory assessments were conducted in all patients. The parents of the probands who presented abnormal findings were also investigated. Gene copy number variation was detected in 7/39 patients: 22q11.2 deletion, 22q11.2 duplication, 15q11.2 duplication, 20p12.2 duplication, 19p deletion, 15q and 8p23.2 duplication with 10p12.31 duplication. The clinical characteristics were consistent with those reported in the literature associated with the encountered microdeletion/microduplication. None of these changes was inherited from the parents. Our results demonstrate that the technique of MLPA is useful in the investigation of microdeletions and microduplications in conotruncal congenital heart defects. Early diagnosis of the copy number variation in patients with congenital heart defect assists in the prevention of morbidity and decreased mortality in these patients.

  12. A network of epigenetic modifiers and DNA repair genes controls tissue-specific copy number alteration preference.

    Science.gov (United States)

    Cramer, Dina; Serrano, Luis; Schaefer, Martin H

    2016-11-10

    Copy number alterations (CNAs) in cancer patients show a large variability in their number, length and position, but the sources of this variability are not known. CNA number and length are linked to patient survival, suggesting clinical relevance. We have identified genes that tend to be mutated in samples that have few or many CNAs, which we term CONIM genes (COpy Number Instability Modulators). CONIM proteins cluster into a densely connected subnetwork of physical interactions and many of them are epigenetic modifiers. Therefore, we investigated how the epigenome of the tissue-of-origin influences the position of CNA breakpoints and the properties of the resulting CNAs. We found that the presence of heterochromatin in the tissue-of-origin contributes to the recurrence and length of CNAs in the respective cancer type.

  13. Stratification of clear cell renal cell carcinoma (ccRCC) genomes by gene-directed copy number alteration (CNA) analysis.

    Science.gov (United States)

    Thiesen, H-J; Steinbeck, F; Maruschke, M; Koczan, D; Ziems, B; Hakenberg, O W

    2017-01-01

    Tumorigenic processes are understood to be driven by epi-/genetic and genomic alterations from single point mutations to chromosomal alterations such as insertions and deletions of nucleotides up to gains and losses of large chromosomal fragments including products of chromosomal rearrangements e.g. fusion genes and proteins. Overall comparisons of copy number alterations (CNAs) presented in 48 clear cell renal cell carcinoma (ccRCC) genomes resulted in ratios of gene losses versus gene gains between 26 ccRCC Fuhrman malignancy grades G1 (ratio 1.25) and 20 G3 (ratio 0.58). Gene losses and gains of 15762 CNA genes were mapped to 795 chromosomal cytoband loci including 280 KEGG pathways. CNAs were classified according to their contribution to Fuhrman tumour gradings G1 and G3. Gene gains and losses turned out to be highly structured processes in ccRCC genomes enabling the subclassification and stratification of ccRCC tumours in a genome-wide manner. CNAs of ccRCC seem to start with common tumour related gene losses flanked by CNAs specifying Fuhrman grade G1 losses and CNA gains favouring grade G3 tumours. The appearance of recurrent CNA signatures implies the presence of causal mechanisms most likely implicated in the pathogenesis and disease-outcome of ccRCC tumours distinguishing lower from higher malignant tumours. The diagnostic quality of initial 201 genes (108 genes supporting G1 and 93 genes G3 phenotypes) has been successfully validated on published Swiss data (GSE19949) leading to a restricted CNA gene set of 171 CNA genes of which 85 genes favour Fuhrman grade G1 and 86 genes Fuhrman grade G3. Regarding these gene sets overall survival decreased with the number of G3 related gene losses plus G3 related gene gains. CNA gene sets presented define an entry to a gene-directed and pathway-related functional understanding of ongoing copy number alterations within and between individual ccRCC tumours leading to CNA genes of prognostic and predictive value.

  14. Penicillin production in industrial strain Penicillium chrysogenum P2niaD18 is not dependent on the copy number of biosynthesis genes.

    Science.gov (United States)

    Ziemons, Sandra; Koutsantas, Katerina; Becker, Kordula; Dahlmann, Tim; Kück, Ulrich

    2017-02-16

    Multi-copy gene integration into microbial genomes is a conventional tool for obtaining improved gene expression. For Penicillium chrysogenum, the fungal producer of the beta-lactam antibiotic penicillin, many production strains carry multiple copies of the penicillin biosynthesis gene cluster. This discovery led to the generally accepted view that high penicillin titers are the result of multiple copies of penicillin genes. Here we investigated strain P2niaD18, a production line that carries only two copies of the penicillin gene cluster. We performed pulsed-field gel electrophoresis (PFGE), quantitative qRT-PCR, and penicillin bioassays to investigate production, deletion and overexpression strains generated in the P. chrysogenum P2niaD18 background, in order to determine the copy number of the penicillin biosynthesis gene cluster, and study the expression of one penicillin biosynthesis gene, and the penicillin titer. Analysis of production and recombinant strain showed that the enhanced penicillin titer did not depend on the copy number of the penicillin gene cluster. Our assumption was strengthened by results with a penicillin null strain lacking pcbC encoding isopenicillin N synthase. Reintroduction of one or two copies of the cluster into the pcbC deletion strain restored transcriptional high expression of the pcbC gene, but recombinant strains showed no significantly different penicillin titer compared to parental strains. Here we present a molecular genetic analysis of production and recombinant strains in the P2niaD18 background carrying different copy numbers of the penicillin biosynthesis gene cluster. Our analysis shows that the enhanced penicillin titer does not strictly depend on the copy number of the cluster. Based on these overall findings, we hypothesize that instead, complex regulatory mechanisms are prominently implicated in increased penicillin biosynthesis in production strains.

  15. Heritable heading time variation in wheat lines with the same number of Ppd-B1 gene copies

    Czech Academy of Sciences Publication Activity Database

    Ivaničová, Zuzana; Valárik, Miroslav; Pánková, K.; Trávníčková, M.; Doležel, Jaroslav; Šafář, Jan; Milec, Zbyněk

    2017-01-01

    Roč. 12, č. 8 (2017), č. článku e0183745. E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) LO1204; GA ČR GBP501/12/G090 Institutional support: RVO:61389030 Keywords : triticum-aestivum l. * dna methylation * copy number * flowering time * human genome * se gene * vernalization * earliness * barley * region Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  16. Low C4 gene copy numbers are associated with superior graft survival in patients transplanted with a deceased donor kidney

    DEFF Research Database (Denmark)

    Bay, Jakob T; Schejbel, Lone; Madsen, Hans O

    2013-01-01

    rejection, but a relationship between graft survival and serum C4 concentration as well as C4 genetic variation has not been established. We evaluated this using a prospective study design of 676 kidney transplant patients and 211 healthy individuals as controls. Increasing C4 gene copy numbers......Complement C4 is a central component of the classical and the lectin pathways of the complement system. The C4 protein exists as two isotypes C4A and C4B encoded by the C4A and C4B genes, both of which are found with varying copy numbers. Deposition of C4 has been implicated in kidney graft...... significantly correlated with the C4 serum concentration in both patients and controls. Patients with less than four total copies of C4 genes transplanted with a deceased donor kidney experienced a superior 5-year graft survival (hazard ratio 0.46, 95% confidence interval: 0.25-0.84). No significant association...

  17. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

    Science.gov (United States)

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

    2014-05-01

    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.

  18. Copy number variation in VEGF gene as a biomarker of susceptibility to age-related macular degeneration

    Directory of Open Access Journals (Sweden)

    Norshakimah Md Bakri

    2018-07-01

    Full Text Available Background: Several studies in various populations have been conducted to determine candidate genes that could contribute to age-related macular degeneration (AMD pathogenesis. Objective: The present study was undertaken to determine the association of high temperature requirement A-1 (HTRA1, vascular endothelial growth factor (VEGF and very-low-density receptor (VLDR genes with wet AMD subjects in Malaysia. Methods: A total of 125 subjects with wet AMD and 120 subjects without AMD from the Malaysian population were selected for this study. Genomic DNA was extracted and copy number variations (CNVs were determined using quantitative real-time Polymerase Chain Reaction (qPCR and comparison between the two groups was done. The demographic characteristics were also recorded. Statistical analysis was carried out using software where a level of P  0.05. Conclusion: Observations of an association between CNVs of VEGF gene and wet AMD have revealed that the CNVs of VEGF gene appears to be a possible contributor to wet AMD subjects in Malaysia. Keywords: Age-related macular degeneration, Copy number variations, VEGF, HTRA1, VLDR genes and Malaysia

  19. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Energy Technology Data Exchange (ETDEWEB)

    Pejcha, Robert; Ludwig, Martha L. (Michigan)

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  20. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    International Nuclear Information System (INIS)

    Pejcha, Robert; Ludwig, Martha L.

    2005-01-01

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα) 8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys) 3 Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E · Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  1. Cobalamin-independent methionine synthase (MetE: a face-to-face double barrel that evolved by gene duplication.

    Directory of Open Access Journals (Sweden)

    Robert Pejchal

    2005-02-01

    Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  2. Assessment of Tumor Heterogeneity, as Evidenced by Gene Expression Profiles, Pathway Activation, and Gene Copy Number, in Patients with Multifocal Invasive Lobular Breast Tumors

    Science.gov (United States)

    Norton, Nadine; Advani, Pooja P.; Serie, Daniel J.; Geiger, Xochiquetzal J.; Necela, Brian M.; Axenfeld, Bianca C.; Kachergus, Jennifer M.; Feathers, Ryan W.; Carr, Jennifer M.; Crook, Julia E.; Moreno-Aspitia, Alvaro; Anastasiadis, Panos Z.; Perez, Edith A.; Thompson, E. Aubrey

    2016-01-01

    Background Invasive lobular carcinoma (ILC) comprises approximately ~10–20% of breast cancers. In general, multifocal/multicentric (MF/MC) breast cancer has been associated with an increased rate of regional lymph node metastases. Tumor heterogeneity between foci represents a largely unstudied source of genomic variation in those rare patients with MF/MC ILC. Methods We characterized gene expression and copy number in 2 or more foci from 11 patients with MF/MC ILC (all ER+, HER2-) and adjacent normal tissue. RNA and DNA were extracted from 3x1.5mm cores from all foci. Gene expression (730 genes) and copy number (80 genes) were measured using Nanostring PanCancer and Cancer CNV panels. Linear mixed models were employed to compare expression in tumor versus normal samples from the same patient, and to assess heterogeneity (variability) in expression among multiple ILC within an individual. Results 35 and 34 genes were upregulated (FC>2) and down-regulated (FC<0.5) respectively in ILC tumor relative to adjacent normal tissue, q<0.05. 9/34 down-regulated genes (FIGF, RELN, PROM1, SFRP1, MMP7, NTRK2, LAMB3, SPRY2, KIT) had changes larger than CDH1, a hallmark of ILC. Copy number changes in these patients were relatively few but consistent across foci within each patient. Amplification of three genes (CCND1, FADD, ORAOV1) at 11q13.3 was present in 2/11 patients in both foci. We observed significant evidence of within-patient between-foci variability (heterogeneity) in gene expression for 466 genes (p<0.05 with FDR 8%), including CDH1, FIGF, RELN, SFRP1, MMP7, NTRK2, LAMB3, SPRY2 and KIT. Conclusions There was substantial variation in gene expression between ILC foci within patients, including known markers of ILC, suggesting an additional level of complexity that should be addressed. PMID:27078887

  3. Dual gain of HER2 and EGFR gene copy numbers impacts the prognosis of carcinoma ex pleomorphic adenoma.

    Science.gov (United States)

    Nishijima, Toshimitsu; Yamamoto, Hidetaka; Nakano, Takafumi; Nakashima, Torahiko; Taguchi, Ken-ichi; Masuda, Muneyuki; Motoshita, Jun-ichi; Komune, Shizuo; Oda, Yoshinao

    2015-11-01

    We investigated the potential roles of HER2 and EGFR and evaluated their prognostic significance in carcinoma ex pleomorphic adenoma (CXPA). We analyzed HER2 and EGFR overexpression status using immunohistochemistry (IHC) and gene copy number gain by chromogenic in situ hybridization (CISH) in 50 cases of CXPA (40 ductal-type and 10 myoepithelial-type CXPAs). Salivary duct carcinoma was the most common histologic subtype of malignant component (n = 21). Immunohistochemistry positivity and chromogenic in situ hybridization positivity were closely correlated in both HER2 and EGFR. HER2 CISH positivity (mostly gene amplification) and EGFR CISH positivity (mostly gene high polysomy) were present in 19 (40%) and 21 (44%) cases, respectively, and were each significantly correlated with poor outcome (P = .0009 and P = .0032, respectively). Dual gain of HER2 and EGFR gene copy numbers was present in 11 cases (23%) and was the most aggressive genotype. HER2 CISH positivity was more frequently present in ductal-type CXPAs (47%) than in myoepithelial-type CXPAs (10%), whereas the prevalence of EGFR CISH positivity was similar in both histologic subtypes (42% and 50%, respectively). Our results suggest that HER2 and EGFR gene copy number gains may play an important role in the progression of CXPA, in particular ductal-type CXPAs. HER2 CISH-positive/EGFR CISH-positive tumors may be the most aggressive subgroup in CXPA. The molecular subclassification of CXPA based on the HER2 and EGFR status may be helpful for prognostic prediction and decisions regarding the choice of therapeutic strategy. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

    Science.gov (United States)

    Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

    2012-01-01

    Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

  5. GeneBreak: detection of recurrent DNA copy number aberration-associated chromosomal breakpoints within genes [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Evert van den Broek

    2017-07-01

    Full Text Available Development of cancer is driven by somatic alterations, including numerical and structural chromosomal aberrations. Currently, several computational methods are available and are widely applied to detect numerical copy number aberrations (CNAs of chromosomal segments in tumor genomes. However, there is lack of computational methods that systematically detect structural chromosomal aberrations by virtue of the genomic location of CNA-associated chromosomal breaks and identify genes that appear non-randomly affected by chromosomal breakpoints across (large series of tumor samples. ‘GeneBreak’ is developed to systematically identify genes recurrently affected by the genomic location of chromosomal CNA-associated breaks by a genome-wide approach, which can be applied to DNA copy number data obtained by array-Comparative Genomic Hybridization (CGH or by (low-pass whole genome sequencing (WGS. First, ‘GeneBreak’ collects the genomic locations of chromosomal CNA-associated breaks that were previously pinpointed by the segmentation algorithm that was applied to obtain CNA profiles. Next, a tailored annotation approach for breakpoint-to-gene mapping is implemented. Finally, dedicated cohort-based statistics is incorporated with correction for covariates that influence the probability to be a breakpoint gene. In addition, multiple testing correction is integrated to reveal recurrent breakpoint events. This easy-to-use algorithm, ‘GeneBreak’, is implemented in R (www.cran.r-project.org and is available from Bioconductor (www.bioconductor.org/packages/release/bioc/html/GeneBreak.html.

  6. Diversity and population-genetic properties of copy number variations and multicopy genes in cattle

    Science.gov (United States)

    The diversity and population-genetics of copy number variation (CNV) in domesticated animals are not well understood. In this study, we analyzed 75 genomes of major taurine and indicine cattle breeds (including Angus, Brahman, Gir, Holstein, Jersey, Limousin, Nelore, Romagnola), sequenced to 11-fold...

  7. Insertional translocation leading to a 4q13 duplication including the EPHA5 gene in two siblings with attention-deficit hyperactivity disorder.

    Science.gov (United States)

    Matoso, Eunice; Melo, Joana B; Ferreira, Susana I; Jardim, Ana; Castelo, Teresa M; Weise, Anja; Carreira, Isabel M

    2013-08-01

    An insertional translocation (IT) can result in pure segmental aneusomy for the inserted genomic segment allowing to define a more accurate clinical phenotype. Here, we report on two siblings sharing an unbalanced IT inherited from the mother with a history of learning difficulty. An 8-year-old girl with developmental delay, speech disability, and attention-deficit hyperactivity disorder (ADHD), showed by GTG banding analysis a subtle interstitial alteration in 21q21. Oligonucleotide array comparative genomic hybridization (array-CGH) analysis showed a 4q13.1-q13.3 duplication spanning 8.6 Mb. Fluorescence in situ hybridization (FISH) with bacterial artificial chromosome (BAC) clones confirmed the rearrangement, a der(21)ins(21;4)(q21;q13.1q13.3). The duplication described involves 50 RefSeq genes including the EPHA5 gene that encodes for the EphA5 receptor involved in embryonic development of the brain and also in synaptic remodeling and plasticity thought to underlie learning and memory. The same rearrangement was observed in a younger brother with behavioral problems and also exhibiting ADHD. ADHD is among the most heritable of neuropsychiatric disorders. There are few reports of patients with duplications involving the proximal region of 4q and a mild phenotype. To the best of our knowledge this is the first report of a duplication restricted to band 4q13. This abnormality could be easily missed in children who have nonspecific cognitive impairment. The presence of this behavioral disorder in the two siblings reinforces the hypothesis that the region involved could include genes involved in ADHD. Copyright © 2013 Wiley Periodicals, Inc.

  8. Optimization of Critical Hairpin Features Allows miRNA-based Gene Knockdown Upon Single-copy Transduction

    Directory of Open Access Journals (Sweden)

    Renier Myburgh

    2014-01-01

    Full Text Available Gene knockdown using micro RNA (miRNA-based vector constructs is likely to become a prominent gene therapy approach. It was the aim of this study to improve the efficiency of gene knockdown through optimizing the structure of miRNA mimics. Knockdown of two target genes was analyzed: CCR5 and green fluorescent protein. We describe here a novel and optimized miRNA mimic design called mirGE comprising a lower stem length of 13 base pairs (bp, positioning of the targeting strand on the 5′ side of the miRNA, together with nucleotide mismatches in upper stem positions 1 and 12 placed on the passenger strand. Our mirGE proved superior to miR-30 in four aspects: yield of targeting strand incorporation into RNA-induced silencing complex (RISC; incorporation into RISC of correct targeting strand; precision of cleavage by Drosha; and ratio of targeting strand over passenger strand. A triple mirGE hairpin cassette targeting CCR5 was constructed. It allowed CCR5 knockdown with an efficiency of over 90% upon single-copy transduction. Importantly, single-copy expression of this construct rendered transduced target cells, including primary human macrophages, resistant to infection with a CCR5-tropic strain of HIV. Our results provide new insights for a better knockdown efficiency of constructs containing miRNA. Our results also provide the proof-of-principle that cells can be rendered HIV resistant through single-copy vector transduction, rendering this approach more compatible with clinical applications.

  9. Using paleogenomics to study the evolution of gene families: origin and duplication history of the relaxin family hormones and their receptors.

    Directory of Open Access Journals (Sweden)

    Sergey Yegorov

    Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of

  10. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    Science.gov (United States)

    Cuypers, Thomas D; Hogeweg, Paulien

    2014-04-01

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and adaptation remains unknown. Here, we study the duplicate retention pattern postWGD, by letting virtual cells adapt to environmental changes. The virtual cells have structured genomes that encode a regulatory network and simple metabolism. Populations are under selection for homeostasis and evolve by point mutations, small indels and WGD. After populations had initially adapted fully to fluctuating resource conditions re-adaptation to a broad range of novel environments was studied by tracking mutations in the line of descent. WGD was established in a minority (≈30%) of lineages, yet, these were significantly more successful at re-adaptation. Unexpectedly, WGD lineages conserved more seemingly redundant genes, yet had higher per gene mutation rates. While WGD duplicates of all functional classes were significantly over-retained compared to a model of neutral losses, duplicate retention was clearly biased towards highly connected TFs. Importantly, no subfunctionalization occurred in conserved pairs, strongly suggesting that dosage balance shaped retention. Meanwhile, singles diverged significantly. WGD, therefore, is a powerful mechanism to cope with environmental change, allowing conservation of a core machinery, while adapting the peripheral network to accommodate change.

  11. Copy number variants and VNTR length polymorphisms of the carboxyl-ester lipase (CEL) gene as risk factors in pancreatic cancer.

    Science.gov (United States)

    Dalva, Monica; El Jellas, Khadija; Steine, Solrun J; Johansson, Bente B; Ringdal, Monika; Torsvik, Janniche; Immervoll, Heike; Hoem, Dag; Laemmerhirt, Felix; Simon, Peter; Lerch, Markus M; Johansson, Stefan; Njølstad, Pål R; Weiss, Frank U; Fjeld, Karianne; Molven, Anders

    We have recently described copy number variants (CNVs) of the human carboxyl-ester lipase (CEL) gene, including a recombined deletion allele (CEL-HYB) that is a genetic risk factor for chronic pancreatitis. Associations with pancreatic disease have also been reported for the variable number of tandem repeat (VNTR) region located in CEL exon 11. Here, we examined if CEL CNVs and VNTR length polymorphisms affect the risk for developing pancreatic cancer. CEL CNVs and VNTR were genotyped in a German family with non-alcoholic chronic pancreatitis and pancreatic cancer, in 265 German and 197 Norwegian patients diagnosed with pancreatic adenocarcinoma, and in 882 controls. CNV screening was performed using PCR assays followed by agarose gel electrophoresis whereas VNTR lengths were determined by DNA fragment analysis. The investigated family was CEL-HYB-positive. However, an association of CEL-HYB or a duplication CEL allele with pancreatic cancer was not seen in our two patient cohorts. The frequency of the 23-repeat VNTR allele was borderline significant in Norwegian cases compared to controls (1.2% vs. 0.3%; P = 0.05). For all other VNTR lengths, no statistically significant difference in frequency was observed. Moreover, no association with pancreatic cancer was detected when CEL VNTR lengths were pooled into groups of short, normal or long alleles. We could not demonstrate an association between CEL CNVs and pancreatic cancer. An association is also unlikely for CEL VNTR lengths, although analyses in larger materials are necessary to completely exclude an effect of rare VNTR alleles. Copyright © 2016 IAP and EPC. Published by Elsevier B.V. All rights reserved.

  12. SLC26A4 gene copy number variations in Chinese patients with non-syndromic enlarged vestibular aqueduct

    Directory of Open Access Journals (Sweden)

    Zhao Jiandong

    2012-05-01

    Full Text Available Abstract Background Many patients with enlarged vestibular aqueduct (EVA have either only one allelic mutant of the SLC26A4 gene or lack any detectable mutation. In this study, multiplex ligation-dependent probe amplification (MLPA was used to screen for copy number variations (CNVs of SLC26A4 and to reveal the pathogenic mechanisms of non-syndromic EVA (NSEVA. Methods Between January 2003 and March 2010, 923 Chinese patients (481 males, 442 females with NSEVA were recruited. Among these, 68 patients (7.4% were found to carry only one mutant allele of SLC26A4 and 39 patients (4.2% lacked any detectable mutation in SLC26A4; these 107 patients without double mutant alleles were assigned to the patient group. Possible copy number variations in SLC26A4 were detected by SALSA MLPA. Results Using GeneMapper, no significant difference was observed between the groups, as compared with the standard probe provided in the assay. The results of the capillary electrophoresis showed no significant difference between the patients and controls. Conclusion Our results suggest that CNVs and the exon deletion in SLC26A4 are not important factors in NSEVA. However, it would be premature to conclude that CNVs have no role in EVA. Genome-wide studies to explore CNVs within non-coding regions of the SLC26A4 gene and neighboring regions are warranted, to elucidate their roles in NSEVA etiology.

  13. Assessment and Reconstruction of Novel HSP90 Genes: Duplications, Gains and Losses in Fungal and Animal Lineages

    Czech Academy of Sciences Publication Activity Database

    Pantzartzi, Chrysoula; Drosopoulou, E.; Scouras, Z.

    2013-01-01

    Roč. 8, č. 9 (2013), s. 1-11 E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:68378050 Keywords : Hsp90s * Fungi * duplication events Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.534, year: 2013

  14. Delineation of a new chromosome 20q11.2 duplication syndrome including the ASXL1 gene

    DEFF Research Database (Denmark)

    Avila, Magali; Kirchhoff, Eva Maria; Marle, Nathalie

    2013-01-01

    We report on three males with de novo overlapping 7.5, 9.8, and 10 Mb duplication of chromosome 20q11.2. Together with another patient previously published in the literature with overlapping 20q11 microduplication, we show that such patients display common clinical features including metopic ridg...

  15. High frequency of rare copy number variants affecting functionally related genes in patients with structural brain malformations

    DEFF Research Database (Denmark)

    Kariminejad, Roxana; Lind-Thomsen, Allan; Tümer, Zeynep

    2011-01-01

    ) to investigate copy number variants (CNVs) in a cohort of 169 patients with various structural brain malformations including lissencephaly, polymicrogyria, focal cortical dysplasia, and corpus callosum agenesis. The majority of the patients had intellectual disabilities (ID) and suffered from symptomatic...... that genes involved in "axonal transport," "cation transmembrane transporter activity," and the "c-Jun N-terminal kinase (JNK) cascade" play a significant role in the etiology of brain malformations. This is to the best of our knowledge the first systematic study of CNVs in patients with structural brain...

  16. Plasticity of the Leishmania genome leading to gene copy number variations and drug resistance [version 1; referees: 5 approved

    Directory of Open Access Journals (Sweden)

    Marie-Claude N. Laffitte

    2016-09-01

    Full Text Available Leishmania has a plastic genome, and drug pressure can select for gene copy number variation (CNV. CNVs can apply either to whole chromosomes, leading to aneuploidy, or to specific genomic regions. For the latter, the amplification of chromosomal regions occurs at the level of homologous direct or inverted repeated sequences leading to extrachromosomal circular or linear amplified DNAs. This ability of Leishmania to respond to drug pressure by CNVs has led to the development of genomic screens such as Cos-Seq, which has the potential of expediting the discovery of drug targets for novel promising drug candidates.

  17. The Symbiotic Performance of Chickpea Rhizobia Can Be Improved by Additional Copies of the clpB Chaperone Gene.

    Science.gov (United States)

    Paço, Ana; Brígido, Clarisse; Alexandre, Ana; Mateos, Pedro F; Oliveira, Solange

    2016-01-01

    The ClpB chaperone is known to be involved in bacterial stress response. Moreover, recent studies suggest that this protein has also a role in the chickpea-rhizobia symbiosis. In order to improve both stress tolerance and symbiotic performance of a chickpea microsymbiont, the Mesorhizobium mediterraneum UPM-Ca36T strain was genetically transformed with pPHU231 containing an extra-copy of the clpB gene. To investigate if the clpB-transformed strain displays an improved stress tolerance, bacterial growth was evaluated under heat and acid stress conditions. In addition, the effect of the extra-copies of the clpB gene in the symbiotic performance was evaluated using plant growth assays (hydroponic and pot trials). The clpB-transformed strain is more tolerant to heat shock than the strain transformed with pPHU231, supporting the involvement of ClpB in rhizobia heat shock tolerance. Both plant growth assays showed that ClpB has an important role in chickpea-rhizobia symbiosis. The nodulation kinetics analysis showed a higher rate of nodule appearance with the clpB-transformed strain. This strain also induced a greater number of nodules and, more notably, its symbiotic effectiveness increased ~60% at pH5 and 83% at pH7, compared to the wild-type strain. Furthermore, a higher frequency of root hair curling was also observed in plants inoculated with the clpB-transformed strain, compared to the wild-type strain. The superior root hair curling induction, nodulation ability and symbiotic effectiveness of the clpB-transformed strain may be explained by an increased expression of symbiosis genes. Indeed, higher transcript levels of the nodulation genes nodA and nodC (~3 folds) were detected in the clpB-transformed strain. The improvement of rhizobia by addition of extra-copies of the clpB gene may be a promising strategy to obtain strains with enhanced stress tolerance and symbiotic effectiveness, thus contributing to their success as crop inoculants, particularly under

  18. The Symbiotic Performance of Chickpea Rhizobia Can Be Improved by Additional Copies of the clpB Chaperone Gene.

    Directory of Open Access Journals (Sweden)

    Ana Paço

    Full Text Available The ClpB chaperone is known to be involved in bacterial stress response. Moreover, recent studies suggest that this protein has also a role in the chickpea-rhizobia symbiosis. In order to improve both stress tolerance and symbiotic performance of a chickpea microsymbiont, the Mesorhizobium mediterraneum UPM-Ca36T strain was genetically transformed with pPHU231 containing an extra-copy of the clpB gene. To investigate if the clpB-transformed strain displays an improved stress tolerance, bacterial growth was evaluated under heat and acid stress conditions. In addition, the effect of the extra-copies of the clpB gene in the symbiotic performance was evaluated using plant growth assays (hydroponic and pot trials. The clpB-transformed strain is more tolerant to heat shock than the strain transformed with pPHU231, supporting the involvement of ClpB in rhizobia heat shock tolerance. Both plant growth assays showed that ClpB has an important role in chickpea-rhizobia symbiosis. The nodulation kinetics analysis showed a higher rate of nodule appearance with the clpB-transformed strain. This strain also induced a greater number of nodules and, more notably, its symbiotic effectiveness increased ~60% at pH5 and 83% at pH7, compared to the wild-type strain. Furthermore, a higher frequency of root hair curling was also observed in plants inoculated with the clpB-transformed strain, compared to the wild-type strain. The superior root hair curling induction, nodulation ability and symbiotic effectiveness of the clpB-transformed strain may be explained by an increased expression of symbiosis genes. Indeed, higher transcript levels of the nodulation genes nodA and nodC (~3 folds were detected in the clpB-transformed strain. The improvement of rhizobia by addition of extra-copies of the clpB gene may be a promising strategy to obtain strains with enhanced stress tolerance and symbiotic effectiveness, thus contributing to their success as crop inoculants

  19. Prevalence and spectrum of large deletions or duplications in the major long QT syndrome-susceptibility genes and implications for long QT syndrome genetic testing.

    Science.gov (United States)

    Tester, David J; Benton, Amber J; Train, Laura; Deal, Barbara; Baudhuin, Linnea M; Ackerman, Michael J

    2010-10-15

    Long QT syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for 3 cardiac ion channel α-subunits (LQT1 to LQT3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. We set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes in unrelated patients who were mutation negative after point mutation analysis of LQT1- to LQT12-susceptibility genes. Forty-two unrelated, clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification, a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA multiplex ligation-dependent probe amplification LQTS kit from MRC-Holland was used to analyze the 3 major LQTS-associated genes, KCNQ1, KCNH2, and SCN5A, and the 2 minor genes, KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2 of 42 unrelated patients (4.8%, confidence interval 1.7 to 11). A deletion of KCNQ1 exon 3 was identified in a 10-year-old Caucasian boy with a corrected QT duration of 660 ms, a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17-year-old Caucasian girl with a corrected QT duration of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, because nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. Copyright © 2010 Elsevier Inc. All rights reserved.

  20. Possible gene dosage effect of glutathione-S-transferases on atopic asthma: using real-time PCR for quantification of GSTM1 and GSTT1 gene copy numbers

    DEFF Research Database (Denmark)

    Brasch-Andersen, Charlotte; Christiansen, L; Tan, Q

    2004-01-01

    -S-transferase (GST) involved in the antioxidant defense were tested for association to asthma using 246 Danish atopic families in a family-based transmission disequilibrium test (TDT) design. A real-time PCR assay for relative quantification of gene copy number of GSTM1 and GSTT1 was developed. The assay made......Asthma is a complex genetic disorder characterized by chronic inflammation in the airways. As oxidative stress is a key component of inflammation, variations in genes involved in antioxidant defense could therefore be likely candidates for asthma. Three enzymes from the superfamily glutathione...

  1. Small homologous blocks in phytophthora genomes do not point to an ancient whole-genome duplication.

    Science.gov (United States)

    van Hooff, Jolien J E; Snel, Berend; Seidl, Michael F

    2014-05-01

    Genomes of the plant-pathogenic genus Phytophthora are characterized by small duplicated blocks consisting of two consecutive genes (2HOM blocks) and by an elevated abundance of similarly aged gene duplicates. Both properties, in particular the presence of 2HOM blocks, have been attributed to a whole-genome duplication (WGD) at the last common ancestor of Phytophthora. However, large intraspecies synteny-compelling evidence for a WGD-has not been detected. Here, we revisited the WGD hypothesis by deducing the age of 2HOM blocks. Two independent timing methods reveal that the majority of 2HOM blocks arose after divergence of the Phytophthora lineages. In addition, a large proportion of the 2HOM block copies colocalize on the same scaffold. Therefore, the presence of 2HOM blocks does not support a WGD at the last common ancestor of Phytophthora. Thus, genome evolution of Phytophthora is likely driven by alternative mechanisms, such as bursts of transposon activity.

  2. MSOAR 2.0: Incorporating tandem duplications into ortholog assignment based on genome rearrangement

    Directory of Open Access Journals (Sweden)

    Zhang Liqing

    2010-01-01

    Full Text Available Abstract Background Ortholog assignment is a critical and fundamental problem in comparative genomics, since orthologs are considered to be functional counterparts in different species and can be used to infer molecular functions of one species from those of other species. MSOAR is a recently developed high-throughput system for assigning one-to-one orthologs between closely related species on a genome scale. It attempts to reconstruct the evolutionary history of input genomes in terms of genome rearrangement and gene duplication events. It assumes that a gene duplication event inserts a duplicated gene into the genome of interest at a random location (i.e., the random duplication model. However, in practice, biologists believe that genes are often duplicated by tandem duplications, where a duplicated gene is located next to the original copy (i.e., the tandem duplication model. Results In this paper, we develop MSOAR 2.0, an improved system for one-to-one ortholog assignment. For a pair of input genomes, the system first focuses on the tandemly duplicated genes of each genome and tries to identify among them those that were duplicated after the speciation (i.e., the so-called inparalogs, using a simple phylogenetic tree reconciliation method. For each such set of tandemly duplicated inparalogs, all but one gene will be deleted from the concerned genome (because they cannot possibly appear in any one-to-one ortholog pairs, and MSOAR is invoked. Using both simulated and real data experiments, we show that MSOAR 2.0 is able to achieve a better sensitivity and specificity than MSOAR. In comparison with the well-known genome-scale ortholog assignment tool InParanoid, Ensembl ortholog database, and the orthology information extracted from the well-known whole-genome multiple alignment program MultiZ, MSOAR 2.0 shows the highest sensitivity. Although the specificity of MSOAR 2.0 is slightly worse than that of InParanoid in the real data experiments

  3. Analysis of high-identity segmental duplications in the grapevine genome

    Directory of Open Access Journals (Sweden)

    Carelli Francesco N

    2011-08-01

    Full Text Available Abstract Background Segmental duplications (SDs are blocks of genomic sequence of 1-200 kb that map to different loci in a genome and share a sequence identity > 90%. SDs show at the sequence level the same characteristics as other regions of the human genome: they contain both high-copy repeats and gene sequences. SDs play an important role in genome plasticity by creating new genes and modeling genome structure. Although data is plentiful for mammals, not much was known about the representation of SDs in plant genomes. In this regard, we performed a genome-wide analysis of high-identity SDs on the sequenced grapevine (Vitis vinifera genome (PN40024. Results We demonstrate that recent SDs (> 94% identity and >= 10 kb in size are a relevant component of the grapevine genome (85 Mb, 17% of the genome sequence. We detected mitochondrial and plastid DNA and genes (10% of gene annotation in segmentally duplicated regions of the nuclear genome. In particular, the nine highest copy number genes have a copy in either or both organelle genomes. Further we showed that several duplicated genes take part in the biosynthesis of compounds involved in plant response to environmental stress. Conclusions These data show the great influence of SDs and organelle DNA transfers in modeling the Vitis vinifera nuclear DNA structure as well as the impact of SDs in contributing to the adaptive capacity of grapevine and the nutritional content of grape products through genome variation. This study represents a step forward in the full characterization of duplicated genes important for grapevine cultural needs and human health.

  4. Comparative analyses of gene copy number and mRNA expression in GBM tumors and GBM xenografts

    Energy Technology Data Exchange (ETDEWEB)

    Hodgson, J. Graeme; Yeh, Ru-Fang; Ray, Amrita; Wang, Nicholas J.; Smirnov, Ivan; Yu, Mamie; Hariono, Sujatmi; Silber, Joachim; Feiler, Heidi S.; Gray, Joe W.; Spellman, Paul T.; Vandenberg, Scott R.; Berger, Mitchel S.; James, C. David

    2009-04-03

    Development of model systems that recapitulate the molecular heterogeneity observed among glioblastoma multiforme (GBM) tumors will expedite the testing of targeted molecular therapeutic strategies for GBM treatment. In this study, we profiled DNA copy number and mRNA expression in 21 independent GBM tumor lines maintained as subcutaneous xenografts (GBMX), and compared GBMX molecular signatures to those observed in GBM clinical specimens derived from the Cancer Genome Atlas (TCGA). The predominant copy number signature in both tumor groups was defined by chromosome-7 gain/chromosome-10 loss, a poor-prognosis genetic signature. We also observed, at frequencies similar to that detected in TCGA GBM tumors, genomic amplification and overexpression of known GBM oncogenes, such as EGFR, MDM2, CDK6, and MYCN, and novel genes, including NUP107, SLC35E3, MMP1, MMP13, and DDX1. The transcriptional signature of GBMX tumors, which was stable over multiple subcutaneous passages, was defined by overexpression of genes involved in M phase, DNA replication, and chromosome organization (MRC) and was highly similar to the poor-prognosis mitosis and cell-cycle module (MCM) in GBM. Assessment of gene expression in TCGA-derived GBMs revealed overexpression of MRC cancer genes AURKB, BIRC5, CCNB1, CCNB2, CDC2, CDK2, and FOXM1, which form a transcriptional network important for G2/M progression and/or checkpoint activation. Our study supports propagation of GBM tumors as subcutaneous xenografts as a useful approach for sustaining key molecular characteristics of patient tumors, and highlights therapeutic opportunities conferred by this GBMX tumor panel for testing targeted therapeutic strategies for GBM treatment.

  5. A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3

    Directory of Open Access Journals (Sweden)

    Stefanie Lehner

    2018-02-01

    Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.

  6. Array comparative genomic hybridisation analysis of boys with X linked hypopituitarism identifies a 3.9 Mb duplicated critical region at Xq27 containing SOX3.

    NARCIS (Netherlands)

    Solomon, N.M.; Ross, S.; Morgan, T.; Belsky, J.L.; Hol, F.A.; Karnes, P.; Hopwood, N.J.; Myers, S.E.; Tan, A.; Warne, G.L.; Forrest, S.M.; Thomas, P.Q.

    2004-01-01

    INTRODUCTION: Array comparative genomic hybridisation (array CGH) is a powerful method that detects alteration of gene copy number with greater resolution and efficiency than traditional methods. However, its ability to detect disease causing duplications in constitutional genomic DNA has not been

  7. Genome-wide identification and comparative expression analysis reveal a rapid expansion and functional divergence of duplicated genes in the WRKY gene family of cabbage, Brassica oleracea var. capitata.

    Science.gov (United States)

    Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi

    2015-02-15

    WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Finding cancer genes in copy number data and insertional mutagenesis data

    NARCIS (Netherlands)

    Klijn, C.N.

    2011-01-01

    Cancer is a genetic disease. Step-wise alteration of genes that have a normal function in the cell can lead to the transformation of a healthy cell into a malignant cancer cell. Cancer genes provide several traits to the cell that allow it to become malignant. These traits have been researched for

  9. Mechanisms of topoisomerase I (TOP1) gene copy number increase in a stage III colorectal cancer patient cohort

    DEFF Research Database (Denmark)

    Smith, David Hersi; Christensen, Ib Jarle; Jensen, Niels Frank

    2013-01-01

    Topoisomerase I (Top1) is the target of Top1 inhibitor chemotherapy. The TOP1 gene, located at 20q12-q13.1, is frequently detected at elevated copy numbers in colorectal cancer (CRC). The present study explores the mechanism, frequency and prognostic impact of TOP1 gene aberrations in stage III C...

  10. Intron-exon organization of the active human protein S gene PS. alpha. and its pseudogene PS. beta. : Duplication and silencing during primate evolution

    Energy Technology Data Exchange (ETDEWEB)

    Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.; Bertina, R.M. (University Hospital, Leiden (Netherlands))

    1990-08-28

    The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing of an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.

  11. Network topologies and convergent aetiologies arising from deletions and duplications observed in individuals with autism.

    Science.gov (United States)

    Noh, Hyun Ji; Ponting, Chris P; Boulding, Hannah C; Meader, Stephen; Betancur, Catalina; Buxbaum, Joseph D; Pinto, Dalila; Marshall, Christian R; Lionel, Anath C; Scherer, Stephen W; Webber, Caleb

    2013-06-01

    Autism Spectrum Disorders (ASD) are highly heritable and characterised by impairments in social interaction and communication, and restricted and repetitive behaviours. Considering four sets of de novo copy number variants (CNVs) identified in 181 individuals with autism and exploiting mouse functional genomics and known protein-protein interactions, we identified a large and significantly interconnected interaction network. This network contains 187 genes affected by CNVs drawn from 45% of the patients we considered and 22 genes previously implicated in ASD, of which 192 form a single interconnected cluster. On average, those patients with copy number changed genes from this network possess changes in 3 network genes, suggesting that epistasis mediated through the network is extensive. Correspondingly, genes that are highly connected within the network, and thus whose copy number change is predicted by the network to be more phenotypically consequential, are significantly enriched among patients that possess only a single ASD-associated network copy number changed gene (p = 0.002). Strikingly, deleted or disrupted genes from the network are significantly enriched in GO-annotated positive regulators (2.3-fold enrichment, corrected p = 2×10(-5)), whereas duplicated genes are significantly enriched in GO-annotated negative regulators (2.2-fold enrichment, corrected p = 0.005). The direction of copy change is highly informative in the context of the network, providing the means through which perturbations arising from distinct deletions or duplications can yield a common outcome. These findings reveal an extensive ASD-associated molecular network, whose topology indicates ASD-relevant mutational deleteriousness and that mechanistically details how convergent aetiologies can result extensively from CNVs affecting pathways causally implicated in ASD.

  12. DNA copy-number alterations underlie gene expression differences between microsatellite stable and unstable colorectal cancers

    DEFF Research Database (Denmark)

    Jorissen, Robert N; Lipton, Lara; Gibbs, Peter

    2008-01-01

    Purpose: About 15% of colorectal cancers harbor microsatellite instability (MSI). MSI-associated gene expression changes have been identified in colorectal cancers, but little overlap exists between signatures hindering an assessment of overall consistency. Little is known about the causes...... and downstream effects of differential gene expression. Experimental Design: DNA microarray data on 89 MSI and 140 microsatellite-stable (MSS) colorectal cancers from this study and 58 MSI and 77 MSS cases from three published reports were randomly divided into test and training sets. MSI-associated gene......-number data. Results: MSI-associated gene expression changes in colorectal cancers were found to be highly consistent across multiple studies of primary tumors and cancer cell lines from patients of different ethnicities (P

  13. Copy Number Variations in Candidate Genes and Intergenic Regions Affect Body Mass Index and Abdominal Obesity in Mexican Children

    Science.gov (United States)

    Burguete-García, Ana Isabel; Bonnefond, Amélie; Peralta-Romero, Jesús; Froguel, Philippe

    2017-01-01

    Introduction. Increase in body weight is a gradual process that usually begins in childhood and in adolescence as a result of multiple interactions among environmental and genetic factors. This study aimed to analyze the relationship between copy number variants (CNVs) in five genes and four intergenic regions with obesity in Mexican children. Methods. We studied 1423 children aged 6–12 years. Anthropometric measurements and blood levels of biochemical parameters were obtained. Identification of CNVs was performed by real-time PCR. The effect of CNVs on obesity or body composition was assessed using regression models adjusted for age, gender, and family history of obesity. Results. Gains in copy numbers of LEPR and NEGR1 were associated with decreased body mass index (BMI), waist circumference (WC), and risk of abdominal obesity, whereas gain in ARHGEF4 and CPXCR1 and the intergenic regions 12q15c, 15q21.1a, and 22q11.21d and losses in INS were associated with increased BMI and WC. Conclusion. Our results indicate a possible contribution of CNVs in LEPR, NEGR1, ARHGEF4, and CPXCR1 and the intergenic regions 12q15c, 15q21.1a, and 22q11.21d to the development of obesity, particularly abdominal obesity in Mexican children. PMID:28428959

  14. A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4 Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle.

    Directory of Open Access Journals (Sweden)

    Bertram Brenig

    Full Text Available Aristaless-like homeobox 4 (ALX4 gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA and 289 White Galloway (WGA cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed.

  15. Dosage sensitivity shapes the evolution of copy-number varied regions.

    Directory of Open Access Journals (Sweden)

    Benjamin Schuster-Böckler

    2010-03-01

    Full Text Available Dosage sensitivity is an important evolutionary force which impacts on gene dispensability and duplicability. The newly available data on human copy-number variation (CNV allow an analysis of the most recent and ongoing evolution. Provided that heterozygous gene deletions and duplications actually change gene dosage, we expect to observe negative selection against CNVs encompassing dosage sensitive genes. In this study, we make use of several sources of population genetic data to identify selection on structural variations of dosage sensitive genes. We show that CNVs can directly affect expression levels of contained genes. We find that genes encoding members of protein complexes exhibit limited expression variation and overlap significantly with a manually derived set of dosage sensitive genes. We show that complexes and other dosage sensitive genes are underrepresented in CNV regions, with a particular bias against frequent variations and duplications. These results suggest that dosage sensitivity is a significant force of negative selection on regions of copy-number variation.

  16. A next-generation sequencing method for overcoming the multiple gene copy problem in polyploid phylogenetics, applied to Poa grasses

    Directory of Open Access Journals (Sweden)

    Robin Charles

    2011-03-01

    Full Text Available Abstract Background Polyploidy is important from a phylogenetic perspective because of its immense past impact on evolution and its potential future impact on diversification, survival and adaptation, especially in plants. Molecular population genetics studies of polyploid organisms have been difficult because of problems in sequencing multiple-copy nuclear genes using Sanger sequencing. This paper describes a method for sequencing a barcoded mixture of targeted gene regions using next-generation sequencing methods to overcome these problems. Results Using 64 3-bp barcodes, we successfully sequenced three chloroplast and two nuclear gene regions (each of which contained two gene copies with up to two alleles per individual in a total of 60 individuals across 11 species of Australian Poa grasses. This method had high replicability, a low sequencing error rate (after appropriate quality control and a low rate of missing data. Eighty-eight percent of the 320 gene/individual combinations produced sequence reads, and >80% of individuals produced sufficient reads to detect all four possible nuclear alleles of the homeologous nuclear loci with 95% probability. We applied this method to a group of sympatric Australian alpine Poa species, which we discovered to share an allopolyploid ancestor with a group of American Poa species. All markers revealed extensive allele sharing among the Australian species and so we recommend that the current taxonomy be re-examined. We also detected hypermutation in the trnH-psbA marker, suggesting it should not be used as a land plant barcode region. Some markers indicated differentiation between Tasmanian and mainland samples. Significant positive spatial genetic structure was detected at Conclusions Our results demonstrate that 454 sequencing of barcoded amplicon mixtures can be used to reliably sample all alleles of homeologous loci in polyploid species and successfully investigate phylogenetic relationships among

  17. Apparent polyploidization after gamma irradiation: pitfalls in the use of quantitative polymerase chain reaction (qPCR) for the estimation of mitochondrial and nuclear DNA gene copy numbers.

    Science.gov (United States)

    Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard

    2013-05-30

    Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.

  18. Exploration of the gene fusion landscape of glioblastoma using transcriptome sequencing and copy number data.

    Science.gov (United States)

    Shah, Nameeta; Lankerovich, Michael; Lee, Hwahyung; Yoon, Jae-Geun; Schroeder, Brett; Foltz, Greg

    2013-11-22

    RNA-seq has spurred important gene fusion discoveries in a number of different cancers, including lung, prostate, breast, brain, thyroid and bladder carcinomas. Gene fusion discovery can potentially lead to the development of novel treatments that target the underlying genetic abnormalities. In this study, we provide comprehensive view of gene fusion landscape in 185 glioblastoma multiforme patients from two independent cohorts. Fusions occur in approximately 30-50% of GBM patient samples. In the Ivy Center cohort of 24 patients, 33% of samples harbored fusions that were validated by qPCR and Sanger sequencing. We were able to identify high-confidence gene fusions from RNA-seq data in 53% of the samples in a TCGA cohort of 161 patients. We identified 13 cases (8%) with fusions retaining a tyrosine kinase domain in the TCGA cohort and one case in the Ivy Center cohort. Ours is the first study to describe recurrent fusions involving non-coding genes. Genomic locations 7p11 and 12q14-15 harbor majority of the fusions. Fusions on 7p11 are formed in focally amplified EGFR locus whereas 12q14-15 fusions are formed by complex genomic rearrangements. All the fusions detected in this study can be further visualized and analyzed using our website: http://ivygap.swedish.org/fusions. Our study highlights the prevalence of gene fusions as one of the major genomic abnormalities in GBM. The majority of the fusions are private fusions, and a minority of these recur with low frequency. A small subset of patients with fusions of receptor tyrosine kinases can benefit from existing FDA approved drugs and drugs available in various clinical trials. Due to the low frequency and rarity of clinically relevant fusions, RNA-seq of GBM patient samples will be a vital tool for the identification of patient-specific fusions that can drive personalized therapy.

  19. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  20. Obesity, starch digestion and amylase: association between copy number variants at human salivary (AMY1) and pancreatic (AMY2) amylase genes.

    Science.gov (United States)

    Carpenter, Danielle; Dhar, Sugandha; Mitchell, Laura M; Fu, Beiyuan; Tyson, Jess; Shwan, Nzar A A; Yang, Fengtang; Thomas, Mark G; Armour, John A L

    2015-06-15

    The human salivary amylase genes display extensive copy number variation (CNV), and recent work has implicated this variation in adaptation to starch-rich diets, and in association with body mass index. In this work, we use paralogue ratio tests, microsatellite analysis, read depth and fibre-FISH to demonstrate that human amylase CNV is not a smooth continuum, but is instead partitioned into distinct haplotype classes. There is a fundamental structural distinction between haplotypes containing odd or even numbers of AMY1 gene units, in turn coupled to CNV in pancreatic amylase genes AMY2A and AMY2B. Most haplotypes have one copy each of AMY2A and AMY2B and contain an odd number of copies of AMY1; consequently, most individuals have an even total number of AMY1. In contrast, haplotypes carrying an even number of AMY1 genes have rearrangements leading to CNVs of AMY2A/AMY2B. Read-depth and experimental data show that different populations harbour different proportions of these basic haplotype classes. In Europeans, the copy numbers of AMY1 and AMY2A are correlated, so that phenotypic associations caused by variation in pancreatic amylase copy number could be detected indirectly as weak association with AMY1 copy number. We show that the quantitative polymerase chain reaction (qPCR) assay previously applied to the high-throughput measurement of AMY1 copy number is less accurate than the measures we use and that qPCR data in other studies have been further compromised by systematic miscalibration. Our results uncover new patterns in human amylase variation and imply a potential role for AMY2 CNV in functional associations. © The Author 2015. Published by Oxford University Press.

  1. Obesity, starch digestion and amylase: association between copy number variants at human salivary (AMY1) and pancreatic (AMY2) amylase genes

    Science.gov (United States)

    Carpenter, Danielle; Dhar, Sugandha; Mitchell, Laura M.; Fu, Beiyuan; Tyson, Jess; Shwan, Nzar A.A.; Yang, Fengtang; Thomas, Mark G.; Armour, John A.L.

    2015-01-01

    The human salivary amylase genes display extensive copy number variation (CNV), and recent work has implicated this variation in adaptation to starch-rich diets, and in association with body mass index. In this work, we use paralogue ratio tests, microsatellite analysis, read depth and fibre-FISH to demonstrate that human amylase CNV is not a smooth continuum, but is instead partitioned into distinct haplotype classes. There is a fundamental structural distinction between haplotypes containing odd or even numbers of AMY1 gene units, in turn coupled to CNV in pancreatic amylase genes AMY2A and AMY2B. Most haplotypes have one copy each of AMY2A and AMY2B and contain an odd number of copies of AMY1; consequently, most individuals have an even total number of AMY1. In contrast, haplotypes carrying an even number of AMY1 genes have rearrangements leading to CNVs of AMY2A/AMY2B. Read-depth and experimental data show that different populations harbour different proportions of these basic haplotype classes. In Europeans, the copy numbers of AMY1 and AMY2A are correlated, so that phenotypic associations caused by variation in pancreatic amylase copy number could be detected indirectly as weak association with AMY1 copy number. We show that the quantitative polymerase chain reaction (qPCR) assay previously applied to the high-throughput measurement of AMY1 copy number is less accurate than the measures we use and that qPCR data in other studies have been further compromised by systematic miscalibration. Our results uncover new patterns in human amylase variation and imply a potential role for AMY2 CNV in functional associations. PMID:25788522

  2. Single-copy nuclear genes place haustorial Hydnoraceae within piperales and reveal a cretaceous origin of multiple parasitic angiosperm lineages.

    Directory of Open Access Journals (Sweden)

    Julia Naumann

    Full Text Available Extreme haustorial parasites have long captured the interest of naturalists and scientists with their greatly reduced and highly specialized morphology. Along with the reduction or loss of photosynthesis, the plastid genome often decays as photosynthetic genes are released from selective constraint. This makes it challenging to use traditional plastid genes for parasitic plant phylogenetics, and has driven the search for alternative phylogenetic and molecular evolutionary markers. Thus, evolutionary studies, such as molecular clock-based age estimates, are not yet available for all parasitic lineages. In the present study, we extracted 14 nuclear single copy genes (nSCG from Illumina transcriptome data from one of the "strangest plants in the world", Hydnora visseri (Hydnoraceae. A ~15,000 character molecular dataset, based on all three genomic compartments, shows the utility of nSCG for reconstructing phylogenetic relationships in parasitic lineages. A relaxed molecular clock approach with the same multi-locus dataset, revealed an ancient age of ~91 MYA for Hydnoraceae. We then estimated the stem ages of all independently originated parasitic angiosperm lineages using a published dataset, which also revealed a Cretaceous origin for Balanophoraceae, Cynomoriaceae and Apodanthaceae. With the exception of Santalales, older parasite lineages tend to be more specialized with respect to trophic level and have lower species diversity. We thus propose the "temporal specialization hypothesis" (TSH implementing multiple independent specialization processes over time during parasitic angiosperm evolution.

  3. Copy number variations of genes involved in stress responses reflect the redox state and DNA damage in brewing yeasts.

    Science.gov (United States)

    Adamczyk, Jagoda; Deregowska, Anna; Skoneczny, Marek; Skoneczna, Adrianna; Natkanska, Urszula; Kwiatkowska, Aleksandra; Rawska, Ewa; Potocki, Leszek; Kuna, Ewelina; Panek, Anita; Lewinska, Anna; Wnuk, Maciej

    2016-09-01

    The yeast strains of the Saccharomyces sensu stricto complex involved in beer production are a heterogeneous group whose genetic and genomic features are not adequately determined. Thus, the aim of the present study was to provide a genetic characterization of selected group of commercially available brewing yeasts both ale top-fermenting and lager bottom-fermenting strains. Molecular karyotyping revealed that the diversity of chromosome patterns and four strains with the most accented genetic variabilities were selected and subjected to genome-wide array-based comparative genomic hybridization (array-CGH) analysis. The differences in the gene copy number were found in five functional gene categories: (1) maltose metabolism and transport, (2) response to toxin, (3) siderophore transport, (4) cellular aldehyde metabolic process, and (5) L-iditol 2-dehydrogenase activity (p < 0.05). In the Saflager W-34/70 strain (Fermentis) with the most affected array-CGH profile, loss of aryl-alcohol dehydrogenase (AAD) gene dosage correlated with an imbalanced redox state, oxidative DNA damage and breaks, lower levels of nucleolar proteins Nop1 and Fob1, and diminished tolerance to fermentation-associated stress stimuli compared to other strains. We suggest that compromised stress response may not only promote oxidant-based changes in the nucleolus state that may affect fermentation performance but also provide novel directions for future strain improvement.

  4. submitter Metabolomic Profile of Low–Copy Number Carriers at the Salivary α-Amylase Gene Suggests a Metabolic Shift Toward Lipid-Based Energy Production

    CERN Document Server

    Arredouani, Abdelilah; Culeddu, Nicola; Moustafa, Julia El-Sayed; Tichet, Jean; Balkau, Beverley; Brousseau, Thierry; Manca, Marco; Falchi, Mario

    2016-01-01

    Low serum salivary amylase levels have been associated with a range of metabolic abnormalities, including obesity and insulin resistance. We recently suggested that a low copy number at the AMY1 gene, associated with lower enzyme levels, also increases susceptibility to obesity. To advance our understanding of the effect of AMY1 copy number variation on metabolism, we compared the metabolomic signatures of high– and low–copy number carriers. We analyzed, using mass spectrometry and nuclear magnetic resonance (NMR), the sera of healthy normal-weight women carrying either low–AMY1 copies (LAs: four or fewer copies; n = 50) or high–AMY1 copies (HAs: eight or more copies; n = 50). Best-fitting multivariate models (empirical P < 1 × $10^{−3})$ of mass spectrometry and NMR data were concordant in showing differences in lipid metabolism between the two groups. In particular, LA carriers showed lower levels of long- and medium-chain fatty acids, and higher levels of dicarboxylic fatty acids and 2-hydrox...

  5. Comparisons of Copy Number, Genomic Structure, and Conserved Motifs for α-Amylase Genes from Barley, Rice, and Wheat

    Directory of Open Access Journals (Sweden)

    Qisen Zhang

    2017-10-01

    Full Text Available Barley is an important crop for the production of malt and beer. However, crops such as rice and wheat are rarely used for malting. α-amylase is the key enzyme that degrades starch during malting. In this study, we compared the genomic properties, gene copies, and conserved promoter motifs of α-amylase genes in barley, rice, and wheat. In all three crops, α-amylase consists of four subfamilies designated amy1, amy2, amy3, and amy4. In wheat and barley, members of amy1 and amy2 genes are localized on chromosomes 6 and 7, respectively. In rice, members of amy1 genes are found on chromosomes 1 and 2, and amy2 genes on chromosome 6. The barley genome has six amy1 members and three amy2 members. The wheat B genome contains four amy1 members and three amy2 members, while the rice genome has three amy1 members and one amy2 member. The B genome has mostly amy1 and amy2 members among the three wheat genomes. Amy1 promoters from all three crop genomes contain a GA-responsive complex consisting of a GA-responsive element (CAATAAA, pyrimidine box (CCTTTT and TATCCAT/C box. This study has shown that amy1 and amy2 from both wheat and barley have similar genomic properties, including exon/intron structures and GA-responsive elements on promoters, but these differ in rice. Like barley, wheat should have sufficient amy activity to degrade starch completely during malting. Other factors, such as high protein with haze issues and the lack of husk causing Lauting difficulty, may limit the use of wheat for brewing.

  6. Phenotypic Consequences of Altering the Copy Number of abiA, a Gene Responsible for Aborting Bacteriophage Infections in Lactococcus lactis†

    OpenAIRE

    Dinsmore, Polly K.; Klaenhammer, Todd R.

    1994-01-01

    The abiA gene (formerly hsp) encodes an abortive phage infection mechanism which inhibits phage DNA replication. To analyze the effects of varying the abiA gene dosage on bacteriophage resistance in Lactococcus lactis, various genetic constructions were made. An IS946-based integration vector, pTRK75, was used to integrate a single copy of abiA into the chromosomes of two lactococcal strains, MG1363 and NCK203. In both strains, a single copy of abiA did not confer any significant phage resist...

  7. Analysis Of Segmental Duplications In The Pig Genome Based On Next-Generation Sequencing

    DEFF Research Database (Denmark)

    Fadista, João; Bendixen, Christian

    Segmental duplications are >1kb segments of duplicated DNA present in a genome with high sequence identity (>90%). They are associated with genomic rearrangements and provide a significant source of gene and genome evolution within mammalian genomes. Although segmental duplications have been...... extensively studied in other organisms, its analysis in pig has been hampered by the lack of a complete pig genome assembly. By measuring the depth of coverage of Illumina whole-genome shotgun sequencing reads of the Tabasco animal aligned to the latest pig genome assembly (Sus scrofa 10 – based also...... and their associated copy number alterations, focusing on the global organization of these segments and their possible functional significance in porcine phenotypes. This work provides insights into mammalian genome evolution and generates a valuable resource for porcine genomics research...

  8. Copy number variation in the bovine genome

    DEFF Research Database (Denmark)

    Fadista, João; Thomsen, Bo; Holm, Lars-Erik

    2010-01-01

    to genetic variation in cattle. Results We designed and used a set of NimbleGen CGH arrays that tile across the assayable portion of the cattle genome with approximately 6.3 million probes, at a median probe spacing of 301 bp. This study reports the highest resolution map of copy number variation...... in the cattle genome, with 304 CNV regions (CNVRs) being identified among the genomes of 20 bovine samples from 4 dairy and beef breeds. The CNVRs identified covered 0.68% (22 Mb) of the genome, and ranged in size from 1.7 to 2,031 kb (median size 16.7 kb). About 20% of the CNVs co-localized with segmental...... duplications, while 30% encompass genes, of which the majority is involved in environmental response. About 10% of the human orthologous of these genes are associated with human disease susceptibility and, hence, may have important phenotypic consequences. Conclusions Together, this analysis provides a useful...

  9. Parental Origin of Interstitial Duplications at 15q11.2-q13.3 in Schizophrenia and Neurodevelopmental Disorders

    Science.gov (United States)

    Isles, Anthony R.; Ingason, Andrés; Lowther, Chelsea; Gawlick, Micha; Stöber, Gerald; Potter, Harry; Georgieva, Lyudmila; Pizzo, Lucilla; Ozaki, Norio; Kushima, Itaru; Ikeda, Masashi; Iwata, Nakao; Levinson, Douglas F.; Gejman, Pablo V.; Shi, Jianxin; Sanders, Alan R.; Duan, Jubao; Sisodiya, Sanjay; Costain, Gregory; Degenhardt, Franziska; Giegling, Ina; Rujescu, Dan; Hreidarsson, Stefan J.; Saemundsen, Evald; Ahn, Joo Wook; Ogilvie, Caroline; Stefansson, Hreinn; Stefansson, Kari; O’Donovan, Michael C.; Owen, Michael J.; Bassett, Anne; Kirov, George

    2016-01-01

    expressed imprinted genes in the contribution of Copy Number Variants (CNVs) at this interval to the incidence of psychotic illness. This work will have tangible benefits for patients with 15q11.2-q13.3 duplications by aiding genetic counseling. PMID:27153221

  10. Parental Origin of Interstitial Duplications at 15q11.2-q13.3 in Schizophrenia and Neurodevelopmental Disorders.

    Directory of Open Access Journals (Sweden)

    Anthony R Isles

    2016-05-01

    maternally expressed imprinted genes in the contribution of Copy Number Variants (CNVs at this interval to the incidence of psychotic illness. This work will have tangible benefits for patients with 15q11.2-q13.3 duplications by aiding genetic counseling.

  11. Characterization of the interferon genes in homozygous rainbow trout reveals two novel genes, alternate splicing and differential regulation of duplicated genes

    Science.gov (United States)

    Purcell, M.K.; Laing, K.J.; Woodson, J.C.; Thorgaard, G.H.; Hansen, J.D.

    2009-01-01

    The genes encoding the type I and type II interferons (IFNs) have previously been identified in rainbow trout and their proteins partially characterized. These previous studies reported a single type II IFN (rtIFN-??) and three rainbow trout type I IFN genes that are classified into either group I (rtIFN1, rtIFN2) or group II (rtIFN3). In this present study, we report the identification of a novel IFN-?? gene (rtIFN-??2) and a novel type I group II IFN (rtIFN4) in homozygous rainbow trout and predict that additional IFN genes or pseudogenes exist in the rainbow trout genome. Additionally, we provide evidence that short and long forms of rtIFN1 are actively and differentially transcribed in homozygous trout, and likely arose due to alternate splicing of the first exon. Quantitative reverse transcriptase PCR (qRT-PCR) assays were developed to systematically profile all of the rainbow trout IFN transcripts, with high specificity at an individual gene level, in na??ve fish and after stimulation with virus or viral-related molecules. Cloned PCR products were used to ensure the specificity of the qRT-PCR assays and as absolute standards to assess transcript abundance of each gene. All IFN genes were modulated in response to Infectious hematopoietic necrosis virus (IHNV), a DNA vaccine based on the IHNV glycoprotein, and poly I:C. The most inducible of the type I IFN genes, by all stimuli tested, were rtIFN3 and the short transcript form of rtIFN1. Gene expression of rtIFN-??1 and rtIFN-??2 was highly up-regulated by IHNV infection and DNA vaccination but rtIFN-??2 was induced to a greater magnitude. The specificity of the qRT-PCR assays reported here will be useful for future studies aimed at identifying which cells produce IFNs at early time points after infection. ?? 2008 Elsevier Ltd.

  12. Evolutionary history and functional divergence of the cytochrome P450 gene superfamily between Arabidopsis thaliana and Brassica species uncover effects of whole genome and tandem duplications.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Wang, Linhai; Dossa, Komivi; Zhang, Xiurong; Ke, Tao; Liao, Boshou

    2017-09-18

    The cytochrome P450 monooxygenase (P450) superfamily is involved in the biosynthesis of various primary and secondary metabolites. However, little is known about the effects of whole genome duplication (WGD) and tandem duplication (TD) events on the evolutionary history and functional divergence of P450s in Brassica after splitting from a common ancestor with Arabidopsis thaliana. Using Hidden Markov Model search and manual curation, we detected that Brassica species have nearly 1.4-fold as many P450 members as A. thaliana. Most P450s in A. thaliana and Brassica species were located on pseudo-chromosomes. The inferred phylogeny indicated that all P450s were clustered into two different subgroups. Analysis of WGD event revealed that different P450 gene families had appeared after evolutionary events of species. For the TD event analyses, the P450s from TD events in Brassica species can be divided into ancient and recent parts. Our comparison of influence of WGD and TD events on the P450 gene superfamily between A. thaliana and Brassica species indicated that the family-specific evolution in the Brassica lineage can be attributed to both WGD and TD, whereas WGD was recognized as the major mechanism for the recent evolution of the P450 super gene family. Expression analysis of P450s from A. thaliana and Brassica species indicated that WGD-type P450s showed the same expression pattern but completely different expression with TD-type P450s across different tissues in Brassica species. Selection force analysis suggested that P450 orthologous gene pairs between A. thaliana and Brassica species underwent negative selection, but no significant differences were found between P450 orthologous gene pairs in A. thaliana-B. rapa and A. thaliana-B. oleracea lineages, as well as in different subgenomes in B. rapa or B. oleracea compared with A. thaliana. This study is the first to investigate the effects of WGD and TD on the evolutionary history and functional divergence of P450

  13. Copy number variation and association analysis of SHANK3 as a candidate gene for autism in the IMGSAC collection.

    Science.gov (United States)

    Sykes, Nuala H; Toma, Claudio; Wilson, Natalie; Volpi, Emanuela V; Sousa, Inês; Pagnamenta, Alistair T; Tancredi, Raffaella; Battaglia, Agatino; Maestrini, Elena; Bailey, Anthony J; Monaco, Anthony P

    2009-10-01

    SHANK3 is located on chromosome 22q13.3 and encodes a scaffold protein that is found in excitatory synapses opposite the pre-synaptic active zone. SHANK3 is a binding partner of neuroligins, some of whose genes contain mutations in a small subset of individuals with autism. In individuals with autism spectrum disorders (ASDs), several studies have found SHANK3 to be disrupted by deletions ranging from hundreds of kilobases to megabases, suggesting that 1% of individuals with ASDs may have these chromosomal aberrations. To further analyse the involvement of SHANK3 in ASD, we screened the International Molecular Genetic Study of Autism Consortium (IMGSAC) multiplex family sample, 330 families, for SNP association and copy number variants (CNVs) in SHANK3. A collection of 76 IMGSAC Italian probands from singleton families was also examined by multiplex ligation-dependent probe amplification for CNVs. No CNVs or SNP associations were found within the sample set, although sequencing of the gene was not performed. Our data suggest that SHANK3 deletions may be limited to lower functioning individuals with autism.

  14. Expression of embryonic hemoglobin genes in mice heterozygous for α-thalassemia or β-duplication traits and in mice heterozygous for both traits

    International Nuclear Information System (INIS)

    Popp, R.A.; Marsh, C.L.; Skow, L.C.

    1981-01-01

    Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous α-thalassemic embryos, expression of EI (x 2 y 2 ) and EII (α 2 y 2 ) is deficient because the x- and α-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- and α-globin genes indicates that these genes must be closely linked. Reduced x- and α-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y 4 hemoglobin also appears in β-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and β-globin genes. In double heterozygotes, which have a single functional allele of x- and α-globin genes and three functional alleles of y- and β-globin genes, synthesis of α and non-α chains is severely imbalanced and half of the total hemoglobin is y 4 . Mouse y 4 has a high affinity for oxygen, P 50 of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues

  15. Life-threatening Arrhythmias in a Becker Muscular Dystrophy Family due to the Duplication of Exons 3-4 of the Dystrophin Gene.

    Science.gov (United States)

    Ishizaki, Masatoshi; Fujimoto, Akiko; Ueyama, Hidetsugu; Nishida, Yasuto; Imamura, Shigehiro; Uchino, Makoto; Ando, Yukio

    2015-01-01

    We herein present a report of three patients with Becker muscular dystrophy in the same family who developed complete atrioventricular block or ventricular tachycardia with severe cardiomyopathy. Our cases became unable to walk in their teens, and were introduced to mechanical ventilation due to respiratory muscle weakness in their twenties and thirties. In all three cases, a medical device such as a permanent cardiac pacemaker or an implantable cardiac defibrillator was considered to be necessary. The duplication of exons 3-4 in the dystrophin gene was detected in two of the patients. In patients with Becker muscular dystrophy, complete atrioventricular block or ventricular tachycardia within a family has rarely been reported. Thus attention should be paid to the possibility of severe arrhythmias in the severe phenotype of Becker muscular dystrophy.

  16. 10 CFR 7.21 - Cost of duplication of documents.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Cost of duplication of documents. 7.21 Section 7.21 Energy NUCLEAR REGULATORY COMMISSION ADVISORY COMMITTEES § 7.21 Cost of duplication of documents. Copies of the records, reports, transcripts, minutes, appendices, working papers, drafts, studies, agenda, or other...

  17. Topoisomerase 1(TOP1) gene copy number in stage III colorectal cancer patients and its relation to prognosis

    DEFF Research Database (Denmark)

    Rømer, Maria Unni Koefoed; Nygård, Sune Boris; Christensen, Ib Jarle

    2013-01-01

    A Topoisomerase 1 (Top1) poison is frequently included in the treatment regimens for metastatic colorectal cancer (mCRC). However, no predictive biomarkers for Top1 poisons are available. We here report a study on the TOP1 gene copy number in CRC patients and its association with patient prognosis...

  18. Evaluation of the Cow Rumen Metagenome: Assembly by Single Copy Gene Analysis and Single Cell Genome Assemblies (Metagenomics Informatics Challenges Workshop: 10K Genomes at a Time)

    Energy Technology Data Exchange (ETDEWEB)

    Sczyrba, Alex

    2011-10-13

    DOE JGI's Alex Sczyrba on "Evaluation of the Cow Rumen Metagenome" and "Assembly by Single Copy Gene Analysis and Single Cell Genome Assemblies" at the Metagenomics Informatics Challenges Workshop held at the DOE JGI on October 12-13, 2011.

  19. Construction of a restriction map and gene map of the lettuce chloroplast small single-copy region using Southern cross-hybridization.

    Science.gov (United States)

    Mitchelson, K R

    1996-01-01

    The small single-copy region (SSCR) of the chloroplast genome of many higher plants typically contain ndh genes encoding proteins that share homology with subunits of the respiratory-chain reduced nicotinamide adenine dinucleotide (NADH) dehydrogenase complex of mitochondria. A map of the lettuce chloroplast SSCR has been determined by Southern cross-hybridization, taking advantage of the high degree of homology between a tobacco small single-copy fragment and a corresponding lettuce chloroplast fragment. The gene order of the SSCR of lettuce and tobacco chloroplasts is similar. The cross-hybridization method can rapidly create a primary gene map of unknown chloroplast fragments, thus providing detailed information of the localization and arrangement of genes and conserved open reading frame regions.

  20. Recombination and evolution of duplicate control regions in the mitochondrial genome of the Asian big-headed turtle, Platysternon megacephalum.

    Directory of Open Access Journals (Sweden)

    Chenfei Zheng

    Full Text Available Complete mitochondrial (mt genome sequences with duplicate control regions (CRs have been detected in various animal species. In Testudines, duplicate mtCRs have been reported in the mtDNA of the Asian big-headed turtle, Platysternon megacephalum, which has three living subspecies. However, the evolutionary pattern of these CRs remains unclear. In this study, we report the completed sequences of duplicate CRs from 20 individuals belonging to three subspecies of this turtle and discuss the micro-evolutionary analysis of the evolution of duplicate CRs. Genetic distances calculated with MEGA 4.1 using the complete duplicate CR sequences revealed that within turtle subspecies, genetic distances between orthologous copies from different individuals were 0.63% for CR1 and 1.2% for CR2app:addword:respectively, and the average distance between paralogous copies of CR1 and CR2 was 4.8%. Phylogenetic relationships were reconstructed from the CR sequences, excluding the variable number of tandem repeats (VNTRs at the 3' end using three methods: neighbor-joining, maximum likelihood algorithm, and Bayesian inference. These data show that any two CRs within individuals were more genetically distant from orthologous genes in different individuals within the same subspecies. This suggests independent evolution of the two mtCRs within each P. megacephalum subspecies. Reconstruction of separate phylogenetic trees using different CR components (TAS, CD, CSB, and VNTRs suggested the role of recombination in the evolution of duplicate CRs. Consequently, recombination events were detected using RDP software with break points at ≈290 bp and ≈1,080 bp. Based on these results, we hypothesize that duplicate CRs in P. megacephalum originated from heterological ancestral recombination of mtDNA. Subsequent recombination could have resulted in homogenization during independent evolutionary events, thus maintaining the functions of duplicate CRs in the mtDNA of P

  1. Assessing duplication and loss of APETALA1/FRUITFULL homologs in Ranunculales

    Science.gov (United States)

    Pabón-Mora, Natalia; Hidalgo, Oriane; Gleissberg, Stefan; Litt, Amy

    2013-01-01

    Gene duplication and loss provide raw material for evolutionary change within organismal lineages as functional diversification of gene copies provide a mechanism for phenotypic variation. Here we focus on the APETALA1/FRUITFULL MADS-box gene lineage evolution. AP1/FUL genes are angiosperm-specific and have undergone several duplications. By far the most significant one is the core-eudicot duplication resulting in the euAP1 and euFUL clades. Functional characterization of several euAP1 and euFUL genes has shown that both function in proper floral meristem identity, and axillary meristem repression. Independently, euAP1 genes function in floral meristem and sepal identity, whereas euFUL genes control phase transition, cauline leaf growth, compound leaf morphogenesis and fruit development. Significant functional variation has been detected in the function of pre-duplication basal-eudicot FUL-like genes, but the underlying mechanisms for change have not been identified. FUL-like genes in the Papaveraceae encode all functions reported for euAP1 and euFUL genes, whereas FUL-like genes in Aquilegia (Ranunculaceae) function in inflorescence development and leaf complexity, but not in flower or fruit development. Here we isolated FUL-like genes across the Ranunculales and used phylogenetic approaches to analyze their evolutionary history. We identified an early duplication resulting in the RanFL1 and RanFL2 clades. RanFL1 genes were present in all the families sampled and are mostly under strong negative selection in the MADS, I and K domains. RanFL2 genes were only identified from Eupteleaceae, Papaveraceae s.l., Menispermaceae and Ranunculaceae and show relaxed purifying selection at the I and K domains. We discuss how asymmetric sequence diversification, new motifs, differences in codon substitutions and likely protein-protein interactions resulting from this Ranunculiid-specific duplication can help explain the functional differences among basal-eudicot FUL-like genes

  2. Original Copies

    DEFF Research Database (Denmark)

    Sørensen, Tim Flohr

    2013-01-01

    of similarity by looking at artefactual similarity as the results of prototyping and as a production of simulacra. In this light, the concept of copying turns out to be more than simply a matter of trying to imitate an exotic or prestigious original, and it fundamentally raises the question how different a copy...

  3. A case report of Chinese brothers with inherited MECP2-containing duplication: autism and intellectual disability, but not seizures or respiratory infections

    OpenAIRE

    Xu, Xiu; Xu, Qiong; Zhang, Ying; Zhang, Xiaodi; Cheng, Tianlin; Wu, Bingbing; Ding, Yanhua; Lu, Ping; Zheng, Jingjing; Zhang, Min; Qiu, Zilong; Yu, Xiang

    2012-01-01

    Abstract Background Autistic spectrum disorders (ASDs) are a family of neurodevelopmental disorders with strong genetic components. Recent studies have shown that copy number variations in dosage sensitive genes can contribute significantly to these disorders. One such gene is the transcription factor MECP2, whose loss of function in females results in Rett syndrome, while its duplication in males results in developmental delay and autism. Case presentation Here, we identified a Chinese famil...

  4. Genome-wide signatures of 'rearrangement hotspots' within segmental duplications in humans.

    Directory of Open Access Journals (Sweden)

    Mohammed Uddin

    Full Text Available The primary objective of this study was to create a genome-wide high resolution map (i.e., >100 bp of 'rearrangement hotspots' which can facilitate the identification of regions capable of mediating de novo deletions or duplications in humans. A hierarchical method was employed to fragment segmental duplications (SDs into multiple smaller SD units. Combining an end space free pairwise alignment algorithm with a 'seed and extend' approach, we have exhaustively searched 409 million alignments to detect complex structural rearrangements within the reference-guided assembly of the NA18507 human genome (18× coverage, including the previously identified novel 4.8 Mb sequence from de novo assembly within this genome. We have identified 1,963 rearrangement hotspots within SDs which encompass 166 genes and display an enrichment of duplicated gene nucleotide variants (DNVs. These regions are correlated with increased non-allelic homologous recombination (NAHR event frequency which presumably represents the origin of copy number variations (CNVs and pathogenic duplications/deletions. Analysis revealed that 20% of the detected hotspots are clustered within the proximal and distal SD breakpoints flanked by the pathogenic deletions/duplications that have been mapped for 24 NAHR-mediated genomic disorders. FISH Validation of selected complex regions revealed 94% concordance with in silico localization of the highly homologous derivatives. Other results from this study indicate that intra-chromosomal recombination is enhanced in genic compared with agenic duplicated regions, and that gene desert regions comprising SDs may represent reservoirs for creation of novel genes. The generation of genome-wide signatures of 'rearrangement hotspots', which likely serve as templates for NAHR, may provide a powerful approach towards understanding the underlying mutational mechanism(s for development of constitutional and acquired diseases.

  5. Bayesian mixture models for assessment of gene differential behaviour and prediction of pCR through the integration of copy number and gene expression data.

    Directory of Open Access Journals (Sweden)

    Filippo Trentini

    Full Text Available We consider modeling jointly microarray RNA expression and DNA copy number data. We propose Bayesian mixture models that define latent Gaussian probit scores for the DNA and RNA, and integrate between the two platforms via a regression of the RNA probit scores on the DNA probit scores. Such a regression conveniently allows us to include additional sample specific covariates such as biological conditions and clinical outcomes. The two developed methods are aimed respectively to make inference on differential behaviour of genes in patients showing different subtypes of breast cancer and to predict the pathological complete response (pCR of patients borrowing strength across the genomic platforms. Posterior inference is carried out via MCMC simulations. We demonstrate the proposed methodology using a published data set consisting of 121 breast cancer patients.

  6. Epidermal growth factor receptor gene copy number in 101 advanced colorectal cancer patients treated with chemotherapy plus cetuximab

    Directory of Open Access Journals (Sweden)

    Zeuli Massimo

    2010-04-01

    Full Text Available Abstract Background Responsiveness to Cetuximab alone can be mediated by an increase of Epidermal Growth factor Receptor (EGFR Gene Copy Number (GCN. Aim of this study was to assess the role of EGFR-GCN in advanced colorectal cancer (CRC patients receiving chemotherapy plus Cetuximab. Methods One hundred and one advanced CRC patients (43 untreated- and 58 pre-treated were retrospectively studied by fluorescence in situ hybridization (FISH to assess EGFR-GCN and by immunohistochemistry (IHC to determine EGFR expression. Sixty-one out of 101 patients were evaluated also for k-ras status by direct sequencing. Clinical end-points were response rate (RR, progression-free survival (PFS and overall survival (OS. Results Increased EGFR-GCN was found in 60/101 (59% tumor samples. There was no correlation between intensity of EGFR-IHC and EGFR-GCN (p = 0.43. Patients receiving chemotherapy plus Cetuximab as first line treatment had a RR of 70% (30/43 while it was 18% (10/56 in the group with previous lines of therapy (p Conclusion In metastatic CRC patients treated with chemotherapy plus Cetuximab number of chemotherapy lines and increased EGFR-GCN were significantly associated with a better clinical outcome, independent of k-ras status.

  7. Deciphering the Correlation between Breast Tumor Samples and Cell Lines by Integrating Copy Number Changes and Gene Expression Profiles

    Directory of Open Access Journals (Sweden)

    Yi Sun

    2015-01-01

    Full Text Available Breast cancer is one of the most common cancers with high incident rate and high mortality rate worldwide. Although different breast cancer cell lines were widely used in laboratory investigations, accumulated evidences have indicated that genomic differences exist between cancer cell lines and tissue samples in the past decades. The abundant molecular profiles of cancer cell lines and tumor samples deposited in the Cancer Cell Line Encyclopedia and The Cancer Genome Atlas now allow a systematical comparison of the breast cancer cell lines with breast tumors. We depicted the genomic characteristics of breast primary tumors based on the copy number variation and gene expression profiles and the breast cancer cell lines were compared to different subgroups of breast tumors. We identified that some of the breast cancer cell lines show high correlation with the tumor group that agrees with previous knowledge, while a big part of them do not, including the most used MCF7, MDA-MB-231, and T-47D. We presented a computational framework to identify cell lines that mostly resemble a certain tumor group for the breast tumor study. Our investigation presents a useful guide to bridge the gap between cell lines and tumors and helps to select the most suitable cell line models for personalized cancer studies.

  8. Use of next-generation sequencing to detect LDLR gene copy number variation in familial hypercholesterolemia[S

    Science.gov (United States)

    Iacocca, Michael A.; Wang, Jian; Dron, Jacqueline S.; Robinson, John F.; McIntyre, Adam D.; Cao, Henian

    2017-01-01

    Familial hypercholesterolemia (FH) is a heritable condition of severely elevated LDL cholesterol, caused predominantly by autosomal codominant mutations in the LDL receptor gene (LDLR). In providing a molecular diagnosis for FH, the current procedure often includes targeted next-generation sequencing (NGS) panels for the detection of small-scale DNA variants, followed by multiplex ligation-dependent probe amplification (MLPA) in LDLR for the detection of whole-exon copy number variants (CNVs). The latter is essential because ∼10% of FH cases are attributed to CNVs in LDLR; accounting for them decreases false negative findings. Here, we determined the potential of replacing MLPA with bioinformatic analysis applied to NGS data, which uses depth-of-coverage analysis as its principal method to identify whole-exon CNV events. In analysis of 388 FH patient samples, there was 100% concordance in LDLR CNV detection between these two methods: 38 reported CNVs identified by MLPA were also successfully detected by our NGS method, while 350 samples negative for CNVs by MLPA were also negative by NGS. This result suggests that MLPA can be removed from the routine diagnostic screening for FH, significantly reducing associated costs, resources, and analysis time, while promoting more widespread assessment of this important class of mutations across diagnostic laboratories. PMID:28874442

  9. Multiplex PCR detection of GSTM1, GSTT1, and GSTP1 gene variants: simultaneously detecting GSTM1 and GSTT1 gene copy number and the allelic status of the GSTP1 Ile105Val genetic variant

    DEFF Research Database (Denmark)

    Buchard, Anders; Sanchez Sanchez, Juan Jose; Dalhoff, Kim

    2007-01-01

    , the enzyme activity of GSTM1 and GSTT1 is absent in approximately 50 and 15% of the population, respectively, due to deletions of both chromosomal copies of the genes. A trimodal phenotype pattern exists in which individuals with two, one, or no functional genes are fast, intermediate, or slow "conjugators...

  10. A common copy number variation polymorphism in the CNTNAP2 gene: sexual dimorphism in association with healthy aging and disease.

    Science.gov (United States)

    Iakoubov, Leonid; Mossakowska, Malgorzata; Szwed, Malgorzata; Puzianowska-Kuznicka, Monika

    2015-01-01

    New therapeutic targets are needed to fight aging-related diseases and increase life span. A new female-specific association with diseases and limited survival past 80 years was recently reported for a copy number variation (CNV) in the CNTNAP4 gene from the neurexin superfamily. We asked whether there are CNVs that are associated with aging phenotypes within other genes from the neurexin superfamily and whether this association is sex specific. Select CNV polymorphisms were genotyped with proprietary TaqMan qPCR assays. A case/control study, in which a group of 81- to 90-year-old community-dwelling Caucasians with no chronic diseases (case) was compared to a similar control group of 65- to 75-year-olds, revealed a negative association with healthy aging for the ins allele of common esv11910 CNV in the CNTNAP2 gene (n = 388; OR = 0.29, 95% CI: 0.14-0.59, p = 0.0004 for males, and OR = 0.82, 95% CI: 0.42-1.57, p = 0.625 for females). This male-specific association was validated in a study of an independent group of 76- to 80-year-olds. To look for a corresponding positive association of the allele with aging-related diseases, two case subgroups of 81- to 90-year-olds, one composed of individuals with cognitive impairment and the other with various diseases not directly related to the nervous system, such as cardiovascular diseases, etc., were compared to a healthy control subgroup of the same age. A positive male-specific association was found for both cases (OR = 2.75, p = 0.008 for association with cognitive impairment, and OR = 3.18, p = 0.002 for other diseases combined). A new male-specific association with aging is reported for a CNV in the CNTNAP2 gene. The polymorphism might be useful for diagnosing individual genetic predispositions to healthy aging versus aging complicated by chronic diseases. © 2014 S. Karger AG, Basel.

  11. Signatures derived from increase in SHARPIN gene copy number are associated with poor prognosis in patients with breast cancer

    Directory of Open Access Journals (Sweden)

    Diane Ojo

    2017-12-01

    Full Text Available We report three signatures produced from SHARPIN gene copy number increase (GCN-Increase and their effects on patients with breast cancer (BC. In the Metabric dataset (n = 2059, cBioPortal, SHARPIN GCN-Increase occurs preferentially or mutual exclusively with mutations in TP53, PIK3CA, and CDH1. These genomic alterations constitute a signature (SigMut that significantly correlates with reductions in overall survival (OS in BC patients (n = 1980; p = 1.081e−6. Additionally, SHARPIN GCN-Increase is associated with 4220 differentially expressed genes (DEGs. These DEGs are enriched in activation of the pathways regulating cell cycle progression, RNA transport, ribosome biosynthesis, DNA replication, and in downregulation of the pathways related to extracellular matrix. These DEGs are thus likely to facilitate the proliferation and metastasis of BC cells. Additionally, through forward (FWD and backward (BWD stepwise variate selections among the top 160 downregulated and top 200 upregulated DEGs using the Cox regression model, a 6-gene (SigFWD and a 50-gene (SigBWD signature were derived. Both signatures robustly associate with decreases in OS in BC patients within the Curtis (n = 1980; p = 6.16e−11 for SigFWD; p = 1.06e−10, for SigBWD and TCGA cohort (n = 817; p = 4.53e−4 for SigFWD and p = 0.00525 for SigBWD. After adjusting for known clinical factors, SigMut (HR 1.21, p = 0.0297, SigBWD (HR 1.25, p = 0.0263, and likely SigFWD (HR 1.17, p = 0.062 remain independent risk factors of BC deaths. Furthermore, the proportion of patients positive for these signatures is significantly increased in ER−, Her2-enriched, basal-like, and claudin-low BCs compared to ER+ and luminal BCs. Collectively, these SHARPIN GCN-Increase-derived signatures may have clinical applications in management of patients with BC.

  12. Establishing a novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure for the direct detection of gene doping.

    Science.gov (United States)

    Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles

    2008-01-01

    So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.

  13. Role of the duplicated CCAAT box region in γ-globin gene regulation and hereditary persistence of fetal haemoglobin.

    NARCIS (Netherlands)

    A. Ronchi (Antonella); M. Berry (Meera); S. Raguz (Selina); A.M.A. Imam (Ali); N. Yannoutsos (Nikos); S. Ottolenghi (Sergio); F.G. Grosveld (Frank); N.O. Dillon (Niall)

    1996-01-01

    textabstractHereditary persistence of fetal haemoglobin (HPFH) is a clinically important condition in which a change in the developmental specificity of the gamma-globin genes results in varying levels of expression of fetal haemoglobin in the adult. The condition is benign and can significantly

  14. MECP2 Duplication Syndrome

    DEFF Research Database (Denmark)

    Signorini, Cinzia; De Felice, Claudio; Leoncini, Silvia

    2016-01-01

    Rett syndrome (RTT) and MECP2 duplication syndrome (MDS) are neurodevelopmental disorders caused by alterations in the methyl-CpG binding protein 2 (MECP2) gene expression. A relationship between MECP2 loss-of-function mutations and oxidative stress has been previously documented in RTT patients...... and murine models. To date, no data on oxidative stress have been reported for the MECP2 gain-of-function mutations in patients with MDS. In the present work, the pro-oxidant status and oxidative fatty acid damage in MDS was investigated (subjects n = 6) and compared to RTT (subjects n = 24) and healthy...... similar to those observed in RTT patients except for higher plasma F2-isoprostanes levels (P work shows unique data in patients affected by MDS. For the first...

  15. The E2F-DP1 Transcription Factor Complex Regulates Centriole Duplication in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Jacqueline G. Miller

    2016-03-01

    Full Text Available Centrioles play critical roles in the organization of microtubule-based structures, from the mitotic spindle to cilia and flagella. In order to properly execute their various functions, centrioles are subjected to stringent copy number control. Central to this control mechanism is a precise duplication event that takes place during S phase of the cell cycle and involves the assembly of a single daughter centriole in association with each mother centriole . Recent studies have revealed that posttranslational control of the master regulator Plk4/ZYG-1 kinase and its downstream effector SAS-6 is key to ensuring production of a single daughter centriole. In contrast, relatively little is known about how centriole duplication is regulated at a transcriptional level. Here we show that the transcription factor complex EFL-1-DPL-1 both positively and negatively controls centriole duplication in the Caenorhabditis elegans embryo. Specifically, we find that down regulation of EFL-1-DPL-1 can restore centriole duplication in a zyg-1 hypomorphic mutant and that suppression of the zyg-1 mutant phenotype is accompanied by an increase in SAS-6 protein levels. Further, we find evidence that EFL-1-DPL-1 promotes the transcription of zyg-1 and other centriole duplication genes. Our results provide evidence that in a single tissue type, EFL-1-DPL-1 sets the balance between positive and negative regulators of centriole assembly and thus may be part of a homeostatic mechanism that governs centriole assembly.

  16. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.

    Directory of Open Access Journals (Sweden)

    Thomas D Cuypers

    2014-04-01

    Full Text Available Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and adaptation remains unknown. Here, we study the duplicate retention pattern postWGD, by letting virtual cells adapt to environmental changes. The virtual cells have structured genomes that encode a regulatory network and simple metabolism. Populations are under selection for homeostasis and evolve by point mutations, small indels and WGD. After populations had initially adapted fully to fluctuating resource conditions re-adaptation to a broad range of novel environments was studied by tracking mutations in the line of descent. WGD was established in a minority (≈30% of lineages, yet, these were significantly more successful at re-adaptation. Unexpectedly, WGD lineages conserved more seemingly redundant genes, yet had higher per gene mutation rates. While WGD duplicates of all functional classes were significantly over-retained compared to a model of neutral losses, duplicate retention was clearly biased towards highly connected TFs. Importantly, no subfunctionalization occurred in conserved pairs, strongly suggesting that dosage balance shaped retention. Meanwhile, singles diverged significantly. WGD, therefore, is a powerful mechanism to cope with environmental change, allowing conservation of a core machinery, while adapting the peripheral network to accommodate change.

  17. Copy Counts

    Science.gov (United States)

    Beaumont, Lee R.

    1970-01-01

    The level of difficulty of straight copy, which is used to measure typewriting speed, is influenced by syllable intensity (the average number of syllables per word), stroke intensity (average number of strokes per word), and high-frequency words. (CH)

  18. Copy Masters.

    Science.gov (United States)

    Humane Education, 1984

    1984-01-01

    Three activities related to pets are presented. The first focuses on caring for a pet. The second focuses on who is responsible for the actions of a pet. The third is a mathematics activity on pet overpopulation. The activities are designed to be duplicated for class use. (JN)

  19. Clinical features of SMARCA2 duplication overlap with Coffin-Siris syndrome.

    Science.gov (United States)

    Miyake, Noriko; Abdel-Salam, Ghada; Yamagata, Takanori; Eid, Maha M; Osaka, Hitoshi; Okamoto, Nobuhiko; Mohamed, Amal M; Ikeda, Takahiro; Afifi, Hanan H; Piard, Juliette; van Maldergem, Lionel; Mizuguchi, Takeshi; Miyatake, Satoko; Tsurusaki, Yoshinori; Matsumoto, Naomichi

    2016-10-01

    Coffin-Siris syndrome is a rare congenital malformation and intellectual disability syndrome. Mutations in at least seven genes have been identified. Here, we performed copy number analysis in 37 patients with features of CSS in whom no causative mutations were identified by exome sequencing. We identified a patient with a 9p24.3-p22.2 duplication and another patient with the chromosome der(6)t(6;9)(p25;p21)mat. Both patients share a duplicated 15.8-Mb region containing 46 protein coding genes, including SMARCA2. Dominant negative effects of SMARCA2 mutations may contribute to Nicolaides-Baraitser syndrome. We conclude that their features better resemble Coffin-Siris syndrome, rather than Nicolaides-Baraitser syndrome and that these features likely arise from SMARCA2 over-dosage. Pure 9p duplications (not caused by unbalanced translocations) are rare. Copy number analysis in patients with features that overlap with Coffin-Siris syndrome is recommended to further determine their genetic aspects. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  20. Molecular mechanisms of extensive mitochondrial gene rearrangementin plethodontid salamanders

    Energy Technology Data Exchange (ETDEWEB)

    Mueller, Rachel Lockridge; Boore, Jeffrey L.

    2005-06-01

    Extensive gene rearrangement is reported in the mitochondrial genomes of lungless salamanders (Plethodontidae). In each genome with a novel gene order, there is evidence that the rearrangement was mediated by duplication of part of the mitochondrial genome, including the presence of both pseudogenes and additional, presumably functional, copies of duplicated genes. All rearrangement-mediating duplications include either the origin of light strand replication and the nearby tRNA genes or the regions flanking the origin of heavy strand replication. The latter regions comprise nad6, trnE, cob, trnT, an intergenic spacer between trnT and trnP and, in some genomes, trnP, the control region, trnF, rrnS, trnV, rrnL, trnL1, and nad1. In some cases, two copies of duplicated genes, presumptive regulatory regions, and/or sequences with no assignable function have been retained in the genome following the initial duplication; in other genomes, only one of the duplicated copies has been retained. Both tandem and non-tandem duplications are present in these genomes, suggesting different duplication mechanisms. In some of these mtDNAs, up to 25 percent of the total length is composed of tandem duplications of non-coding sequence that includes putative regulatory regions and/or pseudogenes of tRNAs and protein-coding genes along with otherwise unassignable sequences. These data indicate that imprecise initiation and termination of replication, slipped-strand mispairing, and intra-molecular recombination may all have played a role in generating repeats during the evolutionary history of plethodontid mitochondrial genomes.

  1. Sorting cancer karyotypes using double-cut-and-joins, duplications and deletions.

    Science.gov (United States)

    Zeira, Ron; Shamir, Ron

    2018-05-03

    Problems of genome rearrangement are central in both evolution and cancer research. Most genome rearrangement models assume that the genome contains a single copy of each gene and the only changes in the genome are structural, i.e., reordering of segments. In contrast, tumor genomes also undergo numerical changes such as deletions and duplications, and thus the number of copies of genes varies. Dealing with unequal gene content is a very challenging task, addressed by few algorithms to date. More realistic models are needed to help trace genome evolution during tumorigenesis. Here we present a model for the evolution of genomes with multiple gene copies using the operation types double-cut-and-joins, duplications and deletions. The events supported by the model are reversals, translocations, tandem duplications, segmental deletions, and chromosomal amplifications and deletions, covering most types of structural and numerical changes observed in tumor samples. Our goal is to find a series of operations of minimum length that transform one karyotype into the other. We show that the problem is NP-hard and give an integer linear programming formulation that solves the problem exactly under some mild assumptions. We test our method on simulated genomes and on ovarian cancer genomes. Our study advances the state of the art in two ways: It allows a broader set of operations than extant models, thus being more realistic, and it is the first study attempting to reconstruct the full sequence of structural and numerical events during cancer evolution. Code and data are available in https://github.com/Shamir-Lab/Sorting-Cancer-Karyotypes. ronzeira@post.tau.ac.il, rshamir@tau.ac.il. Supplementary data are available at Bioinformatics online.

  2. Duplicated Gephyrin Genes Showing Distinct Tissue Distribution and Alternative Splicing Patterns Mediate Molybdenum Cofactor Biosynthesis, Glycine Receptor Clustering, and Escape Behavior in Zebrafish*

    Science.gov (United States)

    Ogino, Kazutoyo; Ramsden, Sarah L.; Keib, Natalie; Schwarz, Günter; Harvey, Robert J.; Hirata, Hiromi

    2011-01-01

    Gephyrin mediates the postsynaptic clustering of glycine receptors (GlyRs) and GABAA receptors at inhibitory synapses and molybdenum-dependent enzyme (molybdoenzyme) activity in non-neuronal tissues. Gephyrin knock-out mice show a phenotype resembling both defective glycinergic transmission and molybdenum cofactor (Moco) deficiency and die within 1 day of birth due to starvation and dyspnea resulting from deficits in motor and respiratory networks, respectively. To address whether gephyrin function is conserved among vertebrates and whether gephyrin deficiency affects molybdoenzyme activity and motor development, we cloned and characterized zebrafish gephyrin genes. We report here that zebrafish have two gephyrin genes, gphna and gphnb. The former is expressed in all tissues and has both C3 and C4 cassette exons, and the latter is expressed predominantly in the brain and spinal cord and harbors only C4 cassette exons. We confirmed that all of the gphna and gphnb splicing isoforms have Moco synthetic activity. Antisense morpholino knockdown of either gphna or gphnb alone did not disturb synaptic clusters of GlyRs in the spinal cord and did not affect touch-evoked escape behaviors. However, on knockdown of both gphna and gphnb, embryos showed impairments in GlyR clustering in the spinal cord and, as a consequence, demonstrated touch-evoked startle response behavior by contracting antagonistic muscles simultaneously, instead of displaying early coiling and late swimming behaviors, which are executed by side-to-side muscle contractions. These data indicate that duplicated gephyrin genes mediate Moco biosynthesis and control postsynaptic clustering of GlyRs, thereby mediating key escape behaviors in zebrafish. PMID:20843816

  3. Myxococcus xanthus DK1622 Coordinates Expressions of the Duplicate groEL and Single groES Genes for Synergistic Functions of GroELs and GroES

    Directory of Open Access Journals (Sweden)

    Yue-zhong Li

    2017-04-01

    Full Text Available Chaperonin GroEL (Cpn60 requires cofactor GroES (Cpn10 for protein refolding in bacteria that possess single groEL and groES genes in a bicistronic groESL operon. Among 4,861 completely-sequenced prokaryotic genomes, 884 possess duplicate groEL genes and 770 possess groEL genes with no neighboring groES. It is unclear whether stand-alone groEL requires groES in order to function and, if required, how duplicate groEL genes and unequal groES genes balance their expressions. In Myxococcus xanthus DK1622, we determined that, while duplicate groELs were alternatively deletable, the single groES that clusters with groEL1 was essential for cell survival. Either GroEL1 or GroEL2 required interactions with GroES for in vitro and in vivo functions. Deletion of groEL1 or groEL2 resulted in decreased expressions of both groEL and groES; and ectopic complementation of groEL recovered not only the groEL but also groES expressions. The addition of an extra groES gene upstream groEL2 to form a bicistronic operon had almost no influence on groES expression and the cell survival rate, whereas over-expression of groES using a self-replicating plasmid simultaneously increased the groEL expressions. The results indicated that M. xanthus DK1622 cells coordinate expressions of the duplicate groEL and single groES genes for synergistic functions of GroELs and GroES. We proposed a potential regulation mechanism for the expression coordination.

  4. Reduction in the copy number and expression level of the recurrent human papillomavirus integration gene fragile histidine triad (FHIT predicts the transition of cervical lesions.

    Directory of Open Access Journals (Sweden)

    Liming Wang

    Full Text Available Cervical cancer is the second most common cancer and the third leading cause of cancer death in females worldwide, especially in developing countries. High risk human papillomavirus (HR-HPV infection causes cervical cancer and precancerous cervical intraepithelial neoplasia (CIN. Integration of the HR-HPV genome into the host chromatin is an important step in cervical carcinogenesis. The detection of integrated papillomavirus sequences-PCR (DIPS-PCR allowed us to explore HPV integration in the human genome and to determine the pattern of this integration. We performed DIPS-PCR for 4 cell lines including 3 cervical cancer cell lines and 40 tissue samples. Overall, 32 HR-HPV integration loci were detected in the clinical samples and the HeLa and SiHa cell lines. Among all the integration loci, we identified three recurrent integration loci: 3p14.2 (3 samples, 13q22.1 (2 samples and a SiHa cell line and 8q24 (1 sample and a HeLa cell line. To further explore the effect of HR-HPV integration in the 3p14.2 locus, we used fluorescence in situ hybridization (FISH to determine the copy number of the 3p14.2 locus and immunohistochemistry (IHC to determine the protein expression levels of the related FHIT gene in the clinical samples. Both the 3p14.2 locus copy number and FHIT protein expression levels showed significant decreases when CIN transitioned to cervical cancer. HPV copy number was also evaluated in these clinical samples, and the copy number of HPV increased significantly between CIN and cervical cancer samples. Finally, we employed receiver operating characteristic curve (ROC curve analysis to evaluate the potential of all these indexes in distinguishing CIN and cervical cancer, and the HPV copy number, FHIT copy number and FHIT protein expression levels have good diagnostic efficiencies.

  5. miR-24-2 controls H2AFX expression regardless of gene copy number alteration and induces apoptosis by targeting antiapoptotic gene BCL-2: a potential for therapeutic intervention.

    Science.gov (United States)

    Srivastava, Niloo; Manvati, Siddharth; Srivastava, Archita; Pal, Ranjana; Kalaiarasan, Ponnusamy; Chattopadhyay, Shilpi; Gochhait, Sailesh; Dua, Raina; Bamezai, Rameshwar N K

    2011-04-04

    New levels of gene regulation with microRNA (miR) and gene copy number alterations (CNAs) have been identified as playing a role in various cancers. We have previously reported that sporadic breast cancer tissues exhibit significant alteration in H2AX gene copy number. However, how CNA affects gene expression and what is the role of miR, miR-24-2, known to regulate H2AX expression, in the background of the change in copy number, are not known. Further, many miRs, including miR-24-2, are implicated as playing a role in cell proliferation and apoptosis, but their specific target genes and the pathways contributing to them remain unexplored. Changes in gene copy number and mRNA/miR expression were estimated using real-time polymerase chain reaction assays in two mammalian cell lines, MCF-7 and HeLa, and in a set of sporadic breast cancer tissues. In silico analysis was performed to find the putative target for miR-24-2. MCF-7 cells were transfected with precursor miR-24-2 oligonucleotides, and the gene expression levels of BRCA1, BRCA2, ATM, MDM2, TP53, CHEK2, CYT-C, BCL-2, H2AFX and P21 were examined using TaqMan gene expression assays. Apoptosis was measured by flow cytometric detection using annexin V dye. A luciferase assay was performed to confirm BCL-2 as a valid cellular target of miR-24-2. It was observed that H2AX gene expression was negatively correlated with miR-24-2 expression and not in accordance with the gene copy number status, both in cell lines and in sporadic breast tumor tissues. Further, the cells overexpressing miR-24-2 were observed to be hypersensitive to DNA damaging drugs, undergoing apoptotic cell death, suggesting the potentiating effect of mir-24-2-mediated apoptotic induction in human cancer cell lines treated with anticancer drugs. BCL-2 was identified as a novel cellular target of miR-24-2. mir-24-2 is capable of inducing apoptosis by modulating different apoptotic pathways and targeting BCL-2, an antiapoptotic gene. The study suggests

  6. Tank-Binding Kinase 1 (TBK1) Gene and Open-Angle Glaucomas (An American Ophthalmological Society Thesis).

    Science.gov (United States)

    Fingert, John H; Robin, Alan L; Scheetz, Todd E; Kwon, Young H; Liebmann, Jeffrey M; Ritch, Robert; Alward, Wallace L M

    2016-08-01

    To investigate the role of TANK-binding kinase 1 ( TBK1 ) gene copy-number variations (ie, gene duplications and triplications) in the pathophysiology of various open-angle glaucomas. In previous studies, we discovered that copy-number variations in the TBK1 gene are associated with normal-tension glaucoma. Here, we investigated the prevalence of copy-number variations in cohorts of patients with other open-angle glaucomas-juvenile-onset open-angle glaucoma (n=30), pigmentary glaucoma (n=209), exfoliation glaucoma (n=225), and steroid-induced glaucoma (n=79)-using a quantitative polymerase chain reaction assay. No TBK1 gene copy-number variations were detected in patients with juvenile-onset open-angle glaucoma, pigmentary glaucoma, or steroid-induced glaucoma. A TBK1 gene duplication was detected in one (0.44%) of the 225 exfoliation glaucoma patients. TBK1 gene copy-number variations (gene duplications and triplications) have been previously associated with normal-tension glaucoma. An exploration of other open-angle glaucomas detected a TBK1 copy-number variation in a patient with exfoliation glaucoma, which is the first example of a TBK1 mutation in a glaucoma patient with a diagnosis other than normal-tension glaucoma. A broader phenotypic range may be associated with TBK1 copy-number variations, although mutations in this gene are most often detected in patients with normal-tension glaucoma.

  7. Influences of AMY1 gene copy number and protein expression on salivary alpha-amylase activity before and after citric acid stimulation in splenic asthenia children.

    Science.gov (United States)

    Yang, Zemin; Lin, Jing; Chen, Longhui; Zhang, Min; Yang, Xiaorong; Chen, Weiwen

    2015-06-01

    To compare the correlations between salivary alpha-amylase (sAA) activity and amylase, alpha 1 (salivary) gene (AMYl) copy number or its gene expression between splenic asthenia and healthy children, and investigate the reasons of attenuated sAA activity ratio before and after citric acid stimulation in splenic asthenia children. Saliva samples from 20 splenic asthenia children and 29 healthy children were collected before and after citric acid stimulation. AMYl copy number, sAA activity, and total sAA and glycosylated sAA contents were determined, and their correlations were analyzed. Although splenic asthenia and healthy children had no differences in AMY1 copy number, splenic asthenia children had positive correlations between AMY1 copy number and sAA activity before or after citric acid stimulation. Splenic asthenia children had a higher sAA glycosylated proportion ratio and glycosylated sAA content ratio, while their total sAA content ratio and sAA activity ratio were lower compared with healthy children. The glycosylated sAA content ratio was higher than the total sAA content ratio in both groups. Splenic asthenia and healthy children had positive correlations between total sAA or glycosylated sAA content and sAA activity. However, the role played by glycosylated sAA content in sAA activity in healthy children increased after citric acid stimulation, while it decreased in splenic asthenia children. Genetic factors like AMY1 copy number variations, and more importantly, sAA glycosylation abnormalities leading to attenuated sAA activity after citric acid stimulation, which were the main reasons of the attenuated sAA activity ratio in splenic asthenia children compared with healthy children.

  8. Partial AZFc duplications not deletions are associated with male infertility in the Yi population of Yunnan Province, China.

    Science.gov (United States)

    Ye, Jun-jie; Ma, Li; Yang, Li-juan; Wang, Jin-huan; Wang, Yue-li; Guo, Hai; Gong, Ning; Nie, Wen-hui; Zhao, Shu-hua

    2013-09-01

    There are many reports on associations between spermatogenesis and partial azoospermia factor c (AZFc) deletions as well as duplications; however, results are conflicting, possibly due to differences in methodology and ethnic background. The purpose of this study is to investigate the association of AZFc polymorphisms and male infertility in the Yi ethnic population, residents within Yunnan Province, China. A total of 224 infertile patients and 153 fertile subjects were selected in the Yi ethnic population. The study was performed by sequence-tagged site plus/minus (STS+/-) analysis followed by gene dosage and gene copy definition analysis. Y haplotypes of 215 cases and 115 controls were defined by 12 binary markers using single nucleotide polymorphism on Y chromosome (Y-SNP) multiplex assays based on single base primer extension technology. The distribution of Y haplotypes was not significantly different between the case and control groups. The frequencies of both gr/gr (7.6% vs. 8.5%) and b2/b3 (6.3% vs. 8.5%) deletions do not show significant differences. Similarly, single nucleotide variant (SNV) analysis shows no significant difference of gene copy definition between the cases and controls. However, the frequency of partial duplications in the infertile group (4.0%) is significantly higher than that in the control group (0.7%). Further, we found a case with sY1206 deletion which had two CDY1 copies but removed half of DAZ genes. Our results show that male infertility is associated with partial AZFc duplications, but neither gr/gr nor b2/b3 deletions, suggesting that partial AZFc duplications rather than deletions are risk factors for male infertility in Chinese-Yi population.

  9. Ancestral genomic duplication of the insulin gene in tilapia: An analysis of possible implications for clinical islet xenotransplantation using donor islets from transgenic tilapia expressing a humanized insulin gene.

    Science.gov (United States)

    Hrytsenko, Olga; Pohajdak, Bill; Wright, James R

    2016-07-03

    Tilapia, a teleost fish, have multiple large anatomically discrete islets which are easy to harvest, and when transplanted into diabetic murine recipients, provide normoglycemia and mammalian-like glucose tolerance profiles. Tilapia insulin differs structurally from human insulin which could preclude their use as islet donors for xenotransplantation. Therefore, we produced transgenic tilapia with islets expressing a humanized insulin gene. It is now known that fish genomes may possess an ancestral duplication and so tilapia may have a second insulin gene. Therefore, we cloned, sequenced, and characterized the tilapia insulin 2 transcript and found that its expression is negligible in islets, is not islet-specific, and would not likely need to be silenced in our transgenic fish.

  10. Efficient Algorithms for Analyzing Segmental Duplications, Deletions, and Inversions in Genomes

    Science.gov (United States)

    Kahn, Crystal L.; Mozes, Shay; Raphael, Benjamin J.

    Segmental duplications, or low-copy repeats, are common in mammalian genomes. In the human genome, most segmental duplications are mosaics consisting of pieces of multiple other segmental duplications. This complex genomic organization complicates analysis of the evolutionary history of these sequences. Earlier, we introduced a genomic distance, called duplication distance, that computes the most parsimonious way to build a target string by repeatedly copying substrings of a source string. We also showed how to use this distance to describe the formation of segmental duplications according to a two-step model that has been proposed to explain human segmental duplications. Here we describe polynomial-time exact algorithms for several extensions of duplication distance including models that allow certain types of substring deletions and inversions. These extensions will permit more biologically realistic analyses of segmental duplications in genomes.

  11. Multi-platform whole-genome microarray analyses refine the epigenetic signature of breast cancer metastasis with gene expression and copy number.

    Directory of Open Access Journals (Sweden)

    Joseph Andrews

    2010-01-01

    Full Text Available We have previously identified genome-wide DNA methylation changes in a cell line model of breast cancer metastasis. These complex epigenetic changes that we observed, along with concurrent karyotype analyses, have led us to hypothesize that complex genomic alterations in cancer cells (deletions, translocations and ploidy are superimposed over promoter-specific methylation events that are responsible for gene-specific expression changes observed in breast cancer metastasis.We undertook simultaneous high-resolution, whole-genome analyses of MDA-MB-468GFP and MDA-MB-468GFP-LN human breast cancer cell lines (an isogenic, paired lymphatic metastasis cell line model using Affymetrix gene expression (U133, promoter (1.0R, and SNP/CNV (SNP 6.0 microarray platforms to correlate data from gene expression, epigenetic (DNA methylation, and combination copy number variant/single nucleotide polymorphism microarrays. Using Partek Software and Ingenuity Pathway Analysis we integrated datasets from these three platforms and detected multiple hypomethylation and hypermethylation events. Many of these epigenetic alterations correlated with gene expression changes. In addition, gene dosage events correlated with the karyotypic differences observed between the cell lines and were reflected in specific promoter methylation patterns. Gene subsets were identified that correlated hyper (and hypo methylation with the loss (or gain of gene expression and in parallel, with gene dosage losses and gains, respectively. Individual gene targets from these subsets were also validated for their methylation, expression and copy number status, and susceptible gene pathways were identified that may indicate how selective advantage drives the processes of tumourigenesis and metastasis.Our approach allows more precisely profiling of functionally relevant epigenetic signatures that are associated with cancer progression and metastasis.

  12. Whole-genome copy number variation analysis in anophthalmia and microphthalmia.

    Science.gov (United States)

    Schilter, K F; Reis, L M; Schneider, A; Bardakjian, T M; Abdul-Rahman, O; Kozel, B A; Zimmerman, H H; Broeckel, U; Semina, E V

    2013-11-01

    Anophthalmia/microphthalmia (A/M) represent severe developmental ocular malformations. Currently, mutations in known genes explain less than 40% of A/M cases. We performed whole-genome copy number variation analysis in 60 patients affected with isolated or syndromic A/M. Pathogenic deletions of 3q26 (SOX2) were identified in four independent patients with syndromic microphthalmia. Other variants of interest included regions with a known role in human disease (likely pathogenic) as well as novel rearrangements (uncertain significance). A 2.2-Mb duplication of 3q29 in a patient with non-syndromic anophthalmia and an 877-kb duplication of 11p13 (PAX6) and a 1.4-Mb deletion of 17q11.2 (NF1) in two independent probands with syndromic microphthalmia and other ocular defects were identified; while ocular anomalies have been previously associated with 3q29 duplications, PAX6 duplications, and NF1 mutations in some cases, the ocular phenotypes observed here are more severe than previously reported. Three novel regions of possible interest included a 2q14.2 duplication which cosegregated with microphthalmia/microcornea and congenital cataracts in one family, and 2q21 and 15q26 duplications in two additional cases; each of these regions contains genes that are active during vertebrate ocular development. Overall, this study identified causative copy number mutations and regions with a possible role in ocular disease in 17% of A/M cases. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Duplication and concerted evolution of MiSp-encoding genes underlie the material properties of minor ampullate silks of cobweb weaving spiders.

    Science.gov (United States)

    Vienneau-Hathaway, Jannelle M; Brassfield, Elizabeth R; Lane, Amanda Kelly; Collin, Matthew A; Correa-Garhwal, Sandra M; Clarke, Thomas H; Schwager, Evelyn E; Garb, Jessica E; Hayashi, Cheryl Y; Ayoub, Nadia A

    2017-03-14

    Orb-web weaving spiders and their relatives use multiple types of task-specific silks. The majority of spider silk studies have focused on the ultra-tough dragline silk synthesized in major ampullate glands, but other silk types have impressive material properties. For instance, minor ampullate silks of orb-web weaving spiders are as tough as draglines, due to their higher extensibility despite lower strength. Differences in material properties between silk types result from differences in their component proteins, particularly members of the spidroin (spider fibroin) gene family. However, the extent to which variation in material properties within a single silk type can be explained by variation in spidroin sequences is unknown. Here, we compare the minor ampullate spidroins (MiSp) of orb-weavers and cobweb weavers. Orb-web weavers use minor ampullate silk to form the auxiliary spiral of the orb-web while cobweb weavers use it to wrap prey, suggesting that selection pressures on minor ampullate spidroins (MiSp) may differ between the two groups. We report complete or nearly complete MiSp sequences from five cobweb weaving spider species and measure material properties of minor ampullate silks in a subset of these species. We also compare MiSp sequences and silk properties of our cobweb weavers to published data for orb-web weavers. We demonstrate that all our cobweb weavers possess multiple MiSp loci and that one locus is more highly expressed in at least two species. We also find that the proportion of β-spiral-forming amino acid motifs in MiSp positively correlates with minor ampullate silk extensibility across orb-web and cobweb weavers. MiSp sequences vary dramatically within and among spider species, and have likely been subject to multiple rounds of gene duplication and concerted evolution, which have contributed to the diverse material properties of minor ampullate silks. Our sequences also provide templates for recombinant silk proteins with tailored

  14. Integrative analysis of copy number and gene expression in breast cancer using formalin-fixed paraffin-embedded core biopsy tissue: a feasibility study.

    Science.gov (United States)

    Iddawela, Mahesh; Rueda, Oscar; Eremin, Jenny; Eremin, Oleg; Cowley, Jed; Earl, Helena M; Caldas, Carlos

    2017-07-11

    An absence of reliable molecular markers has hampered individualised breast cancer treatments, and a major limitation for translational research is the lack of fresh tissue. There are, however, abundant banks of formalin-fixed paraffin-embedded (FFPE) tissue. This study evaluated two platforms available for the analysis of DNA copy number and gene expression using FFPE samples. The cDNA-mediated annealing, selection, extension, and ligation assay (DASL™) has been developed for gene expression analysis and the Molecular Inversion Probes assay (Oncoscan™), were used for copy number analysis using FFPE tissues. Gene expression and copy number were evaluated in core-biopsy samples from patients with breast cancer undergoing neoadjuvant chemotherapy (NAC). Forty-three core-biopsies were evaluated and characteristic copy number changes in breast cancers, gains in 1q, 8q, 11q, 17q and 20q and losses in 6q, 8p, 13q and 16q, were confirmed. Regions that frequently exhibited gains in tumours showing a pathological complete response (pCR) to NAC were 1q (55%), 8q (40%) and 17q (40%), whereas 11q11 (37%) gain was the most frequent change in non-pCR tumours. Gains associated with poor survival were 11q13 (62%), 8q24 (54%) and 20q (47%). Gene expression assessed by DASL correlated with immunohistochemistry (IHC) analysis for oestrogen receptor (ER) [area under the curve (AUC) = 0.95], progesterone receptor (PR)(AUC = 0.90) and human epidermal growth factor type-2 receptor (HER-2) (AUC = 0.96). Differential expression analysis between ER+ and ER- cancers identified over-expression of TTF1, LAF-4 and C-MYB (p ≤ 0.05), and between pCR vs non-pCRs, over-expression of CXCL9, AREG, B-MYB and under-expression of ABCG2. This study was an integrative analysis of copy number and gene expression using FFPE core biopsies and showed that molecular marker data from FFPE tissues were consistent with those in previous studies using fresh-frozen samples. FFPE tissue can provide

  15. A retrospective analysis of RET translocation, gene copy number gain and expression in NSCLC patients treated with vandetanib in four randomized Phase III studies.

    Science.gov (United States)

    Platt, Adam; Morten, John; Ji, Qunsheng; Elvin, Paul; Womack, Chris; Su, Xinying; Donald, Emma; Gray, Neil; Read, Jessica; Bigley, Graham; Blockley, Laura; Cresswell, Carl; Dale, Angela; Davies, Amanda; Zhang, Tianwei; Fan, Shuqiong; Fu, Haihua; Gladwin, Amanda; Harrod, Grace; Stevens, James; Williams, Victoria; Ye, Qingqing; Zheng, Li; de Boer, Richard; Herbst, Roy S; Lee, Jin-Soo; Vasselli, James

    2015-03-23

    To determine the prevalence of RET rearrangement genes, RET copy number gains and expression in tumor samples from four Phase III non-small-cell lung cancer (NSCLC) trials of vandetanib, a selective inhibitor of VEGFR, RET and EGFR signaling, and to determine any association with outcome to vandetanib treatment. Archival tumor samples from the ZODIAC ( NCT00312377 , vandetanib ± docetaxel), ZEAL ( NCT00418886 , vandetanib ± pemetrexed), ZEPHYR ( NCT00404924 , vandetanib vs placebo) and ZEST ( NCT00364351 , vandetanib vs erlotinib) studies were evaluated by fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC) in 944 and 1102 patients. The prevalence of RET rearrangements by FISH was 0.7% (95% CI 0.3-1.5%) among patients with a known result. Seven tumor samples were positive for RET rearrangements (vandetanib, n = 3; comparator, n = 4). 2.8% (n = 26) of samples had RET amplification (innumerable RET clusters, or ≥7 copies in > 10% of tumor cells), 8.1% (n = 76) had low RET gene copy number gain (4-6 copies in ≥40% of tumor cells) and 8.3% (n = 92) were RET expression positive (signal intensity ++ or +++ in >10% of tumor cells). Of RET-rearrangement-positive patients, none had an objective response in the vandetanib arm and one patient responded in the comparator arm. Radiologic evidence of tumor shrinkage was observed in two patients treated with vandetanib and one treated with comparator drug. The objective response rate was similar in the vandetanib and comparator arms for patients positive for RET copy number gains or RET protein expression. We have identified prevalence for three RET biomarkers in a population predominated by non-Asians and smokers. RET rearrangement prevalence was lower than previously reported. We found no evidence of a differential benefit for efficacy by IHC and RET gene copy number gains. The low prevalence of RET rearrangements (0.7%) prevents firm conclusions regarding association of vandetanib treatment with

  16. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia) gene family: tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes.

    Science.gov (United States)

    Harduin-Lepers, Anne; Petit, Daniel; Mollicone, Rosella; Delannoy, Philippe; Petit, Jean-Michel; Oriol, Rafael

    2008-09-23

    initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD) R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.

  17. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia gene family: Tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes

    Directory of Open Access Journals (Sweden)

    Petit Jean-Michel

    2008-09-01

    activities, in both invertebrates and vertebrates. The initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.

  18. Reciprocal deletion and duplication at 2q23.1 indicates a role for MBD5 in autism spectrum disorder.

    Science.gov (United States)

    Mullegama, Sureni V; Rosenfeld, Jill A; Orellana, Carmen; van Bon, Bregje W M; Halbach, Sara; Repnikova, Elena A; Brick, Lauren; Li, Chumei; Dupuis, Lucie; Rosello, Monica; Aradhya, Swaroop; Stavropoulos, D James; Manickam, Kandamurugu; Mitchell, Elyse; Hodge, Jennelle C; Talkowski, Michael E; Gusella, James F; Keller, Kory; Zonana, Jonathan; Schwartz, Stuart; Pyatt, Robert E; Waggoner, Darrel J; Shaffer, Lisa G; Lin, Angela E; de Vries, Bert B A; Mendoza-Londono, Roberto; Elsea, Sarah H

    2014-01-01

    Copy number variations associated with abnormal gene dosage have an important role in the genetic etiology of many neurodevelopmental disorders, including intellectual disability (ID) and autism. We hypothesize that the chromosome 2q23.1 region encompassing MBD5 is a dosage-dependent region, wherein deletion or duplication results in altered gene dosage. We previously established the 2q23.1 microdeletion syndrome and report herein 23 individuals with 2q23.1 duplications, thus establishing a complementary duplication syndrome. The observed phenotype includes ID, language impairments, infantile hypotonia and gross motor delay, behavioral problems, autistic features, dysmorphic facial features (pinnae anomalies, arched eyebrows, prominent nose, small chin, thin upper lip), and minor digital anomalies (fifth finger clinodactyly and large broad first toe). The microduplication size varies among all cases and ranges from 68 kb to 53.7 Mb, encompassing a region that includes MBD5, an important factor in methylation patterning and epigenetic regulation. We previously reported that haploinsufficiency of MBD5 is the primary causal factor in 2q23.1 microdeletion syndrome and that mutations in MBD5 are associated with autism. In this study, we demonstrate that MBD5 is the only gene in common among all duplication cases and that overexpression of MBD5 is likely responsible for the core clinical features present in 2q23.1 microduplication syndrome. Phenotypic analyses suggest that 2q23.1 duplication results in a slightly less severe phenotype than the reciprocal deletion. The features associated with a deletion, mutation or duplication of MBD5 and the gene expression changes observed support MBD5 as a dosage-sensitive gene critical for normal development.

  19. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template [v1; ref status: indexed, http://f1000r.es/48i

    Directory of Open Access Journals (Sweden)

    Hossein Gouran

    2014-09-01

    Full Text Available Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC, implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF. In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

  20. Duplication of the oesophagus

    International Nuclear Information System (INIS)

    Lingg, G.; Nebel, G.

    1981-01-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined. (orig.) [de

  1. Duplication of the oesophagus

    Energy Technology Data Exchange (ETDEWEB)

    Lingg, G; Nebel, G

    1981-08-01

    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined.

  2. Copy-number variation of housekeeping gene rpl13a in rat strains selected for nervous system excitability

    Czech Academy of Sciences Publication Activity Database

    Kalendar, R.; Belyayev, Alexander; Zachepilo, T.; Vaido, A.; Maidanyuk, D.; Schulman, A. H.; Dyuzhikova, N.

    2017-01-01

    Roč. 33, JUN 2017 (2017), s. 11-15 ISSN 0890-8508 Institutional support: RVO:67985939 Keywords : copy number variation (CNV) * quantitative real-time multicolor multiplex * PCR (qmPCR) Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Cell biology Impact factor: 1.403, year: 2016

  3. CNV-RF Is a Random Forest-Based Copy Number Variation Detection Method Using Next-Generation Sequencing.

    Science.gov (United States)

    Onsongo, Getiria; Baughn, Linda B; Bower, Matthew; Henzler, Christine; Schomaker, Matthew; Silverstein, Kevin A T; Thyagarajan, Bharat

    2016-11-01

    Simultaneous detection of small copy number variations (CNVs) (<0.5 kb) and single-nucleotide variants in clinically significant genes is of great interest for clinical laboratories. The analytical variability in next-generation sequencing (NGS) and artifacts in coverage data because of issues with mappability along with lack of robust bioinformatics tools for CNV detection have limited the utility of targeted NGS data to identify CNVs. We describe the development and implementation of a bioinformatics algorithm, copy number variation-random forest (CNV-RF), that incorporates a machine learning component to identify CNVs from targeted NGS data. Using CNV-RF, we identified 12 of 13 deletions in samples with known CNVs, two cases with duplications, and identified novel deletions in 22 additional cases. Furthermore, no CNVs were identified among 60 genes in 14 cases with normal copy number and no CNVs were identified in another 104 patients with clinical suspicion of CNVs. All positive deletions and duplications were confirmed using a quantitative PCR method. CNV-RF also detected heterozygous deletions and duplications with a specificity of 50% across 4813 genes. The ability of CNV-RF to detect clinically relevant CNVs with a high degree of sensitivity along with confirmation using a low-cost quantitative PCR method provides a framework for providing comprehensive NGS-based CNV/single-nucleotide variant detection in a clinical molecular diagnostics laboratory. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  4. Phenotype of transgenic mice carrying a very low copy number of the mutant human G93A superoxide dismutase-1 gene associated with amyotrophic lateral sclerosis.

    Directory of Open Access Journals (Sweden)

    Jeffrey S Deitch

    Full Text Available Amyotrophic lateral sclerosis (ALS is a progressive neurodegenerative disease of the motor neuron. While most cases of ALS are sporadic, 10% are familial (FALS with 20% of FALS caused by a mutation in the gene that codes for the enzyme Cu/Zn superoxide dismutase (SOD1. There is variability in sporadic ALS as well as FALS where even within the same family some siblings with the same mutation do not manifest disease. A transgenic (Tg mouse model of FALS containing 25 copies of the mutant human SOD1 gene demonstrates motor neuron pathology and progressive weakness similar to ALS patients, leading to death at approximately 130 days. The onset of symptoms and survival of these transgenic mice are directly related to the number of copies of the mutant gene. We report the phenotype of a very low expressing (VLE G93A SOD1 Tg carrying only 4 copies of the mutant G93ASOD1 gene. While weakness can start at 9 months, only 74% of mice 18 months or older demonstrate disease. The VLE mice show decreased motor neurons compared to wild-type mice as well as increased cytoplasmic translocation of TDP-43. In contrast to the standard G93A SOD1 Tg mouse which always develops motor weakness leading to death, not all VLE animals manifested clinical disease or shortened life span. In fact, approximately 20% of mice older than 24 months had no motor symptoms and only 18% of VLE mice older than 22 months reached end stage. Given the variable penetrance of clinical phenotype, prolonged survival, and protracted loss of motor neurons the VLE mouse provides a new tool that closely mimics human ALS. This tool will allow the study of pathologic events over time as well as the study of genetic and environmental modifiers that may not be causative, but can exacerbate or accelerate motor neuron disease.

  5. Neofunctionalization of Duplicated Tic40 Genes Caused a Gain-of-Function Variation Related to Male Fertility in Brassica oleracea Lineages1[W][OPEN

    Science.gov (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf

    2014-01-01

    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. PMID:25185122

  6. Neofunctionalization of duplicated Tic40 genes caused a gain-of-function variation related to male fertility in Brassica oleracea lineages.

    Science.gov (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf

    2014-11-01

    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. © 2014 American Society of Plant Biologists. All Rights Reserved.

  7. Gene duplication and neo-functionalization in the evolutionary and functional divergence of the metazoan copper transporters Ctr1 and Ctr2.

    Science.gov (United States)

    Logeman, Brandon L; Wood, L Kent; Lee, Jaekwon; Thiele, Dennis J

    2017-07-07

    Copper is an essential element for proper organismal development and is involved in a range of processes, including oxidative phosphorylation, neuropeptide biogenesis, and connective tissue maturation. The copper transporter (Ctr) family of integral membrane proteins is ubiquitously found in eukaryotes and mediates the high-affinity transport of Cu + across both the plasma membrane and endomembranes. Although mammalian Ctr1 functions as a Cu + transporter for Cu acquisition and is essential for embryonic development, a homologous protein, Ctr2, has been proposed to function as a low-affinity Cu transporter, a lysosomal Cu exporter, or a regulator of Ctr1 activity, but its functional and evolutionary relationship to Ctr1 is unclear. Here we report a biochemical, genetic, and phylogenetic comparison of metazoan Ctr1 and Ctr2, suggesting that Ctr2 arose over 550 million years ago as a result of a gene duplication event followed by loss of Cu + transport activity. Using a random mutagenesis and growth selection approach, we identified amino acid substitutions in human and mouse Ctr2 proteins that support copper-dependent growth in yeast and enhance copper accumulation in Ctr1 -/- mouse embryonic fibroblasts. These mutations revert Ctr2 to a more ancestral Ctr1-like state while maintaining endogenous functions, such as stimulating Ctr1 cleavage. We suggest key structural aspects of metazoan Ctr1 and Ctr2 that discriminate between their biological roles, providing mechanistic insights into the evolutionary, biochemical, and functional relationships between these two related proteins. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. A large scale survey reveals that chromosomal copy-number alterations significantly affect gene modules involved in cancer initiation and progression

    Directory of Open Access Journals (Sweden)

    Cigudosa Juan C

    2011-05-01

    Full Text Available Abstract Background Recent observations point towards the existence of a large number of neighborhoods composed of functionally-related gene modules that lie together in the genome. This local component in the distribution of the functionality across chromosomes is probably affecting the own chromosomal architecture by limiting the possibilities in which genes can be arranged and distributed across the genome. As a direct consequence of this fact it is therefore presumable that diseases such as cancer, harboring DNA copy number alterations (CNAs, will have a symptomatology strongly dependent on modules of functionally-related genes rather than on a unique "important" gene. Methods We carried out a systematic analysis of more than 140,000 observations of CNAs in cancers and searched by enrichments in gene functional modules associated to high frequencies of loss or gains. Results The analysis of CNAs in cancers clearly demonstrates the existence of a significant pattern of loss of gene modules functionally related to cancer initiation and progression along with the amplification of modules of genes related to unspecific defense against xenobiotics (probably chemotherapeutical agents. With the extension of this analysis to an Array-CGH dataset (glioblastomas from The Cancer Genome Atlas we demonstrate the validity of this approach to investigate the functional impact of CNAs. Conclusions The presented results indicate promising clinical and therapeutic implications. Our findings also directly point out to the necessity of adopting a function-centric, rather a gene-centric, view in the understanding of phenotypes or diseases harboring CNAs.

  9. Evolutionary mechanisms driving the evolution of a large polydnavirus ge