
Sample records for dubnium 268

  1. Extraction systems for the study of dubnium

    International Nuclear Information System (INIS)

    Gates, J.M.; Sudowe, R.; Ali, M.N.; Calvert, M.G.; Dragojevic, I.; Ellison, P.A.; Garcia, M.A.; Gharibyan, N.; Gregorich, K.E.; Nelson, S.L.; Neumann, S.H.; Parsons-Moss, T.; Stavsetra, L.; Nitsche, H.


    The chemistry of transactinide elements (Z (ge) 104) is a topic of great interest in current nuclear chemistry research. The chemical systems that can be used in these studies are limited by the short half-lives of the isotopes and the small production rates of atoms per minute or even atoms per week. In the initial investigations, the chemistry used had to be very selective to the periodic group of interest to separate the transactinide atom from all the other unwanted nuclear reaction products, e.g., transfer products. By using the Berkeley Gas-filled Separator (BGS) as a physical pre-separator, we are able concentrate on systems that are selective between the members of the group of interest, because all other interfering products and the beam are being suppressed by the BGS [1]. We are developing suitable extraction systems for the study of element 105, dubnium. For this purpose we have studied the extraction of niobium and tantalum, the lighter homologs of dubnium, from mineral acids with different organophosphorus compounds. All studies were performed online, using short-lived niobium and tantalum produced in the 124 Sn( 51 V,5n) 170 Ta and 74 Se( 18 O,p3n) 88 Nb reactions. This allowed for the study of the lighter homologues at metal concentrations of 10 -16 M. At these low metal concentrations, the formation of polymeric species is largely prohibited. As seen in Fig. 1, by varying the extractant and the hydrochloric acid concentration from 1 to 11 M, we are able to see a difference in extraction behavior between niobium and tantalum. While the system is suitable for determining chemical differences between the lighter homologues, the extraction of tantalum from hydrochloric acid shows slow kinetics. Figure 2 shows that after 90 seconds of mixing, the system is not in equilibrium. However, experiments indicate that equilibrium is reached faster at higher acid concentrations. We have studied the influence of hydrogen ion concentration on the extraction

  2. 12 CFR 268.705 - Employment. (United States)


    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Employment. 268.705 Section 268.705 Banks and... Physical or Mental Disability § 268.705 Employment. No qualified individual with a disability shall, on the basis of a disability, be subjected to discrimination in employment under any program or activity...

  3. Dicty_cDB: SLH268 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLH268 (Link to dictyBase) - - - - SLH268Z (Link to Original site) - - SLH2...68Z 640 - - - - Show SLH268 Library SL (Link to library) Clone ID SLH268 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID SLH268Z (Link to Original site) R...epresentative DNA sequence >SLH268 (SLH268Q) /CSM/SL/SLH2-C/SLH268Q.Seq.d/ XXXXXXXXXXCTGGTGGTTATATTTCTCGTACT

  4. 39 CFR 268.1 - General principles. (United States)


    ... 39 Postal Service 1 2010-07-01 2010-07-01 false General principles. 268.1 Section 268.1 Postal Service UNITED STATES POSTAL SERVICE ORGANIZATION AND ADMINISTRATION PRIVACY OF INFORMATION-EMPLOYEE RULES OF CONDUCT § 268.1 General principles. In order to conduct its business, the Postal Service has the...

  5. 12 CFR 268.105 - Individual complaints. (United States)


    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Individual complaints. 268.105 Section 268.105... RULES REGARDING EQUAL OPPORTUNITY Board Program To Promote Equal Opportunity § 268.105 Individual... individual and the Board and to describe generally the action(s) or practice(s) that form the basis of the...

  6. 40 CFR 268.4 - Treatment surface impoundment exemption. (United States)


    ... residues may not be placed in any other surface impoundment for subsequent management. (iv) Recordkeeping... exemption. 268.4 Section 268.4 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID...), the residues from treatment are analyzed, as specified in § 268.7 or § 268.32, to determine if they...

  7. 12 CFR 268.202 - Equal Pay Act. (United States)


    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Equal Pay Act. 268.202 Section 268.202 Banks... REGARDING EQUAL OPPORTUNITY Provisions Applicable to Particular Complaints § 268.202 Equal Pay Act. Complaints alleging violations of the Equal Pay Act shall be processed under this part. ...

  8. 12 CFR 268.601 - EEO group statistics. (United States)


    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false EEO group statistics. 268.601 Section 268.601... RULES REGARDING EQUAL OPPORTUNITY Matters of General Applicability § 268.601 EEO group statistics. (a... solely statistical purpose for which the data is being collected, the need for accuracy, the Board's...

  9. 12 CFR 268.302 - Mixed case complaints. (United States)


    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Mixed case complaints. 268.302 Section 268.302... RULES REGARDING EQUAL OPPORTUNITY Related Processes § 268.302 Mixed case complaints. A mixed case... discrimination or it may contain additional allegations that the MSPB has jurisdiction to address. A mixed case...

  10. 12 CFR 268.710 - Compliance procedures. (United States)


    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Compliance procedures. 268.710 Section 268.710 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM... Women's Program Manager, the Hispanic Employment Program Coordinator, or the People with Disabilities...

  11. 12 CFR 268.203 - Rehabilitation Act. (United States)


    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Rehabilitation Act. 268.203 Section 268.203... Rehabilitation Act. (a) Model employer. The Board shall be a model employer of individuals with disabilities. The... Rehabilitation Act of 1973, as amended (29 U.S.C. 791), has been violated in a complaint alleging nonaffirmative...

  12. 40 CFR 268.49 - Alternative LDR treatment standards for contaminated soil. (United States)


    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Alternative LDR treatment standards for contaminated soil. 268.49 Section 268.49 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Treatment Standards § 268.49 Alternative LDR treatment standards for contaminated...

  13. 12 CFR 268.101 - General policy for equal opportunity. (United States)


    ... Discrimination in Employment Act (ADEA) (29 U.S.C. 621 et seq.), the Equal Pay Act (29 U.S.C. 206(d)), or the... 12 Banks and Banking 3 2010-01-01 2010-01-01 false General policy for equal opportunity. 268.101... RESERVE SYSTEM RULES REGARDING EQUAL OPPORTUNITY Board Program To Promote Equal Opportunity § 268.101...

  14. 49 CFR 268.1 - Definitions. (United States)


    ... TRANSPORTATION MAGNETIC LEVITATION TRANSPORTATION TECHNOLOGY DEPLOYMENT PROGRAM Overview § 268.1 Definitions. As used in this part— CMAQ means Congestion Mitigation and Air Quality Improvement Program (23 U.S.C. 149... Stat. 1978). Under that usage any corridor exhibiting Partnership Potential must at least meet the...

  15. 40 CFR 268.35 - Waste specific prohibitions-petroleum refining wastes. (United States)


    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste specific prohibitions-petroleum refining wastes. 268.35 Section 268.35 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... generator may use knowledge of the waste. If the waste contains constituents in excess of the applicable...

  16. 40 CFR 268.36 - Waste specific prohibitions-inorganic chemical wastes (United States)


    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste specific prohibitions-inorganic chemical wastes 268.36 Section 268.36 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... generator may use knowledge of the waste. If the waste contains regulated constituents in excess of the...

  17. 40 CFR 268.20 - Waste specific prohibitions-Dyes and/or pigments production wastes. (United States)


    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste specific prohibitions-Dyes and/or pigments production wastes. 268.20 Section 268.20 Protection of Environment ENVIRONMENTAL... Disposal § 268.20 Waste specific prohibitions—Dyes and/or pigments production wastes. (a) Effective August...

  18. Time-Dependent Expression of Arc and Zif268 after Acquisition of Fear Conditioning

    Directory of Open Access Journals (Sweden)

    Mary E. Lonergan


    Full Text Available Memory consolidation requires transcription and translation of new protein. Arc, an effector immediate early gene, and zif268, a regulatory transcription factor, have been implicated in synaptic plasticity underlying learning and memory. This study explored the temporal expression profiles of these proteins in the rat hippocampus following fear conditioning. We observed a time-dependent increase of Arc protein in the dorsal hippocampus 30-to-90-minute post training, returning to basal levels at 4 h. Zif268 protein levels, however, gradually increased at 30-minute post training before peaking in expression at 60 minute. The timing of hippocampal Arc and zif268 expression coincides with the critical period for protein synthesis-dependent memory consolidation following fear conditioning. However, the expression of Arc protein appears to be driven by context exploration, whereas, zif268 expression may be more specifically related to associative learning. These findings suggest that altered Arc and zif268 expression are related to neural plasticity during the formation of fear memory.

  19. 43 CFR 30.268 - May I demand a hearing regarding the tribal purchase option decision? (United States)


    ... tribal purchase option decision? 30.268 Section 30.268 Public Lands: Interior Office of the Secretary of the Interior INDIAN PROBATE HEARINGS PROCEDURES Tribal Purchase of Interests Under Special Statutes § 30.268 May I demand a hearing regarding the tribal purchase option decision? Yes. You may file with...

  20. Behavioral experience induces zif268 expression in mature granule cells but suppresses its expression in immature granule cells (United States)

    Huckleberry, Kylie A.; Kane, Gary A.; Mathis, Rita J.; Cook, Sarah G.; Clutton, Jonathan E.; Drew, Michael R.


    Thousands of neurons are born each day in the dentate gyrus (DG), but many of these cells die before reaching maturity. Both death and survival of adult-born neurons are regulated by neuronal activity in the DG. The immediate-early gene (IEG) zif268 appears to be an important mediator of these effects, as its expression can be induced by neural activity and knockout of zif268 impairs survival of adult-born neurons (Richardson et al., 1992; Veyrac et al., 2013). Despite the apparent importance of zif268 for adult neurogenesis, its behavior-induced expression has not been fully characterized in adult-born neurons. Here we characterize behavior-evoked expression of zif268 in mature and newborn dentate granule cells (DGCs). We first quantified zif268 expression in doublecortin-positive (DCX+) immature neurons and in the general granule cell population after brief exposure to a novel environment (NE). In the general granule cell population, zif268 expression peaked 1 h after NE exposure and returned to baseline by 8 h post-exposure. However, in the DCX+ cells, zif268 expression was suppressed relative to home cage for at least 8 h post-exposure. We next asked whether suppression of zif268 in DCX+ immature cells occurs in other behavioral paradigms that recruit the hippocampus. Exposure to Morris water maze (MWM) training, an enriched environment, or a NE caused approximately equal suppression of zif268 expression in DCX+ cells and approximately equal activation of zif268 expression among the general granule cell population. The same behavioral procedures activated zif268 expression in 6-week-old BrdU-labeled adult-born neurons, indicating that zif268 suppression is specific to immature neurons. Finally, we asked whether zif268 suppression varied as a function of age within the DCX+ population, which ranges in age from 0 to approximately 4 weeks. NE exposure had no significant effect on zif268 expression in 2- or 4-week-old BrdU-labeled neurons, but it significantly

  1. Behavioral experience induces zif268 expression in mature granule cells but suppresses its expression in immature granule cells

    Directory of Open Access Journals (Sweden)

    Kylie A. Huckleberry


    Full Text Available Thousands of neurons are born each day in the dentate gyrus (DG, but many of these cells die before reaching maturity. Both death and survival of adult-born neurons are regulated by neuronal activity in DG. The immediate-early gene (IEG zif268 is an important mediator of these effects, as its expression is induced by neural activity and knockout of zif268 impairs survival of adult-born neurons (Veyrac et al., 2013. Despite the apparent importance of zif268 for adult neurogenesis, its behavior-induced expression has not been fully characterized in adult-born neurons. Here we characterize behavior-evoked expression of zif268 in mature and newborn dentate granule cells (DGCs. In the general granule cell population, zif268 expression peaked 1 hour after novel environment exposure and returned to baseline by 8 hours post-exposure. However, in the doublecortin-positive (DCX+ immature neurons, zif268 expression was suppressed relative to home cage for at least 8 hours post-exposure. We next determined that exposure to water maze training, an enriched environment, or a novel environment caused approximately equal suppression of zif268 expression in DCX+ cells and approximately equal activation of zif268 in the general DGC population and in 6-week-old adult-born neurons. Finally, we asked whether zif268 suppression varied as a function of age within the DCX+ population, which ranges in age from 0 to approximately 4 weeks. Novel environment exposure had no significant effect on zif268 expression in 2- or 4-week-old BrdU-labeled neurons, but it significantly suppressed zif268 expression in 3-week-old neurons. In summary, behavioral experience transiently activated expression of zif268 in mature DGCs but caused a more long-lasting suppression of zif268 expression in immature, adult-born DGCs. We hypothesize that zif268 suppression inhibits memory-related synaptic plasticity in immature DGCs or mediates learning-induced apoptosis of immature adult

  2. Zif268/Egr1 gain of function facilitates hippocampal synaptic plasticity and long-term spatial recognition memory. (United States)

    Penke, Zsuzsa; Morice, Elise; Veyrac, Alexandra; Gros, Alexandra; Chagneau, Carine; LeBlanc, Pascale; Samson, Nathalie; Baumgärtel, Karsten; Mansuy, Isabelle M; Davis, Sabrina; Laroche, Serge


    It is well established that Zif268/Egr1, a member of the Egr family of transcription factors, is critical for the consolidation of several forms of memory; however, it is as yet uncertain whether increasing expression of Zif268 in neurons can facilitate memory formation. Here, we used an inducible transgenic mouse model to specifically induce Zif268 overexpression in forebrain neurons and examined the effect on recognition memory and hippocampal synaptic transmission and plasticity. We found that Zif268 overexpression during the establishment of memory for objects did not change the ability to form a long-term memory of objects, but enhanced the capacity to form a long-term memory of the spatial location of objects. This enhancement was paralleled by increased long-term potentiation in the dentate gyrus of the hippocampus and by increased activity-dependent expression of Zif268 and selected Zif268 target genes. These results provide novel evidence that transcriptional mechanisms engaging Zif268 contribute to determining the strength of newly encoded memories.

  3. 40 CFR Appendix Viii to Part 268 - LDR Effective Dates of Injected Prohibited Hazardous Wastes (United States)


    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false LDR Effective Dates of Injected Prohibited Hazardous Wastes VIII Appendix VIII to Part 268 Protection of Environment ENVIRONMENTAL PROTECTION... to Part 268—LDR Effective Dates of Injected Prohibited Hazardous Wastes National Capacity LDR...

  4. Cold Fusion Production and Decay of Neutron-Deficient Isotopes of Dubnium and Development of Extraction Systems for Group V Elements

    Energy Technology Data Exchange (ETDEWEB)

    Gates, Jacklyn M. [Univ. of California, Berkeley, CA (United States)


    Excitation functions for the 1n and 2n exit channels of the 208Pb(51V,xn)259-xDb reaction were measured. A maximum cross section of the 1n exit channel of 2070$+1100\\atop{-760}$ pb was measured at an excitation energy of 16.0 ± 1.8 MeV. For the 2n exit channel, a maximum cross section of 1660$+450\\atop{-370}$ pb was measured at 22.0 ± 1.8 MeV excitation energy. The 1n excitation function for the 209Bi(50Ti,n)258Db reaction was remeasured, resulting in a cross section of 5480$+1730\\atop{-1370}$ pb at an excitation energy of 16.0 ± 1.6 MeV. Differences in cross section maxima are discussed in terms of the fusion probability below the barrier. The extraction of niobium (Nb) and tantalum (Ta) from hydrochloric acid and mixed hydrochloric acid/lithium chloride media by bis(2-ethylhexyl) hydrogen phosphate (HDEHP) and bis(2-ethylhexyl) hydrogen phosphite (BEHP) was studied. The goal of the experiments was to find a system that demonstrates selectivity among the members of group five of the Periodic Table and is also suitable for the study of dubnium (Db, Z = 105). Experiments with niobium and tantalum were performed with carrier (10-6 M), carrier free (10-10 M) and trace (10-16 M) concentrations of metal using hydrochloric acid solution with concentrations ranging from 1 - 11 M. The extraction of niobium and tantalum from mixed hydrochloric acid/lithium chloride media by HDEHP and BEHP as a function of hydrogen ion (H+) concentration was also investigated. The data obtained are used as the basis to discuss the speciation of niobium and tantalum under the conditions studied and to evaluate possible extraction mechanisms. The 74Se(18O,p3n)88gNb excitation function was measured to determine the best energy for producing the 88Nb used in chemistry experiments. A maximum cross section of 495 +- 5 mb was observed at an 18O energy of 74.0 Me

  5. Lower expression of glutamic acid decarboxylase 67 in the prefrontal cortex in schizophrenia: contribution of altered regulation by Zif268. (United States)

    Kimoto, Sohei; Bazmi, H Holly; Lewis, David A


    Cognitive deficits of schizophrenia may be due at least in part to lower expression of the 67-kDa isoform of glutamic acid decarboxylase (GAD67), a key enzyme for GABA synthesis, in the dorsolateral prefrontal cortex of individuals with schizophrenia. However, little is known about the molecular regulation of lower cortical GAD67 levels in schizophrenia. The GAD67 promoter region contains a conserved Zif268 binding site, and Zif268 activation is accompanied by increased GAD67 expression. Thus, altered expression of the immediate early gene Zif268 may contribute to lower levels of GAD67 mRNA in the dorsolateral prefrontal cortex in schizophrenia. The authors used polymerase chain reaction to quantify GAD67 and Zif268 mRNA levels in dorsolateral prefrontal cortex area 9 from 62 matched pairs of schizophrenia and healthy comparison subjects, and in situ hybridization to assess Zif268 expression at laminar and cellular levels of resolution. The effects of potentially confounding variables were assessed in human subjects, and the effects of antipsychotic treatments were tested in antipsychotic-exposed monkeys. The specificity of the Zif268 findings was assessed by quantifying mRNA levels for other immediate early genes. GAD67 and Zif268 mRNA levels were significantly lower and were positively correlated in the schizophrenia subjects. Both Zif268 mRNA-positive neuron density and Zif268 mRNA levels per neuron were significantly lower in the schizophrenia subjects. These findings were robust to the effects of the confounding variables examined and differed from other immediate early genes. Deficient Zif268 mRNA expression may contribute to lower cortical GAD67 levels in schizophrenia, suggesting a potential mechanistic basis for altered cortical GABA synthesis and impaired cognition in schizophrenia.

  6. 40 CFR Appendix Vii to Part 268 - LDR Effective Dates of Surface Disposed Prohibited Hazardous Wastes (United States)


    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false LDR Effective Dates of Surface Disposed Prohibited Hazardous Wastes VII Appendix VII to Part 268 Protection of Environment ENVIRONMENTAL... VII to Part 268—LDR Effective Dates of Surface Disposed Prohibited Hazardous Wastes Table 1—Effective...

  7. 49 CFR 268.7 - Federal/State share and restrictions on the uses of Federal Maglev Funds. (United States)


    ... of Federal Maglev Funds. 268.7 Section 268.7 Transportation Other Regulations Relating to... Federal Maglev Funds. (a) Federal share. The Federal share of Full Projects Costs shall be not more than 2...) Restrictions on the uses of Federal Maglev Funds. (1) Federal Maglev Funds may be applied only to Eligible...

  8. Technical and Clinical Outcomes Following Colonic Stenting: A Seven-Year Analysis of 268 Procedures

    Energy Technology Data Exchange (ETDEWEB)

    Little, M. W.; Oakley, T.; Briggs, J. H.; Sutcliffe, J. A.; Allouni, A. K.; Makris, G.; Bratby, M. J.; Tapping, C. R.; Patel, R.; Wigham, A.; Anthony, S.; Phillips-Hughes, J.; Uberoi, R., E-mail: [Oxford University Hospitals NHS Foundation Trust, Department of Interventional Radiology, John Radcliffe Hospital (United Kingdom)


    AimsTo assess the factors contributing to the technical and clinical success of colorectal stenting for large bowel obstruction.Methodology268 cases of colonic stenting for large bowel obstruction were performed in 249 patients of mean age of 72 years (28–98) between 2006 and 2013. The majority of strictures were due to malignant disease, 244/268 (91 %). Diverticular strictures accounted for 24/268 (9 %).ResultsOverall technical success rate was 81 % (217/268), with a clinical success rate of 65 % (174/268). Duration of symptoms ranged from 0 to 180 days (mean 8 days). Technical success rate was seen to decrease with increasing symptom duration. For symptom duration of less than 1 week, technical success was 85.4 % (181/212) versus 69.6 % (39/56) for those with symptoms of greater than a week (p < 0.05). Clinical success rates fell from 71.3 % (107/150) to 59.3 % (70/118) (p < 0.05) when attempting to stent lesions of greater than 5 cm. There was also a significant reduction in clinical success when stenting lesions on a bend rather than a straight segment of colon 75.7 % (109/144) versus 59.7 % (74/124) (p < 0.05). A total of 20 (7.46 %) perforations were identified during the study. Stent migration occurred in 6.6 % of cases. In-stent stenosis occurred in 3.3 %. The overall 30-day all cause mortality rate was 9 %.ConclusionLesion size, location and duration of obstructive symptoms are statistically significant determinants of patient outcome. These factors could be used to advise patient selection for colonic stenting or direct progression to surgical intervention.

  9. Technical and Clinical Outcomes Following Colonic Stenting: A Seven-Year Analysis of 268 Procedures

    International Nuclear Information System (INIS)

    Little, M. W.; Oakley, T.; Briggs, J. H.; Sutcliffe, J. A.; Allouni, A. K.; Makris, G.; Bratby, M. J.; Tapping, C. R.; Patel, R.; Wigham, A.; Anthony, S.; Phillips-Hughes, J.; Uberoi, R.


    AimsTo assess the factors contributing to the technical and clinical success of colorectal stenting for large bowel obstruction.Methodology268 cases of colonic stenting for large bowel obstruction were performed in 249 patients of mean age of 72 years (28–98) between 2006 and 2013. The majority of strictures were due to malignant disease, 244/268 (91 %). Diverticular strictures accounted for 24/268 (9 %).ResultsOverall technical success rate was 81 % (217/268), with a clinical success rate of 65 % (174/268). Duration of symptoms ranged from 0 to 180 days (mean 8 days). Technical success rate was seen to decrease with increasing symptom duration. For symptom duration of less than 1 week, technical success was 85.4 % (181/212) versus 69.6 % (39/56) for those with symptoms of greater than a week (p < 0.05). Clinical success rates fell from 71.3 % (107/150) to 59.3 % (70/118) (p < 0.05) when attempting to stent lesions of greater than 5 cm. There was also a significant reduction in clinical success when stenting lesions on a bend rather than a straight segment of colon 75.7 % (109/144) versus 59.7 % (74/124) (p < 0.05). A total of 20 (7.46 %) perforations were identified during the study. Stent migration occurred in 6.6 % of cases. In-stent stenosis occurred in 3.3 %. The overall 30-day all cause mortality rate was 9 %.ConclusionLesion size, location and duration of obstructive symptoms are statistically significant determinants of patient outcome. These factors could be used to advise patient selection for colonic stenting or direct progression to surgical intervention.

  10. Technical and Clinical Outcomes Following Colonic Stenting: A Seven-Year Analysis of 268 Procedures. (United States)

    Little, M W; Oakley, T; Briggs, J H; Sutcliffe, J A; Allouni, A K; Makris, G; Bratby, M J; Tapping, C R; Patel, R; Wigham, A; Anthony, S; Phillips-Hughes, J; Uberoi, R


    To assess the factors contributing to the technical and clinical success of colorectal stenting for large bowel obstruction. 268 cases of colonic stenting for large bowel obstruction were performed in 249 patients of mean age of 72 years (28-98) between 2006 and 2013. The majority of strictures were due to malignant disease, 244/268 (91 %). Diverticular strictures accounted for 24/268 (9 %). Overall technical success rate was 81 % (217/268), with a clinical success rate of 65 % (174/268). Duration of symptoms ranged from 0 to 180 days (mean 8 days). Technical success rate was seen to decrease with increasing symptom duration. For symptom duration of less than 1 week, technical success was 85.4 % (181/212) versus 69.6 % (39/56) for those with symptoms of greater than a week (p < 0.05). Clinical success rates fell from 71.3 % (107/150) to 59.3 % (70/118) (p < 0.05) when attempting to stent lesions of greater than 5 cm. There was also a significant reduction in clinical success when stenting lesions on a bend rather than a straight segment of colon 75.7 % (109/144) versus 59.7 % (74/124) (p < 0.05). A total of 20 (7.46 %) perforations were identified during the study. Stent migration occurred in 6.6 % of cases. In-stent stenosis occurred in 3.3 %. The overall 30-day all cause mortality rate was 9 %. Lesion size, location and duration of obstructive symptoms are statistically significant determinants of patient outcome. These factors could be used to advise patient selection for colonic stenting or direct progression to surgical intervention.

  11. 24 CFR 203.268 - Pro rata payment of periodic MIP. (United States)


    ... HOUSING AND URBAN DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT AND OTHER AUTHORITIES SINGLE FAMILY MORTGAGE INSURANCE Contract Rights and Obligations Mortgage Insurance Premiums-Periodic Payment § 203.268 Pro rata payment of periodic MIP. (a) If the insurance contract is terminated...

  12. 12 CFR 268.503 - Enforcement of final EEOC decisions. (United States)


    ... the decision pursuant to title VII, the ADEA, the Equal Pay Act or the Rehabilitation Act and to seek... RESERVE SYSTEM RULES REGARDING EQUAL OPPORTUNITY Remedies and Enforcement § 268.503 Enforcement of final... Procedures Act, 5 U.S.C. 701 et seq., and the mandamus statute, 28 U.S.C. 1361, or to commence de novo...

  13. 12 CFR 268.407 - Civil action: Equal Pay Act. (United States)


    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Civil action: Equal Pay Act. 268.407 Section... Civil action: Equal Pay Act. A complainant is authorized under section 16(b) of the Fair Labor Standards..., if the violation is willful, three years of the date of the alleged violation of the Equal Pay Act...

  14. Sex Differences in Social Interaction in Rats: Role of the Immediate-Early Gene zif268


    Stack, Ashley; Carrier, Nicole; Dietz, David; Hollis, Fiona; Sorenson, Jamie; Kabbaj, Mohamed


    Given both the high prevalence of anxiety disorders in women and the fact that little is known about the mechanisms of gender differences in anxiety, our primary aim in this study was to investigate the neurobiological mechanisms underlying sex differences in social anxiety-like behavior in rats. Through the use of zif268 antisense oligodeoxynucleotides (zif ASO), we induced a temporary downregulation of zif268 expression in the medial prefrontal cortex of male and female rats and found that ...

  15. 49 CFR 268.3 - Different phases of the Maglev Deployment Program. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Different phases of the Maglev Deployment Program... DEPLOYMENT PROGRAM Overview § 268.3 Different phases of the Maglev Deployment Program. (a) The Maglev... deadlines—based on the progress of the Maglev Deployment Program; grantees will be notified accordingly. (b...

  16. 12 CFR 268.205 - Employment of aliens; Access to sensitive information. (United States)


    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Employment of aliens; Access to sensitive... Complaints § 268.205 Employment of aliens; Access to sensitive information. (a) Definitions. The definitions...— (i) A citizen or National of the United States, (ii) An alien who: (A) Meets the conditions set forth...


    Energy Technology Data Exchange (ETDEWEB)

    Barry, R. K.; Danchi, W. C. [NASA Goddard Space Flight Center, Laboratory for Exoplanets and Stellar Astrophysics, Code 667, Greenbelt, MD 20771 (United States); Demory, B.-O.; Segransan, D.; Di Folco, E.; Queloz, D.; Udry, S. [Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Forveille, T.; Delfosse, X.; Mayor, M.; Perrier, C. [Geneva Observatory, Geneva University, 51 Ch.des Maillettes, CH-1290 Versoix (Switzerland); Spooner, H. R. [University of Maryland, College Park, MD 20742 (United States); Torres, G. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02136 (United States); Traub, W. A., E-mail: [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA 91109 (United States)


    We report high-precision interferometric and radial velocity (RV) observations of the M-dwarf binary Gl 268. Combining measurements conducted using the IOTA interferometer and the ELODIE and Harvard Center for Astrophysics RV instruments leads to a mass of 0.22596 {+-} 0.00084 M {sub Sun} for component A and 0.19230 {+-} 0.00071 M {sub Sun} for component B. The system parallax as determined by these observations is 0.1560 {+-} 0.0030 arcsec-a measurement with 1.9% uncertainty in excellent agreement with Hipparcos (0.1572 {+-} 0.0033). The absolute H-band magnitudes of the component stars are not well constrained by these measurements; however, we can place an approximate upper limit of 7.95 and 8.1 for Gl 268A and B, respectively. We test these physical parameters against the predictions of theoretical models that combine stellar evolution with high fidelity, non-gray atmospheric models. Measured and predicted values are compatible within 2{sigma}. These results are among the most precise masses measured for visual binaries and compete with the best adaptive optics and eclipsing binary results.

  18. 40 CFR 268.9 - Special rules regarding wastes that exhibit a characteristic. (United States)


    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Special rules regarding wastes that... (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS General § 268.9 Special rules regarding wastes that exhibit a characteristic. (a) The initial generator of a solid waste must determine each EPA...

  19. 49 CFR 268.5 - Federal funding sources for the Maglev Deployment Program. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Federal funding sources for the Maglev Deployment... TECHNOLOGY DEPLOYMENT PROGRAM Overview § 268.5 Federal funding sources for the Maglev Deployment Program. (a) Federal Maglev Funds. Section 322 of Title 23 provides for the following funds for the Maglev Deployment...

  20. A Precise Physical Orbit For The M-Dwarf Binary Gliese 268 (United States)

    Barry, R. K.; Demory, B. -O.; Segransan, D.; Forveille, T.; Danchi, W. C.; Di Folco, E.; Queloz, D.; Spooner, H. R.; Torres, G.; Traub, W. A.; hide


    We report high-precision interferometric and radial velocity (RV) observations of the M-dwarf binary Gl 268. Combining measurements conducted using the IOTA interferometer and the ELODIE and Harvard Center for Astrophysics RV instruments leads to a mass of 0.22596 plus-minus 0.00084 Mass compared to the sun for component A and 0.19230 plus-minus 0.00071 Mass compared to the sun for component B. The system parallax as determined by these observations is 0.1560 plus-minus 0.0030 arcsec - a measurement with 1.9% uncertainty in excellent agreement with Hipparcos (0.1572 plus-minus 0.0033). The absolute H-band magnitudes of the component stars are not well constrained by these measurements; however, we can place an approximate upper limit of 7.95 and 8.1 for Gl 268A and B, respectively.We test these physical parameters against the predictions of theoretical models that combine stellar evolution with high fidelity, non-gray atmospheric models. Measured and predicted values are compatible within 2sigma. These results are among the most precise masses measured for visual binaries and compete with the best adaptive optics and eclipsing binary results.

  1. Viral-mediated Zif268 expression in the prefrontal cortex protects against gonadectomy-induced working memory, long-term memory, and social interaction deficits in male rats. (United States)

    Dossat, Amanda M; Jourdi, Hussam; Wright, Katherine N; Strong, Caroline E; Sarkar, Ambalika; Kabbaj, Mohamed


    In humans, some males experience reductions in testosterone levels, as a natural consequence of aging or in the clinical condition termed hypogonadism, which are associated with impaired cognitive performance and mood disorder(s). Some of these behavioral deficits can be reversed by testosterone treatment. Our previous work in rats reported that sex differences in the expression of the transcription factor Zif268, a downstream target of testosterone, within the medial prefrontal cortex (mPFC) mediates sex differences in social interaction. In the present study, we aimed to examine the effects of gonadectomy (GNX) in male rats on mPFC Zif268 expression, mood and cognitive behaviors. We also examined whether reinstitution of Zif268 in GNX rats will correct some of the behavioral deficits observed following GNX. Our results show that GNX induced a downregulation of Zif268 protein in the mPFC, which was concomitant with impaired memory in the y-maze and spontaneous object recognition test, reduced social interaction time, and depression-like behaviors in the forced swim test. Reinstitution of mPFC Zif268, using a novel adeno-associated-viral (AAV) construct, abrogated GNX-induced working memory and long-term memory impairments, and reductions in social interaction time, but not GNX-induced depression-like behaviors. These findings suggest that mPFC Zif268 exerts beneficial effects on memory and social interaction, and could be a potential target for novel treatments for behavioral impairments observed in hypogonadal and aged men with declining levels of gonadal hormones. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.

  2. 40 CFR 268.32 - Waste specific prohibitions-Soils exhibiting the toxicity characteristic for metals and... (United States)


    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Waste specific prohibitions-Soils... Prohibitions on Land Disposal § 268.32 Waste specific prohibitions—Soils exhibiting the toxicity characteristic... from land disposal: any volumes of soil exhibiting the toxicity characteristic solely because of the...

  3. Chemical Identification of Dubnium as a Decay Product of Element 115 Produced in the Reaction $\\rm {^{48}Ca}+{^{243}Am}$

    CERN Document Server

    Dmitriev, S N; Utyonkov, V K; Shishkin, S V; Eremin, A V; Lobanov, Yu V; Chepigin, V I; Sokol, E A; Tsyganov, Yu S; Vostokin, G K; Aksenov, N V; Hussonnois, M; Itkis, M G; Aggeler, H W; Schumann, D; Bruchertseifer, H; Eichler, R; Shaughnessy, D A; Wilk, P A; Kenneally, J M; Stoyer, M A; Wild, J F


    The results of an experiment designed to identify $^{268}$Db as the terminal isotope in the $\\alpha $-decay chain of element 115 produced via the ${\\rm {^{243}Am}}({\\rm {^{48}Ca}},3n){\\rm {^{288}115}}$ reaction are presented. The $^{243}$Am target was bombarded with a beam dose of $3.4\\cdot 10^{18}$ $^{48}$Ca projectiles at an energy of 247 MeV at the center of the target. The reaction products were collected in the surface layer of a copper catcher block, which was removed with a lathe and then dissolved in concentrated HNO$_{3}$. The group-5 elements were separated by sorption onto Dowex $50{\\times} 8$ cation-exchange resin with subsequent desorption using 1 M HF, which forms anionic fluoride complexes of group-5 elements. The eluent was evaporated onto a 0.4 $\\mu$m thick polyethylene foil that was placed between a pair of semiconductor detectors surrounded by $^{3}$He neutron counters for measurement of $\\alpha$ particles, fission fragments, and neutrons. In the course of the experiment, we observed 15 spo...

  4. 25 CFR 26.8 - Where do I go to apply for Job Placement and Training assistance? (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false Where do I go to apply for Job Placement and Training... PLACEMENT AND TRAINING PROGRAM General Applicability § 26.8 Where do I go to apply for Job Placement and Training assistance? You may apply for Job Placement and Training assistance at the servicing office...

  5. Understanding the mechanism of atovaquone drug resistance in Plasmodium falciparum cytochrome b mutation Y268S using computational methods.

    Directory of Open Access Journals (Sweden)

    Bashir A Akhoon

    Full Text Available The rapid appearance of resistant malarial parasites after introduction of atovaquone (ATQ drug has prompted the search for new drugs as even single point mutations in the active site of Cytochrome b protein can rapidly render ATQ ineffective. The presence of Y268 mutations in the Cytochrome b (Cyt b protein is previously suggested to be responsible for the ATQ resistance in Plasmodium falciparum (P. falciparum. In this study, we examined the resistance mechanism against ATQ in P. falciparum through computational methods. Here, we reported a reliable protein model of Cyt bc1 complex containing Cyt b and the Iron-Sulphur Protein (ISP of P. falciparum using composite modeling method by combining threading, ab initio modeling and atomic-level structure refinement approaches. The molecular dynamics simulations suggest that Y268S mutation causes ATQ resistance by reducing hydrophobic interactions between Cyt bc1 protein complex and ATQ. Moreover, the important histidine contact of ATQ with the ISP chain is also lost due to Y268S mutation. We noticed the induced mutation alters the arrangement of active site residues in a fashion that enforces ATQ to find its new stable binding site far away from the wild-type binding pocket. The MM-PBSA calculations also shows that the binding affinity of ATQ with Cyt bc1 complex is enough to hold it at this new site that ultimately leads to the ATQ resistance.

  6. Characterization of Group V Dubnium Homologs on DGA Extraction Chromatography Resin from Nitric and Hydrofluoric Acid Matrices

    Energy Technology Data Exchange (ETDEWEB)

    Despotopulos, J D; Sudowe, R


    Studies of the chemical properties of superheavy elements (SHE) pose interesting challenges due to their short half-lives and low production rates. Chemical systems must have extremely fast kinetics, fast enough kinetics to be able to examine the chemical properties of interest before the SHE decays to another nuclide. To achieve chemistry on such time scales, the chemical system must also be easily automated. Most importantly however, a chemical system must be developed which provides suitable separation and kinetics before an on-line study of a SHE can be performed. Relativistic effects make studying the chemical properties of SHEs interesting due to the impact these effects could have on the SHEs chemical properties. Relativistic effects arise when the velocity of the s orbital electrons approach the speed of light. As this velocity increases, the Bohr radius of the inner electron orbitals decreases and there is an increase in the particles mass. This contraction results in a destabilization of the energy of the outer d and f electron orbitals (5f and 6d in the case of SHE), which can cause these to expand due to their increased shielding from the nuclear charge. Another relativistic effect is the spin-orbit splitting for p, d, and f orbitals into j = 1 {+-} 1/2 states. This can lead most interestingly to a possible increased stability of element 114, which due to large spin-orbit splitting of the 7p orbital and the relativistically stabilized 7p{sub 1/2} and 7s orbital gives rise to a closed shell ground state of 7s{sup 2}7p{sub 1/2}{sup 2}. The homologs of element 105, dubnium (Db), Ta and Nb and the pseudo-homolog Pa, are well known to hydrolyze and form both neutral and non-neutral monoatomic and polyatomic species that may cause issues with extraction from a given chemical system. Early ion-exchange and solvent-extraction studies show mixed results for the behavior of Db. Some studies show Db behaving most similar to Ta, while others show it behaving

  7. Florida creativity index scores, conservatism, and openness in 268 U.S. regions. (United States)

    McCann, Stewart J H


    This study assessed whether Florida's Creativity Index (2002) scores for 268 U.S. regions were related to levels of conservatism and openness in the states in which the regions were situated. State conservatism was measured as the percentage voting for Bush in 2000. State openness z scores were taken from a survey of 619,397 residents (Rentfrow, Gosling, & Potter, 2008). Creativity scores correlated negatively with conservatism (r = -.22) and positively with openness (r = .23). Regression showed that the two predictors accounted jointly (7%) and separately for significant variance in the Creativity Index. The findings contribute evidence for the construct validity of Florida's composite Creativity Index and some, albeit moderate to weak, support of the Rentfrow, et al. conclusion that state-aggregated openness reflects the unconventionality, tolerance, and creativity of a state.

  8. Chronic stress enhanced fear memories are associated with increased amygdala zif268 mRNA expression and are resistant to reconsolidation. (United States)

    Hoffman, Ann N; Parga, Alejandro; Paode, Pooja R; Watterson, Lucas R; Nikulina, Ella M; Hammer, Ronald P; Conrad, Cheryl D


    The chronically stressed brain may present a vulnerability to develop maladaptive fear-related behaviors in response to a traumatic event. In rodents, chronic stress leads to amygdala hyperresponsivity and dendritic hypertrophy and produces a post traumatic stress disorder (PTSD)-like phenotype that includes exaggerated fear learning following Pavlovian fear conditioning and resistance to extinction. It is unknown whether chronic stress-induced enhanced fear memories are vulnerable to disruption via reconsolidation blockade, as a novel therapeutic approach for attenuating exaggerated fear memories. We used a chronic stress procedure in a rat model (wire mesh restraint for 6h/d/21d) to create a vulnerable brain that leads to a PTSD-like phenotype. We then examined freezing behavior during acquisition, reactivation and after post-reactivation rapamycin administration (i.p., 40mg/kg) in a Pavlovian fear conditioning paradigm to determine its effects on reconsolidation as well as the subsequent functional activation of limbic structures using zif268 mRNA. Chronic stress increased amygdala zif268 mRNA during fear memory retrieval at reactivation. Moreover, these enhanced fear memories were unaffected by post reactivation rapamycin to disrupt long-term fear memory. Also, post-reactivation long term memory processing was also associated with increased amygdala (LA and BA), and decreased hippocampal CA1 zif268 mRNA expression. These results suggest potential challenges for reconsolidation blockade as an effective approach in treating exaggerated fear memories, as in PTSD. Our findings also support chronic stress manipulations combined with fear conditioning as a useful preclinical approach to study a PTSD-like phenotype. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Observations of interstellar ultraviolet extinction from the S2/68 experiment in the TD-1 satellite

    International Nuclear Information System (INIS)

    Nandy, K.; Thompson, G.I.; Carnochan, D.J.; Wilson, R.


    The galactic distribution of the agents which cause the extinction bump near 2200 A and the ultraviolet colour excess E(1550-2740) within 2 kpc of the Sun in the galactic plane have been studied from the observations obtained with the S2/68 experiment in the TD-1 satellite. The mean reddening-distance relation in the galactic plane has been obtained for different longitudes. The study of the extinction parameter with galactic latitude shows a strong concentration of the dust towards the galactic plane with a scale height of 110 pc. (author)

  10. 49 CFR 268.21 - Down-selection of one or more Maglev projects for further study and selection of one project for... (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Down-selection of one or more Maglev projects for... Procedures For Financial Assistance § 268.21 Down-selection of one or more Maglev projects for further study... completion of Phase III of the Maglev Deployment Program, FRA will down-select one or more projects to...

  11. Genetic variants of ACE (Insertion/Deletion) and AGT (M268T) genes in patients with diabetes and nephropathy. (United States)

    Shaikh, Rozeena; Shahid, Syed M; Mansoor, Qaisar; Ismail, Muhammad; Azhar, Abid


    Diabetes mellitus (DM) has been a growing epidemic worldwide and poses a major socio-economic challenge. The leading cause of DM death is nephropathy due to end-stage renal disease (ESRD). This study aims to identify the possible association of I/D variants of the ACE gene and M268T (rs699) of the AGT gene of renin-angiotensin-aldosterone system (RAAS). Study subjects include 115 patients with DM, 110 with diabetic nephropathy (DN) and 110 controls. Fasting blood samples were collected for biochemical analyses and PCR amplification of specific regions of the ACE and AGT genes using primers. The distribution of ACE (I/D) II 28.8%, ID 35.6% and DD 35.6% while in DN II 24.5%, ID 41% and DD 34.5%. The AGT (M268T) genotypes were distributed in DM as TT 30.4%, MT 66.9% and MM 2.6% while in DN subjects TT 56.4%, MT 42.7% and MM 0.9%. Significant differences were observed in the DD genotype and D allele of the ACE gene and the TT genotype and T allele of AGT genes between diabetic patients with and without nephropathy. The study may conclude that the D allele polymorphism in the ACE gene and the T allele polymorphism in AGT gene may be considered as genetic risk factors for the development of nephropathy in diabetes. © The Author(s) 2014.

  12. HI absorption in 3C 49 and 3C 268.3 - Probing the environment of compact steep spectrum and GHz peaked spectrum sources

    NARCIS (Netherlands)

    Labiano, A; Vermeulen, RC; Barthel, PD; O'Dea, CP; Gallimore, JF; Baum, S; de Vries, W

    Aims. Localize and study the redshifted 21 cm H I absorption known to occur in the subgalactic sized compact steep spectrum galaxies 3C 49 and 3C 268.3. Methods. We carried out European VLBI Network UHF hand spectral line observations. Results. We have detected H I absorption towards the western

  13. Differential cortical c-Fos and Zif-268 expression after object and spatial memory processing in a standard or episodic-like object recognition task

    Directory of Open Access Journals (Sweden)

    Flávio F Barbosa


    Full Text Available Episodic memory reflects the capacity to recollect what, where and when a specific event happened in an integrative manner. Animal studies have suggested that the medial temporal lobe and the medial pre-frontal cortex are important for episodic-like memory formation. The goal of present study was to evaluate whether there are different patterns of expression of the immediate early genes c-Fos and Zif-268 in these cortical areas after rats are exposed to object recognition tasks with different cognitive demands. Male rats were randomly assigned to five groups: home cage control (CTR-HC, empty open field (CTR-OF, open field with one object (CTR-OF + Obj, novel object recognition task (OR and episodic-like memory task (ELM and were killed one hour after the last behavioral procedure. Rats were able to discriminate the objects in the OR task. In the ELM task, rats showed spatial (but not temporal discrimination of the objects. We found an increase in the c-Fos expression in the dorsal dentate gyrus (DG and in the perirhinal cortex (PRh in the OR and ELM groups. The OR group also presented an increase of c-Fos expression in the medial prefrontal cortex (mPFC. Additionally, the OR and ELM groups had increased expression of Zif-268 in the mPFC. Moreover, Zif-268 was increased in the dorsal CA1 and perirhinal cortex only in the ELM group. In conclusion, the pattern of activation was different in tasks with different cognitive demands. Accordingly, correlation tests suggest the engagement of different neural networks in the object recognition tasks used. Specifically, perirhinal-dentate gyrus co-activation was detected after the what-where memory retrieval, but not after the novel object recognition task. Both regions correlated with the respective behavioral outcome. These findings can be helpful in the understanding of the neural networks underlying memory tasks with different cognitive demands.

  14. Long-term gas and brine migration at the Waste Isolation Pilot Plant: Preliminary sensitivity analyses for post-closure 40 CFR 268 (RCRA), May 1992

    International Nuclear Information System (INIS)


    This report describes preliminary probabilistic sensitivity analyses of long term gas and brine migration at the Waste Isolation Pilot Plant (WIPP). Because gas and brine are potential transport media for organic compounds and heavy metals, understanding two-phase flow in the repository and the surrounding Salado Formation is essential to evaluating long-term compliance with 40 CFR 268.6, which is the portion of the Land Disposal Restrictions of the Hazardous and Solid Waste Amendments to the Resource Conservation and Recovery Act that states the conditions for disposal of specified hazardous wastes. Calculations described here are designed to provide guidance to the WIPP Project by identifying important parameters and helping to recognize processes not yet modeled that may affect compliance. Based on these analyses, performance is sensitive to shaft-seal permeabilities, parameters affecting gas generation, and the conceptual model used for the disturbed rock zone surrounding the excavation. Brine migration is less likely to affect compliance with 40 CFR 268.6 than gas migration. However, results are preliminary, and additional iterations of uncertainty and sensitivity analyses will be required to provide the confidence needed for a defensible compliance evaluation. Specifically, subsequent analyses will explicitly include effects of salt creep and, when conceptual and computational models are available, pressure-dependent fracturing of anhydrite marker beds

  15. Work history and mortality risks in 90,268 US radiological technologists. (United States)

    Liu, Jason J; Freedman, D Michal; Little, Mark P; Doody, Michele M; Alexander, Bruce H; Kitahara, Cari M; Lee, Terrence; Rajaraman, Preetha; Miller, Jeremy S; Kampa, Diane M; Simon, Steven L; Preston, Dale L; Linet, Martha S


    There have been few studies of work history and mortality risks in medical radiation workers. We expanded by 11 years and more outcomes our previous study of mortality risks and work history, a proxy for radiation exposure. Using Cox proportional hazards models, we estimated mortality risks according to questionnaire work history responses from 1983 to 1989 through 2008 by 90,268 US radiological technologists. We controlled for potential confounding by age, birth year, smoking history, body mass index, race and gender. There were 9566 deaths (3329 cancer and 3020 circulatory system diseases). Mortality risks increased significantly with earlier year began working for female breast (p trend=0.01) and stomach cancers (p trend=0.01), ischaemic heart (p trend=0.03) and cerebrovascular diseases (p trend=0.02). The significant trend with earlier year first worked was strongly apparent for breast cancer during baseline through 1997, but not 1998-2008. Risks were similar in the two periods for circulatory diseases. Radiological technologists working ≥5 years before 1950 had elevated mortality from breast cancer (HR=2.05, 95% CI 1.27 to 3.32), leukaemia (HR=2.57, 95% CI 0.96 to 6.68), ischaemic heart disease (HR=1.13, 95% CI 0.96 to 1.33) and cerebrovascular disease (HR=1.28, 95% CI 0.97 to 1.69). No other work history factors were consistently associated with mortality risks from specific cancers or circulatory diseases, or other conditions. Radiological technologists who began working in early periods and for more years before 1950 had increased mortality from a few cancers and some circulatory system diseases, likely reflecting higher occupational radiation exposures in the earlier years. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to

  16. Determination of diffusion coefficients of carbon dioxide in water between 268 and 473 K in a high-pressure capillary optical cell with in situ Raman spectroscopic measurements (United States)

    Lu, Wanjun; Guo, Huirong; Chou, I.-Ming; Burruss, R.C.; Li, Lanlan


    Accurate values of diffusion coefficients for carbon dioxide in water and brine at reservoir conditions are essential to our understanding of transport behavior of carbon dioxide in subsurface pore space. However, the experimental data are limited to conditions at low temperatures and pressures. In this study, diffusive transfer of carbon dioxide in water at pressures up to 45 MPa and temperatures from 268 to 473 K was observed within an optical capillary cell via time-dependent Raman spectroscopy. Diffusion coefficients were estimated by the least-squares method for the measured variations in carbon dioxide concentration in the cell at various sample positions and time. At the constant pressure of 20 MPa, the measured diffusion coefficients of carbon dioxide in water increase with increasing temperature from 268 to 473 K. The relationship between diffusion coefficient of carbon dioxide in water [D(CO2) in m2/s] and temperature (T in K) was derived with Speedy–Angell power-law approach as: D(CO2)=D0[T/Ts-1]m where D0 = 13.942 × 10−9 m2/s, Ts = 227.0 K, and m = 1.7094. At constant temperature, diffusion coefficients of carbon dioxide in water decrease with pressure increase. However, this pressure effect is rather small (within a few percent).

  17. Different mutation patterns of atovaquone resistance to Plasmodium falciparum in vitro and in vivo: rapid detection of codon 268 polymorphisms in the cytochrome b as potential in vivo resistance marker

    DEFF Research Database (Denmark)

    Schwöbel, Babett; Alifrangis, Michael; Salanti, Ali


    , we developed a detection method for the diagnostic of codon 268 polymorphisms as a potential atovaquone/proguanil resistance marker. A nested PCR with 3 different pairs of primers for the second round was designed. Each product was digested with restriction enzymes, capable to distinguish the wild...

  18. Project W-314 acceptance test report HNF-4651 for HNF-4650 SN-268 encasement leak detection ANA-WT-LDSTA-335 for project W-314

    International Nuclear Information System (INIS)



    The purpose of the test was to verify that the AN Tank Farm Encasement Leak Detector components are functionally integrated and operate in accordance with engineering design specifications The Acceptance Test Procedure HNF-4650, SN-268 Encasement Leak Detection ANA-W-LDSTA-335, was conducted between 22 June and 01 July 1999 at the 200E AN Tank Farm. The test has been completed with no open test exceptions The test was conducted prior to final engineering ''as built'' activities being completed this had no impact on the procedure or test results. All components, identified in the procedure, were found to be labeled and identified as written in the procedure

  19. Expressão de zif-268 durante a aquisição, evocação e extinção de uma memória aversiva


    Lemos, Nelson Alessandretti de Mello


    No paradigma comportamental da esquiva discriminativa, as memórias de curto e de longo prazo têm sido extensivamente estudadas tanto comportamental quanto farmacologicamente. O objetivo do presente estudo foi avaliar, usando o modelo supracitado, a expressão hipocampal de zif-268 - gene imediato dependente de cálcio implicado em processos de plasticidade sináptica - ao longo das diversas etapas da formação da memória, como aquisição, evocação e extinção. O aparato comportamental consistiu de ...

  20. Regulatory issues for Waste Isolation Pilot Plant long-term compliance with U.S. Environmental Protection Agency 40 CFR 191B and 268

    International Nuclear Information System (INIS)

    Anderson, D.R.; Marietta, M.G.; Higgins, P.J. Jr.


    Before disposing of transuranic radioactive waste at the Waste Isolation Pilot Plant (WIPP), the United States Department of Energy (DOE) must evaluate compliance with long-term regulations of the United States Environmental Protection Agency (EPA), specifically the Environmental Standards for the Management and Disposal of Spent Nuclear Fuel, High-Level and Transuranic Radioactive Wastes (40 CFR 191), and the Land Disposal Restrictions (40 CFR 268) of the Hazardous and Solid Waste Amendments to the Resource Conservation and Recovery Act (RCRA). Sandia National Laboratories (SNL) is conducting iterative performance assessments (PAs) of the WIPP for the DOE to provide interim guidance while preparing for final compliance evaluations. This paper provides background information on the regulations, describes the SNL WIPP PA Departments approach to developing a defensible technical basis for consistent compliance evaluations, and summarizes the major observations and conclusions drawn from the 1991 and 1992 PAs

  1. [Blood plasma protein adsorption capacity of perfluorocarbon emulsion stabilized by proxanol 268 (in vitro and in vivo studies)]. (United States)

    Sklifas, A N; Zhalimov, V K; Temnov, A A; Kukushkin, N I


    The adsorption abilities of the perfluorocarbon emulsion stabilized by Proxanol 268 were investigated in vitro and in vivo. In vitro, the saturation point for the blood plasma proteins was nearly reached after five minutes of incubation of the emulsion with human/rabbit blood plasma and was stable for all incubation periods studied. The decrease in volume ratio (emulsion/plasma) was accompanied by the increase in the adsorptive capacity of the emulsion with maximal values at 1/10 (3.2 and 1.5 mg of proteins per 1 ml of the emulsion, for human and rabbit blood plasma, respectively) that was unchanged at lower ratios. In vivo, in rabbits, intravenously injected with the emulsion, the proteins with molecular masses of 12, 25, 32, 44, 55, 70, and 200 kDa were adsorbed by the emulsion (as in vitro) if it was used 6 hours or less before testing. More delayed testing (6 h) revealed elimination of proteins with molecular masses of 25 and 44 kDa and an additional pool of adsorpted new ones of 27, 50, and 150 kDa. Specific adsorptive capacity of the emulsion enhanced gradually after emulsion injection and reached its maximum (3.5-5 mg of proteins per 1 ml of the emulsion) after 24 hours.

  2. Patellar tendinopathy in junior basketball players: a controlled clinical and ultrasonographic study of 268 patellar tendons in players aged 14-18 years. (United States)

    Cook, J L; Khan, K M; Kiss, Z S; Griffiths, L


    Anterior knee pain is a common presenting complaint amongst adolescent athletes. We hypothesised that patellar tendinopathy may occur at a younger age than is generally recognised. Thus, we studied the patellar tendons in 134 elite 14- to 18-year-old female (n=64) and male (n=70) basketball players and 29 control swimmers (17 female, 12 male) clinically and with ultrasonography. We found that of 268 tendons, 19 (7%) had current patellar tendinopathy on clinical grounds (11% in males, 2% in females). Twenty-six percent of the basketball players' patellar tendons contained an ultrasonographic hypoechoic region. Ultrasonographic abnormality was more prevalent in the oldest tertile of players (17-18 years) than the youngest tertile (14-15.9 years). Of tendons categorised clinically as 'Never patellar tendinopathy', 22% had an ultrasonographic hypoechoic region nevertheless. This study indicates that patellar tendinopathy can occur in 14- to 18-year-old basketball players. Ultrasonographic tendon abnormality is 3 times as common as clinical symptoms.

  3. 40__268

    African Journals Online (AJOL)


    in regulating algal productivity through grazing and the transfer of ..... 9.1mg/L, which is quite satisfactory to support aquatic life perhaps due to ... reported to be governed by a balance between input from .... assistance for the work, respectively.

  4. Retinal vascular abnormalities and dragged maculae in a carrier with a new NDP mutation (c.268delC) that caused severe Norrie disease in the proband. (United States)

    Lin, Phoebe; Shankar, Suma P; Duncan, Jacque; Slavotinek, Anne; Stone, Edwin M; Rutar, Tina


    Norrie disease (ND) is caused by mutations in the ND pseudoglioma (NDP) gene (MIM 300658) located at chromosome Xp11.4-p11.3. ND is characterized by abnormal retinal vascular development and vitreoretinal disorganization presenting at birth. Systemic manifestations include sensorineural deafness, progressive mental disorder, behavioral and psychological problems, growth failure, and seizures. Other vitreoretinopathies that are associated with NDP gene mutations include X-linked familial exudative vitreoretinopathy, Coats disease, persistent fetal vasculature, and retinopathy of prematurity. Phenotypic variability associated with NDP gene mutations has been well documented in affected male patients. However, there are limited data on signs in female carriers, with mild peripheral retinal abnormalities reported in both carrier and noncarrier females of families with NDP gene mutations. Here, we report a family harboring a single base-pair deletion, c.268delC, in the NDP gene causing a severe ND phenotype in the male proband and peripheral retinal vascular abnormalities with dragged maculae similar to those observed in familial exudative vitreoretinopathy in his carrier mother. Copyright (c) 2010 American Association for Pediatric Ophthalmology and Strabismus. Published by Mosby, Inc. All rights reserved.

  5. Extraction of niobium and tantalum isotopes using organophosphorus compounds. Pt. 1. Extraction of 'carrier-free' metal concentrations from HCl solutions

    International Nuclear Information System (INIS)

    Gates, J.M.; California Univ., Berkeley, CA; Sudowe, R.; Stavsetra, L.


    The extraction of niobium (Nb) and tantalum (Ta) from hydrochloric acid media by bis(2-ethylhexyl) hydrogen phosphate (HDEHP) and bis(2-ethylhexyl) hydrogen phosphite (BEHP) was studied. The goal of the experiments is to find a system that demonstrates selectivity between the members of group five of the Periodic Table and is also suitable for the study of dubnium (Db, Z=105). Experiments were performed at the trace level (10 -16 M Nb or Ta) using hydrochloric acid with concentrations ranging from 1-11 M and short-lived isotopes of Nb and Ta produced in nuclear reactions. When HDEHP was used as the extractant, the Nb extraction yield decreased with increasing acid concentrations above 6 M, while the amount of Ta extracted remained over 75% for all acid concentrations studied. Tantalum was found to be extracted by BEHP at acid concentrations above 6 M, while niobium was not significantly extracted. The data obtained are used as the basis to discuss the speciation of Nb and Ta under the conditions studied and to evaluate possible extraction mechanisms. (orig.)

  6. Chemistry of superheavy elements

    International Nuclear Information System (INIS)

    Schaedel, M.


    The chemistry of superheavy elements - or transactinides from their position in the Periodic Table - is summarized. After giving an overview over historical developments, nuclear aspects about synthesis of neutron-rich isotopes of these elements, produced in hot-fusion reactions, and their nuclear decay properties are briefly mentioned. Specific requirements to cope with the one-atom-at-a-time situation in automated chemical separations and recent developments in aqueous-phase and gas-phase chemistry are presented. Exciting, current developments, first applications, and future prospects of chemical separations behind physical recoil separators ('pre-separator') are discussed in detail. The status of our current knowledge about the chemistry of rutherfordium (Rf, element 104), dubnium (Db, element 105), seaborgium (Sg, element 106), bohrium (Bh, element 107), hassium (Hs, element 108), copernicium (Cn, element 112), and element 114 is discussed from an experimental point of view. Recent results are emphasized and compared with empirical extrapolations and with fully-relativistic theoretical calculations, especially also under the aspect of the architecture of the Periodic Table. (orig.)

  7. Remaining Sites Verification Package for the 1607-F1 Sanitary Sewer System (124-F-1) and the 100-F-26:8 (1607-F1) Sanitary Sewer Pipelines Waste Sites. Attachment to Waste Site Reclassification Forms 2004-130 and 2005-004

    International Nuclear Information System (INIS)

    Dittmer, L.M.


    The 100-F-26:8 waste site consisted of the underground pipelines that conveyed sanitary waste water from the 1701-F Gatehouse, 1709-F Fire Station, and the 1720-F Administrative Office to the 1607-F1 septic tank. The site has been remediated and presently exists as an open excavation. In accordance with this evaluation, the verification sampling results support a reclassification of this site to Interim Closed Out. The results of verification sampling demonstrated that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also showed that residual contaminant concentrations are protective of groundwater and the Columbia River

  8. 77 FR 69765 - Colorado: Final Authorization of State Hazardous Waste Management Program Revisions (United States)


    ... comment includes information claimed to be Confidential Business Information (CBI) or other information... business hours. FOR FURTHER INFORMATION CONTACT: Moye Lin, (303) 312-6667, [email protected] or Randy Perila...; (Checklist 189). 261.32, 261 Appendix VII & VIII, 268.33(a), 268.33(b) intro, 268.(b)(1)- (5), 268.33(c), 268...

  9. Physical activity attenuates the influence of FTO variants on obesity risk: a meta-analysis of 218,166 adults and 19,268 children.

    Directory of Open Access Journals (Sweden)

    Tuomas O Kilpeläinen


    Full Text Available The FTO gene harbors the strongest known susceptibility locus for obesity. While many individual studies have suggested that physical activity (PA may attenuate the effect of FTO on obesity risk, other studies have not been able to confirm this interaction. To confirm or refute unambiguously whether PA attenuates the association of FTO with obesity risk, we meta-analyzed data from 45 studies of adults (n = 218,166 and nine studies of children and adolescents (n = 19,268.All studies identified to have data on the FTO rs9939609 variant (or any proxy [r(2>0.8] and PA were invited to participate, regardless of ethnicity or age of the participants. PA was standardized by categorizing it into a dichotomous variable (physically inactive versus active in each study. Overall, 25% of adults and 13% of children were categorized as inactive. Interaction analyses were performed within each study by including the FTO×PA interaction term in an additive model, adjusting for age and sex. Subsequently, random effects meta-analysis was used to pool the interaction terms. In adults, the minor (A- allele of rs9939609 increased the odds of obesity by 1.23-fold/allele (95% CI 1.20-1.26, but PA attenuated this effect (p(interaction  = 0.001. More specifically, the minor allele of rs9939609 increased the odds of obesity less in the physically active group (odds ratio  = 1.22/allele, 95% CI 1.19-1.25 than in the inactive group (odds ratio  = 1.30/allele, 95% CI 1.24-1.36. No such interaction was found in children and adolescents.The association of the FTO risk allele with the odds of obesity is attenuated by 27% in physically active adults, highlighting the importance of PA in particular in those genetically predisposed to obesity.

  10. Aqueous chemistry of transactinides

    International Nuclear Information System (INIS)

    Schaedel, M.


    The aqueous chemistry of the first three transactinide elements is briefly reviewed with special emphasis given to recent experimental results. Short introductory remarks are discussing the atom-at-a-time situation of transactinide chemistry as a result of low production cross-sections and short half-lives. In general, on-line experimental techniques and, more specifically, the automated rapid chemistry apparatus, ARCA, are presented. Present and future developments of experimental techniques and resulting perspectives are outlined at the end. The central part is mainly focussing on hydrolysis and complex formation aspects of the superheavy group 4, 5, and 6 transition metals with F - and Cl - anions. Experimental results are compared with the behaviour of lighter homologous elements and with relativistic calculations. It will be shown that the chemical behaviour of the first superheavy elements is already strongly influenced by relativistic effects. While it is justified to place rutherfordium, dubnium and seaborgium in the Periodic Table of the Elements into group 4, 5 and 6, respectively, it is no more possible to deduce from this position in detail the chemical properties of these transactinide or superheavy elements. (orig.)

  11. Confirmation of emergence of mutations associated with atovaquone-proguanil resistance in unexposed Plasmodium falciparum isolates from Africa

    Directory of Open Access Journals (Sweden)

    Kyle Dennis E


    Full Text Available Abstract Background In vitro and in vivo resistance of Plasmodium falciparum to atovaquone or atovaquone-proguanil hydrochloride combination has been associated to two point mutations in the parasite cytochrome b (cytb gene (Tyr268Ser and Tyr268Asn. However, little is known about the prevalence of codon-268 mutations in natural populations of P. falciparum without previous exposure to the drug in Africa. Methods The prevalence of codon-268 mutations in the cytb gene of African P. falciparum isolates from Nigeria, Malawi and Senegal, where atovaquone-proguanil has not been introduced for treatment of malaria was assessed. Genotyping of the cytb gene in isolates of P. falciparum was performed by PCR-restriction fragment length polymorphism and confirmed by sequencing. Results 295 samples from Nigeria (111, Malawi (91 and Senegal (93 were successfully analyzed for detection of either mutant Tyr268Ser or Tyr268Asn. No case of Ser268 or Asn268 was detected in cytb gene of parasites from Malawi or Senegal. However, Asn268 was detected in five out of 111 (4.5% unexposed P. falciparum isolates from Nigeria. In addition, one out of these five mutant Asn268 isolates showed an additional cytb mutation leading to a Pro266Thr substitution inside the ubiquinone reduction site. Conclusion No Tyr268Ser mutation is found in cytb of P. falciparum isolates from Nigeria, Malawi or Senegal. This study reports for the first time cytb Tyr268Asn mutation in unexposed P. falciparum isolates from Nigeria. The emergence in Africa of P. falciparum isolates with cytb Tyr268Asn mutation is a matter of serious concern. Continuous monitoring of atovaquone-proguanil resistant P. falciparum in Africa is warranted for the rational use of this new antimalarial drug, especially in non-immune travelers.

  12. Confirmation of emergence of mutations associated with atovaquone-proguanil resistance in unexposed Plasmodium falciparum isolates from Africa. (United States)

    Happi, Christian T; Gbotosho, Grace O; Folarin, Onikepe A; Milner, Danny; Sarr, Ousmane; Sowunmi, Akintunde; Kyle, Dennis E; Milhous, Wilbur K; Wirth, Dyann F; Oduola, Ayoade M J


    In vitro and in vivo resistance of Plasmodium falciparum to atovaquone or atovaquone-proguanil hydrochloride combination has been associated to two point mutations in the parasite cytochrome b (cytb) gene (Tyr268Ser and Tyr268Asn). However, little is known about the prevalence of codon-268 mutations in natural populations of P. falciparum without previous exposure to the drug in Africa. The prevalence of codon-268 mutations in the cytb gene of African P. falciparum isolates from Nigeria, Malawi and Senegal, where atovaquone-proguanil has not been introduced for treatment of malaria was assessed. Genotyping of the cytb gene in isolates of P. falciparum was performed by PCR-restriction fragment length polymorphism and confirmed by sequencing. 295 samples from Nigeria (111), Malawi (91) and Senegal (93) were successfully analyzed for detection of either mutant Tyr268Ser or Tyr268Asn. No case of Ser268 or Asn268 was detected in cytb gene of parasites from Malawi or Senegal. However, Asn268 was detected in five out of 111 (4.5%) unexposed P. falciparum isolates from Nigeria. In addition, one out of these five mutant Asn268 isolates showed an additional cytb mutation leading to a Pro266Thr substitution inside the ubiquinone reduction site. No Tyr268Ser mutation is found in cytb of P. falciparum isolates from Nigeria, Malawi or Senegal. This study reports for the first time cytb Tyr268Asn mutation in unexposed P. falciparum isolates from Nigeria. The emergence in Africa of P. falciparum isolates with cytb Tyr268Asn mutation is a matter of serious concern. Continuous monitoring of atovaquone-proguanil resistant P. falciparum in Africa is warranted for the rational use of this new antimalarial drug, especially in non-immune travelers.

  13. 29 CFR 1910.268 - Telecommunications. (United States)


    ... the maintenance and repair of equipment frame lineups, may require a higher level of illumination. In... spaces. Maintenance aisles, or wiring aisles, between equipment frame lineups are working spaces and are.... Employees assigned to work with storage batteries shall be instructed in emergency procedures such as...

  14. 12 CFR 268.702 - Definitions. (United States)


    ... Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM RULES... disfigurement, or anatomical loss affecting one of more of the following body systems: Neurological..., muscular dystrophy, multiple sclerosis, cancer, heart disease, diabetes, mental retardation, emotional...

  15. Confirmation of emergence of mutations associated with atovaquone-proguanil resistance in unexposed Plasmodium falciparum isolates from Africa


    Happi, Christian T; Gbotosho, Grace O; Folarin, Onikepe A; Milner, Danny; Sarr, Ousmane; Sowunmi, Akintunde; Kyle, Dennis E; Milhous, Wilbur K; Wirth, Dyann F; Oduola, Ayoade MJ


    Abstract Background In vitro and in vivo resistance of Plasmodium falciparum to atovaquone or atovaquone-proguanil hydrochloride combination has been associated to two point mutations in the parasite cytochrome b (cytb) gene (Tyr268Ser and Tyr268Asn). However, little is known about the prevalence of codon-268 mutations in natural populations of P. falciparum without previous exposure to the drug in Africa. Methods The prevalence of codon-268 mutations in the cytb gene of African P. falciparum...

  16. Publications | Page 268 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Through books, articles, research publications, and studies, we aim to widen the ... Journal articles ... Potato farmers in the province of Carchi in northern Ecuador suffer from decreased mental capacity caused by high exposure to chemical ...

  17. 12 CFR 268.204 - Class complaints. (United States)


    ... agent or representative and must identify the policy or practice adversely affecting the class as well..., Notice of Appeal/Petition. (e) Notification. (1) Within 15 days of receiving notice that the...) Both parties shall furnish to the administrative judge copies of all materials that they wish to be...

  18. Publications | Page 268 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    “It's my job as a journalist to broadcast the story of Afghanistan to the world. ... the words and a stereotype comes to mind — a system of education that is “second best. ... Thirty-one countries from war-torn Afghanistan to Yemen are queued for ...

  19. Publications | Page 268 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Is the developing world healthier, wealthier, better fed. ... Thirty-one countries from war-torn Afghanistan to Yemen are queued for membership ... Just say the words and a stereotype comes to mind — a system of education that is “second best.

  20. Influence of relativistic effects on hydration and hydrolysis of rutherfordium, dubnium and some 6-th row element cations

    International Nuclear Information System (INIS)

    Bilewicz, A.; Siekierski, S.


    New evidence for the influence of relativistic effect on coordination number, (CN), and hydrolysis of Rf 4+ and Db 5+ aqua ions has been presented. It has been argued that very strong hydrolysis of the heaviest members of Groups 12, 13 is caused by the low CN of Hg 2+ and Tl 3+ in their aqua ions. Low CN is the result of relativistic effects which stabilize the 6s orbital, increasing thereby the respective promotion energy. That supports our previous view that strong hydrolysis of Rf aq 4+ much greater than that of Hf aq 4+ and Zr aq 4+ , is also a result of lower CN. Since the promotion energy for sp 3 d 4 hybridization (CN 8) seems to be close to that od sp 3 d 2 hybridization (CN 6), and since hybridization energies of Zr 4+ , Hf 4+ and Rf 4+ do not differ very much for hexa- and octahydrates the two aqua ions i.e., M(H 2 O) 6 4+ and M(H 2 O) 8 4+ may coexist in aqueous acid solutions. However, due to relativistic stabilization of 7s and destabilization of 6s orbitals, which increases promotion energy, the Rf 4+ aqua cation should show coordination number 6 rather than 8. A shift of equilibrium toward a lower hydrate increases the tendency to hydrolyse. (author)

  1. Les leishmanioses cutanées à Leishmania major et à Leishmania tropica au Maroc: aspects épidémio-cliniques comparatifs de 268 cas (United States)

    Chiheb, Soumia; Slaoui, Widad; Mouttaqui, Tarik; Riyad, Meriem; Benchikhi, Hakima


    Introduction Depuis 1995, le Maroc a connu une réactivation des foyers de leishmanioses cutanées (LC) à L. major et une nouvelle répartition géographique des foyers à L. tropica. Le but de cette étude est de comparer les aspects épidémio-cliniques associés aux LC potentiellement dûes à L. major et à L. tropica. Méthodes Une étude rétrospective a colligé 268 cas de LC au service de dermatologie du CHU Ibn Rochd de Casablanca entre Janvier 1995 et Septembre 2010. Les données étaient analysées par Epi info version 3.5.1. Le test X2 était appliqué (Différence significative = p< 0,05). Résultats Deux cent soixante-huit cas de LC ont été colligés, dont 160 femmes et 108 hommes. Ils ont été répartis en 123 patients originaires des foyers à L.major et 145 patients originaires des foyers à L. tropica. L'aspect ulcéronodulaire, ulcérovégétant ou végétant était retrouvé dans 58 cas (47,2%) des cas de LC à L. major versus 24 cas (16,7%) dans la L.C à L. tropica. L'aspect papulonodulaire était retrouvé dans 84 cas (58%) de LC à L. tropica contre 41 cas (33,3%) de LC à L. major. Conclusion Dans la LC à L. major, l'atteinte des membres et les aspects cliniques végétant ou ulcéro-végétant restent toujours prédominants. Dans la L.C à L. tropica, l'atteinte papulonodulaire unique du visage reste prédominante mais des formes ulcéronodulaires, végétantes ou ulcérovégétantes existent également dans les foyers récents à L. tropica, prêtant à confusion cliniquement avec des LC à L. major. PMID:25810796

  2. Chemistry of the superheavy elements. (United States)

    Schädel, Matthias


    The quest for superheavy elements (SHEs) is driven by the desire to find and explore one of the extreme limits of existence of matter. These elements exist solely due to their nuclear shell stabilization. All 15 presently 'known' SHEs (11 are officially 'discovered' and named) up to element 118 are short-lived and are man-made atom-at-a-time in heavy ion induced nuclear reactions. They are identical to the transactinide elements located in the seventh period of the periodic table beginning with rutherfordium (element 104), dubnium (element 105) and seaborgium (element 106) in groups 4, 5 and 6, respectively. Their chemical properties are often surprising and unexpected from simple extrapolations. After hassium (element 108), chemistry has now reached copernicium (element 112) and flerovium (element 114). For the later ones, the focus is on questions of their metallic or possibly noble gas-like character originating from interplay of most pronounced relativistic effects and electron-shell effects. SHEs provide unique opportunities to get insights into the influence of strong relativistic effects on the atomic electrons and to probe 'relativistically' influenced chemical properties and the architecture of the periodic table at its farthest reach. In addition, they establish a test bench to challenge the validity and predictive power of modern fully relativistic quantum chemical models. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  3. 32 CFR 268.9 - Discussion of terms. (United States)


    ... arrearages of principal and interest. They shall be computed at the reporting rate prescribed by Treasury... principal payments or interest on short-term and long-term loans and credits. (b) Arrearage delinquency... or convention between sovereign states. (d) Dollar equivalents of foreign currency. Represents dollar...

  4. 12 CFR 268.501 - Remedies and relief. (United States)


    ... types of discrimination found will not recur; (2) Commitment that corrective, curative or preventive... where sovereign immunity has been waived. The individual shall be deemed to have performed service for... sovereign immunity has been waived. The back pay liability under title VII or the Rehabilitation Act is...

  5. 24 CFR 213.268 - Final insurance endorsement. (United States)


    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Final insurance endorsement. 213... insurance endorsement. When all advances of mortgage or loan proceeds have been made and all the terms and... indicate on the original credit instrument the total of all advances he has approved for insurance and...

  6. 49 CFR 268.11 - Project eligibility standards. (United States)


    ... to run the Corridor or the project—once built and paid for—as a completely self-sustaining entity, in... location of their critical habitat; identification of navigable waterways, wetlands and other sensitive...

  7. 49 CFR 268.17 - Project selection criteria. (United States)


    ... criteria will govern FRA's selection of projects to receive funding under the Maglev Deployment Program. (a... are to be expected in the United States. (4) The degree to which the project will augment a Maglev... development status of the Maglev technology selected by the applicant for the project. (c) Benefits for the...

  8. Effect Of Cognitive Stimulation On Hippocampal Ripples In Epileptic Patients

    Czech Academy of Sciences Publication Activity Database

    Brázdil, M.; Cimbálník, J.; Roman, R.; Stead, M.; Daniel, P.; Halámek, Josef; Jurák, Pavel


    Roč. 54, S3 (2013), s. 268-268 ISSN 0013-9580. [International Epilepsy Congress /30./. 23.06.2013-27.06.2013, Montreal] Institutional support: RVO:68081731 Keywords : Cognitive Stimulation * Epileptic Patients Subject RIV: FH - Neurology

  9. Chemical behaviour of a few atoms of rutherfordium (Rf, Z= 104) and of dubnium (Db, Z= 105) produced at Orsay

    International Nuclear Information System (INIS)

    Trubert, D.; Hussonnois, M.; Le Naour, C.; Brillard, L.; Monroy Guzman, F.; Le Du, J.F.; Servajean, V.


    The isotopes 261 Rf and 262 Db were produced by irradiation of a 248 Cm target with respectively 18 O and 19 F ions, at the MP Tandem accelerator of Orsay (France). These isotopes were isolated in HF medium, using he RACHEL setup. Moreover, the radioisotope 262 DB was produced by a nuclear reaction. (authors)

  10. Matthew Crabbe, Myth-Busting China's Numbers: Understandig and Using China's Statistics

    DEFF Research Database (Denmark)

    Grünberg, Nis


    Book review of: Matthew Crabbe: Myth-Busting China's Numbers: Understandig and Using China's Statistics. Houndmills, Basingstoke: Palgrave Macmillan, 2014. 268 pp.......Book review of: Matthew Crabbe: Myth-Busting China's Numbers: Understandig and Using China's Statistics. Houndmills, Basingstoke: Palgrave Macmillan, 2014. 268 pp....

  11. AcEST: BP912129 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000015_D11 268 Adiantum capillus-veneris mRNA. clone: YMU001_000015_D11. BP91212...9 CL691Contig1 Show BP912129 Clone id YMU001_000015_D11 Library YMU01 Length 268 Definition Adiantum cap...illus-veneris mRNA. clone: YMU001_000015_D11. Accession BP912129 Tissue type prothallium Developmental stage...tabase search programs, Nucleic Acids Res. 25:3389-3402. Query= BP912129|Adiantum capillus-veneris mRNA, YMU001_000015_D11. (268 letters) Database: uniprot_sprot.fasta 412,525 sequences; 148,809,765 total lett

  12. NMDA and dopamine D1 receptors within NAc-shell regulate IEG proteins expression in reward circuit during cocaine memory reconsolidation. (United States)

    Li, Y; Ge, S; Li, N; Chen, L; Zhang, S; Wang, J; Wu, H; Wang, X; Wang, X


    Reactivation of consolidated memory initiates a memory reconsolidation process, during which the reactivated memory is susceptible to strengthening, weakening or updating. Therefore, effective interference with the memory reconsolidation process is expected to be an important treatment for drug addiction. The nucleus accumbens (NAc) has been well recognized as a pathway component that can prevent drug relapse, although the mechanism underlying this function is poorly understood. We aimed to clarify the regulatory role of the NAc in the cocaine memory reconsolidation process, by examining the effect of applying different pharmacological interventions to the NAc on Zif 268 and Fos B expression in the entire reward circuit after cocaine memory reactivation. Through the cocaine-induced conditioned place preference (CPP) model, immunohistochemical and immunofluorescence staining for Zif 268 and Fos B were used to explore the functional activated brain nuclei after cocaine memory reactivation. Our results showed that the expression of Zif 268 and Fos B was commonly increased in the medial prefrontal cortex (mPFC), the infralimbic cortex (IL), the NAc-core, the NAc-shell, the hippocampus (CA1, CA2, and CA3 subregions), the amygdala, the ventral tegmental area (VTA), and the supramammillary nucleus (SuM) following memory reconsolidation, and Zif 268/Fos B co-expression was commonly observed (for Zif 268: 51-68%; for Fos B: 52-66%). Further, bilateral NAc-shell infusion of MK 801 and SCH 23390, but not raclopride or propranolol, prior to addictive memory reconsolidation, decreased Zif 268 and Fos B expression in the entire reward circuit, except for the amygdala, and effectively disturbed subsequent CPP-related behavior. In summary, N-methyl-d-aspartate (NMDA) and dopamine D1 receptors, but not dopamine D2 or β adrenergic receptors, within the NAc-shell, may regulate Zif 268 and Fos B expression in most brain nuclei of the reward circuit after cocaine memory reactivation

  13. Ammonothermal synthesis of alkali-alkaline earth metal and alkali-rare earth metal carbodiimides. K{sub 5-x}M{sub x}(CN{sub 2}){sub 2+x}(HCN{sub 2}){sub 1-x} (M = Sr, Eu) and Na{sub 4.32}Sr{sub 0.68}(CN{sub 2}){sub 2.68}(HCN{sub 2}){sub 0.32}

    Energy Technology Data Exchange (ETDEWEB)

    Mallmann, Mathias; Haeusler, Jonas; Cordes, Niklas; Schnick, Wolfgang [Department of Chemistry, University of Munich (LMU) (Germany)


    Alkali-alkaline earth metal and alkali-rare earth metal carbodiimides, namely K{sub 5-x}M{sub x}(CN{sub 2}){sub 2+x}(HCN{sub 2}){sub 1-x} (x = 0 - 1) (M = Sr, Eu) and Na{sub 4.32}Sr{sub 0.68}(CN{sub 2}){sub 2.68}(HCN{sub 2}){sub 0.32}, were synthesized under ammonothermal conditions in high-pressure autoclaves. The structures of the three compounds can be derived from homeotypic K{sub 5}H(CN{sub 2}){sub 3} and Na{sub 5}H(CN{sub 2}){sub 3} by partial substitution of K{sup +} or Na{sup +}by Sr{sup 2+} or Eu{sup 2+}. The reactions were carried out in two step syntheses (T{sub 1} = 673 K, T{sub 2} = 823 K) starting from sodium or potassium azide, dicyandiamide and strontium or Eu(NH{sub 2}){sub 2}, respectively. The crystal structures were solved and refined from single-crystal X-ray diffraction data [K{sub 4.16}Sr{sub 0.84}(CN{sub 2}){sub 2.84}(HCN{sub 2}){sub 0.16}: space group Im3m (no. 229), a = 7.8304(5) Aa, Z = 2, R{sub 1} = 0.024, wR{sub 2} = 0.052; K{sub 4.40}Eu{sub 0.60}(CN{sub 2}){sub 2.60}(HCN{sub 2}){sub 0.40}: space group Im anti 3m (no. 229), a = 7.8502(6) Aa, Z = 2, R{sub 1} = 0.022, wR{sub 2} = 0.049]. In contrast to the potassium carbodiimides, the sodium-strontium carbodiimide was only synthesized as microcrystalline powder. The crystal structure was determined by powder X-ray diffraction and refined by the Rietveld method [Na{sub 4.32}Sr{sub 0.68}(CN{sub 2}){sub 2.68}(HCN{sub 2}){sub 0.32}: space group Im3m (no. 229), a = 7.2412(1) Aa, Z = 2, R{sub wp} = 0.050]. The presence of hydrogencyanamide units ([HNCN]{sup -}) next to carbodiimide units ([CN{sub 2}]{sup 2-}) in all compounds was confirmed by FT-IR spectroscopy. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  14. Dicty_cDB: AFL268 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available dration Library Tortula ruralis cDNA, mRNA sequence. 78 4e-10 1 BM398179 |BM398179.... patens cDNA clone:pph30f12, 3' end,single read. 599 e-167 1 CN206669 |CN206669.1 Tor7097 Gametophyte rehy

  15. 40 CFR 268.40 - Applicability of treatment standards. (United States)


    ... treatment sludges, spent catalysts, and wastes listed in § 261.31 or § 261.32). All F024 wastes2-Chloro-1,3.../water/solids separation sludge—Any sludge generated from the gravitational separation of oil/water... refineries. Such sludges include, but are not limited to, those generated in: oil/water/solids separators...

  16. 77 FR 268 - Marine Mammals; File No. 16998 (United States)


    ... Mammals; File No. 16998 AGENCY: National Marine Fisheries Service (NMFS), National Oceanic and Atmospheric... permit is requested under the authority of the Marine Mammal Protection Act of 1972, as amended (MMPA; 16 U.S.C. 1361 et seq.), the regulations governing the taking and importing of marine mammals (50 CFR...

  17. 77 FR 268 - Marine Mammals; File No. 15682 (United States)


    ... Mammals; File No. 15682 AGENCY: National Marine Fisheries Service (NMFS), National Oceanic and Atmospheric... been issued under the authority of the Marine Mammal Protection Act of 1972, as amended (16 U.S.C. 1361 et seq.), the regulations governing the taking and importing of marine mammals (50 CFR [[Page 269...

  18. Translations on Narcotics and Dangerous Drugs No. 268 (United States)


    COSTA RICA INDICTMENT OF DRUG TRAFFICKERS San Jose LA NACION in Spanish 24 Aug 76 pp 10a, 11a PA [Text] Third Arraigning Judge Maria Luisa Castillo has...been distributing drugs in Las Lomas de Chapultepec . The prisoners will today be turned over to the Directorate General of Pre- Trial Investigations...Guerra, Mary Iraida Rengifo Castillo , Zaida Maria Porras de Marcano and Mercedes Teodora Perez Zambrano were arrested on 5 August. Ten jars containing

  19. President Ilves andis teenetemärgi 268 inimesele

    Index Scriptorium Estoniae


    Eesti Vabariigi 90. aastapäeva puhul riiklike autasudega tunnustatud isikute nimekiri. Vt. samas: Allar Viivik. Ärimees ja kirjanik on saanud kolm autasu. Kolm teenetemärki on saanud kirjanik ja riigitegelane Lehte Sööt (Hainsalu) ning ärimees Toomas Luman; Kadri Paas. Valgetähe orden purjutajast naaklejale. President Toomas Hendrik Ilves annab Valgetähe III klassi ordeni Indrek Tarandile kaasa aitamise eest Eesti liitumisele Euroopa Liidu ja NATOga; Teenetemärke on antud välja 5544. Eesti riiklikke teenetemärke jagab Vabariigi President 1995. aastast. Statistilised andmed eri aastatel antud teenetemärkide kohta. Vt. ka lk. 10 juhtkiri: Ärma ordenipuu. Autasustatute nimekiri ilmunud ka: Eesti Päevaleht 7. veebr. 2008, lk. 8-9, pealk.: Vabariigi president Toomas Hendrik Ilves jagab teenetemärke; Postimees 7. veebr. 2008, lk. 12-15, pealk.: Riiklike teenetemärkide saajad; Postimees : na russkom jazõke 7. veebr. 2008, lk. 2, 4-5 ; Maaleht 7. veebr. 2008, lk. 12-13, pealk.: Eesti tänab 2008; Linnaleht : Tallinn 7. veebr. 2008, lk. 4, pealk.: Eesti tänab; Eesti Päevaleht (Stockholm) 21. veebr. 2008, lk. 3, 11, pealk.: Selgusid 2008. aasta Eesti riiklikud autasud; Eesti Elu 22. veebr. 2008, lk. 12-13, pealk.: Riiklike autasude andmine

  20. Population dynamics of soil microbes and diversity of Bacillus ...

    African Journals Online (AJOL)



    Jan 25, 2010 ... Population dynamics of soil microbes and diversity of ... 25.78, 25.78, 86.26, 24.73, 68.0, 26.8 and 26.8 kDa proteins and equivalent to Cyt, Cry5 and Cry2 toxins ..... Molecular weight (kDa) of protein fractions of the BT isolates.

  1. Resonance – Journal of Science Education | News

    Indian Academy of Sciences (India)

    More Details Fulltext PDF. pp 257-258. Author Index · More Details Fulltext PDF. pp 259-264. Subject Index · More Details Fulltext PDF. pp 265-266. Index · More Details Fulltext PDF. pp 267-267 Flowering Trees. Prima Vera · More Details Fulltext PDF. pp 268-268 Featured Scientist. C. V. Raman · More Details Fulltext PDF ...

  2. 33 CFR 110.95 - Newport Bay Harbor, Calif. (United States)


    ... 268° from Lido Isle East Light 2, this line being the northwest line of the main fairway; west of the... of a line bearing 268° from Newport Bay Channel Light 11, this line being the south line of the main... Channel Light 11, this line being the southerly line of the main fairway. Note: This area is reserved for...

  3. Chinese Middle Classes: Taiwan, Hong Kong, Macao and China. Edited by Hsin-Huang Michael Hsiao

    DEFF Research Database (Denmark)

    Brødsgaard, Kjeld Erik


    Book review of: Chinese Middle Classes:Taiwan, Hong Kong, Macao and China. Edited by Hsin-Huang Michael Hsiao. Abingdon: Routledge, 2014. Pp. 268. ISBN 10: 1138120847; ISBN 13: 978-1138120846......Book review of: Chinese Middle Classes:Taiwan, Hong Kong, Macao and China. Edited by Hsin-Huang Michael Hsiao. Abingdon: Routledge, 2014. Pp. 268. ISBN 10: 1138120847; ISBN 13: 978-1138120846...

  4. Processing of metacaspase 2 from Trypanosoma brucei (TbMCA2) broadens its substrate specificity. (United States)

    Gilio, Joyce M; Marcondes, Marcelo F; Ferrari, Débora; Juliano, Maria A; Juliano, Luiz; Oliveira, Vitor; Machado, Maurício F M


    Metacaspases are members of the cysteine peptidase family and may be implicated in programmed cell death in plants and lower eukaryotes. These proteases exhibit calcium-dependent activity and specificity for arginine residues at P 1 . In contrast to caspases, they do not require processing or dimerization for activity. Indeed, unprocessed metacaspase-2 of Trypanosoma brucei (TbMCA2) is active; however, it has been shown that cleavages at Lys 55 and Lys 268 increase TbMCA2 hydrolytic activity on synthetic substrates. The processed TbMCA2 comprises 3 polypeptide chains that remain attached by non-covalent bonds. Replacement of Lys 55 and Lys 268 with Gly via site-directed mutagenesis results in non-processed but enzymatically active mutant, TbMCA2 K55/268G. To investigate the importance of this processing for the activity and specificity of TbMCA2, we performed activity assays comparing the non-processed mutant (TbMCA2 K55/268G) with the processed TbMCA2 form. Significant differences between TbMCA2 WT (processed form) and TbMCA2 K55/268G (non-processed form) were observed. Specifically, we verified that although non-processed TbMCA2 is active when assayed with small synthetic substrates, the TbMCA2 form does not exhibit hydrolytic activity on large substrates such as azocasein, while processed TbMCA2 is able to readily digest this protein. Such differences can be relevant for understanding the physiological regulation and function of TbMCA2. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Stability results for a soil model with singular hysteretic hydrology

    Czech Academy of Sciences Publication Activity Database

    Krejčí, Pavel; O'Kane, J.P.; Pokrovskii, A.; Rachinskii, D.


    Roč. 268, č. 1 (2011), 012016 ISSN 1742-6588. [5th International workshop on multi-rate processes and hysteresis. Pecs , 31.05.2010-03.06.2010] R&D Projects: GA ČR GAP201/10/2315 Institutional research plan: CEZ:AV0Z10190503 Keywords : hysteresis * evolution equation * stability Subject RIV: BA - General Mathematics

  6. 47 CFR 80.268 - Technical requirements for radiotelephone installation. (United States)


    ... a visual indication whenever the transmitter is supplying power to the antenna. (4) Have a two-tone... between masts or other supports subject to whipping, a safety link must be installed which under heavy stress will reduce breakage of the antenna, the halyards, or any other supporting elements. (d) The...

  7. 28 CFR 2.68 - Prisoners transferred pursuant to treaty. (United States)


    ... comparable punishment with a similarly-situated U.S. Code offender. The application of service credits under... Prisons, a condition that the transferee not commit another Federal, state or local crime, and a condition...

  8. All projects related to | Page 268 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Topic: AGRICULTURAL RESEARCH, AGRICULTURAL ENGINEERING, AGRICULTURAL PRODUCTION, ADAPTATION TO CHANGE. Region: Kenya, North of Sahara, South of Sahara. Program: Climate Change. Total Funding: CA$ 0.00. Quality, Reach, and Impact of Open Scholarly Publishing in Latin America. Project.

  9. Powdery Mildew Resistance in 268 Entries of Hordeum vulgare

    DEFF Research Database (Denmark)

    Jiang, W.M.; Jørgensen, Jørgen Helms; Torp, J


    A collection of 24 'Spontaneum' barley [H. vulgare ssp. spontaneum] entries and one comprising 244 Ethiopian barleys [H. vulgare ssp. vulgare] were tested for resistance to 4 powdery mildew [used by Erysiphe graminis f. sp. hordei] cultures that carried genes for virulence corresponding to most...

  10. 40 CFR 268.2 - Definitions applicable in this part. (United States)


    ... radioactive lead solids; process residuals such as smelter slag and residues from the treatment of waste... Standards, except fluoride, selenium, sulfides, vanadium, and zinc, which can reasonably be expected to be...

  11. 40 CFR 268.44 - Variance from a treatment standard. (United States)


    ... complete petition may be requested as needed to send to affected states and Regional Offices. (e) The... provide an opportunity for public comment. The final decision on a variance from a treatment standard will... than) the concentrations necessary to minimize short- and long-term threats to human health and the...

  12. 40 CFR 268.45 - Treatment standards for hazardous debris. (United States)


    ... contact after placement (leachate, other waste, microbes) None. 2. Microencapsulation: Stabilization of...). Reagents (e.g., iron salts, silicates, and clays) may be added to enhance the set/cure time and/or... surface, when viewed without magnification, shall be free of all visible contaminated soil and hazardous...

  13. 7 CFR 2.68 - Administrator, National Agricultural Statistics Service. (United States)


    ....S.C. 3318). (6) Enter cost-reimbursable agreements relating to agricultural research and statistical... promote and support the development of a viable and sustainable global agricultural system. Such work may... 7 Agriculture 1 2010-01-01 2010-01-01 false Administrator, National Agricultural Statistics...

  14. The in vivo phosphorylation sites in multiple isoforms of amphiphysin I from rat brain nerve terminals

    DEFF Research Database (Denmark)

    Craft, George E; Graham, Mark E; Bache, Nicolai


    : serines 250, 252, 262, 268, 272, 276, 285, 293, 496, 514, 539, and 626 and Thr-310. These were distributed into two clusters around the proline-rich domain and the C-terminal Src homology 3 domain. Hierarchical phosphorylation of Ser-262 preceded phosphorylation of Ser-268, -272, -276, and -285. Off......, incorporating 16 and 23% of the 32P. The multiple phosphopeptides containing Ser-268, Ser-276, Ser-272, and Ser-285 had 27% of the 32P. Evidence for a role for at least one proline-directed protein kinase and one non-proline-directed kinase was obtained. Four phosphosites predicted for non-proline...... that are either dynamically turning over or constitutively phosphorylated in nerve terminals and improve understanding of the role of individual amphI sites or phosphosite clusters in synaptic SVE....

  15. 40 CFR Appendix Xi to Part 268 - Metal Bearing Wastes Prohibited From Dilution in a Combustion Unit According to 40 CFR 268.3(c) (United States)


    ... sludges from electroplating operations except from the following processes: (1) sulfuric acid anodizing of aluminum; (2) tin plating carbon steel; (3) zinc plating (segregated basis) on carbon steel; (4) aluminum or zinc-plating on carbon steel; (5) cleaning/stripping associated with tin, zinc and aluminum...

  16. (Off-label drug use for children at community pharmacies in Yogyakarta, Indonesia

    Directory of Open Access Journals (Sweden)

    Ndaru Setyaningrum


    Full Text Available Population of children is at risk of getting off-label medication because of its particular condition. This study was conducted to find out how the prevalence of off-label drug use for children at community pharmacies in Yogyakarta. This was a retrospective, medical record-based study using the 2014-2015. The study subjects consisted of children under 12 years old. About 828 prescriptions were reviewed, 268 were included accord with completeness diagnose data in patients medical records. The accumulative of drug use among 268 prescriptions were 816 drugs use with 76 item drugs. We have identified 268 prescriptions, of those 268 prescriptions, we found off label drugs in 57 prescriptions (21%. identified, off-label use accounted for 57 prescriptions (21%. The prevalence of off-label use classified as off-label age accounted for 91 use (11.1%; off-label indications accounted for 7 use (0.8%; and did not find off-label category dosage, route of administration and contraindication. The three highest use off-label drugs respectively pseudoephedrine accounted for 47 (5.7%, tripolidine 20 (2.4%, and dextromethorphan 14 (1.7% of all drug use. Based on the results of this study, we found that the use of off-label drugs in children is quite high (21% so that supervision-related risks of drug use need to be done.

  17. Association of bacteria with marine invertebrates: Implications for ballast water management

    Digital Repository Service at National Institute of Oceanography (India)

    Khandeparker, L.; Anil, A.C.

    stream_size 36739 stream_content_type text/plain stream_name EcoHealth_10_268a.pdf.txt stream_source_info EcoHealth_10_268a.pdf.txt Content-Encoding UTF-8 Content-Type text/plain; charset=UTF-8 1 Author version: EcoHealth... transportation, can have direct impact on society and human health. Ship’s ballast tanks hold different non-indigenous vertebrates, invertebrates, plants, microscopic algae, bacteria etc. (Williams et al. 1988; Carlton and Geller 1993; Smith et al. 1996...

  18. 12 CFR 268.102 - Board program for equal employment opportunity. (United States)


    ... Commission's Management Directives; (3) Conduct a continuing campaign to eradicate every form of prejudice or... candidates without regard to race, color, religion, sex, national origin, age or disability, and solicit... when those accommodations can be made without undue hardship on the business of the Board; (8) Make...

  19. 40 CFR 268.42 - Treatment standards expressed as specified technologies. (United States)


    ... such as copper, zinc, nickel, gold, and sulfur that result in a nonliquid, semi-solid amalgam and..., hydroxides, carbonates, sulfides, sulfates, chlorides, flourides, or phosphates. The following reagents (or... hydroxides of calcium and/or magnesium; (2) caustic (i.e., sodium and/or potassium hydroxides; (3) soda ash...

  20. People and things. CERN Courier, Oct 1986, v. 26(8)

    Energy Technology Data Exchange (ETDEWEB)



    The article reports on achievements of various people, staff changes and position opportunities within the CERN organization and contains news updates on upcoming or past events. Already acknowledged as the world's most versatile system of particle accelerators, CERN's complex of big machines put on a spectacular performance after the short summer shutdown. On 3 September, the new LEP Injection Linac (LIL) was put through its paces and the ejection line tested in readiness for the next step. The 1986 Dirac Medals of the International Centre for Theoretical Physics, Trieste, Italy, have been awarded to Ybichiro Nambu and Alexander Polyakov for their important contributions to mathematical physics.

  1. People and things. CERN Courier, Oct 1986, v. 26(8)

    International Nuclear Information System (INIS)



    The article reports on achievements of various people, staff changes and position opportunities within the CERN organization and contains news updates on upcoming or past events. Already acknowledged as the world's most versatile system of particle accelerators, CERN's complex of big machines put on a spectacular performance after the short summer shutdown. On 3 September, the new LEP Injection Linac (LIL) was put through its paces and the ejection line tested in readiness for the next step. The 1986 Dirac Medals of the International Centre for Theoretical Physics, Trieste, Italy, have been awarded to Ybichiro Nambu and Alexander Polyakov for their important contributions to mathematical physics

  2. IAEA Newsbriefs. V. 10, no. 2(68). Jun-Jul 1995

    International Nuclear Information System (INIS)


    This issue gives brief information on the following topics: IAEA General Conference opens in September in Vienna, IAEA Board of Governors' June meetings (Safeguards proposals, Technical cooperation, Radiation safety, Radioactive waste management, Liability for nuclear damage, IAEA regular budget for 1996), NPT Conference reaffirms support for IAEA roles, Director General addresses NPT Conference, Seminar on nuclear waste management in Russian Federation, Safety Reviews of Medzamor in Armenia, Update on Nuclear Safety Convention, Cuba and Brazil: Public information seminars, India: Donation to the IAEA Laboratories, Simulated emergency tests global procedures, INIS: Happy Anniversary, China hosts international isotope conference, Nuclear power: Status and outlook, and other short information

  3. Feto-maternal haemorrhage associated with genetic amniocentesis

    DEFF Research Database (Denmark)

    Tabor, A; Bang, J; Nørgaard-Pedersen, B


    Maternal serum alpha-fetoprotein (AFP) levels were determined before and after genetic amniocentesis (n = 283) or ultrasound scan (n = 268) in a group of women participating in a randomized trial of genetic amniocentesis. Increases in AFP levels were seen significantly more often after amniocente......Maternal serum alpha-fetoprotein (AFP) levels were determined before and after genetic amniocentesis (n = 283) or ultrasound scan (n = 268) in a group of women participating in a randomized trial of genetic amniocentesis. Increases in AFP levels were seen significantly more often after...

  4. The Constitutional Court of the Republic of Estonia : 3-4-1-10-2000 (22 Dec 2000) : review of the petition of Administrative Law Chamber of the Supreme Court to declare clause 17 of the Procedure for Privatisation of Land by Auction partly unconstitu

    Index Scriptorium Estoniae


    Riigikohtu lahendi 3-4-1-10-00 (Riigikohtu halduskolleegiumi taotlus tunnistada, et Vabariigi Valitsuse 06. 11. 96. a. määrusega nr. 268 kinnitatud "Maa enampakkumisega erastamise korra" p. 17 lg 2 alapunkt 2 see osa, mis sätestas maa enampakkumisel osalejale 1000-kroonise osavõtutasu maksmise kohustuse (kuni 08. 03. 2000), oli põhiseadusevastane ning tunnistada Vabariigi Valitsuse 06. 11. 96. a. määrusega nr. 268 kinnitatud "Maa enampakkumisega erastamise korra" p. 49 esimene lause kehtetuks) tekst inglise keeles

  5. Prenatal Exposure to Carbon Black (Printex 90)

    DEFF Research Database (Denmark)

    Jackson, Petra; Vogel, Ulla; Wallin, Håkan


    Maternal pulmonary exposure to ultrafine particles during pregnancy may affect the health of the child. Developmental toxicity of carbon black (Printex 90) nanoparticles was evaluated in a mouse model. Time-mated mice were intratracheally instilled with Printex 90 dispersed in Millipore water on ...... on gestation days (GD) 7, 10, 15 and 18, with total doses of 11, 54 and 268 mu g Printex 90/animal. The female offspring prenatally exposed to 268 mu g Printex 90/animal displayed altered habituation pattern during the Open field test....

  6. A Study of Selected Isozymes in Capsicum baccatum, Capsicum eximium, Capsicum cardenasii and Two Interspecific F1 Hybrids in Capsicum Species


    ONUS, Ahmet Naci


    Selected isozymes were investigated in plants of Capsicum baccatum L. ( Solanaceae) accessions SA219 (P.G.Smith), Hawkes 6489 (P.G.Smith), Capsicum cardenasii Heiser and Smith accession SA268 (P.G.Smith), Capsicum eximium A.T.Hunz accession Hawkes 3860 (J.G.Hawkes) and two interspecific F1 hybrids, C. baccatum SA219 x C. eximium Hawkes 3860 and C. baccatum Hawkes 6489 x C. cardenasii SA 268. The standard technique of horizontal gel electrophoresis was employed. The gel was cut into severa...

  7. Crystallization and preliminary X-ray analysis of pyruvate kinase from Bacillus stearothermophilus

    International Nuclear Information System (INIS)

    Suzuki, Kenichiro; Ito, Sohei; Shimizu-Ibuka, Akiko; Sakai, Hiroshi


    This report describes the crystallization and X-ray diffraction data collection of three types (wild-type, W416F/V435W and C9S/C268S) of B. stearothermophilus. Crystals of C9S/C268S belonged to space group P6 2 22 and diffracted to a resolution of 2.4 Å. Pyruvate kinase (PK) from a moderate thermophile, Bacillus stearothermophilus (BstPK), is an allosteric enzyme activated by AMP and ribose 5-phosphate but not by fructose 1,6-bisphosphate (FBP). However, almost all other PKs are activated by FBP. The wild-type and W416F/V435W mutant BstPKs were crystallized by the hanging-drop vapour-diffusion method. However, they were unsuitable for structural analysis because their data sets exhibited low completeness. A crystal suitable for structural analysis was obtained using C9S/C268S enzyme. The crystal belonged to space group P6 2 22, with unit-cell parameters a = b = 145.97, c = 118.03 Å

  8. ORF Alignment: NC_004547 [GENIUS II[Archive

    Lifescience Database Archive (English)


  9. 12 CFR 268.103 - Complaints of discrimination covered by this part. (United States)


    ... disability), or the Equal Pay Act (sex-based wage discrimination) shall be processed in accordance with this... for employment. (c) This part does not apply to Equal Pay Act complaints of employees whose services... OF THE FEDERAL RESERVE SYSTEM RULES REGARDING EQUAL OPPORTUNITY Board Program To Promote Equal...

  10. : tous les projets | Page 268 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Sujet: TOBACCO INDUSTRY, SMOKING, CROP DIVERSIFICATION, INCOME GENERATION. Région: India, Central Asia, Far East Asia, South Asia. Programme: Alimentation, environnement et santé. Financement total : CA$ 200,500.00. Solutions de remplacement à la culture du tabac et aux activités connexes (Inde).

  11. Standardized UXO Technology Demonstration Site Blind Grid Scoring Record No. 268

    National Research Council Canada - National Science Library

    Overbay, Larry, Jr; Fling, Rick; McClung, Christina; Robitaille, George


    ...) utilizing the APG Standardized UXO Technology Demonstration Site Blind Grid. The scoring record was coordinated by Larry Overbay and by the Standardized UXO Technology Demonstration Site Scoring Committee...

  12. ORF Alignment: NC_003070 [GENIUS II[Archive

    Lifescience Database Archive (English)


  13. [Analysis of structural characteristics of alpha-tubulins in plants with enhanced cold tolerance]. (United States)

    Nyporko, A Iu; Demchuk, O N; Blium, Ia B


    The uniqueness of the point substitutions in the sequences of two alpha-tubulin isotypes from psychrophilic alga Chloromonas that can determine the increased cold tolerance of this alga was analyzed. The comparison of all known amino acid sequences of plant alpha-tubulins enabled to ascertain that only M268-->V replacement is unique and may have a significant influence on spatial structure of plant alpha-tubulins. Modeling of molecular surfaces of alpha-tubulins from Chloromonas, Chalmydomonas reinhardtii and goose grass Eleusine indica showed that insertion of the amino acid replacement M268-->V into the sequence of goose grace tubulin led to the likening of this protein surface to the surface of native alpha-tubulin from Chloromonas. Alteration of local hydrophobic properties of alpha-tubulin molecular surface in interdimeric contact zone as a result of the mentioned replacement was shown that may play important role in increasing the level of cold resistance of microtubules. The crucial role of amino acid residue in 268 position for forming the interdimeric contact surface of alpha-tubulin molecule was revealed. The assumption is made about the importance of replacements at this position for plant tolerance to abiotic factors of different nature (cold, herbicides).

  14. Energy transfer mechanism in CsI:Eu crystal

    International Nuclear Information System (INIS)

    Yakovlev, V.; Trefilova, L.; Karnaukhova, A.; Ovcharenko, N.


    This paper studies the scintillation process in CsI:Eu crystal exposed to the pulse electron irradiation (E=0.25 MeV, t 1/2 =15 ns and W=0.003 J/cm 2 ). It has been proved that the energy transfer from the lattice to Eu 2+ ions in CsI:Eu occurs through the re-absorption of STE emission. The proposed model rests on the following experimental facts: (1) the activator emission at 2.68 eV rises gradually after the decay of the excitation pulse even at temperature lower than 90 K when V k centers are immobile; (2) the rise time of 2.68 eV emission and the decay time of STE emission have the same temperature dependences at T=78–300 K; (3) the excitation spectrum of 2.68 eV emission overlaps the emission spectrum of STE. -- Highlights: • The scintillation process in CsI:Eu was studied under pulsed electron irradiation. • A model of the energy transfer from the lattice to Eu 2+ ions in CsI:Eu was proposed. • Eu 2+ ions in CsI:Eu reabsorb the π-emission of self-trapped excitons

  15. AcEST: DK956834 [AcEST

    Lifescience Database Archive (English)

    Full Text Available urotrypsin OS=Saguinus labiatus GN=PRSS12... 35 0.31 sp|Q5G268|NETR_HYLLE Neurotr...Y Neurotrypsin OS=Pongo pygmaeus GN=PRSS12 PE... 32 3.5 sp|O13817|SEC7C_SCHPO Protein transport protein sec7...3 OS=Schizos... 31 4.5 sp|Q5G267|NETR_MACMU Neurotrypsin OS=Macaca mulatta GN=PRSS12...HUMAN Forkhead box protein J3 OS=Homo sapiens GN... 30 7.7 >sp|Q5G265|NETR_SAGLB Neurotrypsin OS=Saguinus labiatus GN=PRSS12...YPHYLPTEQRHRRTRPPPPLPRFPRPPRALPALRPHALQAGHTP 86 >sp|Q5G268|NETR_HYLLE Neurotrypsin OS=Hylobates leucogenys GN=PRSS12

  16. ORF Alignment: NC_006582 [GENIUS II[Archive

    Lifescience Database Archive (English)


  17. Yield and gross income of arracacha in monocrop and intercropping with the Japanese bunching onion and parsley Produção e renda bruta de mandioquinha-salsa em cultivo solteiro e consorciado com cebolinha e salsa

    Directory of Open Access Journals (Sweden)

    Néstor Antonio Heredia Zárate


    Full Text Available The objective of this work was to study the yield performance and to determine the gross income of arracacha (Arracacia xanthorrhiza Bancroft, cultivar Amarela de Carandaí, grown in monoculture as well as in intercropping with the Japanese bunching onion (Allium fistulosum L., cultivar Todo Ano (A-JBO and parsley (Petroselinum crispum (Mill., cultivar Lisa Preferida (A-P. Arracacha and the Japanese bunching onion were vegetatively propagated, while parsley was propagated by seeds. The Japanese bunching onion was first harvested 87 days after the planting (DAP, with resprouts harvested 154 and 212 DAP. Parsley was first harvested 105 days after the sowing (DAS, and, resprouts, 171, 212, and 268 DAS. Arracacha was harvested 268 DAP. At the harvest carried out 212 DAP, the Japanese bunching onion plants in monocrop significantly exceeded those in intercropping in 1.73 cm height and 0.99 t ha-1 commercial fresh mass (CFM. In parsley, the CFM yield in monocrop significantly exceeded the intercropping figures in 0.63, 0.66, and 0.72 t ha-1 at harvests carried out respectively 171, 212, and 268 DAS. Plant height and CFM of the Japanese bunching onion and parsley increased after every new harvest, except in parsley, for plant height 171 DAS and CFM 268 DAS. No significant differences were found in any of the evaluated characteristics when arracacha as single crop was compared to the A-JBO intercropping arrangement. Nevertheless, the A-P intercropping arrangement significantly reduced all characteristics in relation to the other systems, except for yield of non-commercial arracacha roots. A-JBO intercropping arrangement was viable (LER = 1.49 and therefore may be employed by farmers. A-P intercropping, on its turn, was unfeasible (LER = 0.97.Este trabalho teve como objetivo estudar o desempenho produtivo e determinar a renda bruta obtida a partir do cultivo da mandioquinha-salsa (Arracacia xanthorrhiza Bancroft, cultivar Amarela de Carandaí, em

  18. [Neurons in NAc core and BLA are activated during cocaine context-associated reward memory retrieval in mice]. (United States)

    Wang, Jun-Jun; Yao, Wen-Qing; Chen, Yue-Jun; Ma, Lan; Tao, Ye-Zheng


    The intense associative memories that develop between cocaine-paired contexts and rewarding stimuli make addiction hard to cure by contributing to cocaine seeking and relapse. So it's of great importance to examine the neurobiological basis of addiction memory. Cocaine conditioned place preference (CPP) used in this study is a form of Pavlovian conditioning which can establish associations between drug and contextual factors. c-Fos and Zif268 are commonly used immediate early gene (IEG) makers to identify neurons that are activated after a stimulus or behavioral conditioning. This study was designed to reveal neuronal c-Fos, Zif268 expression pattern in 10 brain regions following cocaine context-associated reward memory retrieval in mice, combining animal behavioral study and immunofluorescence method. C57BL/6 mice were randomly divided into 3 groups: Saline retrieval, Cocaine retrieval, and No retrieval of cocaine groups. Cocaine retrieval and No retrieval of cocaine underwent CPP training (one side paired with cocaine, and the other side with saline) except that No retrieval of cocaine group didn't undergo CPP test. Saline retrieval group received saline injections (i.p) on both sides. The results showed that: Neuronal c-Fos, Zif268 protein expression levels in nucleus accumbens (NAc) core both were elevated in Cocaine retrieval group compared with those in Saline retrieval (Control) group during cocaine context-associated reward memory retrieval. Zif268 protein expression level in basolateral amygdala (BLA) was also elevated in Cocaine retrieval group compared with that in control mice. Elevation was not seen in other regions such as hippocampus, prefrontal cortex (PFC). Thus, NAc core and BLA were activated during cocaine context-associated reward memory retrieval. The results suggest that neurons that are activated in NAc core and BLA are crucial basis of cocaine context-associated reward memory.

  19. Retrospective Analysis of Bacterial Cultures Sampled in German Chicken-Fattening Farms During the Years 2011–2012 Revealed Additional VIM-1 Carbapenemase-Producing Escherichia coli and a Serologically Rough Salmonella enterica Serovar Infantis

    Directory of Open Access Journals (Sweden)

    Nicole Roschanski


    Full Text Available Carbapenems are last-resort antibiotics used in human medicine. The increased detection of carbapenem-resistant Enterobacteriaceae (CRE is therefore worrying. In 2011 we reported the first livestock-associated VIM-1-producing Salmonella (S. enterica serovar Infantis (R3 isolate from dust, sampled in a German chicken fattening farm. Due to this observation we retrospectively investigated more than 536 stored bacterial cultures, isolated from 45 chicken fattening farms during the years 2011 and 2012. After a non-selective overnight incubation, the bacteria were transferred to selective media. Escherichia (E. coli and Salmonella growing on these media were further investigated, including antibiotic susceptibility testing, carbapenemase gene screening and whole genome sequencing (WGS. In total, four CRE were found in three out of 45 investigated farms: Besides R3, one additional Salmonella (G-336-1a as well as two E. coli isolates (G-336-2, G-268-2. All but G-268-2 harbored the blaVIM-1 gene. Salmonella isolates R3 and G-336-1 were closely related although derived from two different farms. All three blaVIM-1-encoding isolates possessed identical plasmids and the blaVIM-1- containing transposon showed mobility at least in vitro. In isolate G-268-2, the AmpC beta-lactamase gene blaCMY-2 but no known carbapenemase gene was identified. However, a transfer of the phenotypic resistance was possible. Furthermore, G-268-2 contained the mcr-1 gene, combining phenotypical carbapenem- as well as colistin resistance in one isolate. Carbapenem-resistant Enterobacteriaceae have been found in three out of 45 investigated chicken flocks. This finding is alarming and emphasizes the importance of intervention strategies to contain the environmental spread of resistant bacteria in animals and humans.

  20. Retrospective Analysis of Bacterial Cultures Sampled in German Chicken-Fattening Farms During the Years 2011–2012 Revealed Additional VIM-1 Carbapenemase-Producing Escherichia coli and a Serologically Rough Salmonella enterica Serovar Infantis (United States)

    Roschanski, Nicole; Fischer, Jennie; Falgenhauer, Linda; Pietsch, Michael; Guenther, Sebastian; Kreienbrock, Lothar; Chakraborty, Trinad; Pfeifer, Yvonne; Guerra, Beatriz; Roesler, Uwe H.


    Carbapenems are last-resort antibiotics used in human medicine. The increased detection of carbapenem-resistant Enterobacteriaceae (CRE) is therefore worrying. In 2011 we reported the first livestock-associated VIM-1-producing Salmonella (S.) enterica serovar Infantis (R3) isolate from dust, sampled in a German chicken fattening farm. Due to this observation we retrospectively investigated more than 536 stored bacterial cultures, isolated from 45 chicken fattening farms during the years 2011 and 2012. After a non-selective overnight incubation, the bacteria were transferred to selective media. Escherichia (E.) coli and Salmonella growing on these media were further investigated, including antibiotic susceptibility testing, carbapenemase gene screening and whole genome sequencing (WGS). In total, four CRE were found in three out of 45 investigated farms: Besides R3, one additional Salmonella (G-336-1a) as well as two E. coli isolates (G-336-2, G-268-2). All but G-268-2 harbored the blaVIM-1 gene. Salmonella isolates R3 and G-336-1 were closely related although derived from two different farms. All three blaVIM-1-encoding isolates possessed identical plasmids and the blaVIM-1- containing transposon showed mobility at least in vitro. In isolate G-268-2, the AmpC beta-lactamase gene blaCMY-2 but no known carbapenemase gene was identified. However, a transfer of the phenotypic resistance was possible. Furthermore, G-268-2 contained the mcr-1 gene, combining phenotypical carbapenem- as well as colistin resistance in one isolate. Carbapenem-resistant Enterobacteriaceae have been found in three out of 45 investigated chicken flocks. This finding is alarming and emphasizes the importance of intervention strategies to contain the environmental spread of resistant bacteria in animals and humans. PMID:29636734

  1. Retrospective Analysis of Bacterial Cultures Sampled in German Chicken-Fattening Farms During the Years 2011-2012 Revealed Additional VIM-1 Carbapenemase-Producing Escherichia coli and a Serologically Rough Salmonella enterica Serovar Infantis. (United States)

    Roschanski, Nicole; Fischer, Jennie; Falgenhauer, Linda; Pietsch, Michael; Guenther, Sebastian; Kreienbrock, Lothar; Chakraborty, Trinad; Pfeifer, Yvonne; Guerra, Beatriz; Roesler, Uwe H


    Carbapenems are last-resort antibiotics used in human medicine. The increased detection of carbapenem-resistant Enterobacteriaceae (CRE) is therefore worrying. In 2011 we reported the first livestock-associated VIM-1-producing Salmonella ( S .) enterica serovar Infantis (R3) isolate from dust, sampled in a German chicken fattening farm. Due to this observation we retrospectively investigated more than 536 stored bacterial cultures, isolated from 45 chicken fattening farms during the years 2011 and 2012. After a non-selective overnight incubation, the bacteria were transferred to selective media. Escherichia (E.) coli and Salmonella growing on these media were further investigated, including antibiotic susceptibility testing, carbapenemase gene screening and whole genome sequencing (WGS). In total, four CRE were found in three out of 45 investigated farms: Besides R3, one additional Salmonella (G-336-1a) as well as two E. coli isolates (G-336-2, G-268-2). All but G-268-2 harbored the bla VIM-1 gene. Salmonella isolates R3 and G-336-1 were closely related although derived from two different farms. All three bla VIM-1 -encoding isolates possessed identical plasmids and the bla VIM-1- containing transposon showed mobility at least in vitro . In isolate G-268-2, the AmpC beta-lactamase gene bla CMY-2 but no known carbapenemase gene was identified. However, a transfer of the phenotypic resistance was possible. Furthermore, G-268-2 contained the mcr-1 gene, combining phenotypical carbapenem- as well as colistin resistance in one isolate. Carbapenem-resistant Enterobacteriaceae have been found in three out of 45 investigated chicken flocks. This finding is alarming and emphasizes the importance of intervention strategies to contain the environmental spread of resistant bacteria in animals and humans.

  2. An overview of financial sources being utilized to support Zika Virus published research. (United States)

    Goodridge, Keisha; Reveiz, Ludovic; Elias, Vanessa


    Since its initial detection in Brazil in 2015, Zika Virus (ZIKV) has spread rapidly throughout most of the Caribbean and South, Central and North America. An upsurge in congenital syndrome associated with ZIKV and Guillain-Barre Syndrome (GBS) has been associated with the increase in ZIKV. This amplification in numbers led to the need for funded research initiatives focusing on various countries globally and on specific experimental types. To determine the financial institutions involved in the production of primary research into the ZIKV epidemic. This research also intends to draw attention to the investigative areas that are dominating, experimental types being conducted and the geographical areas that are producing the bulk of the research utilizing available funds. A cross sectional search of published primary research was conducted using Pan American Health Organization (PAHO) Zika platform and PubMed between January 2007 and October 2016. Titles, abstract and full articles were assed and one researcher extracted data. Information was crossed checked by a second researcher to ensure accuracy. 268 articles were included and investigations occurred across 48 countries with Brazil and USA dominating the research. Applied Research and Laboratory based studies were most frequently utilized. 38.1% of articles did not report financial sources. Public institutions were the major known contributors. Other financiers included private, non-profits and mixed funders exclusive of public sources. 156 individual financial bodies assisted with National Institute of Health being most frequently mentioned followed by The National Council for Scientific and Technological Development (CNPq) and the Institut Pasteur. Virus, vectors and reservoirs was most frequently used (99/268, 36.9%) followed by clinical management (70/268, 26.1%) and epidemiology (46/268, 17.2%). The evidence suggests international efforts to fund ZIKV research and a need to foster collaborative and

  3. PCB i bygninger - afhjælpning, renovering og nedrivning

    DEFF Research Database (Denmark)

    Andersen, Helle Vibeke

    SBi-anvisning 268 beskriver, hvordan PCB-forurening af indeluften afhjælpes, og hvordan PCB håndteres, når man renoverer eller nedriver bygninger med PCB. Uanset om der er tale om afhjælpning, renovering eller nedrivning, kan arbejdet generere PCB-holdigt affald. Anvisningen forklarer derfor......, hvordan affaldet skal håndteres, og hvordan man beskytter mennesker og miljø under arbejdet. Anvisningen er baseret på byggebranchens erfaringer og den aktuelle forskningsbaserede viden om PCB i bygninger. SBi-anvisning 268 afløser den snart fire år gamle SBi-anvisning 242 om renovering af bygninger med...... PCB, som ikke behandlede spørgsmålet om affaldshåndtering....

  4. 75 FR 29219 - Proposed Flood Elevation Determinations (United States)


    ... County. approximately 268 feet upstream of Robbin Lane. * National Geodetic Vertical Datum. + North... Judge, 516 Fairway Drive, Brandenburg, KY 40108. Scott County, Kentucky, and Incorporated Areas Dry Run...

  5. The undefined function differs from the pointwise undefined function


    Dosch, Walter (Prof.)


    The undefined function differs from the pointwise undefined function. - In: Joint Conference on Declarative Programming : Proceedings / Maria I. Sessa ... (eds.). - Salerno : Univ. degli Studi, 1995. - S. 257-268

  6. Tanel Toom sai UNICA'l pronksi

    Index Scriptorium Estoniae


    66. ülemaailmsel mitteprofessionaalsete filmitegijate festivalil (World Festival of Non-professional Film Makers) Saksamaal Veitshöchheimis sai TPÜ III kursuse tudeng Tanel Toom oma filmiga "2.68" pronksmedali

  7. Crystallization and preliminary diffraction studies of CBM3b of cellobiohydrolase 9A from Clostridium thermocellum

    Energy Technology Data Exchange (ETDEWEB)

    Jindou, Sadanari [Department of Molecular Microbiology and Biotechnology, Tel Aviv University 69978 (Israel); Petkun, Svetlana [Department of Molecular Microbiology and Biotechnology, Tel Aviv University 69978 (Israel); The Daniella Rich Institute for Structural Biology, Tel Aviv University 69978 (Israel); Shimon, Linda [Department of Chemical Research Support, The Weizmann Institute of Science, Rehovot 76100 (Israel); Bayer, Edward A. [Department of Biological Chemistry, The Weizmann Institute of Science, Rehovot 76100 (Israel); Lamed, Raphael; Frolow, Felix, E-mail: [Department of Molecular Microbiology and Biotechnology, Tel Aviv University 69978 (Israel); The Daniella Rich Institute for Structural Biology, Tel Aviv University 69978 (Israel)


    The cloning, expression, purification and crystallization of the CBM3b module of cellobiohydrolase 9A from C. thermocellum is described. The crystals diffract to 2.68 Å. Family 3 carbohydrate-binding modules (CBM3s) are associated with the scaffoldin subunit of the multi-enzyme cellulosome complex and with the family 9 glycoside hydrolases, which are multimodular enzymes that act on plant cell-wall polysaccharides, notably cellulose. Here, the crystallization of CBM3b from cellobiohydrolase 9A is reported. The crystals are tetragonal and belong to space group P4{sub 1} or P4{sub 3}. X-ray diffraction data for CBM3b have been collected to 2.68 Å resolution on beamline ID14-4 at the ESRF.

  8. Pressure-induced phase transition in C sub 6 O sub 2 I sub 4

    CERN Document Server

    Nakayama, A; Takemura, K; Aoki, K; Carlon, R P


    Powder x-ray diffraction measurements on iodanil (C sub 6 O sub 2 I sub 4) have been carried out at pressures up to 39 GPa at room temperature with a diamond-anvil cell under the best hydrostatic conditions using helium as the pressure-transmitting medium. The diffraction patterns up to 23.3 GPa were fitted with a space group P 2 sub 1 /c. New peaks appeared above 26.8 GPa and their intensities increased with increasing pressure while the original ones observed for the low-pressure phase were gradually depressed. This phase transition was accompanied with a mixed state of low- and high-pressure phases over the wide pressure range between 26.8 and at least 39 GPa.

  9. Viral pathogenesis in diagrams

    National Research Council Canada - National Science Library

    Tremblay, Michel; Berthiaume, Laurent; Ackermann, Hans-Wolfgang


    .... The 268 diagrams in Viral Pathogenesis in Diagrams were selected from over 800 diagrams of English and French virological literature, including one derived from a famous drawing by Leonardo da Vinci...

  10. Inactivation of Francisella tularensis Gene Encoding Putative ABC Transporter Has a Pleiotropic Effect upon Production of Various Glycoconjugates

    Czech Academy of Sciences Publication Activity Database

    Daňková, V.; Balonová, L.; Link, M.; Strašková, Adéla; Sheshko, V .; Stulík, J.


    Roč. 15, č. 2 (2016), s. 510-524 ISSN 1535-3893 Institutional support: RVO:61388971 Keywords : Francisella tularensis * glycosylation * lipopolysaccharide Subject RIV: EE - Microbiology, Virology Impact factor: 4.268, year: 2016

  11. Asthma: What You Need to Know | NIH MedlinePlus the Magazine (United States)

    Skip to main content NIH MedlinePlus the Magazine NIH MedlinePlus Salud Download the Current Issue PDF [2.68 mb] Trusted Health Information from the National Institutes of Health Home Current Issue ...

  12. Helping others hear better | NIH MedlinePlus the Magazine (United States)

    Skip to main content NIH MedlinePlus the Magazine NIH MedlinePlus Salud Download the Current Issue PDF [2.68 mb] Trusted Health Information from the National Institutes of Health Home Current Issue ...

  13. Breathtaking: Managing a COPD Diagnosis | NIH MedlinePlus the Magazine (United States)

    Skip to main content NIH MedlinePlus the Magazine NIH MedlinePlus Salud Download the Current Issue PDF [2.68 mb] Trusted Health Information from the National Institutes of Health Home Current Issue ...

  14. A Journey with Mid-life Hearing Loss | NIH MedlinePlus the Magazine (United States)

    Skip to main content NIH MedlinePlus the Magazine NIH MedlinePlus Salud Download the Current Issue PDF [2.68 mb] Trusted Health Information from the National Institutes of Health Home Current Issue ...

  15. The Opioid Crisis | NIH MedlinePlus the Magazine (United States)

    Skip to main content NIH MedlinePlus the Magazine NIH MedlinePlus Salud Download the Current Issue PDF [2.68 mb] Trusted Health Information from the National Institutes of Health Home Current Issue ...

  16. The ABCs of GERD | NIH MedlinePlus the Magazine (United States)

    Skip to main content NIH MedlinePlus the Magazine NIH MedlinePlus Salud Download the Current Issue PDF [2.68 mb] Trusted Health Information from the National Institutes of Health Home Current Issue ...

  17. The Future of Asthma Monitoring | NIH MedlinePlus the Magazine (United States)

    Skip to main content NIH MedlinePlus the Magazine NIH MedlinePlus Salud Download the Current Issue PDF [2.68 mb] Trusted Health Information from the National Institutes of Health Home Current Issue ...

  18. Too ‘Stubborn’ to Give in to COPD | NIH MedlinePlus the Magazine (United States)

    Skip to main content NIH MedlinePlus the Magazine NIH MedlinePlus Salud Download the Current Issue PDF [2.68 mb] Trusted Health Information from the National Institutes of Health Home Current Issue ...

  19. A Lifelong Asthma Struggle | NIH MedlinePlus the Magazine (United States)

    Skip to main content NIH MedlinePlus the Magazine NIH MedlinePlus Salud Download the Current Issue PDF [2.68 mb] Trusted Health Information from the National Institutes of Health Home Current Issue ...

  20. Solving the Undiagnosed Disease Puzzle at NIH | NIH MedlinePlus the Magazine (United States)

    Skip to main content NIH MedlinePlus the Magazine NIH MedlinePlus Salud Download the Current Issue PDF [2.68 mb] Trusted Health Information from the National Institutes of Health Home Current Issue ...

  1. Love and Life without Gluten | NIH MedlinePlus the Magazine (United States)

    Skip to main content NIH MedlinePlus the Magazine NIH MedlinePlus Salud Download the Current Issue PDF [2.68 mb] Trusted Health Information from the National Institutes of Health Home Current Issue ...

  2. Exploring the Celiac Disease Mystery | NIH MedlinePlus the Magazine (United States)

    Skip to main content NIH MedlinePlus the Magazine NIH MedlinePlus Salud Download the Current Issue PDF [2.68 mb] Trusted Health Information from the National Institutes of Health Home Current Issue ...

  3. Expanding Hearing Healthcare | NIH MedlinePlus the Magazine (United States)

    Skip to main content NIH MedlinePlus the Magazine NIH MedlinePlus Salud Download the Current Issue PDF [2.68 mb] Trusted Health Information from the National Institutes of Health Home Current Issue ...

  4. Understanding Asthma from the Inside Out | NIH MedlinePlus the Magazine (United States)

    Skip to main content NIH MedlinePlus the Magazine NIH MedlinePlus Salud Download the Current Issue PDF [2.68 mb] Trusted Health Information from the National Institutes of Health Home Current Issue ...

  5. Obtaining isochrones from pollution signals in a fluvial sediment record: A case study in a uranium-polluted floodplain of the Ploucnice River, Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Matys Grygar, Tomáš; Elznicová, J.; Bábek, O.; Hošek, Michal; Engel, Z.; Kiss, T.


    Roč. 48, SEP (2014), s. 1-15 ISSN 0883-2927 Institutional support: RVO:61388980 Keywords : GEOCHEMICAL BASE-LINES * HEAVY - METALS * CONTAMINATION ASSESSMENT Subject RIV: DD - Geochemistry Impact factor: 2.268, year: 2014

  6. TJOG Vol 26 No 1.cdr

    African Journals Online (AJOL)

    Plasma C-Reactive Protein and Selected Nutritional Indices in Elective ... 13.27 respectively, while albumin reduced significantly (2.68 + 1.08) vs ... constitute the inflammatory response after ... acid mobilization from muscle used for hepatic.

  7. The Constitutional Review Chamber of the Republic of Estonia judgment : no. of the case 3-4-1-1-03 : date of decision 17 February 2003

    Index Scriptorium Estoniae


    Riigikohtu lahendi 3-4-1-1-03 (Vabariigi Valitsuse 06. 11. 1996 määrusega nr. 268 kinnitatud "Maa enampakkumisega erastamise korra" p. 47 vastavuse kontrollimiseks Põhiseaduse §-ga 11) tekst inglise keeles

  8. Molar Heat Increment under Impact of Transverse Contraction in Metals

    Czech Academy of Sciences Publication Activity Database

    Pekárek, Viktor


    Roč. 52, č. 3 (2007), s. 261-268 ISSN 0001-7043 Institutional research plan: CEZ:AV0Z20570509 Keywords : atomic structure * thermal agitation * heat expansion Subject RIV: BM - Solid Matter Physics ; Magnetism

  9. Proposal of new Oβ oxidation criterion for new types of the Zr1Nb alloy of fuel claddings

    Czech Academy of Sciences Publication Activity Database

    Negyesi, M.; Klouček, V.; Lorinčík, Jan; Novotný, L.; Kabátová, J.; Linhart, S.; Adámek, J.; Siegl, J.; Vrtílková, V.


    Roč. 261, August (2013), s. 260-268 ISSN 0029-5493 Institutional support: RVO:67985882 Keywords : Oxygen * Experimental methods * Kinetics equation Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 0.972, year: 2013

  10. O ČEZu, UNESCU a Ikee. Psaní iniciálových zkratkových slov a tendence k jejich skloňování

    Czech Academy of Sciences Publication Activity Database

    Dufek, Ondřej


    Roč. 99, č. 5 (2016), s. 256-268 ISSN 0027-8203 R&D Projects: GA MŠk(CZ) LM2010013 Institutional support: RVO:68378092 Keywords : initialism * acronym * declension * orthography Subject RIV: AI - Linguistics


    Directory of Open Access Journals (Sweden)



    Full Text Available Este trabalho teve como objetivo estabelecer o protocolo para a produção de plântulas in vitro a partir da conversão de embriões zigóticos de açaizeiro (Euterpe oleracea Mart.. Os embriões zigóticos maduros foram excisados sob condições assépticas, a partir de sementes obtidas de frutos maduros, e cultivados em tubos de ensaio com 10 mL de meio MS modificado pela presença de 0,17 g.L-1 de NaH2PO4, com 0,6 % de ágar, 0,25 % de carvão ativado e 3 % de sacarose. Foram testadas diferentes combinações de ANA (0,54; 2,68 e 5,37 miM e BAP (0,44; 1,11; 1,55 e 2,22 miM e uma testemunha adicional. Em média, os tratamentos constituídos da combinação de ANA e BAP foram superiores à testemunha para todas as variáveis avaliadas. As concentrações de 0,54 e 2,68 miM de ANA promoveram, em média, maior formação de plântulas normais quando comparado com 5,37 miM de ANA. O maior comprimento da parte aérea foi induzido pela presença de 2,68 miM de ANA combinado com 1,11; 1,55 e 2,22 miM de BAP. Não foram verificadas diferenças significativas entre as concentrações de ANA e BAP para a percentagem de conversão de embriões e número de raízes por plântulaThis work had as objective to establish protocol for the production of seedlings in vitro from of the conversion of assai palm zygotic embryos (Euterpe oleracea Mart.. The mature zygotic embryos obtained of seeds of mature fruits were excised under aseptic conditions, and cultivated in rehearsal tubes with 10 mL of a MS medium modified by the presence of 0,17 g.L-1 of NaH2PO4, with agar 0,6%, 0,25% activated charcoal and 3% sucrose. Different combinations of NAA were tested (0,54; 2,68 and 5,37 muM and BAP (0,44; 1,11; 1,55 and 2,22 muM and a treatment without growth regulator. On the average, the constituted treatments of ANA and BAP were superiors the to a treatment without growth regulator to all the parameters. The concentrations of 0,54 and 2,68 muM of NAA promoted, on the

  12. Avaliação de medidas da persistência da lactação de cabras da raça Saanen sob modelo de regressão aleatória Evaluation of persistency lactation measures of Saanen goats under random regression model

    Directory of Open Access Journals (Sweden)

    Gilberto Romeiro de Oliveira Menezes


    Full Text Available Utilizaram-se 10.238 registros semanais de produção de leite no dia do controle, provenientes de 388 primeiras lactações de cabras da raça Saanen, na avaliação de seis medidas da persistência da lactação, a fim de verificar qual a mais adequada para o uso em avaliações genéticas para a característica. As seis medidas avaliadas são adaptações de medidas utilizadas em bovinos de leite, obtidas por substituir, nas fórmulas, os valores de referência de bovinos pelos de caprinos. Os valores usados nos cálculos foram obtidos de modelos de regressão aleatória. As estimativas de herdabilidade para as medidas de persistência variaram entre 0,03 e 0,09. As correlações genéticas entre medidas de persistência e produção de leite até 268 dias variaram entre -0,64 e 0,67. Por apresentar a menor correlação genética com produção aos 268 dias (0,14, a medida de persistência PS4, obtida pelo somatório dos valores do 41º ao 240º dia de lactação como desvios da produção aos 40 dias de lactação, é a mais indicada em avaliações genéticas para persistência da lactação em cabras da raça Saanen. Assim, a seleção de cabras de melhor persistência da lactação não altera a produção aos 268 dias. Em razão da baixa herdabilidade dessa medida (0,03, pequenas respostas à seleção são esperadas neste rebanho.It was used 10,238 weekly milk production records on the control day from the first 388 lactations of Saanen goats on the evalution of six lactation persistency measures in order to find out which was the best fitted for using in genetic evaluations on this trait. These six evaluated measures are adaptations from those used on dairy cattle, obtained by replacing, in the formula, bovine reference values by the goat ones. The values used in the calculations were obtained from random regression models. Heritability estimates for persistency measures ranged from 0.03 to 0.09. Genetic correlations between

  13. Black Cohosh (United States)

    ... Events Multimedia (Video, Images, and Audio) NCCIH Clinical Digest A monthly newsletter with evidence-based information on ... require a viewer such as the free Adobe Reader . NCCIH Publication No.: D268 Updated: September 2016 Print ...

  14. Cerium oxide for the destruction of chemical warfare agents: A comparison of synthetic routes

    Czech Academy of Sciences Publication Activity Database

    Janos, P.; Henych, Jiří; Pelant, O.; Pilařová, V.; Vrtoch, L.; Kormunda, M.; Mazanec, K.; Štengl, Václav


    Roč. 304, MAR (2016), s. 259-268 ISSN 0304-3894 Institutional support: RVO:61388980 Keywords : Cerium oxide * Chemical warfare agents * Organophosphate compounds * Decontamination Subject RIV: CA - Inorganic Chemistry Impact factor: 6.065, year: 2016

  15. Attitudes of undergraduates towards mental illness: A comparison ...

    African Journals Online (AJOL)

    of Business Management (BBM) courses. Methods. A cross-sectional descriptive design was adopted for the present study. A total of 268 ... combat discrimination, and potentially enhance the promotion of human rights for the mentally ill.

  16. An introduction to differential equations and their applications

    CERN Document Server

    Farlow, Stanley J


    This introductory text explores 1st- and 2nd-order differential equations, series solutions, the Laplace transform, difference equations, much more. Numerous figures, problems with solutions, notes. 1994 edition. Includes 268 figures and 23 tables.

  17. 75 FR 63857 - In the Matter of: Certain Digital Televisions and Components Thereof; Notice of Investigation (United States)


    ..., CA 92618. AmTRAN Technology Co., Ltd., 17f, 268, Lien Cheng Rd., Chungho City, Taipei, 23553, Taiwan... right to appear and contest the allegations of the complaint and this notice, and to authorize the...

  18. Intelligent Advanced Communications IP Telephony Feasibility for the U.S. Navy (DVD)

    National Research Council Canada - National Science Library

    Binns, Todd D; Naas, Bill


    ...: 2 DVD-ROMs; 4 3/4 in.; 2.68 GB. ABSTRACT: The purpose of this research paper is to research technologies and solutions supporting the communications infrastructure necessary to implement an integrated VoIP (IP telephony...

  19. The NDUFS4 nuclear gene of complex 1 encodes a subunit essential for the assembly and cAMP-dependent regulation of the activity of the complex

    Czech Academy of Sciences Publication Activity Database

    Papa, S.; Sardanelli, A. M.; Petruzzella, V.; Scacco, S.; Vergari, R.; Dobrová, Zuzana; Lamantea, E.; Zeviani, M.; van den Heuvel, L.; Smeitink, J.


    Roč. 268, Suppl 1 (2001), s. 69 [Meeting of the Federation of European Biochemical Societies /27./. 30.06.2001-05.07.2001, Lisbon] Institutional research plan: CEZ:AV0Z5020903 Subject RIV: CE - Biochemistry

  20. Towards a Common Toolbox for Rarity: A Response to Violle et al.

    Czech Academy of Sciences Publication Activity Database

    Carmona, C. P.; de Bello, Francesco; Sasaki, T.; Uchida, K.; Pärtel, M.


    Roč. 32, č. 12 (2017), s. 889-891 ISSN 0169-5347 Institutional support: RVO:67985939 Keywords : rarity * species loss * functional composition Subject RIV: EH - Ecology, Behaviour OBOR OECD: Ecology Impact factor: 15.268, year: 2016

  1. Application of polyaniline dispersions by means of screen printing

    Czech Academy of Sciences Publication Activity Database

    Držková, M.; Peřinka, N.; Hajná, Milena; Kaplanová, M.; Stejskal, Jaroslav


    Roč. 19, č. 2013 (2013), s. 257-268 ISSN 1211-5541 R&D Projects: GA TA ČR TE01020022 Institutional support: RVO:61389013 Keywords : polyaniline * colloids * screen printing Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering

  2. Time-course of changes in neuronal activity markers following iTBS-TMS of the rat neocortex. (United States)

    Hoppenrath, Kathrin; Funke, Klaus


    In a rat model of transcranial magnetic stimulation we could recently show that intermittent theta-burst stimulation (iTBS) affects the neocortical expression of the immediate early gene products c-Fos and zif268 as well as that of the two glutamic acid decarboxylase isoforms GAD65 and GAD67 and that of the calcium-binding proteins calbindin (CB) and parvalbumin (PV), known as markers of excitatory and inhibitory activity. We now analyzed in more detail the time course of changes in the expression of these proteins at 10, 20, 40, 80 and 160min following a single block of iTBS consisting of 600 stimuli. Initial increase in c-Fos, zif268 and GAD65 (20min) signals transient activation of excitatory and inhibitory neurons, thereafter first followed by a decrease in markers of activity of inhibitory neurons (GAD67, PV, CB: 20-80min) and then by a late decrease in c-Fos and GAD65 expression (160min). The results demonstrate that one iTBS block may have an after-effect of at least two different phases, an early phase with increased neuronal activity (c-Fos, zif268) but also the likelihood of increased GABA-release (GAD65), followed by a late phase (>40min) of reduced neuronal activity in excitatory and inhibitory systems which may indicate a state of reduced excitability. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  3. 76 FR 74753 - Authority To Manufacture and Distribute Postage Evidencing Systems (United States)


    ...) provided to customers by manufacturers or distributors. The proposed changes are intended to clarify the... (202) 268-7613. SUPPLEMENTARY INFORMATION: The office formerly known as Postage Technology Management... the business relationship, distribution, control, storage, maintenance, repair, replacement, and...

  4. Coupling of seasonal variations in the zooplankton community within the limnetic and littoral zones of a shallow pond

    Czech Academy of Sciences Publication Activity Database

    Šorf, M.; Devetter, Miloslav


    Roč. 47, č. 3 (2011), s. 259-268 ISSN 0003-4088 Institutional research plan: CEZ:AV0Z60660521 Keywords : limnetic zone * littoral zone * seasonal succession Subject RIV: EH - Ecology, Behaviour Impact factor: 0.930, year: 2011

  5. Exponentially Weighted Moving Average Chart as a Suitable Tool for Nuchal Translucency Quality Review

    Czech Academy of Sciences Publication Activity Database

    Hynek, M.; Smetanová, D.; Stejskal, D.; Zvárová, Jana


    Roč. 34, č. 4 (2014), s. 367-376 ISSN 0197-3851 Institutional support: RVO:67985807 Keywords : nuchal translucency * exponentially weighted moving average model * statistics Subject RIV: BB - Applied Statistics, Operational Research Impact factor: 3.268, year: 2014

  6. Nanophase iron production through laser irradiation and magnetic detection of space weathering analogs

    Czech Academy of Sciences Publication Activity Database

    Markley, M.; Kletetschka, Günther


    Roč. 268, April (2016), s. 204-214 ISSN 0019-1035 Institutional support: RVO:67985831 Keywords : experimental techniques asteroids * surfaces Mercury * surface Moon * surface spectroscopy Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 3.131, year: 2016

  7. Znovu odkrytá nástěnná malba "Průvod a Klanění tří králů" v presbytáři kostela sv. Martina v Sedlčanech

    Czech Academy of Sciences Publication Activity Database

    Pavlíková, M.; Popová, T.; Všetečková, Zuzana

    -, č. 23 (2016), s. 252-268 ISSN 1211-5169 R&D Projects: GA ČR GA13-39192S Institutional support: RVO:68378033 Keywords : Middle Ages (about 1400) * wall painting * iconography Subject RIV: AL - Art, Architecture, Cultural Heritage

  8. Correlation of Ultrastructural Changes of Endothelial Cells and Astrocytes Occurring during Blood Brain Barrier Damage after Traumatic Brain Injury with Biochemical Markers of Blood Brain Barrier Leakage and Inflammatory Response

    Czech Academy of Sciences Publication Activity Database

    Vajtr, D.; Benada, Oldřich; Kukačka, J.; Průša, R.; Houšťava, L.; Toupalík, P.; Kizek, R.


    Roč. 58, č. 2 (2009), s. 263-268 ISSN 0862-8408 Institutional research plan: CEZ:AV0Z50200510 Keywords : Blood brain barrier * Expansive contusion * Metalloproteinases Subject RIV: EE - Microbiology, Virology Impact factor: 1.430, year: 2009

  9. Multi-wavelength observations of Asteroid 2100 Ra-Shalom

    Czech Academy of Sciences Publication Activity Database

    Shepard, M.K.; Clark, B. E.; Nolan, M. C.; Benner, L. A. M.; Ostro, S. J.; Giorgini, J. D.; Vilas, F.; Jarvis, K.; Lederer, S.; Lim, L.F.; McConnochie, T.; Bell, J.; Margot, J. L.; Rivkin, A. S.; Magrik, C.; Scheeres, D.J.; Pravec, Petr


    Roč. 193, č. 1 (2008), s. 20-38 ISSN 0019-1035 Institutional research plan: CEZ:AV0Z10030501 Keywords : asteroids composition * radar observations Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 3.268, year: 2008

  10. Research Library Issues: A Bimonthly Report from ARL, CNI, and SPARC. RLI 268 (United States)

    Barrett, G. Jaia, Ed.


    "Research Library Issues" ("RLI") is a bimonthly report from ARL (Association of Research Libraries), CNI (Coalition of Networked Information), and SPARC (Scholarly Publishing and Academic Resources Coalition). This special issue includes the following articles: (1) Themes within the ARL Strategic Plan 2010-2012 (Charles B. Lowry); (2) ARL…

  11. 49 CFR 268.15 - Form and contents of applications for preconstruction planning assistance. (United States)


    ... have Maglev projects are invited to submit applications in Phase I of the Maglev Deployment Program..., including but not necessarily limited to: (1) Preconstruction planning work as is needed to develop a Maglev... made a definitive choice of the particular Maglev technology proposed to be included, a description of...

  12. Rational design of Bacillus stearothermophilus US100 L-arabinose isomerase: potential applications for D-tagatose production. (United States)

    Rhimi, Moez; Aghajari, Nushin; Juy, Michel; Chouayekh, Hichem; Maguin, Emmanuelle; Haser, Richard; Bejar, Samir


    L-arabinose isomerases catalyze the bioconversion of D-galactose into D-tagatose. With the aim of producing an enzyme optimized for D-tagatose production, three Bacillus stearothermophilus US100 L-arabinose isomerase mutants were constructed, purified and characterized. Our results indicate that mutant Q268K was significantly more acidotolerant and more stable at acidic pH than the wild-type enzyme. The N175H mutant has a broad optimal temperature range from 50 to 65 degrees C. With the aim of constructing an acidotolerant mutant working at relatively low temperatures we generated the Q268K/N175H construct. This double mutant displays an optimal pH in the range 6.0-7.0 and an optimal activity around 50-65 degrees C, temperatures at which the enzyme was stable without addition of metal ions.

  13. Hyaluronidase-inhibitory activities of glycosaminoglycans from Liparis tessellatus eggs

    DEFF Research Database (Denmark)

    Ticar, Bernadeth F.; Rohmah, Zuliyati; Mussatto, Solange Ines


    Polysaccharide fractions isolated from L. tessellatus eggs were purified and eluted using the DEAE-sepharose fast flow column. These were collected, tested and pooled based on their sugars content: F1, F2, and F3 which contain 26.8, 23.3, and 20.2% sulfated glycans; 34.5, 38.2, and 45.0% uronic a...... the presence of uronic acids on F3, which could be a 0,2A2 fragment plus loss of methyl group which is very common among nonmethylated, sulfated disaccharides.......Polysaccharide fractions isolated from L. tessellatus eggs were purified and eluted using the DEAE-sepharose fast flow column. These were collected, tested and pooled based on their sugars content: F1, F2, and F3 which contain 26.8, 23.3, and 20.2% sulfated glycans; 34.5, 38.2, and 45.0% uronic...

  14. Kvitovat

    Czech Academy of Sciences Publication Activity Database

    Šimandl, Josef


    Roč. 88, č. 5 (2005), s. 265-268 ISSN 0027-8203 R&D Projects: GA ČR GA405/03/0377 Institutional research plan: CEZ:AV0Z90610518 Keywords : meaning * etymology * loan word Subject RIV: AI - Linguistics

  15. Trace metal dynamics in fishes from the southwest coast of India

    Digital Repository Service at National Institute of Oceanography (India)

    Rejomon, G.; Nair, M.; Joseph, T.

    metals, with highest bioaccumulation for the essential element iron and lowest bioaccumulation for the non-essential element lead. Among the demersal species, C. melampygus and N. japonicus had high concentration factors for the metals Fe (280,268 to 322...

  16. The Constitutional Review Chamber of the Republic of Estonia : 3-4-1-5-01 decision of 3 March 2001 : review of the petition of Saare County Court to declare clause 25 (1) of Procedure for Privatisation of Land by Auction invalid

    Index Scriptorium Estoniae


    Riigikohtu lahendi 3-4-1-5-01 (Saare Maakohtu taotlus kontrollida Vabariigi Valitsuse 06. 11. 96. a. määrusega nr. 268 kinnitatud "Maa enampakkumisega erastamise korra" p. 25.1 vastavus seadusele ja põhiseadusele) tekst inglise keeles

  17. Short communication report Dr Ndams Siliadse

    African Journals Online (AJOL)

    Dr. Ahmed

    .; Doom, J. P.; Chuenkova, M.; Manger, I. D. &. Pereira, M. E. (1993). Enzymatic characterization of B-D- galactoside & 2,3 trans-sialidase from Trypanosoma cruzi. Journal of Biological Chemistry. 268: 9886-9891. Service, M.W. (1980). A guide ...


    African Journals Online (AJOL)

    Ill. Examination and Diagnosis. IV. Methods of Treatment. V. Techniques of Treatment. VI. ... C. drugs, y tematicaUy pr nted under indi idual tit! , ..... 265), wrong vowels in residuum and vitamin (pages 268 and 279), .... Cancer of the Stomach.

  19. On the effect of oxygen flooding on the detection of noble gas ions in a SIMS instrument

    Czech Academy of Sciences Publication Activity Database

    Williams, P.; Franzreb, K.; Sobers Jr., R. C.; Lorinčík, Jan


    Roč. 268, 17-18 (2010), s. 2758-2765 ISSN 0168-583X Institutional research plan: CEZ:AV0Z20670512 Keywords : SIMS * noble gases * uranium Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 1.042, year: 2010

  20. Density-functional study of the CO adsorption on the ferromagnetic fcc Co(001) film surface

    Czech Academy of Sciences Publication Activity Database

    Pick, Štěpán


    Roč. 604, 3-4 (2010), s. 265-268 ISSN 0039-6028 Institutional research plan: CEZ:AV0Z40400503 Keywords : Density functional calculations * chemisorption * magnetic films Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.010, year: 2010

  1. OMC: an optical monitoring camera for INTEGRAL

    Czech Academy of Sciences Publication Activity Database

    Mas-Hesse, J. M.; Giménez, A.; Culhane, J. L.; Jamar, C.; McBreen, B.; Torra, J.; Hudec, René; Fabregat, J.; Meurs, E.; Swings, J. P.; Alcacera, M. A.; Balado, A.; Beiztegui, R.; Belenguer, T.; Bradley, L.; Caballero, M. D.; Cabo, P.; Defise, J. M.; Díaz, E.; Domingo, A.; Figueras, F.; Figueroa, I.; Hanlon, L.; Hroch, Filip; Hudcová, Věra; García, T.; Jordan, B.; Jordi, C.; Kretschmar, P.; Laviada, C.; March, M.; Martín, E.; Mazy, E.; Menéndez, M.; Mi, J. M.; de Miguel, E.; Munoz, T.; Nolan, K.; Olmedo, R.; Pesseria, J. Y.; Polcar, Jiří; Reina, M.; Renotte, E.; Rochus, P.; Sánchez, A.; San Martín, J. C.; Smith, A.; Soldán, Jan; Thomas, P.; Timón, V.; Walton, D. J.


    Roč. 411, č. 1 (2003), L261-L268 ISSN 0004-6361 Institutional research plan: CEZ:AV0Z1003909 Keywords : photometers instrumentation * stars * photometric Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 3.843, year: 2003

  2. Changes in the Intra-household Roles in Agriculture among Tiv ...

    African Journals Online (AJOL)


    household activities which had earlier been known as female roles; it is recommended .... divided into different sections on the basis of the objectives. ..... attention (M=2.68), as well as encouraging common residence and kinship ties with the ...

  3. Data of evolutionary structure change: 1PVDA-2VBFA [Confc[Archive

    Lifescience Database Archive (English)


  4. The murine endogenous retrovirus MIA14 encodes an active aspartic proteinase that is functionally similar to proteinases from D-type retroviruses

    Czech Academy of Sciences Publication Activity Database

    Stříšovský, Kvido; Smrž, Daniel; Fehrmann, F.; Kräusslich, H. G.; Konvalinka, Jan


    Roč. 398, č. 2 (2002), s. 261-268 ISSN 0003-9861 Grant - others:HHMI(GB) 75195-54081 Institutional research plan: CEZ:AV0Z4055905 Keywords : endogenous retrovirus Subject RIV: CE - Biochemistry Impact factor: 2.606, year: 2002

  5. Could we have predicted the recent downturn in the South African housing market?

    CSIR Research Space (South Africa)

    Das, Sonali


    Full Text Available This paper develops large-scale Bayesian Vector Autoregressive (BVAR) models, based on 268 quarterly series, for forecasting annualized real house price growth rates for large-, medium- and small-middle-segment housing for the South African economy...

  6. Search for dark matter produced in association with a hadronically decaying vector boson in pp collisions at √s = 13 TeV with the ATLAS detector

    Czech Academy of Sciences Publication Activity Database

    Aaboud, M.; Aad, G.; Abbott, B.; Chudoba, Jiří; Havránek, Miroslav; Hejbal, Jiří; Jakoubek, Tomáš; Kepka, Oldřich; Kupčo, Alexander; Kůs, Vlastimil; Lokajíček, Miloš; Lysák, Roman; Marčišovský, Michal; Mikeštíková, Marcela; Němeček, Stanislav; Penc, Ondřej; Šícho, Petr; Staroba, Pavel; Svatoš, Michal; Taševský, Marek; Vrba, Václav


    Roč. 763, Dec (2016), 251-268 ISSN 0370-2693 Institutional support: RVO:68378271 Keywords : ATLAS * effective field theory * transverse momentum * missing-energy * CERN LHC Coll Subject RIV: BF - Elementary Particles and High Energy Physics Impact factor: 4.807, year: 2016

  7. 77 FR 60380 - Caribbean Fishery Management Council; Public Meeting (United States)


    ... Caribbean Fishery Management Council's Scientific and Statistical Committee (SSC) will hold meetings. DATES... Fishery Management Council; Public Meeting AGENCY: National Marine Fisheries Service (NMFS), National... CONTACT: Caribbean Fishery Management Council, 268 Mu[ntilde]oz Rivera Avenue, Suite 1108, San Juan...

  8. Wall Shear Rate in the Taylor-Couette-Poiseuille Flow at Low Axial Reynolds Number

    Czech Academy of Sciences Publication Activity Database

    Dumont, E.; Fayolle, F.; Sobolík, Václav; Legrand, J.


    Roč. 45, č. 3 (2002), s. 679-689 ISSN 0017-9310 Institutional research plan: CEZ:AV0Z4072921 Keywords : Taylor vortices * electrodiffusion diagnostics * model fluid s Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 1.268, year: 2002

  9. Complexity in behavioural organization and strongylid infection among wild chimpanzees

    Czech Academy of Sciences Publication Activity Database

    Burgunder, J.; Pafčo, B.; Petrželková, Klára Judita; Modrý, David; Hashimoto, C.; MacIntosh, A. J. J.


    Roč. 129, July (2017), s. 257-268 ISSN 0003-3472 Institutional support: RVO:60077344 Keywords : behavioural complexity * chimpanzees * fractal analysis * health monitoring * Pan troglodytes schweinfurthii * strongylid infection Subject RIV: EG - Zoology OBOR OECD: Zoology Impact factor: 2.869, year: 2016

  10. Complexity in behavioural organization and strongylid infection among wild chimpanzees

    Czech Academy of Sciences Publication Activity Database

    Burgunder, J.; Pafčo, B.; Petrželková, Klára Judita; Modrý, D.; Hashimoto, C.; MacIntosh, A. J. J.


    Roč. 129, July (2017), s. 257-268 ISSN 0003-3472 Institutional support: RVO:68081766 Keywords : behavioural complexity * chimpanzees * fractal analysis * health monitoring * Pan troglodytes schweinfurthii * strongylid infection Subject RIV: EG - Zoology OBOR OECD: Zoology Impact factor: 2.869, year: 2016

  11. Onemocnění člověka způsobená hantaviry – stále opomíjené zoonózy?

    Czech Academy of Sciences Publication Activity Database

    Vrbovská, V.; Chalupa, P.; Straková, Petra; Hubálek, Zdeněk; Rudolf, Ivo


    Roč. 64, č. 4 (2015), s. 188-196 ISSN 1210-7913 Institutional support: RVO:68081766 Keywords : hantaviruses * Dobrava-Belgrade * Puumala * rodents * insectivores * emerging diseases * surveillance Subject RIV: FN - Epidemiology, Contagious Diseases ; Clinical Immunology Impact factor: 0.268, year: 2015

  12. Contaminants in fish tissue from US lakes and reservoirs: A national probabilistic study (United States)

    An unequal probability design was used to develop national estimates for 268 persistent, bioaccumulative, and toxic chemicals in fish tissue from lakes and reservoirs of the conterminous United States (excluding the Laurentian Great Lakes and Great Salt Lake). Predator (fillet) ...

  13. The intermediate state in Patd

    African Journals Online (AJOL)

    Again, there exists in these writings a great variety of speculations pertaining to the interim ..... to 'remember' him, that is, at the resurrection (Ellis 1974: 268; Gelden- huys 1951: 611). ...... Word pictures in the New Testament. Vol 2, The Gospel ...

  14. CPAP Tips

    Medline Plus

    Full Text Available ... Up next Philips Respironics Dream Station CPAP Machine Review - Duration: 8:29. The CPAP Shop 268,918 ... Philips Respironics Wisp Nasal CPAP Bilevel Mask Fitting Review Demonstration FreeCPAPAdvice com - Duration: 7:36. TheLankyLefty27 102, ...

  15. Celoplošná příprava půdy v lesích a její důsledky pro biodiverzitu

    Czech Academy of Sciences Publication Activity Database

    Čížek, Lukáš; Roleček, J.; Danihelka, Jiří


    Roč. 55, č. 6 (2007), s. 266-268 ISSN 0044-4812 R&D Projects: GA MŠk LC06073 Institutional research plan: CEZ:AV0Z50070508; CEZ:AV0Z60050516 Keywords : biodiversity Subject RIV: EH - Ecology, Behaviour

  16. Influence of Isoflurane on Immediate-Early Gene Expression. (United States)

    Bunting, Kristopher M; Nalloor, Rebecca I; Vazdarjanova, Almira


    Anterograde amnesia is a hallmark effect of volatile anesthetics. Isoflurane is known to affect both the translation and transcription of plasticity-associated genes required for normal memory formation in many brain regions. What is not known is whether isoflurane anesthesia prevents the initiation of transcription or whether it halts transcription already in progress. We tested the hypothesis that general anesthesia with isoflurane prevents learning-induced initiation of transcription of several memory-associated immediate-early genes (IEGs) correlated with amnesia; we also assessed whether it stops transcription initiated prior to anesthetic administration. Using a Tone Fear Conditioning paradigm, rats were trained to associate a tone with foot-shock. Animals received either no anesthesia, anesthesia immediately after training, or anesthesia before, during, and after training. Animals were either sacrificed after training or tested 24 h later for long-term memory. Using Cellular Compartment Analysis of Temporal Activity by Fluorescence in situ Hybridization (catFISH), we examined the percentage of neurons expressing the IEGs Arc/Arg3.1 and Zif268/Egr1/Ngfi-A/Krox-24 in the dorsal hippocampus, primary somatosensory cortex, and primary auditory cortex. On a cellular level, isoflurane administered at high doses (general anesthesia) prevented initiation of transcription, but did not stop transcription of Arc and Zif268 mRNA initiated prior to anesthesia. On a behavioral level, the same level of isoflurane anesthesia produced anterograde amnesia for fear conditioning when administered before and during training, but did not produce retrograde amnesia when administered immediately after training. General anesthesia with isoflurane prevents initiation of learning-related transcription but does not stop ongoing transcription of two plasticity-related IEGs, Arc and Zif268, a pattern of disruption that parallels the effects of isoflurane on memory formation. Combined with

  17. Influence of isoflurane on Immediate-Early Gene expression

    Directory of Open Access Journals (Sweden)

    Kristopher M Bunting


    Full Text Available Background: Anterograde amnesia is a hallmark effect of volatile anesthetics. Isoflurane is known to affect both the translation and transcription of plasticity-associated genes required for normal memory formation in many brain regions. What is not known is whether isoflurane anesthesia prevents the initiation of transcription or whether it halts transcription already in progress. We tested the hypothesis that general anesthesia with isoflurane prevents learning-induced initiation of transcription of several memory-associated immediate-early genes (IEGs correlated with amnesia; we also assessed whether it stops transcription initiated prior to anesthetic administration.Methods: Using a Tone Fear Conditioning paradigm, rats were trained to associate a tone with foot-shock. Animals received either no anesthesia, anesthesia immediately after training, or anesthesia before, during, and after training. Animals were either sacrificed after training or tested 24 hours later for memory. Using Cellular Compartment Analysis of Temporal Activity by Fluorescence in situ Hybridization (catFISH, we examined the percentage of neurons expressing the IEGs Arc/Arg3.1 and Zif268/Egr1/Ngfi-A/Krox-24 in the dorsal hippocampus, primary somatosensory cortex, and primary auditory cortex.Results: On a cellular level, isoflurane administered at high doses (general anesthesia prevented initiation of transcription, but did not stop transcription of Arc and Zif268 mRNA initiated prior to anesthesia. On a behavioral level, the same level of isoflurane anesthesia produced anterograde amnesia for fear conditioning when administered before and during training, but did not produce retrograde amnesia when administered immediately after training. Conclusions: General anesthesia with isoflurane prevents initiation of learning-related transcription but does not stop ongoing transcription of two plasticity-related IEGs, Arc and Zif268, a pattern of disruption that parallels the

  18. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    Czech Academy of Sciences Publication Activity Database

    Lake, A.D.; Novák, Petr; Shipkova, P.; Aranibar, N.; Robertson, D.; Reily, M.D.; Lu, Z.; Lehman-McKeeman, L.D.; Cherrington, N.J.


    Roč. 268, č. 2 (2013), s. 132-140 ISSN 0041-008X Institutional research plan: CEZ:AV0Z50510513 Institutional support: RVO:60077344 Keywords : Bile Acids * Liver * Metabolomics Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.630, year: 2013

  19. Chemical ecology of marine sponges

    Digital Repository Service at National Institute of Oceanography (India)

    Thakur, N.L.; Singh, A.

    . University of California Press, Berkeley/Los Angeles, 268 pp Bewley CA, He H, Williams DH, Faulkner DJ (1996) Aciculitins AC: cytotoxic and antifungal cyclic pep- tides from the lithistid sponge Aciculites orientalis. J Am Chem Soc 118(18):4314–4321 48 N...

  20. Measuring Physical Activity with Pedometers in Older Adults with Intellectual Disability : Reactivity and Number of Days

    NARCIS (Netherlands)

    Hilgenkamp, Thessa; Van Wijck, Ruud; Evenhuis, Heleen

    The minimum number of days of pedometer monitoring needed to estimate valid average weekly step counts and reactivity was investigated for older adults with intellectual disability. Participants (N = 268) with borderline to severe intellectual disability ages 50 years and older were instructed to

  1. Resonance – Journal of Science Education | Indian Academy of ...

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 3. The Scientific Enterprise - Science in the Modern Indian Context. V V Raman. Reflections Volume 15 Issue 3 March 2010 pp 268-276. Fulltext. Click here to view fulltext PDF. Permanent link:

  2. Interindividual variation, correlations, and sex-related differences in the salivary biochemistry of young healthy adults

    NARCIS (Netherlands)

    Prodan, A.; Brand, H.S.; Ligtenberg, A.J.M.; Imangaliyev, S.; Tsivtsivadze, E.; van der Weijden, F.; Crielaard, W.; Keijser, B.J.F.; Veerman, E.C.I.


    A cross-sectional observational study was conducted to evaluate interindividual biochemical variation in unstimulated whole saliva in a population of 268 systemically healthy young students, 18-30 yr of age, with no apparent caries lesions or periodontal disease. Salivary flow rate, protein content,

  3. Kasumi jaotamine aktsiaseltsis : [bakalaureusetöö] / Risto Vahimets ; Tartu Ülikool, õigusteaduskond ; juhendaja: Andres Vutt

    Index Scriptorium Estoniae

    Vahimets, Risto, 1974-


    Kasumijaotamise üldmõisted (viisid aktsiaseltsis, omakapitali mõisted, jaotised, dividendid, eelisaktsiad, mitterahaline vara, uute aktsiate jagamine, reservfond, varjatud kasumijaotamine); kasumijaotamise reeglid Euroopa Liidus; Eesti äriseadustik ja Euroopa Liidu direktiivid; kasumijaotamine Soome Vabariigis. Vt. ka: Juridica (1996) nr. 6, lk. 266-268

  4. 76 FR 66087 - Telecommunications; Extension of the Office of Management and Budget's (OMB) Approval of... (United States)


    ...] Telecommunications; Extension of the Office of Management and Budget's (OMB) Approval of Information Collection... the Standard on Telecommunications (29 CFR 1910.268). The purpose of this requirement is to ensure... of the information collection requirement contained in the Standard on Telecommunications (29 CFR...

  5. Some new Eocene elasmobranch reports from the outer Western Carpathians (Moravia, Czech Republic)

    Czech Academy of Sciences Publication Activity Database

    Přikryl, Tomáš; Skupien, P.


    Roč. 268, č. 1 (2013), s. 113-123 ISSN 0077-7749 Institutional research plan: CEZ:AV0Z30130516 Institutional support: RVO:67985831 Keywords : Elasmobranchii * Leidybatis jugossus * Centrophorus * Eocene * Western Carpathian Subject RIV: DB - Geology ; Mineralogy Impact factor: 0.541, year: 2013

  6. 75 FR 56471 - Revisions to the Requirements for Authority To Manufacture and Distribute Postage Evidencing Systems (United States)


    ... evidencing systems (``Company or Companies'') engage a qualified, independent audit firm to perform an... Distribute Postage Evidencing Systems AGENCY: Postal Service TM . ACTION: Final rule. SUMMARY: The Postal..., at 202-268-7613. SUPPLEMENTARY INFORMATION: Postage Evidencing Systems are devices or systems of...

  7. Reconstruction of the central carbon metabolism of Aspergillus niger

    DEFF Research Database (Denmark)

    David, Helga; Åkesson, Mats Fredrik; Nielsen, Jens


    database for annotation of genes identified in future genome sequencing projects on aspergilli. Based on the metabolic reconstruction, a stoichiometric model was set up that includes 284 metabolites and 335 reactions, of which 268 represent biochemical conversions and 67 represent transport processes...

  8. Gotické a renesanční kamnové kachle z hradu a zámku v Českém Krumlově

    Czech Academy of Sciences Publication Activity Database

    Ernée, Michal

    -, č. 9 (2004), s. 251-268 ISSN 1211-6831 R&D Projects: GA MK PK99P04OPP011 Institutional research plan: CEZ:AV0Z8002910 Keywords : Stove tiles * Český Krumlov * late Gothic Subject RIV: AC - Archeology, Anthropology, Ethnology

  9. Search for single production of a vector-like quark via a heavy gluon in the 4b final state with the ATLAS detector in pp collisions at √s = 8 TeV

    Czech Academy of Sciences Publication Activity Database

    Aad, G.; Abbott, B.; Abdallah, J.; Chudoba, Jiří; Havránek, Miroslav; Hejbal, Jiří; Jakoubek, Tomáš; Kepka, Oldřich; Kupčo, Alexander; Kůs, Vlastimil; Lokajíček, Miloš; Lysák, Roman; Marčišovský, Michal; Mikeštíková, Marcela; Němeček, Stanislav; Penc, Ondřej; Šícho, Petr; Staroba, Pavel; Svatoš, Michal; Taševský, Marek; Vrba, Václav


    Roč. 758, Jul (2016), 249-268 ISSN 0370-2693 Institutional support: RVO:68378271 Keywords : CERN LHC Coll * background * composite * benchmark * gluon * experimental results * 8000 GeV-cms Subject RIV: BF - Elementary Particles and High Energy Physics Impact factor: 4.807, year: 2016

  10. Bildungsmäzenatentum und lutherisches Schulwesen in den böhmischen Ländern des 16. und des frühen 17. Jahrhunderts

    Czech Academy of Sciences Publication Activity Database

    Holý, Martin


    Roč. 18, č. 2 (2017), s. 268-278 ISSN 1805-790X Institutional support: RVO:67985963 Subject RIV: AB - History OBOR OECD: History (history of science and technology to be 6.3, history of specific sciences to be under the respective headings)

  11. Isect silk contains both a Kunitz-type and a unique Kazal-type proteinase inhibitor

    Czech Academy of Sciences Publication Activity Database

    Nirmala, Xavier; Kodrík, Dalibor; Žurovec, Michal; Sehnal, František


    Roč. 268, - (2001), s. 2064-2073 ISSN 0014-2956 R&D Projects: GA ČR GA204/00/0019; GA MŠk ME 204 Institutional research plan: CEZ:AV0Z5007907 Subject RIV: CE - Biochemistry Impact factor: 2.849, year: 2001

  12. Screening ethnically diverse human embryonic stem cells identifies a chromosome 20 minimal amplicon conferring growth advantage

    Czech Academy of Sciences Publication Activity Database

    Amps, K.; Andrews, P.W.; Anyfantis, G.; Armstrong, L.; Avery, S.; Baharvand, H.; Baker, J.; Baker, D.; Munoz, M. N.; Beil, S.; Benvenisty, N.; Ben-Yosef, D.; Biancotti, J. C.; Bosman, A.; Brena, R. M.; Brison, D.; Caisander, G.; Camarasa, M. V.; Chen, J. M.; Chiao, E.; Choi, Y. M.; Choo, E.; Collins, D.; Colman, A.; Crook, J. M.; Daley, G. Q.; Dalton, A.; De Sousa, P. A.; Denning, C.; Downie, J.; Dvořák, P.; Hampl, Aleš


    Roč. 29, č. 12 (2011), s. 1132-1144 ISSN 1087-0156 Institutional research plan: CEZ:AV0Z50390703 Keywords : comparative genomic hybridization * copy number variation * human es cells Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 23.268, year: 2011

  13. Vplyv postihnutia na copingové stratégie a osobnostnú štruktúru rannej adolescencie

    Czech Academy of Sciences Publication Activity Database

    Karaffová, Eva


    Roč. 44, č. 3 (2009), s. 253-268 ISSN 0555-5574 R&D Projects: GA ČR GA406/09/2096 Institutional research plan: CEZ:AV0Z70250504 Keywords : coping strategies * personality factors * physical disability * early adolescence Subject RIV: AN - Psychology

  14. Antioxidative and Hepatoprotective Activities of Deinoxanthin-Rich ...

    African Journals Online (AJOL)

    1Institute of Nuclear-Agricultural Sciences, Zhejiang University, Kaixuan Road No. 268, 310029 Hangzhou, 2Department of. Horticulture, Zhejiang Academy of Agricultural Sciences, Shiqiao Road No. 139, 310021 Hangzhou, 3Cancer Research. Institute, Zhejiang Cancer Hospital, Guangji Road No. 139, 310020 Hangzhou ...

  15. Effect of Anti-inflammatory Treatment on Depression, Depressive Symptoms, and Adverse Effects

    DEFF Research Database (Denmark)

    Köhler, Ole; Benros, Michael E; Nordentoft, Merete


    -controlled trials assessing the efficacy and adverse effects of pharmacologic anti-inflammatory treatment in adults with depressive symptoms, including those who fulfilled the criteria for depression. DATA EXTRACTION AND SYNTHESIS: Data were extracted by 2 independent reviewers. Pooled standard mean difference (SMD...... investigated cytokine inhibitors (n=2,004). The pooled effect estimate suggested that anti-inflammatory treatment reduced depressive symptoms (SMD, -0.34; 95% CI, -0.57 to -0.11; I2=90%) compared with placebo. This effect was observed in studies including patients with depression (SMD, -0.54; 95% CI, -1.......08 to -0.01; I2=68%) and depressive symptoms (SMD, -0.27; 95% CI, -0.53 to -0.01; I2=68%). The heterogeneity of the studies was not explained by differences in inclusion of clinical depression vs depressive symptoms or use of NSAIDs vs cytokine inhibitors. Subanalyses emphasized the antidepressant...

  16. Plutonium Finishing Plant (PFP) Criticality Alarm System Commercial Grade Item (CGI) Critical Characteristics

    International Nuclear Information System (INIS)

    WHITE, W.F.


    This document specifies the critical characteristics for Commercial Grade Items (CGI) procured for PFP's criticality alarm system as required by HNF-PRO-268 and HNF-PRO-1819. These are the minimum specifications that the equipment must meet in order to properly perform its safety function. There may be several manufacturers or models that meet the critical characteristics for any one item. PFP's Criticality Alarm System includes the nine criticality alarm system panels and their associated hardware. This includes all parts up to the first breaker in the electrical distribution system. Specific system boundaries and justifications are contained in HNF-SD-CP-SDD-003, ''Definition and Means of Maintaining the Criticality Detectors and Alarms Portion of the PFP Safety Envelope.'' The procurement requirements associated with the system necessitates procurement of some system equipment as Commercial Grade Items in accordance with HNF-PRO-268, ''Control of Purchased Items and Services.''

  17. Hot spring therapy of atomic bomb exposed patients, (9)

    Energy Technology Data Exchange (ETDEWEB)

    Hatta, O [Balneogic Sanatorium for the Atomic Bomb Injured Beppu, Oita (Japan); Tsuji, H


    The following description shows the statistics and the results of medical examinatin concerning the patients utilized Beppu Atomic Bomb Center from April, 1977, to March, 1978. Number of persons utilized the center was 3904, and 20285 man-days in total. Number of case treated there was 268. Number of diseases amounted to 442 of 66 sorts, excluding temporary of acute diseases such as acute entergastritis and cold diseases, etc. According to the report by the Ministry of Health and Welfare, atomic bomb-exposed persons show twice as much rate of incidence as normal persons, and owing to aging, many of them have more than two kinds of diseases. Among the diseases, 60 cases were hypertension, 32 heart disease, 30 knee-arthritis, 26 diabetes, 25 hepatitis, 23 spondylosis deformans, etc. Among 268 cases treated by hot spring therapy, 6 were totally cured, and 252 showed alleviation, while 10 showed no change.

  18. Stereotactic core needle breast biopsy marker migration: An analysis of factors contributing to immediate marker migration. (United States)

    Jain, Ashali; Khalid, Maria; Qureshi, Muhammad M; Georgian-Smith, Dianne; Kaplan, Jonah A; Buch, Karen; Grinstaff, Mark W; Hirsch, Ariel E; Hines, Neely L; Anderson, Stephan W; Gallagher, Katherine M; Bates, David D B; Bloch, B Nicolas


    To evaluate breast biopsy marker migration in stereotactic core needle biopsy procedures and identify contributing factors. This retrospective study analyzed 268 stereotactic biopsy markers placed in 263 consecutive patients undergoing stereotactic biopsies using 9G vacuum-assisted devices from August 2010-July 2013. Mammograms were reviewed and factors contributing to marker migration were evaluated. Basic descriptive statistics were calculated and comparisons were performed based on radiographically-confirmed marker migration. Of the 268 placed stereotactic biopsy markers, 35 (13.1%) migrated ≥1 cm from their biopsy cavity. Range: 1-6 cm; mean (± SD): 2.35 ± 1.22 cm. Of the 35 migrated biopsy markers, 9 (25.7%) migrated ≥3.5 cm. Patient age, biopsy pathology, number of cores, and left versus right breast were not associated with migration status (P> 0.10). Global fatty breast density (P= 0.025) and biopsy in the inner region of breast (P = 0.031) were associated with marker migration. Superior biopsy approach (P= 0.025), locally heterogeneous breast density, and t-shaped biopsy markers (P= 0.035) were significant for no marker migration. Multiple factors were found to influence marker migration. An overall migration rate of 13% supports endeavors of research groups actively developing new biopsy marker designs for improved resistance to migration. • Breast biopsy marker migration is documented in 13% of 268 procedures. • Marker migration is affected by physical, biological, and pathological factors. • Breast density, marker shape, needle approach etc. affect migration. • Study demonstrates marker migration prevalence; marker design improvements are needed.

  19. Technical realisation of the VISA-II project, phase I, part IV, IZ-165-o268-1962; Tehnicka realizacija projekta VISA-II, I faza (I-V), IV deo, IZ-165-o268-1962

    Energy Technology Data Exchange (ETDEWEB)

    Pavicevic, M [Institute of Nuclear Sciences Boris Kidric, Vinca, Beograd (Serbia and Montenegro)


    Project VISA-II is described in IX chapters as follows: introduction, definition of experiments and possibilities of performance; VISA-II channel, new experimental space in the RA reactor; hydraulic tests in the VISA-II channel; measurement of fast neutron and gamma flux in VISA-II channels; measurement of water flow through different VISA-2 irradiation capsules; fabrication of VISA-II capsules; corrosion and heavy water purity problems; safety problems of experiment VISA-2; experimental operation of VISA-II. This chapter VI includes documentation for each type of capsule, review about each experiment within the VISA-II project, the objective and purpose of the experiment as well as experimental device. [Serbo-Croat] Projekat VISA-2 opisan je u sledecih IX poglavlja: uvod, definicija eksperimenta VISA-2 i mogucnost njegovog izvodjenja; kanal VISA-2 novi eksperimentalni prostor u reaktoru RA; hidraulicna ispitivanja na tehnoloskom kanalu VISA-2; Realizacija merenja fluksa brzih neutrona i gama zracenja u kanalima VISA-2; merenje protoka vode kroz razne tipove kapsula VISA-2; Kapsule VISA-2 i njihova realizacija; problemi korozije i cistoce teske vode u projektu VISA-2; problemi sigurnosti eksperimenta VISA-2; probni pogon eksperimenta VISA-2. Ova VI glava elaborata sadrzi dokumentaciju za svaku vrstu kapsula, preglednu sliku o svakom eksperimentu u okviru projekta VISA-2, o njegovom cilju i nameni kao i o eksperimentalnom uredjaju.

  20. African Journal of Urology - Vol 10, No 4 (2004)

    African Journals Online (AJOL)

    Diagnosis of Unilateral Single System Ectopic Ureter in Girls in the Era of Magnetic Resonance Urography (MRU) · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. H Hammouda, A Abdel Lateef, M El-Akkad, M Shalaby, 264-268 ...

  1. Zur Beteiligung des Bundestages an gemischten völkerrechtlichen Abkommen. Internationale Freihandelsabkommen als Herausforderung des deutschen Europa- und Außenverfassungsrechts / Bernd Grzeszick, Juliane Hettche

    Index Scriptorium Estoniae

    Grzeszick, Bernd


    Jagatud pädevusest ELi kaubanduspoliitikas ja liikmesriigi parlamentide osalusest rahvusvaheliste vabakaubanduslepingute sõlmimisel Saksamaa näitel (põhiseaduse artiklite 23 lg 2 ja 59 lg 2 tõlgendamine ning konstitutsioonikohtu hinnang). Kokkuvõte inglise keeles. Samal teemal artikkel ka lk. 268-282.

  2. Half collisions by photodissociation

    International Nuclear Information System (INIS)

    Vries, M.S. de.


    The photodissociation of ICl, IBr and TlBr is studied. In the case of ICl and IBr, experiments are reported at various wavelengths between 480 and 530 nm. For TlBr, photodissociation for a range of wavelengths between 264 and 268 nm is reported. (Auth.)

  3. Akvabela a krasoplavec

    Czech Academy of Sciences Publication Activity Database

    Černá, Anna


    Roč. 88, č. 5 (2005), s. 268-269 ISSN 0027-8203 R&D Projects: GA AV ČR 1ET200610406 Institutional research plan: CEZ:AV0Z90610521 Keywords : loan word * word formation * derivation of feminine forms from masculine Subject RIV: AI - Linguistics

  4. Probes for narcotic receptor mediated phenomena 22. Pt.1: Synthesis and characterization of optically pure [{sup 3}H](+)-4-[({alpha}R)-{alpha}-((2S,5R)-4-propyl-2,5-dimethyl-1-pi perazinyl)-3-methoxybenzyl]-N,N-diethylbenzamide, [{sup 3}H]SNC 121, a novel high affinity and selective ligand for delta opioid receptors

    Energy Technology Data Exchange (ETDEWEB)

    Calderon, S.N.; Bertha, C.M.; Rice, K.C. [National Inst. of Diabetes and Digestive and Kidney Diseases, Medicinal Chemistry Lab., Bethesda, MD (United States); Gutkind, J.S. [National Inst. of Dental Research, Bethesda, MD (United States); Heng Xu; Partilla, J.S.; Rothman, R.B. [National Inst. on Drug Abuse, Clinical Psychopharmacology Section, Baltimore, MD (United States)


    The synthesis of unlabelled and labelled SNC 121, a selective nonpeptide ligand for the delta opioid receptor is reported. [{sup 3}H]SNC 121 of specific activity of 26.8 Ci/mmol, was synthesized by catalytic tritiation of the optically pure precursor SNC 80. (author).

  5. 77 FR 60966 - Marine Mammals; File No. 16239 (United States)


    ..., proposed energy and construction areas; (2) movement patterns of marine mammal species most at risk; and (3... DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration RIN 0648-XC268 Marine Mammals; File No. 16239 AGENCY: National Marine Fisheries Service (NMFS), National Oceanic and Atmospheric...

  6. Relationships of the Pachydactylus rugosus group of geckos ...

    African Journals Online (AJOL)

    We examined phylogenetic relationships of the Pachydactylus rugosus complex using DNA sequence data from segments of the mitochondrial genes ... Further, high levels of sequence divergence observed between currently recognized subspecies (19.1–26.8 % for cyt b), even across short geographic distances, support ...

  7. The Cape horse mackerel Trachurus trachurus capensis is the most ...

    African Journals Online (AJOL)


    25 cm being sampled by the latter. Also, the .... Parallel trawl comparison tests .... fish (>27 cm). The modal length of the fish in both. 268. A Decade of Namibian Fisheries Science. South African Journal of Marine Science 23. 2001. B. A C W u.

  8. The SILCC (SImulating the LifeCycle of molecular Clouds) project - I. Chemical evolution of the supernova-driven ISM

    Czech Academy of Sciences Publication Activity Database

    Walch, S.; Girichidis, P.; Naab, T.; Gatto, A.; Glover, S.C.O.; Wünsch, Richard; Klessen, R.S.; Clark, P.C.; Peters, T.; Derigs, D.; Baczynski, C.


    Roč. 454, č. 1 (2015), s. 238-268 ISSN 0035-8711 R&D Projects: GA ČR GAP209/12/1795 Institutional support: RVO:67985815 Keywords : magnetodydrodynamics * ISM clouds * ISM evolution Subject RIV: BN - Astronomy , Celestial Mechanics, Astrophysics Impact factor: 4.952, year: 2015

  9. Correlations between two different methods to score bleeding and the relationship with plaque in systemically healthy young adults

    NARCIS (Netherlands)

    Oliveira, S.C.; Slot, D.E.; Celeste, R.K.; Abegg, C.; Keijser, B.J.F.; Weijden, F.A. van der


    Aim To evaluate the correlation between bleeding on marginal probing (BOMP) and bleeding on pocket probing (BOPP), and the correlation of both bleeding indices with plaque. Materials and Methods This cross-sectional study screened 336 participants, from which 268 were eligible for examination and

  10. PFP Commercial Grade Food Pack Cans for Plutonium Handling and Storage Critical Characteristics

    International Nuclear Information System (INIS)



    This document specifies the critical characteristics for Commercial Grade Items (CGI) procured for PFP's Vault Operations system as required by HNF-PRO-268 and HNF-PRO-1819. These are the minimum specifications that the equipment must meet in order to perform its safety function

  11. Acetylated starch of Ofada rice as a sustained polymer in ...

    African Journals Online (AJOL)

    Objectives: To formulate and evaluate repaglinide microspheres using acetylated starch of the indigenous rice species Oryza glaberrima Steud (Ofada) as polymer. Materials and Methods: Ofada rice starch was acetylated with acetic anhydride in pyridine (DS 2.68) and characterized for morphology (Scanning electron ...

  12. Growth and Evaporation of Aerosol Particles in the Presence of Adsorbable Gases

    Czech Academy of Sciences Publication Activity Database

    Levdansky, V.V.; Smolík, Jiří; Ždímal, Vladimír; Moravec, Pavel


    Roč. 45, č. 18 (2002), s. 3831-3837 ISSN 0017-9310 R&D Projects: GA AV ČR IAA4072205; GA ČR GA104/02/1079 Keywords : evaporation * aerosol particles * gas Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.268, year: 2002

  13. PFP vault operations containers for Plutonium Handling and Storage Critical Characteristics

    International Nuclear Information System (INIS)



    This document specifies the critical characteristics for containers procured for Plutonium Finishing Plant's (PFP's) Vault Operations system as required by HNF-PRO-268 and HNF-PRO-1819. These are the minimum specifications that the equipment must meet in order to perform its safety function

  14. Qualitative analysis of trapped Dirac fermions in graphene

    Czech Academy of Sciences Publication Activity Database

    Jakubský, Vít; Krejčiřík, David


    Roč. 349, OCT (2014), s. 268-287 ISSN 0003-4916 R&D Projects: GA ČR(CZ) GA14-06818S Institutional support: RVO:61389005 Keywords : graphene * Dirac fermion * confinement * Varitional principle Subject RIV: BE - Theoretical Physics Impact factor: 2.103, year: 2014

  15. Structural and Functional Characterization of the Wnt Inhibitor APC Membrane Recruitment 1 (Amer1)

    Czech Academy of Sciences Publication Activity Database

    Tanneberger, K.; Pfister, A.S.; Kříž, Vitězslav; Bryja, Vítězslav; Schambony, A.; Behrens, J.


    Roč. 268, č. 22 (2011), s. 19204-19214 ISSN 0021-9258 R&D Projects: GA ČR(CZ) GC204/09/J030 Institutional support: RVO:68081707 Keywords : BETA-CATENIN * SIGNALING PATHWAY * EMBRYONIC AXIS Subject RIV: BO - Biophysics Impact factor: 4.773, year: 2011

  16. Probes for narcotic receptor mediated phenomena 22. Pt.1: Synthesis and characterization of optically pure [3H](+)-4-[(αR)-α-((2S,5R)-4-propyl-2,5-dimethyl-1-pi perazinyl)-3-methoxybenzyl]-N,N-diethylbenzamide, [3H]SNC 121, a novel high affinity and selective ligand for delta opioid receptors

    International Nuclear Information System (INIS)

    Calderon, S.N.; Bertha, C.M.; Rice, K.C.; Gutkind, J.S.; Heng Xu; Partilla, J.S.; Rothman, R.B.


    The synthesis of unlabelled and labelled SNC 121, a selective nonpeptide ligand for the delta opioid receptor is reported. [ 3 H]SNC 121 of specific activity of 26.8 Ci/mmol, was synthesized by catalytic tritiation of the optically pure precursor SNC 80. (author)

  17. Ecological restoration of central European mining sites: a summary of a multi-site analysis

    Czech Academy of Sciences Publication Activity Database

    Prach, Karel; Řehounková, Klára; Řehounek, J.; Konvalinková, Petra


    Roč. 36, č. 2 (2011), 263-268 ISSN 0142-6397 R&D Projects: GA AV ČR IAA600050702 Institutional research plan: CEZ:AV0Z60050516 Keywords : ecological restoration * mining * succession Subject RIV: EH - Ecology, Behaviour Impact factor: 0.677, year: 2011

  18. Performance evaluation of prototype mechanical cassava harvester ...

    African Journals Online (AJOL)

    Large-scale cassava harvesting, especially during the dry season, is a major constraint to its industrial demand and commercial production. Manual harvesting is slow and ... Results from field trials showed prototype harvesters weighing 268 – 310 kg can achieve optimum performance on ridged landforms. When harvested ...

  19. Pediatric Palliative Care: A Personal Story

    Medline Plus

    Full Text Available ... Health - Meriter 252,222 views 13:34 Teen Cancer Stories | UCLA Daltrey/Townshend Teen & Young Adult Cancer Program - Duration: 11:08. UCLA Health 268,713 ... views 5:27 The Ugly Truth of Pediatric Cancer - Duration: 5:21. KidsCancerChannel 64,186 views 5: ...

  20. Production of human papillomavirus type16 E7 oncoprotein fused with ß-glucuronidase in transgenic tomato and potato

    Czech Academy of Sciences Publication Activity Database

    Bříza, Jindřich; Pavingerová, Daniela; Vlasák, Josef; Ludvíková, V.; Niedermeierová, Hana


    Roč. 51, č. 2 (2007), s. 268-276 ISSN 0006-3134 R&D Projects: GA ČR GA521/05/2092 Institutional research plan: CEZ:AV0Z50510513 Keywords : transgenic plants * human papillomavirus Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.259, year: 2007

  1. The Free Energy in the Derrida-Retaux Recursive Model (United States)

    Hu, Yueyun; Shi, Zhan


    We are interested in a simple max-type recursive model studied by Derrida and Retaux (J Stat Phys 156:268-290, 2014) in the context of a physics problem, and find a wide range for the exponent in the free energy in the nearly supercritical regime.

  2. Contribution of forest restoration to rural livelihoods and household income in Indonesia

    DEFF Research Database (Denmark)

    Widianingsih, Nayu Nuringdati; Theilade, Ida; Pouliot, Mariéve


    restoration area in Sumatra, Indonesia. Survey data were collected on 268 households, with a four-month recall period and three repeat visits to each selected household within a year. Random sampling was applied to select households in five villages and five Batin Sembilan (indigenous) semi-nomadic groups...

  3. Stress Carry-Over and College Student Health Outcomes (United States)

    Pedersen, Daphne E.


    Objective: Using a stress carry-over perspective, this study examines the relationship between stress stemming from school and family domains and physical and mental health outcomes. Methods: The study sample included 268 undergraduate men and women from a Midwestern university. Participants completed an anonymous online questionnaire. OLS…

  4. Economic Efficiency of Maize Production in Yola North Local ...

    African Journals Online (AJOL)


    Table 2. mean effects of two location on the properties of the undisturbed soil samples. Location ... 12.0. 37.8. LSD. NS. NS. NS. NS. NS. CV. 32.8. 12.9. 26.8. 25.4. 31.6. BD: Bulk density. ... brain damage; produce tumour. 0.01. Nickel.

  5. Depressive symptoms in adolescence : Longitudinal links with maternal empathy and psychological control

    NARCIS (Netherlands)

    Werner, Lente L. A. A.; Van der Graaff, Jolien; Meeus, W.H.J.; Branje, Susan J. T.

    Building on self-determination theory (Deci and Ryan in Psychological Inquiry, 11, 227-268. doi:10.1207/S15327965PLI1104_01, 2000), the aim of the current study was to examine the role of maternal affective and cognitive empathy in predicting adolescents' depressive symptoms, through mothers'

  6. Depressive Symptoms in Adolescence: Longitudinal Links with Maternal Empathy and Psychological Control

    NARCIS (Netherlands)

    Werner, L.A.A.; van der Graaff, J.; Meeus, W.H.J.; Branje, S.J.T.


    Building on self-determination theory (Deci and Ryan in Psychological Inquiry, 11, 227-268. doi:10.1207/ S15327965PLI1104_01, 2000), the aim of the current study was to examine the role of maternal affective and cognitive empathy in predicting adolescents’ depressive symptoms, through mothers’

  7. Constructing "Deservingness": DREAMers and Central American Unaccompanied Children in the National Immigration Debate (United States)

    Pérez Huber, Lindsay


    Utilizing a Latina/o Critical Theory framework (LatCrit), I examine the narratives that emerged within national newsprint media coverage of DREAMers and Central American unaccompanied children. Data included 268 newspaper articles published during periods of heightened national media attention about DREAMers (96 articles) and Central American…

  8. 76 FR 30027 - Land Disposal Restrictions: Site-Specific Treatment Variance for Hazardous Selenium-Bearing Waste... (United States)


    ... Restrictions: Site-Specific Treatment Variance for Hazardous Selenium-Bearing Waste Treated by U.S. Ecology... treatment of a hazardous waste generated by the Owens-Brockway Glass Container Company in Vernon, California... action. List of Subjects in 40 CFR Part 268 Environmental protection, Hazardous waste, and Variances...

  9. 75 FR 32210 - United States v. Idaho Orthopaedic Society, Timothy Doerr, Jeffrey Hessing, Idaho Sports Medicine... (United States)


    ..., Jeffrey Hessing, Idaho Sports Medicine Institute, John Kloss, David Lamey, and Troy Watkins; Proposed... Sports Medicine Institute, John Kloss, David Lamey, and Troy Watkins, Civil Case No. 10-268. On May 28..., Jeffrey Hessing, Idaho Sports Medicine Institute, John Kloss, David Lamey, and Troy Watkins, Defendants...

  10. Articulation Matrix for Home Health Aide, Nursing Assistant, Patient Care Assistant, Practical Nursing. (United States)

    Florida State Univ., Tallahassee. Center for Instructional Development and Services.

    This document demonstrates the relationships among four Florida nursing education programs (home health aide, nursing assistant, patient care assistant, and practical nursing) by listing student performance standards and indicating which ones are required in each program. The 268 student performance standards are arranged in 23 areas of…

  11. download full text

    African Journals Online (AJOL)

    ... country and mass migration of the farming communities to IDP camps in major cities ..... "Global Warming Impact: Flood Events, Wet-Dry Conditions and Changing ... Global Environmental Change, Vol. 16, pp. 268-281.Web. Adger, W. N. (1999). "Social Vulnerability to Climate Change and Extremes in Coastal Vietnam.

  12. 77 FR 21476 - Final Flood Elevation Determinations (United States)


    ... State Highway 115. Black River Approximately 9,000 feet +268 City of Pocahontas, downstream of the... the confluence with +269 City of Pocahontas, the Black River. Unincorporated Areas of Randolph County...). Swan Creek At the confluence with +69 City of Lambertville. the Delaware River. Approximately 40 feet...

  13. 76 FR 46719 - Western Pacific Bottomfish and Seamount Groundfish Fisheries; 2011-12 Main Hawaiian Islands Deep... (United States)


    ... Fisheries Service (NMFS), National Oceanic and Atmospheric Administration (NOAA), Commerce. ACTION: Proposed... 268,089 lb (121,603 kg). In general, the relative importance of MHI bottomfish to commercial participants as a percentage of overall fishing or household income is unknown, as the total suite of fishing...

  14. Applying Western models of volunteering in Hong Kong : The role of empathy, prosocial motivation and motive-experience fit for volunteering

    NARCIS (Netherlands)

    Aydinli, A.; Bender, M.; Chong, A.; Yue, X.


    The present research investigates the applicability of prominent Western volunteering frameworks in Hong Kong. Two cross-sectional surveys involving a total of 268 respondents were conducted. In Study 1, we tested a model of volunteering among 149 Hong Kong Chinese adult individuals (Mage = 34.8

  15. 77 FR 22229 - Hazardous Waste Technical Corrections and Clarifications Rule (United States)


    ... requirements under the Land Disposal Restrictions (``LDR'') regulatory program (53 FR 31138, August 17, 1988... recyclers using recyclable materials in a manner constituting disposal. This provision included a reference... 266.20(b) alerting recyclers to the LDR certification and notification requirements in 40 CFR 268.7(b...

  16. Food and feeding of sperm whales physeter macrocephalus off the ...

    African Journals Online (AJOL)

    The stomach contents of 1 268 sperm whales Physeter macrocephalus processed at the Donkergat whaling station, South Africa, were examined during the 1962 and 1963 whaling seasons. Results were compared with. Clarkefs analysis of cephalopod beaks collected in 1963 (Clarke 1980). There was no significant ...

  17. Development of risk-taking: contributions from adolescent testosterone and the orbito-frontal cortex

    NARCIS (Netherlands)

    Peper, J.S.; Koolschijn, P.C.M.P.; Crone, E.A.


    The role of puberty in the development of risk taking remains poorly understood. Here, in a normative sample of 268 participants between 8 and 25 years old, we applied a psycho-endocrine neuroimaging approach to investigate the contribution of testosterone levels and OFC morphology to individual

  18. Genetics Home Reference: monoamine oxidase A deficiency (United States)

    ... Cases O, Seif I, Grimsby J, Gaspar P, Chen K, Pournin S, Müller U, Aguet M, Babinet C, Shih JC, et al. Aggressive behavior and altered amounts of brain serotonin and norepinephrine in mice lacking MAOA. Science. 1995 Jun 23;268(5218):1763-6. Citation on ...

  19. Body mass dynamics of Daphnia in the context of life history theory: an approach based on contribution analysis (in Russian, Abstract in English)

    NARCIS (Netherlands)

    Polishchuk, L.; Vijverberg, J.


    In this paper, we elaborate on the method of contribution analysis in relation to body mass dynamics which has been proposed recently (Polishchuk, Vijverberg, 2005. Oecologia. V. 144. P. 268-277). We suggest that contribution analysis as applied to body mass dynamics makes a bridge between

  20. An item response theory analysis of Harter’s self-perception profile for children or why strong clinical scales should be distrusted

    NARCIS (Netherlands)

    Egberink, I.J.L.; Meijer, R.R.


    The authors investigated the psychometric properties of the subscales of the Self-Perception Profile for Children with item response theory (IRT) models using a sample of 611 children. Results from a nonparametric Mokken analysis and a parametric IRT approach for boys (n = 268) and girls (n = 343)

  1. An item response theory analysis of Harter's Self-Perception Profile for Children or why strong clinical scales should be distrusted

    NARCIS (Netherlands)

    Egberink, Iris J. L.; Meijer, Rob R.

    The authors investigated the psychometric properties of the subscales of the Self-Perception Profile for Children with item response theory (IRT) models using a sample of 611 children. Results from a nonparametric Mokken analysis and a parametric IRT approach for boys (n = 268) and girls (n = 343)

  2. Marital Conflict and Adolescents' Peer Aggression: The Mediating and Moderating Role of Mother-Child Emotional Reciprocity (United States)

    Lindsey, Eric W.; Chambers, Jessica Campbell; Frabutt, James M.; Mackinnon-Lewis, Carol


    This study examined the role of mother-adolescent emotional reciprocity in connections between marital conflict and adolescent aggression with peers. Data were collected from a racially diverse community sample of 268 adolescents and their mothers. Adolescents reported on parents' marital conflict, and mother-adolescent positive and negative…

  3. Effects of damage to auditory cortex on the discrimination of speech sounds by rats

    Czech Academy of Sciences Publication Activity Database

    Floody, O. R.; Ouda, Ladislav; Porter, B. A.; Kilgard, M. P.


    Roč. 101, č. 2 (2010), s. 260-268 ISSN 0031-9384 R&D Projects: GA ČR GA309/07/1336 Institutional research plan: CEZ:AV0Z50390703 Keywords : auditory cortex * brain lesions * prepulse inhibition Subject RIV: FH - Neurology Impact factor: 2.891, year: 2010

  4. A genome-wide scan in affected sibling pairs with idiopathic recurrent miscarriage suggests genetic linkage

    DEFF Research Database (Denmark)

    Kolte, Astrid Marie; Nielsen, H S; Moltke, Ida


    Previously, siblings of patients with idiopathic recurrent miscarriage (IRM) have been shown to have a higher risk of miscarriage. This study comprises two parts: (i) an epidemiological part, in which we introduce data on the frequency of miscarriage among 268 siblings of 244 patients with IRM...

  5. Patogeneze klíšťové encefalitidy a možnosti antivirové terapie

    Czech Academy of Sciences Publication Activity Database

    Růžek, Daniel


    Roč. 64, č. 4 (2015), s. 204-209 ISSN 1210-7913 Institutional support: RVO:60077344 Keywords : virus klíšťové encefalitidy * klíšťová encefalitida * antivirová terapie * patogeneze Subject RIV: EC - Immunology Impact factor: 0.268, year: 2015

  6. Performance of an undulator for visible and UV FELs at FELI

    Energy Technology Data Exchange (ETDEWEB)

    Miyauchi, Y.; Zako, A.; Koga, A. [Free Electron Laser Research Institute, Inc., Osaka (Japan)] [and others


    Two infrared free electron lasers (FELs) of the FELI project are now operating in the wavelength range of 1-20{mu}m. A 2.68-m undulator has been constructed for visible and UV FELs covering the wavelength of 1-0.2{mu}m for 100-165 MeV electron beams. It generates alternating, horizontal magnetic field, and wiggles electron beam on a vertical plane. The undulator length and period are 2.68m and 40mm, respectively. The gap of undulator magnets can be changed remotely by using servomotors with an accuracy of 1 {mu}m from the control room. The maximum K-value and related magnetic field strength are 1.9 and 0.5T, respectively, when its gap is set to the minimum value of 16mm. In order to minimize magnetic field reduction due to radiation damage, Sm-Co permanent magnet was adopted. Its structure and the results of magnetic field measurement will be reported.

  7. Colorectal cancer in patients with inflammatory bowel disease

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Halfvarson, Jonas; Vogel, Ulla Birgitte


    The inflammatory bowel diseases (IBD), Crohn's disease (CD) and ulcerative colitis (UC), may be complicated by colorectal cancer (CRC). In a recent population-based cohort study of 47 347 Danish patients with IBD by Tine Jess and colleagues 268 patients with UC and 70 patients with CD developed C...... preventive strategies in order to avoid CRC in IBD patients. The achieved knowledge may also be relevant for other inflammation-associated cancers.......The inflammatory bowel diseases (IBD), Crohn's disease (CD) and ulcerative colitis (UC), may be complicated by colorectal cancer (CRC). In a recent population-based cohort study of 47 347 Danish patients with IBD by Tine Jess and colleagues 268 patients with UC and 70 patients with CD developed CRC...... during 30 years of observation. The overall risk of CRC among patients with UC and CD was comparable with that of the general population. However, patients diagnosed with UC during childhood or as adolescents, patients with long duration of disease and those with concomitant primary sclerosing...

  8. Effects of ambient temperature and early open-field response on the behaviour, feed intake and growth of fast- and slow-growing broiler strains

    DEFF Research Database (Denmark)

    Nielsen, Birte Lindstrøm


    Increased activity improves broiler leg health, but also increases the heat production of the bird. This experiment investigated the effects of early open-field activity and ambient temperature on the growth and feed intake of two strains of broiler chickens. On the basis of the level of activity...... in an open-field test on day 3 after hatching, fast-growing Ross 208 and slow-growing i657 chickens were allocated on day 13 to one of the 48 groups. Each group included either six active or six passive birds from each strain and the groups were housed in floor-pens littered with wood chips and fitted...... with two heat lamps. Each group was fed ad libitum and subjected to one of the three temperature treatments: two (HH; 268C), one (HC; 168C to 268C) or no (CC; 168C) heat lamps turned on. Production and behavioural data were collected every 2 weeks until day 57. For both strains, early open-field activity...

  9. Coulomb excitations of low lying levels in 127I and 197Au

    International Nuclear Information System (INIS)

    Singh, K.P.; Tayal, D.C.; Hans, H.S.


    The low-lying levels of 127 I and 197 Au were Coulomb excited with 3.54 to 4.2 MeV protons. The reduced quadrupole transition probabilities of the 203, 374.9, 418, 618.4, 628.7, 651.1 and 745.5 keV states of 127 I, and the 268.8, 278.9, 502, and 547.5 keV states of 197 Au was measured from Coulomb excitation by observing the de-excitation gamma rays with a high resolution Ge(Li) detector. The low-energy protons were used for the first time to Coulomb-excite the two levels at 618.4 and 651.1 keV of 127 I and one level at 502 keV of 197 Au. The present experimental results are found in agreement with the existing experimental data except the B(E2) value of the level at 268.8 keV of 197 Au. (author). 4 figs., 4 tabs., 32 refs

  10. Yeast Interacting Proteins Database: YDL239C, YGR268C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available of a Don1p-containing structure at the leading edge of the prospore membrane via interaction with spindle p...sembly of a Don1p-containing structure at the leading edge of the prospore membrane via interaction with spi

  11. Manipulation of food intake and weight dynamics using retrograde neural gastric electrical stimulation in a chronic canine model

    NARCIS (Netherlands)

    Aelen, P.; Neshev, E.; Cholette, M.; Crisanti, K.; Mitchell, P.; De bru, E.; Church, N.; Mintchev, M.P.


    Neural gastric electrical stimulation (NGES) could be a new technique for treating obesity. However, chronic animal experimentation exploring the efficacy of this therapy is lacking. In this study we investigated the utility of retrograde NGES in a chronic canine model. Nine mongrel dogs (26.8 ± 5.2

  12. Frazzled by Facebook? An Exploratory Study of Gender Differences in Social Network Communication among Undergraduate Men and Women (United States)

    Thompson, Sharon H.; Lougheed, Eric


    Although a majority of young adults are members of at least one social networking site, peer reviewed research examining gender differences in social networking communication is sparse. This study examined gender differences in social networking, particularly for Facebook use, among undergraduates. A survey was distributed to 268 college students…

  13. Factors Influencing the Outcomes in Extradural Haematoma Patients

    African Journals Online (AJOL)

    was recorded for only 30.8% of the patients. Other common symptoms included headaches (32.6%) and nausea (29.5%). Additional neurological symptoms that were encountered were confusion (27.7%), focal limb weakness (26.8%), convulsions (14.7%), memory loss (6.7%), visual disturbances (5%) and sensory deficits ...

  14. 75 FR 9439 - FM Approvals: Application for Expansion of Recognition; Wyle Laboratories: Voluntary Modification... (United States)


    ... superseded by UL 153. UL 268A Smoke Detectors for Duct Application UL 484 Room Air Conditioners UL 521 Heat... Transformers and Motor Transformer for Use in Audio-, Radio-, and Television-Type Appliances UL 1412 Fusing... Halon 1211 Recovery/Recharge Equipment UL 2111 Overheating Protection for Motors III. Temporary...

  15. Methods for Determination of Bioaccessibility and Bioavailability of Hydrophobic Organic Pollutants

    Czech Academy of Sciences Publication Activity Database

    Čvančarová, Monika; Cajthaml, Tomáš


    Roč. 109, č. 4 (2015), s. 254-268 ISSN 0009-2770 R&D Projects: GA TA ČR TE01020218; GA ČR GA13-28283S Institutional support: RVO:61388971 Keywords : bioremediation * bioaccumulation * environmental risk assessment Subject RIV: EE - Microbiology, Virology Impact factor: 0.279, year: 2015

  16. Level of Farmers' Participation In The International Institute Of ...

    African Journals Online (AJOL)


    ( X =2.68), while consumers had link with farmers ( X =2.72). The major ... objectives, motivation, extension approaches and sources of funding. This means ... actors and the organizational and institutional learning behaviors and practices .... more the consumers rice preference is satisfied, the stronger their link with farmers ...

  17. Browse Title Index

    African Journals Online (AJOL)

    Items 201 - 250 of 268 ... Journal of Pharmaceutical and Allied Sciences. ... of Poloxamer 188 solid dispersions of Indomethacin, Abstract ... Vol 10, No 2 (2013), Prescription pattern of anxiolytic drugs in burn patients: a case study of national ... in two selected secondary health facilities in Bayelsa State of Nigeria, Abstract.

  18. 78 FR 54178 - Virginia: Final Authorization of State Hazardous Waste Management Program Revisions (United States)


    ... XIX Academic Laboratories 73 FR 72912, 9 VAC Sec. Sec. 20- Generator Standards, Revision December 1... 17, 60-18, 20-60-261 A, Hazardous Constituents, 2010. 20-60-268 A. Revision Checklist 225. Academic... steps to eliminate drafting errors and ambiguity, minimize potential litigation, and provide a clear...

  19. A magnetic filter with permanent magnets on the basis of rare earths

    Czech Academy of Sciences Publication Activity Database

    Žežulka, Václav; Straka, Pavel; Mucha, Pavel


    Roč. 268, - (2004), s. 219-226 ISSN 0304-8853 R&D Projects: GA AV ČR IBS3046004 Institutional research plan: CEZ:AV0Z3046908 Keywords : magnetic filtration * rare earth magnets * high gradient magnetic Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.031, year: 2004

  20. Effects of bovine prolactin gene polymorphism within exon 4 on milk ...

    African Journals Online (AJOL)

    In this study, polymorphism of prolactin gene was analyzed as a candidate gene responsible for variation and genetic trends in milk yield and composition traits. Genomic DNAs were extracted from 268 semen samples belonged to Iranian Holstein bulls. Genotyping for the prolactin gene using PCRRFLP technique and RsaI ...

  1. Hyperthyreoidie, radioactief jodium en daarna.

    NARCIS (Netherlands)

    Grient, Anton Jacobus van der


    The cause of hyperthyroidism is unknown. The methods available for treating this disease are thus limited to decreasing the hyperfunction of the gland by drugs, or eliminating a large pan of the gland by surgical removal or radiation. From 1959 to 1967 268 cases of hyperthyroidism were treated with

  2. 77 FR 77217 - Fiscal Year 2012 Annual Report to Congress on the Trade Adjustment Assistance for Firms Program (United States)


    ... productivity was about a 4 percent increase.'' \\1\\ GAO also noted in the report that manufacturing firms, specifically, associate the TAAF program with increased sales and productivity. \\1\\ U.S. Government... percent, an average sales increase of 26.8 percent, and an average productivity increase of 11.9 percent...

  3. Self-Perceived Stability and Change in Children's Competence (United States)

    Vandenplas-Holper, Christiane; Roskam, Isabelle; Fontaine, Anne-Marie


    Using Harter's ("Child Dev" 53(1):87-97, 1982) perceived competence scale, this study integrates several paradigms related to the issues of self-perceived competence, stability or change and attributional theory. It examines how 268 Belgian and Portuguese fifth graders consider their scholastic, social and physical competence at present…

  4. 76 FR 13536 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2C10 (Regional Jet Series 700, 701, & 702... (United States)


    ...., Monday through Friday, except Federal holidays. For service information identified in this proposed AD...., Monday through Friday, except Federal holidays. The AD docket contains this proposed AD, the regulatory..., 135, 139, 142, 145, 146, 266, 268, 271, 274, 276, 277, 280, 282 through 285 inclusive, 290, 292, 294...

  5. An Investigation of Calculus Learning Using Factorial Modeling. (United States)

    Dick, Thomas P.; Balomenos, Richard H.

    Structural covariance models that would explain the correlations observed among mathematics achievement and participation measures and related cognitive and affective variables were developed. A sample of college calculus students (N=268; 124 females and 144 males) was administered a battery of cognitive tests (including measures of spatial-visual…

  6. Separating the wheat from the chaff: Dating charred plant remains extracted from Daub (with reference to the 14C chronology of the Epi-Lengyel culture in Upper Silesia)

    Czech Academy of Sciences Publication Activity Database

    Chmielewski, T. J.; Sady, A.; Goslar, T.; Furmanek, M.; Juchelka, Jiří


    Roč. 59, č. 1 (2017), s. 251-268 ISSN 0033-8222 Institutional support: RVO:68081758 Keywords : food residue * dates * pottery * bones * ams * radiocarbon AMS dating * chaff temper dating * Eneolithic * epi-Lengyel * Upper Silesia Subject RIV: AC - Archeology, Anthropology, Ethnology OBOR OECD: Archaeology Impact factor: 1.280, year: 2016

  7. Changing strategies of the retrograde approach for chronic total occlusion during the past 7 years

    NARCIS (Netherlands)

    Muramatsu, Toshiya; Tsukahara, Reiko; Ito, Yoshiaki; Ishimori, Hiroshi; Park, Seung-Jung; de Winter, Robert; Shokry, Khaled; Wang, Lefeng; Chen, Jiyan; Wang, Haichang


    We reviewed the technical changes and results achieved with the retrograde approach since we introduced it 7 years ago. The subjects were 1,268 patients who were treated for CTO between January 2004 and December 2010. They were investigated with respect to the success rate, the frequency of

  8. Determinants of full valid vaccine dose administration among 12-32 ...

    African Journals Online (AJOL)


    Urban residence 2.6 (95% CI: 2.50, 2.68), mothers with age groups of 21-34 and >35 were 1.26 (95% CI: 1.22, ... adherence to vaccination schedule also has an effect on it. (2, 3). ..... well as knowledge, attitude and practice of service users in ...

  9. Relationship between starch and lipid accumulation induced by nutrient depletion and replenishment in the microalga Parachlorella kessleri

    Czech Academy of Sciences Publication Activity Database

    Fernandes, B.; Teixeira, J.; Dragone, G.; Vicente, A. A.; Kawano, S.; Bišová, Kateřina; Přibyl, Pavel; Zachleder, Vilém; Vítová, Milada


    Roč. 144, SEP 2013 (2013), s. 268-274 ISSN 0960-8524 R&D Projects: GA MŠk LH12145; GA TA ČR TE01020080 Institutional support: RVO:61388971 ; RVO:67985939 Keywords : Lipids * Nutrient depletion * Nutrient replenishment Subject RIV: EE - Microbiology, Virology Impact factor: 5.039, year: 2013

  10. The impact of patients reported flares on functional impairment in rheumatoid arthritis patients with low-disease activity

    DEFF Research Database (Denmark)

    Küttel, Dorota Paulina; Christensen, R.; Primdahl, J.


    -term outcomes. Objectives: To investigate whether transient patient reported flares can influence functional disability in patients with established low active RA. Methods: Out of 287 patients from the AMBRA trial (1), 268 RA patients with low disease activity (DAS28CRP MCID of 0.22) was compared across three...

  11. Classroom Organization and Teacher Stress Predict Learning Motivation in Kindergarten Children (United States)

    Pakarinen, Eija; Kiuru, Noona; Lerkkanen, Marja-Kristiina; Poikkeus, Anna-Maija; Siekkinen, Martti; Nurmi, Jari-Erik


    This study examined the extent to which observed teaching practices and self-reported teacher stress predict children's learning motivation and phonological awareness in kindergarten. The pre-reading skills of 1,268 children were measured at the beginning of their kindergarten year. Their learning motivation and phonological awareness were…

  12. 78 FR 71557 - Radio Broadcasting Services; Tohatchi, New Mexico (United States)


    ...] Radio Broadcasting Services; Tohatchi, New Mexico AGENCY: Federal Communications Commission. ACTION... Channel 268C2, Tohatchi, New Mexico, as a first local service under the Tribal Priority. A staff... [Amended] 0 2. Section 73.202(b), the Table of FM Allotments under New Mexico, is amended by adding...

  13. the prospects, impacts, and research challenges of enhanced ...

    African Journals Online (AJOL)


    36, No. 1, January 2017 268 research needs for enhanced CE production are recommended to serve .... uncatalyzed steam explosion (USE) and liquid hot water. (LHW). USE refers to .... produced is fed into a catalytic reactor where the gas is converted to ethanol .... innovative design of bioreactors for integrated processes.

  14. Monogenic diabetes syndromes

    DEFF Research Database (Denmark)

    Astuti, Dewi; Sabir, Ataf; Fulton, Piers


    (n = 268), and SLC19A2 (n = 48) for Wolfram type 1, Wolfram type 2, Alström, and Thiamine-responsive megaloblastic anemia syndromes, respectively; and included 23 previously unpublished novel germline variants in WFS1 and 17 variants in ALMS1. We then investigated genotype-phenotype relations...

  15. 76 FR 17787 - Market Dominant Negotiated Service Agreement (NSA) for First-Class Mail and Standard Mail (United States)


    ... POSTAL SERVICE 39 CFR Part 111 Market Dominant Negotiated Service Agreement (NSA) for First- Class....1, to establish a new Negotiated Service Agreement (NSA) Market Dominant product for First-Class... Gifford at 202-268-8082. SUPPLEMENTARY INFORMATION: This new NSA for First-Class Mail and Standard Mail is...

  16. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    The photoluminescence properties of the synthesized molecules are influenced by peripheral amines. ... used hole transporters. Thermal studies also reveal that these synthesized molecules have good thermal stability with 5% and 10% weight loss temperature ranging from 200 to 355°C and 268 to 442°C, respectively.

  17. Thoracic wall lipoblastoma: a rare case with rare presentation

    African Journals Online (AJOL)

    Sama Savli Road, 390024 Vadodara, Gujarat. Tel: +919879609195; e-mail: Received 14 December 2011 accepted 16 January .... lipoblastoma involving the right common iliac artery and vein. Eur J Pediatr. Surg 2003; 13:268–271. 6 Lorenzen JC, Godballe C, Kerndrup GB. Lipoblastoma of the ...

  18. The electrostatic role of the Zn-Cys2His2 complex in binding of operator DNA with transcription factors: mouse EGR-1 from the Cys2His2 family. (United States)

    Chirgadze, Y N; Boshkova, E A; Polozov, R V; Sivozhelezov, V S; Dzyabchenko, A V; Kuzminsky, M B; Stepanenko, V A; Ivanov, V V


    The mouse factor Zif268, known also as early growth response protein EGR-1, is a classical representative for the Cys2His2 transcription factor family. It is required for binding the RNA polymerase with operator dsDNA to initialize the transcription process. We have shown that only in this family of total six Zn-finger protein families the Zn complex plays a significant role in the protein-DNA binding. Electrostatic feature of this complex in the binding of factor Zif268 from Mus musculus with operator DNA has been considered. The factor consists of three similar Zn-finger units which bind with triplets of coding DNA. Essential contacts of the factor with the DNA phosphates are formed by three conservative His residues, one in each finger. We describe here the results of calculations of the electrostatic potentials for the Zn-Cys2His2 complex, Zn-finger unit 1, and the whole transcription factor. The potential of Zif268 has a positive area on the factor surface, and it corresponds exactly to the binding sites of each of Zn-finger units. The main part of these areas is determined by conservative His residues, which form contacts with the DNA phosphate groups. Our result shows that the electrostatic positive potential of this histidine residue is enhanced due to the Zn complex. The other contacts of the Zn-finger with DNA are related to nucleotide bases, and they are responsible for the sequence-specific binding with DNA. This result may be extended to all other members of the Cys2His2 transcription factor family.

  19. Stress-induced resistance to the fear memory labilization/reconsolidation process. Involvement of the basolateral amygdala complex. (United States)

    Espejo, Pablo Javier; Ortiz, Vanesa; Martijena, Irene Delia; Molina, Victor Alejandro


    Consolidated memories can enter into a labile state after reactivation followed by a restabilization process defined as reconsolidation. This process can be interfered with Midazolam (MDZ), a positive allosteric modulator of the GABA-A receptor. The present study has evaluated the influence of prior stress on MDZ's interfering effect. We also assessed the influence of both systemic and intra-basolateral amygdala (BLA) infusion of d-cycloserine (DCS), a partial agonist of the NMDA receptors, on the MDZ effect in previously stressed rats. Furthermore, we analyzed the effect of stress on the expression of Zif-268 and the GluN2B sites, two molecular markers of the labilization/reconsolidation process, following reactivation. The results revealed that prior stress resulted into a memory trace that was insensitive to the MDZ impairing effect. Both systemic and intra-BLA DCS administration previous to reactivation restored MDZ's disruptive effect on memory reconsolidation in stressed animals. Further, reactivation enhanced Zif-268 expression in the BLA in control unstressed rats, whereas no elevation was observed in stressed animals. In agreement with the behavioral findings, DCS restored the increased level of Zif-268 expression in the BLA in stressed animals. Moreover, memory reactivation in unstressed animals elevated GluN2B expression in the BLA, thus suggesting that this effect is involved in memory destabilization, whereas stressed animals did not reveal any changes. These findings are consistent with resistance to the MDZ effect in these rats, indicating that stress exposure prevents the onset of destabilization following reactivation. In summary, prior stress limited both the occurrence of the reactivation-induced destabilization and restabilization. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Cryptosporidiosis and Isosporiasis among HIV-positive individuals in south Ethiopia: a cross sectional study. (United States)

    Girma, Mekonnen; Teshome, Wondu; Petros, Beyene; Endeshaw, Tekola


    Cryptosporidium spp and I. belli are intestinal opportunistic infections associated with HIV/AIDS. A decline in the incidence of these opportunistic infections due to HAART was reported. We aim to investigate these parasites among HAART naïve and experienced HIV patients in south Ethiopia. A cross sectional study was carried out among 268 HIV- positive patients between January and September, 2007. Interview with questionnaires and document reviews were used to collect data. Stool samples were obtained from each patient and parasites were examined by direct, formol-ether and modified Ziehl-Neelsen stain for Cryptosporidium spp and I. belli. Univariate and multivariate analysis were carried out. Level of significance was set at p-value of 0.05. A total of 268 patients participated in the study. The mean age was 34.0 (±1 SD of 8.34) years. Females constituted 53.4% (143) of the study participants. Half of the study participants were on HAART; majorities (85.8%) of such patients were within the first year of treatment. The prevalence of Cryptosporidium spp was 34.3% (92/268) and I. belli was 1.5% (4/268). Dual infection was detected in two patients (0.75%). The crude analysis revealed significant reduction in the odds of Cryptosporidium spp infection among patients who have started HAART (crude OR = 0.59, 95% CI 0.35, 0.98). The adjusted analysis remained in the same direction but has lost significance (Adj OR 0.65, 95%CI 0.35, 1.24). No differences in the risk of developing infection with Cryptosporidium spp were observed between groups based on most recent CD4 counts, sex, duration on HAART and age (p > 0.05 for all variables). Patients with Cryptosporidium spp were more likely to report vomiting [Adj OR 2.34 (95% CI 1.22, 5.41)], weight loss [Adj OR 2.10 (95% CI 1.15, 3.81)] and chronic diarrhea [Adj OR 3.35 (95%CI 1.05, 10.63)]. There is high burden of infection with Cryptosporidium spp among HIV infected individuals in southern Ethiopia but that of I

  1. Role of protein structure and the role of individual fingers in zinc finger protein-DNA recognition: a molecular dynamics simulation study and free energy calculations (United States)

    Hamed, Mazen Y.


    Molecular dynamics and MM_GBSA energy calculations on various zinc finger proteins containing three and four fingers bound to their target DNA gave insights into the role of each finger in the DNA binding process as part of the protein structure. The wild type Zif 268 (PDB code: 1AAY) gave a ΔG value of - 76.1 (14) kcal/mol. Zinc fingers ZF1, ZF2 and ZF3 were mutated in one experiment and in another experiment one finger was cut and the rest of the protein was studied for binding. The ΔΔG values for the Zinc Finger protein with both ZF1 and ZF2 mutated was + 80 kcal/mol, while mutating only ZF1 the ΔΔG value was + 52 kcal/mol (relative to the wild type). Cutting ZF3 and studying the protein consisting only of ZF1 linked to ZF2 gave a ΔΔG value of + 68 kcal/mol. Upon cutting ZF1, the resulting ZF2 linked to ZF3 protein gave a ΔΔG value of + 41 kcal/mol. The above results shed light on the importance of each finger in the binding process, especially the role of ZF1 as the anchoring finger followed in importance by ZF2 and ZF3. The energy difference between the binding of the wild type protein Zif268 (1AAY) and that for individual finger binding to DNA according to the formula: ΔΔGlinkers, otherstructuralfactors = ΔGzif268 - (ΔGF1+F2+F3) gave a value = - 44.5 kcal/mol. This stabilization can be attributed to the contribution of linkers and other structural factors in the intact protein in the DNA binding process. DNA binding energies of variant proteins of the wild type Zif268 which differ in their ZF1 amino acid sequence gave evidence of a good relationship between binding energy and recognition and specificity, this finding confirms the reported vital role of ZF1 in the ZF protein scanning and anchoring to the target DNA sequence. The role of hydrogen bonds in both specific and nonspecific amino acid-DNA contacts is discussed in relation to mutations. The binding energies of variant Zinc Finger proteins confirmed the role of ZF1 in the recognition

  2. Developing Novel Therapeutics Targeting Undifferentiated and Castration-Resistant Prostate Cancer Stem Cells (United States)


    2009;106:268-73. 41. Carver BS, Chapinski C, Wongvipat J, Hieronymus H, Chen Y, Chandarlapaty S, Arora VK, Le C, Koutcher J, Scher H, Scardino PT... Rosen N, Sawyers CL. Reciprocal feedback regulation of PI3K and androgen receptor signaling in PTEN- deficient prostate cancer. Cancer Cell. 2011;19

  3. Socioeconomic health inequalities among a nationally representative sample of Danish adolescents: the role of different types of social relations

    DEFF Research Database (Denmark)

    Due, P; Lynch, J; Holstein, B


    found in the ways adolescents reported their own and their parents relations to school. For example, girls from families of lower socioeconomic position were more than four times as likely to report their parents unwilling to attend school meetings (odds ratio=4.54, 95% confidence intervals: 2.68 to 7...

  4. Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

    The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

  5. The Exclusive Induction of Extinction Is Gated by BDNF (United States)

    Kirtley, Anne; Thomas, Kerrie L.


    We have previously reported that the reconsolidation and extinction of hippocampal-dependent contextual fear memory can be initiated by a single context conditioned stimulus (CS) presentation of either short or long duration, and that both processes require protein synthesis in this brain region. Furthermore, reconsolidation depends on Zif268

  6. The Impact of Years of Teaching Experience on the Classroom Management Approaches of Elementary School Teachers (United States)

    Unal, Zafer; Unal, Aslihan


    This study provided a basis for answering the following essential question: Does the years of experience affect teachers' classroom management approaches? Data were collected from 268 primary school teachers. The findings of this study demonstrated that experienced teachers are more likely to prefer to be in control in their classrooms than…

  7. Antenatal clinical pelvimetry in primigravidae and outcome of labour ...

    African Journals Online (AJOL)

    Method: A retrospective study of clinical pelvimetry and outcome of labour in primigravidae. Results: The total number of primigravidae included in the study was 268 and of these, 74 were adjudged to have adequate pelvis at antenatal clinical pelvimetry. The APGAR scores at one and five minutes were significantly higher ...

  8. Children, ethics, and modern medicine

    National Research Council Canada - National Science Library

    Miller, Richard B


    ... 220 11. Ethical Issues in Pediatric Research 238 :     ⁄ 275  ⁄ 301 268 AcknowledgmentsACKNOWLEDGMENTS The remotest origin...

  9. 12 CFR 225.111 - Limit on investment by bank holding company system in stock of small business investment companies. (United States)


    .... L. 90-104, 81 Stat. 268, 270), a national bank may invest in stock of small business investment... system in stock of small business investment companies. 225.111 Section 225.111 Banks and Banking FEDERAL... Limit on investment by bank holding company system in stock of small business investment companies. (a...

  10. Language and Social Competence in Typically Developing Children and Late Talkers between 18 and 35 Months of Age (United States)

    Longobardi, Emiddia; Spataro, Pietro; Frigerio, Alessandra; Rescorla, Leslie


    The present study examined the relation between language and social ability in a sample of 268 preschoolers aged 18-35 months. Expressive language was assessed with the Italian adaptation of the Language Development Survey (LDS), and Social Competence was assessed with the Questionnaire on Peer Interactions in the Kindergarten (QPI). Results…

  11. Relationship between Motivation for Learning EFL and Intrinsic Motivation for Learning in General among Japanese Elementary School Students (United States)

    Carreira, Junko Matsuzaki


    This study investigated children's motivation for learning English as a foreign language (EFL) and intrinsic motivation for learning in general. The participants were 268 third-sixth graders in a public school in Japan. Data were collected using two questionnaires, one measuring motivation for learning EFL and the other investigating intrinsic…

  12. 77 FR 74915 - Additional Designations, Foreign Narcotics Kingpin Designation Act (United States)


    .... jurisdiction, owned or controlled by significant foreign narcotics traffickers as identified by the President... Enrique; DOB 25 Mar 1980; POB Culiacan, Sinaloa, Mexico; C.U.R.P. EUEJ800325HSLSSR02 (Mexico) (individual... GUTIERREZ, Julio Cesar, Calle Platon 268, Col. Paso Blanco, Ocotlan, Jalisco, Mexico; DOB 03 Oct 1981; POB...

  13. Cryoseston of the Pirin Mountains, Bulgaria

    Czech Academy of Sciences Publication Activity Database

    Cepák, Vladislav; Lukavský, Jaromír


    Roč. 72, č. 2 (2013), s. 257-268 ISSN 0365-0588 R&D Projects: GA TA ČR TE01020080; GA TA ČR TA03011027 Institutional research plan: CEZ:AV0Z60050516 Keywords : Chlainomonas * Pirin * Bulgaria Subject RIV: EI - Biotechnology ; Bionics Impact factor: 0.449, year: 2013

  14. The Impact of Instructional Design on College Students' Cognitive Load and Learning Outcomes in a Large Food Science and Human Nutrition Course (United States)

    Andrade, Jeanette; Huang, Wen-Hao David; Bohn, Dawn M.


    The effective design of course materials is critical for student learning, especially for large lecture introductory courses. This quantitative study was designed to explore the effect multimedia and content difficulty has on students' cognitive load and learning outcomes. College students (n = 268) were randomized into 1 of 3 multimedia groups:…

  15. On adaptive time stepping for large-scale parabolic problems: Computer simulation of heat and mass transfer in vacuum freeze-drying

    Czech Academy of Sciences Publication Activity Database

    Georgiev, K.; Kosturski, N.; Margenov, S.; Starý, Jiří


    Roč. 226, č. 2 (2009), s. 268-274 ISSN 0377-0427 Institutional research plan: CEZ:AV0Z30860518 Keywords : Vacuum freeze drying * Zeolites * Heat and mass transfer * Finite element method * MIC(0) preconditioning Subject RIV: BA - General Mathematics Impact factor: 1.292, year: 2009

  16. Relation between Democratic Leadership and Organizational Cynicism (United States)

    Terzi, Ali Riza; Derin, Ramazan


    This study intends to analyze the relation between school principals' leadership styles and teachers' perception of organizational cynicism. The study group consists of 268 participants teaching at high schools in the Balikesir district of Turkey during 2014-2015 academic year. In the study, which used relational survey model, data was collected…

  17. Attitudes toward the Homeless: A U.S.-Japan Comparison. (United States)

    Guzewicz, Tony D.; Takooshian, Harold


    Compares attitudes toward the homeless in Japan and the United States through a survey of 268 Japanese and 254 U.S. adults and adolescents interviewed in public places. In Japan, homelessness is seldom discussed, and poverty, which may be as widespread as in the United States, is often not recognized. (SLD)

  18. Philometra johnii sp nov (Nematoda, Philometridae), a new gonad-infecting philometrid from the sin croaker Johnius dussumieri (Cuvier) (Perciformes, Sciaenidae) from marine waters of Iraq

    Czech Academy of Sciences Publication Activity Database

    Moravec, František; Ali, A. H.


    Roč. 58, č. 3 (2013), s. 263-268 ISSN 1230-2821 R&D Projects: GA ČR GBP505/12/G112 Institutional support: RVO:60077344 Keywords : Parasitic nematode * Philometra * new species * marine fish * Johnius * Iraq * Arabian Gulf Subject RIV: EA - Cell Biology Impact factor: 0.965, year: 2013

  19. Charge carrier transport on molecular wire controlled by dipolar species: towards light-driven molecular switch

    Czech Academy of Sciences Publication Activity Database

    Nešpůrek, Stanislav; Toman, Petr; Sworakowski, J.

    438-439, - (2003), s. 268-278 ISSN 0040-6090. [International Conference on Nano- Molecular Electronics /5./. Kobe, 10.12.2002-12.12.2002] R&D Projects: GA AV ČR KSK4050111 Keywords : molecular electronics * polymers * quantum effects Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.598, year: 2003

  20. Surabhi Potnis

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education. Surabhi Potnis. Articles written in Resonance – Journal of Science Education. Volume 22 Issue 3 March 2017 pp 257-268 General Article. From Carbon to Buckypaper · Surabhi Potnis · More Details Abstract Fulltext PDF. This article aims to highlight the amazing ...

  1. FDA Developments: Food Code 2013 and Proposed Trans Fat Determination

    NARCIS (Netherlands)

    Grossman, M.R.


    268 Reports EFFL 4|2014 USA FDA Developments: Food Code 2013 and Proposed Trans Fat Determination Margaret Rosso Grossman* I. Food Code 2013 and Food Code Reference System Since 1993, the US Food and Drug Administration has published a Food Code, now updated every four years. In November 2013, the

  2. Invasion science: looking forward rather than revisiting old ground – a reply to Zenni et al

    Czech Academy of Sciences Publication Activity Database

    Ricciardi, A.; Blackburn, T. M.; Carlton, J. T.; Dick, J. T. A.; Hulme, P. E.; Iacarella, J. C.; Jeschke, J.M.; Liebhold, A. M.; Lockwood, J. L.; MacIsaac, H. J.; Pyšek, Petr; Richardson, D. M.; Ruiz, G. M.; Simberloff, D.; Sutherland, W. J.; Wardle, D. A.; Aldridge, D.


    Roč. 32, č. 11 (2017), s. 809-810 ISSN 0169-5347 Grant - others:AV ČR(CZ) AP1002 Program:Akademická prémie - Praemium Academiae Institutional support: RVO:67985939 Keywords : invasion * impact * prediction Subject RIV: EH - Ecology, Behaviour OBOR OECD: Ecology Impact factor: 15.268, year: 2016

  3. Extradyadic Involvement, Narcissism, and Callousness in College Students (United States)

    Crass, Suzanne L.; Terranova, Andrew M.


    The relationship between narcissism, callousness, and extradyadic involvement (EDI), has been understudied. It was anticipated that callousness and narcissism would be associated with increased likelihood of engaging in an EDI and less distress about having engaged in the EDI. Participants (268 college students; 75% female; mean age of 20 years…

  4. Career Paths in Sport Management (United States)

    Schwab, Keri A.; Legg, Eric; Tanner, Preston; Timmerman, Danielle; Dustin, Daniel; Arthur-Banning, Skye G.


    Sport management alumni (N = 268) from five universities that offer undergraduate programs with an emphasis in sport management within departments of parks, recreation, and tourism were sampled via an electronic survey. The survey sought to learn where alumni were working, and how they felt about their career choice and undergraduate professional…

  5. Narrow Viewing: The Vocabulary in Related Television Programs (United States)

    Rodgers, Michael P. H.; Webb, Stuart


    In this study, the scripts of 288 television episodes were analyzed to determine the extent to which vocabulary reoccurs in related and unrelated television programs, and the potential for incidental vocabulary learning through watching one season (approximately 24 episodes) of television programs. The scripts consisted of 1,330,268 running words…

  6. Rotaphone, a Self-Calibrated Six-Degree-of-Freedom Seismic Sensor and Its Strong-Motion Records

    Czech Academy of Sciences Publication Activity Database

    Brokešová, J.; Málek, Jiří


    Roč. 84, č. 5 (2013), s. 737-744 ISSN 0895-0695 R&D Projects: GA ČR GAP210/10/0925; GA MŠk LM2010008 Institutional support: RVO:67985891 Keywords : rotational seismology * sensor * six-degree-of-freedom Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 2.268, year: 2013

  7. 77 FR 25652 - Drawbridge Operation Regulation; Atlantic Intracoastal Waterway (AIWW), at Wrightsville Beach, NC... (United States)


    ... are expected to have minimal impacts on mariners due to the short duration that the moveable bridges... North Carolina Department of Transportation (NCDOT) bridges: The S.R. 74 Bridge, across the AIWW, mile 283.1 at Wrightsville Beach, NC; the Cape Fear Memorial Bridge across the Cape Fear River, mile 26.8...

  8. Biosynthesis of acid phosphatase of baker's yeast . Characterization of a protoplast-bound fraction containing precursors of the exo-enzyme

    NARCIS (Netherlands)

    Boer, Pieter; Rijn, Herman J.M. van; Reinking, A.; Steyn-Parvé, Elizabeth P.


    1. 1.|Yest protoplasts, secreting acid phosphatase (orthophosphoric-monoester phosphohydrolase (acid optimum) EC contain a small amount of firmly bound enzyme, even after lysis (Van Rijn, H.J.M.; Boer, P. and Steyn-Parvé, E.P. (1972) Biochim. Biophys. Acta 268, 431–441). The major part

  9. Optimization of the Development of a Plastic Recycling Machine ...

    African Journals Online (AJOL)

    Nigerian Journal of Technology ... The performance test analysis carried out defines the characteristics of the machine and shows that at a speed of 268 rpm the machine functions effectively and efficiently in performing its task producing a high finishing recycling efficiency or recyclability of 97%, takes 2 minutes to recycle a ...

  10. Profile of children with cerebral palsy attending outpatient ...

    African Journals Online (AJOL)

    Jaundice (39.9%), asphyxia (26.8%) and infection (17.4%) were the leading causes of CP and spastic CP was the most common type (81.7%). Quadriplegic CP presentation was predominant (67.1%), and leading co-morbidities were mental retardation (31%) and speech impairment (26.3%). About 50% of the children ...

  11. 76 FR 33334 - Endangered and Threatened Wildlife and Plants; Initiation of 5-Year Reviews of Nine Species... (United States)


    ... includes any species or subspecies of fish, wildlife, or plant, and any distinct population segment of any... danger of extinction throughout all or a significant portion of its range; and (C) Threatened species... DEPARTMENT OF THE INTERIOR Fish and Wildlife Service [FWS-R5-ES-2010-N268; 50120 1113 0000 D2...

  12. Journal of Astrophysics and Astronomy | Indian Academy of Sciences

    Indian Academy of Sciences (India)


    Jan 27, 2016 ... Home; Journals; Journal of Astrophysics and Astronomy; Volume 36; Issue 2. Issue front cover thumbnail. Volume 36, Issue 2. June 2015, pages 255-334. pp 255-268. Modeling the Emission from Turbulent Relativistic Jets in Active Galactic Nuclei · Victoria Calafut Paul J. Wiita · More Details Abstract ...

  13. Using Common Themes: Cost-Effectiveness of Permanent Supported Housing for People with Mental Illness (United States)

    McLaughlin, Thomas Chalmers


    This article examines the cost-effectiveness of providing permanent supported housing to homeless people with mental illness. Through the use of billing records and frequency of use charts, researchers were able to map the service usage of a cohort of 268 homeless individuals from both urban and rural communities. The results suggest that…

  14. The situation of the nucleo-electric power in the world

    International Nuclear Information System (INIS)

    Souza, Jair A.M. de.


    In this report, several global aspects of nucleo-electric power generation are presented. The role of nuclear power in the world electric system and its economical, social and environmental aspects are described. The nuclear program of the main countries are presented together with several tables and graphics. 268 refs., 59 figs., 62 tabs

  15. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences. Sangappa. Articles written in Journal of Biosciences. Volume 30 Issue 2 March 2005 pp 259-268 Articles. Crystal structure of raw pure Mysore silk fibre based on (Ala-Gly)2-Ser-Gly peptide sequence using Linked-Atom-Least-Squares method · Sangappa S S Mahesh R Somashekar.

  16. Cloning and characterization of a pathogen-induced chitinase in Brassica napus

    DEFF Research Database (Denmark)

    Rasmussen, U.; Bojsen, K.; Collinge, D.B.


    A chitinase cDNA clone from rapeseed (Brassica napus L. ssp. oleifera) was isolated. The cDNA clone, ChB4, represents a previously purified and characterized basic chitinase isozyme. The longest open reading frame in ChB4 encodes a polypeptide of 268 amino acids. This polypeptide consists of a 24...

  17. Thinking Styles of Primary School Teachers in Beijing, China (United States)

    Wang, Ying; Pang, Nicholas Sun-Keung


    Previous studies on teachers' thinking have usually related to teaching and learning, and concentrated on classroom-level outcomes. In this study, an organizational and administrative perspective was adopted in examining teachers' thinking style. Data collected were from a sample of 268 in-service teachers from 6 primary schools in Beijing, China.…

  18. Diverse retrotransposon families and an AT-rich satellite DNA revealed in giant genomes of Fritillaria lilies

    Czech Academy of Sciences Publication Activity Database

    Ambrožová, K.; Mandáková, T.; Bureš, P.; Neumann, Pavel; Leitch, I. J.; Koblížková, Andrea; Macas, Jiří; Lysák, M.


    Roč. 107, č. 2 (2011), s. 255-268 ISSN 0305-7364 R&D Projects: GA ČR GA521/07/0284; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50510513 Keywords : Fritillaria * Liliaceae * repetitive DNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.030, year: 2011

  19. 3-D Enzymatic Nanomaterial Architectures for Energy Harvesting (United States)


    There are several benefits to EFCs such as renewability, use of inexpensive fuel and catalyst, high level of selectivity towards fuel, mild pH and...fermentation in wines , Talanta 81, 925-933. [26] Elrod-Erickson, M., Rould, M. A., Nekludova, l., and Pabo, C. O. (1996) Zif268 protein- DNA complex refined at

  20. Traits Without Borders:Integrating Functional Diversity Across Scales

    Czech Academy of Sciences Publication Activity Database

    Carmona, C. P.; de Bello, Francesco; Mason, N. W. H.; Lepš, Jan


    Roč. 31, č. 5 (2016), s. 382-394 ISSN 0169-5347 R&D Projects: GA ČR GAP505/12/1296; GA ČR GB14-36079G Institutional support: RVO:67985939 ; RVO:60077344 Keywords : functional trait * functional diversity * functional niche Subject RIV: EH - Ecology, Behaviour Impact factor: 15.268, year: 2016

  1. Neli uut lühimängufilmi noortelt

    Index Scriptorium Estoniae


    Eesti Kino Suvepäevade raames esilinastuvad 3. juunil TPÜ filmi ja video õppetooli mängufilmi režissööride II kursuse kursusetööd-lühimängufilmid : "2.68" (Tanel Toom), "Teispool vihma" (Margus Paju), "Sünnipäev" (Kaupo Kruusiauk) ja "Liivakellade parandaja" (Anu Aun)

  2. Stress-strain-temperature behavior due to B2-R-B19 ' transformation in NiTi polycrystals

    Czech Academy of Sciences Publication Activity Database

    Šittner, Petr; Novák, Václav; Lukáš, Petr; Landa, Michal


    Roč. 128, č. 3 (2006), s. 268-278 ISSN 0094-4289 Institutional research plan: CEZ:AV0Z10480505; CEZ:AV0Z10100520; CEZ:AV0Z20760514 Keywords : shape- memory alloy * situ neutron-diffraction * martensitic transformations Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.239, year: 2006

  3. Suresh, Prof. Subra

    Indian Academy of Sciences (India)

    Date of birth: 30 May 1956. Address: President, Carnegie-Mellon University, 5000, Forbes Avenue, Pittsburgh, PA 15213, U.S.A.. Contact: Office: (_1-412) 268 2200. Email: YouTube; Twitter; Facebook; Blog. Academy News. IAS Logo. 29th Mid-year meeting. Posted on 19 January 2018. The 29th ...

  4. Enhancement of the efficiency of dye-sensitized solar cell with multi-wall carbon nanotubes/polypyrrole composite counter electrodes prepared by electrophoresis/electrochemical polymerization

    International Nuclear Information System (INIS)

    Luo, Jun; Niu, Hai-jun; Wen, Hai-lin; Wu, Wen-jun; Zhao, Ping; Wang, Cheng; Bai, Xu-duo; Wang, Wen


    Graphical abstract: The overall energy conversion efficiency of the DSSC employing the MWCNT/PPy CE reached 3.78%. Compared with a reference DSSC using single MWCNT film CE with efficiency of 2.68%, the energy conversion efficiency was increased by 41.04%. Highlights: ► MWCNT/PPy composite film prepared by electrodeposition layer by layer was used as counter electrode in DSSC. ► The overall energy conversion efficiency of the DSSC was 3.78% by employing the composite film. ► The energy conversion efficiency increased by 41.04% compared with efficiency of 2.68% by using the single MWCNT film. ► We analyzed the mechanism and influence factor of electron transfer in the composite electrode by EIS. - Abstract: For the purpose of replacing the precious Pt counter electrode in dye-sensitized solar cells (DSSCs) with higher energy conversion efficiency, multi-wall carbon nanotube (MWCNT)/polypyrrole (PPy) double layers film counter electrode (CE) was fabricated by electrophoresis and cyclic voltammetry (CV) layer by layer. Atom force microscopy (AFM), scanning electron microscopy (SEM) and transmission electron microscope (TEM) demonstrated the morphologies of the composite electrode and Raman spectroscopy verified the PPy had come into being. The overall energy conversion efficiency of the DSSC employing the MWCNT/PPy CE reached 3.78%. Compared with a reference DSSC using single MWCNT film CE with efficiency of 2.68%, the energy conversion efficiency was increased by 41.04%. The result of impedance showed that the charge transfer resistance R ct of the MWCNT/PPy CE had the lowest value compared to that of MWCNT or PPy electrode. These results indicate that the composite film with high conductivity, high active surface area, and good catalytic properties for I 3 − reduction can potentially be used as the CE in a high-performance DSSC

  5. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase

    Energy Technology Data Exchange (ETDEWEB)

    Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan); Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki [System Instruments Co., Ltd., 776-2 Komiya-cho, Hachioji, Tokyo 192-0031 (Japan); Noda, Mamoru; Igimi, Shizunobu [Division of Biomedical Food Research, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Ikebukuro, Kazunori, E-mail: [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan)


    Graphical abstract: -- Highlights: •Zif268 fused to luciferase was used for E. coli O157, Salmonella and coliform detection. •Artificial zinc finger protein fused to luciferase was constructed for Norovirus detection. •An analyzer that automatically detects PCR products by zinc finger protein fused to luciferase was developed. •Target pathogens were specifically detected by the automatic analyzer with zinc finger protein fused to luciferase. -- Abstract: An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268–luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF–luciferase fusion protein. By means of the automatic analyzer with ZF–luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0 × 10 to 1.0 × 10{sup 6} copies.

  6. A multicenter, retrospective chart review study comparing index therapy change rates in open-angle glaucoma or ocular hypertension patients newly treated with latanoprost or travoprost-Z monotherapy. (United States)

    Fain, Joel M; Kotak, Sameer; Mardekian, Jack; Bacharach, Jason; Edward, Deepak P; Rauchman, Steven; Brevetti, Teresa; Fox, Janet L; Lovelace, Cherie


    Because latanoprost and the original formulation of travoprost that included benzalkonium chloride (BAK) have been shown to be similar with regard to tolerability, we compared initial topical intraocular pressure (IOP)-lowering medication change rates in patients newly treated with latanoprost or travoprost-Z monotherapy. At 14 clinical practice sites, medical records were abstracted for patients with a diagnosis of open-angle glaucoma or ocular hypertension and who were ≥40 years of age, had a baseline and at least one follow-up visit, and had no prior history of ocular prostaglandin use. Data regarding demographics, ocular/systemic medical histories, clinical variables, therapy initiations and reasons for changes, adverse events, and resource utilization were recorded from randomly chosen eligible charts. Primary outcomes were rates of and reasons for changing from the initial therapy within six months and across the full study period (1000 days). Data from 900 medical charts (latanoprost, 632; travoprost-Z, 268) were included. For both cohorts, average follow-up was >1 year. Cohorts were similar with regard to age (median ~67 years), gender distribution (>50% female), and diagnosis (~80% with open-angle glaucoma). Within six months, rates of index therapy change for latanoprost versus travoprost-Z were 21.2% (134/632) and 28.7% (77/268), respectively (p = 0.0148); across the full study period, rates were 34.5% (218/632) and 45.2% (121/268), respectively (p = 0.0026). Among those who changed their index therapy, insufficient IOP control was the most commonly reported reason followed by adverse events; hyperemia was the most commonly reported adverse event at index therapy change. In this "real world" study of changes in therapy in patients prescribed initial monotherapy with latanoprost with BAK or travoprost-Z with SofZia, medication changes were common in both treatment groups but statistically significantly more frequent with travoprost-Z.

  7. Enhancement of the efficiency of dye-sensitized solar cell with multi-wall carbon nanotubes/polypyrrole composite counter electrodes prepared by electrophoresis/electrochemical polymerization

    Energy Technology Data Exchange (ETDEWEB)

    Luo, Jun; Niu, Hai-jun; Wen, Hai-lin [Key Laboratory of Functional Inorganic Material Chemistry (Heilongjiang University), Ministry of Education, Department of Macromolecular Material and Engineering, Heilongjiang University, Harbin 150086 (China); Wu, Wen-jun; Zhao, Ping [Key Laboratory for Advanced Materials and Institute of Fine Chemicals, East China University of Science and Technology, Shanghai 200237 (China); Wang, Cheng; Bai, Xu-duo [Key Laboratory of Functional Inorganic Material Chemistry (Heilongjiang University), Ministry of Education, Department of Macromolecular Material and Engineering, Heilongjiang University, Harbin 150086 (China); Wang, Wen, E-mail: [School of Material Science and Engineering, Harbin Institute of Technology, Harbin 150080 (China)


    Graphical abstract: The overall energy conversion efficiency of the DSSC employing the MWCNT/PPy CE reached 3.78%. Compared with a reference DSSC using single MWCNT film CE with efficiency of 2.68%, the energy conversion efficiency was increased by 41.04%. Highlights: ► MWCNT/PPy composite film prepared by electrodeposition layer by layer was used as counter electrode in DSSC. ► The overall energy conversion efficiency of the DSSC was 3.78% by employing the composite film. ► The energy conversion efficiency increased by 41.04% compared with efficiency of 2.68% by using the single MWCNT film. ► We analyzed the mechanism and influence factor of electron transfer in the composite electrode by EIS. - Abstract: For the purpose of replacing the precious Pt counter electrode in dye-sensitized solar cells (DSSCs) with higher energy conversion efficiency, multi-wall carbon nanotube (MWCNT)/polypyrrole (PPy) double layers film counter electrode (CE) was fabricated by electrophoresis and cyclic voltammetry (CV) layer by layer. Atom force microscopy (AFM), scanning electron microscopy (SEM) and transmission electron microscope (TEM) demonstrated the morphologies of the composite electrode and Raman spectroscopy verified the PPy had come into being. The overall energy conversion efficiency of the DSSC employing the MWCNT/PPy CE reached 3.78%. Compared with a reference DSSC using single MWCNT film CE with efficiency of 2.68%, the energy conversion efficiency was increased by 41.04%. The result of impedance showed that the charge transfer resistance R{sub ct} of the MWCNT/PPy CE had the lowest value compared to that of MWCNT or PPy electrode. These results indicate that the composite film with high conductivity, high active surface area, and good catalytic properties for I{sub 3}{sup −} reduction can potentially be used as the CE in a high-performance DSSC.

  8. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase

    International Nuclear Information System (INIS)

    Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi; Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki; Noda, Mamoru; Igimi, Shizunobu; Ikebukuro, Kazunori


    Graphical abstract: -- Highlights: •Zif268 fused to luciferase was used for E. coli O157, Salmonella and coliform detection. •Artificial zinc finger protein fused to luciferase was constructed for Norovirus detection. •An analyzer that automatically detects PCR products by zinc finger protein fused to luciferase was developed. •Target pathogens were specifically detected by the automatic analyzer with zinc finger protein fused to luciferase. -- Abstract: An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268–luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF–luciferase fusion protein. By means of the automatic analyzer with ZF–luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0 × 10 to 1.0 × 10 6 copies

  9. Interacting star clusters in the Large Magellanic Cloud. Overmerging problem solved by cluster group formation (United States)

    Leon, Stéphane; Bergond, Gilles; Vallenari, Antonella


    We present the tidal tail distributions of a sample of candidate binary clusters located in the bar of the Large Magellanic Cloud (LMC). One isolated cluster, SL 268, is presented in order to study the effect of the LMC tidal field. All the candidate binary clusters show tidal tails, confirming that the pairs are formed by physically linked objects. The stellar mass in the tails covers a large range, from 1.8x 10(3) to 3x 10(4) \\msun. We derive a total mass estimate for SL 268 and SL 356. At large radii, the projected density profiles of SL 268 and SL 356 fall off as r(-gamma ) , with gamma = 2.27 and gamma =3.44, respectively. Out of 4 pairs or multiple systems, 2 are older than the theoretical survival time of binary clusters (going from a few 10(6) years to 10(8) years). A pair shows too large age difference between the components to be consistent with classical theoretical models of binary cluster formation (Fujimoto & Kumai \\cite{fujimoto97}). We refer to this as the ``overmerging'' problem. A different scenario is proposed: the formation proceeds in large molecular complexes giving birth to groups of clusters over a few 10(7) years. In these groups the expected cluster encounter rate is larger, and tidal capture has higher probability. Cluster pairs are not born together through the splitting of the parent cloud, but formed later by tidal capture. For 3 pairs, we tentatively identify the star cluster group (SCG) memberships. The SCG formation, through the recent cluster starburst triggered by the LMC-SMC encounter, in contrast with the quiescent open cluster formation in the Milky Way can be an explanation to the paucity of binary clusters observed in our Galaxy. Based on observations collected at the European Southern Observatory, La Silla, Chile}

  10. Subtotal parathyroidectomy for secondary renal hyperparathyroidism: a 20-year surgical outcome study. (United States)

    Konturek, Aleksander; Barczyński, Marcin; Stopa, Małgorzata; Nowak, Wojciech


    The aim of this study was to evaluate the outcomes of surgery for patients with secondary renal hyperparathyroidism (rHPT). This is a retrospective cohort study. Our institutional database was searched for eligible patients treated in 1995-2014. The inclusion criterion was initial parathyroidectomy for rHPT. Clinical and follow-up data were analyzed to estimate the cure rate (primary outcome), and morbidity (secondary outcome). The study group comprised 297 patients (154 females, age 44.5 ± 13.7 years, follow-up 24.6 ± 10.5 months), including 268 (90.2 %) patients who had underwent subtotal parathyroidectomy, and 29 (9.8 %) who had had incomplete parathyroidectomy. Intraoperative iPTH assay was utilized in 207 (69.7 %) explorations. Persistent rHPT occurred in 12/268 (4.5 %) patients after subtotal parathyroidectomy and 5/29 (17.2 %) subjects after incomplete parathyroidectomy (p = 0.005). The patients operated on with intraoperative iPTH assay had a higher cure rate than non-monitored individuals, 201/207 (97.1 %) vs. 79/90 (87.8 %), respectively (p = 0.001). In-hospital mortality occurred in 1/297 (0.3 %) patient. The hungry bone syndrome occurred in 84/268 (31.3 %) patients after subtotal parathyroidectomy and 2/29 (6.9 %) subjects after incomplete parathyroidectomy (p = 0.006). Transient recurrent laryngeal nerve paresis occurred in 14/594 (2.4 %) and permanent in 5/594 (0.8 %) nerves at risk. Subtotal parathyroidectomy is a safe and efficacious treatment for patients with rHPT. Utilization of intraoperative iPTH assay can guide surgical exploration and improve the cure rate.

  11. 77 FR 50376 - Drawbridge Operation Regulation, Atlantic Intracoastal Waterway (AIWW); Wrightsville Beach, NC... (United States)


    ... duration that the moveable bridges will be maintained in the closed position. The races have been reserved... of Transportation (NCDOT) bridges: The S.R. 74 Bridge, across the AIWW, mile 283.1 at Wrightsville Beach, NC; the Cape Fear Memorial Bridge across the Cape Fear River, mile 26.8; and the Isabel S. Holmes...

  12. Discrimination of Single-Copy IS6110 DNA Fingerprints of Mycobacterium tuberculosis Isolates by High-Resolution Minisatellite-Based Typing


    Lee, Ann S. G.; Tang, Lynn L. H.; Lim, Irene H. K.; Bellamy, Richard; Wong, Sin-Yew


    Seven isoniazid-resistant isolates with mutations in the NADH dehydrogenase (ndh) gene were molecularly typed by IS6110-based restriction fragment length polymorphism analysis. All seven isolates with the R268H mutation had identical 1.4-kb IS6110 fingerprints. High-resolution minisatellite-based typing discriminated five of these isolates; two isolates were identical.

  13. Discrimination of single-copy IS6110 DNA fingerprints of Mycobacterium tuberculosis isolates by high-resolution minisatellite-based typing. (United States)

    Lee, Ann S G; Tang, Lynn L H; Lim, Irene H K; Bellamy, Richard; Wong, Sin-Yew


    Seven isoniazid-resistant isolates with mutations in the NADH dehydrogenase (ndh) gene were molecularly typed by IS6110-based restriction fragment length polymorphism analysis. All seven isolates with the R268H mutation had identical 1.4-kb IS6110 fingerprints. High-resolution minisatellite-based typing discriminated five of these isolates; two isolates were identical.

  14. Topological properties and spatial organization of villous capillaries in normal and diabetic placentas

    Czech Academy of Sciences Publication Activity Database

    Jirkovská, Marie; Kubínová, Lucie; Janáček, Jiří; Moravcová, M.; Krejčí, V.; Karen, Petr


    Roč. 39, č. 3 (2002), s. 268-278 ISSN 1018-1172 R&D Projects: GA ČR GA304/97/0420; GA ČR GA304/01/0257 Institutional research plan: CEZ:AV0Z5011922 Keywords : diabetic placentas * vascular topology * confocal microscopy Subject RIV: EA - Cell Biology Impact factor: 2.458, year: 2002

  15. Microcalorimetry of Li/CFx Cells and Discharge Mechanism (United States)


    improved heat transfer from the cell to the microcalorimeter. The aluminum holder was electrically insulated from the metal microcalorimeter chamber using...Area, m2/g 139 350 323 Micropore Surface Area, m2/g 78 82 92 External Surface Area, m2/g 61 268 230 Decomposition Temp., oC 672 660 659 3. Results

  16. Esca eius erant locustae. The origin and meaning of the imaginary quadruped locusta

    Czech Academy of Sciences Publication Activity Database

    Šedinová, Hana


    Roč. 138, 3/4 (2015), s. 231-268 ISSN 0024-4457 Institutional support: RVO:67985955 Keywords : medieval latin lexicography * ancient zoology * medieval zoology * quadrupeds * locust * lobster * locusta * Thomas of Cantimpré * Jacques de Vitry * Bartholomaeus de Solencia * Claretus * Albert the Great * diet of John the Baptist * lepusculus * Aristoteles Latinus Subject RIV: AI - Linguistics

  17. Cognitive Attributions and Emotional Expectancies Predict Emotions in Mother-Adolescent Interactions (United States)

    Lindsey, Eric W.; MacKinnon-Lewis, Carol; Frabutt, James M.; Campbell Chambers, Jessica


    The purpose of this study was to examine adolescent's hostile attributions of mother's intent and emotional self-expectancies as contributors to expression of emotion between mothers and adolescents. Data were collected from 268 10- to 12-year-olds (133 girls, 135 boys) and their mothers. Each dyad was observed in a conversational activity that…

  18. Numerical solution of modified fokker-planck equation with poissonian input

    Czech Academy of Sciences Publication Activity Database

    Náprstek, Jiří; Král, Radomil


    Roč. 17, 3/4 (2010), s. 251-268 ISSN 1802-1484 R&D Projects: GA AV ČR(CZ) IAA200710805; GA ČR(CZ) GA103/09/0094 Institutional research plan: CEZ:AV0Z20710524 Keywords : Fokker-Planck equation * poisson ian exciation * numerical solution * transition effects Subject RIV: JN - Civil Engineering

  19. 40 CFR 260.3 - Use of number and gender. (United States)


    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Use of number and gender. 260.3... (CONTINUED) HAZARDOUS WASTE MANAGEMENT SYSTEM: GENERAL General § 260.3 Use of number and gender. As used in parts 260 through 265 and 268 of this chapter: (a) Words in the masculine gender also include the...

  20. Site-Specific Differentiation of Fibroblasts in Normal and Scleroderma Skin (United States)


    the accordance in the structure and growth of animals and plants . London: The Syden- ham Society, 1–268 Sessa L, Breiling A, Lavorgna G, Silvestri L...targets. Heredity 97:88–96 Wolpert L (1969) Positional information and the spatial pattern of cellular differentiation. J Theor Biol 25:1–47 Yamaguchi Y

  1. Infection

    Institute of Scientific and Technical Information of China (English)


    2010373 Eosinophilic meningitis caused by Angiostrongylus cantonensis:a clinical and cerebrospinal fluid cytology report of 9 cases. GUAN Hongzhi(关鸿志),et al. Dept Neurol,PUMC & CAMS,Bejing 100730. Chin J Neurol 2010;43(4):268-271. Objective To report 9 cases of eosinophilic meningitis caused by Angiostrongylus cantonensis in Beijing,and to evaluate

  2. Jaderná bezpečnost fúzních elektráren a jejich vliv na životní prostředí.

    Czech Academy of Sciences Publication Activity Database

    Entler, Slavomír; Dostál, V.


    Roč. 25, 9-10 (2017), s. 262-268 ISSN 1210-7085 Grant - others:AV ČR(CZ) StrategieAV21/2 Program:StrategieAV Institutional support: RVO:61389021 Keywords : design * reactor safety * thermonuclear fuel s * thermonuclear reactions * thermonuclear reactor materials * thermonuclear reactors * tokamak devices Subject RIV: JF - Nuclear Energetics OBOR OECD: Nuclear related engineering

  3. 33 CFR 117.823 - Cape Fear River. (United States)


    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Cape Fear River. 117.823 Section... DRAWBRIDGE OPERATION REGULATIONS Specific Requirements North Carolina § 117.823 Cape Fear River. The draw of the Cape Fear Memorial Bridge, mile 26.8, at Wilmington need not open for the passage of vessel from 8...

  4. 2010 Recruiting Benchmarks Survey. Research Brief (United States)

    National Association of Colleges and Employers (NJ1), 2010


    The National Association of Colleges and Employers conducted its annual survey of employer members from June 15, 2010 to August 15, 2010, to benchmark data relevant to college recruiting. From a base of 861 employers holding organizational membership, there were 268 responses for a response rate of 31 percent. Following are some of the major…

  5. Cyklus a bilance uhlíku v mokřadech

    Czech Academy of Sciences Publication Activity Database

    Čížková, Hana; Pokorný, Jan; Květ, Jan; Bauer, Václav


    Roč. 21, č. 3 (2004), s. 265-268 ISSN 1212-0731. [Agroregion 2004. České Budějovice, 06.09.2004-07.09.2004] R&D Projects: GA MŽP SM/640/18/03 Institutional research plan: CEZ:AV0Z6087904 Keywords : carbon * wetland * sustainable management Subject RIV: EH - Ecology, Behaviour

  6. Zkoumání vlivu různého procentního plnění nanočásticemi na elektrické vlastnosti epoxidové pryskyřice

    Czech Academy of Sciences Publication Activity Database

    Hudec, Jiří; Neděla, Vilém; Polsterová, H.


    Roč. 60, č. 9 (2015), s. 268-271 ISSN 0447-6441 R&D Projects: GA ČR(CZ) GA14-22777S; GA MŠk ED0017/01/01; GA MŠk(CZ) LO1212 Institutional support: RVO:68081731 Keywords : epoxy resin * nanoparticles * oxides * spectral analysis * SEM Subject RIV: BH - Optics, Masers, Lasers

  7. Caesarean Delivery: Why The Aversion? | Ezechi | Tropical Journal ...

    African Journals Online (AJOL)

    While only 28.9% will accept caesarean section on doctor\\'s advice, 71.1% will not accept caesarean delivery for any reason. 26.8% of the patients that have had previous caesarean section prefer to die while attempting vaginal delivery than to have a repeat caesarean section. Reasons for refusing caesarean section were ...

  8. Clambunk skidder: economical evaluation in drags of wood / Clambunk skidder: avaliação econômica no arraste de madeira

    Directory of Open Access Journals (Sweden)

    Juliana Lorensi do Canto


    Full Text Available The present study had the objective of evaluating economical performance of Clambunk skidder in log drags activities. The study was developed in an eucalyptus crop property of a Minas Gerais State company that uses a mechanized full-tree system of harvest. The economical evaluation was made with the operational costs determination. The productivity varied from 18.34 to 72.08 m³.h-1 and the effective operational cost was of R$ 268.61 / hour.O presente estudo teve como objetivo avaliar economicamente a atividade de arraste em áreas montanhosas, utilizando-se um trator florestal arrastador com esteiras (Clambunk skidder. O estudo foi conduzido em povoamentos de eucalipto de uma empresa florestal do Estado de Minas Gerais, no sistema de colheita de árvores inteiras. A avaliação econômica consistiu na determinação dos custos operacionais e da distribuição destes custos. A produtividade do Clambunk skidder variou de 18,34 a 72,08 m³.h-1, com custo operacional de R$ 268,61 por hora efetiva.

  9. 75 FR 68379 - In the Matter of: Certain Video Game Systems and Controllers; Notice of Investigation (United States)


    ...Notice is hereby given that a complaint was filed with the U.S. International Trade Commission on October 1, 2010, under section 337 of the Tariff Act of 1930, as amended, 19 U.S.C. 1337, on behalf of Motiva, LLC. of Dublin, Ohio. Motiva filed letters supplementing the Complaint on October 18 and 22, 2010. The complaint alleges violations of section 337 based upon the importation into the United States, the sale for importation, and the sale within the United States after importation of certain video game systems and controllers by reason of infringement of certain claims of U.S. Patent No. 7,292,151 (``the '151 patent'') and U.S. Patent No. 7,492,268 (``the '268 patent''). The complaint further alleges that an industry in the United States exists or in the process of being established as required by subsection (a)(2) of section 337. The complainant requests that the Commission institute an investigation and, after the investigation, issue an exclusion order and a cease and desist order.

  10. The Reconstruction and Analysis of Gene Regulatory Networks. (United States)

    Zheng, Guangyong; Huang, Tao


    In post-genomic era, an important task is to explore the function of individual biological molecules (i.e., gene, noncoding RNA, protein, metabolite) and their organization in living cells. For this end, gene regulatory networks (GRNs) are constructed to show relationship between biological molecules, in which the vertices of network denote biological molecules and the edges of network present connection between nodes (Strogatz, Nature 410:268-276, 2001; Bray, Science 301:1864-1865, 2003). Biologists can understand not only the function of biological molecules but also the organization of components of living cells through interpreting the GRNs, since a gene regulatory network is a comprehensively physiological map of living cells and reflects influence of genetic and epigenetic factors (Strogatz, Nature 410:268-276, 2001; Bray, Science 301:1864-1865, 2003). In this paper, we will review the inference methods of GRN reconstruction and analysis approaches of network structure. As a powerful tool for studying complex diseases and biological processes, the applications of the network method in pathway analysis and disease gene identification will be introduced.

  11. Parasitóides (Hymenoptera: Braconidae de Anastrepha Schiner (Diptera: Tephritidae no estado do Acre Parasitoids (Hymenoptera: Braconidae of Anastrepha Schiner (Diptera: Tephritidae in the state of Acre, Brazil

    Directory of Open Access Journals (Sweden)

    Marcílio José Thomazini


    Full Text Available Este trabalho relata a primeira ocorrência de parasitóides em moscas-das-frutas do gênero Anastrepha Schiner no estado do Acre. No município de Bujari foram encontrados os braconídeos Opius bellus Gahan (72,5%, Doryctobracon areolatus (Szépligeti (26,8% e Utetes anastrephae (Viereck (0,7% associados a A. obliqua (Macquart em frutos de taperebá (Spondias mombin L., com parasitismo de 29,5%. No município de Rio Branco, em frutos de goiaba (Psidium guajava L., ocorreu somente D. areolatus em A. obliqua com parasitismo de 2,7%.This paper records the first parasitoids occurrence on Anastrepha Schiner fruit flies in the state of Acre, Brazil. In the Bujari County there occurred the braconids Opius bellus Gahan (72.5%, Doryctobracon areolatus (Szépligeti (26.8% e Utetes anastrephae (Viereck (0.7% associated with A. obliqua (Macquart in tapereba fruits (Spondias mombin L., with parasitism of 29.5%. In guajava fruits (Psidium guajava L. at Rio Branco County, only D. areolatus on A. obliqua occurred, with parasitism of 2.7%.

  12. Effects of temperature and NaCl on the formation of 3-MCPD esters and glycidyl esters in refined, bleached and deodorized palm olein during deep-fat frying of potato chips. (United States)

    Wong, Yu Hua; Muhamad, Halimah; Abas, Faridah; Lai, Oi Ming; Nyam, Kar Lin; Tan, Chin Ping


    The effects of frying duration, frying temperature and concentration of sodium chloride on the formation of 3-monochloropropane-1,2-diol (3-MCPD) esters and glycidyl esters (GEs) of refined, bleached and deodorized (RBD) palm olein during deep-fat frying (at 160°C and 180°C) of potato chips (0%, 1%, 3% and 5% NaCl) for 100min/d for five consecutive days in eight systems were compared in this study. All oil samples collected after each frying cycle were analyzed for 3-MCPD esters, GEs, free fatty acid (FFA) contents, specific extinction at 232 and 268 nm (K 232 and K 268 ), p-anisidine value (pAV), and fatty acid composition. The 3-MCPD ester trend was decreasing when the frying duration increased, whereas the trend was increasing when frying temperature and concentration of NaCl increased. The GEs trend was increasing when the frying temperature, frying duration and concentration of NaCl increased. All of the oil qualities were within the safety limit. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Prenatal diagnosis of chorionicity in twins.

    LENUS (Irish Health Repository)

    Hassan, T


    The aim of this audit was to assess the accuracy of transabdominal ultrasound scan in predicting chorionicity in twin pregnancies in our unit. The presence or absence of lambda sign, T-sign, dividing membrane thickness and number of placentae were used to determine chorionicity. We retrospectively analysed these antenatal markers in 268 sets of twins delivered over a 5 year period and compared it with the postpartum placental histology and neonatal gender. Of 268 twin deliveries, 204 (76%) had both chorionicity and placental histology to compare. 67 of 84 (80%) were correctly diagnosed antenatally as monochorionic and 137 of 151 (91%) as dichorionic. In 31 cases (15%) the ultrasound diagnosis of chorionicity didn\\'t match placental histology. Seventeen were thought to be monochorionic antenatally but were confirmed dichorionic on placental histology. Overall chorionicity was correctly diagnosed in 171\\/204 (84%) using transabdominal ultrasound scan (USS) in all trimesters. However the sensitivity and specificity of USS was much higher for dichorionic twins when carried out before 14 weeks of gestation.

  14. 40 CFR 268.7 - Testing, tracking, and recordkeeping requirements for generators, treaters, and disposal facilities. (United States)


    ....6, or a national capacity variance or case-by-case capacity variance under subpart C of this part... characteristic hazardous wastes managed in wastewater treatment systems subject to the Clean Water Act (CWA) as... last sent to on-site or off-site treatment, storage, or disposal. The three year record retention...

  15. SU-F-T-268: A Feasibility Study of Independent Dose Verification for Vero4DRT

    International Nuclear Information System (INIS)

    Yamashita, M; Kokubo, M; Takahashi, R; Takayama, K; Tanabe, H; Sueoka, M; Okuuchi, N; Ishii, M; Iwamoto, Y; Tachibana, H


    Purpose: Vero4DRT (Mitsubishi Heavy Industries Ltd.) has been released for a few years. The treatment planning system (TPS) of Vero4DRT is dedicated, so the measurement is the only method of dose verification. There have been no reports of independent dose verification using Clarksonbased algorithm for Vero4DRT. An independent dose verification software program of the general-purpose linac using a modified Clarkson-based algorithm was modified for Vero4DRT. In this study, we evaluated the accuracy of independent dose verification program and the feasibility of the secondary check for Vero4DRT. Methods: iPlan (Brainlab AG) was used as the TPS. PencilBeam Convolution was used for dose calculation algorithm of IMRT and X-ray Voxel Monte Carlo was used for the others. Simple MU Analysis (SMU, Triangle Products, Japan) was used as the independent dose verification software program in which CT-based dose calculation was performed using a modified Clarkson-based algorithm. In this study, 120 patients’ treatment plans were collected in our institute. The treatments were performed using the conventional irradiation for lung and prostate, SBRT for lung and Step and shoot IMRT for prostate. Comparison in dose between the TPS and the SMU was done and confidence limits (CLs, Mean ± 2SD %) were compared to those from the general-purpose linac. Results: As the results of the CLs, the conventional irradiation (lung, prostate), SBRT (lung) and IMRT (prostate) show 2.2 ± 3.5% (CL of the general-purpose linac: 2.4 ± 5.3%), 1.1 ± 1.7% (−0.3 ± 2.0%), 4.8 ± 3.7% (5.4 ± 5.3%) and −0.5 ± 2.5% (−0.1 ± 3.6%), respectively. The CLs for Vero4DRT show similar results to that for the general-purpose linac. Conclusion: The independent dose verification for the new linac is clinically available as a secondary check and we performed the check with the similar tolerance level of the general-purpose linac. This research is partially supported by Japan Agency for Medical Research and Development (AMED)

  16. 268 Origine du phénomène d'ensablement déduite par combinaison ...

    African Journals Online (AJOL)


    Il est clair que le sable a toujours existé au niveau du bassin côtier de ... La lutte contre le phénomène de l'ensablement dans cette zone du Maroc exige la ..... ensablements à la préservation de la lagune car sa survie et la régulation de son ... transactions on pattern analysis and machine intelligence ISSN 0162-8828 ...

  17. SU-F-T-268: A Feasibility Study of Independent Dose Verification for Vero4DRT

    Energy Technology Data Exchange (ETDEWEB)

    Yamashita, M; Kokubo, M [Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Takahashi, R [Cancer Institute Hospital of Japanese Foundation for Cancer Research, Koto, Tokyo (Japan); Takayama, K [Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Tanabe, H; Sueoka, M; Okuuchi, N [Institute of Biomedical Research and Innovation, Kobe, Hyogo (Japan); Ishii, M; Iwamoto, Y [Kobe City Medical Center General Hospital, Kobe, Hyogo (Japan); Tachibana, H [National Cancer Center, Kashiwa, Chiba (Japan)


    Purpose: Vero4DRT (Mitsubishi Heavy Industries Ltd.) has been released for a few years. The treatment planning system (TPS) of Vero4DRT is dedicated, so the measurement is the only method of dose verification. There have been no reports of independent dose verification using Clarksonbased algorithm for Vero4DRT. An independent dose verification software program of the general-purpose linac using a modified Clarkson-based algorithm was modified for Vero4DRT. In this study, we evaluated the accuracy of independent dose verification program and the feasibility of the secondary check for Vero4DRT. Methods: iPlan (Brainlab AG) was used as the TPS. PencilBeam Convolution was used for dose calculation algorithm of IMRT and X-ray Voxel Monte Carlo was used for the others. Simple MU Analysis (SMU, Triangle Products, Japan) was used as the independent dose verification software program in which CT-based dose calculation was performed using a modified Clarkson-based algorithm. In this study, 120 patients’ treatment plans were collected in our institute. The treatments were performed using the conventional irradiation for lung and prostate, SBRT for lung and Step and shoot IMRT for prostate. Comparison in dose between the TPS and the SMU was done and confidence limits (CLs, Mean ± 2SD %) were compared to those from the general-purpose linac. Results: As the results of the CLs, the conventional irradiation (lung, prostate), SBRT (lung) and IMRT (prostate) show 2.2 ± 3.5% (CL of the general-purpose linac: 2.4 ± 5.3%), 1.1 ± 1.7% (−0.3 ± 2.0%), 4.8 ± 3.7% (5.4 ± 5.3%) and −0.5 ± 2.5% (−0.1 ± 3.6%), respectively. The CLs for Vero4DRT show similar results to that for the general-purpose linac. Conclusion: The independent dose verification for the new linac is clinically available as a secondary check and we performed the check with the similar tolerance level of the general-purpose linac. This research is partially supported by Japan Agency for Medical Research and Development (AMED)

  18. Interpersonal Problem Solving, Self-Compassion and Personality Traits in University Students (United States)

    Arslan, Coskun


    The aim of this study was to investigate interpersonal problem solving in terms of self-compassion and personality traits. The participants were 570 (274 females and 296 males) who participated in the research voluntarily. The mean age of the participants was 21.54 years (between 17-32 years old) with a standard deviation of 2.68 years. Data were…

  19. Conduct Disorder and Initiation of Substance Use: A Prospective Longitudinal Study (United States)

    Hopfer, Christian; Salomonsen-Sautel, Stacy; Mikulich-Gilbertson, Susan; Min, Sung-Joon; McQueen, Matt; Crowley, Thomas; Young, Susan; Corley, Robin; Sakai, Joseph; Thurstone, Christian; Hoffenberg, Analice; Hartman, Christie; Hewitt, John


    Objective: To examine the influence of conduct disorder (CD) on substance use initiation. Method: Community adolescents without CD (n = 1,165, mean baseline age = 14.6 years), with CD (n = 194, mean baseline age = 15.3 years), and youth with CD recruited from treatment (n = 268, mean baseline age = 15.7 years) were prospectively followed and…

  20. Peter Van Elsuwege and Roman Petrov, eds. Legislative Approximation and Application of EU Law in the Eastern Neighbourhood of the European Union: Towards a Common Regulatory Space?

    Directory of Open Access Journals (Sweden)

    Andriy Tyushka


    Full Text Available Peter Van Elsuwege and Roman Petrov, eds. Legislative Approximation and Application of EU Law in the Eastern Neighbourhood of the European Union: Towards a Common Regulatory Space? London and New York: Routledge, 2014. xxx, 268 pp. Notes on Contributors. Preface by Marc Maresceau. Foreward by Kostiantyn Yelisieiev. Illustrations. Informative table and list. Index. $145.00, cloth.

  1. Mobile Applications in Cell Biology Present New Approaches for Cell Modelling (United States)

    de Oliveira, Mayara Lustosa; Galembeck, Eduardo


    Cell biology apps were surveyed in order to identify whether there are new approaches for modelling cells allowed by the new technologies implemented in tablets and smartphones. A total of 97 apps were identified in 3 stores surveyed (Apple, Google Play and Amazon), they are presented as: education 48.4%, games 26.8% and medicine 15.4%. The apps…

  2. New data on Myxobolus longisporus (Myxozoa: Myxobolidae), a gill infecting parasite of carp, Cyprinus carpio haematopterus, from Chinese lakes

    Czech Academy of Sciences Publication Activity Database

    Dyková, Iva; Fiala, Ivan; Nie, P.


    Roč. 50, č. 4 (2003), s. 263-268 ISSN 0015-5683 R&D Projects: GA MŠk ME 424 Grant - others:National Natural Science Foundation of China(CN) 30025035 Institutional research plan: CEZ:AV0Z6022909; CEZ:MSM 123100003 Keywords : Myxozoa * Myxobolus longisporus * SSU rDNA Subject RIV: EA - Cell Biology Impact factor: 0.469, year: 2003

  3. Can Ethics Be Taught? A Quasi-Experimental Study of the Impact of Class Size on the Cognitive Moral Reasoning of Freshmen Business Students (United States)

    Sullivan, Ethan A.


    The purpose of this study was to determine the impact of a business ethics course on the cognitive moral reasoning of freshmen business students. The sample consisted of 268 college students enrolled in a required business ethics course. The students took Rest's Defining Issues Test--Version 2 (DIT2) as a pre-test and then post-test (upon…

  4. Lead isotopic signatures of saprotrophic macrofungi of various origins: Tracing for lead sources and possible applications in geomycology

    Czech Academy of Sciences Publication Activity Database

    Borovička, Jan; Mihaljevič, M.; Gryndler, Milan; Kubrová, Jaroslava; Žigová, Anna; Hršelová, Hana; Řanda, Zdeněk


    Roč. 43, APR (2014), s. 114-120 ISSN 0883-2927 R&D Projects: GA ČR(CZ) GAP504/11/0484 Institutional support: RVO:61388971 ; RVO:67985831 ; RVO:61389005 Keywords : macrofungi * Pb isotopic ratio * soils Subject RIV: CH - Nuclear ; Quantum Chemistry; DD - Geochemistry (GLU-S); EE - Microbiology, Virology (MBU-M) Impact factor: 2.268, year: 2014

  5. Financial Stress in the Czech Republic: Measurement and Effects on the Real Economy

    Czech Academy of Sciences Publication Activity Database

    Horváth, Roman; Malega, J.


    Roč. 2017, č. 3 (2017), s. 257-268 ISSN 1210-0455 R&D Projects: GA ČR GA15-10331S Institutional support: RVO:67985556 Keywords : financial stress indicator * vector autoregression * Czech Republic Subject RIV: AH - Economics OBOR OECD: Finance Impact factor: 0.710, year: 2016

  6. Comparison of length of day with oceanic and atmospheric angular momentum series

    Czech Academy of Sciences Publication Activity Database

    Kouba, J.; Vondrák, Jan


    Roč. 79, 4-5 (2005), s.256-268 ISSN 0949-7714 R&D Projects: GA AV ČR IAA3003205; GA MŠk LC506 Institutional research plan: CEZ:AV0Z10030501 Keywords : Earth rotation * length of day * atmospheric angular momentum Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 1.205, year: 2005

  7. Carcinogenicity of Embedded Tungsten Alloys in Mice (United States)


    formation as a result of embedded metal from a lawn mower blade (Saruwatari et al. 2009) and a chain saw blade (Osawa et al. 2006), respectively. In both...granuloma attributable to a piece of lawn - mower blade. Clin Exp Dermatol 34:e268–e269 Schins RP, Borm PJ (1999) Mechanisms and mediators in coal dust induced

  8. Programming Environments for High Level Scientific Problem Solving. IFIP WG 2.5 Working Conference 6 Held in Karlsruhe, Germany on September 23 - 27, 1991 (United States)


    Springer Verlag (1989). (13] Hulshof , B.J.A. and van Hulzen, J.A.: "Automatic error cumulation control", Proceedir EUROSAM 󈨘 (J. Fitch. ed.), Springer...User’s Manual", Dept of Comp. Science. Univ. of Twente (In preparation). 268 [15] van Hulzen, J.A., Hulshof , B.J.A.. Gates, B.L. and van Heerwaarden, M.C


    African Journals Online (AJOL)

    Dr Kazungu

    hepatitis B virus include : Men or women who have multiple sex partners, especially if they don't use a condom, Men who ..... Paid employee. 93. 26.8. Peasant ... It is also surprising that the never married had the least failure time. The ..... from the liver and ascites (fluid retention in the abdominal cavity) is the most common.

  10. Kohakaasluskorras töötamise tingimuste määrustik

    Index Scriptorium Estoniae


    Lisatud tööde loetelu, mida ei peeta kohakaasluseks. Vene keeles: В помощь профсоюзному активисту 1989 nr. 3, lk. 9-14. Selgitused vt. Nõukogude Õigus 1989 nr. 4, lk. 267-268

  11. New design of microwave interferometer for tokamak COMPASS

    Czech Academy of Sciences Publication Activity Database

    Varavin, Mykyta; Zajac, Jaromír; Žáček, František; Nanobashvili, S.I.; Ermak, G.; Varavin, A.; Vasilev, A.; Stumbra, M.; Vetoshko, A.; Fateev, A.; Shevchenko, V.


    Roč. 73, č. 10 (2014), s. 935-942 ISSN 0040-2508 Institutional support: RVO:61389021 Keywords : Microwave interferometry * Plasma diagnostics * Tokamak Subject RIV: BL - Plasma and Gas Discharge Physics,0f0577fd35766f78,6e6cc5d616079cba.html

  12. Enhancing Autonomy-Supportive I-Thou Dialogue in Schools: Conceptualization and Socio-Emotional Effects of an Intervention Program (United States)

    Kaplan, Haya; Assor, Avi


    We present a conceptualization and a 2 year program of autonomy-supportive I-Thou dialogue among teachers and students that is based on self-determination theory (Deci and Ryan in "Psychol Inq" 11(4):227-268, 2000) and Buber's (1960) philosophy. The program was applied in 18 seventh grade classes (420 students). Findings showed: (a) increases in…

  13. 21 CFR 177.1500 - Nylon resins. (United States)


    ... condensation of hexamethyl-enediamine, adipic acid, and terephthalic acid such that composition in terms of...), isophthalic acid (CAS Reg. No. 0121-91-5), and bis(4-amino-3-methylcycl-ohexyl)methane (CAS Reg. No. 6864-37-5) such that the composition in terms of ingredients is 34.4±1.5 weight percent omega-laurolactam, 26.8±0...

  14. First identification of eggs of the Asian fish tapeworm Bothriocephalus acheilognathi (Cestoda: Bothriocephalidea) in human stool

    Czech Academy of Sciences Publication Activity Database

    Yera, H.; Kuchta, Roman; Brabec, Jan; Peyron, F.; Dupouy-Camet, J.


    Roč. 62, č. 3 (2013), s. 268-271 ISSN 1383-5769 R&D Projects: GA ČR GBP505/12/G112; GA ČR GAP506/12/1632 Institutional support: RVO:60077344 Keywords : COI * Diphyllobothrium * French Guiana * Man * Molecular identification * rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.111, year: 2013

  15. 76 FR 33982 - Airworthiness Directives; Bombardier, Inc. Model CL-600-2C10 (Regional Jet Series 700, 701, & 702... (United States)


    ... office between 9 a.m. and 5 p.m., Monday through Friday, except Federal holidays. The AD docket contains..., 139, 142, 145, 146, 266, 268, 271, 274, 276, 277, 280, 282 through 285 inclusive, 290, 292, 294, 297, 299, 307, 309, 320, 337, 400, 402, 403, 410, 412, 418, 421 through 428 inclusive, 430, 435 through 439...

  16. Drie nuwe verklaringsopsies in die Jakobusbrief (Jak 2:1, 4: 5; 5: 6)

    African Journals Online (AJOL)

    van die bogenoemde drie verse in Jakobus het daar in die onlangse navorsing wel ..... schengeist — das ist der Sinn des Zitats' (1921: 268, 1976: 224). Calvyn ... liefde van God (vgl Eks 20: 5, 34: 14; Deut 4: 24; Jos 24: 19; Jes 26: 11) word in die ... word, waarop nie 'n direkte Skrifaanhaling hoef te volg nie. Davids.

  17. Metal Organic Frameworks as Solid Catalysts in Condensation Reactions of Carbonyl Groups

    Czech Academy of Sciences Publication Activity Database

    Dhakshinamoorthy, A.; Opanasenko, Maksym; Čejka, Jiří; Garcia, H.


    Roč. 355, 2-3 (2013), s. 247-268 ISSN 1615-4150 R&D Projects: GA ČR GBP106/12/G015 Grant - others:European Commission(XE) FP7/2007-2013, contract 228862 Institutional support: RVO:61388955 Keywords : alcohol condensation * green chemistry * Henry reaction Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 5.542, year: 2013

  18. An Extended X-ray Absorption Fine Structure Study of Rhodium-Oxygen Bonds in a Highly Dispersed Rhodium/Aluminum Oxide Catalyst

    NARCIS (Netherlands)

    Koningsberger, D.C.; Zon, J.B.A.D. van; Blik, H.F.J. van 't; Visser, G.J.; Prins, R.; Mansour, A.N.; Sayers, D.E.; Short, D.R.


    Analysis of in situ EXAFS measurements on a 2.4 wt % Rh/A120, catalyst, reduced at 473 K after calcination at 623 K, shows the presence of two different rhodium-oxygen bonds (viz. 2.05 and 2.68 A). The oxygen neighbors of rhodium at a distance of 2.05 A disappear after reduction at 673 K. The

  19. Expression of heterologous transporters in Saccharomyces kudriavzevii: A strategy for improving yeast salt tolerance and fermentation performance

    Czech Academy of Sciences Publication Activity Database

    Dibalová-Čuláková, Hana; Alonso-del-Real, J.; Querol, A.; Sychrová, Hana


    Roč. 268, Mar 2 (2018), s. 27-34 ISSN 0168-1605 R&D Projects: GA ČR(CZ) GA15-03708S Institutional support: RVO:67985823 Keywords : fermentation * salt tolerance * alkali-metal-cation exporter * non-conventional yeasts * Nhal antiporter * Ena ATPase Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.339, year: 2016

  20. The Role of Perceived Social Support and Coping Styles in Predicting Adolescents' Positivity (United States)

    Çevik, Gülsen Büyüksahin; Yildiz, Mehmet Ali


    The current research aims to examine the perceived social support and coping styles predicting positivity. Research participants included 268 adolescents, attending high school, with 147 females (54.9%) and 121 males (45.1%). Adolescents participating in the research were 14 to 18 years old and their average age was 16.12 with SD = 1.01. Research…

  1. Health-Related Quality of Life and Health Behaviors in a Population-Based Sample of Older, Foreign-Born, Chinese American Adults Living in New York City (United States)

    Wyatt, Laura C.; Trinh-Shevrin, Chau; Islam, Nadia S.; Kwon, Simona C.


    Although the New York City Chinese population aged =65 years increased by 50% between 2000 and 2010, the health needs of this population are poorly understood. Approximately 3,001 Chinese individuals from high-density Asian American New York City areas were included in the REACH U.S. Risk Factor Survey; 805 (26.8%) were aged =65 years and…

  2. Potential energy curve of Be2 in its ground electronic state

    Czech Academy of Sciences Publication Activity Database

    Špirko, Vladimír


    Roč. 235, č. 2 (2006), s. 268-270 ISSN 0022-2852 R&D Projects: GA AV ČR(CZ) IAA400550511 Institutional research plan: CEZ:AV0Z40550506 Keywords : ground electronic state of Be2 * MR-CI ab initio potentials * reduced potential curves Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.260, year: 2006

  3. Emisión de compuestos tóxicos del aire de fuentes móviles en la Gran Área Metropolitana de Costa Rica en 2007

    Directory of Open Access Journals (Sweden)

    Javier E. Rodríguez-Yáñez


    Del total de 914.486 toneladas emitidas por fuentes móviles, de los contaminantes tóxicos evaluados, el 46% está asociada al benceno y el 26,8% al formaldehído. Las emisiones provienen principalmente de automóviles particulares y microbuses o transporte de carga liviana a gasolina, que representan el 70% del total.

  4. Natura 2000-Solution for Eastern Europe or just a good start? The Sumava National Park as a test case

    Czech Academy of Sciences Publication Activity Database

    Křenová, Zdeňka; Kindlmann, Pavel


    Roč. 186, jun (2015), s. 268-275 ISSN 0006-3207 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0073; GA ČR GB14-36098G Institutional support: RVO:67179843 Keywords : Natura 2000 * Šumava National Park * biodiversity * post-communist countries Subject RIV: DO - Wilderness Conservation Impact factor: 3.985, year: 2015

  5. Compositions of (max, +) automata

    Czech Academy of Sciences Publication Activity Database

    Lahaye, S.; Komenda, Jan; Boimond, J.-L.


    Roč. 25, 1-2 (2015), s. 323-344 ISSN 0924-6703 R&D Projects: GA ČR(CZ) GAP103/11/0517 Institutional support: RVO:67985840 Keywords : (max,+) automata * synchronous product * asynchronous product Subject RIV: BA - General Mathematics Impact factor: 1.268, year: 2015

  6. Comparison of Masculine and Feminine Gender Roles in Iranian Patients with Gender Identity Disorder

    Directory of Open Access Journals (Sweden)

    Kaveh Alavi, MD


    Conclusion: Iranian FM‐GID individuals were less feminine than normal men. However, MF‐GID individuals were similar to normal women or more feminine. Cultural considerations remain to be investigated. Alavi K, Eftekhar M and Jalali Nadoushan AH. Comparison of masculine and feminine gender roles in Iranian patients with gender identity disorder. Sex Med 2015;3:261–268.

  7. Mammography parameters: compression, dose, and discomfort

    International Nuclear Information System (INIS)

    Blanco, S.; Di Risio, C.; Andisco, D.; Rojas, R.R.; Rojas, R.M.


    Objective: To confirm the importance of compression in mammography and relate it to the discomfort expressed by the patients. Materials and methods: Two samples of 402 and 268 mammographies were obtained from two diagnostic centres that use the same mammographic equipment, but different compression techniques. The patient age range was from 21 to 50 years old. (authors) [es

  8. Regional calibration models for predicting loblolly pine tracheid properties using near-infrared spectroscopy (United States)

    Mohamad Nabavi; Joseph Dahlen; Laurence Schimleck; Thomas L. Eberhardt; Cristian Montes


    This study developed regional calibration models for the prediction of loblolly pine (Pinus taeda) tracheid properties using near-infrared (NIR) spectroscopy. A total of 1842 pith-to-bark radial strips, aged 19–31 years, were acquired from 268 trees from 109 stands across the southeastern USA. Diffuse reflectance NIR spectra were collected at 10-mm...

  9. 76 FR 74838 - Agency Information Collection Activities: Proposed Request (United States)


    ... (EDCS) interview, or the Internet application, i3441. This allows claimants to disclose any changes to... disability income Supplemental Security Income (SSI) payments, or who are requesting a hearing before an ALJ...) SSA-3441-BK 5,604 1 45 4,203 EDCS Interview 662,090 1 45 496,568 i3441 (Internet) 605,268 1 28 282,458...

  10. Performance characteristics of a gelled-electrolyte valve-regulated ...

    Indian Academy of Sciences (India)


    trochemical systems ever developed, and no other battery is yet able to ... larly so in photovoltaic and motive-power applications. (Strebe et al 1990; May ... connected to the respective lugs and placed into a poly- propylene ... positive grid and two negative plates in each cell at 55°C .... Batteries & Solar Cells 8 268. Lambert ...

  11. New Perspectives from a Quasi-English Translation of Dusan Savicevic's 2000 Work on Roots in the Development of Andragogy: The 2016 Update of History and Philosophy of Andragogy (United States)

    Henschke, John A.


    This 2016 updated capsule on a History and Philosophy of Andragogy includes 196 concepts and 268 names from a quasi-English translation of Dusan Savicevic's 2000 work on roots in the world-wide development of Andragogy from ancient times. Ten new items were discovered and added to the list. Some of these documents, however, present aspects of the…

  12. Noor filmipõlvkond tulekul

    Index Scriptorium Estoniae


    Eesti Kino Suvepäevade raames esilinastusid 3. juunil TPÜ filmi ja video õppetooli mängufilmi režissööride II kursuse kursusetööd-lühimängufilmid : "2.68" (Tanel Toom), "Teispool vihma" (Margus Paju), "Sünnipäev" (Kaupo Kruusiauk) ja "Liivakellade parandaja" (Anu Aun). Kursuse juhendaja on Jüri Sillart

  13. Noored režissöörid esitlevad uusi filme / Margit Tõnson

    Index Scriptorium Estoniae

    Tõnson, Margit, 1978-


    Eesti Kino Suvepäevade raames esilinastuvad 3. juunil TPÜ filmi ja video õppetooli mängufilmi režissööride II kursuse kursusetööd-lühimängufilmid : "2.68" (Tanel Toom), "Teispool vihma" (Margus Paju), "Sünnipäev" (Kaupo Kruusiauk) ja "Liivakellade parandaja" (Anu Aun). Kursuse juhendaja on Jüri Sillart

  14. The Resurgence of Naxalism: How Great a Threat to India? (United States)


    dislocations occasioned by India’s economic opening and the forces of globalization, these pronouncements doubtless find a receptive audience . A...ideology has historically struggled to find an audience 268 Jeremy Page, “Indian Slum Population...United States. As American investment in India grows, other corporations may, like Pepsi , become symbolically charged outlets for this hatred. Should

  15. Exploring the Value of MBA Degrees: Students' Experiences in Full-Time, Part-Time, and Executive MBA Programs (United States)

    Bruce, Grady D.


    Critics of the overall value of the MBA have not systematically considered the attitudes of MBA students about the value of their degree. The author used data from a large sample of graduates (N = 16,268) to do so, and to explore predictors of overall degree value. The author developed separate regression models for full-time, part-time, and…

  16. Dirac-Hartree-Fock studies of X-ray transitions in meitnerium

    International Nuclear Information System (INIS)

    Thierfelder, C.; Schwerdtfeger, P.; Hessberger, F.P.; Hofmann, S.


    The K -shell and L -shell ionizations potentials for 268 109 Mt were calculated at the Dirac-Hartree-Fock level taking into account quantum electrodynamic and finite nuclear-size effects. The K α1 transition energies for different ionization states are accurately predicted and compared with recent experiments in the α -decay of 272 111 Rg. (orig.)

  17. An experimental study of the reactivity of CN and C3N anions with cyanoacetylene (HC3N)

    Czech Academy of Sciences Publication Activity Database

    Romanzin, C.; Louarn, E.; Lemaire, J.; Žabka, Ján; Polášek, Miroslav; Guillemin, J.-C.; Alcaraz, Ch.


    Roč. 268, APR 2016 (2016), s. 242-252 ISSN 0019-1035 R&D Projects: GA ČR(CZ) GA14-19693S; GA MŠk(CZ) LD14024 Grant - others:COST(XE) CM0805; COST(XE) TD1308 Institutional support: RVO:61388955 Keywords : ionosoheres * titan * satellites Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.131, year: 2016

  18. Tick-borne zoonotic pathogens in ticks feeding on the common nightingale including a novel strain of Rickettsia sp

    Czech Academy of Sciences Publication Activity Database

    Dubská, L.; Literák, I.; Kverek, P.; Roubalová, Eva; Kocianova, E.; Taragelova, V.


    Roč. 3, č. 4 (2012), s. 265-268 ISSN 1877-959X Institutional support: RVO:60077344 Keywords : tick * Ixodes ricinus * Borrelia garinii * Anaplasma phagocytophilum * Rickettsia helvetica * Babesia sp. EU1 * Common nightingale Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 2.353, year: 2012

  19. Research Investigation Directed Toward Extending the Useful Range of the Electromagnetic Spectrum. (United States)


    Surface Science 132, 268 (1983). Aw (4) W.E. Spicer, 1. Lindau, P. Skeath, CA4 Su and P. Chye , Phys. Rev. Lett. 44, 420 (1980). (5) R.H. Williams, J...AFB, OH 45433 Office of Naval Research 800 North Quincy Street Dr. T. N. Chin Dr. Allan Schell ATTh: Code� U. S. Army ARRADCOM RADC/EE Arlington

  20. 175 original article bronchopulmonary tuberculosis

    African Journals Online (AJOL)

    Dr Oboro VO

    Also efforts should be made to ensure that all positive cases .... tuberculosis situation in some cities of the country such as Portharcourt .... countries were above the age of 50 (17, 25) . Of the 350 smear-positive patients, 235 were tested for HIV infection. 63 (26.8%) of these were positive. This agrees with the WHO estimate.

  1. Developments for transactinide chemistry experiments behind the gas-filled separator TASCA

    Energy Technology Data Exchange (ETDEWEB)

    Even, Julia


    synthesised carbonyl complexes were identified by nuclear decay spectroscopy. Some complexes were studied with isothermal chromatography or thermochromatography methods. The chromatograms were compared with Monte Carlo Simulations to determine the adsorption enthalpyrnon silicon dioxide and on gold. These simulations based on existing codes, that were modified for the different geometries of the chromatography channels. All observed adsorption enthalpies (on silcon oxide as well as on gold) are typical for physisorption. Additionally, the thermalstability of some of the carbonyl complexes was studied. This showed that at temperatures above 200 C therncomplexes start to decompose. It was demonstrated that carbonyl-complex chemistry is a suitable method to study rutherfordium, dubnium, seaborgium, bohrium, hassium, and meitnerium. Until now, only very simple, thermally stable compounds have been synthesized in the gas-phase chemistry of the transactindes. With the synthesis of transactinide-carbonyl complexes a new compound class would be discovered. Transactinide chemistry would reach the border between inorganic and metallorganic chemistry. Furthermore, the in-situ synthesised carbonyl complexes would allow nuclear spectroscopy studies under low background conditions making use of chemically prepared samples. [German] Die vorliegende Arbeit befasst sich mit der Entwicklung von Experimenten hinter dem gasgefuellten Separator TASCA (TransActinide Separator and Chemistry Apparatus) zur Studie des chemischen Verhaltens der Transactinide. Zum einen wurde die Moeglichkeit der elektrochemischen Abscheidung kurzlebiger Isotope der Elemente Ruthenium und Osmium auf Goldelektroden im Hinblick auf ein Experiment mit Hassium untersucht. Aus der Literatur ist bekannt, dass bei der elektrochemischen Abscheidung einzelner Atome das Abscheidepotential signifikant vom Nernst-Potential abweicht. Die Verschiebung des Potentials haengt von der Adsorptionsenthalpie des abzuscheidenden Elements

  2. Characterization of pH-sensitive molecular switches that trigger the structural transition of vesicular stomatitis virus glycoprotein from the postfusion state toward the prefusion state. (United States)

    Ferlin, Anna; Raux, Hélène; Baquero, Eduard; Lepault, Jean; Gaudin, Yves


    Vesicular stomatitis virus (VSV; the prototype rhabdovirus) fusion is triggered at low pH and mediated by glycoprotein G, which undergoes a low-pH-induced structural transition. A unique feature of rhabdovirus G is that its conformational change is reversible. This allows G to recover its native prefusion state at the viral surface after its transport through the acidic Golgi compartments. The crystal structures of G pre- and postfusion states have been elucidated, leading to the identification of several acidic amino acid residues, clustered in the postfusion trimer, as potential pH-sensitive switches controlling the transition back toward the prefusion state. We mutated these residues and produced a panel of single and double mutants whose fusion properties, conformational change characteristics, and ability to pseudotype a virus lacking the glycoprotein gene were assayed. Some of these mutations were also introduced in the genome of recombinant viruses which were further characterized. We show that D268, located in the segment consisting of residues 264 to 273, which refolds into postfusion helix F during G structural transition, is the major pH sensor while D274, D395, and D393 have additional contributions. Furthermore, a single passage of recombinant virus bearing the mutation D268L (which was demonstrated to stabilize the G postfusion state) resulted in a pseudorevertant with a compensatory second mutation, L271P. This revealed that the propensity of the segment of residues 264 to 273 to refold into helix F has to be finely tuned since either an increase (mutation D268L alone) or a decrease (mutation L271P alone) of this propensity is detrimental to the virus. Vesicular stomatitis virus enters cells via endocytosis. Endosome acidification induces a structural transition of its unique glycoprotein (G), which mediates fusion between viral and endosomal membranes. G conformational change is reversible upon increases in pH. This allows G to recover its native

  3. Plutonium Finishing Plant (PFP) Safety Class and Safety Significant Commercial Grade Items (CGI) Critical Characteristic

    International Nuclear Information System (INIS)

    THOMAS, R.J.


    This document specifies the critical characteristics for Commercial Grade Items (CGI) procured for use in the Plutonium Finishing Plant as required by HNF-PRO-268 and HNF-PRO-1819. These are the minimum specifications that the equipment must meet in order to properly perform its safety function. There may be several manufacturers or models that meet the critical characteristics of any one item

  4. iMindMap as an Innovative Tool in Teaching and Learning Accounting: An Exploratory Study (United States)

    Wan Jusoh, Wan Noor Hazlina; Ahmad, Suraya


    Purpose: The purpose of this study is to explore the use of iMindMap software as an interactive tool in the teaching and learning method and also to be able to consider iMindMap as an alternative instrument in achieving the ultimate learning outcome. Design/Methodology/Approach: Out of 268 students of the management accounting at the University of…

  5. Borrelia carolinensis sp. nov., a novel species of the Borrelia burgclorferi sensu lato complex isolated from rodents and a tick from the south-eastern USA

    Czech Academy of Sciences Publication Activity Database

    Rudenko, Natalia; Golovchenko, Maryna; Grubhoffer, Libor; Oliver, J. H., Jr.


    Roč. 61, č. 2 (2011), 381-383 ISSN 1466-5026 R&D Projects: GA MŠk(CZ) LC06009; GA ČR GA206/09/1782 Institutional research plan: CEZ:AV0Z60220518 Keywords : MULTILOCUS SEQUENCE-ANALYSIS * FRAGMENT-LENGTH-POLYMORPHISM * LYME -DISEASE * RIBOSOMAL-RNA * Borrelia carolinensis sp. nov. * phylogeny Subject RIV: EE - Microbiology, Virology Impact factor: 2.268, year: 2011

  6. Who likes circus animals?


    Zanola, Roberto


    Using a sample based on 268 questionnaires submitted to people attending the Acquatico Bellucci circus, Italy, this paper analyzes the circusgoers's preferences for circus animals. Results show that higher preferences for circus animals are related to frequency of consumption. However, differently from what commonly expected, more educated and younger people seem to be less sensitive to the claims of animal welfare organizations.

  7. Bose-Einstein condensed supermassive black holes: a case of renormalized quantum field theory in curved space-time

    Czech Academy of Sciences Publication Activity Database

    Nieuwenhuizen, T.M.; Špička, Václav


    Roč. 42, č. 3 (2010), s. 256-268 ISSN 1386-9477. [International Conference on Frontiers of Quantum and Mesoscopic Thermodynamics (FQMT '08). Praha, 28.07.2008-02.08.2008] Institutional research plan: CEZ:AV0Z10100521 Keywords : supermassive black hole * quantum held theory * Bose-Einstein condensation * renormalization Subject RIV: BE - Theoretical Physics Impact factor: 1.304, year: 2010

  8. Resonance journal of science education

    Indian Academy of Sciences (India)

    IAS Admin

    232. Mahlburg's Work on Crank Functions. Ramanujan's Partitions Revisited. Nagesh Juluru and Arni S R Srinivasa Rao. REFLECTIONS. 268. The Scientific Enterprise. Science in the Modern Indian Context. V V Raman. R. R. R4. 2. 1. C r. L. R3+ rL. H. A. C. D. B. E. 244. 223. Transverse section of the ring porous wood ...

  9. Invasion science: a horizon scan of emerging challenges and opportunities

    Czech Academy of Sciences Publication Activity Database

    Riccardi, A.; Blackburn, T. M.; Carlton, J. T.; Dick, J. T. A.; Hulme, P. E.; Iacarella, J. C.; Jeschke, J.M.; Liebhold, A. M.; Lockwood, J. L.; MacIsaac, H. J.; Pyšek, Petr; Richardson, D. M.; Ruiz, G. M.; Simberloff, D.; Sutherland, W. J.; Wardle, D. A.; Aldridge, D.


    Roč. 32, č. 6 (2017), s. 464-474 ISSN 0169-5347 R&D Projects: GA ČR GB14-36079G Grant - others:AV ČR(CZ) AP1002 Program:Akademická prémie - Praemium Academiae Institutional support: RVO:67985939 Keywords : biological invsions * research topics * horizon scanning Subject RIV: EH - Ecology, Behaviour OBOR OECD: Ecology Impact factor: 15.268, year: 2016

  10. Near-field/far-field azimuth and elevation angle estimation using a single vector hydrophone

    Czech Academy of Sciences Publication Activity Database

    Tichavský, Petr; Wong, K. T.; Zoltowski, M.


    Roč. 49, č. 11 (2001), s. 2498-2510 ISSN 1053-587X R&D Projects: GA ČR GA102/97/0466; GA ČR GA102/01/0021 Institutional research plan: AV0Z1075907 Keywords : acoustic signal processing * array signal processing * direction-of-arrival estimation Subject RIV: BB - Applied Statistics, Operational Research Impact factor: 1.268, year: 2001

  11. Solar excitation of bicentennial Earth rotation oscillations

    Czech Academy of Sciences Publication Activity Database

    Ron, Cyril; Chapanov, Y.; Vondrák, Jan


    Roč. 9, č. 3 (2012), s. 259-268 ISSN 1214-9705 R&D Projects: GA ČR GA205/08/0908 Grant - others:Bulgarian NSF(BG) DO02-275; FP7(BG) MCA PIRSES-GA-2009-246874 Institutional support: RVO:67985815 Keywords : Earth rotation * solar activity Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 0.530, year: 2011

  12. Husband and Wife Interaction and Family Regulation in Rural Uruguay. (United States)

    De Winter, A. M.

    Decision-making and family planning were studied in the rural city of Durazno, Uruguay, by means of answers to questions by both husbands and wives. A sample size of 268 couples in which at least one partner was between 21 and 50 years of age was used. Data were collected by means of a pretested and precoded interview schedule. Major conclusions…

  13. Electric conductance of films prepared from polymeric composite nanoparticles

    Czech Academy of Sciences Publication Activity Database

    Hain, J.; Pich, A.; Adler, H. J.; Rais, David; Nešpůrek, Stanislav


    Roč. 268, č. 1 (2008), s. 61-65 ISSN 1022-1360. [Microsymposium on Advanced Polymer Materials for Photonics and Electronics /47./. Prague, 15.07.2007-19.07.2007] R&D Projects: GA AV ČR KAN400720701; GA MŠk OC 138 Institutional research plan: CEZ:AV0Z40500505 Keywords : coatings * composites * conducting polymers Subject RIV: BM - Solid Matter Physics ; Magnetism

  14. The influence of substrate temperature on properties of APS and VPS W coatings

    Czech Academy of Sciences Publication Activity Database

    Kovářík, O.; Haušild, P.; Siegl, J.; Chráska, Tomáš; Matějíček, Jiří; Pala, Zdeněk; Boulos, M.


    Roč. 268, April (2015), s. 7-14 ISSN 0257-8972 R&D Projects: GA ČR(CZ) GAP108/12/1872 Institutional support: RVO:61389021 Keywords : Plasma spray * Substrate temperature * W * Hardness * Coating modulus * Thermal conductivity Subject RIV: JH - Ceramics, Fire-Resistant Materials and Glass Impact factor: 2.139, year: 2015

  15. Statistical study of acoustic emissions generated during the controlled deformation of migmatite specimens

    Czech Academy of Sciences Publication Activity Database

    Vilhelm, J.; Rudajev, V.; Ponomarev, A. V.; Smirnov, V. B.; Lokajíček, Tomáš


    Roč. 100, December 2017 (2017), s. 83-89 ISSN 1365-1609 R&D Projects: GA ČR GA13-13967S; GA ČR(CZ) GA16-03950S Institutional support: RVO:67985831 Keywords : laboratory measurements * steplike loading * cyclic loading * migmatite sample * aftershock series * autocorrelation analysis Subject RIV: DB - Geology ; Mineralogy OBOR OECD: Geology Impact factor: 2.268, year: 2016

  16. Plasma surfactant protein D levels and the relation to body mass index in a chinese population

    DEFF Research Database (Denmark)

    Zhao, X M; Wu, Y P; Wei, R


    in a Chinese population from the Tai An region comprising 268 individuals. We found that (i) plasma SP-D in the Chinese population was distributed with a median value of 380.2 ng/ml (324.9; 418.7) and a range from 79.4 to 3965.3 ng/ml, (ii) significantly higher plasma SP-D in men than in women...

  17. Warsaw Pact: The Question of Cohesion. Phase II, Volume 1. The Greater Socialist Army: Integration and Reliability, (United States)


    235 CHAPTER 9 - Military Political Socialization : Themes and Effectiveness .................................... 268 CHAPTER 10 - comprehensive political socialization efforts,6 the last two also coordinated by Moscow. An in-depth analysis of the national attitudes of all... Political Socialization ...," below. See Chapter 5, "Historical Precedents...," below. 8 See, for example, S.I. Bruk and M.I. Kabuzan, "Dinamika chislennosti

  18. Survey of ethical dilemmas facing intensivists in South Africa in the ...

    African Journals Online (AJOL)

    Intensivists comprising 26.8% (n=22) of the total group rated as probably important or least important the 'resources available'; 'bed used to the prejudice of another patient' was stated by 16.4% (n=14); and 'policy of the intensive care unit' by 17% (n=14). Nearly two-thirds (65.9%; n=58) would respect an informed refusal of ...

  19. Cross-Linked Poly-4-vinylpyridines as Useful Supports in Metal Catalysis: Micro- and Nanometer Scale Morphology.

    Czech Academy of Sciences Publication Activity Database

    D'Archivio, A.A.; Tauro, L.; Galantini, L.; Panatta, A.; Tettamanti, E.; Giammatteo, M.; Jeřábek, Karel; Corain, B.


    Roč. 268, 1-2 (2007) , s. 176-184 ISSN 1381-1169 R&D Projects: GA AV ČR(CZ) KSK4050111 Grant - others:MURS(IT) 2001038991 Institutional research plan: CEZ:AV0Z40720504 Keywords : cross-linked functional polymers * poly-4-vinylpyridines * supported Pt(0) nanoclusters Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 2.707, year: 2007

  20. Optimization of Fit for Mass Customized Apparel Ordering Using Fit Preference and Self Measurement. (United States)


    in significance and definition for both consumers and manufacturers. Fit preference involves an individualized bias toward a particular look, size...Committee. Bishton, D. (1984). The sweatshop report. Birmingham: AFFOR. 268 269 Bjerve, S. & Doksum, K. (1993). Correlation curves: Measures of...anthropometry methods. New York: John Wiley & Sons. Rosenbaum, R. & Schilling D. (1997). In sweatshops , wages are the issue. The Corporate Examiner

  1. Sillarti "lapsed" said käe valgeks / Tarmo Teder

    Index Scriptorium Estoniae

    Teder, Tarmo, 1958-


    Eesti Kino Suvepäevade raames esilinastusid 3. juunil TPÜ filmi ja video õppetooli mängufilmi režissööride II kursuse (juhendaja Jüri Sillart) kursusetööd-lühimängufilmid : "2.68" (Tanel Toom), "Teispool vihma" (Margus Paju), "Sünnipäev" (Kaupo Kruusiauk) ja telerežii lõpetanud Anu Auna "Liivakellade parandaja"

  2. Linaristsed täiskuu aegu / Grete Nootre

    Index Scriptorium Estoniae

    Nootre, Grete


    Eesti Kino Suvepäevade raames esilinastuvad 3. juunil TPÜ filmi ja video õppetooli mängufilmi režissööride II kursuse (juhendaja Jüri Sillart) kursusetööd-lühimängufilmid : "2.68" (Tanel Toom), "Teispool vihma" (Margus Paju), "Sünnipäev" (Kaupo Kruusiauk) ja telerežii lõpetanud Anu Auna "Liivakellade parandaja"

  3. Kolm meest paadis (naisest rääkimata) / Karol Ansip

    Index Scriptorium Estoniae

    Ansip, Karol


    Eesti Kino Suvepäevade raames esilinastusid 3. juunil TPÜ filmi ja video õppetooli mängufilmi režissööride II kursuse (juhendaja Jüri Sillart) kursusetööd-lühimängufilmid : "2.68" (Tanel Toom), "Teispool vihma" (Margus Paju), "Sünnipäev" (Kaupo Kruusiauk) ja telerežii lõpetanud Anu Auna "Liivakellade parandaja"

  4. Компонентный состав эфирного масла полыни австрийской, произрастающей в Ставропольском крае


    Коновалов, Д.; Коновалов, Ю.


    The componental structure of essential oil of Artemisia austriaca Jacq. growing in Stavropol region was investigated by GC-MS method. 31 compounds are identified. The basic components are: a-thujone (55,26%), eucalyptol (12,01%), b-thujone (7,21%), terpineol-4 (4,32%), (+)-camphor (4,11%), (S)-cis-verbenol (2,68%), borneol (1,94%), o-cymene (1,72%), (-)-cis-sabinol (1,25%).

  5. Intake of Cs 137 in wild boars (Sus scrofa l.) daily ration on the territory of Palesski state radiation-ecological reserve

    International Nuclear Information System (INIS)

    Deryabina, T.G.


    Total radiation activity according to Cs 137 in daily ration of adult wild boar's species on the territory of Palesski state radiation-ecological reserve is 15,7 kBq in autumn, 26,8 kBq in winter. Taking soil consumption, together with food, into consideration it is 21,7 kBq in autumn and 32,8 kBq in winter. (authors)

  6. The Role of Sequence Markers on Reading and Recall: A Comparison of Native and Nonnative English Speakers (United States)


    ORGANIZATION PEPOPT NVBER S; 6a E O c PEPFC=V’NG CPC;% ZA " ON 6o OrFiCE SYMBOL 7a NAME OF MONITORING ORGANZA - ON 0 University of Califor-ia (If appi cable...readers. Experimental Aging Research, 7, 253-268. McLeod, B., & McLaughlin, B. (1986). Restructuring or automatization? Reading in a second language

  7. Ashoka : el gran soberano del Imperio Maurya

    Directory of Open Access Journals (Sweden)

    María Teresa Román López


    Full Text Available Ashoka (268-239 a.C. fue el tercer monarca de la dinastía Maurya. Sus edictos y las inscripciones grabadas en rocas o pilares ubicados en varias partes de su reino nos familiarizan no solamente con la personalidad de uno de los gobernantes más importantes de la historia de la India, sino también con los acontecimientos de su reinado. Acaso el más conocido de ellos sea su conversión al budismo. Promovió la labor misionera budista, que rebasó las fronteras extendiéndose por otros países, sobre todo por el sudeste asiático.Ashoka (268-239 a. C. was the third King of the Maurya dinasty. His edicts and the inscriptions engraved on the rocks or pilars placed in several parts of his reign show as not only the personality of one of the most important goberning in the Indian History, but also the events of his Kingdom. Perhaps the most known of them is his conversión to Budism: The prometed the budish missionary labor that crossed the frontiers to another countryes, overcoat througt the Asían south east.

  8. Study on the behavior of unirradiated light water reactor fuel with iodine-127 under the reactivity initiated accident (RIA) conditions

    International Nuclear Information System (INIS)

    Sasajima, Hideo; Yanagisawa, Kazuaki; Kanazawa, Hiroyuki


    In a light water reactor fuel, a stress arised from pellet-cladding interaction (PCI) will have possibility to cause stress corrosion claddling (PCI failure) under an environment of corrosive fission product ; line iodine. A pulse irradiation experiment by NSRR was carried out to examine whether or not an unirradiated NSRR standard fuel rod in which 1.3 mg (33 x 10 -6 g/cm 2 ) of iodine was artificially filled could cause the PCI failure. Obtained results are: (1) The fuel rods with iodine did not fail both at deposited energy levels of 268 and 280 cal/g · UO 2 . On the other hand, the fuel rods without iodine failed at the same energy levels due to thinning of the cladding wall thickness. Within this experimental scope, PCI-failure did not occur on iodine filled fuel rods. (2) At a periphery of the fuel pellet of iodine filled rod, an uniform torus ring was formed. The torus ring consisted of an equi-axed large grains at 268 cal/g · UO 2 and a columnar ones at 280 cal/g · UO 2 . The torus ring was not formed in the fuel without iodine. (author)

  9. Differences in the Fitness Levels of Urban and Rural Middle School Students in Croatia (United States)

    Novak, Dario; Bernstein, Eve R.; Podnar, Hrvoje; Vozzolo, Yolanda


    Background: It is known that suburban youth are more fit than urban youth in Croatia. Method: Differences (p < 0.05) in fitness levels and motor abilities of 9,164 (F = 4,671, M = 4,493) Croatian children (age range: 11-14 years) from urban (F = 1,380, M = 1,268), mixed rural-urban (F = 274, M = 289), and rural (F = 3017, M = 2936) areas were…

  10. Aeromedical Factors in Aviator Fatigue, Crew Work/Rest Schedules and Extended Flight Operations: An Annotated Bibliography. (United States)


    medicina aeronatica). Revisti de Aoronautica y Astronautica. 37:109-118. (In Spanish.) English translation NASA TM-75165, October 1977. Literature on...treatment of flight fatigue. Rxi.t,, 9. Medicina Aeronautica E Spaziale. 32:231-268. (In Italian.) The author frames nosologically flight fatigue syndrome... China Lake, CA 93555 (1) Warminster, PA 18974 (1) US Navy US Navy Naval Aerospace Medical Institute Naval Research Laboratory Library Library Shock

  11. Numerical simulation of flows over 2D and 3D backward-facing inclined steps

    Czech Academy of Sciences Publication Activity Database

    Louda, Petr; Příhoda, Jaromír; Kozel, K.; Sváček, P.


    Roč. 43, October (2013), s. 268-276 ISSN 0142-727X R&D Projects: GA ČR GAP101/10/1230; GA ČR GA103/09/0977 Institutional support: RVO:61388998 Keywords : backward-facing step * EARSM turbulence model * one-sided diffuser Subject RIV: BK - Fluid Dynamics Impact factor: 1.777, year: 2013

  12. Bifidobacterium actinocoloniiforme sp nov and Bifidobacterium bohemicum sp nov., from the bumblebee digestive tract

    Czech Academy of Sciences Publication Activity Database

    Killer, Jiří; Kopečný, Jan; Mrázek, Jakub; Koppová, Ingrid; Havlík, J.; Benada, Oldřich; Kott, T.


    Roč. 61, č. 6 (2011), s. 1315-1321 ISSN 1466-5026 R&D Projects: GA ČR GA523/08/1091; GA ČR GD525/08/H060 Institutional research plan: CEZ:AV0Z50450515; CEZ:AV0Z50200510 Keywords : ACID HOMOLOGY RELATIONSHIPS * HAMSTER DENTAL PLAQUE * HSP60 GENE-SEQUENCES Subject RIV: EE - Microbiology, Virology Impact factor: 2.268, year: 2011

  13. Homoptera, Cicadidae

    African Journals Online (AJOL)


    Oct 24, 1988 ... There are also morphological differences between the two taxa which parallel the differences in their .... Female 5 31,0 29,9--32,2 9 26,8 25,3-28,7 -8,11 0,0001. • Student's t test. [. 1mm. A. B. Figure 2 Male genitalia (pygophore and urite). A, P. stridula; ... mainly on trees, all of which were exotics, e.g. Port.

  14. Coordination control of discrete-event systems revisited

    Czech Academy of Sciences Publication Activity Database

    Komenda, Jan; Masopust, Tomáš; van Schuppen, J. H.


    Roč. 25, 1-2 (2015), s. 65-94 ISSN 0924-6703 R&D Projects: GA ČR(CZ) GPP202/11/P028; GA ČR(CZ) GAP103/11/0517 Institutional support: RVO:67985840 Keywords : coordination control * supervisory control Subject RIV: BA - General Mathematics Impact factor: 1.268, year: 2015

  15. Quantification of expression and methylation of the Igf2r imprinted gene in segmental trisomic mouse model

    Czech Academy of Sciences Publication Activity Database

    Vacík, Tomáš; Forejt, Jiří


    Roč. 82, - (2003), s. 261-268 ISSN 0888-7543 R&D Projects: GA MŠk LN00A079; GA ČR GV204/98/K015 Grant - others:HHMI(US) 555000306 Institutional research plan: CEZ:AV0Z5052915 Keywords : Genomic imprinting * dosage-sensitive genes * Ts43H segmental trisomy of chromosome 17 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.488, year: 2003

  16. Prevalence vybraných vrozených vad v České republice – vývojové vady centrálního nervového systému a zažívacího traktu

    Czech Academy of Sciences Publication Activity Database

    Šípek, A.; Gregor, V.; Horáček, J.; Šípek jr., A.; Klaschka, Jan; Malý, Marek


    Roč. 64, č. 1 (2015), s. 47-53 ISSN 1210-7913 Institutional support: RVO:67985807 Keywords : defekty neurální trubice * vrozený hydrocefalus * defekty břišní stěny * vrozené vady jícnu * anorektální malformace * kongenitální diafragmatická hernie Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.268, year: 2015

  17. Waterborne Commerce of the United States, Calendar Year 1980. Part 1. Waterways and Harbors, Atlantic Coast. (United States)


    3.9 2,68 .007 Sol 22 ----------- ----- 3322 COPPER ALLOTS. UNHORMED -------------------.--------- 3.19’ 0.901 267 6...PRODUCTS-------------- 1~91 11::j; 01.131 Sol 22,641----------- --------- ---------- 3241 BUILDING CEMEN----------------- ------3. 2,2 i74 3.400 1 41t...11,047 ----- TON-MILES, OCEANOING . 6111,267,297, __________ _____ ___________ INSTERN AL (SMORT TONSI COMMODITY TOA Nj’l U#UIUV U OUD ] H TOTAL

  18. 46 CFR 56.01-2 - Incorporation by reference. (United States)


    ... Welded Ferritic and Martensitic Stainless Steel Tubing for General Service (“ASTM A 268”), 56.60-1; (21) ASTM A 276-98, Standard Specification for Stainless Steel Bars and Shapes (“ASTM A 276”), 56.60-2; (22... (27) ASME B36.19M-2004 Stainless Steel Pipe (2004) (“ASME B36.19M”), 56.07-5; 56.60-1. (28) ASME SA...

  19. Influence of intra-row spacing and mulching on weed growth and ...

    African Journals Online (AJOL)



    Feb 2, 2006 ... response of weed growth and bulb yield of garlic to intra-row spacing and mulching. ... advantageous effects on the growth and yield of this crop. ... Portulaca oleracea L x xx .... 50DAP. 60DAP. Spacing (cm). 20 x 10. 2.60b. 4.69. 6.34b. 12.54b. 2.68. 3.90 .... Effect of plant spacing and nitrogen fertilization on.

  20. Three-dimensional confocal morphometry reveals structural changes in astrocyte morphology in situ

    Czech Academy of Sciences Publication Activity Database

    Chvátal, Alexandr; Anděrová, Miroslava; Hock, Miroslav; Prajerová, Iva; Neprašová, Helena; Chvátal, Viktor; Kirchhoff, J. F.; Syková, Eva


    Roč. 85, č. 2 (2007), s. 260-271 ISSN 0360-4012 R&D Projects: GA ČR GA305/04/1293; GA ČR GA305/06/1464; GA ČR GA305/06/1316; GA MŠk 1M0538 Institutional research plan: CEZ:AV0Z50390512 Keywords : Osmotic stress * Glia * Soma Subject RIV: FH - Neurology Impact factor: 3.268, year: 2007

  1. Circulatory Shock. Volume 34. Number 1. May 1991. International Conference on Shock (2nd), Meeting of European Shock Society (5th), Annual Meeting of the Shock Society (USA) (14th), Vienna Shock Form (3rd) Held in Vienna, Austria on 2-6 June 1991 (United States)


    OCTADECENOATE, AS A BURN TOXIN Takayuki Ozawa, Mika Hayakawa, Kazuhiro Kosaka, Satoru Sugiyama, Kazuhisa Yokoo, Hisashi Aoyama, and Yohei Izawa Department...shock. 41 CARDIOPULMONARY HEMODYNAMIC AND PERIPHERAL CIRCULATORY RESPONSES IN SHOCK T. Muteki, N. Kaku. T. Fukushige, I. Kohno and T. Hiraki Department...Tadashi, 242 Machleidt, Werner, 213 Ozawa, Takayuki , 11 Kawarada, Yoshifumi, 442 Mackie, D.P., 348 Ozawa, Kazue, 268 Keser, Claudia, 380 Maitra, Subir R

  2. 75 FR 57188 - Rhode Island: Final Authorization of State Hazardous Waste Management Program Revisions (United States)


    ... implementation of the Land Disposal Restrictions (LDR) requirements in 40 CFR part 268 because Rhode Island has..., April 24, 2006 (other than LDR requirements): Rules 2.2 C, 2.2 C.4, 2.2 F, 2.2 G, 2.2 I, 2.2 J, 7.0 B.82...)), but Safe Food and Fertilizer disagrees with the EPA determinations and states that the ``use of...

  3. Synthesis and structural characterization of Na 2 MnP 2 O 7 crystal

    Indian Academy of Sciences (India)

    Na2MnP2O7 crystals were synthesized by hydrothermal technique. Crystals obtained are in the form of single crystals of rhombohedral morphology with lattice parameters as follows: triclinic, 1 ¯ , = 0.71069 Å, = 6.657(3) Å, = 6.714(6) Å, = 6.518(4) Å, = 112.31(6)°, = 92.14(4)°, = 83.89(5)°, = 268.0(3) Å3, ...

  4. Comparing Sociodemographic Factors Associated with Disability Between Immigrants and the Chilean-Born: Are There Different Stories to Tell?


    Cabieses, Baltica; Pickett, Kate; Tunstall, Helena


    This study explored a range of sociodemographic factors associated with disability among international immigrants in Chile, and compared them to the Chilean-born. Secondary data analysis of the Chilean population-based survey CASEN-2006 was conducted (268,873 participants). Main health outcomes: any disability and six different types of disability: visual, hearing, learning, physical, psychiatric and speaking (binary outcomes). Sociodemographic variables: Demographic factors (age, sex, marita...

  5. Occupational factors and risk of adult bone sarcomas

    DEFF Research Database (Denmark)

    Merletti, Franco; Richiardi, Lorenzo; Bertoni, Franco


    -tool operators (OR = 2.14, 95% CI 1.08-4.26), woodworkers (OR = 2.68, 95% CI 1.36-5.29) and construction workers (OR = 1.62, 95% CI 0.92-2.87). Ever users of pesticide had an OR of 2.33 (95% CI 1.31-4.13), with similar risks for exposure to insecticides and exposure to herbicides. Neither duration of employment...

  6. Comprehensive proteomic analysis of human dentin

    Czech Academy of Sciences Publication Activity Database

    Jágr, Michal; Eckhardt, Adam; Pataridis, Statis; Mikšík, Ivan


    Roč. 120, č. 4 (2012), s. 259-268 ISSN 0909-8836 R&D Projects: GA ČR(CZ) GA203/08/1428; GA ČR(CZ) GAP206/12/0453 Institutional research plan: CEZ:AV0Z50110509 Institutional support: RVO:67985823 Keywords : dentin * mass spectrometry * proteomics * tooth * two-dimensional gel electrophoresis Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 1.420, year: 2012

  7. Domov jako konceptuální rámec, téma i výzkumný terén: vývoj i současná podoba studií domova

    Czech Academy of Sciences Publication Activity Database

    Gibas, Petr


    Roč. 53, č. 2 (2017), s. 241-268 ISSN 0038-0288 R&D Projects: GA ČR(CZ) GAP404/12/1446 Institutional support: RVO:68378025 Keywords : home * house and home * phenomenology of home Subject RIV: AO - Sociology, Demography OBOR OECD: Sociology Impact factor: 0.143, year: 2016 culture =en

  8. The complexity of proving that a graph is Ramsey

    Czech Academy of Sciences Publication Activity Database

    Lauria, M.; Pudlák, Pavel; Rödl, V.; Thapen, Neil


    Roč. 37, č. 2 (2017), s. 253-268 ISSN 0209-9683 R&D Projects: GA AV ČR IAA100190902; GA ČR GBP202/12/G061 Institutional support: RVO:67985840 Keywords : complexity * c-Ramsey graphs Subject RIV: BA - General Mathematics OBOR OECD: Pure mathematics Impact factor: 1.048, year: 2016

  9. Abundance of Ixodes ricinus and prevalence of Borrelia burgdorferi s.l. in the nature reserve Siebengebirge, Germany, in comparison to three former studies from 1978 onwards

    Czech Academy of Sciences Publication Activity Database

    Schwarz, Alexandra; Hönig, Václav; Vavrušková, Zuzana; Grubhoffer, Libor; Balczun, C.; Albring, A.; Schaub, G. A.


    Roč. 5, NOV 21 (2012) ISSN 1756-3305 R&D Projects: GA ČR GD206/09/H026; GA MŠk(CZ) LC06009 Institutional research plan: CEZ:AV0Z60220518 Keywords : Ixodes ricinus * Tick density * Borrelia prevalence * Borrelia lusitaniae * Multiple infections * Siebengebirge Subject RIV: EC - Immunology Impact factor: 3.246, year: 2012

  10. Challenges in Computational Social Modeling and Simulation for National Security Decision Making (United States)


    34 Sociological Theory 25:268-291. Mead , George Herbert . 1913. "The social self." Journal of Philosophy, Psychology and Scientific Methods 10:374-380...Coastal Science and Policy, and University Distinguished Research Professor in the Department of Sociology with adjunct appointments in Biology...Hopkins Applied Physics Laboratory and formerly of the U.S. Defense Modeling and Simulation Office (DMSO) to discuss the history and importance of

  11. Technical realisation of the VISA-II project, phase I, part IV, IZ-165-o268-1962

    International Nuclear Information System (INIS)

    Pavicevic, M.


    Project VISA-II is described in IX chapters as follows: introduction, definition of experiments and possibilities of performance; VISA-II channel, new experimental space in the RA reactor; hydraulic tests in the VISA-II channel; measurement of fast neutron and gamma flux in VISA-II channels; measurement of water flow through different VISA-2 irradiation capsules; fabrication of VISA-II capsules; corrosion and heavy water purity problems; safety problems of experiment VISA-2; experimental operation of VISA-II. This chapter VI includes documentation for each type of capsule, review about each experiment within the VISA-II project, the objective and purpose of the experiment as well as experimental device [sr

  12. El mito del Político (268 D-274 E y la historia de las religiones

    Directory of Open Access Journals (Sweden)

    Giovanni Casadio


    Full Text Available The importance of a religious-historical approach for an appropriate understanding of the myth in Plato's Statesman has not been sufficiently emphasized yet. The myth substantially describes the life of the world as two revolutions of the same circle, the ane forward and the ather backward. In the forward revolution God accompanies the world; during the latter he remains in his watch-tower. Within the framework of this myth, which establishes the current philosophical doctrine of the alternating world-periods, we find more or less developed allusions to other well-known themes of the Greek lore: the Golden age, the kingdom of Cronus, the Earth-born Men (gegeneis ... My aim is to reassess the specificity of this Platonic mythopoeia setting it in the general context of ancient religion. In the first part I characterize the motif of the absence of God against the background of the phenomenological -and historical- category of the deus otiosus (with examples derived from the middle-Platonic and gnostic domains. In the second part 1 consider the problem of the source (or sources of evil: apparently the corporeal principle (τὸ σωματοειδές, more properly the state of precosmical chaos. Finally, the question is raised of Plato's dualism in this context: whether radical or mitigated.

  13. A multicenter, retrospective chart review study comparing index therapy change rates in open-angle glaucoma or ocular hypertension patients newly treated with latanoprost or travoprost-Z monotherapy

    Directory of Open Access Journals (Sweden)

    Edward Deepak P


    Full Text Available Abstract Background Because latanoprost and the original formulation of travoprost that included benzalkonium chloride (BAK have been shown to be similar with regard to tolerability, we compared initial topical intraocular pressure (IOP-lowering medication change rates in patients newly treated with latanoprost or travoprost-Z monotherapy. Methods At 14 clinical practice sites, medical records were abstracted for patients with a diagnosis of open-angle glaucoma or ocular hypertension and who were ≥40 years of age, had a baseline and at least one follow-up visit, and had no prior history of ocular prostaglandin use. Data regarding demographics, ocular/systemic medical histories, clinical variables, therapy initiations and reasons for changes, adverse events, and resource utilization were recorded from randomly chosen eligible charts. Primary outcomes were rates of and reasons for changing from the initial therapy within six months and across the full study period (1000 days. Results Data from 900 medical charts (latanoprost, 632; travoprost-Z, 268 were included. For both cohorts, average follow-up was >1 year. Cohorts were similar with regard to age (median ~67 years, gender distribution (>50% female, and diagnosis (~80% with open-angle glaucoma. Within six months, rates of index therapy change for latanoprost versus travoprost-Z were 21.2% (134/632 and 28.7% (77/268, respectively (p = 0.0148; across the full study period, rates were 34.5% (218/632 and 45.2% (121/268, respectively (p = 0.0026. Among those who changed their index therapy, insufficient IOP control was the most commonly reported reason followed by adverse events; hyperemia was the most commonly reported adverse event at index therapy change. Conclusions In this "real world" study of changes in therapy in patients prescribed initial monotherapy with latanoprost with BAK or travoprost-Z with SofZia, medication changes were common in both treatment groups but statistically

  14. MD simulations and QM/MM calculations show that single-site mutations of cytochrome P450BM3 alter the active site’s complexity and the chemoselectivity of oxidation without changing the active species† †Electronic supplementary information (ESI) available: The RMS deviation of the protein during 100 ns (and 200 ns) of simulation and the total QM/MM and ZPE energies, as well as the Cartesian coordinates of all of the computed species. See DOI: 10.1039/c7sc01932g (United States)

    Dubey, Kshatresh Dutta; Wang, Binju; Vajpai, Manu


    It is a long-standing mechanistic consensus that the mutation of the proton-shuttle mediator Threonine (T) in Cytochrome P450 enzymes severs the water channel and thereby quenches the formation of the active species: the high-valent iron(iv)-oxo porphyrin π-cation radical species, compound I (Cpd I). Using MD simulations and hybrid QM/MM calculations of P450BM3 we demonstrate that this is not the case. Thus, while the original water channel is disrupted in the T268A mutant of the enzyme, a new channel is formed that generates Cpd I. With this new understanding, we address the puzzling regiochemical and kinetic-isotope effect (KIE) results (Volz et al., J. Am. Chem. Soc., 2002, 124, 9724–9725) on the sulfoxidation and N-dealkylation of dimethyl-(4-methylsulfanyl-phenyl)-amine by wild type (WT) P450BM3 and its T268A vs. F87A mutants. We show that the observed variable ratio of S/Me oxidation for these enzymes, vis-à-vis the constant KIE, originates from Cpd I being the sole oxidant. Thus, while the conserved KIE probes the conserved nature of the transition state, the variable regiochemical S/Me ratio reflects the active-site reorganization in the mutants: the shifted location of the new water channel in T268A tightens the binding of the S-end by Cpd I and increases the S/Me ratio, whereas the absence of π-interaction with the S-end in F87A creates a looser binding that lowers the S/Me ratio. Our results match the experimental findings. As such, this study sheds light on puzzling experimental results, and may shift a central paradigm in P450 research. The broader implication on enzymatic research is that a single-site mutation is not a localised alteration but one that may lead to a profound change in the active site, sufficiently so as to change the chemoselectivity of catalyzed reactions. PMID:29568477

  15. Patent foramen ovale in patients with pulmonary embolism: A prognostic factor on CT pulmonary angiography? (United States)

    Zhang, Meng; Tan, Stephanie; Patel, Vishal; Zalta, Benjamin A; Shmukler, Anna; Levsky, Jeffrey M; Jain, Vineet R; Shaban, Nada M; Haramati, Linda B


    Patent foramen ovale (PFO) in patients with acute pulmonary embolism (PE) represents a risk factor for mortality, but this has not been evaluated for CT pulmonary angiography (CTPA). The purpose of the present study was to assess the relationship between PFO and mortality in patients with acute PE diagnosed on CTPA. This retrospective study included 268 adults [173 women, mean age 61 (range 22-98) years] diagnosed with acute PE on non-ECG-gated 64-slice CTPA in 2012 at our medical center. The images were reviewed for PFO by a panel of cardiothoracic radiologists with an average of 11 years of experience (range 1-25 years). CT signs of right heart strain and PE level were noted. Transthoracic echocardiograms (TTE), when available (n = 207), were reviewed for PFO by a cardiologist with subspecialty training in advanced imaging and with 3 years of experience. The main outcome was 30-day mortality. Fischer's exact test was utilized to compare mortality. PFO prevalence on CTPA was 22% (58/268) and 4% (9/207) on TTE. Overall 30-day mortality was 6% (16/268), 9% (5/58) for patients with PFO and 5% (11/210) for those without (p = 0.35). CT signs of right heart strain trended with higher mortality, but statistically significant only for hepatic vein contrast reflux [14% (6/44) vs 4% (10/224), p = 0.03]; right ventricular (RV) to left ventricular (LV) diameter ratio >1 [8% (13/156) vs RV:LV ≤ 1 3% (3/112), p = 0.07], septal bowing [10% (4/42) vs without 5% (12/226), p = 0.30]. PFO was demonstrated on CTPA in a proportion similar to the known population prevalence, while routine TTE was less sensitive. Mortality was non-significantly higher in patients with acute PE and PFO in this moderate-sized study. A larger study to answer this clinically important question is worthwhile. Copyright © 2017 Society of Cardiovascular Computed Tomography. All rights reserved.

  16. Cadmium accumulation characteristics of low-cadmium rice (Oryza sativa L.) line and F1 hybrids grown in cadmium-contaminated soils. (United States)

    Li, Kun; Yu, Haiying; Li, Tingxuan; Chen, Guangdeng; Huang, Fu


    Cadmium (Cd) pollution has threatened severely to food safety and human health. A pot experiment and a field experiment were conducted to investigate the difference of Cd accumulation between rice (Oryza sativa L.) lines and F 1 hybrids in Cd-contaminated soils. The adverse effect on biomass of rice lines was greater than that of F 1 hybrids under Cd treatments in the pot experiment. The variations of Cd concentration among rice cultivars in different organs were smaller in stem and leaf, but larger in root and ear. Average proportion of Cd in root of F 1 hybrids was 1.39, 1.39, and 1.16 times higher than those of rice lines at the treatment of 1, 2, and 4 mg Cd kg -1 soil, respectively. Cd concentrations in ear of F 1 hybrids were significantly lower than rice lines with the reduction from 29.24 to 50.59%. Cd concentrations in brown rice of all F 1 hybrids were less than 0.2 mg kg -1 at 1 mg Cd kg -1 soil, in which Lu98A/YaHui2816, 5406A/YaHui2816, and C268A/YaHui2816 could be screened out as cadmium-safe cultivars (CSCs) for being safe even at 2 mg Cd kg -1 soil. C268A/YaHui2816 showed the lowest Cd concentration in root among F 1 hybrids, while Lu98A/YaHui2816 and 5406A/YaHui2816 showed lower capability of Cd translocation from root to shoot under Cd exposure, which eventually caused the lower Cd accumulation in brown rice. The lower level of Cd translocation contributed to reducing the accumulation of Cd in brown rice had been validated by the field experiment. Thus, Lu98A/YaHui2816, 5406A/YaHui2816, and C268A/YaHui2816 could be considered as potential CSCs to cultivate in Cd-contaminated soils (<2 mg Cd kg -1 soil).

  17. Case report

    African Journals Online (AJOL)


    20 oct. 2017 ... sérologie HIV a été demandé pour notre patient et est revenue négative. L'enfant a été mis ... 2006;. 73(3): 263-268. Google Scholar. 2. Pertuiset E. Tuberculose ostéoarticulaire extravertébrale. Rev. Rhum. 2006; 73(4): 387-393. Google Scholar. 3. Teklali Y, El Alami ZF, El Madhi T, Gourinda H, Miri A. La.

  18. Roentgenological diagnoss of central segmental lung cancer

    International Nuclear Information System (INIS)

    Gurevich, L.A.; Fedchenko, G.G.


    Basing on an analysis of the results of clinicoroentgenological examination of 268 patments roentgenological semiotics of segmental lung cancer is presented. Some peculiarities of the X-ray picture of cancer of different segments of the lungs were revealed depending on tumor site and growth type. For the syndrome of segmental darkening the comprehensive X-ray methods where the chief method is tomography of the segmental bronchi are proposed

  19. Forests and their canopies: Archievements and horizons in canopy science

    Czech Academy of Sciences Publication Activity Database

    Nakamura, A.; Kitching, R. L.; Cao, M.; Creedy, T. J.; Fayle, Tom Maurice; Freiberg, M.; Hewitt, C. N.; Itioka, T.; Koh, L. P.; Ma, K.; Malhi, Y.; Mitchell, A.; Novotný, Vojtěch; Ozanne, C. M. P.; Song, L.; Wang, H.; Ashton, L. A.


    Roč. 32, č. 6 (2017), s. 438-451 ISSN 0169-5347 R&D Projects: GA ČR(CZ) GA16-09427S; GA ČR GB14-36098G EU Projects: European Commission(XE) 669609 - Diversity6continents Institutional support: RVO:60077344 Keywords : biodiversity * canopy * cranes Subject RIV: EH - Ecology, Behaviour OBOR OECD: Ecology Impact factor: 15.268, year: 2016

  20. Scanning electron microscopic imaging of surface effects in desorption and nano-desorption electrospray ionization

    Czech Academy of Sciences Publication Activity Database

    Kaftan, Filip; Kofroňová, Olga; Benada, Oldřich; Lemr, Karel; Havlíček, Vladimír; Cvačka, Josef; Volný, Michael


    Roč. 46, č. 3 (2011), s. 256-261 ISSN 1076-5174 R&D Projects: GA ČR GPP206/10/P018; GA MŠk LC545; GA MŠk(CZ) ME10013 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50200510 Keywords : ionization * DESI * nano-DESI * electron microscopy * mass spectrometry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.268, year: 2011