WorldWideScience

Sample records for drug-sensitive tuberculosis multidrug-resistant

  1. Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

    Directory of Open Access Journals (Sweden)

    Stefan Niemann

    2009-10-01

    Full Text Available Mycobacterium tuberculosis complex (MTBC, the causative agent of tuberculosis (TB, is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients.Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1 and one multidrug resistant (MDR isolate (K-2 of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan. Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1 and 33.0 million (K-2 paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations.Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using

  2. Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

    Science.gov (United States)

    Niemann, Stefan; Köser, Claudio U; Gagneux, Sebastien; Plinke, Claudia; Homolka, Susanne; Bignell, Helen; Carter, Richard J; Cheetham, R Keira; Cox, Anthony; Gormley, Niall A; Kokko-Gonzales, Paula; Murray, Lisa J; Rigatti, Roberto; Smith, Vincent P; Arends, Felix P M; Cox, Helen S; Smith, Geoff; Archer, John A C

    2009-10-12

    Mycobacterium tuberculosis complex (MTBC), the causative agent of tuberculosis (TB), is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients. Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1) and one multidrug resistant (MDR) isolate (K-2) of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan). Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1) and 33.0 million (K-2) paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations. Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using standard

  3. Multidrug-Resistant Tuberculosis

    Centers for Disease Control (CDC) Podcasts

    In this podcast, Dr. Oeltmann discusses multidrug-resistant tuberculosis. An outbreak occurred in Thailand, which led to 45 cases in the U.S. This serious illness can take up to 2 years to treat. MDR TB is a real threat and a serious condition.

  4. Multidrug-Resistant Tuberculosis

    Centers for Disease Control (CDC) Podcasts

    2008-10-28

    In this podcast, Dr. Oeltmann discusses multidrug-resistant tuberculosis. An outbreak occurred in Thailand, which led to 45 cases in the U.S. This serious illness can take up to 2 years to treat. MDR TB is a real threat and a serious condition.  Created: 10/28/2008 by Emerging Infectious Diseases.   Date Released: 10/28/2008.

  5. Drug-sensitive tuberculosis, multidrug-resistant tuberculosis, and nontuberculous mycobacterial pulmonary disease in nonAIDS adults: comparisons of thin-section CT findings

    International Nuclear Information System (INIS)

    Chung, Myung Jin; Lee, Kyung Soo; Kim, Tae Sung; Kim, Sung Mok; Koh, Won-Jung; Kwon, O Jung; Kang, Eun Young; Kim, Seonwoo

    2006-01-01

    The aim of this work was to compare thin-section CT (TSCT) findings of drug-sensitive (DS) tuberculosis (TB), multidrug-resistant (MDR) TB, and nontuberculous mycobacterial (NTM) pulmonary disease in nonAIDS adults. During 2003, 216 (113 DS TB, 35 MDR TB, and 68 NTM) patients with smear-positive sputum for acid-fast bacilli (AFB), and who were subsequently confirmed to have mycobacterial pulmonary disease, underwent thoracic TSCT. The frequency of lung lesion patterns on TSCT and patients' demographic data were compared. The commonest TSCT findings were tree-in-bud opacities and nodules. On a per-person basis, significant differences were found in the frequency of multiple cavities and bronchiectasis (P<0.001, chi-square test and multiple logistic regression analysis). Multiple cavities were more frequent in MDR TB than in the other two groups and extensive bronchiectasis in NTM disease (multiple logistic regression analysis). Patients with MDR TB were younger than those with DS TB or NTM disease (P<0.001, multiple logistic regression analysis). Previous tuberculosis treatment history was significantly more frequent in patients with MDR TB or NTM disease (P<0.001, chi-square test and multiple logistic regression analysis). In patients with positive sputum AFB, multiple cavities, young age, and previous tuberculosis treatment history imply MDR TB, whereas extensive bronchiectasis, old age, and previous tuberculosis treatment history NTM disease. (orig.)

  6. Drug-sensitive tuberculosis, multidrug-resistant tuberculosis, and nontuberculous mycobacterial pulmonary disease in nonAIDS adults: comparisons of thin-section CT findings

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Myung Jin; Lee, Kyung Soo; Kim, Tae Sung; Kim, Sung Mok [Sungkyunkwan University School of Medicine, Department of Radiology and Center for Imaging Science, Samsung Medical Center, Seoul (Korea); Koh, Won-Jung; Kwon, O Jung [Sungkyunkwan University School of Medicine, Division of Pulmonary and Critical Care Medicine, Department of Medicine, Samsung Medical Center, Seoul (Korea); Kang, Eun Young [Korea University Guro Hospital, Department of Diagnostic Radiology, Korea University College of Medicine, Seoul (Korea); Kim, Seonwoo [Sungkyunkwan University School of Medicine, Biostatistics Unit of the Samsung Biomedical Research Institute, Samsung Medical Center, Seoul (Korea)

    2006-09-15

    The aim of this work was to compare thin-section CT (TSCT) findings of drug-sensitive (DS) tuberculosis (TB), multidrug-resistant (MDR) TB, and nontuberculous mycobacterial (NTM) pulmonary disease in nonAIDS adults. During 2003, 216 (113 DS TB, 35 MDR TB, and 68 NTM) patients with smear-positive sputum for acid-fast bacilli (AFB), and who were subsequently confirmed to have mycobacterial pulmonary disease, underwent thoracic TSCT. The frequency of lung lesion patterns on TSCT and patients' demographic data were compared. The commonest TSCT findings were tree-in-bud opacities and nodules. On a per-person basis, significant differences were found in the frequency of multiple cavities and bronchiectasis (P<0.001, chi-square test and multiple logistic regression analysis). Multiple cavities were more frequent in MDR TB than in the other two groups and extensive bronchiectasis in NTM disease (multiple logistic regression analysis). Patients with MDR TB were younger than those with DS TB or NTM disease (P<0.001, multiple logistic regression analysis). Previous tuberculosis treatment history was significantly more frequent in patients with MDR TB or NTM disease (P<0.001, chi-square test and multiple logistic regression analysis). In patients with positive sputum AFB, multiple cavities, young age, and previous tuberculosis treatment history imply MDR TB, whereas extensive bronchiectasis, old age, and previous tuberculosis treatment history NTM disease. (orig.)

  7. Multidrug-resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    McNerney Ruth

    2008-01-01

    Full Text Available Abstract Background With almost 9 million new cases each year, tuberculosis remains one of the most feared diseases on the planet. Led by the STOP-TB Partnership and WHO, recent efforts to combat the disease have made considerable progress in a number of countries. However, the emergence of mutated strains of Mycobacterium tuberculosis that are resistant to the major anti-tuberculosis drugs poses a deadly threat to control efforts. Multidrug-resistant tuberculosis (MDR-TB has been reported in all regions of the world. More recently, extensively drug resistant-tuberculosis (XDR-TB that is also resistant to second line drugs has emerged in a number of countries. To ensure that adequate resources are allocated to prevent the emergence and spread of drug resistance it is important to understand the scale of the problem. In this article we propose that current methods of describing the epidemiology of drug resistant tuberculosis are not adequate for this purpose and argue for the inclusion of population based statistics in global surveillance data. Discussion Whereas the prevalence of tuberculosis is presented as the proportion of individuals within a defined population having disease, the prevalence of drug resistant tuberculosis is usually presented as the proportion of tuberculosis cases exhibiting resistance to anti-tuberculosis drugs. Global surveillance activities have identified countries in Eastern Europe, the former Soviet Union and regions of China as having a high proportion of MDR-TB cases and international commentary has focused primarily on the urgent need to improve control in these settings. Other regions, such as sub-Saharan Africa have been observed as having a low proportion of drug resistant cases. However, if one considers the incidence of new tuberculosis cases with drug resistant disease in terms of the population then countries of sub-Saharan Africa have amongst the highest rates of transmitted MDR-TB in the world. We propose

  8. The Potential Impact of Up-Front Drug Sensitivity Testing on India's Epidemic of Multi-Drug Resistant Tuberculosis.

    Directory of Open Access Journals (Sweden)

    Kuldeep Singh Sachdeva

    Full Text Available In India as elsewhere, multi-drug resistance (MDR poses a serious challenge in the control of tuberculosis (TB. The End TB strategy, recently approved by the world health assembly, aims to reduce TB deaths by 95% and new cases by 90% between 2015 and 2035. A key pillar of this approach is early diagnosis of tuberculosis, including use of higher-sensitivity diagnostic testing and universal rapid drug susceptibility testing (DST. Despite limitations of current laboratory assays, universal access to rapid DST could become more feasible with the advent of new and emerging technologies. Here we use a mathematical model of TB transmission, calibrated to the TB epidemic in India, to explore the potential impact of a major national scale-up of rapid DST. To inform key parameters in a clinical setting, we take GeneXpert as an example of a technology that could enable such scale-up. We draw from a recent multi-centric demonstration study conducted in India that involved upfront Xpert MTB/RIF testing of all TB suspects.We find that widespread, public-sector deployment of high-sensitivity diagnostic testing and universal DST appropriately linked with treatment could substantially impact MDR-TB in India. Achieving 75% access over 3 years amongst all cases being diagnosed for TB in the public sector alone could avert over 180,000 cases of MDR-TB (95% CI 44187 - 317077 cases between 2015 and 2025. Sufficiently wide deployment of Xpert could, moreover, turn an increasing MDR epidemic into a diminishing one. Synergistic effects were observed with assumptions of simultaneously improving MDR-TB treatment outcomes. Our results illustrate the potential impact of new and emerging technologies that enable widespread, timely DST, and the important effect that universal rapid DST in the public sector can have on the MDR-TB epidemic in India.

  9. The imaging feature of multidrug-resistant tuberculosis

    International Nuclear Information System (INIS)

    Yang Jun; Zhou Xinhua; Li Xi; Fu Yuhong; Zheng Suhua; Lv Pingxin; Ma Daqing

    2004-01-01

    Objective: To evaluate the imaging features of multidrug-resistant tuberculosis by collecting multidrug-resistant tuberculosis verified by test of drug-sensitivity, which defined as resistance to three anti-tuberculosis drugs. Methods:Fifty-one cases of multidrug-resistant tuberculosis were categorized as group of observed, and 46 cases of drug sensitive tuberculosis were categorized as control. Cultures were positive for Mycobacterium tuberculosis in all cases with no other illness such as diabetes mellitus. All patients had chest radiographs available for review, while 64 cases had tomography and 30 cases had CT during the same time. All images were analyzed by three of the radiologists, disagreement among them was discussed and a consensus was reached. Results: There was no difference in the distribution of lesions between the multidrug-resistant tuberculosis group and control group. However, the radiological findings in the multidrug-resistant tuberculosis group were significantly more common than in control group, such as multiple nodules (10 cases), disseminated foci (23 cases), cavity (9 cases), and complications (10 cases). Comparing the dynamic cases, deteriorating cases were more commonly seen in observed group than in control group, while improved cases were less in observed group than in control group. Conclusion: Multidrug-resistant tuberculosis is the most serious tuberculosis, which is characterized with significant activity, more disseminated foci, cavity, and complications. The lesion deteriorated while correct anti-tuberculosis treatment is applied. (authors)

  10. The radiological spectrum of pulmonary multidrug-resistant tuberculosis: in HIV-Negative patients

    International Nuclear Information System (INIS)

    Zahirifard, S.; Amiri, M.V.; Bakhshayesh Karam, M.; Mirsaeidi, S.M.; Ehsanpour, A.; Masjedi, M.R.

    2003-01-01

    Background: Multidrug-resistant tuberculosis is a major worldwide health problem. In countries where tuberculosis is of moderate to high prevalence, the issue of Multidrug-resistant tuberculosis carries significant importance. Multidrug-resistant tuberculosis, similar to drug-sensitive tuberculosis, is contagious. Meanwhile its treatment is not only more difficult but also more expensive with lower success rates. Regarding clinical findings, there is no significant difference between Multidrug-resistant tuberculosis and drug-sensitive tuberculosis. Therefore determination of characteristic radiological findings in cases of Multidrug-resistant tuberculosis might be of help in early detection, and hence appropriate management of this disease condition. Objective: To explain the radiological spectrum of pulmonary Multidrug-resistant tuberculosis. Patients and methods: We retrospectively evaluated the radiographic images of 35 patients with clinically-and microbiologically- proven Multidrug-resistant tuberculosis admitted to our tertiary-care tuberculosis unit over a period of 13 months. The latest chest x-ray of all patients and the conventional chest CT scan without contrast of 15 patients were reviewed by three expert radiologists who rendered consensus opinion. Results: Of the 35 patients with imaging studies, 23 (66%) were male and 12 (34%) were female. The mean±SD age of participants was 38.2±17.3 (range: 16-20) years. 33 patients were known as secondary and only 2 had primary Multidrug-resistant tuberculosis. Chest radiography revealed cavitary lesion in 80% pulmonary infiltration in 89% and nodules in 80% of the cases. Pleurisy was the rarest finding observed in only 5 (14%) patients. All of 15 chest CT scans revealed cavitation, 93% of which were bilateral and multiple. Pleural involvement was seen in 93% of patients. Conclusion: Presence of multiple cavities, especially in both lungs, nodular and infiltrative lesions, and pleural effusion are main features

  11. Multidrug-resistant tuberculosis in pregnancy

    International Nuclear Information System (INIS)

    Dhingra, V.K.; Arora, V.K.; Rajpal, S.

    2007-01-01

    This is a case report of 26 years old pregnant woman with multidrug-resistant tuberculosis (MDR TB), treated at outpatient department of New Delhi Tuberculosis (NDTB) Centre, India with second line agents. Before presentation at NDTB Centre, she had been treated with first line drugs for approximately one and-a-half-year, including category II re-treatment DOTS regimen under RNTCP. Patient conceived twice during her anti-TB treatment. The first one was during her category II treatment, when put on second line drugs. We describe congenital abnormalities documented in her second child exposed in-utero to second line anti-tubercular drugs with a brief review of treatment of MDR TB in pregnancy. (author)

  12. Unusual Complication of Multidrug Resistant Tuberculosis

    Directory of Open Access Journals (Sweden)

    Prerna Sharma

    2017-01-01

    Full Text Available Introduction. Capreomycin is a second-line drug often used for multidrug-resistant tuberculosis which can result in nephrotoxic effects similar to other aminoglycosides. We describe a case of capreomycin induced Bartter-like syndrome with hypocalcemic tetany. Case Report. 23-year-old female patient presented with carpopedal spasms and tingling sensations in hands. Patient was being treated with capreomycin for two months for tuberculosis. On further investigation, hypocalcemia, hyponatremia, hypomagnesemia, hypokalemia, and hypochloremic metabolic alkalosis were noted. Vitamin D and serum PTH levels were within normal limits. Hypercalciuria was confirmed by urine calcium/creatinine ratio. Calcium, potassium, and magnesium supplementation was given and capreomycin was discontinued. Electrolytes normalized in two days after cessation of capreomycin with no further abnormalities on repeat investigations. Discussion. Aminoglycosides can result in renal tubular dysfunction leading to Fanconi syndrome, Bartter syndrome, and distal tubular acidosis. Impaired mitochondrial function in the tubular cells has been hypothesized as the possible cause of these tubulopathies. Acquired Bartter-like syndrome phenotypically resembles autosomal dominant type 5 Bartter syndrome. Treatment consists of correction of electrolyte abnormalities, indomethacin, and potassium-sparing diuretics. Prompt diagnosis and treatment of severe dyselectrolytemia are warranted in patients on aminoglycoside therapy.

  13. Risk factors for multidrug resistant tuberculosis patients in Amhara ...

    African Journals Online (AJOL)

    Risk factors for multidrug resistant tuberculosis patients in Amhara National ... risk factors of MDR-TB patients in Amhara National Regional State, Ethiopia. ... strict adherence to directly observed therapy, appropriate management of TB ...

  14. Relationship Between Substance Abuse and Multidrug-Resistant Tuberculosis

    Directory of Open Access Journals (Sweden)

    Sadya Afroz

    2012-07-01

    Full Text Available This case control study was conducted between January to June 2010 to determine the relationship between substance abuse and multidrug- resistant tuberculosis. A total of 73 cases were selected purposively, from culture- positive multidrug- resistant tuberculosis patients admitted in the National Institute of Diseases of the Chest and Hospital, Dhaka and compared with 81 un-matched controls, recruited from the cured patients of pulmonary tuberculosis who attended several DOTS centers of ‘Nagar Shastho Kendra’ under Urban Primary Health Care Project in Dhaka city. Data were collected by face to face interview and documents’ review, using a pre- tested structured questionnaire and a checklist. Multidrug- resistance was found to be associated with smoking status (χ2 = 11.76; p = 0.01 and panmasala use (χ2 = 8.28; p = 0.004. The study also revealed that alcohol consumption and other substance abuse such as jarda, sadapata, gul, snuff, heroine, cannabis, injectable drugs was not associated with the development of multidrug- resistant tuberculosis. Relationship between substance abuse and multidrug- resistant tuberculosis are more or less similar in the developing countries. Bangladesh is not out of this trend. The present study revealed the same fact, which warrants actions targeting specific factors. Further study is recommended to assess the magnitude and these factors related to the development of multidrug- resistant tuberculosis in different settings in our country. Ibrahim Med. Coll. J. 2012; 6(2: 50-54

  15. Exploring the iron metabolism in multidrug resistant tuberculosis ...

    African Journals Online (AJOL)

    The iron metabolism plays a key role in the progression of active Tuberculosis. Several studies have shown a link between iron metabolism disorders an active tuberculosis. The aim of this study was to explore the iron metabolism of 100 patients with multidrug-resistant tuberculosis. (MDR-TB) treated with second ...

  16. Multi-drug resistant tuberculosis in Tanzania: Initial description of ...

    African Journals Online (AJOL)

    Background: Drug resistant Tuberculosis is well documented worldwide and is associated with increasing morbidity and mortality complicating Tuberculosis control with increasing costs of managing the disease. Broad. Objective: To describe clinical and laboratory characteristics of multi-drug resistant Tuberculosis ...

  17. Exploring the iron metabolism in multidrug resistant tuberculosis ...

    African Journals Online (AJOL)

    The iron metabolism plays a key role in the progression of active Tuberculosis. Several studies have shown a link between iron metabolism disorders an active tuberculosis. The aim of this study was to explore the iron metabolism of 100 patients with multidrug-resistant tuberculosis (MDR-TB) treated with second generation ...

  18. Beyond multidrug-resistant tuberculosis in Europe: a TBNET study

    NARCIS (Netherlands)

    Günther, G.; van Leth, F.; Altet, N.; Dedicoat, M.; Duarte, R.; Gualano, G.; Kunst, H.; Muylle, I.; Spinu, V.; Tiberi, S.; Viiklepp, P.; Lange, C.; Alexandru, S.; Cernenco, I.; Ciobanu, A.; Donica, A.; Cayla, J.; Fina, L.; Galvao, M. L. de Souza; Maldonado, J.; Avsar, K.; Bang, D.; Andersen, A. B.; Barbuta, R.; Dubceac, V.; Bothamley, G.; Crudu, V.; Davilovits, M.; Atunes, A.; de Lange, W.; Leimane, V.; Rusmane, L.; de Lorenzo, S.; Cuppen, F.; de Guchtenaire, I.; Magis-Escurra, C.; McLaughlin, A.-M.; Meesters, R.; te Pas, M.; Prins, B.; Mütterlein, R.; Kotrbova, J.; Polcová, V.; Vasakova, M.; Pontali, E.; Rumetshofer, R.; Rowhani, M.; Skrahina, A.; Avchinko, V.; Katovich, D.

    2015-01-01

    The emergence of drug-resistant tuberculosis (TB) is a challenge to TB control in Europe. We evaluated second-line drug susceptibility testing in Mycobacterium tuberculosis isolates from patients with multidrug-resistant, pre-extensively drug-resistant (pre-XDR-TB) and XDR-TB at 23 TBNET sites in 16

  19. Multidrug-resistant tuberculosis, Somalia, 2010-2011.

    Science.gov (United States)

    Sindani, Ireneaus; Fitzpatrick, Christopher; Falzon, Dennis; Suleiman, Bashir; Arube, Peter; Adam, Ismail; Baghdadi, Samiha; Bassili, Amal; Zignol, Matteo

    2013-03-01

    In a nationwide survey in 2011, multidrug-resistant tuberculosis (MDR TB) was found in 5.2% and 40.8% of patients with new and previously treated TB, respectively. These levels of drug resistance are among the highest ever documented in Africa and the Middle East. This finding presents a serious challenge for TB control in Somalia.

  20. Multidrug-Resistant Tuberculosis, Somalia, 2010–2011

    Science.gov (United States)

    Sindani, Ireneaus; Fitzpatrick, Christopher; Falzon, Dennis; Suleiman, Bashir; Arube, Peter; Adam, Ismail; Baghdadi, Samiha; Bassili, Amal

    2013-01-01

    In a nationwide survey in 2011, multidrug-resistant tuberculosis (MDR TB) was found in 5.2% and 40.8% of patients with new and previously treated TB, respectively. These levels of drug resistance are among the highest ever documented in Africa and the Middle East. This finding presents a serious challenge for TB control in Somalia. PMID:23621911

  1. Clarithromycin increases linezolid exposure in multidrug-resistant tuberculosis patients

    NARCIS (Netherlands)

    Bolhuis, Mathieu S.; van Altena, Richard; van Soolingen, Dick; de Lange, Wiel C. M.; Uges, Donald R. A.; van der Werf, Tjip S.; Kosterink, Jos G. W.; Alffenaar, Jan-Willem C.

    2013-01-01

    The use of linezolid for the treatment of multidrug-resistant tuberculosis is limited by dose-and time-dependent toxicity. Recently, we reported a case of pharmacokinetic drug drug interaction between linezolid and clarithromycin that resulted in increased linezolid exposure. The aim of this

  2. Multidrug-Resistant Tuberculosis and Culture Conversion with Bedaquiline

    NARCIS (Netherlands)

    Diacon, Andreas H.; Pym, Alexander; Grobusch, Martin P.; de Los Rios, Jorge M.; Gotuzzo, Eduardo; Vasilyeva, Irina; Leimane, Vaira; Andries, Koen; Bakare, Nyasha; de Marez, Tine; Haxaire-Theeuwes, Myriam; Lounis, Nacer; Meyvisch, Paul; de Paepe, Els; van Heeswijk, Rolf P. G.; Dannemann, Brian; Rolla, Valeria; Dalcomo, Margreth; Gripp, Karla; Escada, Rodrigo; Tavares, Isabel; Borga, Liamar; Thomas, Aleyamma; Rekha, Banu; Nair, Dina; Chandrasekar, Chockalingam; Parthasarathy, Ramavaran Thiruvengadaraj; Sekhar, Gomathi; Ganesh, Krishnamoorthy; Rajagopalan, Krishnakumar; Rajapandian, Gangadevi; Dorairajalu, Rajendran; Sharma, Surendra Kumar; Banavaliker, Jayant; Kadhiravan, Tamilarasu; Gulati, Vinay; Mahmud, Hanif; Gupta, Arvind; Bhatnagar, Anuj; Jain, Vipin; Hari, Smriti; Gupta, Yogesh Kumar; Vaid, Ashok; Cirule, Andra; Dravniece, Gunta; Skripconoka, Vija; Kuksa, Liga; Kreigere, Edite; Ramos, Carlos Rafael Seas; Amat y Leon, Ivan Arapovic

    2014-01-01

    BACKGROUND Bedaquiline (Sirturo, TMC207), a diarylquinoline that inhibits mycobacterial ATP synthase, has been associated with accelerated sputum-culture conversion in patients with multidrug-resistant tuberculosis, when added to a preferred background regimen for 8 weeks. METHODS In this phase 2b

  3. Risk factors associated with multidrug resistant tuberculosis among ...

    African Journals Online (AJOL)

    Background: Multidrug resistant tuberculosis (MDR-TB) remains is an important public health problem in developing world. We conducted this study to determine risk factors associated with MDR-TB and drug susceptibility pattern to second line drug among MDR TB patients in Tanzania. Methods: Unmatched case control ...

  4. Multidrug-resistant tuberculosis and migration to Europe

    DEFF Research Database (Denmark)

    Hargreaves, S.; Lönnroth, K.; Nellums, L. B.

    2017-01-01

    Multidrug-resistant tuberculosis (MDR-TB) in low-incidence countries in Europe is more prevalent among migrants than the native population. The impact of the recent increase in migration to EU and EEA countries with a low incidence of TB (

  5. Multidrug-resistant tuberculosis in Europe, 2010-2011

    DEFF Research Database (Denmark)

    Günther, Gunar; van Leth, Frank; Alexandru, Sofia

    2015-01-01

    Drug-resistant Mycobacterium tuberculosis is challenging elimination of tuberculosis (TB). We evaluated risk factors for TB and levels of second-line drug resistance in M. tuberculosis in patients in Europe with multidrug-resistant (MDR) TB. A total of 380 patients with MDR TB and 376 patients...... with non-MDR TB were enrolled at 23 centers in 16 countries in Europe during 2010-2011. A total of 52.4% of MDR TB patients had never been treated for TB, which suggests primary transmission of MDR M. tuberculosis. At initiation of treatment for MDR TB, 59.7% of M. tuberculosis strains tested were...

  6. Linezolid in multidrug-resistant tuberculosis

    NARCIS (Netherlands)

    Bolhuis, Mathieu

    2015-01-01

    Tuberculose is een potentieel dodelijke infectieziekte die wordt veroorzaakt door de bacterie Mycobacterium tuberculosis. Een deel van de tuberculosepatiënten is besmet met multiresistente tuberculose. In het geval van multiresistente tuberculose is de bacterie resistent tegen de twee belangrijkste

  7. Indolcarboxamide is a preclinical candidate for treating multidrug-resistant tuberculosis.

    Science.gov (United States)

    Rao, Srinivasa P S; Lakshminarayana, Suresh B; Kondreddi, Ravinder R; Herve, Maxime; Camacho, Luis R; Bifani, Pablo; Kalapala, Sarath K; Jiricek, Jan; Ma, Ng L; Tan, Bee H; Ng, Seow H; Nanjundappa, Mahesh; Ravindran, Sindhu; Seah, Peck G; Thayalan, Pamela; Lim, Siao H; Lee, Boon H; Goh, Anne; Barnes, Whitney S; Chen, Zhong; Gagaring, Kerstin; Chatterjee, Arnab K; Pethe, Kevin; Kuhen, Kelli; Walker, John; Feng, Gu; Babu, Sreehari; Zhang, Lijun; Blasco, Francesca; Beer, David; Weaver, Margaret; Dartois, Veronique; Glynne, Richard; Dick, Thomas; Smith, Paul W; Diagana, Thierry T; Manjunatha, Ujjini H

    2013-12-04

    New chemotherapeutic compounds against multidrug-resistant Mycobacterium tuberculosis (Mtb) are urgently needed to combat drug resistance in tuberculosis (TB). We have identified and characterized the indolcarboxamides as a new class of antitubercular bactericidal agent. Genetic and lipid profiling studies identified the likely molecular target of indolcarboxamides as MmpL3, a transporter of trehalose monomycolate that is essential for mycobacterial cell wall biosynthesis. Two lead candidates, NITD-304 and NITD-349, showed potent activity against both drug-sensitive and multidrug-resistant clinical isolates of Mtb. Promising pharmacokinetic profiles of both compounds after oral dosing in several species enabled further evaluation for efficacy and safety. NITD-304 and NITD-349 were efficacious in treating both acute and chronic Mtb infections in mouse efficacy models. Furthermore, dosing of NITD-304 and NITD-349 for 2 weeks in exploratory rat toxicology studies revealed a promising safety margin. Finally, neither compound inhibited the activity of major cytochrome P-450 enzymes or the hERG (human ether-a-go-go related gene) channel. These results suggest that NITD-304 and NITD-349 should undergo further development as a potential treatment for multidrug-resistant TB.

  8. Aggressive Regimens for Multidrug-Resistant Tuberculosis Reduce Recurrence

    Science.gov (United States)

    Franke, Molly F.; Appleton, Sasha C.; Mitnick, Carole D.; Furin, Jennifer J.; Bayona, Jaime; Chalco, Katiuska; Shin, Sonya; Murray, Megan; Becerra, Mercedes C.

    2013-01-01

    Background. Recurrent tuberculosis disease occurs within 2 years in as few as 1% and as many as 29% of individuals successfully treated for multidrug-resistant (MDR) tuberculosis. A better understanding of treatment-related factors associated with an elevated risk of recurrent tuberculosis after cure is urgently needed to optimize MDR tuberculosis therapy. Methods. We conducted a retrospective cohort study among adults successfully treated for MDR tuberculosis in Peru. We used multivariable Cox proportional hazards regression analysis to examine whether receipt of an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion from positive to negative was associated with a reduced rate of recurrent tuberculosis. Results. Among 402 patients, the median duration of follow-up was 40.5 months (interquartile range, 21.2–53.4). Receipt of an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion was associated with a lower risk of recurrent tuberculosis (hazard ratio, 0.40 [95% confidence interval, 0.17–0.96]; P = .04). A baseline diagnosis of diabetes mellitus also predicted recurrent tuberculosis (hazard ratio, 10.47 [95% confidence interval, 2.17–50.60]; P = .004). Conclusions. Individuals who received an aggressive MDR tuberculosis regimen for ≥18 months following sputum conversion experienced a lower rate of recurrence after cure. Efforts to ensure that an aggressive regimen is accessible to all patients with MDR tuberculosis, such as minimization of sequential ineffective regimens, expanded drug access, and development of new MDR tuberculosis compounds, are critical to reducing tuberculosis recurrence in this population. Patients with diabetes mellitus should be carefully managed during initial treatment and followed closely for recurrent disease. PMID:23223591

  9. Multidrug resistance among new tuberculosis cases: detecting local variation through lot quality-assurance sampling.

    Science.gov (United States)

    Hedt, Bethany Lynn; van Leth, Frank; Zignol, Matteo; Cobelens, Frank; van Gemert, Wayne; Nhung, Nguyen Viet; Lyepshina, Svitlana; Egwaga, Saidi; Cohen, Ted

    2012-03-01

    Current methodology for multidrug-resistant tuberculosis (MDR TB) surveys endorsed by the World Health Organization provides estimates of MDR TB prevalence among new cases at the national level. On the aggregate, local variation in the burden of MDR TB may be masked. This paper investigates the utility of applying lot quality-assurance sampling to identify geographic heterogeneity in the proportion of new cases with multidrug resistance. We simulated the performance of lot quality-assurance sampling by applying these classification-based approaches to data collected in the most recent TB drug-resistance surveys in Ukraine, Vietnam, and Tanzania. We explored 3 classification systems- two-way static, three-way static, and three-way truncated sequential sampling-at 2 sets of thresholds: low MDR TB = 2%, high MDR TB = 10%, and low MDR TB = 5%, high MDR TB = 20%. The lot quality-assurance sampling systems identified local variability in the prevalence of multidrug resistance in both high-resistance (Ukraine) and low-resistance settings (Vietnam). In Tanzania, prevalence was uniformly low, and the lot quality-assurance sampling approach did not reveal variability. The three-way classification systems provide additional information, but sample sizes may not be obtainable in some settings. New rapid drug-sensitivity testing methods may allow truncated sequential sampling designs and early stopping within static designs, producing even greater efficiency gains. Lot quality-assurance sampling study designs may offer an efficient approach for collecting critical information on local variability in the burden of multidrug-resistant TB. Before this methodology is adopted, programs must determine appropriate classification thresholds, the most useful classification system, and appropriate weighting if unbiased national estimates are also desired.

  10. Decreasing prevalence of multi-drugs resistant Mycobacterium tuberculosis in Nashik City, India

    OpenAIRE

    More, Arun Punaji; Nagdawane, Ramkrishna Panchamrao; Gangurde, Aniket K

    2013-01-01

    Objective: In India, increasing prevalence of multi-drug resistant tuberculosis (MDR) has aggravated the control oftuberculosis problem. In many urban and semi-urban regions of India, no surveillance data of multidrug resistance inMycobacterium tuberculosisis available.Methods: A surveillance study on multidrug resistance was carried out in semi-urban and rural regions in and aroundNashik City of Maharashtra, India. The surveillance study was conducted in this region found that the prevalence...

  11. Multidrug Resistant Tuberculosis involving the Clavicle, Spine and Ribs

    Directory of Open Access Journals (Sweden)

    H Krishnan

    2011-03-01

    Full Text Available This report describes an unusual case of multidrug resistant tuberculosis (MDR-TB, involving the right clavicle and multicentric aytpical spine involvement without any neurological deficit. The female patient presented with acute onset of right clavicular pain associated with a one-month history of lower backache with constitutional symptoms. The clavicular lesion and MRI spine findings were highly suggestive of TB. Anti TB drugs (ATD were started empirically as Sabah, Malaysia the patient’s home, is an endemic area for TB. Despite, 2 months of ATD administration, the patient did not respond well clinically and developed left sided chest wall abscesses arising from the left 3rd and 6th ribs. She was then treated for MDR-TB infection and has responded well to this treatment.

  12. Clusters of Multidrug-Resistant Mycobacterium tuberculosis Cases, Europe

    Science.gov (United States)

    Kremer, Kristin; Heersma, Herre; Van Soolingen, Dick

    2009-01-01

    Molecular surveillance of multidrug-resistant tuberculosis (MDR TB) was implemented in Europe as case reporting in 2005. For all new MDR TB cases detected from January 2003 through June 2007, countries reported case-based epidemiologic data and DNA fingerprint patterns of MDR TB strains when available. International clusters were detected and analyzed. From 2003 through mid-2007 in Europe, 2,494 cases of MDR TB were reported from 24 European countries. Epidemiologic and molecular data were linked for 593 (39%) cases, and 672 insertion sequence 6110 DNA fingerprint patterns were reported from 19 countries. Of these patterns, 288 (43%) belonged to 18 European clusters; 7 clusters (242/288 cases, 84%) were characterized by strains of the Beijing genotype family, including the largest cluster (175/288 cases, 61%). Both clustering and the Beijing genotype were associated with strains originating in eastern European countries. Molecular cluster detection contributes to identification of transmission profile, risk factors, and control measures. PMID:19624920

  13. The diarylquinoline TMC207 for multidrug-resistant tuberculosis

    NARCIS (Netherlands)

    Diacon, Andreas H.; Pym, Alexander; Grobusch, Martin; Patientia, Ramonde; Rustomjee, Roxana; Page-Shipp, Liesl; Pistorius, Christoffel; Krause, Rene; Bogoshi, Mampedi; Churchyard, Gavin; Venter, Amour; Allen, Jenny; Palomino, Juan Carlos; de Marez, Tine; van Heeswijk, Rolf P. G.; Lounis, Nacer; Meyvisch, Paul; Verbeeck, Johan; Parys, Wim; de Beule, Karel; Andries, Koen; Mc Neeley, David F.

    2009-01-01

    BACKGROUND: The diarylquinoline TMC207 offers a new mechanism of antituberculosis action by inhibiting mycobacterial ATP synthase. TMC207 potently inhibits drug-sensitive and drug-resistant Mycobacterium tuberculosis in vitro and shows bactericidal activity in patients who have drug-susceptible

  14. Outbreak of multidrug-resistant tuberculosis in two secondary schools.

    Science.gov (United States)

    Miravet Sorribes, Luis; Arnedo Pena, Alberto; Bellido Blasco, Juan B; Romeu García, María Angeles; Gil Fortuño, María; García Sidro, Patricia; Cortés Miró, Pascual

    2016-02-01

    To describe an outbreak of multidrug-resistant tuberculosis (MDR-TB) in two schools This was a prospective, observational study of an outbreak of MDR-TB in 2 schools located in the towns of Onda and Nules, in the Spanish province of Castellon, from the moment of detection in November 2008 until November 2014, including patient follow-up and contact tracing. Five cases of MDR-TB were diagnosed. Overall attack rate was 0.9%, and among the contacts traced, 66 had latent tuberculous infection, with an infection rate of 14.4%. Molecular characterization of the 5M. tuberculosis isolates was performed by restriction fragment length polymorphism (RFLP) analysis of the IS6110 sequence. In all 5 patients, cultures were negative at 4-month follow-up, showing the efficacy of the treatment given. No recurrence has been reported to date. In the context of globalization and the increased prevalence of MDR-TB, outbreaks such as the one presented here are only to be expected. Contact tracing, strict follow-up of confirmed cases, the availability of fast diagnostic techniques to avoid treatment delay, and chemoprophylaxis, together with the molecular characterization of strains, are still essential. Copyright © 2015 SEPAR. Published by Elsevier Espana. All rights reserved.

  15. Previous treatment, sputum-smear nonconversion, and suburban living: The risk factors of multidrug-resistant tuberculosis among Malaysians.

    Science.gov (United States)

    Mohd Shariff, Noorsuzana; Shah, Shamsul Azhar; Kamaludin, Fadzilah

    2016-03-01

    The number of multidrug-resistant tuberculosis patients is increasing each year in many countries all around the globe. Malaysia has no exception in facing this burdensome health problem. We aimed to investigate the factors that contribute to the occurrence of multidrug-resistant tuberculosis among Malaysian tuberculosis patients. An unmatched case-control study was conducted among tuberculosis patients who received antituberculosis treatments from April 2013 until April 2014. Cases are those diagnosed as pulmonary tuberculosis patients clinically, radiologically, and/or bacteriologically, and who were confirmed to be resistant to both isoniazid and rifampicin through drug-sensitivity testing. On the other hand, pulmonary tuberculosis patients who were sensitive to all first-line antituberculosis drugs and were treated during the same time period served as controls. A total of 150 tuberculosis patients were studied, of which the susceptible cases were 120. Factors found to be significantly associated with the occurrence of multidrug-resistant tuberculosis are being Indian or Chinese (odds ratio 3.17, 95% confidence interval 1.04-9.68; and odds ratio 6.23, 95% confidence interval 2.24-17.35, respectively), unmarried (odds ratio 2.58, 95% confidence interval 1.09-6.09), living in suburban areas (odds ratio 2.58, 95% confidence interval 1.08-6.19), are noncompliant (odds ratio 4.50, 95% confidence interval 1.71-11.82), were treated previously (odds ratio 8.91, 95% confidence interval 3.66-21.67), and showed positive sputum smears at the 2nd (odds ratio 7.00, 95% confidence interval 2.46-19.89) and 6th months of treatment (odds ratio 17.96, 95% confidence interval 3.51-91.99). Living in suburban areas, positive sputum smears in the 2nd month of treatment, and was treated previously are factors that independently contribute to the occurrence of multidrug-resistant tuberculosis. Those with positive smears in the second month of treatment, have a history of previous

  16. Hearing loss in children treated for multidrug-resistant tuberculosis.

    Science.gov (United States)

    Seddon, James A; Thee, Stephanie; Jacobs, Kayleen; Ebrahim, Adam; Hesseling, Anneke C; Schaaf, H Simon

    2013-04-01

    The aminoglycosides and polypeptides are vital drugs for the management of multidrug-resistant (MDR) tuberculosis (TB). Both classes of drug cause hearing loss. We aimed to determine the extent of hearing loss in children treated for MDR-TB. In this retrospective study, children (Hearing was assessed and classified using audiometry and otoacoustic emissions. Ninety-four children were included (median age: 43 months). Of 93 tested, 28 (30%) were HIV-infected. Twenty-three (24%) children had hearing loss. Culture-confirmed, as opposed to presumed, diagnosis of TB was a risk factor for hearing loss (OR: 4.12; 95% CI: 1.13-15.0; p = 0.02). Seven of 11 (64%) children classified as having hearing loss using audiometry had progression of hearing loss after finishing the injectable drug. Hearing loss is common in children treated for MDR-TB. Alternative drugs are required for the treatment of paediatric MDR-TB. Copyright © 2012 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  17. [Multidrug-resistant tuberculosis: challenges of a global emergence].

    Science.gov (United States)

    Comolet, T

    2015-10-01

    Drug-resistant tuberculosis, in particular Multi-Drug Resistant (MDR-TB) is an increasing global concern and a major burden for some developing countries, especially the BRICS. It is assumed that every year roughly 350 000 new MDR-TB cases occur in the world, on average in 20.5% of TB patients that have been previously treated but also in 3.5% of persons that have never been on TB treatment before. The global distribution of cases is very heterogeneous and is now better understood thanks to a growing number of specific surveys and routine surveillance systems: incidence is much higher in southern Africa and in all countries formerly part of the USSR. Countries with weak health systems and previously inefficient TB control programs are highly vulnerable to MDR epidemics because program failures do help creating, maintaining and spreading resistances. Global response is slowly rolled out and diagnosis capacities are on the rise (mostly with genotypic methods) but adequate and successful treatment and care is still limited to a minority of global cases. From a public health perspective the MDR-TB growing epidemics will not be controlled merely by the introduction of few new antibiotics because it is also linked to patient's compliance and adequate case management supported by efficient TB program. In depth quality improvement will only be achieved after previous errors are thoroughly analyzed and boldly corrected.

  18. Identifying multidrug resistant tuberculosis transmission hotspots using routinely collected data12

    Science.gov (United States)

    Manjourides, Justin; Lin, Hsien-Ho; Shin, Sonya; Jeffery, Caroline; Contreras, Carmen; Cruz, Janeth Santa; Jave, Oswaldo; Yagui, Martin; Asencios, Luis; Pagano, Marcello; Cohen, Ted

    2012-01-01

    SUMMARY In most countries with large drug resistant tuberculosis epidemics, only those cases that are at highest risk of having MDRTB receive a drug sensitivity test (DST) at the time of diagnosis. Because of this prioritized testing, identification of MDRTB transmission hotspots in communities where TB cases do not receive DST is challenging, as any observed aggregation of MDRTB may reflect systematic differences in how testing is distributed in communities. We introduce a new disease mapping method, which estimates this missing information through probability–weighted locations, to identify geographic areas of increased risk of MDRTB transmission. We apply this method to routinely collected data from two districts in Lima, Peru over three consecutive years. This method identifies an area in the eastern part of Lima where previously untreated cases have increased risk of MDRTB. This may indicate an area of increased transmission of drug resistant disease, a finding that may otherwise have been missed by routine analysis of programmatic data. The risk of MDR among retreatment cases is also highest in these probable transmission hotspots, though a high level of MDR among retreatment cases is present throughout the study area. Identifying potential multidrug resistant tuberculosis (MDRTB) transmission hotspots may allow for targeted investigation and deployment of resources. PMID:22401962

  19. New-Onset Psychosis in a Multi-Drug Resistant Tuberculosis Patient ...

    African Journals Online (AJOL)

    Drug-resistant tuberculosis poses a serious challenge to global control of TB. These forms of TB do not respond to the standard six-month treatment; it can take two years or more to treat with category IV drugs that are less potent, more toxic and much more expensive. Treatment of multi-drug resistant tuberculosis is still ...

  20. Limited Sampling Strategies for Therapeutic Drug Monitoring of Linezolid in Patients With Multidrug-Resistant Tuberculosis

    NARCIS (Netherlands)

    Alffenaar, Jan-Willem C.; Kosterink, Jos G. W.; van Altena, Richard; van der Werf, Tjip S.; Uges, Donald R. A.; Proost, Johannes H.

    Introduction: Linezolid is a potential drug for the treatment of multidrug-resistant tuberculosis but its use is limited because of severe adverse effects such as anemia, thrombocytopenia, and peripheral neuropathy. This study aimed to develop a model for the prediction of linezolid area. under the

  1. Multidrug Resistance Among New Tuberculosis Cases Detecting Local Variation Through Lot Quality-assurance Sampling

    NARCIS (Netherlands)

    Hedt, Bethany Lynn; van Leth, Frank; Zignol, Matteo; Cobelens, Frank; van Gemert, Wayne; Nhung, Nguyen Viet; Lyepshina, Svitlana; Egwaga, Saidi; Cohen, Ted

    2012-01-01

    Background: Current methodology for multidrug-resistant tuberculosis (MDR TB) surveys endorsed by the World Health Organization provides estimates of MDR TB prevalence among new cases at the national level. On the aggregate, local variation in the burden of MDR TB may be masked. This paper

  2. Surgery as an Adjunctive Treatment for Multidrug-Resistant Tuberculosis : An Individual Patient Data Metaanalysis

    NARCIS (Netherlands)

    Fox, Gregory J.; Mitnick, Carole D.; Benedetti, Andrea; Chan, Edward D.; Becerra, Mercedes; Chiang, Chen-Yuan; Keshavjee, Salmaan; Koh, Won-Jung; Shiraishi, Yuji; Viiklepp, Piret; Yim, Jae-Joon; Pasvol, Geoffrey; Robert, Jerome; Shim, Tae Sun; Shin, Sonya S.; Menzies, Dick; van der Werf, Tjip S.

    2016-01-01

    Background. Medical treatment for multidrug-resistant (MDR)-tuberculosis is complex, toxic, and associated with poor outcomes. Surgical lung resection may be used as an adjunct to medical therapy, with the intent of reducing bacterial burden and improving cure rates. We conducted an individual

  3. Optimizing the Safety of Multidrug-resistant Tuberculosis Therapy in Namibia

    NARCIS (Netherlands)

    Sagwa, Evans

    2017-01-01

    Introduction: Multidrug-resistant tuberculosis (MDR-TB), a growing global menace, is seriously undermining the previous successes made in the elimination of TB. MDR-TB treatment takes a long time, is complex, and is frequently associated with the occurrence of adverse drug reactions, some of which

  4. Potential antimicrobial agents for the treatment of multidrug-resistant tuberculosis

    NARCIS (Netherlands)

    Alsaad, Noor; Wilffert, Bob; van Altena, Richard; de Lange, Wiel C. M.; van der Werf, Tjip S.; Kosterink, Jos G. W.; Alffenaar, Jan-Willem C.

    2014-01-01

    Treatment of multidrug-resistant (MDR) tuberculosis (TB) is challenging because of the high toxicity of second-line drugs and the longer treatment duration than for drug-susceptible TB patients. In order to speed up novel treatment for MDR-TB, we suggest considering expanding the indications of

  5. The socioeconomic impact of multidrug resistant tuberculosis on patients: results from Ethiopia, Indonesia and Kazakhstan

    NARCIS (Netherlands)

    van den Hof, Susan; Collins, David; Hafidz, Firdaus; Beyene, Demissew; Tursynbayeva, Aigul; Tiemersma, Edine

    2016-01-01

    One of the main goals of the post-2015 global tuberculosis (TB) strategy is that no families affected by TB face catastrophic costs. We revised an existing TB patient cost measurement tool to specifically also measure multi-drug resistant (MDR) TB patients' costs and applied it in Ethiopia,

  6. Genetic diversity of drug and multidrug-resistant Mycobacterium tuberculosis circulating in Veracruz, Mexico

    Science.gov (United States)

    Munro-Rojas, Daniela; Fernandez-Morales, Esdras; Zarrabal-Meza, José; Martínez-Cazares, Ma. Teresa; Parissi-Crivelli, Aurora; Fuentes-Domínguez, Javier; Séraphin, Marie Nancy; Lauzardo, Michael; González-y-Merchand, Jorge Alberto; Rivera-Gutierrez, Sandra

    2018-01-01

    Background Mexico is one of the most important contributors of drug and multidrug-resistant tuberculosis in Latin America; however, knowledge of the genetic diversity of drug-resistant tuberculosis isolates is limited. Methods In this study, the genetic structure of 112 Mycobacterium tuberculosis strains from the southeastern Mexico was determined by spoligotyping and 24-loci MIRU-VNTRs. Findings The results show eight major lineages, the most of which was T1 (24%), followed by LAM (16%) and H (15%). A total of 29 (25%) isolates were identified as orphan. The most abundant SITs were SIT53/T1 and SIT42/LAM9 with 10 isolates each and SIT50/H3 with eight isolates. Fifty-two spoligotype patterns, twenty-seven clusters and ten clonal complexes were observed, demonstrating an important genetic diversity of drug and multidrug-resistant tuberculosis isolates in circulation and transmission level of these aggravated forms of tuberculosis. Being defined as orphan or as part of an orphan cluster, was a risk factor for multidrug resistant-tuberculosis (OR 2.5, IC 1.05–5.86 and OR 3.3, IC 1–11.03, respectively). Multiple correspondence analyses showed association of some clusters and SITs with specific geographical locations. Conclusions Our study provides one of the most detailed description of the genetic structure of drug and multidrug-resistant tuberculosis strains in southeast Mexico, establishing for the first time a baseline of the genotypes observed in resistant isolates circulating, however further studies are required to better elucidate the genetic structure of tuberculosis in region and the factors that could be participating in their dispersion. PMID:29543819

  7. Prevalence of Multidrug-Resistant Tuberculosis and Associated Factors in Ethiopia: A Systematic Review

    OpenAIRE

    Asgedom, Solomon Weldegebreal; Teweldemedhin, Mebrahtu; Gebreyesus, Hailay

    2018-01-01

    Background. Multidrug-resistant tuberculosis (MDR-TB) has continued to be a challenge for tuberculosis (TB) control globally. Ethiopia is one of the countries with high MDR-TB burden. Objective. The main purpose of this study was to determine the prevalence of MDR-TB and associated factors in Ethiopia. Methods. A systematic review of the literatures on prevalence of MDR-TB and associated factors was conducted in the country. Results. In our electronic search, 546 citations were depicted. Amon...

  8. Management of multidrug-resistant tuberculosis in human immunodeficiency virus patients

    Science.gov (United States)

    Jamil, K. F.

    2018-03-01

    Tuberculosis (TB) is a chronic infectious disease mainly caused by Mycobacterium tuberculosis(MTB). 10.4 million new TB cases will appear in 2015 worldwide. There were an estimated 1.4 million TB deaths in 2015, and an additional 0.4 million deaths resulting from TB disease among people living with human immunodeficiency virus (HIV). Multidrug- resistant and extensively drug-resistant tuberculosis (MDR and XDR-TB) are major public health concerns worldwide. 480.000 new cases of MDR-TB will appear in 2015 and an additional 100,000 people with rifampicin-resistant TB (RR-TB) who were also newly eligible for MDR-TB treatment. Their association with HIV infection has contributed to the slowing down of TB incidence decline over the last two decades, therefore representing one important barrier to reach TB elimination. Patients infected with MDR-TB require more expensive treatment regimens than drug-susceptible TB, with poor treatment.Patients with multidrug- resistant tuberculosis do not receive rifampin; drug interactions risk is markedly reduced. However, overlapping toxicities may limit options for co-treatment of HIV and multidrug- resistant tuberculosis.

  9. Genome sequencing and annotation of multidrug resistant Mycobacterium tuberculosis (MDR-TB PR10 strain

    Directory of Open Access Journals (Sweden)

    Mohd Zakihalani A. Halim

    2016-03-01

    Full Text Available Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10 isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. Keywords: Mycobacterium tuberculosis, Genome, MDR, Extrapulmonary

  10. T cell-based tracking of multidrug resistant tuberculosis infection after brief exposure.

    Science.gov (United States)

    Richeldi, Luca; Ewer, Katie; Losi, Monica; Bergamini, Barbara M; Roversi, Pietro; Deeks, Jonathan; Fabbri, Leonardo M; Lalvani, Ajit

    2004-08-01

    Molecular epidemiology indicates significant transmission of Mycobacterium tuberculosis after casual contact with infectious tuberculosis cases. We investigated M. tuberculosis transmission after brief exposure using a T cell-based assay, the enzyme-linked-immunospot (ELISPOT) for IFN-gamma. After childbirth, a mother was diagnosed with sputum smear-positive multidrug-resistant tuberculosis. Forty-one neonates and 47 adults were present during her admission on the maternity unit; 11 weeks later, all underwent tuberculin skin testing (TST) and ELISPOT. We correlated test results with markers of exposure to the index case. The participants, who were asymptomatic and predominantly had no prior tuberculosis exposure, had 6.05 hours mean exposure (range: 0-65 hours) to the index case. Seventeen individuals, including two newborns, were ELISPOT-positive, and ELISPOT results correlated significantly with three of four predefined measures of tuberculosis exposure. For each hour sharing room air with the index case, the odds of a positive ELISPOT result increased by 1.05 (95% CI: 1.02-1.09, p = 0.003). Only four adults were TST-positive and TST results did not correlate with exposure. Thus, ELISPOT, but not TST, suggested quite extensive nosocomial transmission of multidrug-resistant M. tuberculosis after brief exposure. These results help to explain the apparent importance of casual contact for tuberculosis transmission, and may have implications for prevention.

  11. Multidrug resistant to extensively drug resistant tuberculosis: What is ...

    Indian Academy of Sciences (India)

    Prakash

    The modern, ... World Health Organization is based on a four-drug regimen ... Better management and control of tuberculosis specially drug resistant TB by experienced and qualified .... a comprehensive approach including the major DOTS.

  12. High prevalence of multidrug resistant tuberculosis in Djibouti: a retrospective study.

    Science.gov (United States)

    Boyer-Cazajous, Géraldine; Martinaud, Christophe; Déhan, Céline; Hassan, Mohammed Osman; Gaas, Yassin; Chenilleau-Vidal, Marie-Caroline; Soler, Charles

    2014-02-13

    The Republic of Djibouti is an African country that exhibits one of the highest incidence rate of tuberculosis in the world. The aim of this study was to evaluate the prevalence of multidrug-resistant tuberculosis among new cases. We studied retrospectively every tuberculosis case diagnosed over a 12-month period in patients hospitalized at the French Military Hospital of Bouffard. During this period, 1,274 samples from 675 patients were tested. We isolated 266 mycobacteria corresponding to 180 cases of tuberculosis. Thirty-three were fully susceptible and 57% met the tuberculosis criteria, with 46% primary resistance. No extensively-drug-resistant tuberculosis was found. Our results highlight a major concern about the situation in this part of the world.

  13. Decreasing prevalence of multi-drugs resistant Mycobacterium tuberculosis in Nashik City, India

    Directory of Open Access Journals (Sweden)

    Arun P. More

    2013-03-01

    Full Text Available Objective: In India, increasing prevalence of multi-drug resistant tuberculosis (MDR has aggravated the control oftuberculosis problem. In many urban and semi-urban regions of India, no surveillance data of multidrug resistance inMycobacterium tuberculosisis available.Methods: A surveillance study on multidrug resistance was carried out in semi-urban and rural regions in and aroundNashik City of Maharashtra, India. The surveillance study was conducted in this region found that the prevalence ofcombined resistance to first and second-line anti-tuberculosis drugs is remarkably high. The isolates of M. tuberculosiswas identified and subjected to drug susceptibility testing. The patterns of drug susceptibility of isolates of M. tuberculosisduring the periods 2000 and 2004 were compared with drug susceptibility patterns of the organisms during theperiod 2008 to 2011.Results: The 260 isolates identified as M. tuberculosis show mean drug resistance prevalence of 45.6% for more than anytwo drugs and the MDR rate as 37% in the years 2000 to 2004 whereas 305 isolates of the organism show mean drugresistance prevalence of 30.2% and the MDR rate as 25% in the years 2008 to 2011.Conclusion: The researcher found that, though the prevalence of multidrug resistance to the drugs tested is remarkablyhigh, it has come down noticeably during the past seven years due to efforts of State Government and strict implementationof treatment guidelines of WHO by the physicians. J Microbiol Infect Dis 2013; 3(1: 12-17Key words: MDR-TB, XDR-TB, DOTS, drug-resistance prevalence rate.

  14. Role of Risk Factors in the Incidence of Multidrug-Resistant Tuberculosis

    Directory of Open Access Journals (Sweden)

    Alya Putri Khairani

    2017-09-01

    Full Text Available Objective: To determine the risk factors that played roles in the incidence of multidrug-resistant tuberculosis (MDR-TB in such patients. Multidrug-Resistant Tuberculosis is a form of tuberculosis caused by Mycobacterium tuberculosis that is resistant to at least isoniazid and rifampicin. Methods: This was a case control study to compare MDR-TB to non-MDR-TB pulmonary tuberculosis outpatients in Dr. Hasan Sadikin General Hospital, Bandung on August–September 2014. Fifty MDR-TB outpatients were included as the cases and 50 non-MDR-TB outpatients as controls. Data was collected by questionnaires and patient’s registration forms. Bivariate and multivariate analyses were performed using chi-square test and multiple logistic regression test, with p<0.05 considered significant. Results: From bivariate analysis, number of previous tuberculosis treatments, regularity of previous treatment, and burden of cost were significant risk factors for developing MDR-TB (p<0.05; while from multivariate analysis, number of previous TB treatments was the only risk factor that played a significant role in the incidence of MDR-TB (OR 24.128 95% CI 6.771-85,976. Conclusions: Patients and medication factors are risk factors that play roles in the incidence of MDR-TB. The significant risk factor is the number of previous TB treatment.

  15. Bedaquiline in the multidrug-resistant tuberculosis treatment: Belarus experience

    Directory of Open Access Journals (Sweden)

    Alena Skrahina

    2016-01-01

    Conclusion: Our interim results on safety and effectiveness of bedaquiline-containing regimens in multidrug and extensively drug-resistant tuberculosis (M/XDR-TB patients are encouraging. They will add value to understanding role and place of this new anti-TB drug in M/XDR-TB treatment.

  16. Features of Cytokine Regulation in Multidrug-Resistant Tuberculosis Depending on Severity of Endogenous Intoxication

    Directory of Open Access Journals (Sweden)

    L.D. Todoriko

    2016-02-01

    Conclusions. Comprehensive assessment of integral indices of endogenous intoxication and level of certain pro- and anti-inflammatory cytokines in the blood plasma of patients with MDR TB shows a moderate endogenous intoxication, break down of the cellular component of the immune reactivity due to the formation of conditions for the development of Mycobacterium tuberculosis resistance, with further growth of cytotoxic hypoxia and activation of systemic inflammatory response syndrome. Analysis of plasma concentration of IL-6, IL-10 and IL-18 in patients with multidrug-resistance proved, that their level depends on the nature of Mycobacterium tuberculosis resistance.

  17. Health system factors influencing management of multidrug-resistant tuberculosis in four European Union countries - learning from country experiences

    Directory of Open Access Journals (Sweden)

    Gerard de Vries

    2017-04-01

    Full Text Available Abstract Background In the European Union and European Economic Area only 38% of multidrug-resistant tuberculosis patients notified in 2011 completed treatment successfully at 24 months’ evaluation. Socio-economic factors and patient factors such as demographic characteristics, behaviour and attitudes are associated with treatment outcomes. Characteristics of healthcare systems also affect health outcomes. This study was conducted to identify and better understand the contribution of health system components to successful treatment of multidrug-resistant tuberculosis. Methods We selected four European Union countries to provide for a broad range of geographical locations and levels of treatment success rates of the multidrug-resistant tuberculosis cohort in 2009. We conducted semi-structured interviews following a conceptual framework with representatives from policy and planning authorities, healthcare providers and civil society organisations. Responses were organised according to the six building blocks of the World Health Organization health systems framework. Results In the four included countries, Austria, Bulgaria, Spain, and the United Kingdom, the following healthcare system factors were perceived as key to achieving good treatment results for patients with multidrug-resistant tuberculosis: timely diagnosis of drug-resistant tuberculosis; financial systems that ensure access to a full course of treatment and support for multidrug-resistant tuberculosis patients; patient-centred approaches with strong intersectoral collaboration that address patients’ emotional and social needs; motivated and dedicated healthcare workers with sufficient mandate and means to support patients; and cross-border management of multidrug-resistant tuberculosis to secure continuum of care between countries. Conclusion We suggest that the following actions may improve the success of treatment for multidrug-resistant tuberculosis patients: deployment of

  18. A case of multidrug-resistant monoarticular joint tuberculosis in a renal transplant recipient.

    Science.gov (United States)

    Regmi, A; Singh, P; Harford, A

    2014-01-01

    Tuberculosis (TB) is a common opportunistic infection after renal transplantation. The risk of TB in renal transplant recipients is reported to be 20 to 74 times higher than in the general population. Although extrapulmonary TB occurs frequently, isolated ankle joint TB is a rare form of extrapulmonary TB infection. It is often difficult to diagnose because of its atypical presentation; management is complex, especially with multidrug-resistant TB, the need for a prolonged course of therapy, and the risks of drug interactions and drug toxicity. We report herein a case of a 60-year-old female renal allograft recipient who developed multidrug-resistant ankle joint TB 11 months after her deceased donor renal transplantation. She presented to the emergency department with escalating pain and swelling of the left ankle, difficulty in ambulation, and a low-grade fever. An x-ray of the ankle revealed an effusion and soft tissue swelling. A synovial fluid culture was performed which tested positive for acid fast bacilli which grew a multidrug-resistant form of Mycobacterium tuberculosis. She was initially treated with isoniazid, rifampin, ethambutol, and pyrazinamide; then therapy was tailored secondary to the resistant nature of the organism. She received a combination of extensive debridement of the joint and institution of second-line anti-TB therapy with pyrazinamide, ethambutol, moxifloxacin, and ethionamide. To our knowledge, no other cases of multidrug-resistant TB have been reported in the literature after renal transplantation. This case shows both an atypical presentation of TB and the difficulties in managing a transplant patient with this disease. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Phenothiazines as a solution for multidrug resistant tuberculosis

    DEFF Research Database (Denmark)

    Kristiansen, Jette E; Dastidar, Sujata G; Palchoudhuri, Shauroseni

    2015-01-01

    Historically, multiplicity of actions in synthetic compounds is a rule rather than exception. The science of non-antibiotics evolved in this background. From the antimalarial and antitrypanosomial dye methylene blue, chemically similar compounds, the phenothiazines, were developed. The phenothiaz...... thioridazine and its (-) form to be combined with other antitubercular drugs to treat infections by drug-resistant strains of Mycobacterium tuberculosis and try to eradicate this deadly disease. [Int Microbiol 2015; 18(1):1-12]....

  20. MicroRNA signatures from multidrug-resistant Mycobacterium tuberculosis

    Science.gov (United States)

    REN, NA; GAO, GUIJU; SUN, YUE; ZHANG, LING; WANG, HUIZHU; HUA, WENHAO; WAN, KANGLIN; LI, XINGWANG

    2015-01-01

    Tuberculosis (TB) infections, caused by multi-drug-resistant Mycobacterium tuberculosis (MDR MTB), remain a significant public health concern worldwide. The regulatory mechanisms underlying the emergence of MDR MTB strains remain to be fully elucidated, and further investigation is required in order to develop better strategies for TB control. The present study investigated the expression profile of microRNA (miRNA) in MTB strains, and examined the differences between sensitive MTB and MDR MTB using next generation sequencing (NGS) with Illumina Deep Sequencing technology to better understand the mechanisms of resistance in MDR MTB, A total of 5, 785 and 195, and 6, 290 and 595 qualified Illumina reads were obtained from two MDR MTB strains, and 6, 673 and 665, and 7, 210 and 217 qualified Illumina reads were obtained from two sensitive MTB strains. The overall de novo assembly of miRNA sequence data generated 62 and 62, and 95 and 112 miRNAs between the 18 and 30 bp long from sensitive MTB strains and MDR MTB strains, respectively. Comparative miRNA analysis revealed that 142 miRNAs were differentially expressed in the MDR MTB strain, compared with the sensitive MTB strain, of which 48 were upregulated and 94 were downregulated. There were six similarly expressed miRNAs between the MDR and sensitive MTB strains, and 108 miRNAs were expressed only in the MDR MTB strain. The present study acquired miRNA data from sensitive MTB and MDR MTB strains using NGS techniques, and this identification miRNAs may serve as an invaluable resource for revealing the molecular basis of the regulation of expression associated with the mechanism of drug-resistance in MTB. PMID:26324150

  1. Time to sputum conversion in multidrug-resistant tuberculosis patients in Armenia: retrospective cohort study

    Directory of Open Access Journals (Sweden)

    Arax Hovhannesyan

    2012-06-01

    Full Text Available OBJECTIVE: To characterize time to sputum conversion among patients with multidrug resistant tuberculosis who were enrolled into second-line tuberculosis treatment program; to identify risk factors for delayed sputum conversion. DESIGN: Retrospective cohort study designed to identify the factors associated with sputum conversion. Survival analysis was performed using Kaplan-Meier estimator to compute estimates for median time to sputum conversion and Cox proportional hazards model to compute hazard ratios (HR. RESULTS: Sputum conversion from positive to negative was observed in 134 out of 195 cases (69%. Among these who converted the median time to conversion was 3.7 months. Factors independently associated with time to sputum conversion in the proportional hazards model were: male sex (HR=0.51, 95% CI 0.32-0.81, ofloxacin-resistant tuberculosis (HR = 0.45, 95% CI 0.26-0.78 and first period of recruitment into second-line treatment (HR= 0.69, 95% CI 0.47-1.01. CONCLUSION: Time to sputum conversion in patients with multidrug-resistant tuberculosis in Armenia was 5.8 months (range 0.5-17.0 months. High level of ofloxacin resistance was the main reason for compromised response to treatment. Patients with a poor resistance profile and males should be targeted with more aggressive initial therapy.

  2. Time to sputum conversion in multidrug-resistant tuberculosis patients in Armenia: retrospective cohort study

    Directory of Open Access Journals (Sweden)

    Arax Hovhannesyan

    2012-01-01

    Full Text Available OBJECTIVE: To characterize time to sputum conversion among patients with multidrug resistant tuberculosis who were enrolled into second-line tuberculosis treatment program; to identify risk factors for delayed sputum conversion. DESIGN: Retrospective cohort study designed to identify the factors associated with sputum conversion. Survival analysis was performed using Kaplan-Meier estimator to compute estimates for median time to sputum conversion and Cox proportional hazards model to compute hazard ratios (HR. RESULTS: Sputum conversion from positive to negative was observed in 134 out of 195 cases (69%. Among these who converted the median time to conversion was 3.7 months. Factors independently associated with time to sputum conversion in the proportional hazards model were: male sex (HR=0.51, 95% CI 0.32-0.81, ofloxacin-resistant tuberculosis (HR = 0.45, 95% CI 0.26-0.78 and first period of recruitment into second-line treatment (HR= 0.69, 95% CI 0.47-1.01. CONCLUSION: Time to sputum conversion in patients with multidrug-resistant tuberculosis in Armenia was 5.8 months (range 0.5- 17.0 months. High level of ofloxacin resistance was the main reason for compromised response to treatment. Patients with a poor resistance profile and males should be targeted with more aggressive initial therapy.

  3. Multidrug-resistant tuberculosis in Lithuania – Still a long way ahead

    Directory of Open Access Journals (Sweden)

    Greta Musteikienė

    2016-01-01

    Full Text Available Despite the recent advances in the diagnosis of tuberculosis, treatment of the disease, for the most part, remains the same as it was half a century ago. In recent years only two new anti-tuberculosis drugs have been approved by the European Medicines Agency and Food and Drug Administration. Though the prevalence of this disease is slowly decreasing all over Europe, new challenges appear. One of them is multidrug-resistant tuberculosis (MDR-TB. This problem is especially prominent in Lithuania, which is one of the 27 high MDR-TB burden countries in the world and falls behind neighboring countries in terms of the prevalence of the disease. The objective of this paper was to review the situation of tuberculosis and MDR-TB in Lithuania, and current available methods of treatment, control and diagnosis of this disease.

  4. Changing patterns and trends of multidrug-resistant tuberculosis at referral centre in Northern India: A 4-year experience

    Directory of Open Access Journals (Sweden)

    A K Maurya

    2013-01-01

    Full Text Available Purpose: India has a high burden of drug-resistant tuberculosis (TB, although there is little data on multidrug-resistant tuberculosis (MDR-TB. Although MDR-TB has existed for long time in India, very few diagnostic laboratories are well-equipped to test drug sensitivity. The objectives of this study were to determine the prevalence of MDR-TB, first-line drug resistance patterns and its changing trends in northern India in the 4 years. Materials and Methods: This was a prospective study from July 2007 to December 2010. Microscopy, culture by Bactec460 and p-nitro-α-acetylamino-β-hydroxypropiophenone (NAP test was performed to isolate and identify Mycobacterium tuberculosis (M. tb complex (MTBC. Drug sensitivity testing (DST was performed by 1% proportional method (Bactec460 for four drugs: Rifampicin, isoniazid, ethambutol and streptomycin. Various clinical and demographical profiles were evaluated to analyse risk factors for development of drug resistance. Results: We found the overall prevalence rate of MDR-TB to be 38.8%, increasing from 36.4% in 2007 to 40.8% in 2010. we found that the prevalence of MDR-TB in new and previously treated cases was 29.1% and 43.3% ( P < 0.05; CI 95%. The increasing trend of MDR-TB was more likely in pulmonary TB when compared with extra-pulmonary TB ( P < 0.05; CI 95%. Conclusions: we found a high prevalence (38.8% of MDR-TB both in new cases (29.1% and previously treated cases (43.3%.This study strongly highlights the need to make strategies for testing, surveillance, monitoring and management of such drug-resistant cases.

  5. Amikacin Concentrations Predictive of Ototoxicity in Multidrug-Resistant Tuberculosis Patients.

    Science.gov (United States)

    Modongo, Chawangwa; Pasipanodya, Jotam G; Zetola, Nicola M; Williams, Scott M; Sirugo, Giorgio; Gumbo, Tawanda

    2015-10-01

    Aminoglycosides, such as amikacin, are used to treat multidrug-resistant tuberculosis. However, ototoxicity is a common problem and is monitored using peak and trough amikacin concentrations based on World Health Organization recommendations. Our objective was to identify clinical factors predictive of ototoxicity using an agnostic machine learning method. We used classification and regression tree (CART) analyses to identify clinical factors, including amikacin concentration thresholds that predicted audiometry-confirmed ototoxicity among 28 multidrug-resistant pulmonary tuberculosis patients in Botswana. Amikacin concentrations were measured for all patients. The quantitative relationship between predictive factors and the probability of ototoxicity were then identified using probit analyses. The primary predictors of ototoxicity on CART analyses were cumulative days of therapy, followed by cumulative area under the concentration-time curve (AUC), which improved on the primary predictor by 87%. The area under the receiver operating curve was 0.97 on the test set. Peak and trough were not predictors in any tree. When algorithms were forced to pick peak and trough as primary predictors, the area under the receiver operating curve fell to 0.46. Probit analysis revealed that the probability of ototoxicity increased sharply starting after 6 months of therapy to near maximum at 9 months. A 10% probability of ototoxicity occurred with a threshold cumulative AUC of 87,232 days · mg · h/liter, while that of 20% occurred at 120,000 days · mg · h/liter. Thus, cumulative amikacin AUC and duration of therapy, and not peak and trough concentrations, should be used as the primary decision-making parameters to minimize the likelihood of ototoxicity in multidrug-resistant tuberculosis. Copyright © 2015, Modongo et al.

  6. A study of multidrug-resistant tuberculosis in risk groups in the city of Santos, São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Andréa Gobetti Vieira Coelho

    2012-09-01

    Full Text Available Monitoring the extent of and trends in multidrug-resistant tuberculosis (MDR-TB is a priority of the Brazilian National Tuberculosis Control Programme. The current study aimed to estimate the incidence of MDR-TB, describe the profile of TB drug resistance in risk groups and examine whether screening for MDR-TB adhered to the recommended guidelines. A descriptive study that examined diagnosed cases of pulmonary TB was conducted in the city of Santos, Brazil, between 2000-2004. Of the 2,176 pulmonary TB cases studied, 671 (30.8% met the criteria for drug sensitivity testing and, of these cases, 31.7% (213/671 were tested. Among the tested cases, 9.4% were resistant to one anti-TB drug and 15% were MDR. MDR was observed in 11.6% of 86 new TB cases and 17.3% of 127 previously treated cases. The average annual incidence of MDR-TB was 1.9 per 100,000 inhabitants-years. The extent of known MDR-TB in the city of Santos is high, though likely to be underestimated. Our study therefore indicates an inadequate adherence to the guidelines for MDR-TB screening and suggests the necessity of alternative strategies of MDR-TB surveillance.

  7. [Cluster of multidrug-resistant tuberculosis cases in a school of the district of Ica, Peru].

    Science.gov (United States)

    Torres, Julio; Sardón, Victoria; Soto, Mirtha G; Anicama, Rolado; Arroyo-Hernández, Hugo; Munayco, César V

    2011-01-01

    We describe the evolution and features of a cluster of Multidrug-resistant tuberculosis (MDR TB) cases that occurred in 2001, in a school located in a sub-urban area of the district of Ica, Peru. We identified 15 students related before becoming infected with tuberculosis. The mean age of the cluster was 15 years. A total of 12 students were MDR-TB cases and 7 were drug-resistant to 5 first-line drugs (RHEZS). Five out of the 15 cases received at least 3 different anti-tuberculosis treatment schemes. The average treatment duration was 37 months (minimum 21 and maximum 59 months). A total of 13 cases recovered and 2 died. This study describes a cluster of MDR -TB cases in an educational facility, which due to the epidemiological link and time presentation, is probably an outbreak of MDR TB with a satisfactory outcome after prolonged treatment.

  8. Risk factors associated with multidrug-resistant tuberculosis in Espírito Santo, Brazil

    Directory of Open Access Journals (Sweden)

    Geisa Fregona

    Full Text Available ABSTRACT OBJECTIVE To analyze the prevalence and factors associated with multidrug-resistant tuberculosis in Espírito Santo, Brazil. METHODS This is a cross-sectional study of cases of tuberculosis tested for first-line drugs (isoniazid, rifampicin, pyrazinamide, ethambutol, and streptomycin in Espírito Santo between 2002 and 2012. We have used laboratory data and registration of cases of tuberculosis – from the Sistema Nacional de Agravos de Notificação and Sistema para Tratamentos Especiais de Tuberculose. Individuals have been classified as resistant and non-resistant and compared in relation to the sociodemographic, clinical, and epidemiological variables. Some variables have been included in a logistic regression model to establish the factors associated with resistance. RESULTS In the study period, 1,669 individuals underwent anti-tuberculosis drug susceptibility testing. Of these individuals, 10.6% showed resistance to any anti-tuberculosis drug. The rate of multidrug resistance observed, that is, to rifampicin and isoniazid, has been 5%. After multiple analysis, we have identified as independent factors associated with resistant tuberculosis: history of previous treatment of tuberculosis [recurrence (OR = 7.72; 95%CI 4.24–14.05 and re-entry after abandonment (OR = 3.91; 95%CI 1.81–8.43], smoking (OR = 3.93; 95%CI 1.98–7.79, and positive culture for Mycobacterium tuberculosis at the time of notification of the case (OR = 3.22; 95%CI 1.15–8.99. CONCLUSIONS The partnership between tuberculosis control programs and health teams working in the network of Primary Health Care needs to be strengthened. This would allow the identification and monitoring of individuals with a history of previous treatment of tuberculosis and smoking. Moreover, the expansion of the offer of the culture of tuberculosis and anti-tuberculosis drug susceptibility testing would provide greater diagnostic capacity for the resistant types in Espírito Santo.

  9. Enhancement of antibiotic activity by efflux inhibitors against multidrug resistant Mycobacterium tuberculosis clinical isolates from Brazil

    Directory of Open Access Journals (Sweden)

    Tatiane eCoelho

    2015-04-01

    Full Text Available Drug resistant tuberculosis continues to increase and new approaches for its treatment are necessary. The identification of M. tuberculosis clinical isolates presenting efflux as part of their resistant phenotype has a major impact in tuberculosis treatment. In this work, we used a checkerboard procedure combined with the tetrazolium microplate-based assay (TEMA to study single combinations between antituberculosis drugs and efflux inhibitors (EIs against multidrug resistant M. tuberculosis clinical isolates using the fully susceptible strain H37Rv as reference. Efflux activity was studied on a real-time basis by a fluorometric method that uses ethidium bromide as efflux substrate. Quantification of efflux pump genes mRNA transcriptional levels were performed by RT-qPCR. The fractional inhibitory concentrations (FIC indicated synergistic activity for the interactions between isoniazid, rifampicin, amikacin, ofloxacin, and ethidium bromide plus the EIs verapamil, thioridazine and chlorpromazine. The FICs ranged from 0.25, indicating a four-fold reduction on the MICs, to 0.015, 64-fold reduction. The detection of active efflux by real-time fluorometry showed that all strains presented intrinsic efflux activity that contributes to the overall resistance which can be inhibited in the presence of the EIs. The quantification of the mRNA levels of the most important efflux pump genes on these strains shows that they are intrinsically predisposed to expel toxic compounds as the exposure to subinhibitory concentrations of antibiotics were not necessary to increase the pump mRNA levels when compared with the non-exposed counterpart. The results obtained in this study confirm that the intrinsic efflux activity contributes to the overall resistance in multidrug resistant clinical isolates of M. tuberculosis and that the inhibition of efflux pumps by the EIs can enhance the clinical effect of antibiotics that are their substrates.

  10. Drug resistance detection and mutation patterns of multidrug resistant tuberculosis strains from children in Delhi

    Directory of Open Access Journals (Sweden)

    Jyoti Arora

    2017-06-01

    Full Text Available A total of 312 sputum samples from pediatric patients presumptive of multidrug resistant tuberculosis were tested for the detection of drug resistance using the GenoTypeMTBDRplus assay. A total of 193 (61.8% patients were smear positive and 119 (38.1% were smear negative by Ziehl–Neelsen staining. Line probe assay (LPA was performed for 208 samples/cultures (193 smear positive samples and 15 cultures from smear negative samples. Valid results were obtained from 198 tests. Of these, 125/198 (63.1% were sensitive to both rifampicin (RIF and isoniazid (INH. 73/198 (36.9% were resistant to at least INH/RIF, out of which 49 (24.7% were resistant to both INH and RIF (multidrug resistant. Children with tuberculosis are often infected by someone close to them, so strengthening of contact tracing in the program may help in early diagnosis to identify additional cases within the household. There is a need to evaluate newer diagnostic assays which have a high sensitivity in the case of smear negative samples, additional samples other than sputum among young children not able to expectorate, and also to fill the gap between estimated and reported cases under the program.

  11. The function of the thyroid gland in patients with multi-drug resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    S. L. Matveyeva

    2017-08-01

    Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDRTB remains a health problem for many countries in the world. The share of MDRTB is 10–30% among newly diagnosed cases and 20–70% among relapses and treatment failure. The aim of the study is to define the side effects of second line drugs used in the treatment of MDRTB on thyroid function. Methods In 30 patients with multidrug resistant tuberculosis, echostructure of thyroid was studied by ultrasound imaging method. Indices of thyroid function: plasma levels of free thyroxin, thyroid stimulating hormone were studied before chemotherapy initiated, at the end of intensive phase and after the treatment finished. Results Decreasing of thyroid function under antituberculosis chemotherapy was approved. Monitoring and correction of thyroid function during antituberculosis chemotherapy was suggested. Conclusion Patients with MDRTB taking ethionamide and PAS are at increased risk for hypothyroidism and goiter, and therefore require monitoring of thyroid function at all stages of antituberculosis chemotherapy for its timely correction.

  12. Clinical Concentrations of Thioridazine Kill Intracellular Multidrug-Resistant Mycobacterium tuberculosis

    Science.gov (United States)

    Ordway, Diane; Viveiros, Miguel; Leandro, Clara; Bettencourt, Rosário; Almeida, Josefina; Martins, Marta; Kristiansen, Jette E.; Molnar, Joseph; Amaral, Leonard

    2003-01-01

    The phenothiazines chlorpromazine (CPZ) and thioridazine (TZ) have equal in vitro activities against antibiotic-sensitive and -resistant Mycobacterium tuberculosis. These compounds have not been used as anti-M. tuberculosis agents because their in vitro activities take place at concentrations which are beyond those that are clinically achievable. In addition, chronic administration of CPZ produces frequent severe side effects. Because CPZ has been shown to enhance the killing of intracellular M. tuberculosis at concentrations in the medium that are clinically relevant, we have investigated whether TZ, a phenothiazine whose negative side effects are less frequent and serious than those associated with CPZ, kills M. tuberculosis organisms that have been phagocytosed by human macrophages, which have nominal killing activities against these bacteria. Both CPZ and TZ killed intracellular antibiotic-sensitive and -resistant M. tuberculosis organisms when they were used at concentrations in the medium well below those present in the plasma of patients treated with these agents. These concentrations in vitro were not toxic to the macrophage, nor did they affect in vitro cellular immune processes. TZ thus appears to be a serious candidate for the management of a freshly diagnosed infection of pulmonary tuberculosis or as an adjunct to conventional antituberculosis therapy if the patient originates from an area known to have a high prevalence of multidrug-resistant M. tuberculosis isolates. Nevertheless, we must await the outcomes of clinical trials to determine whether TZ itself may be safely and effectively used as an antituberculosis agent. PMID:12604522

  13. Transmission of Multidrug-Resistant and Drug-Susceptible Tuberculosis within Households: A Prospective Cohort Study

    Science.gov (United States)

    Grandjean, Louis; Gilman, Robert H.; Martin, Laura; Soto, Esther; Castro, Beatriz; Lopez, Sonia; Coronel, Jorge; Castillo, Edith; Alarcon, Valentina; Lopez, Virginia; San Miguel, Angela; Quispe, Neyda; Asencios, Luis; Dye, Christopher; Moore, David A. J.

    2015-01-01

    Background The “fitness” of an infectious pathogen is defined as the ability of the pathogen to survive, reproduce, be transmitted, and cause disease. The fitness of multidrug-resistant tuberculosis (MDRTB) relative to drug-susceptible tuberculosis is cited as one of the most important determinants of MDRTB spread and epidemic size. To estimate the relative fitness of drug-resistant tuberculosis cases, we compared the incidence of tuberculosis disease among the household contacts of MDRTB index patients to that among the contacts of drug-susceptible index patients. Methods and Findings This 3-y (2010–2013) prospective cohort household follow-up study in South Lima and Callao, Peru, measured the incidence of tuberculosis disease among 1,055 household contacts of 213 MDRTB index cases and 2,362 household contacts of 487 drug-susceptible index cases. A total of 35/1,055 (3.3%) household contacts of 213 MDRTB index cases developed tuberculosis disease, while 114/2,362 (4.8%) household contacts of 487 drug-susceptible index patients developed tuberculosis disease. The total follow-up time for drug-susceptible tuberculosis contacts was 2,620 person-years, while the total follow-up time for MDRTB contacts was 1,425 person-years. Using multivariate Cox regression to adjust for confounding variables including contact HIV status, contact age, socio-economic status, and index case sputum smear grade, the hazard ratio for tuberculosis disease among MDRTB household contacts was found to be half that for drug-susceptible contacts (hazard ratio 0.56, 95% CI 0.34–0.90, p = 0.017). The inference of transmission in this study was limited by the lack of genotyping data for household contacts. Capturing incident disease only among household contacts may also limit the extrapolation of these findings to the community setting. Conclusions The low relative fitness of MDRTB estimated by this study improves the chances of controlling drug-resistant tuberculosis. However, fitter

  14. Congenital Multidrug-resistant Tuberculosis in a Neonate: A Case Report.

    Science.gov (United States)

    Lhadon, Tenzin; Jullien, Sophie

    2018-04-20

    Multidrug-resistant tuberculosis (MDR-TB) is a well-identified raising public health concern worldwide. However, the data available on MDR-TB in children and particularly in the neonate age group are limited. Congenital tuberculosis (TB) is rare, and its diagnosis is challenging because of non-specific manifestations. The choice of anti-tubercular drugs is difficult because of the lack of international consensus as a consequence of the scarcity of evidence-based data on this age group. We hereby present a case from Bhutan of a 23-day-old male neonate with congenital MDR-TB. His mother was diagnosed with disseminated TB, and treatment was commenced 11 days post-partum. Congenital transmission of TB was suspected, as direct postnatal transmission was unlikely and thorough screening of contacts for TB was negative. In this case, the mother's MDR-TB status was revealed only after her newborn's MDR-TB diagnosis.

  15. A cluster of multidrug-resistant Mycobacterium tuberculosis among patients arriving in Europe from the Horn of Africa: a molecular epidemiological study.

    NARCIS (Netherlands)

    Walker, Timothy M; Merker, Matthias; Knoblauch, Astrid M; Helbling, Peter; Schoch, Otto D; van der Werf, Marieke J; Kranzer, Katharina; Fiebig, Lena; Kröger, Stefan; Haas, Walter; Hoffmann, Harald; Indra, Alexander; Egli, Adrian; Cirillo, Daniela M; Robert, Jérôme; Rogers, Thomas R; Groenheit, Ramona; Mengshoel, Anne T; Mathys, Vanessa; Haanperä, Marjo; Soolingen, Dick van; Niemann, Stefan; Böttger, Erik C; Keller, Peter M

    2018-01-01

    The risk of tuberculosis outbreaks among people fleeing hardship for refuge in Europe is heightened. We describe the cross-border European response to an outbreak of multidrug-resistant tuberculosis among patients from the Horn of Africa and Sudan.

  16. Soluble Urokinase Plasminogen Activator Receptor Levels in Tuberculosis Patients at High Risk for Multidrug Resistance

    Directory of Open Access Journals (Sweden)

    Tri Yudani Mardining Raras

    2012-01-01

    Full Text Available The soluble urokinase plasminogen activator receptor (suPAR has been shown to be a strong prognostic biomarker for tuberculosis (TB. In the present study, the profiles of plasma suPAR levels in pulmonary TB patients at high risk for multidrug resistance were analyzed and compared with those in multidrug resistant (MDR-TB patients. Forty patients were prospectively included, consisting of 10 MDR-TB patients and 30 TB patients at high risk for MDR, underwent clinical assesment. Plasma suPAR levels were measured using ELISA (SUPARnostic, Denmark and bacterial cultures were performed in addition to drug susceptibility tests. All patients of suspected MDR-TB group demonstrated significantly higher suPAR levels compared with the healthy TB-negative group (1.79 ng/mL. Among the three groups at high risk for MDR-TB, only the relapse group (7.87 ng/mL demonstrated suPAR levels comparable with those of MDR-TB patients (7.67 ng/mL. suPAR levels in the two-month negative acid-fast bacilli conversion group (9.29 ng/mL were higher than positive control, whereas levels in the group consisting of therapy failure patients (5.32 ng/mL were lower. Our results strongly suggest that suPAR levels enable rapid screening of suspected MDR-TB patients, but cannot differentiate between groups.

  17. Molecular Genetic Analysis of Multi-drug Resistance in Indian Isolates of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Noman Siddiqi

    1998-09-01

    Full Text Available A total of 116 isolates from patients attending the out-patient department at the All India Institute of Medical Sciences, New Delhi and the New Delhi Tuberculosis Centre, New Delhi, India were collected. They were analyzed for resistance to drugs prescribed in the treatment for tuberculosis. The drug resistance was initially determined by microbiological techniques. The Bactec 460TB system was employed to determine the type and level of resistance in each isolate. The isolates were further characterized at molecular level. The multi-drug loci corresponding to rpo b, gyr A, kat G were studied for mutation(s by the polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP technique. The SSCP positive samples were sequenced to characterize the mutations in rpo b, and gyr A loci. While previously reported mutations in the gyr A and rpo b loci were found to be present, several novel mutations were also scored in the rpo b locus. Interestingly, analysis of the gyr A locus showed the presence of point mutation(s that could not be detected by PCR-SSCP. Furthermore, rifampicin resistance was found to be an important marker for checking multi-drug resistance (MDR in clinical isolates of Mycobacterium tuberculosis. This is the first report on molecular genetic analysis of MDR tuberculosis one from India, highlights the increasing incidence of MDR in the Indian isolates of M. tuberculosis.

  18. Dried blood spot analysis for therapeutic drug monitoring of linezolid in patients with multidrug-resistant tuberculosis

    NARCIS (Netherlands)

    Vu, D H; Bolhuis, M S; Koster, R A; Greijdanus, B; de Lange, W C M; van Altena, R; Brouwers, J R B J; Uges, D R A; Alffenaar, J W C

    2012-01-01

    Linezolid is a promising antimicrobial agent for the treatment of multidrug-resistant tuberculosis (MDR-TB), but its use is limited by toxicity. Therapeutic drug monitoring (TDM) may help to minimize toxicity while adequate drug exposure is maintained. Conventional plasma sampling and monitoring

  19. How many sputum culture results do we need to monitor multidrug-resistant-tuberculosis (MDR-TB) patients during treatment?

    NARCIS (Netherlands)

    Janssen, Saskia; Padanilam, Xavier; Louw, Rianna; Mahanyele, Russel; Coetzee, Gerrit; Hänscheid, Thomas; Leenstra, Tjalling; Grobusch, Martin P.

    2013-01-01

    Discharge of a hospital patient after a single negative sputum culture may save money when treating multidrug-resistant tuberculosis. However, after initial sputum conversion in 336 South Africans, 11.6% and 5.4% reconverted after 1 and 2 months, respectively. These findings endorse the WHO

  20. Clinical Validation of the Analysis of Linezolid and Clarithromycin in Oral Fluid of Patients with Multidrug-Resistant Tuberculosis

    NARCIS (Netherlands)

    Bolhuis, M. S.; van Altena, R.; van Hateren, K.; de Lange, W. C. M.; Greijdanus, B.; Uges, D. R. A.; Kosterink, J. G. W.; van der Werf, T. S.; Alffenaar, J. W. C.

    Linezolid plays an increasingly important role in the treatment of multidrug-resistant tuberculosis (MDR-TB). However, patients should be carefully monitored due to time-and dose-dependent toxicity. Clarithromycin plays a more modest role. Therapeutic drug monitoring may contribute to assessment of

  1. Efficacy of moxifloxacin & econazole against multidrug resistant (MDR Mycobacterium tuberculosis in murine model

    Directory of Open Access Journals (Sweden)

    U D Gupta

    2015-01-01

    Full Text Available Background & objectives: Studies have shown the bactericidal potential of econazole and clotrimazole against Mycobacterium tuberculosis under in vitro and ex vivo conditions along with their synergism with conventional antituberculosis drugs. These molecules were also found to be effective against different multidrug resistant (MDR M. tuberculosis isolates in vitro. Hence the present study was designed to evaluate the in vivo antimycobacterial potential of moxifloxacin and econazole alone and in combination against multidrug resistant tuberculosis (MDR-TB in a mice model. Methods: Mice were infected with 2.5×10 [7] bacilli of MDR strain of M. tuberculosis by aerosol route of infection. After four weeks of infection, chemotherapy was started orally by moxifloxacin 8.0 mg/kg body wt and econazole 3.3 mg/kg alone and in combination, as well as with four first line anti-tuberculosis drugs as a positive control. The animals were sacrificed and the lungs and spleen were excised under aspetic conditions. The tissues were homogenized with sterile normal saline, an aliquot of the homogenate was plated on Middlebrook 7H11 agar supplemented with oleate albumin dextrose catalase (OADC and incubated at 37°C for four weeks. The number of visible and individual colonies were counted. Results: The first line anti-tuberculosis drugs (RIF+INH+EMB+PZA after eight weeks of therapy had no impact as the bacillary load in lungs and spleens remained unchanged. However, econazole, moxifloxacin alone as well as in combination significantly reduced the bacillary load in lungs as well as in spleens of MDR-TB bacilli infected mice. Interpretation & conclusions: Co-administration of the two drugs (econazole and moxifloxacin to MDR-TB strain JAL-7782 infected mice exhibited additive effect, the efficacy of the drugs in combination being higher as compared with ECZ or MOX alone. These results were substantiated by histopathological studies. This study suggests the utility of

  2. Multidrug resistant tuberculosis in prisons located in former Soviet countries: A systematic review.

    Directory of Open Access Journals (Sweden)

    Maxwell Droznin

    Full Text Available A systematic literature review was performed to investigate the occurrence of multidrug-resistant tuberculosis (MDR TB in prisons located in countries formerly part of the Soviet Union.A systematic search of published studies reporting MDR TB occurrence in prisons located in former Soviet countries was conducted by probing PubMed and Cumulative Index Nursing and Allied Health Literature for articles that met predetermined inclusion criteria.Seventeen studies were identified for systematic review. Studies were conducted in six different countries. Overall, prevalence of MDR TB among prisoners varied greatly between studies. Our findings suggest a high prevalence of MDR TB in prisons of Post-Soviet states with percentages as high as 16 times more than the worldwide prevalence estimated by the WHO in 2014.All studies suggested a high prevalence of MDR TB in prison populations in Post-Soviet states.

  3. In vitro screening of snake venom against multidrug-resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    Sujay Kumar Bhunia

    2015-12-01

    Full Text Available The re-emergence of multidrug-resistant tuberculosis (MDR-TB has brought to light the importance of screening effective novel drugs. In the present study, in vitro activities of different snake (Naja naja, Bungarus fasciatus, Daboia russelli russelli, Naja kaouthia venoms have been investigated against clinical isolate of MDR-TB strains. The treatment with all the venoms inhibited the mycobacterial growth for at least a week in common and two of them (Naja naja and Naja kaouthia showed significantly longer inhibition up to two weeks against the MDR-TB strain with single dose and a repetition of those two venoms exhibited inhibition up to more than four weeks.

  4. Serum vitamin d level and susceptibility to multidrug-resistant tuberculosis among household contacts

    Science.gov (United States)

    Herlina, N.; Sinaga, B. Y. M.; Siagian, P.; Mutiara, E.

    2018-03-01

    Low levels of vitamin D is a predisposing factor for Multidrug-resistant tuberculosis. Family members in contact with the patient are also at risk of infection. Currently, there is no study that compares vitamin D levels between MDR-TB patients and household contact. This study aims to identify the association between level vitamin D within MDR-TB occurrence. This was a case-control study, with the number of samples in each group (MDR-TB) patients and household contactswere40 people. Each member of each group was checked for vitamin D levels using enzyme-linked immunosorbent assay (ELISA) technique. Statistical analysis was by using Chi-Square analysis using SPSS. Mean levels of vitamin D in MDR-TB patients were 32.21, household contact 31.7. There was anosignificant association between vitamin D levels and MDR-TB occurrence (p=1.0).No significant associationbetween vitamin D level with theMDR-TB occurrence.

  5. Hypothyroidism during second-line treatment of multidrug-resistant tuberculosis: a prospective study.

    Science.gov (United States)

    Bares, R; Khalid, N; Daniel, H; Dittmann, H; Reimold, M; Gallwitz, B; Schmotzer, C

    2016-07-01

    Hypothyroidism is an adverse effect of certain anti-tuberculosis drugs. This is a prospective study of the frequency and possible pathomechanisms associated with hypothyroidism due to second-line treatment of multidrug-resistant tuberculosis. Fifty human immunodeficiency virus negative patients and 20 controls were included. All participants underwent ultrasonography of the thyroid and measurement of thyroid stimulating hormone (TSH). TSH levels were checked every 3 months. If hypothyroidism was present, T3, T4 and thyroid peroxidase autoantibodies were measured, and imaging extended to scintigraphy and repeated ultrasonography. Before treatment, 7 patients (14%) and 1 control (5%) were hypothyreotic. During the first 6 months of treatment, TSH levels increased in 41 patients (82%), 39 (78%) had values above the normal range and 19 (38%) had overt hypothyroidism. As none of the patients had signs of autoimmune thyroiditis, interaction with anti-tuberculosis drugs was assumed to be the cause of hypothyroidism. Nine patients died during treatment, all of whom had developed hypothyroidism. In seven, the metabolic situation at their death was known, and they had become euthyreotic following levothyroxine substitution. TSH levels should be checked before initiating anti-tuberculosis treatment and after 3 and 6 months to start timely replacement of levothyroxine. Further studies are needed to elucidate the exact pathomechanism involved in hypothyroidism and whether hypothyroidism can be used as predictor of treatment failure.

  6. Genitourinary and pulmonary multidrug resistant Mycobacterium tuberculosis infection in an Asian elephant (Elephas maximus).

    Science.gov (United States)

    Dumonceaux, Genevieve A; St Leger, Judy; Olsen, John H; Burton, Michael S; Ashkin, David; Maslow, Joel N

    2011-12-01

    A female Asian elephant (Elephas maximus) developed vaginal and trunk discharge. Cultures were positive for pan-susceptible Mycobacterium tuberculosis. Isoniazid and pyrazinamide were given rectally and monitored by serum levels. After being trained at 10 mo to accept oral dosing, treatment was changed and rifampin was added. Oral medications were administered for another 10 mo. A year after completion of therapy, the vaginal discharge increased and cultures yielded M. tuberculosis, resistant to isoniazid and rifampin. Treatment with oral ethambutol, pyrazinamide, and enrofloxacin and intramuscular amikacin was initiated. Although followup cultures became negative, adverse reactions to medications precluded treatment completion. Due to public health concerns related to multidrug resistant M. tuberculosis (MDR-TB), the elephant was euthanized. Postmortem smears from the lung, peribronchial, and abdominal lymph nodes yielded acid-fast bacteria, although cultures were negative. This case highlights important considerations in the treatment of M. tuberculosis in animals and the need for a consistent approach to diagnosis, treatment, and follow-up.

  7. Conspicuous multidrug-resistant Mycobacterium tuberculosis cluster strains do not trespass country borders in Latin America and Spain.

    Science.gov (United States)

    Ritacco, Viviana; Iglesias, María-José; Ferrazoli, Lucilaine; Monteserin, Johana; Dalla Costa, Elis R; Cebollada, Alberto; Morcillo, Nora; Robledo, Jaime; de Waard, Jacobus H; Araya, Pamela; Aristimuño, Liselotte; Díaz, Raúl; Gavin, Patricia; Imperiale, Belen; Simonsen, Vera; Zapata, Elsa M; Jiménez, María S; Rossetti, Maria L; Martin, Carlos; Barrera, Lucía; Samper, Sofia

    2012-06-01

    Multidrug-resistant Mycobacterium tuberculosis strain diversity in Ibero-America was examined by comparing extant genotype collections in national or state tuberculosis networks. To this end, genotypes from over 1000 patients with multidrug-resistant tuberculosis diagnosed from 2004 through 2008 in Argentina, Brazil, Chile, Colombia, Venezuela and Spain were compared in a database constructed ad hoc. Most of the 116 clusters identified by IS6110 restriction fragment length polymorphism were small and restricted to individual countries. The three largest clusters, of 116, 49 and 25 patients, were found in Argentina and corresponded to previously documented locally-epidemic strains. Only 13 small clusters involved more than one country, altogether accounting for 41 patients, of whom 13 were, in turn, immigrants from Latin American countries different from those participating in the study (Peru, Ecuador and Bolivia). Most of these international clusters belonged either to the emerging RD(Rio) LAM lineage or to the Haarlem family of M. tuberculosis and four were further split by country when analyzed with spoligotyping and rifampin resistance-conferring mutations, suggesting that they did not represent ongoing transnational transmission events. The Beijing genotype accounted for 1.3% and 10.2% of patients with multidrug-resistant tuberculosis in Latin America and Spain, respectively, including one international cluster of two cases. In brief, Euro-American genotypes were widely predominant among multidrug-resistant M. tuberculosis strains in Ibero-America, reflecting closely their predominance in the general M. tuberculosis population in the region, and no evidence was found of acknowledged outbreak strains trespassing country borders. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Risk factors and timing of default from treatment for non-multidrug-resistant tuberculosis in Moldova.

    Science.gov (United States)

    Jenkins, H E; Ciobanu, A; Plesca, V; Crudu, V; Galusca, I; Soltan, V; Cohen, T

    2013-03-01

    The Republic of Moldova, in Eastern Europe, has among the highest reported nationwide proportions of tuberculosis (TB) patients with multidrug-resistant tuberculosis (MDR-TB) worldwide. Default has been associated with increased mortality and amplification of drug resistance, and may contribute to the high MDR-TB rates in Moldova. To assess risk factors and timing of default from treatment for non-MDR-TB from 2007 to 2010. A retrospective analysis of routine surveillance data on all non-MDR-TB patients reported. A total of 14.7% of non-MDR-TB patients defaulted from treatment during the study period. Independent risk factors for default included sociodemographic factors, such as homelessness, living alone, less formal education and spending substantial time outside Moldova in the year prior to diagnosis; and health-related factors such as human immunodeficiency virus co-infection, greater lung pathology and increasing TB drug resistance. Anti-tuberculosis treatment is usually initiated within an institutional setting in Moldova, and the default risk was highest in the month following the phase of hospitalized treatment (among civilians) and after leaving prison (among those diagnosed while incarcerated). Targeted interventions to increase treatment adherence for patients at highest risk of default, and improving the continuity of care for patients transitioning from institutional to community care may substantially reduce risk of default.

  9. Rapid detection of multidrug-resistant Mycobacterium tuberculosis using the malachite green decolourisation assay

    Science.gov (United States)

    Coban, Ahmet Yilmaz; Uzun, Meltem

    2013-01-01

    Early detection of drug resistance in Mycobacterium tuberculosis isolates allows for earlier and more effective treatment of patients. The aim of this study was to investigate the performance of the malachite green decolourisation assay (MGDA) in detecting isoniazid (INH) and rifampicin (RIF) resistance in M. tuberculosis clinical isolates. Fifty M. tuberculosis isolates, including 19 multidrug-resistant, eight INH-resistant and 23 INH and RIF-susceptible samples, were tested. The sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and agreement of the assay for INH were 92.5%, 91.3%, 92.5%, 91.3% and 92%, respectively. Similarly, the sensitivity, specificity, PPV, NPV and agreement of the assay for RIF were 94.7%, 100%, 100%, 96.8% and 98%, respectively. There was a major discrepancy in the tests of two isolates, as they were sensitive to INH by the MGDA test, but resistant by the reference method. There was a minor discrepancy in the tests of two additional isolates, as they were sensitive to INH by the reference method, but resistant by the MGDA test. The drug susceptibility test results were obtained within eight-nine days. In conclusion, the MGDA test is a reliable and accurate method for the rapid detection of INH and RIF resistance compared with the reference method and the MGDA test additionally requires less time to obtain results. PMID:24402143

  10. Rapid detection of multidrug-resistant Mycobacterium tuberculosis using the malachite green decolourisation assay

    Directory of Open Access Journals (Sweden)

    Ahmet Yilmaz Coban

    2013-12-01

    Full Text Available Early detection of drug resistance in Mycobacterium tuberculosis isolates allows for earlier and more effective treatment of patients. The aim of this study was to investigate the performance of the malachite green decolourisation assay (MGDA in detecting isoniazid (INH and rifampicin (RIF resistance in M. tuberculosis clinical isolates. Fifty M. tuberculosis isolates, including 19 multidrug-resistant, eight INH-resistant and 23 INH and RIF-susceptible samples, were tested. The sensitivity, specificity, positive predictive value (PPV, negative predictive value (NPV and agreement of the assay for INH were 92.5%, 91.3%, 92.5%, 91.3% and 92%, respectively. Similarly, the sensitivity, specificity, PPV, NPV and agreement of the assay for RIF were 94.7%, 100%, 100%, 96.8% and 98%, respectively. There was a major discrepancy in the tests of two isolates, as they were sensitive to INH by the MGDA test, but resistant by the reference method. There was a minor discrepancy in the tests of two additional isolates, as they were sensitive to INH by the reference method, but resistant by the MGDA test. The drug susceptibility test results were obtained within eight-nine days. In conclusion, the MGDA test is a reliable and accurate method for the rapid detection of INH and RIF resistance compared with the reference method and the MGDA test additionally requires less time to obtain results.

  11. Multidrug-resistant pulmonary tuberculosis in Los Altos, Selva and Norte regions, Chiapas, Mexico.

    Science.gov (United States)

    Sánchez-Pérez, H J; Díaz-Vázquez, A; Nájera-Ortiz, J C; Balandrano, S; Martín-Mateo, M

    2010-01-01

    To analyse the proportion of multidrug-resistant tuberculosis (MDR-TB) in cultures performed during the period 2000-2002 in Los Altos, Selva and Norte regions, Chiapas, Mexico, and to analyse MDR-TB in terms of clinical and sociodemographic indicators. Cross-sectional study of patients with pulmonary tuberculosis (PTB) from the above regions. Drug susceptibility testing results from two research projects were analysed, as were those of routine sputum samples sent in by health personnel for processing (n = 114). MDR-TB was analysed in terms of the various variables of interest using bivariate tests of association and logistic regression. The proportion of primary MDR-TB was 4.6% (2 of 43), that of secondary MDR-TB was 29.2% (7/24), while among those whose history of treatment was unknown the proportion was 14.3% (3/21). According to the logistic regression model, the variables most highly associated with MDR-TB were as follows: having received anti-tuberculosis treatment previously, cough of >3 years' duration and not being indigenous. The high proportion of MDR cases found in the regions studied shows that it is necessary to significantly improve the control and surveillance of PTB.

  12. Converging risk factors but no association between HIV infection and multidrug-resistant tuberculosis in Kazakhstan.

    Science.gov (United States)

    van den Hof, S; Tursynbayeva, A; Abildaev, T; Adenov, M; Pak, S; Bekembayeva, G; Ismailov, S

    2013-04-01

    Kazakhstan is a country with a low HIV/AIDS (human immunodeficiency virus/acquired immune-deficiency syndrome) burden, but a high prevalence of multidrug-resistant tuberculosis (MDR-TB). We describe the epidemiology of multidrug resistance and HIV among TB patients, using the 2007-2011 national electronic TB register. HIV test results were available for 97.2% of TB patients. HIV prevalence among TB patients increased from 0.6% in 2007 to 1.5% in 2011. Overall, 41.6% of patients had a positive smear at diagnosis, 38.6% a positive culture and 51.7% either a positive smear or culture. Drug susceptibility testing (DST) results were available for 92.7% of culture-positive cases. Socio-economic factors independently associated with both HIV and MDR-TB were urban residency, drug use, homelessness and a history of incarceration. In adjusted analysis, HIV positivity was not associated with MDR-TB (OR 1.0, 95%CI 0.86-1.2). Overall, among TB patients with DST and HIV test results available, 65.0% were positive for neither HIV nor MDR-TB, 33.5% only for MDR-TB, 0.9% only for HIV and 0.6% for both HIV and MDR-TB. Among injection drug users, 12.5% were positive for HIV and MDR-TB. We showed increasing HIV prevalence among TB patients in Kazakhstan. HIV was not an independent risk factor for MDR-TB, but risk factors were largely overlapping and we did identify subgroups at particular risk of HIV-MDR-TB co-infection, notably drug users. Enhanced efforts are necessary to provide care to these socially vulnerable populations.

  13. Dielectrophoretic analysis of changes in cytoplasmic ion levels due to ion channel blocker action reveals underlying differences between drug-sensitive and multidrug-resistant leukaemic cells

    International Nuclear Information System (INIS)

    Duncan, L; Shelmerdine, H; Hughes, M P; Coley, H M; Huebner, Y; Labeed, F H

    2008-01-01

    Dielectrophoresis (DEP)-the motion of particles in non-uniform AC fields-has been used in the investigation of cell electrophysiology. The technique offers the advantages of rapid determination of the conductance and capacitance of membrane and cytoplasm. However, it is unable to directly determine the ionic strengths of individual cytoplasmic ions, which has potentially limited its application in assessing cell composition. In this paper, we demonstrate how dielectrophoresis can be used to investigate the cytoplasmic ion composition by using ion channel blocking agents. By blocking key ion transporters individually, it is possible to determine their overall contribution to the free ions in the cytoplasm. We use this technique to evaluate the relative contributions of chloride, potassium and calcium ions to the cytoplasmic conductivities of drug sensitive and resistant myelogenous leukaemic (K562) cells in order to determine the contributions of individual ion channel activity in mediating multi-drug resistance in cancer. Results indicate that whilst K + and Ca 2+ levels were extremely similar between sensitive and resistant lines, levels of Cl - were elevated by three times to that in the resistant line, implying increased chloride channel activity. This result is in line with current theories of MDR, and validates the use of ion channel blockers with DEP to investigate ion channel function. (note)

  14. Concordance of programmatic and laboratory-based multidrug-resistant tuberculosis treatment outcomes in Peru.

    Science.gov (United States)

    Alexy, E R; Podewils, L J; Mitnick, C D; Becerra, M C; Laserson, K F; Bonilla, C

    2012-01-01

    Confirmation of cure for multidrug-resistant tuberculosis (MDR-TB) patients requires laboratory tests for Mycobacterium tuberculosis growth on culture media. Outcome decisions dictate patient management, and inaccuracies place patients at an increased risk of morbidity and mortality, and may contribute to continued transmission of MDR-TB. To examine concordance between programmatic and laboratory-based MDR-TB treatment outcomes. The study population included 1658 MDR-TB patients in Peru treated between 1996 and 2002 with both program and laboratory-based outcomes. Laboratory-based outcomes were assigned according to international standards requiring at least five consecutive negative cultures in the last 12 months of treatment to confirm cure. Compared to the global culture-defined standard classification, only 1.1% of treatment successes, but 54.3% of failures, were misclassified programmatically. Overall, 10.4% of patients identified by a clinician as having a successful treatment outcome still had cultures positive for MDR-TB. Most patients with successful treatment outcomes by strict culture definitions were also classified by clinicians as having successful outcomes. However, many culture-confirmed failures were missed. In light of delays and incomplete access to culture in MDR-TB programs, efforts should be made to improve the accuracy of programmatically determined treatment outcomes.

  15. Surgical Face Masks Worn by Patients with Multidrug-Resistant Tuberculosis

    Science.gov (United States)

    Mphahlele, Matsie; Stoltz, Anton; Venter, Kobus; Mathebula, Rirhandzu; Masotla, Thabiso; Lubbe, Willem; Pagano, Marcello; First, Melvin; Jensen, Paul A.; van der Walt, Martie; Nardell, Edward A.

    2012-01-01

    Rationale: Drug-resistant tuberculosis transmission in hospitals threatens staff and patient health. Surgical face masks used by patients with tuberculosis (TB) are believed to reduce transmission but have not been rigorously tested. Objectives: We sought to quantify the efficacy of surgical face masks when worn by patients with multidrug-resistant TB (MDR-TB). Methods: Over 3 months, 17 patients with pulmonary MDR-TB occupied an MDR-TB ward in South Africa and wore face masks on alternate days. Ward air was exhausted to two identical chambers, each housing 90 pathogen-free guinea pigs that breathed ward air either when patients wore surgical face masks (intervention group) or when patients did not wear masks (control group). Efficacy was based on differences in guinea pig infections in each chamber. Measurements and Main Results: Sixty-nine of 90 control guinea pigs (76.6%; 95% confidence interval [CI], 68–85%) became infected, compared with 36 of 90 intervention guinea pigs (40%; 95% CI, 31–51%), representing a 56% (95% CI, 33–70.5%) decreased risk of TB transmission when patients used masks. Conclusions: Surgical face masks on patients with MDR-TB significantly reduced transmission and offer an adjunct measure for reducing TB transmission from infectious patients. PMID:22323300

  16. Topicality of the problem of combined course of multi-drug resistant pulmonary tuberculosis with diabetes mellitus

    Directory of Open Access Journals (Sweden)

    O. M. Raznatovska

    2017-08-01

    Full Text Available According to the World Health Organization, today in the world among the infectious chronic diseases one of the leading places and causes of death is multi-drug resistant tuberculosis of the lungs, and chronic non-communicable diseases – diabetes mellitus. The situation is complicated by the fact that the number of patients with combined course of these two heavy separate illnesses that complicate each other increases. It is established that with increasing severity of diabetes mellitus, tuberculosis process in the lungs becomes more complicate and deteriorates, and vice versa, the specific process complicates the course of diabetes mellitus, contributing to the development of diabetic complications. Against this background, the effectiveness of treatment of patients suffering from multi-drug resistant tuberculosis of the lungs in our country remains very low, mainly due to the toxic adverse reactions to antimycobacterial drugs of the reserve line, and in the case of adding diabetes mellitus, it deteriorates even more. The aim of this study was to review the scientific literature to determine the relevance of the study of combined course of multi-drug resistant tuberculosis of the lungs with diabetes mellitus and perspectives of innovative methods of diagnosis of diabetes mellitus. Early diagnosis of pre-diabetes, and autoimmune diseases will allow the use of timely correction techniques that prevents the development of diabetes mellitus, depending on its type, and in the future the development of serious irreversible processes, allow timely applying appropriate methods of correction of the revealed violations. Results. Very little amount of work is dedicated to the problem of combined course of multi-drug resistant tuberculosis of the lungs with diabetes mellitus, regardless of its type, the theme is relevant for today, in Ukraine there are no data regarding its study. This combined course of very difficult in the treatment diseases requires

  17. The value of microscopic-observation drug susceptibility assay in the diagnosis of tuberculosis and detection of multidrug resistance.

    Science.gov (United States)

    Sertel Şelale, Denİz; Uzun, Meltem

    2018-01-01

    Inexpensive, rapid, and reliable tests for detecting the presence and drug susceptibility of Mycobacterium tuberculosis complex (MTBC) are urgently needed to control the transmission of tuberculosis. In this study, we aimed to assess the accuracy and speed of the microscopic-observation drug susceptibility (MODS) assay in the identification of MTBC and detection of multidrug resistance. Sputum samples from patients suspected to have tuberculosis were simultaneously tested with MODS and conventional culture [Löwenstein-Jensen (LJ) culture, BACTEC MGIT™ 960 (MGIT) system], and drug susceptibility testing (MGIT system) methods. A total of 331 sputum samples were analyzed. Sensitivity and specificity of MODS assay for detection of MTBC strains were 96% and 98.8%, respectively. MODS assay detected multidrug resistant MTBC isolates with 92.3% sensitivity and 96.6% specificity. Median time to culture positivity was similar for MGIT (8 days) and MODS culture (8 days), but was significantly longer with LJ culture (20 days) (p tuberculosis and detection of multidrug resistance. © 2017 APMIS. Published by John Wiley & Sons Ltd.

  18. Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolated in Nepal.

    Science.gov (United States)

    Poudel, Ajay; Nakajima, Chie; Fukushima, Yukari; Suzuki, Haruka; Pandey, Basu Dev; Maharjan, Bhagwan; Suzuki, Yasuhiko

    2012-06-01

    Despite the fact that Nepal is one of the first countries globally to introduce multidrug-resistant tuberculosis (MDR-TB) case management, the number of MDR-TB cases is continuing to rise in Nepal. Rapid molecular tests applicable in this setting to identify resistant organisms would be an effective tool in reversing this trend. To develop such tools, information about the frequency and distribution of mutations that are associated with phenotypic drug resistance in Mycobacterium tuberculosis is required. In the present study, we investigated the prevalence of mutations in rpoB and katG genes and the inhA promoter region in 158 M. tuberculosis isolates (109 phenotypically MDR and 49 non-MDR isolates collected in Nepal) by DNA sequencing. Mutations affecting the 81-bp rifampin (RIF) resistance-determining region (RRDR) of rpoB were identified in 106 of 109 (97.3%) RIF-resistant isolates. Codons 531, 526, and 516 were the most commonly affected, at percentages of 58.7, 15.6, and 15.6%, respectively. Of 113 isoniazid (INH)-resistant isolates, 99 (87.6%) had mutations in the katG gene, with Ser315Thr being the most prevalent (81.4%) substitution. Mutations in the inhA promoter region were detected in 14 (12.4%) INH-resistant isolates. The results from this study provide an overview of the current situation of RIF and INH resistance in M. tuberculosis in Nepal and can serve as a basis for developing or improving rapid molecular tests to monitor drug-resistant strains in this country.

  19. Surgery as an Adjunctive Treatment for Multidrug-Resistant Tuberculosis: An Individual Patient Data Metaanalysis.

    Science.gov (United States)

    Fox, Gregory J; Mitnick, Carole D; Benedetti, Andrea; Chan, Edward D; Becerra, Mercedes; Chiang, Chen-Yuan; Keshavjee, Salmaan; Koh, Won-Jung; Shiraishi, Yuji; Viiklepp, Piret; Yim, Jae-Joon; Pasvol, Geoffrey; Robert, Jerome; Shim, Tae Sun; Shin, Sonya S; Menzies, Dick; Ahuja, S; Ashkin, D; Avendaño, M; Banerjee, R; Bauer, M; Burgos, M; Centis, R; Cobelens, F; Cox, H; D'Ambrosio, L; de Lange, W C M; DeRiemer, K; Enarson, D; Falzon, D; Flanagan, K; Flood, J; Gandhi, N; Garcia-Garcia, L; Granich, R M; Hollm-Delgado, M G; Holtz, T H; Hopewell, P; Iseman, M; Jarlsberg, L G; Kim, H R; Lancaster, J; Lange, C; Leimane, V; Leung, C C; Li, J; Menzies, D; Migliori, G B; Narita, M; Nathanson, E; Odendaal, R; O'Riordan, P; Pai, M; Palmero, D; Park, S K; Pena, J; Pérez-Guzmán, C; Ponce-de-Leon, A; Quelapio, M I D; Quy, H T; Riekstina, V; Royce, S; Salim, M; Schaaf, H S; Seung, K J; Shah, L; Shean, K; Sifuentes-Osornio, J; Sotgiu, G; Strand, M J; Sung, S W; Tabarsi, P; Tupasi, T E; Vargas, M H; van Altena, R; van der Walt, M; van der Werf, T S; Westenhouse, J; Yew, W W

    2016-04-01

    Medical treatment for multidrug-resistant (MDR)-tuberculosis is complex, toxic, and associated with poor outcomes. Surgical lung resection may be used as an adjunct to medical therapy, with the intent of reducing bacterial burden and improving cure rates. We conducted an individual patient data metaanalysis to evaluate the effectiveness of surgery as adjunctive therapy for MDR-tuberculosis. Individual patient data, was obtained from the authors of 26 cohort studies, identified from 3 systematic reviews of MDR-tuberculosis treatment. Data included the clinical characteristics and medical and surgical therapy of each patient. Primary analyses compared treatment success (cure and completion) to a combined outcome of failure, relapse, or death. The effects of all forms of resection surgery, pneumonectomy, and partial lung resection were evaluated. A total of 4238 patients from 18 surgical studies and 2193 patients from 8 nonsurgical studies were included. Pulmonary resection surgery was performed on 478 patients. Partial lung resection surgery was associated with improved treatment success (adjusted odds ratio [aOR], 3.0; 95% confidence interval [CI], 1.5-5.9; I(2)R, 11.8%), but pneumonectomy was not (aOR, 1.1; 95% CI, .6-2.3; I(2)R, 13.2%). Treatment success was more likely when surgery was performed after culture conversion than before conversion (aOR, 2.6; 95% CI, 0.9-7.1; I(2)R, 0.2%). Partial lung resection, but not pneumonectomy, was associated with improved treatment success among patients with MDR-tuberculosis. Although improved outcomes may reflect patient selection, partial lung resection surgery after culture conversion may improve treatment outcomes in patients who receive optimal medical therapy. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  20. Multidrug-resistant tuberculosis: Rapid molecular detection with MTBDRplus® assay in clinical samples

    Directory of Open Access Journals (Sweden)

    Rita Macedo

    2009-05-01

    Full Text Available Nowadays, the greatest concern of tuberculosis control programmes is the appearance of multidrug-resistant tuberculosis and extensively drug-resistant tuberculosis. Rapid determination of drug resistance in clinical samples, with Mycobacterium tuberculosis complex (MTC, is the prerequisite for initiating effective chemotherapy, ensuring successful treatment of the patient and preventing further spread of drugresistant isolates.The aim of our study was to determine the sensitivity of the new MTBDRplus® assay in comparison to culture, identification and classic DST, directly from smear-positive clinical specimens.A total of 68 smear-positive sputum specimens were processed by both the classical mycobacteriological methods and the molecular assay, MTBDRplus®.MTBDRplus® assay allowed an accurate identification of MTC species by detection of the specific band in all samples, from which we also isolated and identified MTC strains by culture methods. In the samples from which we isolated susceptible strains (63.2%, wild type patterns were found using MTBDRplus® assay. The samples from which we isolated resistant strains (36.8% showed specific mutations associated with the correspondent resistant phenotype.Our study indicated that this assay allows rapid detection of resistance, always in agreement with classic methods. Resumo: Uma das principais problematicas no controlo da tuberculose e o aparecimento de casos de tuberculose multirresistente (TB-MR e tuberculose extensivamente resistente (TB-XDR. A deteccao precoce da resistencia a farmacos, directamente a partir de amostras respiratorias, e essencial para que se assegure o tratamento atempado, adequado e eficaz da tuberculose, bem como para prevenir a disseminacao destes casos de especial gravidade.O nosso objectivo foi avaliar a sensibilidade e comparar os resultados obtidos com um metodo de genetica molecular disponivel comercialmente – MTBDRplus® – e o isolamento

  1. Animal experiment and clinical preliminary application of percutaneous 70% ethanol injection therapy in multi-drug resistant pulmonary tuberculosis

    International Nuclear Information System (INIS)

    Liu Fuquan; Yue Zhendong; Gao Shunyu; Li YanSheng; Wei Guobin; Guo Weiyi; Chen Xijun; Li Baoyu

    2004-01-01

    Objective: To evaluate the clinical value of percutaneous injection of 70% ethanol in the treatment of multidrug resistant pulmonary tuberculosis. Methods: Percutaneous and transcatheter absolute ethanol, 70% ethanol, and 60% meglucamine diatrizoate(or distilled water) injection into the lung (25 cases) and the bronchi (25 cases) of healthy rabbits were performed, respectively.All specimens were studied with pathology. On the base of animals experiment, thirty-five patients with multi-drug resistant pulmonary tuberculosis were treated with percutaneous 70% ethanol injection. Every patient was treated by the same way for 1-3 times. Results: Pathological findings of the specimens of pulmonary tissue showed nonspecific inflammation, necrosis, and fibrosis. The chief pathological changes with percutaneous or transcatheter 70% ethanol injection were slighter than those with absolute ethanol injection. Pathological findings of the specimens of bronchi showed slight mucosal edema, nonspecific inflammation, and focal cytonecrosis. Recovery of the damaged bronchial mucosa occurred within 14-30 days after the treatment. All patients with multi-drug resistant pulmonary tuberculosis were followed up for 6 to 33 months. The sputum bacterial conversion to negative rate was 100% within 6 months after the treatment. Cavity closing, shrinking, and no changing rate were 47.1% (16/34), 50.0% (17/34), and 2.9% (1/34), respectively. Radiographic improvement rate was 94.3 % (33/35). No severe complications and adverse reactions occurred. Conclusion: Percutaneous 70% ethanol injection is safe, effective, and easy to perform in the treatment of multi-drug resistant pulmonary tuberculosis. (authors)

  2. Applicability of the shorter ‘Bangladesh regimen’ in high multidrug-resistant tuberculosis settings

    Directory of Open Access Journals (Sweden)

    Giovanni Sotgiu

    2017-03-01

    Full Text Available In spite of the recent introduction of two new drugs (delamanid and bedaquiline and a few repurposed compounds to treat multidrug-resistant and extensively drug-resistant tuberculosis (MDR- and XDR-TB, clinicians are facing increasing problems in designing effective regimens in severe cases. Recently a 9 to 12-month regimen (known as the ‘Bangladesh regimen’ proved to be effective in treating MDR-TB cases. It included an initial phase of 4 to 6 months of kanamycin, moxifloxacin, prothionamide, clofazimine, pyrazinamide, high-dose isoniazid, and ethambutol, followed by 5 months of moxifloxacin, clofazimine, pyrazinamide, and ethambutol. However, recent evidence from Europe and Latin America identified prevalences of resistance to the first-line drugs in this regimen (ethambutol and pyrazinamide exceeding 60%, and of prothionamide exceeding 50%. Furthermore, the proportions of resistance to the two most important pillars of the regimen – quinolones and kanamycin – were higher than 40%. Overall, only 14 out of 348 adult patients (4.0% were susceptible to all of the drugs composing the regimen, and were therefore potentially suitable for the ‘shorter regimen’. A shorter, cheaper, and well-tolerated MDR-TB regimen is likely to impact the number of patients treated and improve adherence if prescribed to the right patients through the systematic use of rapid MTBDRsl testing.

  3. Multidrug-resistant tuberculosis treatment failure detection depends on monitoring interval and microbiological method

    Science.gov (United States)

    White, Richard A.; Lu, Chunling; Rodriguez, Carly A.; Bayona, Jaime; Becerra, Mercedes C.; Burgos, Marcos; Centis, Rosella; Cohen, Theodore; Cox, Helen; D'Ambrosio, Lia; Danilovitz, Manfred; Falzon, Dennis; Gelmanova, Irina Y.; Gler, Maria T.; Grinsdale, Jennifer A.; Holtz, Timothy H.; Keshavjee, Salmaan; Leimane, Vaira; Menzies, Dick; Milstein, Meredith B.; Mishustin, Sergey P.; Pagano, Marcello; Quelapio, Maria I.; Shean, Karen; Shin, Sonya S.; Tolman, Arielle W.; van der Walt, Martha L.; Van Deun, Armand; Viiklepp, Piret

    2016-01-01

    Debate persists about monitoring method (culture or smear) and interval (monthly or less frequently) during treatment for multidrug-resistant tuberculosis (MDR-TB). We analysed existing data and estimated the effect of monitoring strategies on timing of failure detection. We identified studies reporting microbiological response to MDR-TB treatment and solicited individual patient data from authors. Frailty survival models were used to estimate pooled relative risk of failure detection in the last 12 months of treatment; hazard of failure using monthly culture was the reference. Data were obtained for 5410 patients across 12 observational studies. During the last 12 months of treatment, failure detection occurred in a median of 3 months by monthly culture; failure detection was delayed by 2, 7, and 9 months relying on bimonthly culture, monthly smear and bimonthly smear, respectively. Risk (95% CI) of failure detection delay resulting from monthly smear relative to culture is 0.38 (0.34–0.42) for all patients and 0.33 (0.25–0.42) for HIV-co-infected patients. Failure detection is delayed by reducing the sensitivity and frequency of the monitoring method. Monthly monitoring of sputum cultures from patients receiving MDR-TB treatment is recommended. Expanded laboratory capacity is needed for high-quality culture, and for smear microscopy and rapid molecular tests. PMID:27587552

  4. Risk factors associated with multidrug-resistant tuberculosis in Espírito Santo, Brazil.

    Science.gov (United States)

    Fregona, Geisa; Cosme, Lorrayne Belique; Moreira, Cláudia Maria Marques; Bussular, José Luis; Dettoni, Valdério do Valle; Dalcolmo, Margareth Pretti; Zandonade, Eliana; Maciel, Ethel Leonor Noia

    2017-04-27

    To analyze the prevalence and factors associated with multidrug-resistant tuberculosis in Espírito Santo, Brazil. This is a cross-sectional study of cases of tuberculosis tested for first-line drugs (isoniazid, rifampicin, pyrazinamide, ethambutol, and streptomycin) in Espírito Santo between 2002 and 2012. We have used laboratory data and registration of cases of tuberculosis - from the Sistema Nacional de Agravos de Notificação and Sistema para Tratamentos Especiais de Tuberculose. Individuals have been classified as resistant and non-resistant and compared in relation to the sociodemographic, clinical, and epidemiological variables. Some variables have been included in a logistic regression model to establish the factors associated with resistance. In the study period, 1,669 individuals underwent anti-tuberculosis drug susceptibility testing. Of these individuals, 10.6% showed resistance to any anti-tuberculosis drug. The rate of multidrug resistance observed, that is, to rifampicin and isoniazid, has been 5%. After multiple analysis, we have identified as independent factors associated with resistant tuberculosis: history of previous treatment of tuberculosis [recurrence (OR = 7.72; 95%CI 4.24-14.05) and re-entry after abandonment (OR = 3.91; 95%CI 1.81-8.43)], smoking (OR = 3.93; 95%CI 1.98-7.79), and positive culture for Mycobacterium tuberculosis at the time of notification of the case (OR = 3.22; 95%CI 1.15-8.99). The partnership between tuberculosis control programs and health teams working in the network of Primary Health Care needs to be strengthened. This would allow the identification and monitoring of individuals with a history of previous treatment of tuberculosis and smoking. Moreover, the expansion of the offer of the culture of tuberculosis and anti-tuberculosis drug susceptibility testing would provide greater diagnostic capacity for the resistant types in Espírito Santo. Analisar a prevalência e fatores associados à tuberculose resistente

  5. Type 2 diabetes mellitus and its influence in the development of multidrug resistance tuberculosis in patients from southeastern Mexico.

    Science.gov (United States)

    Pérez-Navarro, Lucia Monserrat; Fuentes-Domínguez, Francisco Javier; Zenteno-Cuevas, Roberto

    2015-01-01

    To determine the factors associated with the presence of pulmonary tuberculosis in patients with type 2 diabetes mellitus and the effect in the development of drug and multi-drug resistance, in a population with tuberculosis from the southeast of Mexico. This is a case-control study including 409 individuals, 146 with the binomial tuberculosis-type 2 diabetes mellitus and 263 individuals with tuberculosis. Demographic, epidemiological and outcome variables were collected. Risks were calculated. The factors associated with the presence of type 2 diabetes mellitus were age ≥35years, (OR=9.7; CI: 5.2-17.8), previous contact with a person infected with tuberculosis (OR=1.7; CI: 1.1-3.1). Body mass index ≥25 kg/m(2) (OR=2.2; CI: 1.1-4.3), and inherited family history of diabetes (OR=5.4; CI: 3.2-9.2). It was also found that patients with tuberculosis-type 2 diabetes mellitus presented a 4.7-fold (CI: 1.4-11.3) and 3.5-fold (CI: 1.1-11.1) higher risk of developing drug- and multidrug resistance tuberculosis, respectively. By last, individuals with tuberculosis-type 2 diabetes had a 2.3-fold (CI: 1.5-4.1) greater chance of persisting as tuberculosis-positive by the second month of treatment, delaying the resolution of the tuberculosis infection. Type 2 diabetes exerts a strong influence on the presentation and evolution of tuberculosis within the analyzed population and displays remarkable particularities, necessitating the development of dedicated tuberculosis-diabetes surveillance systems that consider the particular epidemiological characteristics of the population affected. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Association between HIV/AIDS and multi-drug resistance tuberculosis: a systematic review and meta-analysis.

    Directory of Open Access Journals (Sweden)

    Yonatan Moges Mesfin

    Full Text Available BACKGROUND: Human immunodeficiency virus (HIV, multi-drug resistant tuberculosis (MDR is emerging as major challenge facing tuberculosis control programs worldwide particularly in Asia and Africa. Findings from different studies on associations of HIV co-infection and drug resistance among patients with TB have been contradictory (discordant. Some institution based studies found strongly increased risks for multi-drug resistant TB (MDR TB among patients co-infected with TB and HIV, whereas other studies found no increased risk (it remains less clear in community based studies. The aim was to conduct a systematic review and meta-analysis of the association between multi-drug resistant tuberculosis and HIV infection. METHODS AND FINDINGS: Systematic review of the published literature of observational studies was conducted. Original studies were identified using databases of Medline/Pubmed, Google Scholar and HINARI. The descriptions of original studies were made using frequency and forest plot. Publication bias was assessed using Funnel plot graphically and Egger weighted and Begg rank regression tests statistically. Heterogeneity across studies was checked using Cochrane Q test statistic and I(2. Pool risk estimates of MDR-TB and sub-grouping analysis were computed to analyze associations with HIV. Random effects of the meta-analysis of all 24 observational studies showed that HIV is associated with a marginal increased risk of multi-drug resistant tuberculosis (estimated Pooled OR 1.24; 95%, 1.04-1.43. Subgroup analyses showed that effect estimates were higher (Pooled OR 2.28; 95%, 1.52-3.04 for primary multi-drug resistance tuberculosis and moderate association between HIV/AIDS and MDR-TB among population based studies and no significant association in institution settings. CONCLUSIONS: This study demonstrated that there is association between MDR-TB and HIV. Capacity for diagnosis of MDR-TB and initiating and scale up of antiretroviral

  7. Knowledge and Attitude about Multidrug-Resistant Tuberculosis among Healthcare Workers in Public Health Centres

    Directory of Open Access Journals (Sweden)

    Bony Wiem Lestari

    2016-12-01

    Full Text Available Background: Multidrug-resistant Tuberculosis (MDR-TB is a significant public health problem and poses a threat to global tuberculosis (TB control. In 2015, at least 504 new MDR-TB cases were identified in Indonesia. Treating MDR-TB patients is very challenging. It may take more than two years for MDR-TB treatment. Therefore, it is crucial healthcare workers (HCWs are knowledgeable about MDR-TB. The aim of this study was to measure level of knowledge and attitude regarding MDR-TB among HCWs in public health centres. Methods: A cross-sectional study was conducted at 73 Public Health Centres in Bandung the capital of West Java Province from August until November 2015. The samples were 73 TB nurses and 32 laboratory staff. A self-administered questionnaire was given comprising 27 knowledge questions and 29 attitude questions. Correlation between knowledge and attitude scores was calculated by Pearson correlation test. Results: The majority of study participants were women (82.9%, married (92.4%, nursing staff (65.7% with history of TB training (98.1%. Most of the participants were 40-59 years old (69.5% with working experience in TB programme < 10 years (69.5%. Less than half (38.1% of study participants had good knowledge. In terms of attitude, more than half (53.3% of study participants had a positive attitude towards MDR-TB. Conclusions: The level of knowledge among HCWs about MDR-TB is still at an unacceptable level. Certain educational interventions aim to ensure prompt diagnosis, implement infection control and accurate treatment should be established among those HCWs.

  8. Multidrug resistant tuberculosis versus non-tuberculous mycobacterial infections: a CT-scan challenge

    International Nuclear Information System (INIS)

    Kahkouee, Shahram; Esmi, Elham; Moghadam, Azadeh; Karam, Mehrdad Bakhshayesh; Mosadegh, Leila; Salek, Solmaz; Tabarsi, Payam

    2013-01-01

    Introduction: clinical, laboratory and imaging findings in patients with multidrug resistant tuberculosis (MDR-TB) and non-tuberculosis mycobacterium (NTM) are similar, and the majority of these patients present with positive smear for Acid Fast Bacilli (ADB) and no response to first line anti-TB treatment, so sputum culture and PCR are necessary, especially in NTM. Objective: In this study we evaluate more details of imaging findings to help earlier diagnosis of pathogens. Materials and methods: 66 patients with positive smear for AFB and no response to first line anti-TB drugs were divided into two groups by PCR and culture: MDR-TB (43 patients) and NTM (23 patients). Age, sex, history of anti-TB treatment, smoking and CT-scan findings (parenchymal, pleural and mediastinal variables) by details and lobar distribution were analyzed. Results: mean age of NTM patients was slightly higher (52 versus 45) and there is no significant difference in sex and smoking. In MDR-TB group, history of anti-TB treatment and evidence of chronic pulmonary disease such as calcified and fibrodestructed parenchyma, volume loss and pleural thickening were higher significantly. Cavities in MDR-TB were thick wall in the background of consolidation, while NTM cavities were more thin-walled with adjacent satellite nodules in same segment or lobe. Prevalence of bronchiectasis was similar in both groups, while bronchiectasis in MDR-TB group was in fibrobronchiectatic background in upper lobes, and in NTM group the distribution was more uniform with slightly middle lobes predominance. Prevalence and distribution of nodular infiltrations were similar more in Tree in Buds and scattered pattern. Calcified or non-calcified lymph nodes and also pleural changes were more frequent in MDR-TB but prevalence of lymphadenopathy was mildly higher in NTM. (author)

  9. Psychiatric disorders in patients with multidrug resistant tuberculosis (MDR-TB in Sardjito Hospital, Yogyakarta, Indonesia

    Directory of Open Access Journals (Sweden)

    Irwan Supriyanto

    2017-08-01

    Full Text Available Introduction: Tuberculosis has become a chronic debilitating disease in developing countries, particularly after the emergence of multidrug resistant tuberculosis (MDR-TB. Second line treatments for the disease which were subsequently developed were associated with psychiatric disorders among patients. Psychiatric disorder can either be induced by treatment regiments or psychosocial factors. Cycloserine administration is frequently reported to be associated with psychiatric disorders. In this study, we examined the prevalence and characteristics of psychiatric disorders among MDR-TB patients in Sardjito Hospital, Yogyakarta, Indonesia. Methods: In this descriptive study, we studied medical records of MDR-TB patients admitted for MDR-TB treatments to Sardjito Hospital from January 2014 to July 2016 and screened for psychiatric disorders. Results: We found that 32.8% of the patients had psychiatric disorders, some of which had multiple psychiatric diagnoses (14.1%. The diagnoses were medication induced delirium, substance/medication induced psychotic disorder, substance/medication use depressive disorder, depressive type schizoaffective disorder, bipolar I disorder current episode severe manic with psychotic features, mild depression, moderate depression, major depression without psychotic features, major depression with psychotic features, adjustment disorders with mixed anxiety and depressed mood, adjustment disorder with anxiety, acute stress disorder, and insomnia. Psychiatric disorders were significantly associated with cycloserine dose and sex. Psychotic symptoms were significantly associated with sex and level of education. Conclusion: The presence of psychiatric disorders might disturb MDR-TB treatment resulting in poor outcomes. Precaution and prompt managements are required for psychiatric disorders in patients receiving MDR-TB treatment regiments.

  10. Treatment outcomes of rifabutin-containing regimens for rifabutin-sensitive multidrug-resistant pulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    Hyun Lee

    2017-12-01

    Full Text Available Objectives: The aim of this study was to evaluate whether rifabutin can improve treatment outcomes in patients with rifabutin-sensitive MDR-TB. Methods: A retrospective cohort study was performed on 76 patients with rifabutin-sensitive MDR-TB who were treated with or without rifabutin between 2006 and 2011. Results: Overall, 75% (57/76 of patients achieved favorable outcomes, including cure (53/76, 70% and treatment completion (4/76, 5%. In contrast, 25% (19/76 had unfavorable treatment outcomes, which included treatment failure (6/76, 8%, death (2/76, 3%, loss to follow-up (4/76. 5%, and no evaluation due to transfer to other institutions (7/76, 9%. Rifabutin was given to 52 (68% of the 76 patients with rifabutin-sensitive MDR-TB. Although favorable treatment outcomes were more frequent in patients who received rifabutin [81% (42/52] than in those who did not receive rifabutin [63% (15/24], this difference was not statistically significant (P = 0.154. However, in multivariable regression logistic analysis, use of rifabutin was significantly associated with favorable treatment outcomes in patients with rifabutin-sensitive MDR-TB (adjusted odds ratio = 9.80, 95% confidence interval = 1.65–58.37, P = 0.012. Conclusions: These results suggest that the use of rifabutin can improve treatment outcomes in patients with rifabutin-sensitive MDR-TB. Keywords: Multidrug-resistant tuberculosis, Extensively drug-resistant tuberculosis, Rifabutin, Treatment outcome

  11. Multidrug resistant tuberculosis versus non-tuberculous mycobacterial infections: a CT-scan challenge

    Energy Technology Data Exchange (ETDEWEB)

    Kahkouee, Shahram; Esmi, Elham; Moghadam, Azadeh; Karam, Mehrdad Bakhshayesh; Mosadegh, Leila; Salek, Solmaz; Tabarsi, Payam, E-mail: bestlala@yahoo.com [Chronic Respiratory Disease Research Center, NRITLD, Masih Daneshvari Hospital, Shahid Beheshti University of Medical Science, Tehran (Iran, Islamic Republic of)

    2013-03-15

    Introduction: clinical, laboratory and imaging findings in patients with multidrug resistant tuberculosis (MDR-TB) and non-tuberculosis mycobacterium (NTM) are similar, and the majority of these patients present with positive smear for Acid Fast Bacilli (ADB) and no response to first line anti-TB treatment, so sputum culture and PCR are necessary, especially in NTM. Objective: In this study we evaluate more details of imaging findings to help earlier diagnosis of pathogens. Materials and methods: 66 patients with positive smear for AFB and no response to first line anti-TB drugs were divided into two groups by PCR and culture: MDR-TB (43 patients) and NTM (23 patients). Age, sex, history of anti-TB treatment, smoking and CT-scan findings (parenchymal, pleural and mediastinal variables) by details and lobar distribution were analyzed. Results: mean age of NTM patients was slightly higher (52 versus 45) and there is no significant difference in sex and smoking. In MDR-TB group, history of anti-TB treatment and evidence of chronic pulmonary disease such as calcified and fibrodestructed parenchyma, volume loss and pleural thickening were higher significantly. Cavities in MDR-TB were thick wall in the background of consolidation, while NTM cavities were more thin-walled with adjacent satellite nodules in same segment or lobe. Prevalence of bronchiectasis was similar in both groups, while bronchiectasis in MDR-TB group was in fibrobronchiectatic background in upper lobes, and in NTM group the distribution was more uniform with slightly middle lobes predominance. Prevalence and distribution of nodular infiltrations were similar more in Tree in Buds and scattered pattern. Calcified or non-calcified lymph nodes and also pleural changes were more frequent in MDR-TB but prevalence of lymphadenopathy was mildly higher in NTM. (author)

  12. Sensitivity Pattern of Second Line Anti-Tuberculosis Drugs against Clinical Isolates of Multidrug Resistant Mycobacterium Tuberculosis

    International Nuclear Information System (INIS)

    Ghafoor, T.; Ikram, A.; Abbasi, S. A.; Zaman, G.; Ayyub, M.; Palomino, J. C.; Vandamme, P.; Martin, A.

    2015-01-01

    Objective:To determine the current sensitivity pattern of second line anti-tuberculosis drugs against clinical isolates of Multidrug Resistant Mycobacterium tuberculosis (MDR-TB). Study Design: A cross-sectional study. Place and Duration of Study: Department of Microbiology, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from November 2011 to April 2013. Methodology: Samples received during the study period were processed on BACTEC MGIT 960 system for Mycobacterium tuberculosis (MTB) culture followed by first line drugs susceptibility testing of culture proven MTB isolates. On the basis of resistance to rifampicin and isoniazid, 100 clinical isolates of MDR-TB were further subjected to susceptibility testing against amikacin (AMK), capreomycin (CAP), ofloxacin (OFL) and ethionamide (ETH) as per standard BACTEC MGIT 960 instructions. Results: Out of 100 MDR-TB isolates, 62% were from male patients and 38% from female patients. 97% were sensitive to AMK, 53% to OFL, 87% to CAP; and 87% were sensitive to ETH. Conclusion: The majority of the MDR-TB isolates showed excellent sensitivity against AMK, CAP and ETH. However, sensitivity of MDR-TB isolates against fluoroquinolones like OFL was not encouraging. (author)

  13. Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco

    Directory of Open Access Journals (Sweden)

    Zakham F

    2013-11-01

    Full Text Available Fathiah Zakham,1,4 Imane Chaoui,1 Amina Hadbae Echchaoui,2 Fouad Chetioui,3 My Driss Elmessaoudi,3 My Mustapha Ennaji,4 Mohammed Abid,2 Mohammed El Mzibri11Unité de Biologie et Recherché Médicale, Centre National de l'Energie, des Sciences et des Techniques Nucléaires (CNESTEN, Rabat, 2Laboratoire de Génétique Mycobacterienne, Institut Pasteur, Tangier, 3Laboratoire de Tuberculose Institut Pasteur, Casablanca, 4Laboratoire de Microbiologie, Hygiène et Virologie, Faculté des Sciences et Techniques, Mohammedia, MoroccoBackground: Tuberculosis (TB is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR and extensively drug resistant (XDR TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid.Methods: For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing.Results: Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%. Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a

  14. Multidrug-resistant tuberculosis: The problem and some priorities in controlling it

    Directory of Open Access Journals (Sweden)

    Sven Hoffner

    2016-01-01

    Full Text Available Multidrug-resistant tuberculosis (MDR-TB, and even more severe forms of drug resistance, cause significant problems and costs for national TB control programs and constitutes an increasing public health concern globally. In parts of the former Soviet Union, the prevalence of MDR-TB is as high as 50% and one third of all newly detected TB patients are infected with MDR strains. Such strains transmit and certain MDR-TB clones constitute an important part of the problem, especially in high MDR-TB burden areas. There are several actions that should be given priority to control this situation. A first important step is timely detection of all patients infected with resistant strains, which makes possible prompt change of standard TB chemotherapy to more effective combinations of drugs. This is important both from the public health and clinical perspectives, since it renders the individual patient noninfectious and subsequently cured. Early detection of MDR-TB also allows infection control to be focused where it is most needed. Strengthened infection control measures are crucial for limiting the ongoing spread of resistant TB in hospitals and elsewhere. In addition, a sustainable drug supply must be ensured to guarantee that all patients are initiated on effective treatment and can avoid interruptions due to drug shortages. An extra focus should be put on vulnerable cases, such as immunosuppressed individuals, prisoners, drug addicts, and migrants, in whom TB is generally more frequent and difficult to control than in the normal population. Finally, political support is needed to ensure necessary infrastructures, human and financial resources to effectively control drug resistant TB.

  15. Multidrug-resistant tuberculosis: The problem and some priorities in controlling it.

    Science.gov (United States)

    Hoffner, Sven

    2016-12-01

    Multidrug-resistant tuberculosis (MDR-TB), and even more severe forms of drug resistance, cause significant problems and costs for national TB control programs and constitutes an increasing public health concern globally. In parts of the former Soviet Union, the prevalence of MDR-TB is as high as 50% and one third of all newly detected TB patients are infected with MDR strains. Such strains transmit and certain MDR-TB clones constitute an important part of the problem, especially in high MDR-TB burden areas. There are several actions that should be given priority to control this situation. A first important step is timely detection of all patients infected with resistant strains, which makes possible prompt change of standard TB chemotherapy to more effective combinations of drugs. This is important both from the public health and clinical perspectives, since it renders the individual patient noninfectious and subsequently cured. Early detection of MDR-TB also allows infection control to be focused where it is most needed. Strengthened infection control measures are crucial for limiting the ongoing spread of resistant TB in hospitals and elsewhere. In addition, a sustainable drug supply must be ensured to guarantee that all patients are initiated on effective treatment and can avoid interruptions due to drug shortages. An extra focus should be put on vulnerable cases, such as immunosuppressed individuals, prisoners, drug addicts, and migrants, in whom TB is generally more frequent and difficult to control than in the normal population. Finally, political support is needed to ensure necessary infrastructures, human and financial resources to effectively control drug resistant TB. Copyright © 2016.

  16. Possible impact of the standardized Category IV regimen on multidrug-resistant tuberculosis patients in Mumbai.

    Science.gov (United States)

    Udwadia, Zarir F; Mullerpattan, Jai Bharat; Shah, Kushal D; Rodrigues, Camilla S

    2016-01-01

    Treatment of multidrug-resistant tuberculosis (MDR-TB) in the Programmatic Management of Drug-resistant TB program involves a standard regimen with a 6-month intensive phase and an 18-month continuation phase. However, the local drug resistance patterns in high MDR regions such as Mumbai may not be adequately reflected in the design of the regimen for that particular area. The study was carried out at a private Tertiary Level Hospital in Mumbai in a mycobacteriology laboratory equipped to perform the second-line drug susceptibility testing (DST). We attempted to analyze the impact of prescribing the standardized Category IV regimen to all patients receiving a DST at our mycobacteriology laboratory. All samples confirmed to be MDR-TB and tested for the second-line drugs at Hinduja Hospital's Mycobacteriology Laboratory in the year 2012 were analyzed. A total of 1539 samples were analyzed. Of these, 464 (30.14%) were MDR-TB, 867 (56.33%) were MDR with fluoroquinolone resistance, and 198 (12.8%) were extensively drug-resistant TB. The average number of susceptible drugs per sample was 3.07 ± 1.29 (assuming 100% cycloserine susceptibility). Taking 4 effective drugs to be the cut or an effective regimen, the number of patients receiving 4 or more effective drugs from the standardized directly observed treatment, short-course plus regimen would be 516 (33.5%) while 66.5% of cases would receive 3 or less effective drugs. Our study shows that a high proportion of patients will have resistance to a number of the first- and second-line drugs. Local epidemiology must be factored in to avoid amplification of resistance.

  17. Risk factors and mortality associated with default from multidrug-resistant tuberculosis treatment.

    Science.gov (United States)

    Franke, Molly F; Appleton, Sasha C; Bayona, Jaime; Arteaga, Fernando; Palacios, Eda; Llaro, Karim; Shin, Sonya S; Becerra, Mercedes C; Murray, Megan B; Mitnick, Carole D

    2008-06-15

    Completing treatment for multidrug-resistant (MDR) tuberculosis (TB) may be more challenging than completing first-line TB therapy, especially in resource-poor settings. The objectives of this study were to (1) identify risk factors for default from MDR TB therapy (defined as prolonged treatment interruption), (2) quantify mortality among patients who default from treatment, and (3) identify risk factors for death after default from treatment. We performed a retrospective chart review to identify risk factors for default from MDR TB therapy and conducted home visits to assess mortality among patients who defaulted from such therapy. Sixty-seven (10.0%) of 671 patients defaulted from MDR TB therapy. The median time to treatment default was 438 days (interquartile range, 152-710 days), and 27 (40.3%) of the 67 patients who defaulted from treatment had culture-positive sputum at the time of default. Substance use (hazard ratio, 2.96; 95% confidence interval, 1.56-5.62; P = .001), substandard housing conditions (hazard ratio, 1.83; 95% confidence interval, 1.07-3.11; P = .03), later year of enrollment (hazard ratio, 1.62, 95% confidence interval, 1.09-2.41; P = .02), and health district (P = .02) predicted default from therapy in a multivariable analysis. Severe adverse events did not predict default from therapy. Forty-seven (70.1%) of 67 patients who defaulted from therapy were successfully traced; of these, 25 (53.2%) had died. Poor bacteriologic response, default, low education level, and diagnosis with a psychiatric disorder significantly predicted death after default in a multivariable analysis. The proportion of patients who defaulted from MDR TB treatment was relatively low. The large proportion of patients who had culture-positive sputum at the time of treatment default underscores the public health importance of minimizing treatment default. Prognosis for patients who defaulted from therapy was poor. Interventions aimed at preventing treatment default may

  18. Impact of diabetes on treatment outcomes and long-term survival in multidrug-resistant tuberculosis.

    Science.gov (United States)

    Kang, Young Ae; Kim, Song Yee; Jo, Kyung-Wook; Kim, Hee Jin; Park, Seung-Kyu; Kim, Tae-Hyung; Kim, Eun Kyung; Lee, Ki Man; Lee, Sung Soon; Park, Jae Seuk; Koh, Won-Jung; Kim, Dae Yun; Shim, Tae Sun

    2013-01-01

    Few studies have investigated the impact of diabetes mellitus (DM), a globally increasing metabolic disease, on treatment outcomes and long-term survival in patients with multidrug-resistant forms of tuberculosis (MDR-TB). We analyzed outcomes in a large cohort to assess the impact of DM on treatment outcomes of patients with MDR-TB. MDR-TB patients newly diagnosed or retreated between 2000 and 2002 and followed for 8-11 years were retrospectively analyzed with respect to the effect of DM as a comorbidity on their treatment outcome and long-term survival. Of 1,407 patients with MDR-TB, 239 (17.0%) had coexisting DM. The mean age and body mass index were higher in MDR-TB patients with DM [MDR-TBDM(+)] than in those without DM [MDR-TBDM(-)]. Patients with MDR-TB and a comorbidity of DM had a significantly lower treatment success rate than those without a history of DM (36.0 vs. 47.2%, p = 0.002). In addition, DM was the negative predictor for MDR-TB treatment success in multivariate analyses [odds ratio 0.51, 95% confidence interval (CI) 0.26-0.99]. Mean survival times were also lower in MDR-TBDM(+) than in MDR-TBDM(-) patients (102 vs. 114 months, p = 0.001), with DM as a significant predictor of poor long-term survival in multivariate analyses (hazard ratio 1.59, 95% CI 1.01-2.50). Among MDR-TB patients, DM was a relatively common comorbidity. In patients undergoing treatment for MDR-TB and followed for 8-11 years, it was found to be independently associated with an increased risk of both treatment failure and death. Copyright © 2013 S. Karger AG, Basel.

  19. Effectiveness of a novel cellular therapy to treat multidrug-resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    Aliaksandr Skrahin

    2016-08-01

    Full Text Available Introduction: We urgently need novel treatments for multidrug-resistant tuberculosis (MDR-TB. Autologous mesenchymal stromal cell (MSC infusion is one such possibility due to its potential to repair damaged lung tissue and boost immune responses. We aimed to assess the effectiveness of MSC to improve outcomes among MDR-TB patients. Methods: We analyzed outcomes for 108 Belarussian MDR-TB patients receiving chemotherapy. Thirty-six patients (“cases” also had MSCs extracted, cultured and re-infused (average time from chemotherapy start to infusion was 49 days; another 36 patients were “study controls”. We identified another control group: 36 patients from the Belarussian surveillance database (“surveillance controls” 1:1 matched to cases. Results: Of the cases, 81% had successful outcomes versus 42% of surveillance controls and 39% of study controls. Successful outcome odds were 6.5 (95% Confidence Interval: 1.2–36.2, p=0.032 times greater for cases than surveillance controls (age-adjusted. Radiological improvement was more likely in cases than study controls. Culture analysis prior to infusion demonstrated a poorer initial prognosis in cases, yet despite this they had better outcomes than the control groups. Conclusion: MSC treatment could vastly improve outcomes for MDR-TB patients. Our findings could revolutionize therapy options and have strong implications for future directions of MDR-TB therapy research. Keywords: Mesenchymal stromal cells, Extensively drug resistant, Outcomes, Treatment

  20. Chronic airflow obstruction after successful treatment of multidrug-resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    Anthony L. Byrne

    2017-07-01

    Full Text Available Cross-sectional studies reveal an association between tuberculosis (TB and chronic airflow obstruction, but cannot adequately address confounding. We hypothesised that treated pulmonary TB is an independent risk factor for chronic airflow obstruction. The Pulmones Post TB cohort study enrolled participants from Lima, Peru, aged 10–70 years with a history of drug-susceptible (DS- or multidrug-resistant (MDR-TB who had completed treatment and were clinically cured. Unexposed participants without TB were randomly selected from the same districts. We assessed respiratory symptoms, relevant environmental exposures, and spirometric lung function pre- and post-bronchodilator. In total, 144 participants with DS-TB, 33 with MDR-TB and 161 unexposed participants were fully evaluated. Compared with unexposed participants, MDR-TB patients had lower lung volumes (adjusted mean difference in forced vital capacity −370 mL, 95% CI −644– −97 and post-bronchodilator airflow obstruction (adjusted OR 4.89, 95% CI 1.27–18.78. Participants who had recovered from DS-TB did not have lower lung volumes than unexposed participants, but were more likely to have a reduced forced expiratory volume in 1 s/forced vital capacity ratio <0.70 (adjusted OR 2.47, 95% CI 1.01–6.03. Individuals successfully treated for TB may experience long-lasting sequelae. Interventions facilitating earlier TB treatment and management of chronic respiratory disease should be explored.

  1. Molecular approaches for detection of the multi-drug resistant tuberculosis (MDR-TB in Bangladesh.

    Directory of Open Access Journals (Sweden)

    Tafsina Haque Aurin

    Full Text Available The principal obstacles in the treatment of tuberculosis (TB are delayed and inaccurate diagnosis which often leads to the onset of the drug resistant TB cases. To avail the appropriate treatment of the patients and to hinder the transmission of drug-resistant TB, accurate and rapid detection of resistant isolates is critical. Present study was designed to demonstrate the efficacy of molecular techniques inclusive of line probe assay (LPA and GeneXpert MTB/RIF methods for the detection of multi-drug resistant (MDR TB. Sputum samples from 300 different categories of treated and new TB cases were tested for the detection of possible mutation in the resistance specific genes (rpoB, inhA and katG through Genotype MTBDRplus assay or LPA and GeneXpert MTB/RIF tests. Culture based conventional drug susceptibility test (DST was also carried out to measure the efficacy of the molecular methods employed. Among 300 samples, 191 (63.7% and 193 (64.3% cases were found to be resistant against rifampicin in LPA and GeneXpert methods, respectively; while 189 (63% cases of rifampicin resistance were detected by conventional DST methods. On the other hand, 196 (65.3% and 191 (63.7% isolates showed isoniazid resistance as detected by LPA and conventional drug susceptibility test (DST, respectively. Among the drug resistant isolates (collectively 198 in LPA and 193 in conventional DST, 189 (95.6% and 187 (96.9% were considered to be MDR as examined by LPA and conventional DST, respectively. Category-II and -IV patients encountered higher frequency of drug resistance compared to those from category-I and new cases. Considering the higher sensitivity, specificity and accuracy along with the required time to results significantly shorter, our study supports the adoption of LPA and GeneXpert assay as efficient tools in detecting drug resistant TB in Bangladesh.

  2. Diabetes is Associated with Severe Adverse Events in Multidrug-Resistant Tuberculosis.

    Science.gov (United States)

    Muñoz-Torrico, Marcela; Caminero-Luna, José; Migliori, Giovanni Battista; D'Ambrosio, Lia; Carrillo-Alduenda, José Luis; Villareal-Velarde, Héctor; Torres-Cruz, Alfredo; Flores-Vergara, Héctor; Martínez-Mendoza, Dina; García-Sancho, Cecilia; Centis, Rosella; Salazar-Lezama, Miguel Ángel; Pérez-Padilla, Rogelio

    2017-05-01

    Diabetes mellitus (DM), a very common disease in Mexico, is a well-known risk factor for tuberculosis (TB). However, it is not known by which extent DM predisposes to adverse events (AE) to anti-TB drugs and/or to worse outcomes in patients with multidrug-resistant (MDR-TB) and extensively drug-resistant TB (XDR-TB). The main objective of this study was to describe the outcomes of TB treatment, the impact of DM and the prevalence of AE in a cohort of patients with MDR-/XDR pulmonary TB treated at the national TB referral centre in Mexico City. Ninety patients were enrolled between 2010 and 2015: 73 with MDR-TB (81.1%), 11 with pre-XDR-TB (12.2%) and 6 (6.7%) with XDR-TB, including 49 (54.4%) with DM, and 3 with Human Immunodeficiency Virus (HIV) co-infection (3.3%). In 98% of patients, diagnosis was made by culture and drug susceptibility testing, while in a single case the diagnosis was made by a molecular test. The presence of DM was associated with an increased risk of serious drug-related AEs, such as nephrotoxicity (Odds Ratio [OR]=6.5; 95% Confidence Interval [95% CI]: 1.9-21.8) and hypothyroidism (OR=8.8; 95% CI: 1.8-54.2), but not for a worse outcome. Our data suggest that DM does not impact second-line TB treatment outcomes, but patients with DM have a higher risk of developing serious AEs to drug-resistant TB treatment, such as nephrotoxicity and hypothyroidism. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

  3. The making of a public health problem: multi-drug resistant tuberculosis in India.

    Science.gov (United States)

    Engel, Nora C

    2013-07-01

    This paper examines how actors construct the public problem of multi-drug resistant tuberculosis (MDR-TB) in India. MDR-TB has been framed by the World Health Organization as a pressing, global public health problem. The responses to MDR-TB are complicated as treatment takes longer and is more expensive than routine TB treatment. This is particularly problematic in countries, such as India, with high patient loads, a large and unregulated private sector, weak health systems and potentially high numbers of MDR-TB cases. This paper analyses how actors struggle for control over ownership, causal theories and political responsibility of the public problem of MDR-TB in India. It combines Gusfield's theory on the construction of public problems with insights from literature on the social construction of diseases and on medical social control. It highlights that there are flexible definitions of public problems, which are negotiated among actor groups and which shift over time. The Indian government has shifted its policy in recent years and acknowledged that MDR-TB needs to be dealt with within the TB programme. The study results reveal how the policy shift happened, why debates on the construction of MDR-TB as a public problem in India continue, and why actors with alternative theories than the government do not succeed in their lobbying efforts. Two main arguments are put forward. First, the construction of the public problem of MDR-TB in India is a social and political process. The need for representative data, international influence and politics define what is controllable. Second, the government seems to be anxious to control the definition of India's MDR-TB problem. This impedes an open, critical and transparent discussion on the definition of the public problem of MDR-TB, which is important in responding flexibly to emerging public health challenges.

  4. Aggressive regimens for multidrug-resistant tuberculosis decrease all-cause mortality.

    Directory of Open Access Journals (Sweden)

    Carole D Mitnick

    Full Text Available A better understanding of the composition of optimal treatment regimens for multidrug-resistant tuberculosis (MDR-TB is essential for expanding universal access to effective treatment and for developing new therapies for MDR-TB. Analysis of observational data may inform the definition of an optimized regimen.This study assessed the impact of an aggressive regimen-one containing at least five likely effective drugs, including a fluoroquinolone and injectable-on treatment outcomes in a large MDR-TB patient cohort.This was a retrospective cohort study of patients treated in a national outpatient program in Peru between 1999 and 2002. We examined the association between receiving an aggressive regimen and the rate of death.In total, 669 patients were treated with individualized regimens for laboratory-confirmed MDR-TB. Isolates were resistant to a mean of 5.4 (SD 1.7 drugs. Cure or completion was achieved in 66.1% (442 of patients; death occurred in 20.8% (139. Patients who received an aggressive regimen were less likely to die (crude hazard ratio [HR]: 0.62; 95% CI: 0.44,0.89, compared to those who did not receive such a regimen. This association held in analyses adjusted for comorbidities and indicators of severity (adjusted HR: 0.63; 95% CI: 0.43,0.93.The aggressive regimen is a robust predictor of MDR-TB treatment outcome. TB policy makers and program directors should consider this standard as they design and implement regimens for patients with drug-resistant disease. Furthermore, the aggressive regimen should be considered the standard background regimen when designing randomized trials of treatment for drug-resistant TB.

  5. Feasibility, diagnostic accuracy, and effectiveness of decentralised use of the Xpert MTB/RIF test for diagnosis of tuberculosis and multidrug resistance: a multicentre implementation study

    NARCIS (Netherlands)

    Boehme, Catharina C.; Nicol, Mark P.; Nabeta, Pamela; Michael, Joy S.; Gotuzzo, Eduardo; Tahirli, Rasim; Gler, Ma Tarcela; Blakemore, Robert; Worodria, William; Gray, Christen; Huang, Laurence; Caceres, Tatiana; Mehdiyev, Rafail; Raymond, Lawrence; Whitelaw, Andrew; Sagadevan, Kalaiselvan; Alexander, Heather; Albert, Heidi; Cobelens, Frank; Cox, Helen; Alland, David; Perkins, Mark D.

    2011-01-01

    The Xpert MTB/RIF test (Cepheid, Sunnyvale, CA, USA) can detect tuberculosis and its multidrug-resistant form with very high sensitivity and specificity in controlled studies, but no performance data exist from district and subdistrict health facilities in tuberculosis-endemic countries. We aimed to

  6. A cluster of multidrug-resistant Mycobacterium tuberculosis among patients arriving in Europe from the Horn of Africa: a molecular epidemiological study

    NARCIS (Netherlands)

    Walker, T.M.; Merker, M.; Knoblauch, A.M.; Helbling, P.; Schoch, O.D.; Werf, M.J. van der; Kranzer, K.; Fiebig, L.; Kroger, S.; Haas, W.; Hoffmann, H.; Indra, A.; Egli, A.; Cirillo, D.M.; Robert, J.; Rogers, T.R.; Groenheit, R.; Mengshoel, A.T.; Mathys, V.; Haanpera, M.; Soolingen, D.V.; Niemann, S.; Bottger, E.C.; Keller, P.M.; Ingen, J. van; Wagner-Wiening, C.; Witschi, M.

    2018-01-01

    BACKGROUND: The risk of tuberculosis outbreaks among people fleeing hardship for refuge in Europe is heightened. We describe the cross-border European response to an outbreak of multidrug-resistant tuberculosis among patients from the Horn of Africa and Sudan. METHODS: On April 29 and May 30, 2016,

  7. Strong In Vitro Activities of Two New Rifabutin Analogs against Multidrug-Resistant Mycobacterium tuberculosis ▿ †

    Science.gov (United States)

    García, Ana-Belén; Palacios, Juan J.; Ruiz, María-Jesús; Barluenga, José; Aznar, Fernando; Cabal, María-Paz; García, José María; Díaz, Natalia

    2010-01-01

    Two new rifabutin analogs, RFA-1 and RFA-2, show high in vitro antimycobacterial activities against Mycobacterium tuberculosis. MIC values of RFA-1 and RFA-2 were ≤0.02 μg/ml against rifamycin-susceptible strains and 0.5 μg/ml against a wide selection of multidrug-resistant strains, compared to ≥50 μg/ml for rifampin and 10 μg/ml for rifabutin. Molecular dynamic studies indicate that the compounds may exert tighter binding to mutants of RNA polymerase that have adapted to the rifamycins. PMID:20855731

  8. Culture and drug sensitivity testing among patients with pulmonary tuberculosis in Mexico: national data for 2009-2013.

    Science.gov (United States)

    Orejel, Ivonne; Castellanos, Martin; Marín, Diana; Mendoza, Alberto; Harries, Anthony D

    2016-01-01

    This study documented the number and results of mycobacterial culture and drug sensitivity testing (CDST) in Mexico from 2009-2013 and assessed whether states with a higher risk of multidrug-resistant tuberculosis (MDR-TB) performed more CDST and had more cultures showing MDR-TB. Data for this longitudinal, descriptive, operational research study came from the electronic records of 31 state public health laboratories in Mexico. The total number of CDSTs was 6 470, increasing from 2 143 in the first 2 years to 4 327 in the latter 3 years. There was a significant increase in the proportion of cultures showing sensitivity to all drugs, from 53.1% to 60.9% in 2011-2013 (P tuberculosis were Mexico, particularly in high-risk MDR-TB states where a higher proportion of cultures showed MDR-TB. Scale up and wider coverage of CDST should continue.

  9. Genomic analysis of globally diverse Mycobacterium tuberculosis strains provides insights into emergence and spread of multidrug resistance

    Science.gov (United States)

    Manson, Abigail L.; Cohen, Keira A.; Abeel, Thomas; Desjardins, Christopher A.; Armstrong, Derek T.; Barry, Clifton E.; Brand, Jeannette; Chapman, Sinéad B.; Cho, Sang-Nae; Gabrielian, Andrei; Gomez, James; Jodals, Andreea M.; Joloba, Moses; Jureen, Pontus; Lee, Jong Seok; Malinga, Lesibana; Maiga, Mamoudou; Nordenberg, Dale; Noroc, Ecaterina; Romancenco, Elena; Salazar, Alex; Ssengooba, Willy; Velayati, A. A.; Winglee, Kathryn; Zalutskaya, Aksana; Via, Laura E.; Cassell, Gail H.; Dorman, Susan E.; Ellner, Jerrold; Farnia, Parissa; Galagan, James E.; Rosenthal, Alex; Crudu, Valeriu; Homorodean, Daniela; Hsueh, Po-Ren; Narayanan, Sujatha; Pym, Alexander S.; Skrahina, Alena; Swaminathan, Soumya; Van der Walt, Martie; Alland, David; Bishai, William R.; Cohen, Ted; Hoffner, Sven; Birren, Bruce W.; Earl, Ashlee M.

    2017-01-01

    Multidrug-resistant tuberculosis (MDR-TB), caused by drug resistant strains of Mycobacterium tuberculosis, is an increasingly serious problem worldwide. In this study, we examined a dataset of 5,310 M. tuberculosis whole genome sequences from five continents. Despite great diversity with respect to geographic point of isolation, genetic background and drug resistance, patterns of drug resistance emergence were conserved globally. We have identified harbinger mutations that often precede MDR. In particular, the katG S315T mutation, conferring resistance to isoniazid, overwhelmingly arose before rifampicin resistance across all lineages, geographic regions, and time periods. Molecular diagnostics that include markers for rifampicin resistance alone will be insufficient to identify pre-MDR strains. Incorporating knowledge of pre-MDR polymorphisms, particularly katG S315, into molecular diagnostics will enable targeted treatment of patients with pre-MDR-TB to prevent further development of MDR-TB. PMID:28092681

  10. Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco.

    Science.gov (United States)

    Zakham, Fathiah; Chaoui, Imane; Echchaoui, Amina Hadbae; Chetioui, Fouad; Elmessaoudi, My Driss; Ennaji, My Mustapha; Abid, Mohammed; Mzibri, Mohammed El

    2013-01-01

    Tuberculosis (TB) is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR) and extensively drug resistant (XDR) TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid. For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases) and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing. Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%). Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a new case. The most recorded mutation in the rpoB gene was the substitution TCG > TTG at codon 531 (Ser531 Leu), accounting for 46.15%. Significantly, the only mutation found in the katG gene was at codon 315 (AGC to ACC) with a Ser315Thr amino acid change. Only one sample harbored mutation in the inhA promoter region and was a point mutation at the -15p position (C > T). The polymerase chain reaction sequencing approach is an accurate and rapid method for detection of drug-resistant TB in clinical specimens, and could be of great interest in the management of TB in

  11. Resistance patterns among multidrug-resistant tuberculosis patients in greater metropolitan Mumbai: trends over time.

    Science.gov (United States)

    Dalal, Alpa; Pawaskar, Akshay; Das, Mrinalini; Desai, Ranjan; Prabhudesai, Pralhad; Chhajed, Prashant; Rajan, Sujeet; Reddy, Deepesh; Babu, Sajit; Jayalakshmi, T K; Saranchuk, Peter; Rodrigues, Camilla; Isaakidis, Petros

    2015-01-01

    While the high burden of multidrug-resistant tuberculosis (MDR-TB) itself is a matter of great concern, the emergence and rise of advanced forms of drug-resistance such as extensively drug-resistant TB (XDR-TB) and extremely drug-resistant TB (XXDR-TB) is more troubling. The aim of this study was to investigate the trends over time of patterns of drug resistance in a sample of MDR-TB patients in greater metropolitan Mumbai, India. This was a retrospective, observational study of drug susceptibility testing (DST) results among MDR-TB patients from eight health care facilities in greater Mumbai between 2005 and 2013. We classified resistance patterns into four categories: MDR-TB, pre-XDR-TB, XDR-TB and XXDR-TB. A total of 340 MDR-TB patients were included in the study. Pre-XDR-TB was the most common form of drug-resistant TB observed overall in this Mumbai population at 56.8% compared to 29.4% for MDR-TB. The proportion of patients with MDR-TB was 39.4% in the period 2005-2007 and 27.8% in 2011-2013, while the proportion of those with XDR-TB and XXDR-TB was changed from 6.1% and 0% respectively to 10.6% and 5.6% during the same time period. During the same periods, the proportions of patients with ofloxacin, moxifloxacin and ethionamide resistance significantly increased from 57.6% to 75.3%, from 60.0% to 69.5% and from 24.2% to 52.5% respectively (pMumbai highlight the need for individualized drug regimens, designed on the basis of DST results involving first- and second-line anti-TB drugs and treatment history of the patient. A drug-resistant TB case-finding strategy based on molecular techniques that identify only rifampicin resistance will lead to initiation of suboptimal treatment regimens for a significant number of patients, which may in turn contribute to amplification of resistance and transmission of strains with increasingly advanced resistance within the community.

  12. Childhood multidrug-resistant tuberculosis in the European Union and European Economic Area: an analysis of tuberculosis surveillance data from 2007 to 2015.

    Science.gov (United States)

    Ködmön, Csaba; van den Boom, Martin; Zucs, Phillip; van der Werf, Marieke Johanna

    2017-11-01

    BackgroundConfirming tuberculosis (TB) in children and obtaining information on drug susceptibility is essential to ensure adequate treatment. We assessed whether there are gaps in diagnosis and treatment of multidrug-resistant (MDR) TB in children in the European Union and European Economic Area (EU/EEA), quantified the burden of MDR TB in children and characterised cases. Methods : We analysed surveillance data from 2007 to 2015 for paediatric cases younger than 15 years. Results : In that period, 26 EU/EEA countries reported 18,826 paediatric TB cases of whom 4,129 (21.9%) were laboratory-confirmed. Drug susceptibility testing results were available for 3,378 (17.9%), representing 81.8% of the confirmed cases. The majority (n = 2,967; 87.8%) had drug-sensitive TB, 249 (7.4%) mono-resistant TB, 64 (1.9%) poly-resistant TB, 90 (2.7%) MDR TB and eight (0.2%) had extensively drug-resistant (XDR) TB. MDR TB was more frequently reported among paediatric cases with foreign background (adjusted odds ratio (aOR) = 1.73; 95% confidence interval (95% CI): 1.12-2.67) or previous TB treatment (aOR: 6.42; 95% CI: 3.24-12.75). Successful treatment outcome was reported for 58 of 74 paediatric MDR TB cases with outcome reported from 2007 to 2013; only the group of 5-9 years-olds was significantly associated with unsuccessful treatment outcome (crude odds ratio (cOR) = 11.45; 95% CI: 1.24-106.04). Conclusions : The burden of MDR TB in children in the EU/EEA appears low, but may be underestimated owing to challenges in laboratory confirmation. Diagnostic improvements are needed for early detection and adequate treatment of MDR TB. Children previously treated for TB or of foreign origin may warrant higher attention.

  13. Responding to the multidrug-resistant tuberculosis crisis: mainstreaming programmatic management to the Philippine National Tuberculosis Programme.

    Science.gov (United States)

    Quelapio, M I D; Mira, N R C; Orillaza-Chi, R B; Belen, V; Muñez, N; Belchez, R; Egos, G E; Evangelista, M; Vianzon, R; Tupasi, T E

    2010-06-01

    The Philippines ranks eighth among 27 priority countries for multidrug-resistant TB (MDR-TB). To describe a model of public-private partnership in MDR-TB management. An exploratory study of integrating MDR-TB management initiated in private-public mix DOTS into the National TB Programme (NTP). Recognising that MDR-TB was a threat to DOTS, the Tropical Disease Foundation initiated MDR-TB management in 1999. An official mandate for the integration of MDR-TB services into the NTP was issued by the Department of Health in 2008. With an increased government budget augmented by support from the Global Fund to Fight AIDS, Tuberculosis and Malaria, 1294 MDR-TB patients were placed on treatment from 1999 to 2008. The treatment success rate improved from 64% in 1999 to 75% in 2005. There are now five MDR-TB treatment centres with 181 treatment sites in Metro Manila, and three culture centres. People trained include 12 master trainers, 31 trainers, 25 treatment centre and 381 treatment site staff. Mainstreaming into the NTP of this unique model of MDR-TB management through a dynamic public-private collaboration can be considered best practice in implementation science of an evidence-based intervention leading to change in health care policy and practice.

  14. A systematic review of the cost and cost effectiveness of treatment for multidrug-resistant tuberculosis.

    Science.gov (United States)

    Fitzpatrick, Christopher; Floyd, Katherine

    2012-01-01

    Around 0.4 million cases of multidrug-resistant tuberculosis (MDR-TB) occur each year. Only a small fraction of these cases are treated according to international guidelines. Evidence relevant to decisions about whether to scale-up treatment for MDR-TB includes cost and cost-effectiveness data. Up to 2010, no systematic review of this evidence has been available. Our objective was to conduct a systematic review of the cost and cost effectiveness of treatment for MDR-TB and synthesize the available data. We searched for papers published or prepared for publication in peer-review journals and grey literature using search terms in five languages: English, French, Portuguese, Russian and Spanish. From an initial set of 420 studies, four were included, from Peru, the Philippines, Estonia and Tomsk Oblast in the Russian Federation. Results on costs, effectiveness and cost effectiveness were extracted. Assessment of the quality of each economic evaluation was guided by two existing checklists around which there is broad consensus. Costs were adjusted to a common year of value (2005) to remove distortions caused by inflation, and calculated in two common currencies: $US and international dollars (I$), to standardize for purchasing power parity. Data from the four identified studies were then synthesized using probabilistic sensitivity analysis, to appraise the likely cost and cost effectiveness of MDR-TB treatment in other settings, relative to WHO benchmarks for assessing whether or not an intervention is cost effective. Best estimates are provided as means, with 5th and 95th percentiles of the distributions. The cost per patient for MDR-TB treatment in Estonia, Peru, the Philippines and Tomsk was $US10 880, $US2423, $US3613 and $US14 657, respectively. Best estimates of the cost per disability-adjusted life-year (DALY) averted were $US598 (I$960), $US163 (I$291), $US143 (I$255) and $US745 (I$1059), respectively. The main influences on costs were (i) the model of care

  15. Prevalence of multidrug resistance among retreatment pulmonary tuberculosis cases in a tertiary care hospital, Hyderabad, India

    Directory of Open Access Journals (Sweden)

    Subhakar Kandi

    2013-01-01

    Full Text Available Background: India is one of the high tuberculosis (TB burden countries in the world. India ranks second in harboring multi drug resistant (MDR-TB cases. About 50,000 of MDR cases are recorded in retreatment pulmonary TB cases. This study was conducted in a tertiary care facility (Government General and Chest Hospital in Hyderabad, India. Objectives: Toassess: Proportion of the TB patients having MDR-TB at the initiation of retreatment regimen; the prevalence of isoniazid (INH resistance in this geographical area. Materials and Methods: An analytical, observational, prospective cohort study of patients attending the out-patient department from December 2010 to March 2011. Results: Sputum samples from 100 patients were subjected to acid fast bacilli (AFB culture and drug sensitivity testing. Of these, 28 (28% were MDR-TB, 42 (42% were non-MDR-TB and 39% being INH resistance. Conclusions: In conclusion, one third of the retreatment pulmonary TB cases attending a tertiary care institute for TB will be MDR-TB at the initiation of treatment and there is a need to include ethambutol in the continuation phase of new TB case treatment in view of high INH resistance.

  16. Comparison of the pharmacokinetics of two dosage regimens of linezolid in multidrug-resistant and extensively drug-resistant tuberculosis patients.

    NARCIS (Netherlands)

    Alffenaar, J.W.C.; Altena, R. van; Harmelink, I.M.; Filguera, P.; Molenaar, E.; Wessels, A.M.; Soolingen, D. van; Kosterink, J.G.W.; Uges, D.R.A.; Werf, T.S. van der

    2010-01-01

    BACKGROUND AND OBJECTIVES: For the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis (TB), potent new drugs are urgently needed. Linezolid is a promising drug, but its use is limited by adverse effects with prolonged administration of 600 mg twice daily. In

  17. Comparison of the Pharmacokinetics of Two Dosage Regimens of Linezolid in Multidrug-Resistant and Extensively Drug-Resistant Tuberculosis Patients

    NARCIS (Netherlands)

    Alffenaar, Jan-Willem C.; van Altena, Richard; Harmelink, Ilse M.; Filguera, Patricia; Molenaar, Esther; Wessels, A. Mireille A.; van Soolingen, Dick; Kosterink, Jos G. W.; Uges, Donald R. A.; van der Werf, Tjip S.

    2010-01-01

    Background and Objectives: For the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis (TB), potent new drugs are urgently needed. Linezolid is a promising drug, but its use is limited by adverse effects with prolonged administration of 600 mg twice daily. In

  18. [Reflection on Medical Treatment of Multi-drug Resistance Tuberculosis: The Necessity of Chinese Medicine Holistic View].

    Science.gov (United States)

    Zhang, Lei-lei; Jin, Hua

    2015-12-01

    Causative factors of multi-drug resistance tuberculosis (MDR-TB) were analyzed from iatrogenic angles, patients themselves, and society. Reviewed was the development of treatment strategies for MDR-TB from directly observed treatment short-course (DOTS) to DOTS-Plus. The history of Chinese medicine (CM) fighting TB and characteristics at the present stage were also analyzed. Authors pointed out that CM pays attention not only to killing pathogens and confirms the necessity of getting rid of pathogens, but also to cascade response caused by pathogens. It also regards the occurrence and development of MDR-TB as a whole by combining patients' conditions, climatic, geographic, psychological, and social factors. Authors believed that therapeutic principles under guidance of CM holistic view are of positive significance and inspiration in treating MDR-TB, and emphasized holistic view as basic strategies for treating MDR-TB, but not a single countermeasure.

  19. A novel automatic molecular test for detection of multidrug resistance tuberculosis in sputum specimen: A case control study.

    Science.gov (United States)

    Li, Qiang; Ou, Xi C; Pang, Yu; Xia, Hui; Huang, Hai R; Zhao, Bing; Wang, Sheng F; Zhao, Yan L

    2017-07-01

    MiniLab tuberculosis (ML TB) assay is a new automatic diagnostic tool for diagnosis of multidrug resistance tuberculosis (MDR-TB). This study was conducted with aims to know the performance of this assay. Sputum sample from 224 TB suspects was collected from tuberculosis suspects seeking medical care at Beijing Chest hospital. The sputum samples were directly used for smear and ML TB test. The left sputum sample was used to conduct Xpert MTB/RIF, Bactec MGIT culture and drug susceptibility test (DST). All discrepancies between the results from DST, molecular and phenotypic methods were confirmed by DNA Sequencing. The sensitivity and specificity of ML TB test for detecting MTBC from TB suspects were 95.1% and 88.9%, respectively. The sensitivity for smear negative TB suspects was 64.3%. For detection of RIF resistance, the sensitivity and specificity of ML TB test were 89.2% and 95.7%, respectively. For detection of INH resistance, the sensitivity and specificity of ML TB test were 78.3% and 98.1%, respectively. ML TB test showed similar performance to Xpert MTB/RIF for detection of MTBC and RIF resistance. In addition, ML TB also had good performance for INH resistance detection. Copyright © 2017. Published by Elsevier Ltd.

  20. Surgical face masks worn by patients with multidrug-resistant tuberculosis: impact on infectivity of air on a hospital ward.

    Science.gov (United States)

    Dharmadhikari, Ashwin S; Mphahlele, Matsie; Stoltz, Anton; Venter, Kobus; Mathebula, Rirhandzu; Masotla, Thabiso; Lubbe, Willem; Pagano, Marcello; First, Melvin; Jensen, Paul A; van der Walt, Martie; Nardell, Edward A

    2012-05-15

    Drug-resistant tuberculosis transmission in hospitals threatens staff and patient health. Surgical face masks used by patients with tuberculosis (TB) are believed to reduce transmission but have not been rigorously tested. We sought to quantify the efficacy of surgical face masks when worn by patients with multidrug-resistant TB (MDR-TB). Over 3 months, 17 patients with pulmonary MDR-TB occupied an MDR-TB ward in South Africa and wore face masks on alternate days. Ward air was exhausted to two identical chambers, each housing 90 pathogen-free guinea pigs that breathed ward air either when patients wore surgical face masks (intervention group) or when patients did not wear masks (control group). Efficacy was based on differences in guinea pig infections in each chamber. Sixty-nine of 90 control guinea pigs (76.6%; 95% confidence interval [CI], 68-85%) became infected, compared with 36 of 90 intervention guinea pigs (40%; 95% CI, 31-51%), representing a 56% (95% CI, 33-70.5%) decreased risk of TB transmission when patients used masks. Surgical face masks on patients with MDR-TB significantly reduced transmission and offer an adjunct measure for reducing TB transmission from infectious patients.

  1. [Thin layer agar represents a cost-effective alternative for the rapid diagnosis of multi-drug resistant tuberculosis].

    Science.gov (United States)

    Hernández-Sarmiento, José M; Martínez-Negrete, Milton A; Castrillón-Velilla, Diana M; Mejía-Espinosa, Sergio A; Mejía-Mesa, Gloria I; Zapata-Fernández, Elsa M; Rojas-Jiménez, Sara; Marín-Castro, Andrés E; Robledo-Restrepo, Jaime A

    2014-01-01

    Using cost-benefit analysis for comparing the thin-layer agar culture method to the standard multiple proportion method used in diagnosing multidrug-resistant tuberculosis (MDR TB). A cost-benefit evaluation of two diagnostic tests was made at the Corporación para Investigaciones Biológicas (CIB) in Medellín, Colombia. 100 patients were evaluated; 10.8% rifampicin resistance and 14.3% isoniazid resistance were found. A computer-based decision tree model was used for cost-effectiveness analysis (Treeage Pro); the thin-layer agar culture method was most cost-effective, having 100% sensitivity, specificity and predictive values for detecting rifampicin and isoniazid resistance. The multiple proportion method value was calculated as being US$ 71 having an average 49 day report time compared to US$ 18 and 14 days for the thin-layer agar culture method. New technologies have been developed for diagnosing tuberculosis which are apparently faster and more effective; their operating characteristics must be evaluated as must their effectiveness in terms of cost-benefit. The present study established that using thin-layer agar culture was cheaper, equally effective and could provide results more quickly than the traditional method. This implies that a patient could receive MDR TB treatment more quickly.

  2. A PROSPECTIVE, OBSERVATIONAL STUDY OF ADVERSE REACTIONS TO DRUG REGIME FOR MULTI-DRUG RESISTANT PULMONARY TUBERCULOSIS IN CENTRAL INDIA.

    Directory of Open Access Journals (Sweden)

    Dr. Rohan C. Hire

    2014-09-01

    Full Text Available Abstract Objective: 1 To assess the adverse drug reactions of second line anti-tubercular drugs used to treat Multi-drug resistant Tuberculosis (MDR TB in central India on the basis of causality, severity and avoidability scales. 2 To study the relationship of type of MDR TB (primary or secondary and presence of diabetes mellitus (DM with mean smear conversion time. Material and Methods: A prospective, observational study was carried out on diagnosed multidrug resistant tuberculosis patients enrolled for DOTS‑Plus regimen at TB and Chest Disease Department from January to December 2012. They were followed for 9 months thereafter and encountered adverse drug reactions (ADRs were noted along with the time of sputum conversion. The data were analysed by Chi-square or Fisher’s exact test and unpaired student’s‘t’ test. Results: Total 64 ADRs were reported in 55 patients out of total 110 patients (n = 110. As per the Naranjo causality assessment of ADRs, 7 patients had “definite” causal relation, 45 had “probable” causal relation and 3 had “possible” causal relation with drugs of DOTS Plus regime. As per the Hartwig’s severity assessment scale, there were total 7 ADRs in Level 1, 6 in Level 2, 33 in Level 3 and 9 in Level 4. Hallas avoidability assessment scale divided the ADRs as 3 being “Definitely avoidable”, 26 “Possibly avoidable”, 23 “Not avoidable” and 3 “unevaluable”. . Mean sputum smear conversion time is significantly higher in patients with secondary type than that of primary type of MDR TB (p = 0.0001 and in patients with DM than those without DM (p <0.0001. Conclusion: ADRs were common in patients of MDR TB on DOTs-Plus drug regime. It was due to lack of availability of safer and equally potent drugs in DOTs-Plus drug regime compared to DOTS regime in non-resistant TB. The frequency and severity of ADRs can be reduced by strict vigilance about known and unknown ADRs, monitoring their laboratory and

  3. Rapid diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis using a molecular-based diagnostic algorithm.

    Science.gov (United States)

    Simons, S O; van der Laan, T; Mulder, A; van Ingen, J; Rigouts, L; Dekhuijzen, P N R; Boeree, M J; van Soolingen, D

    2014-10-01

    There is an urgent need for rapid and accurate diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis (MDR-TB). No diagnostic algorithm has been validated in this population. We hypothesized that pncA sequencing added to rpoB mutation analysis can accurately identify patients with pyrazinamide-resistant MDR-TB. We identified from the Dutch national database (2007-11) patients with a positive Mycobacterium tuberculosis culture containing a mutation in the rpoB gene. In these cases, we prospectively sequenced the pncA gene. Results from the rpoB and pncA mutation analysis (pncA added to rpoB) were compared with phenotypic susceptibility testing results to rifampicin, isoniazid and pyrazinamide (reference standard) using the Mycobacterial Growth Indicator Tube 960 system. We included 83 clinical M. tuberculosis isolates containing rpoB mutations in the primary analysis. Rifampicin resistance was seen in 72 isolates (87%), isoniazid resistance in 73 isolates (88%) and MDR-TB in 65 isolates (78%). Phenotypic reference testing identified pyrazinamide-resistant MDR-TB in 31 isolates (48%). Sensitivity of pncA sequencing added to rpoB mutation analysis for detecting pyrazinamide-resistant MDR-TB was 96.8%, the specificity was 94.2%, the positive predictive value was 90.9%, the negative predictive value was 98.0%, the positive likelihood was 16.8 and the negative likelihood was 0.03. In conclusion, pyrazinamide-resistant MDR-TB can be accurately detected using pncA sequencing added to rpoB mutation analysis. We propose to include pncA sequencing in every isolate with an rpoB mutation, allowing for stratification of MDR-TB treatment according to pyrazinamide susceptibility. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  4. Sequential analysis as a tool for detection of amikacin ototoxicity in the treatment of multidrug-resistant tuberculosis.

    Science.gov (United States)

    Vasconcelos, Karla Anacleto de; Frota, Silvana Maria Monte Coelho; Ruffino-Netto, Antonio; Kritski, Afrânio Lineu

    2018-04-01

    To investigate early detection of amikacin-induced ototoxicity in a population treated for multidrug-resistant tuberculosis (MDR-TB), by means of three different tests: pure-tone audiometry (PTA); high-frequency audiometry (HFA); and distortion-product otoacoustic emission (DPOAE) testing. This was a longitudinal prospective cohort study involving patients aged 18-69 years with a diagnosis of MDR-TB who had to receive amikacin for six months as part of their antituberculosis drug regimen for the first time. Hearing was assessed before treatment initiation and at two and six months after treatment initiation. Sequential statistics were used to analyze the results. We included 61 patients, but the final population consisted of 10 patients (7 men and 3 women) because of sequential analysis. Comparison of the test results obtained at two and six months after treatment initiation with those obtained at baseline revealed that HFA at two months and PTA at six months detected hearing threshold shifts consistent with ototoxicity. However, DPOAE testing did not detect such shifts. The statistical method used in this study makes it possible to conclude that, over the six-month period, amikacin-associated hearing threshold shifts were detected by HFA and PTA, and that DPOAE testing was not efficient in detecting such shifts.

  5. Challenges of using new and repurposed drugs for the treatment of multidrug-resistant tuberculosis in children.

    Science.gov (United States)

    Schaaf, H Simon; Garcia-Prats, Anthony J; McKenna, Lindsay; Seddon, James A

    2018-03-01

    New and repurposed antituberculosis drugs are urgently needed to more safely and effectively treat multidrug-resistant (MDR) tuberculosis (TB) in children. Multiple challenges limit timely access to new MDR-TB treatments in children. Areas covered: Diagnosis of MDR-TB in children remains a barrier, with few children with MDR-TB diagnosed and treated. Other barriers to timely access to new and repurposed drugs are discussed, and include delayed initiation of paediatric trials, limited funding for paediatric drug development, fragmented regulatory systems and operational challenges. The status of access to current repurposed and novel drugs is presented. Expert commentary: More timely initiation of paediatric trials is needed and paediatric work should happen and be funded in parallel with each phase of adult trials. Better quality data, increased regulator resources and expertise, harmonization of regulatory requirements across borders/organisations and registration fee waivers would improve registration timelines. Improved diagnosis, recording and reporting will establish better demand. Improved systems for procurement and supply chain management would reduce in-country operational barriers to getting medications to children. The challenges must be addressed to ensure timely and equitable access to new drugs and regimens that are urgently needed for effective, safe and shorter treatment of children with MDR-TB.

  6. Multidrug-resistant tuberculosis in Moldova and the Former Yugoslav Republic of Macedonia: The importance of health system governance

    Directory of Open Access Journals (Sweden)

    R. Gregory Thomas-Reilly

    2016-04-01

    Full Text Available Aim: Multidrug-resistant tuberculosis (MDR-TB arises where treatment is interrupted or inadequate, when patients are treated inappropriately, or when an individual has impaired immune function, which can lead to a rapid progression from infection with an MDR-strain to disease. This study examines the role of health systems in amplifying or preventing the development of MDR-TB. Methods: We present two comparative studies, which were undertaken in The Former Yugoslav Republic of Macedonia (TFYR Macedonia and Moldova. Results: The findings reveal several health systems-level factors that contribute to the different rates of MDR-TB observed in these two countries, including: pre-existing burden of disease; organization of the health system, with the existence of parallel systems; power dynamics among policy makers and disease programmes; and the accountability & effectiveness of programme oversight. Conclusions: The findings do not offer a universal template for health system reform but do identify specific factors that may be contributing to the epidemic and are worthy of further attention in the two countries.

  7. Risk Factors for Acquisition of Drug Resistance during Multidrug-Resistant Tuberculosis Treatment, Arkhangelsk Oblast, Russia, 2005–2010

    Science.gov (United States)

    Ershova, Julia; Vlasova, Natalia; Nikishova, Elena; Tarasova, Irina; Eliseev, Platon; Maryandyshev, Andrey O.; Shemyakin, Igor G.; Kurbatova, Ekaterina; Cegielski, J. Peter

    2015-01-01

    Acquired resistance to antituberculosis drugs decreases effective treatment options and the likelihood of treatment success. We identified risk factors for acquisition of drug resistance during treatment for multidrug-resistant tuberculosis (MDR TB) and evaluated the effect on treatment outcomes. Data were collected prospectively from adults from Arkhangelsk Oblast, Russia, who had pulmonary MDR TB during 2005–2008. Acquisition of resistance to capreomycin and of extensively drug-resistant TB were more likely among patients who received 3 effective drugs (9.4% vs. 0% and 8.6% vs. 0.8%, respectively). Poor outcomes were more likely among patients with acquired capreomycin resistance (100% vs. 25.9%), acquired ofloxacin resistance (83.6% vs. 22.7%), or acquired extensive drug resistance (100% vs. 24.4%). To prevent acquired drug resistance and poor outcomes, baseline susceptibility to first- and second-line drugs should be determined quickly, and treatment should be adjusted to contain >3 effective drugs. PMID:25988954

  8. Association between Multidrug-Resistant Tuberculosis and Risk Factors in China: Applying Partial Least Squares Path Modeling.

    Directory of Open Access Journals (Sweden)

    Yun-Xia Liu

    Full Text Available Multidrug-resistant tuberculosis (MDR-TB resulting from various factors has raised serious public health concerns worldwide. Identifying the ecological risk factors associated with MDR-TB is critical to its prevention and control. This study aimed to explore the association between the development of MDR-TB and the risk factors at the group-level (ecological risk factors in China.Data on MDR-TB in 120 counties were obtained from the National Tuberculosis Information Management System, and data on risk-factor variables were extracted from the Health Statistical Yearbook, provincial databases, and the meteorological bureau of each province (municipality. Partial Least Square Path Modeling was used to detect the associations.The median proportion of MDR-TB in new TB cases was 3.96% (range, 0-39.39%. Six latent factors were extracted from the ecological risk factors, which explained 27.60% of the total variance overall in the prevalence of MDR-TB. Based on the results of PLS-PM, TB prevention, health resources, health services, TB treatment, TB detection, geography and climate factors were all associated with the risk of MDR-TB, but socioeconomic factors were not significant.The development of MDR-TB was influenced by TB prevention, health resources, health services, TB treatment, TB detection, geography and climate factors. Such information may help us to establish appropriate public health intervention strategies to prevent and control MDR-TB and yield benefits to the entire public health system in China.

  9. Diagnosis and interim treatment outcomes from the first cohort of multidrug-resistant tuberculosis patients in Tanzania.

    Directory of Open Access Journals (Sweden)

    Stellah G Mpagama

    Full Text Available Kibong'oto National Tuberculosis Hospital (KNTH, Kilimanjaro, Tanzania.Characterize the diagnostic process and interim treatment outcomes from patients treated for multidrug-resistant tuberculosis (MDR-TB in Tanzania.A retrospective cohort study was performed among all patients treated at KNTH for pulmonary MDR-TB between November 2009 and September 2011.Sixty-one culture-positive MDR-TB patients initiated therapy, 60 (98% with a prior history of TB treatment. Forty-one (67% were male and 9 (14% were HIV infected with a mean CD4 count of 424 (±106 cells/µl. The median time from specimen collection to MDR-TB diagnosis and from diagnosis to initiation of MDR-TB treatment was 138 days (IQR 101-159 and 131 days (IQR 32-233, respectively. Following treatment initiation four (7% patients died (all HIV negative, 3 (5% defaulted, and the remaining 54 (89% completed the intensive phase. Most adverse drug reactions were mild to moderate and did not require discontinuation of treatment. Median time to culture conversion was 2 months (IQR 1-3 and did not vary by HIV status. In 28 isolates available for additional second-line drug susceptibility testing, fluoroquinolone, aminoglycoside and para-aminosalicylic acid resistance was rare yet ethionamide resistance was present in 9 (32%.The majority of MDR-TB patients from this cohort had survived a prolonged referral process, had multiple episodes of prior TB treatment, but did not have advanced AIDS and converted to culture negative early while completing an intensive inpatient regimen without serious adverse event. Further study is required to determine the clinical impact of second-line drug susceptibility testing and the feasibility of alternatives to prolonged hospitalization.

  10. Diabetes and Other Risk Factors for Multi-drug Resistant Tuberculosis in a Mexican Population with Pulmonary Tuberculosis: Case Control Study.

    Science.gov (United States)

    Gómez-Gómez, Alejandro; Magaña-Aquino, Martin; López-Meza, Salvador; Aranda-Álvarez, Marcelo; Díaz-Ornelas, Dora E; Hernández-Segura, María Guadalupe; Salazar-Lezama, Miguel Ángel; Castellanos-Joya, Martín; Noyola, Daniel E

    2015-02-01

    Multidrug resistant tuberculosis (MDR-TB) poses problems in treatment, costs and treatment outcomes. It is not known if classically described risk factors for MDR-TB in other countries are the same in Mexico and the frequency of the association between diabetes mellitus (DM) and MDR-TB in our country is not clear. We undertook this study to analyze risk factors associated with the development of MDR-TB, with emphasis on DM. A case-control study in the state of San Luis Potosi (SLP), Mexico was carried out. All pulmonary MDR-TB patients diagnosed in the state of SLP between 1998 and 2013 (36 cases) evaluated at a state pharmacoresistant tuberculosis (TB) clinic and committee; 139 controls were randomly selected from all pulmonary non-multidrug-resistant tuberculosis (non-MDR-TB) cases identified between 2003 and 2008. Cases and controls were diagnosed and treated under programmatic conditions. Age, gender, malnutrition, being a health-care worker, HIV/AIDS status, and drug abuse were not significantly different between MDR-TB and non-MDR-TB patients. Significant differences between MDR-TB and non-MDR-TB patients were DM (47.2 vs. 28.1%; p = 0.028); previous anti-TB treatments (3 vs. 0, respectively; p <0.001), and duration of first anti-TB treatment (8 vs. 6 months, respectively; p <0.001). MDR-TB and DM are associated in 47.2% of MDR TB cases (17/36) in this study. Other recognized factors were not found to be significantly different in MDR-TB compared to non-MDR-TB in this study. Cost-feasible strategies must be implemented in the treatment of DM-TB in order to prevent the selection of MDR-TB. Copyright © 2015 IMSS. Published by Elsevier Inc. All rights reserved.

  11. Individualized treatment of multidrug-resistant tuberculosis using therapeutic drug monitoring

    Directory of Open Access Journals (Sweden)

    Mathieu S Bolhuis

    2016-01-01

    Conclusion: TDM is highly valuable to individualize and optimize treatment of complex MDR-TB patients. TDM is routinely applied in Tuberculosis Center Beatrixoord, and high success rates for treatment of MDR-TB patients have been achieved. DBS and LSS make implementation of TDM feasible, even in low- and middle-income countries.

  12. Resistance patterns, prevalence, and predictors of fluoroquinolones resistance in multidrug resistant tuberculosis patients

    Directory of Open Access Journals (Sweden)

    Nafees Ahmad

    2016-01-01

    Conclusion: The high degree of drug resistance observed, particularly to fluoroquinolones, is alarming. We recommend the adoption of more restrictive policies to control non-prescription sale of fluoroquinolones, its rational use by physicians, and training doctors in both private and public–private mix sectors to prevent further increase in fluoroquinolones resistant Mycobacterium tuberculosis strains.

  13. Genetic diversity of multidrug-resistant tuberculosis in a resource-limited region of China

    Directory of Open Access Journals (Sweden)

    Dan Zhang

    2014-12-01

    Conclusions: Beijing genotype was the predominant genotype among the isolates from MDR-TB cases in Chongqing. The re-treated MDR-TB cases were more likely to be attributed to Beijing genotype infection. The 10-locus VNTR set demonstrated a good discrimination power for genotyping MDR M. tuberculosis isolates circulating in Chongqing Municipality.

  14. Detection of multidrug-resistant tuberculosis from stored DNA Samples: A multicenter study

    OpenAIRE

    Marie Sylvianne Rabodoarivelo; A Brandao; M C Cergole Novella; A G C. Bombonatte; B Imperiale; N Rakotosamimanana; N Morcillo; V Rasolofo; J C Palomino; A Martin

    2018-01-01

    Background: In low-income countries, rapid detection of tuberculosis (TB) drug resistance is often restricted by the difficulties of transporting and storing sputum samples from remote health centers to the reference laboratories where molecular tests are available. The aim of this study was to evaluate the performance of four transport and storage systems for molecular detection of rifampicin (RIF) and isoniazid (INH) resistance. Methods: This was a multicenter study. Molecular detection of ...

  15. Performance of Four Transport and Storage Systems for Molecular Detection of Multidrug-Resistant Tuberculosis

    Science.gov (United States)

    Rabodoarivelo, Marie Sylvianne; Imperiale, Bélen; andrianiavomikotroka, Rina; Brandao, Angela; Kumar, Parveen; Singh, Sarman; Ferrazoli, Lucilaine; Morcillo, Nora; Rasolofo, Voahangy; Palomino, Juan Carlos; Vandamme, Peter; Martin, Anandi

    2015-01-01

    Background Detection of drug-resistant tuberculosis is essential for the control of the disease but it is often hampered by the limitation of transport and storage of samples from remote locations to the reference laboratory. We performed a retrospective field study to evaluate the performance of four supports enabling the transport and storage of samples to be used for molecular detection of drug resistance using the GenoType MTBDRplus. Methods Two hundred Mycobacterium tuberculosis strains were selected and spotted on slides, FTA cards, GenoCards, and in ethanol. GenoType MTBDRplus was subsequently performed with the DNA extracted from these supports. Sensitivity and specificity were calculated and compared to the results obtained by drug susceptibility testing. Results For all supports, the overall sensitivity and specificity for detection of resistance to RIF was between 95% and 100%, and for INH between 95% and 98%. Conclusion The four transport and storage supports showed a good sensitivity and specificity for the detection of resistance to RIF and INH in M. tuberculosis strains using the GenoType MTBDRplus. These supports can be maintained at room temperature and could represent an important alternative cost-effective method useful for rapid molecular detection of drug-resistant TB in low-resource settings. PMID:26431352

  16. Implementation of the national tuberculosis guidelines on culture and drug sensitivity testing in Guatemala, 2013.

    Science.gov (United States)

    Samayoa-Peláez, Maritza; Ayala, Nancy; Yadon, Zaida E; Heldal, Einar

    2016-01-01

    Objective To assess whether the National Tuberculosis Program (NTP) guidelines for culture and drug sensitivity testing (DST) in Guatemala were successfully implemented, particularly in cases of smear-negative pulmonary tuberculosis (TB) or previously treated TB, by documenting notification rates by department (geographic area), disease type and category, and culture and DST results. Methods This was a cross-sectional, operational research study that merged and linked all patients registered by the NTP and the National Reference Laboratory in 2013, eliminating duplicates. The proportions with culture (for new smear negative pulmonary cases) and culture combined with DST (for previously treated patients) were estimated and analyzed by department. Data were analyzed using EpiData Analysis version 2.2. Results There were 3 074 patients registered with TB (all forms), for a case notification rate of 20/100 000 population. Of these, 2 842 had new TB, of which 2 167 (76%) were smear-positive pulmonary TB (PTB), 385 (14%) were smear-negative PTB, and 290 (10%) were extrapulmonary TB. There were 232 (8%) previously treated cases. Case notification rates (all forms) varied by department from 2-68 per 100 000 population, with the highest rates seen in the southwest and northeast part of Guatemala. Of new TB patients, 136 had a culture performed and 55 had DST of which the results were 33 fully sensitive, 9 monoresistant, 3 polyresistant, and 10 multidrug resistant TB (MDR-TB). Only 21 (5%) of new smear-negative PTB patients had cultures. Of 232 previously treated patients, 54 (23%) had a culture and 47 (20%) had DST, of which 29 were fully sensitive, 7 monoresistant, 2 polyresistant, and 9 MDR-TB. Of 22 departments (including the capital), culture and DST was performed in new smear-negative PTB in 7 departments (32%) and in previously treated TB in 13 departments (59%). Conclusions Despite national guidelines, only 5% of smear-negative PTB cases had a culture and only 20% of

  17. Implementation of the national tuberculosis guidelines on culture and drug sensitivity testing in Guatemala, 2013

    Directory of Open Access Journals (Sweden)

    Maritza Samayoa-Peláez

    Full Text Available ABSTRACT Objective To assess whether the National Tuberculosis Program (NTP guidelines for culture and drug sensitivity testing (DST in Guatemala were successfully implemented, particularly in cases of smear-negative pulmonary tuberculosis (TB or previously treated TB, by documenting notification rates by department (geographic area, disease type and category, and culture and DST results. Methods This was a cross-sectional, operational research study that merged and linked all patients registered by the NTP and the National Reference Laboratory in 2013, eliminating duplicates. The proportions with culture (for new smear negative pulmonary cases and culture combined with DST (for previously treated patients were estimated and analyzed by department. Data were analyzed using EpiData Analysis version 2.2. Results There were 3 074 patients registered with TB (all forms, for a case notification rate of 20/100 000 population. Of these, 2 842 had new TB, of which 2 167 (76% were smear-positive pulmonary TB (PTB, 385 (14% were smear-negative PTB, and 290 (10% were extrapulmonary TB. There were 232 (8% previously treated cases. Case notification rates (all forms varied by department from 2–68 per 100 000 population, with the highest rates seen in the southwest and northeast part of Guatemala. Of new TB patients, 136 had a culture performed and 55 had DST of which the results were 33 fully sensitive, 9 monoresistant, 3 polyresistant, and 10 multidrug resistant TB (MDR-TB. Only 21 (5% of new smear-negative PTB patients had cultures. Of 232 previously treated patients, 54 (23% had a culture and 47 (20% had DST, of which 29 were fully sensitive, 7 monoresistant, 2 polyresistant, and 9 MDR-TB. Of 22 departments (including the capital, culture and DST was performed in new smear-negative PTB in 7 departments (32% and in previously treated TB in 13 departments (59%. Conclusions Despite national guidelines, only 5% of smear-negative PTB cases had a culture and

  18. Multidrug-resistant tuberculosis patients’ views of interventions to reduce treatment loss to follow-up

    Science.gov (United States)

    Tupasi, T.; Garfin, A. M. C. G.; Mangan, J. M.; Orillaza-Chi, R.; Naval, L. C.; Balane, G. I.; Basilio, R.; Golubkov, A.; Joson, E. S.; Lew, W-J.; Lofranco, V.; Mantala, M.; Pancho, S.; Sarol, J. N.; Blumberg, A.; Burt, D.; Kurbatova, E. V.

    2017-01-01

    SUMMARY SETTING Patients who initiated treatment for multi-drug-resistant tuberculosis (MDR-TB) at 15 Programmatic Management of Drug-resistant Tuberculosis (PMDT) health facilities in the Philippines between July and December 2012. OBJECTIVES To describe patients’ views of current interventions, and suggest changes likely to reduce MDR-TB loss to follow-up. METHODS In-depth interviews were conducted between April and July 2014 with MDR-TB patients who were undergoing treatment, had finished treatment at the time of the interview (controls), or had been lost to follow-up (LTFU). Responses were thematically analyzed. RESULTS Interviews were conducted with 182 patients who were undergoing or had completed treatment and 91 LTFU patients. Views and suggestions could be thematically categorized as approaches to facilitate adherence or address barriers to adherence. The top themes were the need for transportation assistance or improvements to the current transportation assistance program, food assistance, and difficulties patients encountered related to their medications. These themes were addressed by respectively 63%, 60%, and 32% of the participants. CONCLUSIONS A more patient-centered approach is needed to improve MDR-TB treatment adherence. Programs should strive to provide assistance that considers patient preferences, is adequate to cover actual costs or needs, and is delivered in a timely, uninterrupted manner. PMID:28157461

  19. Psychosocial wellbeing of patients with multidrug resistant tuberculosis voluntarily confined to long-term hospitalisation in Nigeria

    Science.gov (United States)

    Oladimeji, Olanrewaju; Ushie, Boniface Ayanbekongshie; Udoh, Ekerette Emmanuel; Oladimeji, Kelechi Elizabeth; Ige, Olusoji Mayowa; Obasanya, Olusegun; Lekharu, Daisy; Atilola, Olayinka; Lawson, Lovett; Eltayeb, Osman; Gidado, Mustapha; Tsoka-Gwegweni, Joyce M; Ihekweazu, Chikwe A; Chasela, Charles S

    2016-01-01

    Background and objective Patient isolation, which is a widely successful treatment strategy for tuberculosis (TB), has been suspected to have effects on patient psychosocial wellbeing. We assessed the psychosocial wellbeing of multidrug resistant TB (MDR-TB) patients in voluntary and isolated long-term hospitalisation in Nigeria. Methods 98 accessible and consenting patients in four drug-resistant treatment centres (University College Hospital and Government Chest Hospital, Ibadan; Mainland Hospital, Lagos, and Lawrence Henshaw Memorial Hospital, Calabar) were enrolled in this study. Data were collected using an 18-item psychosocial wellbeing questionnaire including sociodemographic characteristics. We used descriptive statistics to present demographic characteristics; the χ2 test was used to assess associations between psychosocial wellbeing and independent variables and the relationship was modelled using logistic regression. Results The mean age of respondents was 36.1±11.9 years and 63% were males. Respondents had been in hospital an average of 4.5±1.9 months. Females had more psychosocial concerns compared with males. The most common concerns recorded among respondents were concern that people will get to know that the respondent had a bad type of TB (70%), discontent with being separated from and longing for the company of their marital partner (72%), concerns that they may have taken too many drugs (73%), and displeasure with being unable to continue to engage in their usual social and economic activities (75%). Respondents who were employed had eight times the odds of having more psychosocial concerns than the median number among respondents. Respondents who were supported by their own families during hospitalisation experienced a lower burden of psychosocial concerns compared with those who were supported by third parties. Conclusions Prolonged hospitalisation resulted in significant psychosocial burden for the MDR-TB patients in our study centres

  20. Rapid molecular detection of rifampicin resistance facilitates early diagnosis and treatment of multi-drug resistant tuberculosis: case control study.

    Directory of Open Access Journals (Sweden)

    Philly O'Riordan

    2008-09-01

    Full Text Available Multi-drug resistant tuberculosis (MDR-TB is a major public health concern since diagnosis is often delayed, increasing the risk of spread to the community and health care workers. Treatment is prolonged, and the total cost of treating a single case is high. Diagnosis has traditionally relied upon clinical suspicion, based on risk factors and culture with sensitivity testing, a process that can take weeks or months. Rapid diagnostic molecular techniques have the potential to shorten the time to commencing appropriate therapy, but have not been put to the test under field conditions.This retrospective case-control study aimed to identify risk factors for MDR-TB, and analyse the impact of testing for rifampicin resistance using RNA polymerase B (rpoB mutations as a surrogate for MDR-TB. Forty two MDR-TB cases and 84 fully sensitive TB controls were matched by date of diagnosis; and factors including demographics, clinical presentation, microbiology findings, management and outcome were analysed using their medical records. Conventionally recognised risk factors for MDR-TB were absent in almost half (43% of the cases, and 15% of cases were asymptomatic. A significant number of MDR-TB cases were identified in new entrants to the country. Using rpoB mutation testing, the time to diagnosis of MDR-TB was dramatically shortened by a median of 6 weeks, allowing patients to be commenced on appropriate therapy a median of 51days earlier than those diagnosed by conventional culture and sensitivity testing.MDR-TB is frequently an unexpected finding, may be asymptomatic, and is particularly prevalent among TB infected new entrants to the country. Molecular resistance testing of all acid fast bacilli positive specimens has the potential to rapidly identify MDR-TB patients and commence them on appropriate therapy significantly earlier than by conventional methods.

  1. Multidrug-Resistant Mycobacterium tuberculosis of the Latin American Mediterranean Lineage, Wrongly Identified as Mycobacterium pinnipedii (Spoligotype International Type 863 [SIT863]), Causing Active Tuberculosis in South Brazil

    KAUST Repository

    Dalla Costa, Elis R.; Vasconcelos, Sidra E. G.; Esteves, Leonardo S.; Gomes, Harrison M.; Gomes, Lia L.; Almeida da Silva, Pedro; Perdigã o, Joã o; Portugal, Isabel; Viveiros, Miguel; McNerney, Ruth; Pain, Arnab; Clark, Taane G.; Rastogi, Nalin; Unis, Gisela; Rossetti, Maria Lucia R.; Suffys, Philip Noel

    2015-01-01

    We recently detected the spoligotype patterns of strains of Mycobacterium pinnipedii, a species of the Mycobacterium tuberculosis complex, in sputum samples from nine cases with pulmonary tuberculosis residing in Porto Alegre, South Brazil. Because this species is rarely encountered in humans, we further characterized these nine isolates by additional genotyping techniques, including 24-locus mycobacterial interspersed repetitive-unit–variable-number tandem-repeat (MIRU-VNTR) typing, verification of the loci TbD1, RD9, pks15/1, RDRio, and fbpC, the insertion of IS6110 at a site specific to the M. tuberculosis Latin American Mediterranean (LAM) lineage, and whole-genome sequencing. The combined analysis of these markers revealed that the isolates are in fact M. tuberculosis and more specifically belong to the LAM genotype. Most of these isolates (n = 8) were shown to be multidrug resistant (MDR), which prompted us to perform partial sequencing of the rpoA, rpoB, rpoC, katG, and inhA genes. Seven isolates (77.8%) carried the S315T mutation in katG, and one of these (11%) also presented the C(−17)T single-nucleotide polymorphism (SNP) in inhA. Interestingly, six of the MDR isolates also presented an undescribed insertion of 12 nucleotides (CCA GAA CAA CCC) in codon 516 of rpoB. No putative compensatory mutation was found in either rpoA or rpoC. This is the first report of an M. tuberculosis LAM family strain with a convergent M. pinnipedii spoligotype. These spoligotypes are observed in genotype databases at a modest frequency, highlighting that care must be taken when identifying isolates in the M. tuberculosis complex on the basis of single genetic markers.

  2. Multidrug-Resistant Mycobacterium tuberculosis of the Latin American Mediterranean Lineage, Wrongly Identified as Mycobacterium pinnipedii (Spoligotype International Type 863 [SIT863]), Causing Active Tuberculosis in South Brazil

    KAUST Repository

    Dalla Costa, Elis R.

    2015-09-23

    We recently detected the spoligotype patterns of strains of Mycobacterium pinnipedii, a species of the Mycobacterium tuberculosis complex, in sputum samples from nine cases with pulmonary tuberculosis residing in Porto Alegre, South Brazil. Because this species is rarely encountered in humans, we further characterized these nine isolates by additional genotyping techniques, including 24-locus mycobacterial interspersed repetitive-unit–variable-number tandem-repeat (MIRU-VNTR) typing, verification of the loci TbD1, RD9, pks15/1, RDRio, and fbpC, the insertion of IS6110 at a site specific to the M. tuberculosis Latin American Mediterranean (LAM) lineage, and whole-genome sequencing. The combined analysis of these markers revealed that the isolates are in fact M. tuberculosis and more specifically belong to the LAM genotype. Most of these isolates (n = 8) were shown to be multidrug resistant (MDR), which prompted us to perform partial sequencing of the rpoA, rpoB, rpoC, katG, and inhA genes. Seven isolates (77.8%) carried the S315T mutation in katG, and one of these (11%) also presented the C(−17)T single-nucleotide polymorphism (SNP) in inhA. Interestingly, six of the MDR isolates also presented an undescribed insertion of 12 nucleotides (CCA GAA CAA CCC) in codon 516 of rpoB. No putative compensatory mutation was found in either rpoA or rpoC. This is the first report of an M. tuberculosis LAM family strain with a convergent M. pinnipedii spoligotype. These spoligotypes are observed in genotype databases at a modest frequency, highlighting that care must be taken when identifying isolates in the M. tuberculosis complex on the basis of single genetic markers.

  3. Rapid molecular diagnostics for multi-drug resistant tuberculosis in India.

    Science.gov (United States)

    Ramachandran, Rajeswari; Muniyandi, M

    2018-03-01

    Rapid molecular diagnostic methods help in the detection of TB and Rifampicin resistance. These methods detect TB early, are accurate and play a crucial role in reducing the burden of drug resistant tuberculosis. Areas covered: This review analyses rapid molecular diagnostic tools used in the diagnosis of MDR-TB in India, such as the Line Probe Assay and GeneXpert. We have discussed the burden of MDR-TB and the impact of recent diagnostic tools on case detection and treatment outcomes. This review also discusses the costs involved in establishing these new techniques in India. Expert commentary: Molecular methods have considerable advantages for the programmatic management of drug resistant TB. These include speed, standardization of testing, potentially high throughput and reduced laboratory biosafety requirements. There is a desperate need for India to adopt modern, rapid, molecular tools with point-of-care tests being currently evaluated. New molecular diagnostic tests appear to be cost effective and also help in detecting missing cases. There is enough evidence to support the scaling up of these new tools in India.

  4. Detection of multidrug-resistant tuberculosis from stored DNA Samples: A multicenter study

    Directory of Open Access Journals (Sweden)

    Marie Sylvianne Rabodoarivelo

    2018-01-01

    Full Text Available Background: In low-income countries, rapid detection of tuberculosis (TB drug resistance is often restricted by the difficulties of transporting and storing sputum samples from remote health centers to the reference laboratories where molecular tests are available. The aim of this study was to evaluate the performance of four transport and storage systems for molecular detection of rifampicin (RIF and isoniazid (INH resistance. Methods: This was a multicenter study. Molecular detection of RIF and INH resistance was performed directly from smear-positive TB sputa spotted on a slide, FTA card, GenoCard, and ethanol using the Genotype MTBDRplus assay. The performance of the DNA extraction method from each storage support to detect drug resistance was assessed by calculating their sensitivity and specificity compared to the phenotypic method. Results: From all sites, the overall sensitivity and specificity for RIF-resistance detection was 88% and 85%, respectively, for slides, 86% and 92%, respectively, for GenoCard, 87% and 89%, respectively, for FTA card, and 88% and 92%, respectively, for ethanol. For INH-resistance detection, the overall sensitivity and specificity was 82% and 90%, respectively, for slides, 85% and 96%, respectively, for GenoCard, 86% and 92%, respectively, for FTA card, and 86% and 94%, respectively, for ethanol. Conclusion: Smear slides and filter cards showed to be very useful tools to facilitate DNA extraction from sputum samples with the potential to accelerate the detection of drug resistance in remote areas.

  5. Detection of multidrug-resistant tuberculosis from stored DNA Samples: A multicenter study.

    Science.gov (United States)

    Rabodoarivelo, Marie Sylvianne; Brandao, A; Cergole Novella, M C; C Bombonatte, A G; Imperiale, B; Rakotosamimanana, N; Morcillo, N; Rasolofo, V; Palomino, J C; Martin, A

    2018-01-01

    In low-income countries, rapid detection of tuberculosis (TB) drug resistance is often restricted by the difficulties of transporting and storing sputum samples from remote health centers to the reference laboratories where molecular tests are available. The aim of this study was to evaluate the performance of four transport and storage systems for molecular detection of rifampicin (RIF) and isoniazid (INH) resistance. This was a multicenter study. Molecular detection of RIF and INH resistance was performed directly from smear-positive TB sputa spotted on a slide, FTA card, GenoCard, and ethanol using the Genotype MTBDRplus assay. The performance of the DNA extraction method from each storage support to detect drug resistance was assessed by calculating their sensitivity and specificity compared to the phenotypic method. From all sites, the overall sensitivity and specificity for RIF-resistance detection was 88% and 85%, respectively, for slides, 86% and 92%, respectively, for GenoCard, 87% and 89%, respectively, for FTA card, and 88% and 92%, respectively, for ethanol. For INH-resistance detection, the overall sensitivity and specificity was 82% and 90%, respectively, for slides, 85% and 96%, respectively, for GenoCard, 86% and 92%, respectively, for FTA card, and 86% and 94%, respectively, for ethanol. Smear slides and filter cards showed to be very useful tools to facilitate DNA extraction from sputum samples with the potential to accelerate the detection of drug resistance in remote areas.

  6. Retrospective study of tolerability and efficacy of linezolid in patients with multidrug-resistant tuberculosis (1998-2014).

    Science.gov (United States)

    Ramírez-Lapausa, Marta; Pascual Pareja, José Francisco; Carrillo Gómez, Raquel; Martínez-Prieto, Mónica; González-Ruano Pérez, Patricia; Noguerado Asensio, Arturo

    2016-02-01

    Although linezolid is known to be effective when used as an adjunct therapy in the treatment of patients with multidrug-resistant tuberculosis (MDR-TB), the clinical experience is limited. In this study the efficacy and adverse effects of linezolid treatment were evaluated. A retrospective study of tolerability and efficacy of linezolid in MDR-TB patients was performed in Madrid, Spain. Demographic characteristics, microbiological and clinical features and data on treatment tolerability were collected. Regimens were constructed with a target of prescribing, at least, five anti-tuberculosis agents likely to be effective. Linezolid, at a dosage of 1200 or 600 mg daily, was included to complete the treatment if no other sensitive drugs were available. Vitamin B6 was used to reduce toxicity. Treatment outcome and clinical status at last contact were compared between patients with linezolid-containing regimens and with those without linezolid-containing regimens. During the period 1998-2014, 55 patients with MDR-TB received treatment. In 21 of these patients, linezolid was added. The median of linezolid administration was 23.9 months (IQT 13.1-24.7). Patients using linezolid showed a greater resistance to drugs, with a median of 6 (IQR 5-7) compared with those who did not use it, with a median of 4 drugs (IQR 3-5) (plinezolid group (73.5 days) did not differ significantly from those in the non-linezolid group (61 days) (p=0.29). There were no significant differences in the outcomes of the two patient groups. There were no reported adverse events in 81% of patients assigned to linezolid therapy. Only four patients developed toxicity attributed to linezolid. The most serious adverse event in these patients was anemia observed in the two patients treated with 1200 mg per day. One of them also developed moderate paresthesia. In both cases the dosage was reduced to 600 mg per day, with improvement of the anemia and paresthesias. No patients stopped linezolid therapy. A daily

  7. Yield of facility-based verbal screening amongst household contacts of patients with multi-drug resistant tuberculosis in Pakistan

    Directory of Open Access Journals (Sweden)

    Ejaz Qadeer

    2017-05-01

    Full Text Available Background: Household contacts of multidrug-resistant tuberculosis (MDR-TB patients are at a high risk of getting infected with TB/MDR-TB, therefore symptomatic or vulnerable individuals should be screened and treated early. Methods: A cross-sectional study was conducted among household contacts of MDR-TB patients in three high-burden TB sites in Pakistan from July 2013 to June 2014. MDR-TB index patients were asked to provide a list of all members of their household and were asked whether any of them had TB symptoms such as productive cough, fever, weight loss and night sweat (“facility-based verbal screening”. Symptomatic contacts were defined as presumptive TB cases and were invited for investigations at the facility. Those who did not come were paid a home-visit. Confirmed TB/MDR-TB patients were registered in the nearest treatment facility. Results: Of 209 MDR-TB index patients, 1467 household contacts were identified and screened, 95 of them children < 5 years. Of these 172 (12% were symptomatic. Most common symptoms were cough 157 (91% and fever 107 (62%. 58 (34% presumptive TB contacts were not investigated. Of total contacts, 56 (3.8% were diagnosed with TB, among them 54(96% with MDR-TB and 2(4% with drug-susceptible-TB. The number needed to screen (NNS to identify a new MDR-TB case among adult household contacts was 27 and among presumptive adult and pediatric TB contacts was three. All 56 confirmed patients were registered for treatment. Conclusion: Screening household contacts of MDR-TB index cases may be considered a feasible and high yield option, in high-burden, low-resource settings within Pakistan. The number of presumptive TB contacts required to screen to identify a new MDR-TB case was unusually low, indicating an effective strategy that could easily be scaled-up. The screening and management of vulnerable adults and children living with patients having TB of any form is a major priority in the combined efforts

  8. Whole genome sequencing reveals complex evolution patterns of multidrug-resistant Mycobacterium tuberculosis Beijing strains in patients.

    Directory of Open Access Journals (Sweden)

    Matthias Merker

    Full Text Available Multidrug-resistant (MDR Mycobacterium tuberculosis complex (MTBC strains represent a major threat for tuberculosis (TB control. Treatment of MDR-TB patients is long and less effective, resulting in a significant number of treatment failures. The development of further resistances leads to extensively drug-resistant (XDR variants. However, data on the individual reasons for treatment failure, e.g. an induced mutational burst, and on the evolution of bacteria in the patient are only sparsely available. To address this question, we investigated the intra-patient evolution of serial MTBC isolates obtained from three MDR-TB patients undergoing longitudinal treatment, finally leading to XDR-TB. Sequential isolates displayed identical IS6110 fingerprint patterns, suggesting the absence of exogenous re-infection. We utilized whole genome sequencing (WGS to screen for variations in three isolates from Patient A and four isolates from Patient B and C, respectively. Acquired polymorphisms were subsequently validated in up to 15 serial isolates by Sanger sequencing. We determined eight (Patient A and nine (Patient B polymorphisms, which occurred in a stepwise manner during the course of the therapy and were linked to resistance or a potential compensatory mechanism. For both patients, our analysis revealed the long-term co-existence of clonal subpopulations that displayed different drug resistance allele combinations. Out of these, the most resistant clone was fixed in the population. In contrast, baseline and follow-up isolates of Patient C were distinguished each by eleven unique polymorphisms, indicating an exogenous re-infection with an XDR strain not detected by IS6110 RFLP typing. Our study demonstrates that intra-patient microevolution of MDR-MTBC strains under longitudinal treatment is more complex than previously anticipated. However, a mutator phenotype was not detected. The presence of different subpopulations might confound phenotypic and

  9. Multidrug-Resistant Tuberculosis and Its Association with Adrenal Insufficiency: Assessment with the Low-Dose ACTH Stimulation Test

    Directory of Open Access Journals (Sweden)

    René Rodríguez-Gutiérrez

    2016-01-01

    Full Text Available Background. Multidrug-resistant tuberculosis (MDR-TB is a major public health care concern that affects the life of millions of people around the world. The association of tuberculosis and adrenal insufficiency is well known; however, it is thought to be less prevalent every time. A spike in TB incidence and a lack of evidence of this association in patients with MDR-TB call for reassessment of an illness (adrenal dysfunction that if not diagnosed could seriously jeopardize patients’ health. Objective. To determine the prevalence of adrenocortical insufficiency in patients with MDR-TB using the low-dose (1 μg ACTH stimulation test at baseline and at 6–12 months of follow-up after antituberculosis treatment and culture conversion. Methods. A total of 48 men or women, aged ≥18 years (HIV-negative patients diagnosed with pulmonary MDR-TB were included in this prospective observational study. Blood samples for serum cortisol were taken at baseline and 30 and 60 minutes after 1 μg ACTH stimulation at our tertiary level university hospital before and after antituberculosis treatment. Results. Forty-seven percent of subjects had primary MDR-TB; 43.8% had type 2 diabetes; none were HIV-positive. We found at enrollment 2 cases (4.2% of adrenal insufficiency taking 500 nmol/L as the standard cutoff point value and 4 cases (8.3% alternatively, using 550 nmol/L. After antituberculosis intensive phase drug-treatment and a negative mycobacterial culture (10.2±3.6 months adrenocortical function was restored in all cases. Conclusions. In patients with MDR-TB, using the low-dose ACTH stimulation test, a low prevalence of mild adrenal insufficiency was observed. After antituberculosis treatment adrenal function was restored in all cases. Given the increasing and worrying epidemic of MDR-TB these findings have important clinical implications that may help clinicians and patients make better decisions when deciding to test for adrenocortical

  10. Prevalence and molecular characterization of pyrazinamide resistance among multidrug-resistant Mycobacterium tuberculosis isolates from Southern China.

    Science.gov (United States)

    Pang, Yu; Zhu, Damian; Zheng, Huiwen; Shen, Jing; Hu, Yan; Liu, Jie; Zhao, Yanlin

    2017-11-06

    Pyrazinamide (PZA) plays a unique role in the treatment for multidrug-resistant tuberculosis (MDR-TB) in both first- and second-line regimens. The aim of this study was to investigate the prevalence and molecular characterization of PZA resistance among MDR-TB isolates collected in Chongqing municipality. A total of 133 MDR-TB isolates were collected from the smear-positive tuberculosis patients who were registered at local TB dispensaries of Chongqing. PZA susceptibility testing was determined with a Bactec MGIT 960 system. In addition, the genes conferring for PZA resistance were screened by DNA sequencing. Of these 133 MDR-TB isolates, 83 (62.4%) were determined as PZA-resistant by MGIT 960. In addition, streptomycin- (83.1% vs. 56.0%, P < 0.01), ofloxacin- (51.8% vs. 18.0%, P < 0.01), kanamycin- (22.9% vs. 2.0%, P < 0.01), amikacin- (18.1% vs. 2.0%, P = 0.01), capromycin-resistance (12.0% vs. 2.0%, P = 0.05), were more frequently observed among PZA-resistant isolates compared with PZA-susceptible isolates. Sequence analysis revealed that 73 out of 83 (88.0%) MDR strains harbored a mutation located in the pncA gene, including 55 (75.3%, 55/73) of single nucleotide substitutions and 18 (24.7%, 18/73) of frameshift mutation, while no genetic mutation associated with PZA resistance was found in the rpsA gene. The pncA expression of strains harboring substitution from A to G at position -11 in the promoter region of pncA was significantly lower than that of H37Rv (P < 0.01). In conclusion, our data have demonstrated that the analysis of the pncA gene rather than rpsA gene provides rapid and accurate information regarding PZA susceptibility for MDR-TB isolates in Chongqing. In addition, loss of pncA expression caused by promoter mutation confers PZA resistance in MDR-TB isolates.

  11. Time to initiation of multidrug-resistant tuberculosis treatment and its relation with outcome in a high incidence district in Lima, Peru.

    Science.gov (United States)

    Otero, L; De Orbegoso, A; Navarro, A F; Ríos, J; Párraga, T; Gotuzzo, E; Seas, C; Van der Stuyft, P

    2015-03-01

    To determine the time from diagnosis to start of multidrug resistant tuberculosis (MDR TB) treatment in Lima, Peru. We studied new smear-positive TB adults that were started on MDR TB treatment or that were switched to it between June 2008 and December 2011. Time from the first positive smear to MDR-TB treatment was >30 days in 35% (13/37) of patients. Among the 27% (24/88) of patients that switched to MDR-TB treatment, time from the last dose of a drug-susceptible regimen was >30 days. Start of and switching to MDR TB treatment is still delayed. © 2014 John Wiley & Sons Ltd.

  12. Economic evaluation of a shortened standardised treatment regimen of antituberculosis drugs for patients with multidrug-resistant tuberculosis (STREAM): study protocol

    OpenAIRE

    Gama, Elvis; Madan, Jason; Langley, Ivor; Girma, Mamo; Evans, Denise; Rosen, Sydney; Squire, S Bertel

    2016-01-01

    Introduction:\\ud Multidrug-resistant tuberculosis (MDR-TB) poses a serious financial challenge to health systems and patients. The current treatment for patients with MDR-TB takes up to 24 months to complete. Evidence for a shorter regimen which differs from the standard WHO recommended MDR-TB regimen and typically lasts between 9 and 12 months has been reported from Bangladesh. This evaluation aims to assess the economic impact of a shortened regimen on patients and health systems. This eval...

  13. High prevalence of multidrug-resistant tuberculosis among patients with rifampicin resistance using GeneXpert Mycobacterium tuberculosis/rifampicin in Ghana.

    Science.gov (United States)

    Boakye-Appiah, Justice K; Steinmetz, Alexis R; Pupulampu, Peter; Ofori-Yirenkyi, Stephen; Tetteh, Ishmael; Frimpong, Michael; Oppong, Patrick; Opare-Sem, Ohene; Norman, Betty R; Stienstra, Ymkje; van der Werf, Tjip S; Wansbrough-Jones, Mark; Bonsu, Frank; Obeng-Baah, Joseph; Phillips, Richard O

    2016-06-01

    Drug-resistant strains of tuberculosis (TB) represent a major threat to global TB control. In low- and middle-income countries, resource constraints make it difficult to identify and monitor cases of resistance using drug susceptibility testing and culture. Molecular assays such as the GeneXpert Mycobacterium tuberculosis/rifampicin may prove to be a cost-effective solution to this problem in these settings. The objective of this study is to evaluate the use of GeneXpert in the diagnosis of pulmonary TB since it was introduced into two tertiary hospitals in Ghana in 2013. A 2-year retrospective audit of clinical cases involving patients who presented with clinically suspected TB or documented TB not improving on standard therapy and had samples sent for GeneXpert testing. GeneXpert identified 169 cases of TB, including 17 cases of rifampicin-resistant TB. Of the seven cases with final culture and drug susceptibility testing results, six demonstrated further drug resistance and five of these were multidrug-resistant TB. These findings call for a scale-up of TB control in Ghana and provide evidence that the expansion of GeneXpert may be an optimal means to improve case finding and guide treatment of drug-resistant TB in this setting. Copyright © 2016. Published by Elsevier Ltd.

  14. Cost-effectiveness of adding bedaquiline to drug regimens for the treatment of multidrug-resistant tuberculosis in the UK.

    Directory of Open Access Journals (Sweden)

    Lara J Wolfson

    Full Text Available To evaluate the cost-effectiveness of adding bedaquiline to a background regimen (BR of drugs for multidrug-resistant tuberculosis (MDR-TB in the United Kingdom (UK.A cohort-based Markov model was developed to estimate the incremental cost-effectiveness ratio of bedaquiline plus BR (BBR versus BR alone (BR in the treatment of MDR-TB, over a 10-year time horizon. A National Health Service (NHS and personal social services perspective was considered. Cost-effectiveness was evaluated in terms of Quality-Adjusted Life Years (QALYs and Disability-Adjusted Life Years (DALYs. Data were sourced from a phase II, placebo-controlled trial, NHS reference costs, and the literature; the US list price of bedaquiline was used and converted to pounds (£18,800. Costs and effectiveness were discounted at a rate of 3.5% per annum. Probabilistic and deterministic sensitivity analysis was conducted.The total discounted cost per patient (pp on BBR was £106,487, compared with £117,922 for BR. The total discounted QALYs pp were 5.16 for BBR and 4.01 for BR. The addition of bedaquiline to a BR resulted in a cost-saving of £11,434 and an additional 1.14 QALYs pp over a 10-year period, and is therefore considered to be the dominant (less costly and more effective strategy over BR. BBR remained dominant in the majority of sensitivity analyses, with a 81% probability of being dominant versus BR in the probabilistic analysis.In the UK, bedaquiline is likely to be cost-effective and cost-saving, compared with the current MDR-TB standard of care under a range of scenarios. Cost-savings over a 10-year period were realized from reductions in length of hospitalization, which offset the bedaquiline drug costs. The cost-benefit conclusions held after several sensitivity analyses, thus validating assumptions made, and suggesting that the results would hold even if the actual price of bedaquiline in the UK were higher than in the US.

  15. Poor Outcomes in a Cohort of HIV-Infected Adolescents Undergoing Treatment for Multidrug-Resistant Tuberculosis in Mumbai, India

    Science.gov (United States)

    Isaakidis, Petros; Paryani, Roma; Khan, Samsuddin; Mansoor, Homa; Manglani, Mamta; Valiyakath, Asmaa; Saranchuk, Peter; Furin, Jennifer

    2013-01-01

    Background Little is known about the treatment of multidrug-resistant tuberculosis (MDR-TB) in HIV-co-infected adolescents. This study aimed to present the intermediate outcomes of HIV-infected adolescents aged 10–19 years receiving second-line anti-TB treatment in a Médecins Sans Frontières (MSF) project in Mumbai, India. Methods A retrospective review of medical records of 11 adolescents enrolled between July 2007 and January 2013 was undertaken. Patients were initiated on either empirical or individualized second-line ambulatory anti-TB treatment under direct observation. Results The median age was 16 (IQR 14–18) years and 54% were female. Five (46%) adolescents had pulmonary TB (PTB), two (18%) extrapulmonary disease (EPTB) and four (36%) had both. Median CD4 count at the time of MDR-TB diagnosis was 162.7 cells/µl (IQR: 84.8–250.5). By January 2013, eight patients had final and 3 had interim outcomes. Favourable results were seen in four (36.5%) patients: one was cured and three were still on treatment with negative culture results. Seven patients (64%) had poor outcomes: four (36.5%) died and three (27%) defaulted. Three of the patients who died never started on antiretroviral and/or TB treatment and one died 16 days after treatment initiation. Two of the defaulted died soon after default. All patients (100%) on-treatment experienced adverse events (AEs): two required permanent discontinuation of the culprit drug and two were hospitalized due to AEs. No patient required permanent discontinuation of the entire second-line TB or antiretroviral regimens. Conclusions Early mortality and mortality after default were the most common reasons for poor outcomes in this study. Early mortality suggests the need for rapid diagnosis and prompt treatment initiation, and adolescents might benefit from active contact-tracing and immediate referral. Default occurred at different times, suggesting the need for continuous, intensified and individualized psychosocial

  16. High Rate of Hypothyroidism in Multidrug-Resistant Tuberculosis Patients Co-Infected with HIV in Mumbai, India

    Science.gov (United States)

    Andries, Aristomo; Isaakidis, Petros; Das, Mrinalini; Khan, Samsuddin; Paryani, Roma; Desai, Chitranjan; Dalal, Alpa; Mansoor, Homa; Verma, Reena; Fernandes, Dolorosa; Sotgiu, Giovanni; Migliori, Giovanni B.; Saranchuk, Peter

    2013-01-01

    Background Adverse events (AEs) among HIV-infected patients with multidrug-resistant tuberculosis (MDR-TB) receiving anti-TB and antiretroviral treatments (ART) are under-researched and underreported. Hypothyroidism is a common AE associated with ethionamide, p-aminosalicylic acid (PAS), and stavudine. The aim of this study was to determine the frequency of and risk factors associated with hypothyroidism in HIV/MDR-TB co-infected patients. Methods This was a prospective, observational cohort study, using routine laboratory data in a Médecins Sans Frontières (MSF) clinic in collaboration with Sewri TB Hospital, Mumbai, India. Hypothyroidism was defined as a thyroid stimulating hormone (TSH) result >10 mIU/L at least once during treatment. Patients having a baseline result and one additional result after 3 months were eligible for enrolment. Results Between October 2006 and March 2013, 116 patients were enrolled, 69 of whom were included. The median (IQR) age was 38 years (34-43) and 61% were male. By March 2013, 37/69 (54%) had hypothyroidism after at least 90 days of treatment. Age, gender, CD4 counts and stavudine-based ART were not associated with the occurrence of hypothyroidism in multivariate models. The co-administration of PAS and ethionamide was found to double the risk of hypothyroidism (RR: 1.93, 95% CI: 1.06-3.54). Discussion High rate of hypothyroidism was recorded in a Mumbai cohort of MDR-TB/HIV co-infected patients on treatment. This is a treatable and reversible AE, however, it may go undiagnosed in the absence of regular monitoring. Care providers should not wait for clinical symptoms, as this risks compromising treatment adherence. Simple, affordable and reliable point-of-care tools for measuring TSH are needed, especially in high MDR-TB burden countries. Our findings suggest the need for TSH screening at baseline, three months, six months, and every six months thereafter for HIV-infected patients on MDR-TB treatment regimens containing PAS and

  17. Poor outcomes in a cohort of HIV-infected adolescents undergoing treatment for multidrug-resistant tuberculosis in Mumbai, India.

    Directory of Open Access Journals (Sweden)

    Petros Isaakidis

    Full Text Available BACKGROUND: Little is known about the treatment of multidrug-resistant tuberculosis (MDR-TB in HIV-co-infected adolescents. This study aimed to present the intermediate outcomes of HIV-infected adolescents aged 10-19 years receiving second-line anti-TB treatment in a Médecins Sans Frontières (MSF project in Mumbai, India. METHODS: A retrospective review of medical records of 11 adolescents enrolled between July 2007 and January 2013 was undertaken. Patients were initiated on either empirical or individualized second-line ambulatory anti-TB treatment under direct observation. RESULTS: The median age was 16 (IQR 14-18 years and 54% were female. Five (46% adolescents had pulmonary TB (PTB, two (18% extrapulmonary disease (EPTB and four (36% had both. Median CD4 count at the time of MDR-TB diagnosis was 162.7 cells/µl (IQR: 84.8-250.5. By January 2013, eight patients had final and 3 had interim outcomes. Favourable results were seen in four (36.5% patients: one was cured and three were still on treatment with negative culture results. Seven patients (64% had poor outcomes: four (36.5% died and three (27% defaulted. Three of the patients who died never started on antiretroviral and/or TB treatment and one died 16 days after treatment initiation. Two of the defaulted died soon after default. All patients (100% on-treatment experienced adverse events (AEs: two required permanent discontinuation of the culprit drug and two were hospitalized due to AEs. No patient required permanent discontinuation of the entire second-line TB or antiretroviral regimens. CONCLUSIONS: Early mortality and mortality after default were the most common reasons for poor outcomes in this study. Early mortality suggests the need for rapid diagnosis and prompt treatment initiation, and adolescents might benefit from active contact-tracing and immediate referral. Default occurred at different times, suggesting the need for continuous, intensified and individualized psychosocial

  18. Poor outcomes in a cohort of HIV-infected adolescents undergoing treatment for multidrug-resistant tuberculosis in Mumbai, India.

    Science.gov (United States)

    Isaakidis, Petros; Paryani, Roma; Khan, Samsuddin; Mansoor, Homa; Manglani, Mamta; Valiyakath, Asmaa; Saranchuk, Peter; Furin, Jennifer

    2013-01-01

    Little is known about the treatment of multidrug-resistant tuberculosis (MDR-TB) in HIV-co-infected adolescents. This study aimed to present the intermediate outcomes of HIV-infected adolescents aged 10-19 years receiving second-line anti-TB treatment in a Médecins Sans Frontières (MSF) project in Mumbai, India. A retrospective review of medical records of 11 adolescents enrolled between July 2007 and January 2013 was undertaken. Patients were initiated on either empirical or individualized second-line ambulatory anti-TB treatment under direct observation. The median age was 16 (IQR 14-18) years and 54% were female. Five (46%) adolescents had pulmonary TB (PTB), two (18%) extrapulmonary disease (EPTB) and four (36%) had both. Median CD4 count at the time of MDR-TB diagnosis was 162.7 cells/µl (IQR: 84.8-250.5). By January 2013, eight patients had final and 3 had interim outcomes. Favourable results were seen in four (36.5%) patients: one was cured and three were still on treatment with negative culture results. Seven patients (64%) had poor outcomes: four (36.5%) died and three (27%) defaulted. Three of the patients who died never started on antiretroviral and/or TB treatment and one died 16 days after treatment initiation. Two of the defaulted died soon after default. All patients (100%) on-treatment experienced adverse events (AEs): two required permanent discontinuation of the culprit drug and two were hospitalized due to AEs. No patient required permanent discontinuation of the entire second-line TB or antiretroviral regimens. Early mortality and mortality after default were the most common reasons for poor outcomes in this study. Early mortality suggests the need for rapid diagnosis and prompt treatment initiation, and adolescents might benefit from active contact-tracing and immediate referral. Default occurred at different times, suggesting the need for continuous, intensified and individualized psychosocial support for co-infected adolescents

  19. Intensive-phase treatment outcomes among hospitalized multidrug-resistant tuberculosis patients: results from a nationwide cohort in Nigeria.

    Directory of Open Access Journals (Sweden)

    Olanrewaju Oladimeji

    Full Text Available BACKGROUND: Nigeria is faced with a high burden of Human Immunodeficiency Virus (HIV infection and multidrug-resistant tuberculosis (MDR-TB. Treatment outcomes among MDR-TB patients registered across the globe have been poor, partly due to high loss-to-follow-up. To address this challenge, MDR-TB patients in Nigeria are hospitalized during the intensive-phase(IP of treatment (first 6-8 months and are provided with a package of care including standardized MDR-TB treatment regimen, antiretroviral therapy (ART and cotrimoxazole prophylaxis (CPT for HIV-infected patients, nutritional and psychosocial support. In this study, we report the end-IP treatment outcomes among them. METHODS: In this retrospective cohort study, we reviewed the patient records of all bacteriologically-confirmed MDR-TB patients admitted for treatment between July 2010 and October 2012. RESULTS: Of 162 patients, 105(65% were male, median age was 34 years and 28(17% were HIV-infected; all 28 received ART and CPT. Overall, 138(85% were alive and culture negative at the end of IP, 24(15% died and there was no loss-to-follow-up. Mortality was related to low CD4-counts at baseline among HIV-positive patients. The median increase in body mass index among those documented to be underweight was 2.6 kg/m2 (p<0.01 and CD4-counts improved by a median of 52 cells/microL among the HIV-infected patients (p<0.01. CONCLUSIONS: End-IP treatment outcomes were exceptional compared to previously published data from international cohorts, thus confirming the usefulness of a hospitalized model of care. However, less than five percent of all estimated 3600 MDR-TB patients in Nigeria were initiated on treatment during the study period. Given the expected scale-up of MDR-TB care, the hospitalized model is challenging to sustain and the national TB programme is contemplating to move to ambulatory care. Hence, we recommend using both ambulatory and hospitalized approaches, with the latter being reserved

  20. MULTIDRUG-RESISTANT TUBERCULOSIS

    African Journals Online (AJOL)

    Kurt

    health, with the focus of DOTS programmes on cure of infectious TB patients and prevention of drug resistance. ... Despite highly effective drugs and disease control strategies, morbidity and mortality .... notification and registration system.

  1. MULTIDRUG-RESISTANT TUBERCULOSIS

    African Journals Online (AJOL)

    Kurt

    grammes consider implementation of MDR-TB treatment using second-line reserve .... patients with persistently positive acid- fast bacilli ... and emotional support are particularly ..... Importance of socioeconomic conditions should ... not be underestimated as contributing factor to ... Depression and depressive symptoms may.

  2. Extensively and Pre-Extensively Drug Resistant Tuberculosis in Clinical Isolates of Multi-Drug Resistant Tuberculosis Using Classical Second Line Drugs (Levofloxacin and Amikacin)

    International Nuclear Information System (INIS)

    Mirza, I. A.; Khan, F. A.; Khan, K. A.; Satti, L.; Ghafoor, T.; Fayyaz, M.

    2015-01-01

    Objective:To find out the frequency of Extensively Drug Resistant (XDR) and pre-XDR tuberculosis in clinical isolates of Multi-Drug Resistant (MDR) Tuberculosis (TB) by determining the susceptibilities against Levofloxacin and Amikacin (classical second line antituberculosis drugs). Study Design: A descriptive cross-sectional study. Place and Duration of Study: Microbiology Department, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from September 2011 to August 2013. Methodology: Amikacin (AK) and Levofloxacin (LEVO) were obtained in chemically pure form from Sigma (Taufkirchen, Germany). The breakpoint concentration used for AK was 1.0 micro g/ml and for LEVO 2.0 micro g/ml. Mycobacterial Growth Indicator Tube (MGIT) 960 system was used to carry out drug susceptibility testing as per recommended protocol. Results: A total of 3 MDR-TB isolates (3 percentage) turned out to be XDR-TB based upon simultaneous resistance to injectable second line antituberculosis drug AK and one of the fluoro-quinolones (LEVO). A total of 24 MDR-TB isolates (24 percentage) were found to be pre-XDR based upon resistance to LEVO alone. Treatment status record of patients with XDR and pre-XDRTB isolates revealed that majority of patients had received fluoroquinolones (FQs) during the course of treatment. Conclusion: XDR-TB has started to emerge in MDR-TB isolates in our set up. The worrying sign is the high frequency of pre-XDR tuberculosis. Urgent steps need to be taken to stem the tide of pre-XDR-TB in our population. It is thus recommended to develop facilities to carry out drug susceptibility testing to monitor the status of pre-XDR and XDR-TB in our population. (author)

  3. Culture and drug sensitivity testing among patients with pulmonary tuberculosis in Mexico: national data for 2009–2013

    Directory of Open Access Journals (Sweden)

    Ivonne Orejel

    Full Text Available ABSTRACT This study documented the number and results of mycobacterial culture and drug sensitivity testing (CDST in Mexico from 2009–2013 and assessed whether states with a higher risk of multidrug-resistant tuberculosis (MDR-TB performed more CDST and had more cultures showing MDR-TB. Data for this longitudinal, descriptive, operational research study came from the electronic records of 31 state public health laboratories in Mexico. The total number of CDSTs was 6 470, increasing from 2 143 in the first 2 years to 4 327 in the latter 3 years. There was a significant increase in the proportion of cultures showing sensitivity to all drugs, from 53.1% to 60.9% in 2011–2013 (P < 0.001 and a significant decrease in the proportion showing MDR-TB, from 28.2% in 2009 to 19.8% in 2013 (P < 0.001. Cases of extensively drug resistant tuberculosis were < 1% per year. In the 12 states with higher risk for MDR-TB, significantly more CDSTs (2 382 test were done in 2011–2013 than in the other 19 states (1 945 tests. Also, for each year the proportion of cultures showing MDR-TB was significantly higher in high risk MDR-TB states than in lower risk ones (P < 0.001. During the 5-year study period, CDST was scaled up in Mexico, particularly in high-risk MDR-TB states where a higher proportion of cultures showed MDR-TB. Scale up and wider coverage of CDST should continue.

  4. Estimating the future burden of multidrug-resistant and extensively drug-resistant tuberculosis in India, the Philippines, Russia, and South Africa: a mathematical modelling study.

    Science.gov (United States)

    Sharma, Aditya; Hill, Andrew; Kurbatova, Ekaterina; van der Walt, Martie; Kvasnovsky, Charlotte; Tupasi, Thelma E; Caoili, Janice C; Gler, Maria Tarcela; Volchenkov, Grigory V; Kazennyy, Boris Y; Demikhova, Olga V; Bayona, Jaime; Contreras, Carmen; Yagui, Martin; Leimane, Vaira; Cho, Sang Nae; Kim, Hee Jin; Kliiman, Kai; Akksilp, Somsak; Jou, Ruwen; Ershova, Julia; Dalton, Tracy; Cegielski, Peter

    2017-07-01

    Multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis are emerging worldwide. The Green Light Committee initiative supported programmatic management of drug-resistant tuberculosis in 90 countries. We used estimates from the Preserving Effective TB Treatment Study to predict MDR and XDR tuberculosis trends in four countries with a high burden of MDR tuberculosis: India, the Philippines, Russia, and South Africa. We calibrated a compartmental model to data from drug resistance surveys and WHO tuberculosis reports to forecast estimates of incident MDR and XDR tuberculosis and the percentage of incident MDR and XDR tuberculosis caused by acquired drug resistance, assuming no fitness cost of resistance from 2000 to 2040 in India, the Philippines, Russia, and South Africa. The model forecasted the percentage of MDR tuberculosis among incident cases of tuberculosis to increase, reaching 12·4% (95% prediction interval 9·4-16·2) in India, 8·9% (4·5-11·7) in the Philippines, 32·5% (27·0-35·8) in Russia, and 5·7% (3·0-7·6) in South Africa in 2040. It also predicted the percentage of XDR tuberculosis among incident MDR tuberculosis to increase, reaching 8·9% (95% prediction interval 5·1-12·9) in India, 9·0% (4·0-14·7) in the Philippines, 9·0% (4·8-14·2) in Russia, and 8·5% (2·5-14·7) in South Africa in 2040. Acquired drug resistance would cause less than 30% of incident MDR tuberculosis during 2000-40. Acquired drug resistance caused 80% of incident XDR tuberculosis in 2000, but this estimate would decrease to less than 50% by 2040. MDR and XDR tuberculosis were forecast to increase in all four countries despite improvements in acquired drug resistance shown by the Green Light Committee-supported programmatic management of drug-resistant tuberculosis. Additional control efforts beyond improving acquired drug resistance rates are needed to stop the spread of MDR and XDR tuberculosis in countries with a high burden of MDR

  5. Prevalence of resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients in Viet Nam, 2011.

    Science.gov (United States)

    Nguyen, Hoa Binh; Nguyen, Nhung Viet; Tran, Huong Thi Giang; Nguyen, Hai Viet; Bui, Quyen Thi Tu

    2016-01-01

    Extensively drug-resistant tuberculosis (XDR-TB) represents an emerging public health problem worldwide. According to the World Health Organization, an estimated 9.7% of multidrug-resistant TB (MDR-TB) cases are defined as XDR-TB globally. The objective of this study was to determine the prevalence of drug resistance to second-line TB drugs among MDR-TB cases detected in the Fourth National Anti-Tuberculosis Drug Resistance Survey in Viet Nam. Eighty clusters of TB cases were selected using a probability-proportion-to-size approach. To identify MDR-TB cases, drug susceptibility testing (DST) was performed for the four major first-line TB drugs. DST of second-line drugs (ofloxacin, amikacin, kanamycin, capreomycin) was performed on isolates from MDR-TB cases to identify pre-XDR and XDR cases. A total of 1629 smear-positive TB cases were eligible for culture and DST. Of those, DST results for first-line drugs were available for 1312 cases, and 91 (6.9%) had MDR-TB. Second-line DST results were available for 84 of these cases. Of those, 15 cases (17.9%) had ofloxacin resistance and 6.0% were resistant to kanamycin and capreomycin. Five MDR-TB cases (6.0%) met the criteria of XDR-TB. This survey provides the first estimates of the proportion of XDR-TB among MDR-TB cases in Viet Nam and provides important information for local policies regarding second-line DST. Local policies and programmes that are geared towards TB prevention, early diagnosis and treatment with effective regimens are of high importance.

  6. Use of GenoType® MTBDRplus assay to assess drug resistance and mutation patterns of multidrug-resistant tuberculosis isolates in northern India

    Directory of Open Access Journals (Sweden)

    A K Maurya

    2013-01-01

    Full Text Available Purpose: The emergence and spread of multidrug-resistant tuberculosis (MDR-TB is a major public health problem. The diagnosis of MDR-TB is of paramount importance in establishing appropriate clinical management and infection control measures. The aim of this study was to evaluate drug resistance and mutational patterns in clinical isolates MDR-TB by GenoType® MTBDRplus assay. Material and Methods: A total of 350 non-repeated sputum specimens were collected from highly suspected drug-resistant pulmonary tuberculosis (PTB cases; which were processed by microscopy, culture, differentiation and first line drug susceptibility testing (DST using BacT/ALERT 3D system. Results: Among a total of 125 mycobacterium tuberculosis complex (MTBC strains, readable results were obtained from 120 (96% strains by GenoType® MTBDRplus assay. Only 45 MDR-TB isolates were analysed for the performance, frequency and mutational patterns by GenoType® MTBDRplus assay. The sensitivity of the GenoType® MDRTBplus assay for detecting individual resistance to rifampicin (RIF, isoniazid (INH and multidrug resistance was found to be 95.8%, 96.3% and 97.7%, respectively. Mutation in codon S531L of the rpoB gene and codon S315T1 of katG genes were dominated in MDR-TB strains, respectively (P < 0.05. Conclusions: The GenoType® MTBDRplus assay is highly sensitive with short turnaround times and a rapid test for the detection of the most common mutations conferring resistance in MDR-TB strains that can readily be included in a routine laboratory workflow.

  7. Pharmacokinetics and Dosing of Levofloxacin in Children Treated for Active or Latent Multidrug-resistant Tuberculosis, Federated States of Micronesia and Republic of the Marshall Islands.

    Science.gov (United States)

    Mase, Sundari R; Jereb, John A; Gonzalez, Daniel; Martin, Fatma; Daley, Charles L; Fred, Dorina; Loeffler, Ann M; Menon, Lakshmy R; Bamrah Morris, Sapna; Brostrom, Richard; Chorba, Terence; Peloquin, Charles A

    2016-04-01

    In the Federated States of Micronesia and then the Republic of the Marshall Islands (RMI), levofloxacin pharmacokinetics were studied in children receiving directly observed once-daily regimens (10 mg/kg, age >5 years; 15-20 mg/kg, age ≤5 years) for either multidrug-resistant tuberculosis disease or latent infection after multidrug-resistant tuberculosis exposure, to inform future dosing strategies. Blood samples were collected at 0 (RMI only), 1, 2 and 6 hours (50 children, aged 6 months to 15 years) after oral levofloxacin at >6 weeks of treatment. Clinical characteristics and maximal drug concentration (Cmax) of levofloxacin, elimination half-life and area under the curve from 0 to 24 hours (AUC0-24 hours × μg/mL) were correlated to determine the optimal dosage and to examine associations. Population pharmacokinetics and target attainment were modeled. With results from the Federated States of Micronesia, dosages were increased in RMI toward the target Cmax for Mycobacterium tuberculosis, 8-12 µg/mL. Cmax correlated linearly with per-weight dosage. Neither Cmax nor half-life was associated with gender, age, body mass index, concurrent medications or predose meals. At levofloxacin dosage of 15-20 mg/kg, Cmax ≥8 µg/mL was observed, and modeling corroborated a high target attainment across the ratio of the area under the free concentration versus time curve to minimum inhibitory concentration (fAUCss,0-24/MIC) values. Levofloxacin dosage should be 15-20 mg/kg for Cmax ≥8 µg/mL and a high target attainment across fAUCss,0-24/MIC values in children ≥2 years of age.

  8. Prevalence and occurrence rate of Mycobacterium tuberculosis Haarlem family multi-drug resistant in the worldwide population: A systematic review and meta-analysis

    Science.gov (United States)

    Ramazanzadeh, Rashid; Roshani, Daem; Shakib, Pegah; Rouhi, Samaneh

    2015-01-01

    Background: Transmission of Mycobacterium tuberculosis (M. tuberculosis) can occur in different ways. Furthermore, drug resistant in M. tuberculosis family is a major problem that creates obstacles in treatment and control of tuberculosis (TB) in the world. One of the most prevalent families of M. tuberculosis is Haarlem, and it is associated with drug resistant. Our objectives of this study were to determine the prevalence and occurrence rate of M. tuberculosis Haarlem family multi-drug resistant (MDR) in the worldwide using meta-analysis based on a systematic review that performed on published articles. Materials and Methods: Data sources of this study were 78 original articles (2002-2012) that were published in the literatures in several databases including PubMed, Science Direct, Google Scholar, Biological abstracts, ISI web of knowledge and IranMedex. The articles were systematically reviewed for prevalence and rate of MDR. Data were analyzed using meta-analysis and random effects models with the software package Meta R, Version 2.13 (P < 0.10). Results: Final analysis included 28601 persons in 78 articles. The highest and lowest occurrence rate of Haarlem family in M. tuberculosis was in Hungary in 2006 (66.20%) with negative MDR-TB and in China in 2010 (0.8%), respectively. From 2002 to 2012, the lowest rate of prevalence was in 2010, and the highest prevalence rate was in 2012. Also 1.076% were positive for MDR and 9.22% were negative (confidence interval: 95%).0020. Conclusion: Many articles and studies are performed in this field globally, and we only chose some of them. Further studies are needed to be done in this field. Our study showed that M. tuberculosis Haarlem family is prevalent in European countries. According to the presence of MDR that was seen in our results, effective control programs are needed to control the spread of drug-resistant strains, especially Haarlem family. PMID:25767526

  9. Improved Survival and Cure Rates With Concurrent Treatment for Multidrug-Resistant Tuberculosis-Human Immunodeficiency Virus Coinfection in South Africa.

    Science.gov (United States)

    Brust, James C M; Shah, N Sarita; Mlisana, Koleka; Moodley, Pravi; Allana, Salim; Campbell, Angela; Johnson, Brent A; Master, Iqbal; Mthiyane, Thuli; Lachman, Simlatha; Larkan, Lee-Megan; Ning, Yuming; Malik, Amyn; Smith, Jonathan P; Gandhi, Neel R

    2018-04-03

    Mortality in multidrug-resistant (MDR) tuberculosis-human immunodeficiency virus (HIV) coinfection has historically been high, but most studies predated the availability of antiretroviral therapy (ART). We prospectively compared survival and treatment outcomes in MDR tuberculosis-HIV-coinfected patients on ART to those in patients with MDR tuberculosis alone. This observational study enrolled culture-confirmed MDR tuberculosis patients with and without HIV in South Africa between 2011 and 2013. Participants received standardized MDR tuberculosis and HIV regimens and were followed monthly for treatment response, adverse events, and adherence. The primary outcome was survival. Among 206 participants, 150 were HIV infected, 131 (64%) were female, and the median age was 33 years (interquartile range [IQR], 26-41). Of the 191 participants with a final MDR tuberculosis outcome, 130 (73%) were cured or completed treatment, which did not differ by HIV status (P = .50). After 2 years, CD4 count increased a median of 140 cells/mm3 (P = .005), and 64% had an undetectable HIV viral load. HIV-infected and HIV-uninfected participants had high rates of survival (86% and 94%, respectively; P = .34). The strongest risk factor for mortality was having a CD4 count ≤100 cells/mm3 (adjusted hazards ratio, 15.6; 95% confidence interval, 4.4-55.6). Survival and treatment outcomes among MDR tuberculosis-HIV individuals receiving concurrent ART approached those of HIV-uninfected patients. The greatest risk of death was among HIV-infected individuals with CD4 counts ≤100 cells/mm3. These findings provide critical evidence to support concurrent treatment of MDR tuberculosis and HIV.

  10. Prevalence and occurrence rate of Mycobacterium tuberculosis Haarlem family multi-drug resistant in the worldwide population: A systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Rashid Ramazanzadeh

    2015-01-01

    Full Text Available Background: Transmission of Mycobacterium tuberculosis (M. tuberculosis can occur in different ways. Furthermore, drug resistant in M. tuberculosis family is a major problem that creates obstacles in treatment and control of tuberculosis (TB in the world. One of the most prevalent families of M. tuberculosis is Haarlem, and it is associated with drug resistant. Our objectives of this study were to determine the prevalence and occurrence rate of M. tuberculosis Haarlem family multi-drug resistant (MDR in the worldwide using meta-analysis based on a systematic review that performed on published articles. Materials and Methods: Data sources of this study were 78 original articles (2002-2012 that were published in the literatures in several databases including PubMed, Science Direct, Google Scholar, Biological abstracts, ISI web of knowledge and IranMedex. The articles were systematically reviewed for prevalence and rate of MDR. Data were analyzed using meta-analysis and random effects models with the software package Meta R, Version 2.13 (P < 0.10. Results: Final analysis included 28601 persons in 78 articles. The highest and lowest occurrence rate of Haarlem family in M. tuberculosis was in Hungary in 2006 (66.20% with negative MDR-TB and in China in 2010 (0.8%, respectively. From 2002 to 2012, the lowest rate of prevalence was in 2010, and the highest prevalence rate was in 2012. Also 1.076% were positive for MDR and 9.22% were negative (confidence interval: 95%.0020. Conclusion: Many articles and studies are performed in this field globally, and we only chose some of them. Further studies are needed to be done in this field. Our study showed that M. tuberculosis Haarlem family is prevalent in European countries. According to the presence of MDR that was seen in our results, effective control programs are needed to control the spread of drug-resistant strains, especially Haarlem family.

  11. Primary Multidrug Resistant Tuberculosis and Utility of Line Probe Assay for Its Detection in Smear-Positive Sputum Samples in a Tertiary Care Hospital in South India

    Directory of Open Access Journals (Sweden)

    Fahmiya Leena Yacoob

    2016-01-01

    Full Text Available In a high tuberculosis burdened country like India, rapid, cost-effective, and reliable diagnostic tools for tuberculosis are an urgent need of the hour to prevent inappropriate treatment strategies and further spread of resistance. This study aimed to estimate the proportion of new smear-positive tuberculosis cases with primary resistance to rifampicin and/or isoniazid as well as identify the common mutations associated with it. Sputum of 200 newly diagnosed smear-positive cases of 1+ score and above was directly subjected to Line Probe Assay using the GenoType MTBDRplus assay kit. All samples were inoculated onto solid media and 61 samples were inoculated in automated liquid culture also. The Line Probe Assay gave hundred percent interpretable results with 2.5% of the study population showing resistant pattern. Only 1% of the cases were primary multidrug resistant tuberculosis and 1.5% showed isoniazid monoresistance. S531L and C15T were the most common genetic mutations seen for rifampicin and isoniazid resistance, respectively. 40% had absent rpoB wild type 8 band indicating probable silent mutation after clinical correlation. The average turnaround time for Line Probe Assay was far less (3.8 days as compared to solid and liquid cultures (35.6 days and 13.5 days, resp..

  12. Primary Multidrug Resistant Tuberculosis and Utility of Line Probe Assay for Its Detection in Smear-Positive Sputum Samples in a Tertiary Care Hospital in South India.

    Science.gov (United States)

    Yacoob, Fahmiya Leena; Philomina Jose, Beena; Karunakaran Lelitha, Sarada Devi; Sreenivasan, Sreelatha

    2016-01-01

    In a high tuberculosis burdened country like India, rapid, cost-effective, and reliable diagnostic tools for tuberculosis are an urgent need of the hour to prevent inappropriate treatment strategies and further spread of resistance. This study aimed to estimate the proportion of new smear-positive tuberculosis cases with primary resistance to rifampicin and/or isoniazid as well as identify the common mutations associated with it. Sputum of 200 newly diagnosed smear-positive cases of 1+ score and above was directly subjected to Line Probe Assay using the GenoType MTBDRplus assay kit. All samples were inoculated onto solid media and 61 samples were inoculated in automated liquid culture also. The Line Probe Assay gave hundred percent interpretable results with 2.5% of the study population showing resistant pattern. Only 1% of the cases were primary multidrug resistant tuberculosis and 1.5% showed isoniazid monoresistance. S531L and C15T were the most common genetic mutations seen for rifampicin and isoniazid resistance, respectively. 40% had absent rpoB wild type 8 band indicating probable silent mutation after clinical correlation. The average turnaround time for Line Probe Assay was far less (3.8 days) as compared to solid and liquid cultures (35.6 days and 13.5 days, resp.).

  13. High levels of multidrug resistant tuberculosis in new and treatment-failure patients from the Revised National Tuberculosis Control Programme in an urban metropolis (Mumbai in Western India

    Directory of Open Access Journals (Sweden)

    Nicol Mark

    2009-06-01

    Full Text Available Abstract Background India, China and Russia account for more than 62% of multidrug resistant tuberculosis (MDRTB globally. Within India, locations like urban metropolitan Mumbai with its burgeoning population and high incidence of TB are suspected to be a focus for MDRTB. However apart from sporadic surveys at watched sites in the country, there has been no systematic attempt by the Revised National Tuberculosis Control Programme (RNTCP of India to determine the extent of MDRTB in Mumbai that could feed into national estimates. Drug susceptibility testing (DST is not routinely performed as a part of programme policy and public health laboratory infrastructure, is limited and poorly equipped to cope with large scale testing. Methods From April 2004 to January 2007 we determined the extent of drug resistance in 724 {493 newly diagnosed, previously untreated and 231 first line treatment failures (sputum-smear positive at the fifth month after commencement of therapy} cases of pulmonary tuberculosis drawn from the RNTCP in four suboptimally performing municipal wards of Mumbai. The observations were obtained using a modified radiorespirometric Buddemeyer assay and validated by the Swedish Institute for Infectious Disease Control, Stockholm, a supranational reference laboratory. Data was analyzed utilizing SPSS 10.0 and Epi Info 2002. Results This study undertaken for the first time in RNTCP outpatients in Mumbai reveals a high proportion of MDRTB strains in both previously untreated (24% and treatment-failure cases (41%. Amongst new cases, resistance to 3 or 4 drug combinations (amplified drug resistance including isoniazid (H and rifampicin (R, was greater (20% than resistance to H and R alone (4% at any point in time during the study. The trend for monoresistance was similar in both groups remaining highest to H and lowest to R. External quality control revealed good agreement for H and R resistance (k = 0.77 and 0.76 respectively. Conclusion

  14. High levels of multidrug resistant tuberculosis in new and treatment-failure patients from the Revised National Tuberculosis Control Programme in an urban metropolis (Mumbai) in Western India.

    Science.gov (United States)

    D'souza, Desiree T B; Mistry, Nerges F; Vira, Tina S; Dholakia, Yatin; Hoffner, Sven; Pasvol, Geoffrey; Nicol, Mark; Wilkinson, Robert J

    2009-06-29

    India, China and Russia account for more than 62% of multidrug resistant tuberculosis (MDRTB) globally. Within India, locations like urban metropolitan Mumbai with its burgeoning population and high incidence of TB are suspected to be a focus for MDRTB. However apart from sporadic surveys at watched sites in the country, there has been no systematic attempt by the Revised National Tuberculosis Control Programme (RNTCP) of India to determine the extent of MDRTB in Mumbai that could feed into national estimates. Drug susceptibility testing (DST) is not routinely performed as a part of programme policy and public health laboratory infrastructure, is limited and poorly equipped to cope with large scale testing. From April 2004 to January 2007 we determined the extent of drug resistance in 724 {493 newly diagnosed, previously untreated and 231 first line treatment failures (sputum-smear positive at the fifth month after commencement of therapy)} cases of pulmonary tuberculosis drawn from the RNTCP in four suboptimally performing municipal wards of Mumbai. The observations were obtained using a modified radiorespirometric Buddemeyer assay and validated by the Swedish Institute for Infectious Disease Control, Stockholm, a supranational reference laboratory. Data was analyzed utilizing SPSS 10.0 and Epi Info 2002. This study undertaken for the first time in RNTCP outpatients in Mumbai reveals a high proportion of MDRTB strains in both previously untreated (24%) and treatment-failure cases (41%). Amongst new cases, resistance to 3 or 4 drug combinations (amplified drug resistance) including isoniazid (H) and rifampicin (R), was greater (20%) than resistance to H and R alone (4%) at any point in time during the study. The trend for monoresistance was similar in both groups remaining highest to H and lowest to R. External quality control revealed good agreement for H and R resistance (k = 0.77 and 0.76 respectively). Levels of MDRTB are much higher in both previously

  15. Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

    Science.gov (United States)

    Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

    2016-05-01

    For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

  16. Viability, biofilm formation, and MazEF expression in drug-sensitive and drug-resistant Mycobacterium tuberculosis strains circulating in Xinjiang, China.

    Science.gov (United States)

    Zhao, Ji-Li; Liu, Wei; Xie, Wan-Ying; Cao, Xu-Dong; Yuan, Li

    2018-01-01

    Tuberculosis (TB) caused by Mycobacterium tuberculosis (MTB) is one of the most common chronic infectious amphixenotic diseases worldwide. Prevention and control of TB are greatly difficult, due to the increase in drug-resistant TB, particularly multidrug-resistant TB. We speculated that there were some differences between drug-sensitive and drug-resistant MTB strains and that mazEF 3,6,9 toxin-antitoxin systems (TASs) were involved in MTB viability. This study aimed to investigate differences in viability, biofilm formation, and MazEF expression between drug-sensitive and drug-resistant MTB strains circulating in Xinjiang, China, and whether mazEF 3,6,9 TASs contribute to MTB viability under stress conditions. Growth profiles and biofilm-formation abilities of drug-sensitive, drug-resistant MTB strains and the control strain H37Rv were monitored. Using molecular biology experiments, the mRNA expression of the mazF 3, 6, and 9 toxin genes, the mazE 3, 6, and 9 antitoxin genes, and expression of the MazF9 protein were detected in the different MTB strains, H37RvΔ mazEF 3,6,9 mutants from the H37Rv parent strain were generated, and mutant viability was tested. Ex vivo culture analyses demonstrated that drug-resistant MTB strains exhibit higher survival rates than drug-sensitive strains and the control strain H37Rv. However, there was no statistical difference in biofilm-formation ability in the drug-sensitive, drug-resistant, and H37Rv strains. mazE 3,6 mRNA-expression levels were relatively reduced in the drug-sensitive and drug-resistant strains compared to H37Rv. Conversely, mazE 3,9 expression was increased in drug-sensitive strains compared to drug-resistant strains. Furthermore, compared with the H37Rv strain, mazF 3,6 expression was increased in drug-resistant strains, mazF 9 expression was increased in drug-sensitive strains, and mazF 9 exhibited reduced expression in drug-resistant strains compared with drug-sensitive strains. Protein expression of mazF9

  17. Impact of Infection Control Measures to Control an Outbreak of Multidrug-Resistant Tuberculosis in a Human Immunodeficiency Virus Ward, Peru

    Science.gov (United States)

    Ticona, Eduardo; Huaroto, Luz; Kirwan, Daniela E.; Chumpitaz, Milagros; Munayco, César V.; Maguiña, Mónica; Tovar, Marco A.; Evans, Carlton A.; Escombe, Roderick; Gilman, Robert H.

    2016-01-01

    Multidrug-resistant tuberculosis (MDRTB) rates in a human immunodeficiency virus (HIV) care facility increased by the year 2000—56% of TB cases, eight times the national MDRTB rate. We reported the effect of tuberculosis infection control measures that were introduced in 2001 and that consisted of 1) building a respiratory isolation ward with mechanical ventilation, 2) triage segregation of patients, 3) relocation of waiting room to outdoors, 4) rapid sputum smear microscopy, and 5) culture/drug–susceptibility testing with the microscopic-observation drug-susceptibility assay. Records pertaining to patients attending the study site between 1997 and 2004 were reviewed. Six hundred and fifty five HIV/TB–coinfected patients (mean age 33 years, 79% male) who attended the service during the study period were included. After the intervention, MDRTB rates declined to 20% of TB cases by the year 2004 (P = 0.01). Extremely limited access to antiretroviral therapy and specific MDRTB therapy did not change during this period, and concurrently, national MDRTB prevalence increased, implying that the infection control measures caused the fall in MDRTB rates. The infection control measures were estimated to have cost US$91,031 while preventing 97 MDRTB cases, potentially saving US$1,430,026. Thus, this intervention significantly reduced MDRTB within an HIV care facility in this resource-constrained setting and should be cost-effective. PMID:27621303

  18. Comparative analysis of multidrug-resistant tuberculosis and extensively drug-resistant tuberculosis – Epidemiology and predictive factors

    Directory of Open Access Journals (Sweden)

    Ana Sofia Vilariça

    2008-11-01

    Full Text Available Introduction: Extensively drug-resistant tuberculosis (XDR-TB is defined as a form of multidrug-resistant tuberculosis (MDR-TB with additional resistance to fluoroquinolones and at least one of the injectable drugs used in tuberculosis treatment: amikacin, kanamycin and capreomycin. It was classified by WHO as a serious threat to tuberculosis (TB control, with world-wide consequences, taking on the proportions of a real pandemic in some regions. Aim: To compare patients with XDR-TB versus other MDR-TB profiles with regard to epidemiological and demographic characteristics, aetiopathogenic factors and inhospital outcomes. Methods: Patients admitted to Pulido Valente Hospital (Pulmonology Service III in the period ranging from April 1999 to June 2007 with MDR-TB diagnosis microbiologically confirmed. The following variables were evaluated: gender, age, race, forms of TB presentation, treatment groups, resistance profile, immigrant status, number and duration of previous treatments, WHO classification, HIV co-infection, alcoholism and/or drug addiction, average length of hospital stay and inhospital mortality.Statistical analysis was performed using the SPSS (Statistical Package for the Social Sciences, version 15.0. In categorical variables, the statistical differences between groups were evaluated by the Chisquare test and numeric variables using the T-test. Logistical regression analysis was used to build the predictive model of XDR-TB existence (dependent variable, which included the following independent variables: WHO classification, HIV co-infection, immigrant status, alcoholism and/or drug addiction and number and duration of previous treatments. Results: We recorded 132 patients with MDR-TB, of which 69 (52.3% were XDR-TB. Statistically significant differences were observed in the following variables: race (black race was associated with XDRTB in 74% of cases versus 46% of the Caucasian race; WHO classification (patients with retreatment

  19. Social support received by multidrug-resistant tuberculosis patients and related factors: a cross-sectional study in Zhejiang Province, People's Republic of China

    Directory of Open Access Journals (Sweden)

    Chen B

    2016-06-01

    Full Text Available Bin Chen,1 Yin Peng,1 Lin Zhou,1 Chengliang Chai,1 Hui-Chi Yeh,2 Songhua Chen,1 Fei Wang,1 Mingwu Zhang,1 Tieniu He,1 Xiaomeng Wang1 1Department of Tuberculosis Control and Prevention, Zhejiang Provincial Center for Disease Control and Prevention, Binjiang District, Hangzhou, People’s Republic of China; 2Politics & International Relations, Social Sciences, University of Southampton, Southampton, UK Objectives: The objective of this study is to assess the social support received by patients diagnosed with multidrug-resistant tuberculosis (MDR-TB in Zhejiang Province, People’s Republic of China and the factors that may have influenced it. Methods: A total of 220 MDR-TB patients participated in the questionnaire-based survey, and the data from 212 valid questionnaires were analyzed. The respondents reported their sociodemographic status, disease features, and attitudes toward the disease. The social support rating scale was used to measure the patients’ social support scores. An Independent Samples t-test, one-way analysis of variance, and a multiple linear regression model were used to analyze the related factors for the social support scores. Result: The average social support score of each MDR-TB patient was 32.56±7.86. Participants who were single, widowed or divorced, retired, and had fewer family members and lower family income were found to have lower social support scores. Participants unwilling to disclose their disease tended to have less social support (31.59<34.23, P=0.010. Participants who perceived great help from health care workers reported higher social support rating scale scores than those who perceived no help (35.36>29.89, P=0.014. Conclusion: MDR-TB patients in Zhejiang Province were shown to have a low level of social support. Patients who were not married, had smaller families, and lower family income received less social support, suggesting that family harmony could be an important source of social support. Patients

  20. Colorimetric Detection of Multidrug-Resistant or Extensively Drug-Resistant Tuberculosis by Use of Malachite Green Indicator Dye▿

    OpenAIRE

    Farnia, Parissa; Masjedi, Mohammad Reza; Mohammadi, Foroozan; Tabarsei, Payam; Farnia, Poopak; Mohammadzadeh, Ali Reza; Baghei, Parvaneh; Varahram, Mohammad; Hoffner, Sven; Velayati, Ali Akbar

    2007-01-01

    The malachite green microtube (MGMT) susceptibility assay was performed directly on sputum specimens (n = 80) and indirectly on Mycobacterium tuberculosis clinical isolates (n = 60). The technique is based on the malachite green dye, which changes color in response to M. tuberculosis growth. The MGMT assay is simple and rapid and does not require expensive instruments.

  1. Tuberculosis diagnosis and multidrug resistance testing by direct sputum culture in selective broth without decontamination or centrifugation.

    Science.gov (United States)

    Grandjean, Louis; Martin, Laura; Gilman, Robert H; Valencia, Teresa; Herrera, Beatriz; Quino, Willi; Ramos, Eric; Rivero, Maribel; Montoya, Rosario; Escombe, A Roderick; Coleman, David; Mitchison, Denis; Evans, Carlton A

    2008-07-01

    Tuberculosis culture usually requires sputum decontamination and centrifugation to prevent cultures from being overgrown by contaminating bacteria and fungi. However, decontamination destroys many tuberculous bacilli, and centrifugation often is not possible in resource-poor settings. We therefore assessed the performance of Mycobacterium tuberculosis culture with unprocessed samples plated directly by using tuberculosis-selective media and compared this procedure to conventional culture using centrifuge decontamination. Quadruplicate aliquots of strain H37RV were cultured in 7H9 broth with and without selective antimicrobials and after centrifuge decontamination. The subsequent comparison was made with 715 sputum samples. Split paired sputum samples were cultured conventionally with centrifuge decontamination and by direct culture in tuberculosis-selective media containing antibiotics. Centrifuge decontamination reduced tuberculosis H37RV colonies by 78% (P laboratories this deficit may be outweighed by the ease of use.

  2. A Faropenem, Linezolid, and Moxifloxacin Regimen for Both Drug-Susceptible and Multidrug-Resistant Tuberculosis in Children: FLAME Path on the Milky Way.

    Science.gov (United States)

    Deshpande, Devyani; Srivastava, Shashikant; Nuermberger, Eric; Pasipanodya, Jotam G; Swaminathan, Soumya; Gumbo, Tawanda

    2016-11-01

     The regimen of linezolid and moxifloxacin was found to be efficacious in the hollow fiber system model of pediatric intracellular tuberculosis. However, its kill rate was slower than the standard 3-drug regimen of isoniazid, rifampin, and pyrazinamide. We wanted to examine the effect of adding a third oral agent, faropenem, to this dual combination.  We performed a series of studies in the hollow fiber system model of intracellular Mycobacterium tuberculosis, by mimicking pediatric pharmacokinetics of each antibiotic. First, we varied the percentage of time that faropenem persisted above minimum inhibitory concentration (T MIC ) on the moxifloxacin-linezolid regimen. After choosing the best faropenem exposure, we performed experiments in which we varied the moxifloxacin and linezolid doses in the triple regimen. Finally, we performed longer-duration therapy validation experiments. Bacterial burden was quantified using both colony-forming units per milliliter (CFU/mL) and time to positivity (TTP). Kill slopes were modeled using exponential regression.  TTP was a more sensitive measure of bacterial burden than CFU/mL. A faropenem T MIC > 62% was associated with steepest microbial kill slope. Regimens of standard linezolid and moxifloxacin plus faropenem T MIC > 60%, as well as higher-dose moxifloxacin, achieved slopes equivalent to those of the standard regimen based by both TTP and CFU/mL over 28 days of treatment.  We have developed an oral faropenem-linezolid-moxifloxacin (FLAME) regimen that is free of first-line drugs. The regimen could be effective against both multidrug-resistant and drug-susceptible tuberculosis in children. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America.

  3. Multidrug-resistant and extensively drug-resistant tuberculosis: implications for the HIV epidemic and antiretroviral therapy rollout in South Africa.

    Science.gov (United States)

    Andrews, Jason R; Shah, N Sarita; Gandhi, Neel; Moll, Tony; Friedland, Gerald

    2007-12-01

    Drug-resistant tuberculosis (TB) is emerging as a major clinical and public health challenge in areas of sub-Saharan Africa where there is a high prevalence of human immunodeficiency virus (HIV) infection. TB drug-resistance surveillance in this region has been limited by laboratory capacity and the public health infrastructure; however, with the maturation of the HIV epidemic, the burden of drug-resistant TB is increasing rapidly. The recent discovery of large numbers of cases of multidrug-resistant (MDR) TB and extensively drug-resistant (XDR) TB in South Africa likely represents an unrecognized and evolving epidemic rather than sporadic, localized outbreaks. The combination of a large population of HIV-infected susceptible hosts with poor TB treatment success rates, a lack of airborne infection control, limited drug-resistance testing, and an overburdened MDR-TB treatment program provides ideal conditions for an MDR-TB and XDR-TB epidemic of unparalleled magnitude. In the present article, we review the history of drug-resistant TB in South Africa, describe its interaction with the HIV epidemic and the resultant consequences, and suggest measures necessary for controlling MDR-TB and XDR-TB in this context. A successful response to the emergence of MDR-TB and XDR-TB will necessitate increased resources for and collaboration between TB and HIV programs.

  4. Treatment Outcomes of Patients with Multidrug-Resistant Tuberculosis (MDR- TB) Compared with Non-MDR-TB Infections in Peninsular Malaysia.

    Science.gov (United States)

    Elmi, Omar Salad; Hasan, Habsah; Abdullah, Sarimah; Mat Jeab, Mat Zuki; Ba, Zilfalil; Naing, Nyi Nyi

    2016-07-01

    Treating patients with multidrug-resistant tuberculosis (MDR-TB) strains is more complicated, complex, toxic, expensive, than treating patients with susceptible TB strains. This study aims to compare the treatment outcomes and potential factors associated between patients with MDR-TB and non MDR TB infections in peninsular Malaysia. This study was a retrospective cohort study. Data were collected from the medical records of all registered MDR-TB patients and Non-MDR-TB patients at five TB hospitals in peninsular Malaysia from January 2010 to January 2014. A total of 314 subjects were studied, including 105 MDR-TB cases and 209 non-MDR-TB. After TB treatment, 24.8% of the MDR-TB patients and 17.7% of non MDR TB relapsed; 17.1% of the MDR-TB patients and 16.3% of non MDR TB defaulted from TB treatment. A significant difference seen in treatment success rate 17.1% for MDR-TB; 63.1% for non MDR TB (P history of TB treatment, and presence of HIV infection.

  5. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  6. Economic evaluation of a shortened standardised treatment regimen of antituberculosis drugs for patients with multidrug-resistant tuberculosis (STREAM): study protocol.

    Science.gov (United States)

    Gama, Elvis; Madan, Jason; Langley, Ivor; Girma, Mamo; Evans, Denise; Rosen, Sydney; Squire, S Bertel

    2016-10-17

    Multidrug-resistant tuberculosis (MDR-TB) poses a serious financial challenge to health systems and patients. The current treatment for patients with MDR-TB takes up to 24 months to complete. Evidence for a shorter regimen which differs from the standard WHO recommended MDR-TB regimen and typically lasts between 9 and 12 months has been reported from Bangladesh. This evaluation aims to assess the economic impact of a shortened regimen on patients and health systems. This evaluation is innovative as it combines patient and health system costs, as well as operational modelling in assessing the impact. An economic evaluation nested in a clinical trial with 2 arms will be performed at 4 facilities. The primary outcome measure is incremental cost to the health system of the study regimen compared with the control regimen. Secondary outcome measures are mean incremental costs incurred by patients by treatment outcome; patient costs by category (direct medical costs, transport, food and accommodation costs, and cost of guardians/accompanying persons and lost time); health systems cost by category and drugs; and costs related to serious adverse events. The study has been evaluated and approved by the Ethics Advisory Group of the International Union Against Tuberculosis and Lung Disease; South African Medical Research Ethics Committee; Wits Health Consortium Protocol Review Committee; University of the Witwatersrand Human Research Ethics Committee; University of Kwazulu-Natal Biomedical Research Ethics Committee; St Peter TB Specialized Hospital Ethical Review Committee; AHRI-ALERT Ethical Review Committee, and all participants will provide written informed consent. The results of the economic evaluation will be published in a peer-reviewed journal. ISRCTN78372190. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  7. Genome sequence of Mycobacterium yongonense RT 955-2015 isolate from a patient misdiagnosed with multi-drug resistant tuberculosis: first clinical isolate in Tanzania.

    Science.gov (United States)

    Mnyambwa, Nicholaus Peter; Kim, Dong-Jin; Ngadaya, Esther; Chun, Jongsik; Ha, Sung-Min; Petrucka, Pammla; Addo, Kennedy Kwasi; Kazwala, Rudovick R; Mfinanga, Sayoki G

    2018-04-24

    Mycobacterium yongonense is a recently described novel species belonging to Mycobacterium avium complex which is the most prevalent etiology of non-tuberculous mycobacteria associated with pulmonary infections, and posing tuberculosis diagnostic challenges in high-burden, resource-constrained settings. We used whole genome shotgun sequencing and comparative microbial genomic analyses to characterize the isolate from a patient diagnosed with multi-drug resistant tuberculosis (MDR-TB) after relapse. We present a genome sequence of the first case of M. yongonense (M. yongonense RT 955-2015) in Tanzania. Sequence analysis revealed that the RT 955-2015 strain had a high similarity to M. yongonense 05-1390(T) (98.74%) and M. chimaera DSM 44623(T) (98%). Its 16S rRNA showed similarity to M. paraintracellulare KCTC 290849(T) (100%); M. intracellulare ATCC 13950(T) (100%); M. chimaera DSM 44623(T) (99.9%); and M. yongonense 05-1390(T) (98%). The strain had a substantially different rpoB sequence from that of M. yongonense 05-1390 (95.16%) but exhibited a sequence closely related to M. chimaera DSM 44623(T) (99.86%), M. intracellulare ATCC 13950(T) (99.53%), and M. paraintracellulare KCTC 290849(T) (99.53%). In light of the OrthoANI algorithm, and phylogenetic analysis, we conclude that the isolate was M. yongonense Type II genotype, which is an indication that the patient was misdiagnosed with TB/MDR-TB and received inappropriate treatment. Copyright © 2018. Published by Elsevier Ltd.

  8. Efficacy and safety profile of linezolid in the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis: a systematic review and meta-analysis.

    Science.gov (United States)

    Agyeman, Akosua Adom; Ofori-Asenso, Richard

    2016-06-22

    Treatment options for drug-resistant tuberculosis are still limited. Linezolid has been recommended for treatment of patients with multidrug-resistant (MDR) or extensively-drug-resistant (XDR) tuberculosis, although uncertainties remain regarding its safety and tolerability in these circumstances. To systematically evaluate the existing evidence regarding the efficacy and tolerability of linezolid in the treatment of MDR or XDR tuberculosis. We conducted a systematic review and meta-analysis in accordance with the PRISMA guidelines. Searches were conducted in PubMed, Web of Science and EMBASE followed by direct search of abstracts in the International Journal of Tuberculosis and Lung Disease to retrieve primary studies published between January 2000 and January 2016 assessing linezolid efficacy and safety in the treatment of drug-resistant TB. We evaluated the occurrence of outcomes including culture conversion, treatment success and incidence of adverse events such as myelosuppression and neuropathy. Twenty-three (23) studies conducted in fourteen (14) countries and involving 507 patients were retrieved. Only 1 randomized controlled trial was identified and none of the identified studies involved participants from Africa. The pooled proportion for treatment success was 77.36 % (95 % CI = 71.38-82.83 %, I(2) = 37.6 %) with culture conversion rate determined as 88.45 % (95 % CI = 83.82-92.38 %, I(2) = 45.4 %). There was no strong evidence for both culture conversion (p = 0.0948) and treatment success (p = 0.0695) between linezolid daily doses ≤ 600 and > 600 mg. Only myelosuppression showed a strong statistical significance (p linezolid also showed no significance upon dose comparisons (p = 0.3213, p = 0.9050 respectively). Available evidence presents Linezolid as a viable option in the treatment of MDR/XDR TB although patients ought to be monitored closely for the incidence of major adverse events such as myelosuppression and

  9. Multidrug-Resistant Candida

    DEFF Research Database (Denmark)

    Arendrup, Maiken Cavling; Patterson, Thomas F

    2017-01-01

    Invasive Candida infections remain an important cause of morbidity and mortality, especially in hospitalized and immunocompromised or critically ill patients. A limited number of antifungal agents from only a few drug classes are available to treat patients with these serious infections. Resistance...... can be either intrinsic or acquired. Resistance mechanisms are not exchanged between Candida; thus, acquired resistance either emerges in response to an antifungal selection pressure in the individual patient or, more rarely, occur due to horizontal transmission of resistant strains between patients....... Although multidrug resistance is uncommon, increasing reports of multidrug resistance to the azoles, echinocandins, and polyenes have occurred in several Candida species, most notably Candida glabrata and more recently Candida auris. Drivers are overall antifungal use, subtherapeutic drug levels at sites...

  10. Pharmacokinetics of Pyrazinamide and Optimal Dosing Regimens for Drug-Sensitive and -Resistant Tuberculosis.

    Science.gov (United States)

    Chirehwa, Maxwell T; McIlleron, Helen; Rustomjee, Roxana; Mthiyane, Thuli; Onyebujoh, Philip; Smith, Peter; Denti, Paolo

    2017-08-01

    Pyrazinamide is used in the treatment of tuberculosis (TB) because its sterilizing effect against tubercle bacilli allows the shortening of treatment. It is part of standard treatment for drug-susceptible and drug-resistant TB, and it is being considered as a companion drug in novel regimens. The aim of this analysis was to characterize factors contributing to the variability in exposure and to evaluate drug exposures using alternative doses, thus providing evidence to support revised dosing recommendations for drug-susceptible and multidrug-resistant tuberculosis (MDR-TB). Pyrazinamide pharmacokinetic (PK) data from 61 HIV/TB-coinfected patients in South Africa were used in the analysis. The patients were administered weight-adjusted doses of pyrazinamide, rifampin, isoniazid, and ethambutol in fixed-dose combination tablets according to WHO guidelines and underwent intensive PK sampling on days 1, 8, 15, and 29. The data were interpreted using nonlinear mixed-effects modeling. PK profiles were best described using a one-compartment model with first-order elimination. Allometric scaling was applied to disposition parameters using fat-free mass. Clearance increased by 14% from the 1st day to the 29th day of treatment. More than 50% of patients with weight less than 55 kg achieved lower pyrazinamide exposures at steady state than the targeted area under the concentration-time curve from 0 to 24 h of 363 mg · h/liter. Among patients with drug-susceptible TB, adding 400 mg to the dose for those weighing 30 to 54 kg improved exposure. Average pyrazinamide exposure in different weight bands among patients with MDR-TB could be matched by administering 1,500 mg, 1,750 mg, and 2,000 mg to patients in the 33- to 50-kg, 51- to 70-kg, and greater than 70-kg weight bands, respectively. Copyright © 2017 American Society for Microbiology.

  11. AMPLIFIKASI DAN IDENTIFIKASI MUTASI REGIO PROMOTER inhA PADA ISOLAT Mycobacterium tuberculosis MULTIDRUG RESISTANCE DENGAN TEKNIK POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Devita Kusdianingrum

    2014-10-01

    Full Text Available ABSTRAK: Sekitar 8-20% isolate M. tuberculosis yang resisten terhadap isoniazid diketahui telah mengalami mutasi pada posisi regio promoter inhA [1]. Untuk memperoleh titik mutasi pada regio promoter, maka amplifikasi fragmen target perlu untuk dilakukan. Tujuan dilakukannya penelitian ini adalah untuk mengamplifikasi regio promoter inhA, mengetahui ada tidaknya mutasi dan jenis mutasi pada isolat 134 MDR-TB. Tahap isolasi DNA dilakukan menggunakan metode Boom yang telah dimodifikasi. Fragmen target diamplifikasi dengan teknik PCR menggunakan sepasang primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ dan reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’. Amplikon disekuensing secara satu arah menggunakan forward primer. Analisis homologi dilakukan menggunakan program online BLASTn, sementara identifikasi mutasi dilakukan menggunakan software MEGA4. Hasil penelitian menunjukkan bahwa analisis homologi isolate 134 terhadap M. tuberculosis H37Rv adalah sebesar 99%. Tahap analisis mutasi menemukan terjadinya perubahan sitosin menjadi timin (CàT pada posisi -15 isolat 134 MDR-TB   ABSTRACT: Approximately 8-20% M. tuberculosis isolates that are resistant to isoniazid habe been known to have a mutation in inhA promoter region [1]. To find the mutation in inhA promoter region, it is necessary to carry out the amplification of the target fragment. The purpose of this research were to amplify the inhA promoter region and to find out if there is a mutation and type of mutation at MDR-TB isolate. DNA isolation was done by a modified Boom method. Target fragment was amplified by a pair primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ and reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’ using Polymerase Chain Reaction (PCR technique. Amplicon was sequenced in one forward direction. Homology analysis was conducted by online BLASTn program, while the mutation was identified by MEGA4. The result of this research showed that homology analysis of 134 was homolog

  12. Effect of a comprehensive programme to provide universal access to care for sputum-smear-positive multidrug-resistant tuberculosis in China: a before-and-after study.

    Science.gov (United States)

    Li, Renzhong; Ruan, Yunzhou; Sun, Qiang; Wang, Xiexiu; Chen, Mingting; Zhang, Hui; Zhao, Yanlin; Zhao, Jin; Chen, Cheng; Xu, Caihong; Su, Wei; Pang, Yu; Cheng, Jun; Chi, Junying; Wang, Qian; Fu, Yunting; Huan, Shitong; Wang, Lixia; Wang, Yu; Chin, Daniel P

    2015-04-01

    China has a quarter of all patients with multidrug-resistant tuberculosis (MDRTB) worldwide, but less than 5% are in quality treatment programmes. In a before-and-after study we aimed to assess the effect of a comprehensive programme to provide universal access to diagnosis, treatment, and follow-up for MDRTB in four Chinese cities (population 18 million). We designated city-level hospitals in each city to diagnose and treat MDRTB. All patients with smear-positive pulmonary tuberculosis diagnosed in Center for Disease Control (CDC) clinics and hospitals were tested for MDRTB with molecular and conventional drug susceptibility tests. Patients were treated with a 24 month treatment package for MDRTB based on WHO guidelines. Outpatients were referred to the CDC for directly observed therapy. We capped total treatment package cost at US$4644. Insurance reimbursement and project subsidies limited patients' expenses to 10% of charges for services within the package. We compared data from a 12 month programme period (2011) to those from a retrospective survey of all patients with MDRTB diagnosed in the same cities during a baseline period (2006-09). 243 patients were diagnosed with MDRTB or rifampicin-resistant tuberculosis during the 12 month programme period compared with 92 patients (equivalent to 24 per year) during the baseline period. 172 (71%) of 243 individuals were enrolled in the programme. Time from specimen collection for resistance testing to treatment initiation decreased by 90% (from median 139 days [IQR 69-207] to 14 days [10-21]), the proportion of patients who started on appropriate drug regimen increased 2·7 times (from nine [35%] of 26 patients treated to 166 [97%] of 172), and follow-up by the CDC after initial hospitalisation increased 24 times (from one [4%] of 23 patients to 163 [99%] of 164 patients). 6 months after starting treatment, the proportion of patients remaining on treatment increased ten times (from two [8%] of 26 patients to 137 [80

  13. Peripheral neuropathy in a diabetic child treated with linezolid for multidrug-resistant tuberculosis: a case report and review of the literature.

    Science.gov (United States)

    Swaminathan, Aravind; du Cros, Philipp; Seddon, James A; Mirgayosieva, Shamsiya; Asladdin, Rajabov; Dusmatova, Zulfiya

    2017-06-12

    Extensively drug-resistant (XDR) tuberculosis (TB) and multidrug resistant (MDR)-TB with additional resistance to injectable agents or fluoroquinolones are challenging to treat due to lack of available, effective drugs. Linezolid is one of the few drugs that has shown promise in treating these conditions. Long-term linezolid use is associated with toxicities such as peripheral and optic neuropathies. Diabetes mellitus (DM), especially when uncontrolled, can also result in peripheral neuropathy. The global burden of DM is increasing, and DM has been associated with a three-fold increased risk of developing TB disease. TB and DM can be a challenging combination to treat. DM can inhibit the host immune response to tuberculosis infection; and TB and some anti-TB drugs can worsen glycaemic control. A child experiencing neuropathy that is a possible complication of both DM and linezolid used to treat TB has not been reported previously. We report peripheral neuropathy in a 15-year-old boy with type 1 DM, diagnosed with MDR-TB and additional resistance to injectable TB medications. The boy was treated with a linezolid-based regimen, but after 8 months developed peripheral neuropathy. It was unclear whether the neuropathy was caused by the DM or the linezolid therapy. He had clinical improvement following cessation of linezolid and was declared cured following 21 months of treatment. Following completion of treatment, nerve conduction studies demonstrated significant improvement in neuropathy. To the best of our knowledge, this is the first case of peripheral neuropathy reported in a diabetic child on long-term linezolid therapy for tuberculosis. This case study underlines the importance of stringent follow-up for side effects of linezolid, especially when associated with co-morbidity such as DM that increases the chances of adverse effects. The presence of both DM and TB should alert a physician to strive for optimal glycaemic control to minimize the risk of

  14. Evaluation of the microscopic observational drug susceptibility assay for rapid and efficient diagnosis of multi-drug resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    R P Lazarus

    2012-01-01

    Full Text Available Purpose: Tuberculosis (TB is endemic in India and the burden of multi-drug-resistant tuberculosis (MDR-TB is high. Early detection of MDR-TB is of primary importance in controlling the spread of TB. The microscopic observational drug susceptibility (MODS assay has been described as a cost-effective and rapid method by which mycobacterial culture and the drug susceptibility test (DST can be done at the same time. Materials and Methods: A total of 302 consecutive sputum samples that were received in an accredited mycobacteriology laboratory for conventional culture and DST were evaluated by the MODS assay. Results: In comparison with conventional culture on Lowenstein Jensen (LJ media, the MODS assay showed a sensitivity of 94.12% and a specificity of 89.39% and its concordance with the DST by the proportion method on LJ media to isoniazid and rifampicin was 90.8% and 91.5%, respectively. The turnaround time for results by MODS was 9 days compared to 21 days by culture on LJ media and an additional 42 days for DST by the 1% proportion method. The cost of performing a single MODS assay was Rs. 250/-, compared to Rs. 950/- for culture and 1st line DST on LJ. Conclusion: MODS was found to be a sensitive and rapid alternative method for performing culture and DST to identify MDR-TB in resource poor settings.

  15. Outcomes of multidrug-resistant tuberculosis treatment with early initiation of antiretroviral therapy for HIV co-infected patients in Lesotho.

    Directory of Open Access Journals (Sweden)

    Hind Satti

    Full Text Available BACKGROUND: Although the importance of concurrent treatment for multidrug-resistant tuberculosis (MDR-TB and HIV co-infection has been increasingly recognized, there have been few studies reporting outcomes of MDR-TB and HIV co-treatment. We report final outcomes of comprehensive, integrated MDR-TB and HIV treatment in Lesotho and examine factors associated with death or treatment failure. METHODS: We reviewed clinical charts of all adult patients who initiated MDR-TB treatment in Lesotho between January 2008 and September 2009. We calculated hazard ratios (HR and used multivariable Cox proportional hazards regression to identify predictors of poor outcomes. RESULTS: Of 134 confirmed MDR-TB patients, 83 (62% were cured or completed treatment, 46 (34% died, 3 (2% transferred, 1 (1% defaulted, and 1 (1% failed treatment. Treatment outcomes did not differ significantly by HIV status. Among the 94 (70% patients with HIV co-infection, 53% were already on antiretroviral therapy (ART before MDR-TB treatment initiation, and 43% started ART a median of 16 days after the start of the MDR-TB regimen. Among HIV co-infected patients who died, those who had not started ART before MDR-TB treatment had a shorter median time to death (80 days vs. 138 days, p=0.065. In multivariable analysis, predictors of increased hazard of failure or death were low and severely low body mass index (HR 2.75, 95% confidence interval [CI] 1.27-5.93; HR 5.50, 95% CI 2.38-12.69, and a history of working in South Africa (HR 2.37, 95% CI 1.24-4.52. CONCLUSIONS: Favorable outcomes can be achieved in co-infected patients using a community-based treatment model when both MDR-TB and HIV disease are treated concurrently and treatment is initiated promptly.

  16. Evaluation of GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing of multi-drug resistance tuberculosis in Northern India

    Directory of Open Access Journals (Sweden)

    Anand Kumar Maurya

    2013-01-01

    Full Text Available Background: The problem of multi-drug resistance tuberculosis (MDR-TB is growing in several hotspots throughout the world. Rapid and accurate diagnosis of MDR-TB is crucial to facilitate early treatment and to reduce its spread in the community. The aim of the present study was to evaluate the new, novel GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing (DST of MDR-TB cases in Northern India. Materials and Methods: A total of 550 specimens were collected from highly suspected drug resistant from pulmonary and extra-pulmonary TB cases. All the specimens were processed by Ziehl- Neelsen staining, culture, differentiation by the GenoType® CM assay, first line DST using BacT/ALERT 3D system and GenoType® MTBDRplus assay. The concordance of the GenoType® MTBDRplus assay was calculated in comparison with conventional DST results. Results: Overall the sensitivity for detection of rifampicin, isoniazid and MDR-TB resistance by GenoType® MTBDRplus assay was 98.0%, 98.4% and 98.2% respectively. Out of 55 MDR-TB strains, 45 (81.8%, 52 (94.5% and 17 (30.9% strains showed mutation in rpoB, katG and inhA genes respectively (P < 0.05. The most prominent mutations in rpoB, katG and inhA genes were; 37 (67.3% in S531L, 52 (94.5% in S315T1 and 11 (20% in C15T regions respectively (P < 0.05. Conclusions: Our study demonstrated a high concordance between the GenoType® MTBDRplus assay resistance patterns and those were observed by conventional DST with good sensitivity, specificity with short turnaround times and to control new cases of MDR-TB in countries with a high prevalence of MDR-TB.

  17. The relationship between social support, treatment interruption and treatment outcome in patients with multidrug-resistant tuberculosis in China: a mixed-methods study.

    Science.gov (United States)

    Yin, Jia; Wang, Xiaomeng; Zhou, Lin; Wei, Xiaolin

    2018-04-24

    Multidrug-resistant tuberculosis (MDR-TB) has been a major threat for successful TB control. We examined the relationship between social support and treatment outcomes in MDR-TB patients and evaluated barriers to social support. Retrospective cohort study with MDR-TB patients enrolled in the Global Fund program between 1 January 2009 and 30 June 2014 in Zhejiang, China. We reviewed all MDR-TB patients' diagnoses and treatment outcomes. In-depth interviews were conducted with 10 community health workers and 10 patients. Pathway analysis was employed to examine the association between social support and treatment outcomes, and the mediating effect of medication adherence on their relationship. Of 218 participants, 144 (66%) were successfully treated and 59 (27%) had poor treatment adherence. Directly observed therapy (DOT) had an indirect positive effect on treatment success, mediating through medication adherence (β.=0.541, p=0.008; β =0.538, p<0.001). Financial support had both a direct (β.=0.769, p<0.001) and an indirect positive effect on treatment success, which was mediated by a self-reported social support scale (β.=0.541, p=0.008; β =0.538, p<0.001). The interviews indicated poor performance of DOT. Patients often suffered from substantial stigma, but were not provided with psychological support. DOT and financial support were effective strategies for improving successful treatment outcomes in MDR-TB patients, but they were delivered not considering patients' perspectives. There is an urgent need for consistent and specific psychological support for MDR-TB patients in their communities. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  18. Risk factors associated with multidrug-resistant tuberculosis (MDR-TB) in a tertiary armed force referral and teaching hospital, Ethiopia.

    Science.gov (United States)

    Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke

    2018-05-31

    Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of

  19. Determination of plasma concentrations of levofloxacin by high performance liquid chromatography for use at a multidrug-resistant tuberculosis hospital in Tanzania.

    Science.gov (United States)

    Ebers, Andrew; Stroup, Suzanne; Mpagama, Stellah; Kisonga, Riziki; Lekule, Isaack; Liu, Jie; Heysell, Scott

    2017-01-01

    Therapeutic drug monitoring may improve multidrug-resistant tuberculosis (MDR-TB) treatment outcomes. Levofloxacin demonstrates significant individual pharmacokinetic variability. Thus, we sought to develop and validate a high-performance liquid chromatography (HPLC) method with ultraviolet (UV) detection for levofloxacin in patients on MDR-TB treatment. The HPLC-UV method is based on a solid phase extraction (SPE) and a direct injection into the HPLC system. The limit of quantification was 0.25 μg/mL, and the assay was linear over the concentration range of 0.25-15 μg/mL (y = 0.5668x-0.0603, R2 = 0.9992) for the determination of levofloxacin in plasma. The HPLC-UV methodology achieved excellent accuracy and reproducibility along a clinically meaningful range. The intra-assay RSD% of low, medium, and high quality control samples (QC) were 1.93, 2.44, and 1.90, respectively, while the inter-assay RSD% were 3.74, 5.65, and 3.30, respectively. The mean recovery was 96.84%. This method was then utilized to measure levofloxacin concentrations from patients' plasma samples from a retrospective cohort of consecutive enrolled subjects treated for MDR-TB at the national TB hospital in Tanzania during 5/3/2013-8/31/2015. Plasma was collected at 2 hours after levofloxacin administration, the time of estimated peak concentration (eCmax) treatment. Forty-one MDR-TB patients had plasma available and 39 had traceable programmatic outcomes. Only 13 (32%) patients had any plasma concentration that reached the lower range of the expected literature derived Cmax with the median eCmax being 5.86 (3.33-9.08 μg/ml). Using Classification and Regression Tree analysis, an eCmax ≥7.55 μg/mL was identified as the threshold which best predicted cure. Analyzing this CART derived threshold on treatment outcome, the time to sputum culture conversion was 38.3 ± 22.7 days vs. 47.8 ± 26.5 days (p = 0.27) and a greater proportion were cured, in 10 out of 15 (66.7%) vs. 6 out of 18 (33.3%) (p

  20. Effect of Introducing Xpert MTB/RIF to Test and Treat Individuals at Risk of Multidrug-Resistant Tuberculosis in Kazakhstan: A Prospective Cohort Study.

    Directory of Open Access Journals (Sweden)

    Sanne Christine van Kampen

    Full Text Available Xpert MTB/RIF (Xpert was piloted in Kazakhstan to detect tuberculosis (TB and rifampicin resistance (RR-TB among individuals at risk of multidrug-resistant (MDR- TB. This study assessed the performance of Xpert compared to conventional diagnostic methods, RR-TB case detection among various risk groups, treatment initiation and time to diagnosis and treatment.Eligible individuals were tested with Xpert, smear microscopy, culture and drug-susceptibility testing (DST at the national TB reference laboratory and three provincial laboratories. Data was collected prospectively from August 2012 to May 2013 from routine laboratory and treatment registers.A total of 5,611 Xpert tests were performed mostly targeting contacts of MDR-TB patients, 'other' presumptive MDR-TB patients, and retreatment cases (26%, 24% and 22%, respectively. Compared to phenotypic DST, the positive predictive value of Xpert to detect RR-TB was 93.1% and 96.4% and the negative predictive value was 94.6% and 92.7% using solid and liquid culture media, respectively. RR-TB detection was highest among (former prisoners, retreatment cases, people living with HIV/AIDS (PLWHA, and TB patients with positive smears after intensive phase of treatment (59%, 58%, 54% and 53% among TB positives, respectively. 88.9% of RR-TB patients were registered to have started second-line TB treatment. Median time to diagnosis with Xpert was 0.0 days (IQR 0.0-1.0, time from diagnosis to start of first-line treatment 3.0 days (IQR 1.0-7.0, and to start of second-line treatment 7.0 days (IQR 4.0-16.Compared to conventional culture and DST, Xpert had a shorter result turn-around-time and excellent concordance to detect RR-TB. Time from sputum collection to start of second-line treatment was reduced to one week. The yield of Xpert could be maximized by increasing referrals from penitentiary and HIV centers to TB centers.

  1. Alcohol, hospital discharge, and socioeconomic risk factors for default from multidrug resistant tuberculosis treatment in rural South Africa: a retrospective cohort study.

    Science.gov (United States)

    Kendall, Emily A; Theron, Danie; Franke, Molly F; van Helden, Paul; Victor, Thomas C; Murray, Megan B; Warren, Robin M; Jacobson, Karen R

    2013-01-01

    Default from multidrug-resistant tuberculosis (MDR-TB) treatment remains a major barrier to cure and epidemic control. We sought to identify patient risk factors for default from MDR-TB treatment and high-risk time periods for default in relation to hospitalization and transition to outpatient care. We retrospectively analyzed a cohort of 225 patients who initiated MDR-TB treatment between 2007 through 2010 at a rural TB hospital in the Western Cape Province, South Africa. Fifty percent of patients were cured or completed treatment, 27% defaulted, 14% died, 4% failed treatment, and 5% transferred out. Recent alcohol use was common (63% of patients). In multivariable proportional hazards regression, older age (hazard ratio [HR]= 0.97 [95% confidence interval 0.94-0.99] per year of greater age), formal housing (HR=0.38 [0.19-0.78]), and steady employment (HR=0.41 [0.19-0.90]) were associated with decreased risk of default, while recent alcohol use (HR=2.1 [1.1-4.0]), recent drug use (HR=2.0 [1.0-3.6]), and Coloured (mixed ancestry) ethnicity (HR=2.3 [1.1-5.0]) were associated with increased risk of default (PDefaults occurred throughout the first 18 months of the two-year treatment course but were especially frequent among alcohol users after discharge from the initial four-to-five-month in-hospital phase of treatment, with the highest default rates occurring among alcohol users within two months of discharge. Default rates during the first two months after discharge were also elevated for patients who received care from mobile clinics. Among patients who were not cured or did not complete MDR-TB treatment, the majority defaulted from treatment. Younger, economically-unstable patients and alcohol and drug users were particularly at risk. For alcohol users as well as mobile-clinic patients, the early outpatient treatment phase is a high-risk period for default that could be targeted in efforts to increase treatment completion rates.

  2. Pathways to multidrug-resistant tuberculosis diagnosis and treatment initiation: a qualitative comparison of patients' experiences in the era of rapid molecular diagnostic tests.

    Science.gov (United States)

    Naidoo, Pren; van Niekerk, Margaret; du Toit, Elizabeth; Beyers, Nulda; Leon, Natalie

    2015-10-28

    Although new molecular diagnostic tests such as GenoType MTBDRplus and Xpert® MTB/RIF have reduced multidrug-resistant tuberculosis (MDR-TB) treatment initiation times, patients' experiences of diagnosis and treatment initiation are not known. This study aimed to explore and compare MDR-TB patients' experiences of their diagnostic and treatment initiation pathway in GenoType MTBDRplus and Xpert® MTB/RIF-based diagnostic algorithms. The study was undertaken in Cape Town, South Africa where primary health-care services provided free TB diagnosis and treatment. A smear, culture and GenoType MTBDRplus diagnostic algorithm was used in 2010, with Xpert® MTB/RIF phased in from 2011-2013. Participants diagnosed in each algorithm at four facilities were purposively sampled, stratifying by age, gender and MDR-TB risk profiles. We conducted in-depth qualitative interviews using a semi-structured interview guide. Through constant comparative analysis we induced common and divergent themes related to symptom recognition, health-care access, testing for MDR-TB and treatment initiation within and between groups. Data were triangulated with clinical information and health visit data from a structured questionnaire. We identified both enablers and barriers to early MDR-TB diagnosis and treatment. Half the patients had previously been treated for TB; most recognised recurring symptoms and reported early health-seeking. Those who attributed symptoms to other causes delayed health-seeking. Perceptions of poor public sector services were prevalent and may have contributed both to deferred health-seeking and to patient's use of the private sector, contributing to delays. However, once on treatment, most patients expressed satisfaction with public sector care. Two patients in the Xpert® MTB/RIF-based algorithm exemplified its potential to reduce delays, commencing MDR-TB treatment within a week of their first health contact. However, most patients in both algorithms experienced

  3. Multidrug resistant pulmonary tuberculosis treatment regimens and patient outcomes: an individual patient data meta-analysis of 9,153 patients.

    Directory of Open Access Journals (Sweden)

    Shama D Ahuja

    Full Text Available Treatment of multidrug resistant tuberculosis (MDR-TB is lengthy, toxic, expensive, and has generally poor outcomes. We undertook an individual patient data meta-analysis to assess the impact on outcomes of the type, number, and duration of drugs used to treat MDR-TB.Three recent systematic reviews were used to identify studies reporting treatment outcomes of microbiologically confirmed MDR-TB. Study authors were contacted to solicit individual patient data including clinical characteristics, treatment given, and outcomes. Random effects multivariable logistic meta-regression was used to estimate adjusted odds of treatment success. Adequate treatment and outcome data were provided for 9,153 patients with MDR-TB from 32 observational studies. Treatment success, compared to failure/relapse, was associated with use of: later generation quinolones, (adjusted odds ratio [aOR]: 2.5 [95% CI 1.1-6.0], ofloxacin (aOR: 2.5 [1.6-3.9], ethionamide or prothionamide (aOR: 1.7 [1.3-2.3], use of four or more likely effective drugs in the initial intensive phase (aOR: 2.3 [1.3-3.9], and three or more likely effective drugs in the continuation phase (aOR: 2.7 [1.7-4.1]. Similar results were seen for the association of treatment success compared to failure/relapse or death: later generation quinolones, (aOR: 2.7 [1.7-4.3], ofloxacin (aOR: 2.3 [1.3-3.8], ethionamide or prothionamide (aOR: 1.7 [1.4-2.1], use of four or more likely effective drugs in the initial intensive phase (aOR: 2.7 [1.9-3.9], and three or more likely effective drugs in the continuation phase (aOR: 4.5 [3.4-6.0].In this individual patient data meta-analysis of observational data, improved MDR-TB treatment success and survival were associated with use of certain fluoroquinolones, ethionamide, or prothionamide, and greater total number of effective drugs. However, randomized trials are urgently needed to optimize MDR-TB treatment. Please see later in the article for the Editors' Summary.

  4. Effect of Introducing Xpert MTB/RIF to Test and Treat Individuals at Risk of Multidrug-Resistant Tuberculosis in Kazakhstan: A Prospective Cohort Study.

    Science.gov (United States)

    van Kampen, Sanne Christine; Tursynbayeva, Aigul; Koptleuova, Aliya; Murzakhmetova, Zauresh; Murzabekova, Zauresh; Bigalieva, Lyazzat; Aubakirova, Moldir; Pak, Svetlana; van den Hof, Susan

    2015-01-01

    Xpert MTB/RIF (Xpert) was piloted in Kazakhstan to detect tuberculosis (TB) and rifampicin resistance (RR-)TB among individuals at risk of multidrug-resistant (MDR-) TB. This study assessed the performance of Xpert compared to conventional diagnostic methods, RR-TB case detection among various risk groups, treatment initiation and time to diagnosis and treatment. Eligible individuals were tested with Xpert, smear microscopy, culture and drug-susceptibility testing (DST) at the national TB reference laboratory and three provincial laboratories. Data was collected prospectively from August 2012 to May 2013 from routine laboratory and treatment registers. A total of 5,611 Xpert tests were performed mostly targeting contacts of MDR-TB patients, 'other' presumptive MDR-TB patients, and retreatment cases (26%, 24% and 22%, respectively). Compared to phenotypic DST, the positive predictive value of Xpert to detect RR-TB was 93.1% and 96.4% and the negative predictive value was 94.6% and 92.7% using solid and liquid culture media, respectively. RR-TB detection was highest among (former) prisoners, retreatment cases, people living with HIV/AIDS (PLWHA), and TB patients with positive smears after intensive phase of treatment (59%, 58%, 54% and 53% among TB positives, respectively). 88.9% of RR-TB patients were registered to have started second-line TB treatment. Median time to diagnosis with Xpert was 0.0 days (IQR 0.0-1.0), time from diagnosis to start of first-line treatment 3.0 days (IQR 1.0-7.0), and to start of second-line treatment 7.0 days (IQR 4.0-16). Compared to conventional culture and DST, Xpert had a shorter result turn-around-time and excellent concordance to detect RR-TB. Time from sputum collection to start of second-line treatment was reduced to one week. The yield of Xpert could be maximized by increasing referrals from penitentiary and HIV centers to TB centers.

  5. Towards understanding the drivers of policy change: a case study of infection control policies for multi-drug resistant tuberculosis in South Africa.

    Science.gov (United States)

    Saidi, Trust; Salie, Faatiema; Douglas, Tania S

    2017-05-30

    Explaining policy change is one of the central tasks of contemporary policy analysis. In this article, we examine the changes in infection control policies for multi-drug resistant tuberculosis (MDR-TB) in South Africa from the time the country made the transition to democracy in 1994, until 2015. We focus on MDR-TB infection control and refer to decentralised management as a form of infection control. Using Kingdon's theoretical framework of policy streams, we explore the temporal ordering of policy framework changes. We also consider the role of research in motivating policy changes. Policy documents addressing MDR-TB in South Africa over the period 1994 to 2014 were extracted. Literature on MDR-TB infection control in South Africa was extracted from PubMed using key search terms. The documents were analysed to identify the changes that occurred and the factors driving them. During the period under study, five different policy frameworks were implemented. The policies were meant to address the overwhelming challenge of MDR-TB in South Africa, contextualised by high prevalence of HIV infection, that threatened to undermine public health programmes and the success of antiretroviral therapy rollouts. Policy changes in MDR-TB infection control were supported by research evidence and driven by the high incidence and complexity of the disease, increasing levels of dissatisfaction among patients, challenges of physical, human and financial resources in public hospitals, and the ideologies of the political leadership. Activists and people living with HIV played an important role in highlighting the importance of MDR-TB as well as exerting pressure on policymakers, while the mass media drew public attention to infection control as both a cause of and a solution to MDR-TB. The critical factors for policy change for infection control of MDR-TB in South Africa were rooted in the socioeconomic and political environment, were supported by extensive research, and can be framed

  6. Survival of civilian and prisoner drug-sensitive, multi- and extensive drug- resistant tuberculosis cohorts prospectively followed in Russia.

    Directory of Open Access Journals (Sweden)

    Yanina Balabanova

    Full Text Available OBJECTIVE AND METHODS: A long-term observational study was conducted in Samara, Russia to assess the survival and risk factors for death of a cohort of non-multidrug resistant tuberculosis (non-MDRTB and multidrug resistant tuberculosis (MDRTB civilian and prison patients and a civilian extensive drug-resistant tuberculosis (XDRTB cohort. RESULTS: MDRTB and XDRTB rates of 54.8% and 11.1% were identified in the region. Half (50% of MDRTB patients and the majority of non-MDRTB patients (71% were still alive at 5 years. Over half (58% of the patients died within two years of establishing a diagnosis of XDRTB. In the multivariate analysis, retreatment (HR = 1.61, 95%CI 1.04, 2.49 and MDRTB (HR = 1.67, 95%CI 1.17, 2.39 were significantly associated with death within the non-MDR/MDRTB cohort. The effect of age on survival was relatively small (HR = 1.01, 95%CI 1.00, 1.02. No specific factor affected survival of XDRTB patients although median survival time for HIV-infected versus HIV-negative patients from this group was shorter (185 versus 496 days. The majority of MDRTB and XDRTB strains (84% and 92% respectively strains belonged to the Beijing family. Mutations in the rpoB (codon 531 in 81/92; 88.8%, katG (mutation S315T in 91/92, 98.9% and inhA genes accounted for most rifampin and isoniazid resistance respectively, mutations in the QRDR region of gyrA for most fluroquinolone resistance (68/92; 73.5%. CONCLUSIONS: Alarmingly high rates of XDRTB exist. Previous TB treatment cycles and MDR were significant risk factors for mortality. XDRTB patients' survival is short especially for HIV-infected patients. Beijing family strains comprise the majority of drug-resistant strains.

  7. Molecular characterization of mutations associated with resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients from high prevalence tuberculosis city in Morocco.

    Science.gov (United States)

    Oudghiri, Amal; Karimi, Hind; Chetioui, Fouad; Zakham, Fathiah; Bourkadi, Jamal Eddine; Elmessaoudi, My Driss; Laglaoui, Amin; Chaoui, Imane; El Mzibri, Mohammed

    2018-02-27

    The emergence of extensively drug-resistant tuberculosis (XDR-TB) has raised public health concern for global TB control. Although multi drug-resistant tuberculosis (MDR- TB) prevalence and associated genetic mutations in Morocco are well documented, scarce information on XDR TB is available. Hence, the evaluation of pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drugs, is of great value for better management of M/XDR TB in Morocco. To evaluate pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drug resistance, in 703 clinical isolates from TB patients recruited in Casablanca, and to assess the usefulness of molecular tools in clinical laboratories for better management of M/XDR TB in Morocco. Drug susceptibility testing (DST) was performed by the proportional method for first line drugs, and then the selected MDR isolates were tested for second line drugs (Ofloxacin, Kanamycin, Amikacin and Capreomycin). Along with DST, all samples were subjected to rpoB, katG and p-inhA mutation analysis by PCR and DNA sequencing. MDR isolates as well as 30 pan-susceptible strains were subjected to PCR and DNA sequencing of gyrA, gyrB, rrs, tlyA genes and eis promoter, associated with resistance to fluoroquinolones and injectable drugs. Among the 703 analysed strains, 12.8% were MDR; Ser531Leu and Ser315Thr being the most common recorded mutations within rpoB and katG genes associated with RIF and INH resistance respectively. Drug susceptibility testing for second line drugs showed that among the 90 MDR strains, 22.2% (20/90) were resistant to OFX, 2.22% (2/90) to KAN, 3.33% (3/90) to AMK and 1.11% (1/90) to CAP. Genotypic analysis revealed that 19 MDR strains harbored mutations in the gyrA gene; the most recorded mutation being Asp91Ala accounting for 47.6% (10

  8. High prevalence of multidrug-resistant tuberculosis among patients with rifampicin resistance using GeneXpert Mycobacterium tuberculosis/rifampicin in Ghana

    NARCIS (Netherlands)

    Boakye-Appiah, Justice K; Steinmetz, Alexis R; Pupulampu, Peter; Ofori-Yirenkyi, Stephen; Tetteh, Ishmael; Frimpong, Michael; Oppong, Patrick; Opare-Sem, Ohene; Norman, Betty R; Stienstra, Ymkje; van der Werf, Tjip S; Wansbrough-Jones, Mark; Bonsu, Frank; Obeng-Baah, Joseph; Phillips, Richard O

    2016-01-01

    OBJECTIVE/BACKGROUND: Drug-resistant strains of tuberculosis (TB) represent a major threat to global TB control. In low- and middle-income countries, resource constraints make it difficult to identify and monitor cases of resistance using drug susceptibility testing and culture. Molecular assays

  9. Conglomerado de casos de tuberculosis multidrogorresistente en un colegio del distrito de Ica, Perú Cluster of multidrug-resistant tuberculosis cases in a school of the district of Ica, Perú

    Directory of Open Access Journals (Sweden)

    Julio Torres

    2011-09-01

    Full Text Available Se describe la evolución y las características de los casos de un conglomerado de tuberculosis multidrogorresistente (MDR ocurrido el año 2001, en un centro educativo localizado en una zona urbano marginal del distrito de Ica, Perú. Se identificó 15 escolares que estuvieron relacionados entre ellos antes de enfermar de tuberculosis. El promedio de edad fue 15 años. Doce casos fueron MDR y siete fueron resistentes a las cinco drogas de primera línea (RHEZS, cinco de los casos recibieron tres diferentes esquemas de tratamiento antituberculoso; el tiempo promedio de tratamiento antituberculoso fue de 37 meses (mínimo 21 y máximo 59 meses. Trece casos curaron y dos fallecieron. El presente estudio documenta un conglomerado de casos de TB-MDR en un centro educativo que, por los vínculos epidemiológicos y la simultaneidad en que aparecieron, podría tratarse de un probable brote de TB-MDR, con un desenlace satisfactorio luego de un tratamiento prolongado.We describe the evolution and features of a cluster of Multidrug-resistant tuberculosis (MDR TB cases that occurred in 2001, in a school located in a sub-urban area of the district of Ica, Peru. We identified 15 students related before becoming infected with tuberculosis. The mean age of the cluster was 15 years. A total of 12 students were MDR-TB cases and 7 were drug-resistant to 5 first-line drugs (RHEZS. Five out of the 15 cases received at least 3 different anti-tuberculosis treatment schemes. The average treatment duration was 37 months (minimum 21 and maximum 59 months. A total of 13 cases recovered and 2 died. This study describes a cluster of MDR -TB cases in an educational facility, which due to the epidemiological link and time presentation, is probably an outbreak of MDR TB with a satisfactory outcome after prolonged treatment.

  10. Use of a molecular diagnostic test in AFB smear positive tuberculosis suspects greatly reduces time to detection of multidrug resistant tuberculosis.

    Directory of Open Access Journals (Sweden)

    Nestani Tukvadze

    Full Text Available The WHO has recommended the implementation of rapid diagnostic tests to detect and help combat M/XDR tuberculosis (TB. There are limited data on the performance and impact of these tests in field settings.The performance of the commercially available Genotype MTBDRplus molecular assay was compared to conventional methods including AFB smear, culture and drug susceptibility testing (DST using both an absolute concentration method on Löwenstein-Jensen media and broth-based method using the MGIT 960 system. Sputum specimens were obtained from TB suspects in the country of Georgia who received care through the National TB Program.Among 500 AFB smear-positive sputum specimens, 458 (91.6% had both a positive sputum culture for Mycobacterium tuberculosis and a valid MTBDRplus assay result. The MTBDRplus assay detected isoniazid (INH resistance directly from the sputum specimen in 159 (89.8% of 177 specimens and MDR-TB in 109 (95.6% of 114 specimens compared to conventional methods. There was high agreement between the MTBDRplus assay and conventional DST results in detecting MDR-TB (kappa = 0.95, p<0.01. The most prevalent INH resistance mutation was S315T (78% in the katG codon and the most common rifampicin resistance mutation was S531L (68% in the rpoB codon. Among 13 specimens from TB suspects with negative sputum cultures, 7 had a positive MTBDRplus assay (3 with MDR-TB. The time to detection of MDR-TB was significantly less using the MTBDRplus assay (4.2 days compared to the use of standard phenotypic tests (67.3 days with solid media and 21.6 days with broth-based media.Compared to conventional methods, the MTBDRplus assay had high accuracy and significantly reduced time to detection of MDR-TB in an area with high MDR-TB prevalence. The use of rapid molecular diagnostic tests for TB and drug resistance should increase the proportion of patients promptly placed on appropriate therapy.

  11. Direct Application of the INNO-LiPA Rif.TB Line-Probe Assay for Rapid Identification of Mycobacterium tuberculosis Complex Strains and Detection of Rifampin Resistance in 360 Smear-Positive Respiratory Specimens from an Area of High Incidence of Multidrug-Resistant Tuberculosis

    Science.gov (United States)

    Viveiros, Miguel; Leandro, Clara; Rodrigues, Liliana; Almeida, Josefina; Bettencourt, Rosário; Couto, Isabel; Carrilho, Lurdes; Diogo, José; Fonseca, Ana; Lito, Luís; Lopes, João; Pacheco, Teresa; Pessanha, Mariana; Quirim, Judite; Sancho, Luísa; Salfinger, Max; Amaral, Leonard

    2005-01-01

    The INNO-LiPA Rif.TB assay for the identification of Mycobacterium tuberculosis complex strains and the detection of rifampin (RIF) resistance has been evaluated with 360 smear-positive respiratory specimens from an area of high incidence of multidrug-resistant tuberculosis (MDR-TB). The sensitivity when compared to conventional identification/culture methods was 82.2%, and the specificity was 66.7%; the sensitivity and specificity were 100.0% and 96.9%, respectively, for the detection of RIF resistance. This assay has the potential to provide rapid information that is essential for the effective management of MDR-TB. PMID:16145166

  12. Multidrug resistance in Lactococcus lactis

    NARCIS (Netherlands)

    Bolhuis, Hendrik

    1996-01-01

    Multidrug resistance (MDR) was initially recongnized as the major cause of the failure of the drug-based treatment of human cancers. It has become increasingly clear that MDR occurs in mammalian cells but also in lower eukaryotes and bacteria. The appearance of multiple antibiotic resistant

  13. A field evaluation of the Hardy TB MODS Kit™ for the rapid phenotypic diagnosis of tuberculosis and multi-drug resistant tuberculosis.

    Directory of Open Access Journals (Sweden)

    Laura Martin

    Full Text Available Even though the WHO-endorsed, non-commercial MODS assay offers rapid, reliable TB liquid culture and phenotypic drug susceptibility testing (DST at lower cost than any other diagnostic, uptake has been patchy. In part this reflects misperceptions about in-house assay quality assurance, but user convenience of one-stop procurement is also important. A commercial MODS kit was developed by Hardy Diagnostics (Santa Maria, CA, USA with PATH (Seattle, WA, USA to facilitate procurement, simplify procedures through readymade media, and enhance safety with a sealing silicone plate lid. Here we report the results from a large-scale field evaluation of the MODS kit in a government service laboratory.2446 sputum samples were cultured in parallel in Lowenstein-Jensen (LJ, conventional MODS and in the MODS kit. MODS kit DST was compared with conventional MODS (direct DST and proportion method (indirect DST. 778 samples (31.8% were Mycobacterium tuberculosis culture-positive. Compared to conventional MODS the sensitivity, specificity, positive, and negative predictive values (95% confidence intervals of the MODS Kit were 99.3% (98.3-99.8%, 98.3% (97.5-98.8%, 95.8% (94.0-97.1%, and 99.7% (99.3-99.9%. Median (interquartile ranges time to culture-positivity (and rifampicin and isoniazid DST was 10 (9-13 days for conventional MODS and 8.5 (7-11 for MODS Kit (p<0.01. Direct rifampicin and isoniazid DST in MODS kit was almost universally concordant with conventional MODS (97.9% agreement, 665/679 evaluable samples and reference indirect DST (97.9% agreement, 687/702 evaluable samples.MODS kit delivers performance indistinguishable from conventional MODS and offers a convenient, affordable alternative with enhanced safety from the sealing silicone lid. The availability in the marketplace of this platform, which conforms to European standards (CE-marked, readily repurposed for second-line DST in the near future, provides a fresh opportunity for improving equity of

  14. Perfil de sensibilidade e fatores de risco associados à resistência do Mycobacterium tuberculosis, em centro de referência de doenças infecto-contagiosas de Minas Gerais Multidrug-resistant Mycobacterium tuberculosis at a referral center for infectious diseases in the state of Minas Gerais, Brazil: sensitivity profile and related risk factors

    Directory of Open Access Journals (Sweden)

    Márcia Beatriz de Souza

    2006-10-01

    Full Text Available OBJETIVO: Estudar os fatores determinantes da multirresistência do Mycobacterium tuberculosis às drogas tuberculostáticas em centro de referência de doenças infecto-contagiosas do Estado de Minas Gerais, Hospital Eduardo de Menezes. MÉTODOS: Estudo tipo caso-controle, retrospectivo, realizado de setembro de 2000 a janeiro de 2004. Nesse período, 473 culturas com crescimento de M. tuberculosis relativas a 313 pacientes foram analisadas quanto ao perfil de sensibilidade, no Laboratório Central de Minas Gerais. Foram selecionados os casos multirresistentes definidos como resistência a pelo menos rifampicina e isoniazida, depois de pareados com o grupo controle de pacientes com tuberculose sensível a todas as drogas na razão de 1:3. A associação dos dados demográficos e clínicos foi feita por análise estatística uni e multivariada. RESULTADOS: Durante o período de estudo, doze casos de tuberculose multirresistente foram identificados (3,83%. Na análise univariada, a tuberculose multirresistente foi mais comum no sexo masculino, em pacientes com baciloscopia de escarro positiva, pacientes com cavitações maiores que 4 cm de diâmetro e pacientes com um ou mais tratamentos prévios para tuberculose (p = 0,10. Após a análise multivariada somente o tratamento anterior para tuberculose permaneceu estatisticamente significativo (p = 0,0374, com odds ratio de 14,36 (1,96 - 176,46. CONCLUSÃO: O fator de risco que se mostrou independentemente associado ao desenvolvimento de tuberculose multirresistente neste estudo foi a presença de um ou mais tratamentos prévios para tuberculose.OBJECTIVE: To assess the determining factors for Mycobacterium tuberculosis multidrug resistance at a referral center for infectious diseases in the state of Minas Gerais, Brazil. METHODS: A retrospective case-control study was conducted using data collected from September of 2000 to January of 2004. During this period, 473 cultures presenting growth of M

  15. Ambulatory Multi-Drug Resistant Tuberculosis Treatment Outcomes in a Cohort of HIV-Infected Patients in a Slum Setting in Mumbai, India

    Science.gov (United States)

    Isaakidis, Petros; Cox, Helen S.; Varghese, Bhanumati; Montaldo, Chiara; Da Silva, Esdras; Mansoor, Homa; Ladomirska, Joanna; Sotgiu, Giovanni; Migliori, Giovanni B.; Pontali, Emanuele; Saranchuk, Peter; Rodrigues, Camilla; Reid, Tony

    2011-01-01

    Background India carries one quarter of the global burden of multi-drug resistant TB (MDR-TB) and has an estimated 2.5 million people living with HIV. Despite this reality, provision of treatment for MDR-TB is extremely limited, particularly for HIV-infected individuals. Médecins Sans Frontières (MSF) has been treating HIV-infected MDR-TB patients in Mumbai since May 2007. This is the first report of treatment outcomes among HIV-infected MDR-TB patients in India. Methods HIV-infected patients with suspected MDR-TB were referred to the MSF-clinic by public Antiretroviral Therapy (ART) Centers or by a network of community non-governmental organizations. Patients were initiated on either empiric or individualized second-line TB-treatment as per WHO recommendations. MDR-TB treatment was given on an ambulatory basis and under directly observed therapy using a decentralized network of providers. Patients not already receiving ART were started on treatment within two months of initiating MDR-TB treatment. Results Between May 2007 and May 2011, 71 HIV-infected patients were suspected to have MDR-TB, and 58 were initiated on treatment. MDR-TB was confirmed in 45 (78%), of which 18 (40%) were resistant to ofloxacin. Final treatment outcomes were available for 23 patients; 11 (48%) were successfully treated, 4 (17%) died, 6 (26%) defaulted, and 2 (9%) failed treatment. Overall, among 58 patients on treatment, 13 (22%) were successfully treated, 13 (22%) died, 7 (12%) defaulted, two (3%) failed treatment, and 23 (40%) were alive and still on treatment at the end of the observation period. Twenty-six patients (45%) experienced moderate to severe adverse events, requiring modification of the regimen in 12 (20%). Overall, 20 (28%) of the 71 patients with MDR-TB died, including 7 not initiated on treatment. Conclusions Despite high fluoroquinolone resistance and extensive prior second-line treatment, encouraging results are being achieved in an ambulatory MDR-T- program in a slum setting in India. Rapid scale-up of both ART and second-line treatment for MDR-TB is needed to ensure survival of co-infected patients and mitigate this growing epidemic. PMID:22145022

  16. Altered membrane permeability in multidrug resistant Escherichia ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... involvement during the transport of β - lactams in multidrug resistant Escherichia coli isolated from extra-intestinal infections. Also, the ... lactam resistance in multidrug resistant E. coli in ESBL and non-ESBL isolates. .... and decreased susceptibility to carbapenems, particularly ertapenem (Perez et al.,.

  17. Impact of rapid molecular diagnostic tests on time to treatment initiation and outcomes in patients with multidrug-resistant tuberculosis, Tamil Nadu, India.

    Science.gov (United States)

    Nair, Dina; Navneethapandian, Pooranaganga D; Tripathy, Jaya Prasad; Harries, Anthony D; Klinton, Joel S; Watson, Basilea; Sivaramakrishnan, Gomathi N; Reddy, Devarajulu S; Murali, Lakshmi; Natrajan, Mohan; Swaminathan, Soumya

    2016-09-01

    India is replacing culture and drug sensitivity testing (CDST) with rapid molecular tests for diagnosing MDR-TB. We assessed the impact of rapid tests on time to initiation of treatment and outcomes in patients with MDR-TB compared with CDST. A retrospective cohort study involving MDR-TB patients from six districts in Tamil Nadu state, who underwent CDST (2010-2011) and rapid tests (2012-2013). There were 135 patients in the CDST group and 389 in the rapid diagnostic test group. Median time from sputum receipt at the laboratory to initiation of MDR-TB treatment was 130 days (IQR 75-213) in the CDST group and 22 days (IQR 14-38) in the rapid diagnostic test group (p30% in both groups and missing data were higher in CDST (13%) compared with rapid tests (3%). There were significantly higher risks of unfavourable treatment outcomes in males (aRR 1.3, 95% CI 1.1-1.5) and those with treatment initiation delays >30 days (aRR 1.3, 95% CI 1.0-1.6). Rapid molecular diagnostic tests shortened the time to initiate treatment which was associated with reduced unfavourable outcomes in MDR-TB patients. This supports the policy to scale up these tests in India. © The Author 2016. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Active Sputum Monitoring Detects Substantial Rate of Multi-Drug Resistant Tuberculosis (MDR-TB) in an HIV-Infected Population in South Africa

    Science.gov (United States)

    Hassim, Shaheen; Shaw, Pamela A.; Sangweni, Phumelele; Malan, Lizette; Ntshani, Ella; Mathibedi, Monkwe Jethro; Stubbs, Nomso; Metcalf, Julia A; Eckes, Risa; Masur, Henry; Komati, Stephanus

    2010-01-01

    Background Tuberculosis (TB) co-infection with HIV is a substantial problem in South Africa. There has been a presumption that drug resistant strains of TB are common in South Africa, but few studies have documented this impression. Methods In Phidisa, a joint observational and randomized HIV treatment study for South African National Defence Force members and dependents, an initiative obtained microbiologic TB testing in subjects who appeared to be at high risk. We report results for HIV-infected subjects. Results TB was identified by culture in 116/584 (19.9%) of patients selected for sputum examination on the basis of suggestive symptoms. Smear was an insensitive technique for confirming the diagnosis: only 33% of culture-positive patients were identified by smear, with a 0.2% false positive rate. Of the 107 culture-positive individuals with susceptibility testing, 22 (20.6%) were identified to be MDR and 4 (3.7%) became extremely drug resistant tuberculosis (XDR) while under observation. Culture-positive cases with a history of TB treatment had more than twice the rate of MDR than those without, 27.1% vs. 11.9% (p=0.05). Conclusions TB is common in this cohort of HIV-infected patients. Smear was not a sensitive technique for identifying culture-positive cases in this health system. Drug susceptibility testing is essential to proper patient management because MDR was present in 20.6% of culture-positive patients. Better management strategies are needed to reduce the development of MDR-TB since so many such patients had received prior antituberculous therapy that was presumably not curative. PMID:20196651

  19. Análise comparativa entre tuberculose multirresistente e tuberculose extensivamente resistente - Epidemiologia e factores preditivos Comparative analysis of multidrug-resistant tuberculosis and extensively drug-resistant tuberculosis - Epidemiology and predictive factors

    Directory of Open Access Journals (Sweden)

    Ana Sofia Vilariça

    2008-12-01

    ,3% eram TBXDR. Observaram -se diferenças estatisticamente significativas nas seguintes variáveis: raça (a raça negra esteve associada a TBXDR em 74% dos casos versus 46% da raça caucasiana; classificação OMS (doentes com retratamento por insucesso terapêutico, interrupção do tratamento ou recidiva constituíram 69,5% dos casos de TBXDR versus 44,5 % dos casos não TBXDR; duração média dos tratamentos anteriores (4,2 meses para os casos de TBXDR versus 2,8 meses para os casos não TBXDR; coinfecção VIH/SIDA (doentes com coinfecção VIH constituíram 65,2% dos casos de TB XDR versus 42,9% dos casos não TBXDR e mortalidade (33,3% nos doentes com TBXDR versus 14,3% nos doentes não TBXDR. Conclusões: As variáveis com valor preditivo para o diagnóstico de TBXDR versus não TBXDR foram: presença de infecção VIH (risco relativo [RR] para TBXDR de 2,5; intervalo de confiança [IC], 1,24 - 5,05; maior duração média dos tratamentos anteriores ([RR] para TB XDR de 1,2; [IC], 1,11 -2,30 .Introduction: Extensively drug-resistant tuberculosis (XDR-TB is defined as a form of multidrug-resistant tuberculosis (MDR-TB with additional resistance to fluoroquinolones and at least one of the injectable drugs used in tuberculosis treatment: amikacin, kanamycin and capreomycin. It was classified by WHO as a serious threat to tuberculosis (TB control, with world-wide consequences, taking on the proportions of a real pandemic in some regions. Aim: To compare patients with XDR-TB versus other MDR-TB profiles with regard to epidemiological and demographic characteristics, aetiopathogenic factors and inhospital outcomes. Methods: Patients admitted to Pulido Valente Hospital (Pulmonology Service III in the period ranging from April 1999 to June 2007 with MDR-TB diagnosis microbiologically confirmed. The following variables were evaluated: gender, age, race, forms of TB presentation, treatment groups, resistance profile, immigrant status, number and duration of previous

  20. Multidrug resistance in amoebiasis patients.

    Science.gov (United States)

    Bansal, Devendra; Sehgal, Rakesh; Chawla, Yogesh; Malla, Nancy; Mahajan, R C

    2006-08-01

    Amoebiasis, caused by Entamoeba sp. a protozoan parasite, is a major public health problem in tropical and subtropical countries. The symptomatic patients are treated by specific chemotherapy. However, there are reports of treatment failure in some cases suggesting the possibility of drug resistance. The present study was therefore planned to assess the presence and expression of mRNA of multidrug resistance (MDR) gene in clinical isolates of Entamoeba histolytica and E. dispar. Forty five clinical isolates of Entamoeba sp. [E. histolytica (15) and E. dispar (30)] were maintained in polyxenic followed by monoxenic medium. DNA and total RNA were extracted from clinical isolates of Entamoeba sp. and from sensitive strain of E. histolytica (HM1: IMSS) and subjected to polymerase chain reaction (PCR) and multiplex reverse transcription (RT)-PCR techniques. The 344 bp segment of E. histolytica DNA was seen by PCR using primers specific to EhPgp1 in all clinical isolates and sensitive strain of E. histolytica. Over expression of EhPgp1 was observed only in resistant mutant of E. histolytica; however, transcription of EhPgp1 was not seen in any clinical isolates and sensitive strain of E. histolytica. The findings of the present study indicate that, so far, drug resistance in clinical isolates of E. histolytica does not seem to be a major problem in this country. However, susceptibility of clinical isolates of E. histolytica against various antiamoebic drugs needs to be investigated for better management.

  1. Comparative evaluation of GenoType MTBDRplus line probe assay with solid culture method in early diagnosis of multidrug resistant tuberculosis (MDR-TB at a tertiary care centre in India.

    Directory of Open Access Journals (Sweden)

    Raj N Yadav

    Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.

  2. Pattern of intensive phase treatment outcomes of multi-drug resistant ...

    African Journals Online (AJOL)

    Pattern of intensive phase treatment outcomes of multi-drug resistant tuberculosis in University of Port Harcourt Treatment Centre: a review of records from ... Data on patients' age, sex, HIV status, treatment outcomes were extracted from the hospital book records into a computer data sheet at the UPTH treatment centre.

  3. Resistance to fluoroquinolones and second-line injectable drugs: impact on multidrug-resistant TB outcomes

    NARCIS (Netherlands)

    Falzon, Dennis; Gandhi, Neel; Migliori, Giovanni B.; Sotgiu, Giovanni; Cox, Helen S.; Holtz, Timothy H.; Hollm-Delgado, Maria-Graciela; Keshavjee, Salmaan; Deriemer, Kathryn; Centis, Rosella; D'Ambrosio, Lia; Lange, Christoph G.; Bauer, Melissa; Menzies, Dick; Ahuja, S. D.; Ashkin, D.; Avendaño, M.; Banerjee, R.; Bauer, M.; Becerra, M. C.; Benedetti, A.; Burgos, M.; Centis, R.; Chan, E. D.; Chiang, C. Y.; Cobelens, F.; Cox, H.; D'Ambrosio, L.; de Lange, W. C. M.; DeRiemer, K.; Enarson, D.; Falzon, D.; Flanagan, K. L.; Flood, J.; Gandhi, N.; Garcia-Garcia, M. L.; Granich, R. M.; Hollm-Delgado, M. G.; Holtz, T. H.; Hopewell, P.; Iseman, M. D.; Jarlsberg, L. G.; Keshavjee, S.; Kim, H. R.; Koh, W. J.; Lancaster, J. L.; Lange, C.; Leimane, V.; Leung, C. C.; Li, J.

    2013-01-01

    A meta-analysis for response to treatment was undertaken using individual data of multidrug-resistant tuberculosis (MDR-TB) (resistance to isoniazid and rifampicin) patients from 26 centres. The analysis assessed the impact of additional resistance to fluoroquinolones and/or second-line injectable

  4. Risk Factors for Multidrug-resistant Tuberculosis

    Directory of Open Access Journals (Sweden)

    Cleopas Martin Rumende

    2018-04-01

    Diabetes mellitus has been a well-known risk factor for TB in the past. The global convergence of the accelerating type 2 DM pandemic, high TB prevalence and drug-resistant TB during the past couple of decades has become a serious challenge to clinicians worldwide. Over the past few years, some studies have shown that the treatment failure rate is higher in TB patients with DM as comorbidity. Moreover, there is significant association between DM an MDR-TB. There is higher chance of TB bacilli persistence to be present in sputum of pulmonary TB patient with DM than TB-only patient after 5 months treatment, and this persistence made it necessary for more longer treatment. Presence of DM in TB patients cause a longer period for sputum conversion, therefore it may become a major cause of poor treatment outcome in TB patients. Previous studies showed that a major mechanism for the emergence of drugs resistance in TB bacilli is random mutation in the bacterial genome and the pressure of selection by anti-TB drugs. Pulmonary TB in diabetic patients usually show higher mycobacterial loads at the initiation of treatment, hence they may have higher chance of bacillary mutation and the emergence of MDR-TB with the presenting of higher bacterial loads, longer treatment is needed to clear the bacteria. Therefore, it is not suprising that a higher chance of MDR-TB patients could be find in those patients. A pharmacokinetic study noted that plasma levels of rifampicin were 53% lower in TB patients with diabetes, which might affect treatment outcomes. Inadequate immune respons of the host may also be important in this negative effect of diabetes. Depressed production of IFN-γ in diabetic patients is related to decreasing immune response to TB infection. Reduction of IL-12 response to mycobacterial stimulation in leukocytes from TB with diabetic patients suggest a compromise of innate immune response.

  5. Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

    Directory of Open Access Journals (Sweden)

    Chen Tingfu

    2010-07-01

    Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

  6. Antimicrobial Activity of Actinomycetes Against Multidrug Resistant ...

    African Journals Online (AJOL)

    Antimicrobial Activity of Actinomycetes Against Multidrug Resistant Staphylococcus aureus, E. coli and Various Other Pathogens. ... Purpose: The rapid emergence of drug resistance among pathogenic bacteria, especially multidrugresistant bacteria, underlines the need to look for new antibiotics. Methods: In the present ...

  7. Altered membrane permeability in multidrug resistant Escherichia ...

    African Journals Online (AJOL)

    The study was conducted with the objective of examining the outer membrane proteins and their involvement during the transport of β - lactams in multidrug resistant Escherichia coli isolated from extra-intestinal infections. Also, the response of gram negative bacterial biomembrane alteration was studied using extended ...

  8. Expression of multidrug resistance proteins in retinoblastoma

    Directory of Open Access Journals (Sweden)

    Swati Shukla

    2017-11-01

    Full Text Available AIM: To elucidate the mechanism of multidrug resistance in retinoblastoma, and to acquire more insights into in vivo drug resistance. METHODS: Three anticancer drug resistant Y79 human RB cells were generated against vincristine, etoposide or carboplatin, which are used for conventional chemotherapy in RB. Primary cultures from enucleated eyes after chemotherapy (PCNC were also prepared. Their chemosensitivity to chemotherapeutic agents (vincristine, etoposide and carboplatin were measured using MTT assay. Western blot analysis was performed to evaluate the expression of p53, Bcl-2 and various multidrug resistant proteins in retinoblastoma cells. RESULTS: Following exposure to chemotherapeutic drugs, PCNC showed less sensitivity to drugs. No significant changes observed in the p53 expression, whereas Bcl-2 expression was found to be increased in the drug resistant cells as well as in PCNC. Increased expression of P-glycoprotein (P-gp was observed in drug resistant Y79 cells; however there was no significant change in the expression of P-gp found between primary cultures of primarily enucleated eyes and PCNC. Multidrug resistance protein 1 (Mrp-1 expression was found to be elevated in the drug resistant Y79 cells as well as in PCNC. No significant change in the expression of lung resistance associated protein (Lrp was observed in the drug resistant Y79 cells as well as in PCNC. CONCLUSION: Our results suggest that multidrug resistant proteins are intrinsically present in retinoblastoma which causes treatment failure in managing retinoblastoma with chemotherapy.

  9. Multidrug Resistant Acinetobacter Infection and Their Antimicrobial ...

    African Journals Online (AJOL)

    Background: Acinetobacter baumannii, a non-glucose fermenting Gram negative bacillus, has emerged in the last three decades as a major etiological agent of hospital-associated infections giving rise to significant morbidity and mortality particularly in immunocompromised patients. Multidrug resistant A. baumannii ...

  10. Expression of multidrug resistance proteins in retinoblastoma.

    Science.gov (United States)

    Shukla, Swati; Srivastava, Arpna; Kumar, Sunil; Singh, Usha; Goswami, Sandeep; Chawla, Bhavna; Bajaj, Mandeep Singh; Kashyap, Seema; Kaur, Jasbir

    2017-01-01

    To elucidate the mechanism of multidrug resistance in retinoblastoma, and to acquire more insights into in vivo drug resistance. Three anticancer drug resistant Y79 human RB cells were generated against vincristine, etoposide or carboplatin, which are used for conventional chemotherapy in RB. Primary cultures from enucleated eyes after chemotherapy (PCNC) were also prepared. Their chemosensitivity to chemotherapeutic agents (vincristine, etoposide and carboplatin) were measured using MTT assay. Western blot analysis was performed to evaluate the expression of p53, Bcl-2 and various multidrug resistant proteins in retinoblastoma cells. Following exposure to chemotherapeutic drugs, PCNC showed less sensitivity to drugs. No significant changes observed in the p53 expression, whereas Bcl-2 expression was found to be increased in the drug resistant cells as well as in PCNC. Increased expression of P-glycoprotein (P-gp) was observed in drug resistant Y79 cells; however there was no significant change in the expression of P-gp found between primary cultures of primarily enucleated eyes and PCNC. Multidrug resistance protein 1 (Mrp-1) expression was found to be elevated in the drug resistant Y79 cells as well as in PCNC. No significant change in the expression of lung resistance associated protein (Lrp) was observed in the drug resistant Y79 cells as well as in PCNC. Our results suggest that multidrug resistant proteins are intrinsically present in retinoblastoma which causes treatment failure in managing retinoblastoma with chemotherapy.

  11. Expression of multidrug resistance proteins in retinoblastoma

    Science.gov (United States)

    Shukla, Swati; Srivastava, Arpna; Kumar, Sunil; Singh, Usha; Goswami, Sandeep; Chawla, Bhavna; Bajaj, Mandeep Singh; Kashyap, Seema; Kaur, Jasbir

    2017-01-01

    AIM To elucidate the mechanism of multidrug resistance in retinoblastoma, and to acquire more insights into in vivo drug resistance. METHODS Three anticancer drug resistant Y79 human RB cells were generated against vincristine, etoposide or carboplatin, which are used for conventional chemotherapy in RB. Primary cultures from enucleated eyes after chemotherapy (PCNC) were also prepared. Their chemosensitivity to chemotherapeutic agents (vincristine, etoposide and carboplatin) were measured using MTT assay. Western blot analysis was performed to evaluate the expression of p53, Bcl-2 and various multidrug resistant proteins in retinoblastoma cells. RESULTS Following exposure to chemotherapeutic drugs, PCNC showed less sensitivity to drugs. No significant changes observed in the p53 expression, whereas Bcl-2 expression was found to be increased in the drug resistant cells as well as in PCNC. Increased expression of P-glycoprotein (P-gp) was observed in drug resistant Y79 cells; however there was no significant change in the expression of P-gp found between primary cultures of primarily enucleated eyes and PCNC. Multidrug resistance protein 1 (Mrp-1) expression was found to be elevated in the drug resistant Y79 cells as well as in PCNC. No significant change in the expression of lung resistance associated protein (Lrp) was observed in the drug resistant Y79 cells as well as in PCNC. CONCLUSION Our results suggest that multidrug resistant proteins are intrinsically present in retinoblastoma which causes treatment failure in managing retinoblastoma with chemotherapy. PMID:29181307

  12. Multidrug Resistance in Infants and Children

    Directory of Open Access Journals (Sweden)

    Gian Maria Pacifici

    2018-02-01

    Full Text Available Bacterial infections may cause disease and death. Infants and children are often subject to bacterial infections. Antimicrobials kill bacteria protecting the infected patients andreducing the risk of morbidity and mortality caused by bacteria. The antibiotics may lose their antibacterial activity when they become resistant to a bacteria. The resistance to different antibiotics in a bacteria is named multidrug-resistance. Gram-negative bacilli, especially Escherichia coli, Klebsiella, Enterobacter, Salmonella, Shigella, Pseudomonas, Streptococcus, and Haemophilus influenzae type b, may become resistant. Amikacin ampicillin, amoxicillin, amoxiclav, cefuroxime, cefotaxime, ceftazidime, cefoperazone tetracycline, chloramphenicol, ciprofloxacin, and gentamicin may cause bacterial-resistance. Resistance to bacteria for several pathogens makes complications in the treatment of infections caused by them. Salmonella strains may become resistant to ampicillin, cephalotin, ceftriaxone, gentamicin, amikacin, trimethoprim-sulfamethoxazole, chloramphenicol, and tetracycline. Shigella strains may become resistant to ampicillin, cotrimoxazole, chloramphenicol, and streptomycin. Multidrug-resistance of Streptococcus pneumoniae may be due to β-lactams, macrolides, tetracycline, chloramphenicol, and trimethoprim-sulfamethoxazole. Multidrug-resistance of Pseudomonas aeruginosa may become resistant to β-lactams, chloramphenicol, trimethoprim-sulfamethoxazole, and tetracycline. The antibacterial activity against Haemophilus strains may occur with ampicillin, sulbactam-ampicillin, trimethoprim-sulfamethoxazole, gentamicin, chloramphenicol, and ciprofloxacin. Multidrug-resistance of the Klebsiella species may be due with ampicillin, cefotaxime, cefuroxime, co-amxilav, mezlocillin, chloramphenicol, gentamicin, and ceftazidime. Multidrug-resistance of Escherichia coli may be caused by ampicillin, cotrimoxazole, chloramphenicol, ceftriaxone, and ceftazidime. Vibrio

  13. Multi-drug resistant Ewingella Americana

    International Nuclear Information System (INIS)

    Bukhari, Syed Z.; Ashshi, Ahmad M.; Hussain, Waleed M.; Fatani, Mohammad I.

    2008-01-01

    We report a case of pneumonia due to multi-drug resistant Ewingella Americana in a young patient admitted in the Intensive Care Unit of Hera General Hospital, Makkah, Saudi Arabia with severe head injury in a road traffic accident. He was an Indonesian pilgrim who had traveled to the Kingdom of Saudi Arabia to perform Hajj in December 2007. Ewingella Americana was identified to be the pathogen of pneumonia with clinical signs and symptoms along with positive radiological findings. (author)

  14. Multidrug resistance in pediatric urinary tract infections.

    Science.gov (United States)

    Gaspari, Romolo J; Dickson, Eric; Karlowsky, James; Doern, Gary

    2006-01-01

    Urinary tract infections (UTIs) represent a common infection in the pediatric population. Escherichia coli is the most common uropathogen in children, and antimicrobial resistance in this species complicates the treatment of pediatric UTIs. Despite the impact of resistance on empiric antibiotic choice, there is little data on multidrug resistance in pediatric patients. In this paper, we describe characteristics of multidrug-resistant E. coli in pediatric patients using a large national database of uropathogens antimicrobial sensitivities. Antimicrobial susceptibility patterns to commonly prescribed antibiotics were performed on uropathogens isolated from children presenting to participating hospitals between 1999 and 2001. Data were analyzed separately for four pediatric age groups. Single and multidrug resistance to ampicillin, amoxicillin-clavulanate, cefazolin, ciprofloxacin, nitrofurantoin, and trimethoprim-sulfamethoxazole (TMP-SMX) were performed on all specimens. There were a total of 11,341 E. coli urine cultures from 343 infants (0-4 weeks), 1,801 toddlers (5 weeks-24 months), 6,742 preteens (2-12 years), and 2,455 teens (13-17 years). E. coli resistance to ampicillin peaked in toddlers (52.8%) but was high in preteens (52.1%), infants (50.4%), and teens (40.6%). Resistance to two or more antibiotics varied across age groups, with toddlers (27%) leading preteens (23.1%), infants (21%), and teens (15.9%). Resistance to three or more antibiotics was low in all age groups (range 3.1-5.2%). The most common co-resistance in all age groups was ampicillin/TMP-SMZ. In conclusion, less than half of all pediatric UTIs are susceptible to all commonly used antibiotics. In some age groups, there is a significant percentage of co-resistance between the two most commonly used antibiotics (ampicillin and TMP-SMZ).

  15. Reversal of multidrug resistance by surfactants.

    Science.gov (United States)

    Woodcock, D. M.; Linsenmeyer, M. E.; Chojnowski, G.; Kriegler, A. B.; Nink, V.; Webster, L. K.; Sawyer, W. H.

    1992-01-01

    Cremophor EL, a pharmacologically inactive solubilising agent, has been shown to reverse multidrug resistance (MDR). Using flow cytometric evaluation of equilibrium intracellular levels of daunorubicin (DNR), we found that eight other surface active agents will also reverse MDR. All the active detergents contain polyethoxylated moieties but have no similarities in their hydrophobic components. The properties of three polyethoxylated surfactants that showed the lowest toxicities, Cremophor, Tween 80 and Solutol HS15, were examined in more detail. The concentrations of Tween 80 and Solutol required to reverse DNR exclusion were 10-fold lower than for Cremophor. However while concentrations greater than or equal to 1:10(2) of the former two surfactants resulted in breakdown of cells, even 1:10 of Cremophor did not lyse cells. Studies of the effects of Cremophor on the uptake and efflux of DNR in normal and MDR cell types showed that Cremophor increases intracellular DNR primarily by locking the rapid efflux from the cells. This blockage of drug efflux may be mediated by a substantial alteration in the fluidity of cell membranes induced by Cremophor, as shown by decreased fluorescence anisotropy of a membrane probe. Consistent with these data, coinjection of adriamycin plus Cremophor into mice carrying a multidrug resistant P388 transplantable tumour significantly increased the survival time of the mice compared with adriamycin treatment alone. PMID:1637678

  16. Resistant plasmid profile analysis of multidrug resistant Escherichia ...

    African Journals Online (AJOL)

    Background: Multi-drug resistant Escherichia coli has become a major threat and cause of many urinary tract infections (UTIs) in Abeokuta, Nigeria. Objectives: This study was carried out to determine the resistant plasmids of multidrug resistant Escherichia coli isolated from (Urinary tract infections)UTIs in Abeokuta.

  17. Study of multidrug resistance and radioresistance

    International Nuclear Information System (INIS)

    Kang, Yoon Koo; Yoo, Young Do

    1999-04-01

    We investigated the mechanism of 5-FU, adriamycin, radiation resistance in Korean gastric cancer cells. First we investigated the relation between Rb and multidrug resistance. Rb stable transfectants exhibited 5- to 10- fold more resistance to adriamycin than the control cells. These Rb transfectants showed increased MDR1 expression. We also investigated up-regulation in radiation-resistant tumor tissues. HSP27, MRP-8, GST, and NKEF-B were up-regulated in radiation resistant tumor. Expression of NKEF-B was also increased by radiation exposure in Head and Neck cells. These results demonstrated that NKEF-B is a stress response protein and it may have an important role in radiation resistance

  18. Proteome analysis of multidrug-resistant, breast cancer–derived microparticles

    Directory of Open Access Journals (Sweden)

    Deep Pokharel

    2014-08-01

    Full Text Available Cancer multidrug resistance (MDR occurs when cancer cells evade the cytotoxic actions of chemotherapeutics through the active efflux of drugs from within the cells. Our group have previously demonstrated that multidrug-resistant breast cancer cells spontaneously shed microparticles (MPs and that these MPs can transfer resistance to drug-responsive cells and confer MDR on those cells in as little as 4 h. Furthermore, we also showed that, unlike MPs derived from leukaemia cells, breast cancer–derived MPs display a tissue selectivity in the transfer of P-glycoprotein (P-gp, transferring the resistance protein only to malignant breast cells. This study aims to define the proteome of breast cancer–derived MPs in order to understand the differences in protein profiles between those shed from drug-resistant versus drug-sensitive breast cancer cells. In doing so, we detail the protein cargo required for the intercellular transfer of MDR to drug-sensitive recipient cells and the factors governing the transfer selectivity to malignant breast cells. We describe the first proteomic analysis of MPs derived from human breast cancer cells using SDS PAGE and liquid chromatography–tandem mass spectrometry (LC/MS/MS, in which we identify 120 unique proteins found only in drug-resistant, breast cancer–derived MPs. Our results demonstrate that the MP-mediated transfer of P-gp to recipient cells occurs alongside CD44; the Ezrin, Radixin and Moesin protein family (ERM; and cytoskeleton motor proteins within the MP cargo.

  19. Análisis de costos de los métodos rápidos para diagnóstico de Tuberculosis multidrogorresistente en diferentes grupos epidemiológicos del Perú Cost analysis of rapid methods for diagnosis of multidrug resistant Tuberculosis in different epidemiologic groups in Perú

    Directory of Open Access Journals (Sweden)

    Lely Solari

    2011-09-01

    Full Text Available Objetivos. Evaluar los costos de tres métodos diagnósticos para susceptibilidad a drogas antituberculosas y comparar el costo por caso de tuberculosis multidrogorresistente (TB MDR diagnosticado con estos (MODS; GRIESS y Genotype MTBDR plus ® en cuatro grupos epidemiológicos en el Perú. Materiales y métodos. En base a cifras programáticas, se dividió a la población en cuatro grupos: pacientes nuevos de Lima/Callao; nuevos de otras provincias; los antes tratados de Lima/Callao y de otras provincias. Se calcularon los costos de cada prueba en base a la metodología estándar utilizada por el Ministerio de Salud, desde la perspectiva de los servicios de salud. Basado en ello, se calculó el costo por paciente TB MDR diagnosticado para cada grupo epidemiológico. Resultados. Los costos estimados por prueba para MODS, GRIESS, y Genotype MTBDR plus ® fueron de 14,83; 15,51 y 176,41 nuevos soles, respectivamente. El costo por paciente TB MDR diagnosticado con GRIESS y MODS fue menor a los 200 nuevos soles en tres de los cuatro grupos. El costo por TB MDR diagnosticado fue de más de 2000 nuevos soles con el Genotype MTBDR plus ® en los dos grupos de pacientes nuevos y, menores a 1000 nuevos soles en los grupos de pacientes antes tratados. Conclusiones. En grupos de alta prevalencia, como son los pacientes antes tratados, los costos por caso diagnosticado de TB MDR con las tres pruebas evaluadas fueron bajos, sin embargo, con la prueba molecular en los grupos de baja prevalencia, fueron elevados. El uso de las pruebas moleculares debe optimizarse en grupos de altas prevalencias.Objectives.To evaluate the costs of three methods for the diagnosis of drug susceptibility in tuberculosis, and to compare the cost per case of Multidrug-resistant tuberculosis (MDR TB diagnosed with these (MODS, GRIESS and Genotype MTBDR plus ® in 4 epidemiologic groups in Peru. Materials and methods.In the basis of programmatic figures, we divided the population in

  20. Visualization of multidrug resistance in vivo

    International Nuclear Information System (INIS)

    Hendrikse, N.H.; Franssen, E.J.F.; Graaf, W.T.A. van der; Vries, E.G.E. de; Vaalburg, W.

    1999-01-01

    Various mechanisms are involved in multidrug resistance (MDR) for chemotherapeutic drugs, such as the drug efflux pumps, P-glycoprotein (Pgp) and multidrug resistance-associated protein (MRP). In this review the mechanisms involved in MDR are described and results are reviewed with particular attention to the in vivo imaging of Pgp and MRP. Various detection assays provide information about the presence of drug efflux pumps at the mRNA and protein levels. However, these methods do not yield information about the dynamic function of Pgp and MRP in vivo. For the study of Pgp- and MRP-mediated transport, single-photon emission tomography (SPET) and positron emission tomography (PET) are available. Technetium-99m sestamibi is a substrate for Pgp and MRP, and has been used in clinical studies for tumour imaging, and to visualize blockade of Pgp-mediated transport after modulation of the Pgp pump. Other 99m Tc radiopharmaceuticals, such as 99m Tc-tetrofosmin and several 99 Tc-Q complexes, are also substrates for Pgp, but to date only results from in vitro and animal studies are available for these compounds. Several agents, including [ 11 C]colchicine, [ 11 C]verapamil and [ 11 C]daunorubicin, have been evaluated for the quantification of Pgp-mediated transport with PET in vivo. The results suggest that radiolabelled colchicine, verapamil and daunorubicin are feasible substrates with which to image Pgp function in tumours. Uptake of [ 11 C]colchicine and [ 11 C]verapamil is relatively high in the chest area, reducing the value of both tracers for monitoring Pgp-mediated drug transport in tumours located in this region. In addition, it has to be borne in mind that only comparison of Pgp-mediated transport of radioalabelled substrates in the absence and in the presence of Pgp blockade gives quantitative information on Pgp-mediated pharmacokinetics. Leukotrienes are specific substrates for MRP. Therefore, N-[ 11 C]acetyl-leukotriene E 4 provides an opportunity to study MRP

  1. Epidemiologic analysis: Prophylaxis and multidrug-resistance in surgery

    Directory of Open Access Journals (Sweden)

    H. Solís-Téllez

    2017-04-01

    Conclusions: The prophylactic guidelines are not strictly adhered to in our environment. There was a significant association between the development of nosocomial infections from multidrug-resistant germs and admission to the intensive care unit.

  2. Multidrug resistance in enteric and other gram-negative bacteria.

    Science.gov (United States)

    George, A M

    1996-05-15

    In Gram-negative bacteria, multidrug resistance is a term that is used to describe mechanisms of resistance by chromosomal genes that are activated by induction or mutation caused by the stress of exposure to antibiotics in natural and clinical environments. Unlike plasmid-borne resistance genes, there is no alteration or degradation of drugs or need for genetic transfer. Exposure to a single drug leads to cross-resistance to many other structurally and functionally unrelated drugs. The only mechanism identified for multidrug resistance in bacteria is drug efflux by membrane transporters, even though many of these transporters remain to be identified. The enteric bacteria exhibit mostly complex multidrug resistance systems which are often regulated by operons or regulons. The purpose of this review is to survey molecular mechanisms of multidrug resistance in enteric and other Gram-negative bacteria, and to speculate on the origins and natural physiological functions of the genes involved.

  3. Metabolic Reprogramming During Multidrug Resistance in Leukemias

    Directory of Open Access Journals (Sweden)

    Raphael Silveira Vidal

    2018-04-01

    Full Text Available Cancer outcome has improved since introduction of target therapy. However, treatment success is still impaired by the same drug resistance mechanism of classical chemotherapy, known as multidrug resistance (MDR phenotype. This phenotype promotes resistance to drugs with different structures and mechanism of action. Recent reports have shown that resistance acquisition is coupled to metabolic reprogramming. High-gene expression, increase of active transport, and conservation of redox status are one of the few examples that increase energy and substrate demands. It is not clear if the role of this metabolic shift in the MDR phenotype is related to its maintenance or to its induction. Apart from the nature of this relation, the metabolism may represent a new target to avoid or to block the mechanism that has been impairing treatment success. In this mini-review, we discuss the relation between metabolism and MDR resistance focusing on the multiple non-metabolic functions that enzymes of the glycolytic pathway are known to display, with emphasis with the diverse activities of glyceraldehyde-3-phosphate dehydrogenase.

  4. Solutol HS 15, nontoxic polyoxyethylene esters of 12-hydroxystearic acid, reverses multidrug resistance.

    Science.gov (United States)

    Coon, J S; Knudson, W; Clodfelter, K; Lu, B; Weinstein, R S

    1991-02-01

    A recently developed non-ionic surfactant called Solutol HS 15 (poly-oxyethylene esters of 12-hydroxystearic acid), with low toxicity in vivo, was shown to reverse completely the multidrug resistance of KB 8-5 and KB 8-5-11 human epidermoid carcinoma cells in vitro but did not potentiate drug toxicity in drug-sensitive KB 3-1 cells. At a concentration of 10% of its own IC50 (mean concentration of drug that causes 50% inhibition of cell growth compared to controls), Solutol HS 15 produced a 35-, 28-, and 42-fold reduction in the resistance of KB 8-5-11 cells to colchicine, vinblastine, and doxorubicin, respectively. Solutol HS 15 was relatively much more potent than the prototypic reversing agent, verapamil, for reversing colchicine resistance, compared to the ability of each agent to reverse colchicine resistance, compared to the ability of each agent to reverse vinblastine resistance. Like verapamil, Solutol HS 15 promoted a 50-fold accumulation of rhodamine 123 in KB 8-5-11 cells, as measured by flow cytometry. Also, Solutol HS 15 and verapamil reduced the efflux of rhodamine 123 from KB 8-5-11 cells previously loaded with rhodamine 123 to a similar low rate. Solutol HS 15 did not affect the transport of alanine or glucose into KB 8-5-11 cells, indicating that its effect upon membrane active transport is not entirely nonspecific. Considering their different structure and different relative potency for reversing colchicine resistance, Solutol HS 15 and verapamil probably reverse multidrug resistance by different mechanisms. Solutol HS 15 merits consideration as a potential therapeutic agent because of its effectiveness for reversing multidrug resistance in vitro and its low toxicity in vivo.

  5. The management of multidrug-resistant Enterobacteriaceae.

    Science.gov (United States)

    Bassetti, Matteo; Peghin, Maddalena; Pecori, Davide

    2016-12-01

    Multidrug-resistant (MDR) Enterobacteriaceae are often related to the production of extended-spectrum b-lactamases (ESBLs) and carbapenemase-producing Enterobacteriaceae (CRE), and represent an increasing global threat. Recommendations for the therapeutic management of MDR-related infections, however, are mainly derived from retrospective and nonrandomized prospective studies. The aim of this review is to discuss the challenges in the treatment of patients with infections because of MDR Enterobacteriaceae and provide an expert opinion while awaiting for more definitive data. To avoid the selection of carbapenemase-producing Enterobacteriaceae, carbapenem-sparing strategies should be considered. B-lactams/b-lactamase inhibitors, mainly piperacillin-tazobactam, minimum inhibitory concentration (MIC) 16/4mg/ml or less represents the best alternative to carbapenems for the treatment of ESBL-producing strains. Overall, combination therapy may be preferred over monotherapy for CRE. The combination of a carbapenem-containing regimen with colistin or high-dose tigecycline or aminoglycoside can be administered at high-dose prolonged infusion with therapeutic drug monitoring for the treatment of CRE with MIC for meropenem 8-16 mg/l or less. For MIC higher than 8-16 mg/l, the use of meropenem should be avoided and various combination therapies based on the in-vitro susceptibility of antimicrobials (e.g., colistin, high-dose tigecycline, fosfomycin, and aminoglycosides) should be selected. Carbapenem-sparing strategies should be used, when feasible, for ESBL infections. The majority of available nonrandomized studies highlight that combination for CRE seem to offer some therapeutic advantage over monotherapy. Strict infection control measures toward MDR Gram-negative pathogens remain necessary while awaiting for new treatment options.

  6. In vitro antimicrobial activity of five essential oils on multidrug resistant Gram-negative clinical isolates.

    Science.gov (United States)

    Sakkas, Hercules; Gousia, Panagiota; Economou, Vangelis; Sakkas, Vassilios; Petsios, Stefanos; Papadopoulou, Chrissanthy

    2016-01-01

    The emergence of drug-resistant pathogens has drawn attention on medicinal plants for potential antimicrobial properties. The objective of the present study was the investigation of the antimicrobial activity of five plant essential oils on multidrug resistant Gram-negative bacteria. Basil, chamomile blue, origanum, thyme, and tea tree oil were tested against clinical isolates of Acinetobacter baumannii (n = 6), Escherichia coli (n = 4), Klebsiella pneumoniae (n = 7), and Pseudomonas aeruginosa (n = 5) using the broth macrodilution method. The tested essential oils produced variable antibacterial effect, while Chamomile blue oil demonstrated no antibacterial activity. Origanum, Thyme, and Basil oils were ineffective on P. aeruginosa isolates. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration values ranged from 0.12% to 1.50% (v/v) for tea tree oil, 0.25-4% (v/v) for origanum and thyme oil, 0.50% to >4% for basil oil and >4% for chamomile blue oil. Compared to literature data on reference strains, the reported MIC values were different by 2SD, denoting less successful antimicrobial activity against multidrug resistant isolates. The antimicrobial activities of the essential oils are influenced by the strain origin (wild, reference, drug sensitive, or resistant) and it should be taken into consideration whenever investigating the plants' potential for developing new antimicrobials.

  7. Acid-fast bacilli culture positivity and drug resistance in abdominal tuberculosis in Mumbai, India.

    Science.gov (United States)

    Samant, Hrishikesh; Desai, Devendra; Abraham, Philip; Joshi, Anand; Gupta, Tarun; Rodrigues, Camilla; George, Siji

    2014-09-01

    Culture positivity for Mycobacterium tuberculosis complex (MTB) in abdominal tuberculosis (TB) using Lowenstein Jensen medium and Bactec system varies from 25 % to 36 %. Data on the prevalence of drug resistance in primary abdominal TB is scant. Our aim was to study the acid-fast bacilli (AFB) culture positivity rate in primary abdominal TB using Bactec Mycobacterial Growth Indicator Tubes (MGIT) system and the prevalence of drug resistance in these patients. Records of patients with abdominal TB (diagnosed on clinical features, endoscopy, histology, microbiology) seen during the period 2008 to 2013 were retrieved from the Gastroenterology and Microbiology departments. Patients with extra-abdominal TB (five pulmonary, two nodal), adnexal (one), and HIV (one) were excluded from analysis. Of 61 patients, 31 (50.8 %) had a positive AFB culture. In the 30 culture-negative patients, histology showed non-caseating granulomas in 25 patients. Drug sensitivity pattern was analyzed in 18 patients; resistance was detected in eight (14.3 % of all patients and 44.4 % of patients in whom drug sensitivity was done) including three (5.4 % of all subjects and 16.6 % in whom drug sensitivity was available) who were multidrug-resistant. The rate of AFB culture positivity in primary abdominal TB was 50.8 % using Bactec MGIT. Likelihood of drug resistance was seen in 14.3 %, of whom 5.4 % were multidrug-resistant.

  8. Previous treatment, sputum-smear nonconversion, and suburban living: The risk factors of multidrugresistant tuberculosis among Malaysians

    Directory of Open Access Journals (Sweden)

    Noorsuzana Mohd Shariff

    2016-01-01

    Full Text Available The number of multidrug-resistant tuberculosis patients is increasing each year in many countries all around the globe. Malaysia has no exception in facing this burdensome health problem. We aimed to investigate the factors that contribute to the occurrence of multidrug-resistant tuberculosis among Malaysian tuberculosis patients. An unmatched case-control study was conducted among tuberculosis patients who received antituberculosis treatments from April 2013 until April 2014. Cases are those diagnosed as pulmonary tuberculosis patients clinically, radiologically, and/or bacteriologically, and who were confirmed to be resistant to both isoniazid and rifampicin through drug-sensitivity testing. On the other hand, pulmonary tuberculosis patients who were sensitive to all first-line antituberculosis drugs and were treated during the same time period served as controls. A total of 150 tuberculosis patients were studied, of which the susceptible cases were 120. Factors found to be significantly associated with the occurrence of multidrug-resistant tuberculosis are being Indian or Chinese (odds ratio 3.17, 95% confidence interval 1.04–9.68; and odds ratio 6.23, 95% confidence interval 2.24–17.35, respectively, unmarried (odds ratio 2.58, 95% confidence interval 1.09–6.09, living in suburban areas (odds ratio 2.58, 95% confidence interval 1.08–6.19, are noncompliant (odds ratio 4.50, 95% confidence interval 1.71–11.82, were treated previously (odds ratio 8.91, 95% confidence interval 3.66–21.67, and showed positive sputum smears at the 2nd (odds ratio 7.00, 95% confidence interval 2.46–19.89 and 6th months of treatment (odds ratio 17.96, 95% confidence interval 3.51–91.99. Living in suburban areas, positive sputum smears in the 2nd month of treatment, and was treated previously are factors that independently contribute to the occurrence of multidrug-resistant tuberculosis. Those with positive smears in the second month of treatment

  9. Multidrug resistance in tumour cells: characterisation of the multidrug resistant cell line K562-Lucena 1

    Directory of Open Access Journals (Sweden)

    VIVIAN M. RUMJANEK

    2001-03-01

    Full Text Available Multidrug resistance to chemotherapy is a major obstacle in the treatment of cancer patients. The best characterised mechanism responsible for multidrug resistance involves the expression of the MDR-1 gene product, P-glycoprotein. However, the resistance process is multifactorial. Studies of multidrug resistance mechanisms have relied on the analysis of cancer cell lines that have been selected and present cross-reactivity to a broad range of anticancer agents. This work characterises a multidrug resistant cell line, originally selected for resistance to the Vinca alkaloid vincristine and derived from the human erythroleukaemia cell K562. This cell line, named Lucena 1, overexpresses P-glycoprotein and have its resistance reversed by the chemosensitisers verapamil, trifluoperazine and cyclosporins A, D and G. Furthermore, we demonstrated that methylene blue was capable of partially reversing the resistance in this cell line. On the contrary, the use of 5-fluorouracil increased the resistance of Lucena 1. In addition to chemotherapics, Lucena 1 cells were resistant to ultraviolet A radiation and hydrogen peroxide and failed to mobilise intracellular calcium when thapsigargin was used. Changes in the cytoskeleton of this cell line were also observed.A resistência a múltiplos fármacos é o principal obstáculo no tratamento de pacientes com câncer. O mecanismo responsável pela resistência múltipla mais bem caracterizado envolve a expressão do produto do gene MDR-1, a glicoproteína P. Entretanto, o processo de resistência tem fatores múltiplos. Estudos de mecanismos de resistência m��ltipla a fármacos têm dependido da análise de linhagens celulares tumorais que foram selecionadas e apresentam reatividade cruzada a uma ampla faixa de agentes anti-tumorais. Este trabalho caracteriza uma linhagem celular com múltipla resistência a fármacos, selecionada originalmente pela resistência ao alcalóide de Vinca vincristina e derivado

  10. Membrane vesicles from multidrug-resistant human carcinoma cells contain a specific 150,000-170,000 dalton protein detected by photoaffinity labeling

    International Nuclear Information System (INIS)

    Cornwell, M.M.; Safa, A.R.; Felsted, R.L.; Gottesman, M.M.; Pastan, I.

    1986-01-01

    The authors have selected multidrug-resistant human KB carcinoma cells in high levels of colchicine (KB-C4) or vinblastine (KB-V1) which are cross-resistant to many other structurally unrelated chemotheraputic agents. To determine the mechanism of reduced drug accumulation, they measured 3 H-vinblastine ( 3 H-VBL) association with membrane vesicles made from parental drug sensitive, drug-resistant and revertant cells. Membrane vesicles from highly multidrug resistant cells exhibited increased specific and saturable binding of vinblastine, (Kd = 1 μM) that was temperature dependent and trypsin sensitive. To identify the molecules which bind vinblastine, membrane vesicles were exposed to two photo-activatable analogs of vinblastine, (N-P-(azido-3,5,-[ 3 H]-benzoyl)-N'-β-aminoethylvindisine ( 3 H-NAB) and N-P-(azido-3-[ 125 I]-solicyl)-N'-β-aminoethylvindesine ( 125 I-NASV). The specific labeling of a 150,000-170,000 dalton protein in membrane vesicles from multidrug-resistant KB-C4 and KB-V1 cells was found. 125 I-NASV labeling was inhibited by vinblastine, vincrinstine and verapamil but not by colchicine or dexamethasone. The 150,000-170,000 dalton protein may have an important role in the multidrug resistance phenotype

  11. Infection by multidrug-resistant Elizabethkingia meningoseptica: case reports

    Directory of Open Access Journals (Sweden)

    Jailton Lobo da Costa Lima

    2014-12-01

    Full Text Available We report two cases of sepsis in critically ill patients in two tertiary care hospitals in Recife-PE, Brazil. The first case is an 87-year-old patient with chronic myeloid leukemia and sepsis; and the second case is a 93-year-old patient with prostate cancer and septic shock caused by multidrug-resistant (MDR Elizabethkingia meningoseptica.

  12. Increased multi-drug resistant Escherichia coli from hospitals in ...

    African Journals Online (AJOL)

    Background: Multidrug-resistant Escherichia coli (MDR E. coli) has become a major public health concern in Sudan and many countries, causing failure in treatment with consequent huge health burden. Objectives: To determine the prevalence and susceptibility of MDR E. coli isolated from patients in hospitals at Khartoum ...

  13. High incidence of multidrug-resistant strains of methicill inresistant ...

    African Journals Online (AJOL)

    Infections of methicillin-resistant Staphylococcus aureus (MRSA) are becoming an increasingly concerning clinical problem. The aim of this study was to assess the development of multidrug resistant strains of MRSA from clinical samples andpossibilities for reducing resistance. This study included a total of seventy-five (75) ...

  14. Multidrug-resistant hepatocellular carcinoma cells are enriched for ...

    African Journals Online (AJOL)

    Chemotherapy is a main treatment for cancer, while multidrug-resistance is the main reason for chemotherapy failure, and tumor relapse and metastasis. Cancer stem cells or cancer stem-like cells (CSCs) are a small subset of cancer cells, which may be inherently resistant to the cytotoxic effect of chemotherapy.

  15. Antimicrobial activity of peptidomimetics against multidrug-resistant Escherichia coli

    DEFF Research Database (Denmark)

    Jahnsen, Rasmus D; Frimodt-Møller, Niels; Franzyk, Henrik

    2012-01-01

    Novel remedies in the battle against multidrug-resistant bacterial strains are urgently needed, and one obvious approach involves antimicrobial peptides and mimics hereof. The impact of a- and ß-peptoid as well as ß(3)-amino acid modifications on the activity profile against ß-lactamase-producing...

  16. plasmid mediated resistance in multidrug resistant bacteria isolated

    African Journals Online (AJOL)

    User

    PLASMID MEDIATED RESISTANCE IN MULTIDRUG RESISTANT BACTERIA. ISOLATED FROM CHILDREN WITH SUSPECTED SEPTICAEMIA IN ZARIA,. NIGERIA. AbdulAziz, Z. A.,1* Ehinmidu, J. O.,1 Adeshina, G. O.,1 Pala, Y. Y2., Yusuf, S. S2. and. Bugaje, M. A.3. 1Department of Pharmaceutics and Pharmaceutical ...

  17. Overcoming cellular multidrug resistance using classical nanomedicine formulations

    Czech Academy of Sciences Publication Activity Database

    Kunjachan, S.; Blauz, A.; Möckel, D.; Theek, B.; Kiessling, F.; Etrych, Tomáš; Ulbrich, K.; van Bloois, L.; Storm, G.; Bartosz, G.; Rychlik, B.; Lammers, T.

    2012-01-01

    Roč. 45, č. 4 (2012), s. 421-428 ISSN 0928-0987 R&D Projects: GA AV ČR IAA400500806 Institutional research plan: CEZ:AV0Z40500505 Keywords : cancer * nanomedicine * multidrug resistance Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.987, year: 2012

  18. Effect of biocides on biofilms of some multidrug resistant clinical ...

    African Journals Online (AJOL)

    The ability of Escherichia coli and Klebsiella aerogenes to form biofilms was most affected. There was little inhibition of biofilm formation by the biocides on Staphylococcus aureus. This study has shown a relationship between biocide and multidrug resistance. Keywords: Biocides, Multi drug resistance, sodium hypochlorite, ...

  19. Tailoring Cytotoxicity of Antimicrobial Peptidomimetics with High Activity against Multidrug-Resistant Escherichia coli

    DEFF Research Database (Denmark)

    Jahnsen, Rasmus D; Sandberg-Schaal, Anne; Vissing, Karina Juul

    2014-01-01

    Infections with multidrug-resistant pathogens are an increasing concern for public health. Recently, subtypes of peptide-peptoid hybrids were demonstrated to display potent activity against multidrug-resistant Gram-negative bacteria. Here, structural variation of these antibacterial peptidomimetics...... cells. Thus, lead compounds with a high selectivity toward killing of clinically important multidrug-resistant E. coli were identified....

  20. Phenothiazines as a solution for multidrug resistant tuberculosis

    DEFF Research Database (Denmark)

    Kristiansen, Jette E.; Dastidar, Sujata G.; Palchoudhuri, Shauroseni

    2015-01-01

    Historically, multiplicity of actions in synthetic compounds is a rule rather than exception. The science of non-antibiotics evolved in this background. From the antimalarial and antitrypanosomial dye methylene blue, chemically similar compounds, the phenothiazines, were developed. The phenothiaz......Historically, multiplicity of actions in synthetic compounds is a rule rather than exception. The science of non-antibiotics evolved in this background. From the antimalarial and antitrypanosomial dye methylene blue, chemically similar compounds, the phenothiazines, were developed...

  1. Pilot study on multidrug resistant tuberculosis in Nigeria

    African Journals Online (AJOL)

    and 4 were deemed to be contaminants, leaving 35 specimens for analysis of DST. DST was performed in 32 of the 35 isolates; 10 (31%) were resistant to at least one of .... (PCR) technologies that are emerging elsewhere. Future studies should investigate if extensively drug resistant TB (XDR-TB) strains are also affecting.

  2. Thyroid function in multidrug-resistant tuberculosis patients with or ...

    African Journals Online (AJOL)

    free triiodothyronine, values are presented in mean ± standard deviation or median (interquartile range). When all the patients were pooled and compared based on gender (males and females), it was observed that the median levels of TSH, T3 and T4 were similar between the 2 groups. However, male patients were found ...

  3. Cytotoxicity of South-African medicinal plants towards sensitive and multidrug-resistant cancer cells.

    Science.gov (United States)

    Saeed, Mohamed E M; Meyer, Marion; Hussein, Ahmed; Efferth, Thomas

    2016-06-20

    Traditional medicine plays a major role for primary health care worldwide. Cancer belongs to the leading disease burden in industrialized and developing countries. Successful cancer therapy is hampered by the development of resistance towards established anticancer drugs. In the present study, we investigated the cytotoxicity of 29 extracts from 26 medicinal plants of South-Africa against leukemia cell lines, most of which are used traditionally to treat cancer and related symptoms. We have investigated the plant extracts for their cytotoxic activity towards drug-sensitive parental CCRF-CEM leukemia cells and their multidrug-resistant P-glycoprotein-overexpressing subline, CEM/ADR5000 by means of the resazurin assay. A panel of 60 NCI tumor cell lines have been investigated for correlations between selected phytochemicals from medicinal plants and the expression of resistance-conferring genes (ABC-transporters, oncogenes, tumor suppressor genes). Seven extracts inhibited both cell lines (Acokanthera oppositifolia, Hypoestes aristata, Laurus nobilis, Leonotis leonurus, Plectranthus barbatus, Plectranthus ciliates, Salvia apiana). CEM/ADR5000 cells exhibited a low degree of cross-resistance (3.35-fold) towards the L. leonurus extract, while no cross-resistance was observed to other plant extracts, although CEM/ADR5000 cells were highly resistant to clinically established drugs. The log10IC50 values for two out of 14 selected phytochemicals from these plants (acovenoside A and ouabain) of 60 tumor cell lines were correlated to the expression of ABC-transporters (ABCB1, ABCB5, ABCC1, ABCG2), oncogenes (EGFR, RAS) and tumor suppressors (TP53). Sensitivity or resistance of the cell lines were not statistically associated with the expression of these genes, indicating that multidrug-resistant, refractory tumors expressing these genes may still respond to acovenoside A and ouabain. The bioactivity of South African medicinal plants may represent a basis for the development

  4. Multidrug-resistant opportunistic pathogens challenging veterinary infection control.

    Science.gov (United States)

    Walther, Birgit; Tedin, Karsten; Lübke-Becker, Antina

    2017-02-01

    Although the problems associated with healthcare-associated infections (HAI) and the emergence of zoonotic and multidrug-resistant pathogens in companion animal (dogs, cats and horses) medicine have been well-known for decades, current progress with respect to practical implementation of infection control programs in veterinary clinics has been limited. Clinical outbreak events reported for methicillin-resistant Staphylooccus aureus (MRSA) and Staphylococcus pseudintermedius (MRSP), extended spectrum beta-lactamase (ESBL)-producing Escherichia coli and multidrug-resistant (MDR) Salmonella Serovars indicate the necessity of infection control strategies for protecting animal patients at risk as well as veterinary personnel. The close bond between humans and their companion animals provides opportunities for exchange of microorganisms, including MDR pathogens. This particular aspect of the "One Health" idea requires more representative surveillance efforts and infection control strategies with respect to animal-species specific characters. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Multidrug resistant bacteria isolated from septic arthritis in horses

    Directory of Open Access Journals (Sweden)

    Rodrigo G. Motta

    Full Text Available ABSTRACT: Septic arthritis is a debilitating joint infectious disease of equines that requires early diagnosis and immediate therapeutic intervention to prevent degenerative effects on the articular cartilage, as well as loss of athletic ability and work performance of the animals. Few studies have investigated the etiological complexity of this disease, as well as multidrug resistance of isolates. In this study, 60 horses with arthritis had synovial fluid samples aseptically collected, and tested by microbiological culture and in vitro susceptibility test (disk diffusion using nine antimicrobials belonging to six different pharmacological groups. Bacteria were isolated in 45 (75.0% samples, as follows: Streptococcus equi subsp. equi (11=18.3%, Escherichia coli (9=15.0%, Staphylococcus aureus (6=10.0%, Streptococcus equi subsp. zooepidemicus (5=8.3%, Staphylococcus intermedius (2=3.3%, Proteus vulgaris (2=3.3%, Trueperella pyogenes (2=3.3%, Pseudomonas aeruginosa (2=3.3%, Klebsiella pneumoniae (1=1.7%, Rhodococcus equi (1=1.7%, Staphylococcus epidermidis (1=1.7%, Klebsiella oxytoca (1=1.7%, Nocardia asteroides (1=1.7%, and Enterobacter cloacae (1=1.7%. Ceftiofur was the most effective drug (>70% efficacy against the pathogens in the disk diffusion test. In contrast, high resistance rate (>70% resistance was observed to penicillin (42.2%, enrofloxacin (33.3%, and amikacin (31.2%. Eleven (24.4% isolates were resistant to three or more different pharmacological groups and were considered multidrug resistant strains. The present study emphasizes the etiological complexity of equine septic arthritis, and highlights the need to institute treatment based on the in vitro susceptibility pattern, due to the multidrug resistance of isolates. According to the available literature, this is the first report in Brazil on the investigation of the etiology. of the septic arthritis in a great number of horses associated with multidrug resistance of the isolates.

  6. Multidrug-Resistant Escherichia fergusonii: a Case of Acute Cystitis▿

    Science.gov (United States)

    Savini, Vincenzo; Catavitello, Chiara; Talia, Marzia; Manna, Assunta; Pompetti, Franca; Favaro, Marco; Fontana, Carla; Febbo, Fabio; Balbinot, Andrea; Di Berardino, Fabio; Di Bonaventura, Giovanni; Di Zacomo, Silvia; Esattore, Francesca; D'Antonio, Domenico

    2008-01-01

    We report a case in which Escherichia fergusonii, an emerging pathogen in various types of infections, was associated with cystitis in a 52-year-old woman. The offending strain was found to be multidrug resistant. Despite in vitro activity, beta-lactam treatment failed because of a lack of patient compliance with therapy. The work confirms the pathogenic potential of E. fergusonii. PMID:18256229

  7. Candida auris: An emerging multidrug-resistant pathogen

    Directory of Open Access Journals (Sweden)

    David Sears

    2017-10-01

    Full Text Available Candida aurisis an emerging multidrug-resistant pathogen that can be difficult to identify using traditional biochemical methods. C. auris is capable of causing invasive fungal infections, particularly among hospitalized patients with significant medical comorbidities. Echinocandins are the empiric drugs of choice for C. auris, although not all isolates are susceptible and resistance may develop on therapy. Nosocomial C. auris outbreaks have been reported in a number of countries and aggressive infection control measures are paramount to stopping transmission.

  8. Multidrug resistant shigella flexneri infection simulating intestinal intussusception

    Directory of Open Access Journals (Sweden)

    Srirangaraj Sreenivasan

    2016-01-01

    Full Text Available Shigella enteritis remains an important cause of mortality and morbidity in all age groups, in developing as well as developed countries. Owing to the emerging resistance to multiple antibiotics among Shigella spp., it has been recognized as a major global public health concern and warrants constant monitoring of its resistance pattern. We report a case of segmental ileitis caused by non.-ESBL producing multidrug resistant Shigella flexneri in an infant clinically mimicking intussusception, which was effectively treated by ceftriaxone.

  9. Repurposing ebselen for treatment of multidrug-resistant staphylococcal infections

    OpenAIRE

    Shankar Thangamani; Waleed Younis; Mohamed N. Seleem

    2015-01-01

    Novel antimicrobials and new approaches to developing them are urgently needed. Repurposing already-approved drugs with well-characterized toxicology and pharmacology is a novel way to reduce the time, cost, and risk associated with antibiotic innovation. Ebselen, an organoselenium compound, is known to be clinically safe and has a well-known pharmacology profile. It has shown potent bactericidal activity against multidrug-resistant clinical isolates of staphylococcus aureus, including methic...

  10. Multidrug-Resistant Candida: Epidemiology, Molecular Mechanisms, and Treatment.

    Science.gov (United States)

    Arendrup, Maiken Cavling; Patterson, Thomas F

    2017-08-15

    Invasive Candida infections remain an important cause of morbidity and mortality, especially in hospitalized and immunocompromised or critically ill patients. A limited number of antifungal agents from only a few drug classes are available to treat patients with these serious infections. Resistance can be either intrinsic or acquired. Resistance mechanisms are not exchanged between Candida; thus, acquired resistance either emerges in response to an antifungal selection pressure in the individual patient or, more rarely, occur due to horizontal transmission of resistant strains between patients. Although multidrug resistance is uncommon, increasing reports of multidrug resistance to the azoles, echinocandins, and polyenes have occurred in several Candida species, most notably Candida glabrata and more recently Candida auris. Drivers are overall antifungal use, subtherapeutic drug levels at sites of infection/colonization, drug sequestration in the biofilm matrix, and, in the setting of outbreaks, suboptimal infection control. Moreover, recent research suggests that DNA mismatch repair gene mutations may facilitate acquisition of resistance mutations in C. glabrata specifically. Diagnosis of antifungal-resistant Candida infections is critical to the successful management of patients with these infections. Reduction of unnecessary use of antifungals via antifungal stewardship is critical to limit multidrug resistance emergence. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  11. [Impact of fluoroquinolone use on multidrug-resistant bacteria emergence].

    Science.gov (United States)

    Nseir, S; Ader, F; Marquette, C-H; Durocher, A

    2005-01-01

    During the last two decades, fluoroquinolone use has significantly increased in Europe and in the USA. This could be explained by the arrival of newer fluoroquinolones with antipneumoccal activity. Increased use of fluoroquinolones is associated with higher rates of bacterial resistance to these antibiotics. Resistance of Gram-negative bacilli to fluoroquinolones is increasing in industrialized countries. In addition, fluoroquinolone use has been identified as a risk factor for colonization and infection to methicillin-resistant Staphylococcus aureus, Pseudomonas aeruginosa, Acinetobacter baumanni, extending-spectrum beta-lactamase producing Gram negative bacilli, and multidrug-resistant bacteria. Nosocomial infections due to multidrug-resistant bacteria are associated with higher mortality and morbidity rates. This could be related to more frequent inappropriate initial antibiotic treatment in these patients. Limiting the use of fluoroquinolones, limiting the duration of treatment with fluoroquinolones, and using appropriate dosage of these antibiotics could be suggested to reduce resistance to these antibiotics and to reduce the emergence of multidrug-resistant bacteria.

  12. A Salmonella nanoparticle mimic overcomes multidrug resistance in tumours.

    Science.gov (United States)

    Mercado-Lubo, Regino; Zhang, Yuanwei; Zhao, Liang; Rossi, Kyle; Wu, Xiang; Zou, Yekui; Castillo, Antonio; Leonard, Jack; Bortell, Rita; Greiner, Dale L; Shultz, Leonard D; Han, Gang; McCormick, Beth A

    2016-07-25

    Salmonella enterica serotype Typhimurium is a food-borne pathogen that also selectively grows in tumours and functionally decreases P-glycoprotein (P-gp), a multidrug resistance transporter. Here we report that the Salmonella type III secretion effector, SipA, is responsible for P-gp modulation through a pathway involving caspase-3. Mimicking the ability of Salmonella to reverse multidrug resistance, we constructed a gold nanoparticle system packaged with a SipA corona, and found this bacterial mimic not only accumulates in tumours but also reduces P-gp at a SipA dose significantly lower than free SipA. Moreover, the Salmonella nanoparticle mimic suppresses tumour growth with a concomitant reduction in P-gp when used with an existing chemotherapeutic drug (that is, doxorubicin). On the basis of our finding that the SipA Salmonella effector is fundamental for functionally decreasing P-gp, we engineered a nanoparticle mimic that both overcomes multidrug resistance in cancer cells and increases tumour sensitivity to conventional chemotherapeutics.

  13. Phytochemical analysis and cytotoxicity towards multidrug-resistant leukemia cells of essential oils derived from Lebanese medicinal plants.

    Science.gov (United States)

    Saab, Antoine M; Guerrini, Alessandra; Sacchetti, Gianni; Maietti, Silvia; Zeino, Maʼen; Arend, Joachim; Gambari, Roberto; Bernardi, Francesco; Efferth, Thomas

    2012-12-01

    Juniperus excelsa fruit essential oil as well as J. oxycedrus, Cedrus libani, and Pinus pinea wood essential oils have been obtained with yields between 2.2 ± 0.3 % to 3.4 ± 0.5 % and analyzed by gas chromatography. Sesquiterpenes mainly characterized C. libani and J. oxycedrus essential oils, while in P. pinea and J. excelsa, monoterpenes were the most abundant compounds. In J. oxycedrus, cis-calamenene (7.8 %), cuparene (3.8 %), and cis-thujopsenal (2.0 %) have been detected for the first time. The cytotoxic activity of these essential oils against drug-sensitive CCRF-CEM and multidrug-resistant P-glycoprotein-expressing CEM/ADR5000 leukemia cells has been investigated (IC₅₀ values: 29.46 to 61.54 µg/mL). Remarkably, multidrug-resistant CEM/ADR5000 cells did not reveal cross-resistance, indicating that these essential oils might be useful to treat otherwise drug-resistant and refractory tumors. Georg Thieme Verlag KG Stuttgart · New York.

  14. Linezolid susceptibility in Helicobacter pylori, including strains with multidrug resistance.

    Science.gov (United States)

    Boyanova, Lyudmila; Evstatiev, Ivailo; Gergova, Galina; Yaneva, Penka; Mitov, Ivan

    2015-12-01

    Only a few studies have evaluated Helicobacter pylori susceptibility to linezolid. The aim of the present study was to assess linezolid susceptibility in H. pylori, including strains with double/multidrug resistance. The susceptibility of 53 H. pylori strains was evaluated by Etest and a breakpoint susceptibility testing method. Helicobacter pylori resistance rates were as follows: amoxicillin, 1.9%; metronidazole, 37.7%; clarithromycin, 17.0%; tetracycline, 1.9%; levofloxacin, 24.5%; and linezolid (>4 mg/L), 39.6%. The linezolid MIC50 value was 31.2-fold higher than that of clarithromycin and 10.5-fold higher than that of levofloxacin; however, 4 of 11 strains with double/multidrug resistance were linezolid-susceptible. The MIC range of the oxazolidinone agent was larger (0.125-64 mg/L) compared with those in the previous two reports. The linezolid resistance rate was 2.2-fold higher in metronidazole-resistant strains and in strains resistant to at least one antibiotic compared with the remaining strains. Briefly, linezolid was less active against H. pylori compared with clarithromycin and levofloxacin, and linezolid resistance was linked to resistance to metronidazole as well as to resistance to at least one antibiotic. However, linezolid activity against some strains with double/multidrug resistance may render the agent appropriate to treat some associated H. pylori infections following in vitro susceptibility testing of the strains. Clinical trials are required to confirm this suggestion. Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  15. Epidemiologic analysis: Prophylaxis and multidrug-resistance in surgery.

    Science.gov (United States)

    Solís-Téllez, H; Mondragón-Pinzón, E E; Ramírez-Marino, M; Espinoza-López, F R; Domínguez-Sosa, F; Rubio-Suarez, J F; Romero-Morelos, R D

    Surgical site infection is defined as an infection related to the surgical procedure in the area of manipulation occurring within the first 30 postoperative days. The diagnostic criteria include: purulent drainage, isolation of microorganisms, and signs of infection. To describe the epidemiologic characteristics and differences among the types of prophylactic regimens associated with hospital-acquired infections at the general surgery service of a tertiary care hospital. The electronic case records of patients that underwent general surgery at a tertiary care hospital within the time frame of January 1, 2013 and December 31, 2014 were reviewed. A convenience sample of 728 patients was established and divided into the following groups: Group 1: n=728 for the epidemiologic study; Group 2: n=638 for the evaluation of antimicrobial prophylaxis; and Group 3: n=50 for the evaluation of multidrug-resistant bacterial strains in the intensive care unit. The statistical analysis was carried out with the SPSS 19 program, using the Mann-Whitney U test and the chi-square test. A total of 728 procedures were performed (65.9% were elective surgeries). Three hundred twelve of the patients were males and 416 were females. Only 3.98% of the patients complied with the recommended antimicrobial prophylaxis, and multidrug-resistant bacterial strains were found in the intensive care unit. A single prophylactic dose is effective, but adherence to this recommendation was not adequate. The prophylactic guidelines are not strictly adhered to in our environment. There was a significant association between the development of nosocomial infections from multidrug-resistant germs and admission to the intensive care unit. Copyright © 2016 Asociación Mexicana de Gastroenterología. Publicado por Masson Doyma México S.A. All rights reserved.

  16. Drug accumulation in the presence of the multidrug resistance pump

    DEFF Research Database (Denmark)

    Ayesh, S; Litman, Thomas; Stein, W D

    1997-01-01

    We studied the interaction between the multidrug transporter, P-glycoprotein, and two compounds that interact with it: vinblastine, a classical substrate of the pump, and verapamil, a classical reverser. Steady-state levels of accumulation of these two drugs were determined in a multidrug resistant...... P388 leukemia cell line, P388/ADR. The time course of accumulation of these drugs, and the effect of energy starvation and the presence of chloroquine on the level of their steady-state accumulation were quite disparate. Vinblastine inhibited the accumulation of verapamil whereas it enhanced...

  17. Functional imaging of the multidrug resistance in vivo

    International Nuclear Information System (INIS)

    Lee, Jae Tae

    2001-01-01

    Although diverse mechanisms are involved in multidrug resistance for chemotherapeutic drugs, the development of cellular P-glycoprotein(Pgp) and multidrug-resistance associated protein (MRP) are improtant factors in the chemotherapy failure to cancer. Various detection assays provide information about the presence of drug efflux pumps at the mRNA and protein levels. However these methods do not yield information about dynamic function of Pgp and MRP in vivo. Single photon emission tomograpy (SPECT) and positron emission tomograpy (PET) are available for the detection of Pgp and MRP-mediated transport. 99m Tc-sestaMIBI and other 99m Tc-radiopharmaceuticals are substrates for Pgp and MRP, and have been used in clinical studies of tumor imaging, and to visualize blockade of Pgp-mediated transport after modulation of Pgp pump. Colchicine, verapamil and daunorubicin labeled with 11 C have been evaluated for the quantification of Pgp-mediated transport with PET in vivo and reported to be feasible substrates with which to image Pgp function in tumors. Leukotrienes are specific substrates for MRP and N- (11 C]acetyl-leukotriene E4 provides an opportunity to study MRP function non-invasively in vivo. Results obtained from recent publications are reviewed to confirm the feasibility of using SPECT and PET to study the functionality of MDR transportes in vivo

  18. Photoexcited quantum dots for killing multidrug-resistant bacteria

    Science.gov (United States)

    Courtney, Colleen M.; Goodman, Samuel M.; McDaniel, Jessica A.; Madinger, Nancy E.; Chatterjee, Anushree; Nagpal, Prashant

    2016-05-01

    Multidrug-resistant bacterial infections are an ever-growing threat because of the shrinking arsenal of efficacious antibiotics. Metal nanoparticles can induce cell death, yet the toxicity effect is typically nonspecific. Here, we show that photoexcited quantum dots (QDs) can kill a wide range of multidrug-resistant bacterial clinical isolates, including methicillin-resistant Staphylococcus aureus, carbapenem-resistant Escherichia coli, and extended-spectrum β-lactamase-producing Klebsiella pneumoniae and Salmonella typhimurium. The killing effect is independent of material and controlled by the redox potentials of the photogenerated charge carriers, which selectively alter the cellular redox state. We also show that the QDs can be tailored to kill 92% of bacterial cells in a monoculture, and in a co-culture of E. coli and HEK 293T cells, while leaving the mammalian cells intact, or to increase bacterial proliferation. Photoexcited QDs could be used in the study of the effect of redox states on living systems, and lead to clinical phototherapy for the treatment of infections.

  19. The secondary resistome of multidrug-resistant Klebsiella pneumoniae.

    Science.gov (United States)

    Jana, Bimal; Cain, Amy K; Doerrler, William T; Boinett, Christine J; Fookes, Maria C; Parkhill, Julian; Guardabassi, Luca

    2017-02-15

    Klebsiella pneumoniae causes severe lung and bloodstream infections that are difficult to treat due to multidrug resistance. We hypothesized that antimicrobial resistance can be reversed by targeting chromosomal non-essential genes that are not responsible for acquired resistance but essential for resistant bacteria under therapeutic concentrations of antimicrobials. Conditional essentiality of individual genes to antimicrobial resistance was evaluated in an epidemic multidrug-resistant clone of K. pneumoniae (ST258). We constructed a high-density transposon mutant library of >430,000 unique Tn5 insertions and measured mutant depletion upon exposure to three clinically relevant antimicrobials (colistin, imipenem or ciprofloxacin) by Transposon Directed Insertion-site Sequencing (TraDIS). Using this high-throughput approach, we defined three sets of chromosomal non-essential genes essential for growth during exposure to colistin (n = 35), imipenem (n = 1) or ciprofloxacin (n = 1) in addition to known resistance determinants, collectively termed the "secondary resistome". As proof of principle, we demonstrated that inactivation of a non-essential gene not previously found linked to colistin resistance (dedA) restored colistin susceptibility by reducing the minimum inhibitory concentration from 8 to 0.5 μg/ml, 4-fold below the susceptibility breakpoint (S ≤ 2 μg/ml). This finding suggests that the secondary resistome is a potential target for developing antimicrobial "helper" drugs that restore the efficacy of existing antimicrobials.

  20. Repurposing ebselen for treatment of multidrug-resistant staphylococcal infections.

    Science.gov (United States)

    Thangamani, Shankar; Younis, Waleed; Seleem, Mohamed N

    2015-06-26

    Novel antimicrobials and new approaches to developing them are urgently needed. Repurposing already-approved drugs with well-characterized toxicology and pharmacology is a novel way to reduce the time, cost, and risk associated with antibiotic innovation. Ebselen, an organoselenium compound, is known to be clinically safe and has a well-known pharmacology profile. It has shown potent bactericidal activity against multidrug-resistant clinical isolates of staphylococcus aureus, including methicillin- and vancomycin-resistant S. aureus (MRSA and VRSA). We demonstrated that ebselen acts through inhibition of protein synthesis and subsequently inhibited toxin production in MRSA. Additionally, ebselen was remarkably active and significantly reduced established staphylococcal biofilms. The therapeutic efficacy of ebselen was evaluated in a mouse model of staphylococcal skin infections. Ebselen 1% and 2% significantly reduced the bacterial load and the levels of the pro-inflammatory cytokines tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-1 beta (IL-1β), and monocyte chemo attractant protein-1 (MCP-1) in MRSA USA300 skin lesions. Furthermore, it acts synergistically with traditional antimicrobials. This study provides evidence that ebselen has great potential for topical treatment of MRSA skin infections and lays the foundation for further analysis and development of ebselen as a potential treatment for multidrug-resistant staphylococcal infections.

  1. Enhancing Docetaxel Delivery to Multidrug-Resistant Cancer Cells with Albumin-Coated Nanocrystals.

    Science.gov (United States)

    Gad, Sheryhan F; Park, Joonyoung; Park, Ji Eun; Fetih, Gihan N; Tous, Sozan S; Lee, Wooin; Yeo, Yoon

    2018-01-29

    Intravenous delivery of poorly water-soluble anticancer drugs such as docetaxel (DTX) is challenging due to the low bioavailability and the toxicity related to solubilizing excipients. Colloidal nanoparticles are used as alternative carriers, but low drug loading capacity and circulation instability limit their clinical translation. To address these challenges, DTX nanocrystals (NCs) were prepared using Pluronic F127 as an intermediate stabilizer and albumin as a functional surface modifier, which were previously found to be effective in producing small and stable NCs. We hypothesize that the albumin-coated DTX NCs (DTX-F-alb) will remain stable in serum-containing medium so as to effectively leverage the enhanced permeability and retention effect. In addition, the surface-bound albumin, in its native form, may contribute to cellular transport of NCs through interactions with albumin-binding proteins such as secreted protein acidic and rich in cysteine (SPARC). DTX-F-alb NCs showed sheet-like structure with an average length, width, and thickness of 284 ± 96, 173 ± 56, and 40 ± 8 nm and remained stable in 50% serum solution at a concentration greater than 10 μg/mL. Cytotoxicity and cellular uptake of DTX-F-alb and unformulated (free) DTX were compared on three cell lines with different levels of SPARC expression and DTX sensitivity. While the uptake of free DTX was highly dependent on DTX sensitivity, DTX-F-alb treatment resulted in relatively consistent cellular levels of DTX. Free DTX was more efficient in entering drug-sensitive B16F10 and SKOV-3 cells than DTX-F-alb, with consistent cytotoxic effects. In contrast, multidrug-resistant NCI/ADR-RES cells took up DTX-F-alb more than free DTX with time and responded better to the former. This difference was reduced by SPARC knockdown. The high SPARC expression level of NCI/ADR-RES cells, the known affinity of albumin for SPARC, and the opposing effect of SPARC knockdown support that DTX-F-alb have exploited the

  2. Worldwide Endemicity of a Multidrug-Resistant Staphylococcus capitis Clone Involved in Neonatal Sepsis.

    Science.gov (United States)

    Butin, Marine; Martins-Simões, Patricia; Rasigade, Jean-Philippe; Picaud, Jean-Charles; Laurent, Frédéric

    2017-03-01

    A multidrug-resistant Staphylococcus capitis clone, NRCS-A, has been isolated from neonatal intensive care units in 17 countries throughout the world. S. capitis NRCS-A prevalence is high in some neonatal intensive care units in France. These data highlight the worldwide endemicity and epidemiologic relevance of this multidrug-resistant, coagulase-negative staphylococci clone.

  3. Chinese hamster pleiotropic multidrug-resistant cells are not radioresistant

    International Nuclear Information System (INIS)

    Mitchell, J.B.; Gamson, J.; Russo, A.; Friedman, N.; DeGraff, W.; Carmichael, J.; Glatstein, E.

    1988-01-01

    The inherent cellular radiosensitivity of a Chinese hamster ovary pleiotropic cell line that is multidrug resistant (CHRC5) was compared to that of its parental cell line (AuxB1). Radiation survival curve parameters n and D0 were 4.5 and 1.1 Gy, respectively, for the CHRC5 line and 5.0 and 1.2 Gy, respectively, for the parental line. Thus, the inherent radiosensitivity of the two lines was similar even though key intracellular free radical scavenging and detoxifying systems employing glutathione, glutathione transferase, and catalase produced enzyme levels that were 2.0-, 1.9-, and 1.9-fold higher, respectively, in the drug-resistant cell line. Glutathione depletion by buthionine sulfoximine resulted in the same extent of aerobic radiosensitization in both lines (approximately 10%). Incorporation of iododeoxyuridine into cellular DNA sensitized both cell lines to radiation. These studies indicate that pleiotropic drug resistance does not necessarily confer radiation resistance

  4. Chitosan as an effective inhibitor of multidrug resistant Acinetobacter baumannii.

    Science.gov (United States)

    Costa, E M; Silva, S; Vicente, S; Veiga, M; Tavaria, F; Pintado, M M

    2017-12-15

    Over the last two decades worldwide levels of antibiotic resistance have risen leading to the appearance of multidrug resistant microorganisms. Acinetobacter baumannii is a known skin pathogen which has emerged as a major cause of nosocomial outbreaks due to its capacity to colonize indwelling medical devices and natural antibiotic resistance. With chitosan being an effective antimicrobial agent against antibiotic resistant microorganisms, the aim of this work was to access its potential as an alternative to traditional antimicrobials in the management of A. baumannii growth. What the results showed was that both chitosan MW's tested were active upon A. baumannii's planktonic and sessile growth. For planktonic growth MICs and MBCs were obtained at relatively low concentrations (0.5-2mg/mL) while for sessile growth chitosan proved to be an effective inhibitor of A. baumannii's adhesion and biofilm formation. Considering these results chitosan shows a high potential for control of A. baumannii infections. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Photodynamic therapy of cancer — Challenges of multidrug resistance

    Directory of Open Access Journals (Sweden)

    Zheng Huang

    2015-01-01

    Full Text Available Photodynamic therapy (PDT of cancer is a two-step drug-device combination modality, which involves the topical or systemic administration of a photosensitizer followed by light illumination of cancer site. In the presence of oxygen molecules, the light illumination of photosensitizer (PS can lead to the generation of cytotoxic reactive oxygen species (ROS and consequently destroy cancer. Similar to many other anticancer therapies, PDT is also subject to intrinsic cancer resistance mediated by multidrug resistance (MDR mechanisms. This paper will review the recent progress in understanding the interaction between MDR transporters and PS uptake. The strategies that can be used in a clinical setting to overcome or bypass MDR will also be discussed.

  6. Detection of multidrug resistance using molecular nuclear technique

    International Nuclear Information System (INIS)

    Lee, Jae Tae; Ahn, Byeong Cheol

    2004-01-01

    Although the outcome of cancer patients after cytotoxic chemotherapy is related diverse mechanisms, multidrug resistance (MDR) for chemotherapeutic drugs due to cellular P-glycoprotein (Pgp) or multidrug-resistance associated protein (MRP) is most important factor in the chemotherapy failure to cancer. A large number of pharmacologic compounds, including verapamil, quinidine, tamoxifen, cyclosporin A and quinolone derivatives have been reported to overcome MDR. Single photon emission computed tomography (SPECT) and positron emission tomography (PET) are available for the detection of Pgp and MRP-mediated transporter. 99 m-Tc-MIBI and other 99 m-Tc-radiopharmaceuticals are substrates for Pgp and MRP, and have been used in clinical studies for tumor imaging, and to visualize blockade of Pgp-mediated transport after modulation of Pgp pump. Colchicine, verapamil and daunorubicin labeled with 11 C have been evaluated for the quantification of Pgp-mediated transport with PET in vivo and reported to be feasible substrates with which to image Pgp function in tumors. Leukotrienes are specific substrates for MRP and N-( 11 C)acetyl-leukotriene E4 provides an opportunity to study MRP function non-invasively in vivo. SPECT and PET pharmaceuticals have successfully used to evaluate pharmacologic effects of MDR modulators. Imaging of MDR and reversal of MDR with bioluminescence in a living animal is also evaluated for future clinical trial. We have described recent advances in molecular imaging of MDR and reviewed recent publications regarding feasibility of SPECT and PET imaging to study the functionality of MDR transporters in vivo

  7. Drug resistance patterns in pulmonary tuberculosis

    International Nuclear Information System (INIS)

    Khoharo, H.K.; Shaikh, I.A.

    2011-01-01

    Objective: To determine the resistance patterns of mycobacterium tuberculosis (MTB) isolates among category I and II patients of pulmonary tuberculosis. Methods: This cross sectional study was conducted at the Department of Medicine, Liaquat University of Medical and Health Sciences Jamshoro, from November 2008 to September 2009. Patients were divided into category I and II. The sputa were collected, stained with Ziehl-Nielsen (Z-N) staining and ultimately inoculated on Lowenstein-Jensen (L-J) media for six weeks. Out of 890 pulmonary tuberculosis (PTB) patients, the growth was obtained in 285 cases. The Drug sensitivity testing (DST) for Isoniazid (INH), Rifampicin (RIF), Ethambutol (EMB) Pyrazinamide (PZA) and Streptomycin (SM) were performed. The data was analyzed on SPSS 10.0. A p-value of <0.05 was taken as significant. Result: Out of 285 cases, 176 (61.75%) were male and 109 (38.24%) female. The mean age was 37 +- 19.90 years. The DST showed drug sensitive and drug resistant isolates in 80 (28.05%) and 205 (71.92%) cases respectively (p=0.001). The drug resistant tuberculosis (DR-TB) rates for individual drugs; INH, RIF, EMB, PZA and SM were 51,22%, 15.4%, 13.33%, 9%12, and 3.85% respectively (p=0.03). The MDR-TB isolates were detected in 120 (42.10%) cases, including 5 (5.88%) in category I and 115 (57.50%) in category II patients (p=0.0001). Conclusion: Drug resistant and multidrug resistant tuberculosis was observed mainly in category II patients. However, primary MDR was also observed in category I patients and reflects dissemination of MDR cases within the community. (author)

  8. THE ANTI-TB DRUG SENSITIVITY OF MYCOBACTERIUM TUBERCULOSIS FROM CEREBROSPINAL FLUID AND BONE TISSUE BIOPSY SPECIMENS OF PATIENTS SUSPECTED TUBERCULOUS MENINGITIS AND SPINAL TB IN DR SOETOMO HOSPITAL INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Made Mertaniasih

    2014-09-01

    Full Text Available Tuberculous meningitis (TBM is an infection of meningens which potentially life threatening with significant morbidity and mortality. Spinal TB has the same problem with TBM, infection in bone and joint, the delayed diagnosis worsens the prognosis. The rapid and accurate diagnosis plus promt adequate treatment is essential for the good outcome. The aim of this research is to study the first line drug sensitivity of Mycobacterium tuberculosis isolated from specimens of cerebrospinal fluid from suspected tuberculous meningitis patients and bone tissue biopsy from suspected spinal TB patients. The method of this research is TB Laboratory examination in Department of Clinical Microbiology – Dr. Soetomo General Hospital, Indonesia, using the gold standard liquid culture method MGIT 960 System (Becton Dickinson and solid culture method with Lowenstein-Jensen medium. The specimens CSF from 50 TBM patients at January 2013 until May 2014. Positive isolate detection of Mycobacterium tuberculosis complex were 11 isolates (22%, which sensitivity 100% (11/11 isolates to Rifampin (R, Pyrazinamide (Z, Ethambutol (E, and Streptomycin (S; one isolate resistant to Isoniazid, sensitivity to Isoniazid 90,90% (10/11; and received 21 specimens of bone tissue biopsy which positive 5 isolates (23%, all isolates sensitive 100% (5/5 isolates to Rifampin and Pyrazinamide, and 1 isolates resistant to Isoniazid, Ethambutol, and Streptomycin, in which sensitivity 80% (4/5 isolates to Isoniazid, Ethambutol, and Streptomycin. The conclusion of this research is positivity detection 22% of CSF specimens, and 23% of bone tissue biopsy were low. All isolates sensitive 100% to Rifampin and Pyrazinamide, and 80-90% sensitive to Isoniazid.

  9. Evaluation of four colourimetric susceptibility tests for the rapid detection of multidrug-resistant Mycobacterium tuberculosisisolates

    Directory of Open Access Journals (Sweden)

    Ahmet Yilmaz Coban

    2015-08-01

    Full Text Available The purpose of this study is to evaluate four rapid colourimetric methods, including the resazurin microtitre assay (REMA, malachite green decolourisation assay (MGDA, microplate nitrate reductase assay (MNRA and crystal violet decolourisation assay (CVDA, for the rapid detection of multidrug-resistant (MDR tuberculosis. Fifty Mycobacterium tuberculosisisolates were used in this study. Eighteen isolates were MDR, two isolates were only resistant to isoniazid (INH and the remaining isolates were susceptible to both INH and rifampicin (RIF. INH and RIF were tested in 0.25 µg/mL and 0.5 µg/mL, respectively. The agar proportion method was used as a reference method. MNRA and REMA were performed with some modifications. MGDA and CVDA were performed as defined in the literature. The agreements of the MNRA for INH and RIF were 96% and 94%, respectively, while the agreement of the other assays for INH and RIF were 98%. In this study, while the specificities of the REMA, MGDA and CVDA were 100%, the specificity of the MNRA was lower than the others (93.3% for INH and 90.9% for RIF. In addition, while the sensitivity of the MNRA was 100%, the sensitivities of the others were lower than that of the MNRA (from 94.1-95%. The results were reported on the seventh-10th day of the incubation. All methods are reliable, easy to perform, inexpensive and easy to evaluate and do not require special equipment.

  10. Targeting microparticle biogenesis: a novel approach to the circumvention of cancer multidrug resistance.

    Science.gov (United States)

    Roseblade, Ariane; Luk, Frederick; Ung, Alison; Bebawy, Mary

    2015-01-01

    Microparticles (MPs) are released from most eukaryotic cells after the vesiculation of the plasma membrane and serve as vectors of long and short-range signaling. MPs derived from multidrug resistant (MDR) cancer cells carry molecular components of the donor cell such as nucleic acids and proteins, and can alter the activity of drug-sensitive recipient cells through the transfer of their cargo. Given the substantial role of MPs in the acquisition and dissemination of MDR, we propose that the inhibition of MP release provides a novel therapeutic approach. This study characterises the effect of a panel of molecules known to act on MP-biosynthetic pathways. We demonstrate a differential effect by these molecules on MP inhibition that appear dependent on the release of intracellular calcium stores following activation with the calcium ionophore A23187. Calpain inhibitor, PD-150606; a selective inhibitor of Rho-associated, coiled-coil containing protein kinase (ROCK), Y-27632; and the vitamin B5 derivative pantethine, inhibited MP release only upon prior activation with A23187. Calpain inhibitor II showed significant inhibition in the absence of cell activation, whereas the vitamin B5 derivatives cystamine dihydrochloride and cysteamine hydrochloride showed no effect on MP inhibition under either condition. In contrast the classical pharmacological inhibitor of MDR, the calcium channel blocker Verapamil, showed an increase in MP formation on resting cells. These results suggest a potential role for calcium in the mechanism of action for PD-150606, Y-27632 and pantethine. These molecules, together with calpain inhibitor II have shown promise as modulators of MP release and warrant consideration as potential candidates for the development of an alternative therapeutic strategy for the prevention of MP-mediated MDR in cancer.

  11. The Impact of a Line Probe Assay Based Diagnostic Algorithm on Time to Treatment Initiation and Treatment Outcomes for Multidrug Resistant TB Patients in Arkhangelsk Region, Russia.

    Science.gov (United States)

    Eliseev, Platon; Balantcev, Grigory; Nikishova, Elena; Gaida, Anastasia; Bogdanova, Elena; Enarson, Donald; Ornstein, Tara; Detjen, Anne; Dacombe, Russell; Gospodarevskaya, Elena; Phillips, Patrick P J; Mann, Gillian; Squire, Stephen Bertel; Mariandyshev, Andrei

    2016-01-01

    In the Arkhangelsk region of Northern Russia, multidrug-resistant (MDR) tuberculosis (TB) rates in new cases are amongst the highest in the world. In 2014, MDR-TB rates reached 31.7% among new cases and 56.9% among retreatment cases. The development of new diagnostic tools allows for faster detection of both TB and MDR-TB and should lead to reduced transmission by earlier initiation of anti-TB therapy. The PROVE-IT (Policy Relevant Outcomes from Validating Evidence on Impact) Russia study aimed to assess the impact of the implementation of line probe assay (LPA) as part of an LPA-based diagnostic algorithm for patients with presumptive MDR-TB focusing on time to treatment initiation with time from first-care seeking visit to the initiation of MDR-TB treatment rather than diagnostic accuracy as the primary outcome, and to assess treatment outcomes. We hypothesized that the implementation of LPA would result in faster time to treatment initiation and better treatment outcomes. A culture-based diagnostic algorithm used prior to LPA implementation was compared to an LPA-based algorithm that replaced BacTAlert and Löwenstein Jensen (LJ) for drug sensitivity testing. A total of 295 MDR-TB patients were included in the study, 163 diagnosed with the culture-based algorithm, 132 with the LPA-based algorithm. Among smear positive patients, the implementation of the LPA-based algorithm was associated with a median decrease in time to MDR-TB treatment initiation of 50 and 66 days compared to the culture-based algorithm (BacTAlert and LJ respectively, ptime to MDR-TB treatment initiation of 78 days when compared to the culture-based algorithm (LJ, ptime to MDR diagnosis and earlier treatment initiation as well as better treatment outcomes for patients with MDR-TB. These findings also highlight the need for further improvements within the health system to reduce both patient and diagnostic delays to truly optimize the impact of new, rapid diagnostics.

  12. First evaluation in Argentina of the GenoType® MTBDRplus assay for multidrug-resistant Mycobacterium tuberculosis detection from clinical isolates and specimens Primera evaluación en Argentina de GenoType® MTBDRplus para la detección de Mycobacterium tuberculosis multidrogo-resistente desde aislamientos y especímenes clínicos

    Directory of Open Access Journals (Sweden)

    Belén R Imperiale

    2012-12-01

    Full Text Available Tuberculosis (TB and multidrug and extensively drug-resistant (DR TB are important public health problems that are spreading worldwide. The aims of this study were to determine the sensitivity and specificity of the GenoType® MT BDRplus assay from smear-positive clinical specimens and isolates and to explore its possible application in routine work. Clinical samples were previously decontaminated using NaOH-N-acetyl-L-cystein or NaOH-ClNa hypertonic solution for Ziehl-Neelsen staining and cultures. The leftover sediments of smear-positive samples were stored at -20 ºC, 70 of which were selected to be included in this study according to their DR profile. Thirty DR Mycobacterium tuberculosis isolates were also assessed. Sequencing was used as gold standard to detect mutations conferring isoniazid (INH and rifampicin (RIF resistance. Valid results were obtained in 94.0 % of the samples and 85.5 % (53/62 of the INH-R samples were properly identified. Mutations in the katGS315T gene and inhA C-15T gene promoter region were present in 59.7 % (37/62 and 25.8% (16/62 of the INH-R samples, respectively. The system could also identify 97.7 % (41/42 of the RIF-R samples; the mutations found were rpoBS531L (66.7 %, 28/42, D516V (19.0 %, 8/42, H526Y and S531P/W (4.8 %, 2/42 each one, and S522L/Q (2.4 %, 1/42. A 98.8 % concordance between the GenoType assay and sequencing was obtained. GenoType® MT BDRplus has demonstrated to be easy to implement and to perform in clinical laboratories and useful for a rapid detection of DR M. tuberculosis from decontaminated sputa and clinical isolates. Therefore, this assay could be applied as a rapid tool to predict INH-R and/or RIF-R in DR risk cases.La tuberculosis (TBC, y la TBC multi y extensivamente drogo-resistentes (DR son importantes problemas de salud pública mundial. El objetivo de este estudio fue determinar la sensibilidad y especificidad del sistema GenoType® MT BDRplus a partir de esputos (baciloscop

  13. Drug-resistant spinal tuberculosis

    Directory of Open Access Journals (Sweden)

    Anil K Jain

    2018-01-01

    Full Text Available Drug-resistant spinal tuberculosis (TB is an emerging health problem in both developing and developed countries. In this review article, we aim to define management protocols for suspicion, diagnosis, and treatment of such patients. Spinal TB is a deep-seated paucibacillary lesion, and the demonstration of acid-fast bacilli on Ziehl-Neelsen staining is possible only in 10%–30% of cases. Drug resistance is suspected in patients showing the failure of clinicoradiological improvement or appearance of a fresh lesion of osteoarticular TB while on anti tubercular therapy (ATT for a minimum period of 5 months. The conventional culture of Mycobacterium tuberculosis remains the gold standard for both bacteriological diagnosis and drug sensitivity testing (DST; however, the high turn around time of 2–6 weeks for detection with added 3 weeks for DST is a major limitation. To overcome this problem, rapid culture methods and molecular methods have been introduced. From a public health perspective, reducing the period between diagnosis and treatment initiation has direct benefits for both the patient and the community. For all patients of drug-resistant spinal TB, a complete Drug-O-Gram should be prepared which includes details of all drugs, their doses, and duration. Patients with confirmed multidrug-resistant TB strains should receive a regimen with at least five effective drugs, including pyrazinamide and one injectable. Patients with resistance to additional antitubercular drugs should receive individualized ATT as per their DST results.

  14. Survival and evolution of a large multidrug resistance plasmid in new clinical bacterial hosts

    DEFF Research Database (Denmark)

    Porse, Andreas; Schønning, Kristian; Munck, Christian

    2016-01-01

    Large conjugative plasmids are important drivers of bacterial evolution and contribute significantly to the dissemination of antibiotic resistance. Although plasmid borne multidrug resistance is recognized as one of the main challenges in modern medicine, the adaptive forces shaping the evolution...

  15. Lipoteichoic acid synthesis inhibition in combination with antibiotics abrogates growth of multidrug-resistant Enterococcus faecium

    NARCIS (Netherlands)

    Paganelli, Fernanda L.; van de Kamer, Tim; Brouwer, Ellen C.; Leavis, Helen L.; Woodford, Neil; Bonten, Marc J M; Willems, Rob J L; Hendrickx, Antoni P A

    Enterococcus faecium is a multidrug-resistant (MDR) nosocomial pathogen causing significant morbidity in debilitated patients. New antimicrobials are needed to treat antibiotic-resistant E. faecium infections in hospitalised patients. E. faecium incorporates lipoteichoic acid (LTA)

  16. Emergence and spread of a human-transmissible multidrug-resistant nontuberculous mycobacterium

    DEFF Research Database (Denmark)

    Bryant, Josephine M; Grogono, Dorothy M; Rodriguez-Rincon, Daniela

    2016-01-01

    Lung infections with Mycobacterium abscessus, a species of multidrug-resistant nontuberculous mycobacteria, are emerging as an important global threat to individuals with cystic fibrosis (CF), in whom M. abscessus accelerates inflammatory lung damage, leading to increased morbidity and mortality....

  17. Biofilm formation in clinical isolates of nosocomial Acinetobacter baumannii and its relationship with multidrug resistance

    Directory of Open Access Journals (Sweden)

    Ebrahim Babapour

    2016-06-01

    Conclusions: Since most of the multidrug resistant strains produce biofilm, it seems necessary to provide continuous monitoring and determination of antibiotic susceptibility of clinical A. baumannii. This would help to select the most appropriate antibiotic for treatment.

  18. Dominant incidence of multidrug and extensively drug-resistant specific Mycobacterium tuberculosis clones in Osaka Prefecture, Japan.

    Directory of Open Access Journals (Sweden)

    Aki Tamaru

    Full Text Available Infection and transmission of multidrug-resistant Mycobacterium tuberculosis (MDR-Mtb and extensively drug-resistant M. tuberculosis (XDR-Mtb is a serious health problem. We analyzed a total of 1,110 Mtb isolates in Osaka Prefecture and neighboring areas from April 2000 to March 2009. A total of 89 MDR-Mtb were identified, 36 (48.5% of which were determined to be XDR-Mtb. Among the 89 MDR-Mtb isolates, 24 (27.0% phylogenetically distributed into six clusters based on mycobacterial interspersed repetitive units-various number of tandem repeats (MIRU-VNTR typing. Among these six clusters, the MIRU-VNTR patterns of four (OM-V02, OM-V03, OM-V04, and OM-V06 were only found for MDR-Mtb. Further analysis revealed that all isolates belonging to OM-V02 and OM-V03, and two isolates from OM-V04 were clonal. Importantly such genotypes were not observed for drug-sensitive isolates. These suggest that few but transmissible clones can transmit after acquiring multidrug resistance and colonize even in a country with a developed, well-organized healthcare system.

  19. Purification of a Multidrug Resistance Transporter for Crystallization Studies

    Directory of Open Access Journals (Sweden)

    Kamela O. Alegre

    2015-03-01

    Full Text Available Crystallization of integral membrane proteins is a challenging field and much effort has been invested in optimizing the overexpression and purification steps needed to obtain milligram amounts of pure, stable, monodisperse protein sample for crystallography studies. Our current work involves the structural and functional characterization of the Escherichia coli multidrug resistance transporter MdtM, a member of the major facilitator superfamily (MFS. Here we present a protocol for isolation of MdtM to increase yields of recombinant protein to the milligram quantities necessary for pursuit of structural studies using X-ray crystallography. Purification of MdtM was enhanced by introduction of an elongated His-tag, followed by identification and subsequent removal of chaperonin contamination. For crystallization trials of MdtM, detergent screening using size exclusion chromatography determined that decylmaltoside (DM was the shortest-chain detergent that maintained the protein in a stable, monodispersed state. Crystallization trials of MdtM performed using the hanging-drop diffusion method with commercially available crystallization screens yielded 3D protein crystals under several different conditions. We contend that the purification protocol described here may be employed for production of high-quality protein of other multidrug efflux members of the MFS, a ubiquitous, physiologically and clinically important class of membrane transporters.

  20. Targeting protein kinases to reverse multidrug resistance in sarcoma.

    Science.gov (United States)

    Chen, Hua; Shen, Jacson; Choy, Edwin; Hornicek, Francis J; Duan, Zhenfeng

    2016-02-01

    Sarcomas are a group of cancers that arise from transformed cells of mesenchymal origin. They can be classified into over 50 subtypes, accounting for approximately 1% of adult and 15% of pediatric cancers. Wide surgical resection, radiotherapy, and chemotherapy are the most common treatments for the majority of sarcomas. Among these therapies, chemotherapy can palliate symptoms and prolong life for some sarcoma patients. However, sarcoma cells can have intrinsic or acquired resistance after treatment with chemotherapeutics drugs, leading to the development of multidrug resistance (MDR). MDR attenuates the efficacy of anticancer drugs and results in treatment failure for sarcomas. Therefore, overcoming MDR is an unmet need for sarcoma therapy. Certain protein kinases demonstrate aberrant expression and/or activity in sarcoma cells, which have been found to be involved in the regulation of sarcoma cell progression, such as cell cycle, apoptosis, and survival. Inhibiting these protein kinases may not only decrease the proliferation and growth of sarcoma cells, but also reverse their resistance to chemotherapeutic drugs to subsequently reduce the doses of anticancer drugs and decrease drug side-effects. The discovery of novel strategies targeting protein kinases opens a door to a new area of sarcoma research and provides insight into the mechanisms of MDR in chemotherapy. This review will focus on the recent studies in targeting protein kinase to reverse chemotherapeutic drug resistance in sarcoma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Marine Natural Products as Models to Circumvent Multidrug Resistance

    Directory of Open Access Journals (Sweden)

    Solida Long

    2016-07-01

    Full Text Available Multidrug resistance (MDR to anticancer drugs is a serious health problem that in many cases leads to cancer treatment failure. The ATP binding cassette (ABC transporter P-glycoprotein (P-gp, which leads to premature efflux of drugs from cancer cells, is often responsible for MDR. On the other hand, a strategy to search for modulators from natural products to overcome MDR had been in place during the last decades. However, Nature limits the amount of some natural products, which has led to the development of synthetic strategies to increase their availability. This review summarizes the research findings on marine natural products and derivatives, mainly alkaloids, polyoxygenated sterols, polyketides, terpenoids, diketopiperazines, and peptides, with P-gp inhibitory activity highlighting the established structure-activity relationships. The synthetic pathways for the total synthesis of the most promising members and analogs are also presented. It is expected that the data gathered during the last decades concerning their synthesis and MDR-inhibiting activities will help medicinal chemists develop potential drug candidates using marine natural products as models which can deliver new ABC transporter inhibitor scaffolds.

  2. Combating multidrug-resistant Gram-negative bacterial infections.

    Science.gov (United States)

    Xu, Ze-Qi; Flavin, Michael T; Flavin, John

    2014-02-01

    Multidrug-resistant (MDR) bacterial infections, especially those caused by Gram-negative pathogens, have emerged as one of the world's greatest health threats. The development of novel antibiotics to treat MDR Gram-negative bacteria has, however, stagnated over the last half century. This review provides an overview of recent R&D activities in the search for novel antibiotics against MDR Gram-negatives. It provides emphasis in three key areas. First, the article looks at new analogs of existing antibiotic molecules such as β-lactams, tetracyclines, and aminoglycoside as well as agents against novel bacterial targets such as aminoacyl-tRNA synthetase and peptide deformylase. Second, it also examines alternative strategies to conventional approaches including cationic antimicrobial peptides, siderophores, efflux pump inhibitors, therapeutic antibodies, and renewed interest in abandoned treatments or those with limited indications. Third, the authors aim to provide an update on the current clinical development status for each drug candidate. The traditional analog approach is insufficient to meet the formidable challenge brought forth by MDR superbugs. With the disappointing results of the genomics approach for delivering novel targets and drug candidates, alternative strategies to permeate the bacterial cell membrane, enhance influx, disrupt efflux, and target specific pathogens via therapeutic antibodies are attractive and promising. Coupled with incentivized business models, governmental policies, and a clarified regulatory pathway, it is hoped that the antibiotic pipeline will be filled with an effective armamentarium to safeguard global health.

  3. Effect of methylglyoxal on multidrug-resistant Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Katsuhiko eHayashi

    2014-04-01

    Full Text Available Honey has a complex chemistry, and its broad-spectrum antimicrobial activity varies with floral source, climate, and harvesting conditions. Methylglyoxal was identified as the dominant antibacterial component of manuka honey. Although it has been known that methylglyoxal has antibacterial activity against gram-positive bacteria, including methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus, there is not much information describing its activity against gram-negative bacteria. In this study, we report the effect of methylglyoxal against multidrug-resistant Pseudomonas aeruginosa (MDRP using 53 clinically isolated strains. We also assessed the effect of deleting the five multidrug efflux systems in P. aeruginosa, as well as the efflux systems in Escherichia coli and Salmonella enterica serovar Typhimurium, on MICs of methylglyoxal. Our results indicate that methylglyoxal inhibits the growth of MDRP at concentrations of 128–512 µg/ml (1.7–7.1 mM and is not recognized by drug efflux systems.

  4. Higher Desolvation Energy Reduces Molecular Recognition in Multi-Drug Resistant HIV-1 Protease

    Directory of Open Access Journals (Sweden)

    Ladislau C. Kovari

    2012-05-01

    Full Text Available Designing HIV-1 protease inhibitors that overcome drug-resistance is still a challenging task. In this study, four clinical isolates of multi-drug resistant HIV-1 proteases that exhibit resistance to all the US FDA-approved HIV-1 protease inhibitors and also reduce the substrate recognition ability were examined. A multi-drug resistant HIV-1 protease isolate, MDR 769, was co-crystallized with the p2/NC substrate and the mutated CA/p2 substrate, CA/p2 P1’F. Both substrates display different levels of molecular recognition by the wild-type and multi-drug resistant HIV-1 protease. From the crystal structures, only limited differences can be identified between the wild-type and multi-drug resistant protease. Therefore, a wild-type HIV-1 protease and four multi-drug resistant HIV-1 proteases in complex with the two peptides were modeled based on the crystal structures and examined during a 10 ns-molecular dynamics simulation. The simulation results reveal that the multi-drug resistant HIV-1 proteases require higher desolvation energy to form complexes with the peptides. This result suggests that the desolvation of the HIV-1 protease active site is an important step of protease-ligand complex formation as well as drug resistance. Therefore, desolvation energy could be considered as a parameter in the evaluation of future HIV-1 protease inhibitor candidates.

  5. Functional analysis of P-glycoprotein and multidrug resistance associated protein related multidrug resistance in AML-blasts.

    Science.gov (United States)

    Brügger, D; Herbart, H; Gekeler, V; Seitz, G; Liu, C; Klingebiel, T; Orlikowsky, T; Einsele, H; Denzlinger, C; Bader, P; Niethammer, D; Beck, J F

    1999-05-01

    Despite the high effectiveness of various P-glycoprotein (P-gp) modulating substances in vitro their clinical value e.g. for combination treatment of acute myelogenous leukemias (AML) remains still unclear. This might be explainable by recent findings that other factors than P-gp (e.g. the multidrug resistance associated protein (MRP)) may also be involved in clinical occurring drug resistance. To study P-gp and MRP mediated MDR in AML blasts from patients with relapses at the functional level we measured rhodamine 123 (RHO) efflux in combination with a P-gp specific (SDZ PSC 833) or a MRP specific (MK571) modulator, respectively. Furthermore, direct antineoplastic drug action was monitored by determination of damaged cell fraction of a blast population using flow cytometry. We generally found strongly modulated RHO efflux by SDZ PSC 833 but slight RHO-efflux modulation by MK571 in blasts from relapsed states of AML expressing MDR1 or MRP mRNA at various levels. We could not demonstrate, though, significant PSC 833 or MK571 mediated modulation of the cytotoxic effects of etoposide. The results point to the possibility that combination of etoposide and a modulator might not improve responses to chemotherapy by targeting P-gp or MRP exclusively.

  6. Molecular Analysis of Multi-Drug Resistance (MDR) in ...

    African Journals Online (AJOL)

    This review therefore brings to light some of the processes involved in molecular typing of Mycobacterium tuberculosis strains like the use of restriction fragment length polymorphism (RFLP) and spoligotyping, which have become valuable tools in the epidemiology of tuberculosis, identification of genotypes and ...

  7. Comparative genomics of multidrug resistance in Acinetobacter baumannii.

    Directory of Open Access Journals (Sweden)

    Pierre-Edouard Fournier

    2006-01-01

    Full Text Available Acinetobacter baumannii is a species of nonfermentative gram-negative bacteria commonly found in water and soil. This organism was susceptible to most antibiotics in the 1970s. It has now become a major cause of hospital-acquired infections worldwide due to its remarkable propensity to rapidly acquire resistance determinants to a wide range of antibacterial agents. Here we use a comparative genomic approach to identify the complete repertoire of resistance genes exhibited by the multidrug-resistant A. baumannii strain AYE, which is epidemic in France, as well as to investigate the mechanisms of their acquisition by comparison with the fully susceptible A. baumannii strain SDF, which is associated with human body lice. The assembly of the whole shotgun genome sequences of the strains AYE and SDF gave an estimated size of 3.9 and 3.2 Mb, respectively. A. baumannii strain AYE exhibits an 86-kb genomic region termed a resistance island--the largest identified to date--in which 45 resistance genes are clustered. At the homologous location, the SDF strain exhibits a 20 kb-genomic island flanked by transposases but devoid of resistance markers. Such a switching genomic structure might be a hotspot that could explain the rapid acquisition of resistance markers under antimicrobial pressure. Sequence similarity and phylogenetic analyses confirm that most of the resistance genes found in the A. baumannii strain AYE have been recently acquired from bacteria of the genera Pseudomonas, Salmonella, or Escherichia. This study also resulted in the discovery of 19 new putative resistance genes. Whole-genome sequencing appears to be a fast and efficient approach to the exhaustive identification of resistance genes in epidemic infectious agents of clinical significance.

  8. Comparative Genomics of Multidrug Resistance in Acinetobacter baumannii.

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available Acinetobacter baumannii is a species of nonfermentative gram-negative bacteria commonly found in water and soil. This organism was susceptible to most antibiotics in the 1970s. It has now become a major cause of hospital-acquired infections worldwide due to its remarkable propensity to rapidly acquire resistance determinants to a wide range of antibacterial agents. Here we use a comparative genomic approach to identify the complete repertoire of resistance genes exhibited by the multidrug-resistant A. baumannii strain AYE, which is epidemic in France, as well as to investigate the mechanisms of their acquisition by comparison with the fully susceptible A. baumannii strain SDF, which is associated with human body lice. The assembly of the whole shotgun genome sequences of the strains AYE and SDF gave an estimated size of 3.9 and 3.2 Mb, respectively. A. baumannii strain AYE exhibits an 86-kb genomic region termed a resistance island-the largest identified to date-in which 45 resistance genes are clustered. At the homologous location, the SDF strain exhibits a 20 kb-genomic island flanked by transposases but devoid of resistance markers. Such a switching genomic structure might be a hotspot that could explain the rapid acquisition of resistance markers under antimicrobial pressure. Sequence similarity and phylogenetic analyses confirm that most of the resistance genes found in the A. baumannii strain AYE have been recently acquired from bacteria of the genera Pseudomonas, Salmonella, or Escherichia. This study also resulted in the discovery of 19 new putative resistance genes. Whole-genome sequencing appears to be a fast and efficient approach to the exhaustive identification of resistance genes in epidemic infectious agents of clinical significance.

  9. Imaging and Targeted Therapy of Multidrug Resistance. Final Report

    International Nuclear Information System (INIS)

    Piwnica-Worms, David

    2009-01-01

    One focus area of DOE Office of Science was the Imaging of Gene Expression in Health and Disease in real time in tissue culture, whole animals and ultimately patients. Investigators of the Molecular Imaging Group, Washington University Medical School, ascribed to this objective and a major focus of this group directly tied into the DOE program through their efforts targeting the multidrug resistance gene (MDR1). Our plans for continuation of the program were to extend and build on this line of investigation, incorporating new molecular tools into our methodology to selectively inhibit MDR1 gene expression with novel modulation strategies. Two approaches were to be pursued: (1) high throughput screening of compounds that disrupted mutant p53 transactivation of the MDR1 promoter, and (2) knockdown of MDR1 messenger RNA with retroviral-mediated delivery of small interfering RNA constructs. These would be combined with our continuing effort to synthesize ligands and examine structure-activity relationships of bis-salicylaldehydes labeled with gallium-68 to generate PET agents for imaging MDR1 P-glycoprotein function. We would be uniquely positioned to correlate therapeutic modulation of MDR1 gene expression and protein function in the same systems in vivo using PET and bioluminescence reporters. Use of animal models such as the mdr1a/1b(-/-) gene deleted mice would also have enabled refined analysis of modulation and tracer pharmacokinetics in vivo. Overall, this DOE program and resultant tools would enable direct monitoring of novel therapeutic strategies and the MDR phenotype in relation to gene expression and protein function in vivo.

  10. Coexpression of multidrug resistance involve proteins: a flow cytometric analysis.

    Science.gov (United States)

    Boutonnat, J; Bonnefoix, T; Mousseau, M; Seigneurin, D; Ronot, X

    1998-01-01

    Cross resistance to multiple natural cytotoxic products represents a major obstacle in myeloblastic acute leukaemia (AML). Multidrug resistance (MDR) often involves overexpression of plasma membrane drug transporter P-glycoprotein (PGP) or the resistance associated protein (MRP). Recently, a protein overexpressed in a non-PGP MDR lung cancer cell line and termed lung resistance related protein (LRP) was identified. These proteins are known to be associated with a bad prognosis in AML. We have developed a triple indirect labelling analysed by flow cytometry to detect the coexpression of these proteins. Since no cell line expressing all three antigens is known, we mixed K562 cells (resistant to Adriblastine, PGP+, MRP-, LRP-) with GLC4 cells (resistant to Adriblastine, PGP-, MRP+, LRP+) to create a model system to test the method. The antibodies used were UIC2 for PGP, MRPm6 for MRP and LRP56 for LRP. They were revealed by Fab'2 coupled with Fluoresceine-isothiocyanate, Phycoerythrin or Tricolor with isotype specificity. Cells were fixed and permeabilized after PGP labelling because MRPm6 and LRP56 recognize intracellular epitopes. PGP and LRP were easily detected. MRP is expressed at relatively low levels and was more difficult to detect because in the triple labelling the non specific staining was higher than in a single labelling. Despite the increased background in the triple labelling we were able to detect coexpression of PGP, MRP, LRP by flow cytometry. This method appears to be very useful to detect coexpression of markers in AML. Such coexpression could modify the therapeutic approach with revertants.

  11. Multidrug-resistant pathogens in the food supply.

    Science.gov (United States)

    Doyle, Marjorie E

    2015-04-01

    Antimicrobial resistance, including multidrug resistance (MDR), is an increasing problem globally. MDR bacteria are frequently detected in humans and animals from both more- and less-developed countries and pose a serious concern for human health. Infections caused by MDR microbes may increase morbidity and mortality and require use of expensive drugs and prolonged hospitalization. Humans may be exposed to MDR pathogens through exposure to environments at health-care facilities and farms, livestock and companion animals, human food, and exposure to other individuals carrying MDR microbes. The Centers for Disease Control and Prevention classifies drug-resistant foodborne bacteria, including Campylobacter, Salmonella Typhi, nontyphoidal salmonellae, and Shigella, as serious threats. MDR bacteria have been detected in both meat and fresh produce. Salmonellae carrying genes coding for resistance to multiple antibiotics have caused numerous foodborne MDR outbreaks. While there is some level of resistance to antimicrobials in environmental bacteria, the widespread use of antibiotics in medicine and agriculture has driven the selection of a great variety of microbes with resistance to multiple antimicrobials. MDR bacteria on meat may have originated in veterinary health-care settings or on farms where animals are given antibiotics in feed or to treat infections. Fresh produce may be contaminated by irrigation or wash water containing MDR bacteria. Livestock, fruits, and vegetables may also be contaminated by food handlers, farmers, and animal caretakers who carry MDR bacteria. All potential sources of MDR bacteria should be considered and strategies devised to reduce their presence in foods. Surveillance studies have documented increasing trends in MDR in many pathogens, although there are a few reports of the decline of certain multidrug pathogens. Better coordination of surveillance programs and strategies for controlling use of antimicrobials need to be implemented in

  12. Treatment strategy for a multidrug-resistant Klebsiella UTI.

    Science.gov (United States)

    Fleming, Erin; Heil, Emily L; Hynicka, Lauren M

    2014-01-01

    To describe the management strategy for a multidrug-resistant (MDR) Klebsiella urinary tract infection (UTI). A 69-year-old Caucasian woman with a past medical history of recurrent UTIs and a right-lung transplant presented with fever to 101.4°F, chills, malaise, and cloudy, foul-smelling urine for approximately 1 week. She was found to have a MDR Klebsiella UTI that was sensitive to tigecycline and cefepime. To further evaluate the degree of resistance Etest minimum inhibitory concentrations were requested for cefepime, amikacin, meropenem, and ertapenem. The patient received a 14-day course of amikacin, which resulted in resolution of her symptoms. One month later, the patient's UTI symptoms returned. The urine culture again grew MDR Klebsiella, sensitive only to tigecycline. Fosfomycin was initiated and resulted in limited resolution of her symptoms. Colistin was started, however, therapy was discontinued on day 5 secondary to the development of acute kidney injury. Despite the short course of therapy, the patient's symptoms resolved. The case presented lends itself well to numerous discussion items that are important to consider when determining optimal treatment for MDR Gram-negative bacilli (GNBs). Susceptibility testing is an important tool for optimizing antibiotic therapy, however, automated systems may overestimate the susceptibility profile for a MDR GNB. Treatment strategies evaluated to treat MDR GNB, include combination therapy with a carbepenem and synergy using polymyxin. We have described the management strategy for a MDR Klebsiella UTI, the consequences of the initial management strategy, and potential strategies to manage these types of infections in future patients.

  13. In vitro and in vivo activities of the nitroimidazole TBA-354 against Mycobacterium tuberculosis.

    Science.gov (United States)

    Upton, A M; Cho, S; Yang, T J; Kim, Y; Wang, Y; Lu, Y; Wang, B; Xu, J; Mdluli, K; Ma, Z; Franzblau, S G

    2015-01-01

    Nitroimidazoles are a promising new class of antitubercular agents. The nitroimidazo-oxazole delamanid (OPC-67683, Deltyba) is in phase III trials for the treatment of multidrug-resistant tuberculosis, while the nitroimidazo-oxazine PA-824 is entering phase III for drug-sensitive and drug-resistant tuberculosis. TBA-354 (SN31354[(S)-2-nitro-6-((6-(4-trifluoromethoxy)phenyl)pyridine-3-yl)methoxy)-6,7-dihydro-5H-imidazo[2,1-b][1,3]oxazine]) is a pyridine-containing biaryl compound with exceptional efficacy against chronic murine tuberculosis and favorable bioavailability in preliminary rodent studies. It was selected as a potential next-generation antituberculosis nitroimidazole following an extensive medicinal chemistry effort. Here, we further evaluate the pharmacokinetic properties and activity of TBA-354 against Mycobacterium tuberculosis. TBA-354 is narrow spectrum and bactericidal in vitro against replicating and nonreplicating Mycobacterium tuberculosis, with potency similar to that of delamanid and greater than that of PA-824. The addition of serum protein or albumin does not significantly alter this activity. TBA-354 maintains activity against Mycobacterium tuberculosis H37Rv isogenic monoresistant strains and clinical drug-sensitive and drug-resistant isolates. Spontaneous resistant mutants appear at a frequency of 3 × 10(-7). In vitro studies and in vivo studies in mice confirm that TBA-354 has high bioavailability and a long elimination half-life. In vitro studies suggest a low risk of drug-drug interactions. Low-dose aerosol infection models of acute and chronic murine tuberculosis reveal time- and dose-dependent in vivo bactericidal activity that is at least as potent as that of delamanid and more potent than that of PA-824. Its superior potency and pharmacokinetic profile that predicts suitability for once-daily oral dosing suggest that TBA-354 be studied further for its potential as a next-generation nitroimidazole. Copyright © 2015, American

  14. Bloodstream infections caused by multi-drug resistant Proteus mirabilis: Epidemiology, risk factors and impact of multi-drug resistance.

    Science.gov (United States)

    Korytny, Alexander; Riesenberg, Klaris; Saidel-Odes, Lisa; Schlaeffer, Fransisc; Borer, Abraham

    2016-01-01

    The prevalence of antimicrobial co-resistance among ESBL-producing Enterobactereaceae is extremely high in Israel. Multidrug-resistant Proteus mirabilis strains (MDR-PM), resistant to almost all antibiotic classes have been described. The aim was to determine the risk factors for bloodstream infections caused by MDR-PM and clinical outcomes. A retrospective case-control study. Adult patients with PM bacteremia during 7 years were identified retrospectively and their files reviewed for demographics, underlying diseases, Charlson Comorbidity Index, treatment and outcome. One hundred and eighty patients with PM-bloodstream infection (BSI) were included; 90 cases with MDR-PM and 90 controls with sensitive PM (S-PM). Compared to controls, cases more frequently were from nursing homes, had recurrent hospital admissions in the past year and received antibiotic therapy in the previous 3 months, were bedridden and suffered from peripheral vascular disease and peptic ulcer disease (p < 0.001). Two-thirds of the MDR-PM isolates were ESBL-producers vs 4.4% of S-PM isolates (p < 0.001, OR = 47.6, 95% CI = 15.9-142.6). In-hospital crude mortality rate of patients with MDR-PM BSI was 37.7% vs 23.3% in those with S-PM BSI (p = 0.0359, OR = 2, 95% CI = 1.4-3.81). PM bacteremia in elderly and functionally-dependent patients is likely to be caused by nearly pan-resistant PM strains in the institution; 51.8% of the patients received inappropriate empiric antibiotic treatment. The crude mortality rate of patients with MDR-PM BSI was significantly higher than that of patients with S-PM BSI.

  15. Modulation of P-glycoprotein activity by novel synthetic curcumin derivatives in sensitive and multidrug-resistant T-cell acute lymphoblastic leukemia cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Ooko, Edna [Department of Pharmaceutical Biology, Institute of Pharmacy and Biochemistry, Johannes Gutenberg University, Staudinger Weg 5, 55128 Mainz (Germany); Alsalim, Tahseen; Saeed, Bahjat [Department of Chemistry, College of Education for Pure Sciences, University of Basrah, P.O. Box 49 Basrah, Al Basrah (Iraq); Saeed, Mohamed E.M.; Kadioglu, Onat [Department of Pharmaceutical Biology, Institute of Pharmacy and Biochemistry, Johannes Gutenberg University, Staudinger Weg 5, 55128 Mainz (Germany); Abbo, Hanna S. [Department of Chemistry, University of the Western Cape, P/B X17, Bellville, 7535 Cape Town (South Africa); Titinchi, Salam J.J., E-mail: stitinchi@uwc.ac.za [Department of Chemistry, University of the Western Cape, P/B X17, Bellville, 7535 Cape Town (South Africa); Efferth, Thomas, E-mail: efferth@uni-mainz.de [Department of Pharmaceutical Biology, Institute of Pharmacy and Biochemistry, Johannes Gutenberg University, Staudinger Weg 5, 55128 Mainz (Germany)

    2016-08-15

    Background: Multidrug resistance (MDR) and drug transporter P-glycoprotein (P-gp) represent major obstacles in cancer chemotherapy. We investigated 19 synthetic curcumin derivatives in drug-sensitive acute lymphoblastic CCRF–CEM leukemia cells and their multidrug-resistant P-gp-overexpressing subline, CEM/ADR5000. Material and methods: Cytotoxicity was tested by resazurin assays. Doxorubicin uptake was assessed by flow cytometry. Binding modes of compounds to P-gp were analyzed by molecular docking. Chemical features responsible for bioactivity were studied by quantitative structure activity relationship (QSAR) analyses. A 7-descriptor QSAR model was correlated with doxorubicin uptake values, IC{sub 50} values and binding energies. Results: The compounds displayed IC{sub 50} values between 0.7 ± 0.03 and 20.2 ± 0.25 μM. CEM/ADR5000 cells exhibited cross-resistance to 10 compounds, collateral sensitivity to three compounds and regular sensitivity to the remaining six curcumins. Molecular docking studies at the intra-channel transmembrane domain of human P-gp resulted in lowest binding energies ranging from − 9.00 ± 0.10 to − 6.20 ± 0.02 kcal/mol and pKi values from 0.24 ± 0.04 to 29.17 ± 0.88 μM. At the ATP-binding site of P-gp, lowest binding energies ranged from − 9.78 ± 0.17 to − 6.79 ± 0.01 kcal/mol and pKi values from 0.07 ± 0.02 to 0.03 ± 0.03 μM. CEM/ADR5000 cells accumulated approximately 4-fold less doxorubicin than CCRF–CEM cells. The control P-gp inhibitor, verapamil, partially increased doxorubicin uptake in CEM/ADR5000 cells. Six curcumins increased doxorubicin uptake in resistant cells or even exceeded uptake levels compared to sensitive one. QSAR yielded good activity prediction (R = 0.797 and R = 0.794 for training and test sets). Conclusion: Selected derivatives may serve to guide future design of novel P-gp inhibitors and collateral sensitive drugs to combat MDR. - Highlights: • Novel derivatives of curcumin in reversing

  16. Modulation of P-glycoprotein activity by novel synthetic curcumin derivatives in sensitive and multidrug-resistant T-cell acute lymphoblastic leukemia cell lines

    International Nuclear Information System (INIS)

    Ooko, Edna; Alsalim, Tahseen; Saeed, Bahjat; Saeed, Mohamed E.M.; Kadioglu, Onat; Abbo, Hanna S.; Titinchi, Salam J.J.; Efferth, Thomas

    2016-01-01

    Background: Multidrug resistance (MDR) and drug transporter P-glycoprotein (P-gp) represent major obstacles in cancer chemotherapy. We investigated 19 synthetic curcumin derivatives in drug-sensitive acute lymphoblastic CCRF–CEM leukemia cells and their multidrug-resistant P-gp-overexpressing subline, CEM/ADR5000. Material and methods: Cytotoxicity was tested by resazurin assays. Doxorubicin uptake was assessed by flow cytometry. Binding modes of compounds to P-gp were analyzed by molecular docking. Chemical features responsible for bioactivity were studied by quantitative structure activity relationship (QSAR) analyses. A 7-descriptor QSAR model was correlated with doxorubicin uptake values, IC 50 values and binding energies. Results: The compounds displayed IC 50 values between 0.7 ± 0.03 and 20.2 ± 0.25 μM. CEM/ADR5000 cells exhibited cross-resistance to 10 compounds, collateral sensitivity to three compounds and regular sensitivity to the remaining six curcumins. Molecular docking studies at the intra-channel transmembrane domain of human P-gp resulted in lowest binding energies ranging from − 9.00 ± 0.10 to − 6.20 ± 0.02 kcal/mol and pKi values from 0.24 ± 0.04 to 29.17 ± 0.88 μM. At the ATP-binding site of P-gp, lowest binding energies ranged from − 9.78 ± 0.17 to − 6.79 ± 0.01 kcal/mol and pKi values from 0.07 ± 0.02 to 0.03 ± 0.03 μM. CEM/ADR5000 cells accumulated approximately 4-fold less doxorubicin than CCRF–CEM cells. The control P-gp inhibitor, verapamil, partially increased doxorubicin uptake in CEM/ADR5000 cells. Six curcumins increased doxorubicin uptake in resistant cells or even exceeded uptake levels compared to sensitive one. QSAR yielded good activity prediction (R = 0.797 and R = 0.794 for training and test sets). Conclusion: Selected derivatives may serve to guide future design of novel P-gp inhibitors and collateral sensitive drugs to combat MDR. - Highlights: • Novel derivatives of curcumin in reversing multidrug

  17. Multidrug resistance 1 gene polymorphisms may determine Crohn's disease behavior in patients from Rio de Janeiro

    Directory of Open Access Journals (Sweden)

    Ana Teresa P. Carvalho

    2014-01-01

    Full Text Available OBJECTIVES: Conflicting data from studies on the potential role of multidrug resistance 1 gene polymorphisms in inflammatory bowel disease may result from the analysis of genetically and geographically distinct populations. Here, we investigated whether multidrug resistance 1 gene polymorphisms are associated with inflammatory bowel diseases in patients from Rio de Janeiro. METHODS: We analyzed 123 Crohn's disease patients and 83 ulcerative colitis patients to determine the presence of the multidrug resistance 1 gene polymorphisms C1236T, G2677T and C3435T. In particular, the genotype frequencies of Crohn's disease and ulcerative colitis patients were analyzed. Genotype-phenotype associations with major clinical characteristics were established, and estimated risks were calculated for the mutations. RESULTS: No significant difference was observed in the genotype frequencies of the multidrug resistance 1 G2677T/A and C3435T polymorphisms between Crohn's disease and ulcerative colitis patients. In contrast, the C1236T polymorphism was significantly more common in Crohn's disease than in ulcerative colitis (p = 0.047. A significant association was also found between the multidrug resistance 1 C3435T polymorphism and the stricturing form of Crohn's disease (OR: 4.13; p = 0.009, whereas no association was found with penetrating behavior (OR: 0.33; p = 0.094. In Crohn's disease, a positive association was also found between the C3435T polymorphism and corticosteroid resistance/refractoriness (OR: 4.14; p = 0.010. However, no significant association was found between multidrug resistance 1 gene polymorphisms and UC subphenotypic categories. CONCLUSION: The multidrug resistance 1 gene polymorphism C3435T is associated with the stricturing phenotype and an inappropriate response to therapy in Crohn's disease. This association with Crohn's disease may support additional pathogenic roles for the multidrug resistance 1 gene in regulating gut

  18. Cytotoxicity of Endoperoxides from the Caribbean Sponge Plakortis halichondrioides towards Sensitive and Multidrug-Resistant Leukemia Cells: Acids vs. Esters Activity Evaluation

    Directory of Open Access Journals (Sweden)

    Tanja Schirmeister

    2017-03-01

    Full Text Available The 6-epimer of the plakortide H acid (1, along with the endoperoxides plakortide E (2, plakortin (3, and dihydroplakortin (4 have been isolated from a sample of the Caribbean sponge Plakortis halichondrioides. To perform a comparative study on the cytotoxicity towards the drug-sensitive leukemia CCRF-CEM cell line and its multi-drug resistant subline CEM/ADR5000, the acid of plakortin, namely plakortic acid (5, as well as the esters plakortide E methyl ester (6 and 6-epi-plakortide H (7 were synthesized by hydrolysis and Steglich esterification, respectively. The data obtained showed that the acids (1, 2, 5 exhibited potent cytotoxicity towards both cell lines, whereas the esters showed no activity (6, 7 or weaker activity (3, 4 compared to their corresponding acids. Plakortic acid (5 was the most promising derivative with half maximal inhibitory concentration (IC50 values of ca. 0.20 µM for both cell lines.

  19. Pulsed-field gel electrophoresis of multidrug-resistant and -sensitive strains of Pseudomonas aeruginosa from a Malaysian hospital.

    Science.gov (United States)

    Thong, Kwai Lin; Lai, Kin Seng; Ganeswrie, R; Puthucheary, S D

    2004-10-01

    Over a period of 6 months from January to June 2002, an unusual increase in the isolation of highly resistant Pseudomonas aeruginosa strains was observed in the various wards and intensive care units of a large general hospital in Johor Bahru, Malaysia. An equal number of multidrug resistant (MDR) and drug-susceptible strains were collected randomly from swabs, respiratory specimens, urine, blood, cerebral spinal fluid, and central venous catheters to determine the clonality and genetic variation of the strains. Macrorestriction analysis by pulsed-field gel electrophoresis showed that the 19 MDR strains were genetically very homogenous; the majority showed the dominant profile S1 (n = 10), the rest very closely related profiles S1a (n = 1), S2 (n = 4), and S2a (n = 3), indicating the endemicity of these strains. In contrast, the 19 drug-sensitive strains isolated during the same time period were genetically more diverse, showing 17 pulsed-field profiles (F = 0.50-1.00), and probably derived from the patients themselves. The presence of the MDR clone poses serious therapeutic problems as it may become endemic in the hospital and give rise to future clonal outbreaks. There is also the potential for wider geographical spread.

  20. Regorafenib is transported by the organic anion transporter 1B1 and the multidrug resistance protein 2.

    Science.gov (United States)

    Ohya, Hiroki; Shibayama, Yoshihiko; Ogura, Jiro; Narumi, Katsuya; Kobayashi, Masaki; Iseki, Ken

    2015-01-01

    Regorafenib is a small molecule inhibitor of tyrosine kinases, and has been shown to improve the outcomes of patients with advanced colorectal cancer and advanced gastrointestinal stromal tumors. The transport profiles of regorafenib by various transporters were evaluated. HEK293/organic anion transporting polypeptide 1B1 (OATP1B1) cells exhibited increased drug sensitivity to regorafenib. Regorafenib inhibited the uptake of 3H-estrone sulfate by HEK293/OATP1B1 cells in a dose-dependent manner, but did not affect its elimination by P-glycoproteins. The concentration of regorafenib was significantly lower in LLC-PK1/multidrug resistance protein 2 (MRP2) cells than in LLC-PK1 cells treated with the MRP2 inhibitor, MK571. MK571 abolished the inhibitory effects of regorafenib on intracellular accumulation in LLC-PK1/MRP2 cells. The uptake of regorafenib was significantly higher in HEK293/OATP1B1 cells than in OATP1B1-mock cells. Transport kinetics values were estimated to be Km=15.9 µM and Vmax=1.24 nmol/mg/min. No significant difference was observed in regorafenib concentrations between HEK293/OATP1B3 and OATP1B3-mock cells. These results indicated that regorafenib is a substrate for MRP2 and OATP1B1, and also suggest that the substrate preference of regorafenib may implicate the pharmacokinetic profiles of regorafenib.

  1. Photochemical internalisation of chemotherapy potentiates killing of multidrug-resistant breast and bladder cancer cells.

    Science.gov (United States)

    Adigbli, D K; Wilson, D G G; Farooqui, N; Sousi, E; Risley, P; Taylor, I; Macrobert, A J; Loizidou, M

    2007-08-20

    Multidrug resistance (MDR) is the major confounding factor in adjuvant solid tumour chemotherapy. Increasing intracellular amounts of chemotherapeutics to circumvent MDR may be achieved by a novel delivery method, photochemical internalisation (PCI). PCI consists of the co-administration of drug and photosensitiser; upon light activation the latter induces intracellular release of organelle-bound drug. We investigated whether co-administration of hypericin (photosensitiser) with mitoxantrone (MTZ, chemotherapeutic) plus illumination potentiates cytotoxicity in MDR cancer cells. We mapped the extent of intracellular co-localisation of drug/photosensitiser. We determined whether PCI altered drug-excreting efflux pump P-glycoprotein (Pgp) expression or function in MDR cells. Bladder and breast cancer cells and their Pgp-overexpressing MDR subclones (MGHU1, MGHU1/R, MCF-7, MCF-7/R) were given hypericin/MTZ combinations, with/without blue-light illumination. Pilot experiments determined appropriate sublethal doses for each. Viability was determined by the 3-[4,5-dimethylthiazolyl]-2,5-diphenyltetrazolium bromide assay. Intracellular localisation was mapped by confocal microscopy. Pgp expression was detected by immunofluorescence and Pgp function investigated by Rhodamine123 efflux on confocal microscopy. MTZ alone (0.1-0.2 microg ml(-1)) killed up to 89% of drug-sensitive cells; MDR cells exhibited less cytotoxicity (6-28%). Hypericin (0.1-0.2 microM) effects were similar for all cells; light illumination caused none or minimal toxicity. In combination, MTZ /hypericin plus illumination, potentiated MDR cell killing, vs hypericin or MTZ alone. (MGHU1/R: 38.65 and 36.63% increase, Phypericin increased killing by 28.15% (Phypericin was evident before illumination and at serial times post-illumination. MTZ was always found in sensitive cell nuclei, but not in dark resistant cell nuclei. In illuminated resistant cells there was some mobilisation of MTZ into the nucleus. Pgp

  2. Photochemical internalisation of chemotherapy potentiates killing of multidrug-resistant breast and bladder cancer cells

    Science.gov (United States)

    Adigbli, D K; Wilson, D G G; Farooqui, N; Sousi, E; Risley, P; Taylor, I; MacRobert, A J; Loizidou, M

    2007-01-01

    Multidrug resistance (MDR) is the major confounding factor in adjuvant solid tumour chemotherapy. Increasing intracellular amounts of chemotherapeutics to circumvent MDR may be achieved by a novel delivery method, photochemical internalisation (PCI). PCI consists of the co-administration of drug and photosensitiser; upon light activation the latter induces intracellular release of organelle-bound drug. We investigated whether co-administration of hypericin (photosensitiser) with mitoxantrone (MTZ, chemotherapeutic) plus illumination potentiates cytotoxicity in MDR cancer cells. We mapped the extent of intracellular co-localisation of drug/photosensitiser. We determined whether PCI altered drug-excreting efflux pump P-glycoprotein (Pgp) expression or function in MDR cells. Bladder and breast cancer cells and their Pgp-overexpressing MDR subclones (MGHU1, MGHU1/R, MCF-7, MCF-7/R) were given hypericin/MTZ combinations, with/without blue-light illumination. Pilot experiments determined appropriate sublethal doses for each. Viability was determined by the 3-[4,5-dimethylthiazolyl]-2,5-diphenyltetrazolium bromide assay. Intracellular localisation was mapped by confocal microscopy. Pgp expression was detected by immunofluorescence and Pgp function investigated by Rhodamine123 efflux on confocal microscopy. MTZ alone (0.1–0.2 μg ml−1) killed up to 89% of drug-sensitive cells; MDR cells exhibited less cytotoxicity (6–28%). Hypericin (0.1–0.2 μM) effects were similar for all cells; light illumination caused none or minimal toxicity. In combination, MTZ /hypericin plus illumination, potentiated MDR cell killing, vs hypericin or MTZ alone. (MGHU1/R: 38.65 and 36.63% increase, P<0.05; MCF-7/R: 80.2 and 46.1% increase, P<0.001). Illumination of combined MTZ/hypericin increased killing by 28.15% (P<0.05 MGHU1/R) compared to dark controls. Intracytoplasmic vesicular co-localisation of MTZ/hypericin was evident before illumination and at serial times post

  3. Virulence and genomic feature of multidrug resistant Campylobacter jejuni isolated from broiler chicken

    Directory of Open Access Journals (Sweden)

    Haihong Hao

    2016-10-01

    Full Text Available The aim of this study was to reveal the molecular mechanism involved in multidrug resistance and virulence of Campylobacter jejuni isolated from broiler chickens. The virulence of six multidrug resistant C. jejuni was determined by in vitro and in vivo methods. The de novo whole genome sequencing technology and molecular biology methods were used to analyze the genomic features associated with the multidrug resistance and virulence of a selected isolate (C. jejuni 1655. The comparative genomic analyses revealed a large number of single nucleotide polymorphisms, deletions, rearrangements, and inversions in C. jejuni 1655 compared to reference C. jejuni genomes. The co-emergence of Thr-86-Ile mutation in gyrA gene, A2075G mutation in 23S rRNA gene, tetO, aphA and aadE genes and pTet plasmid in C. jejuni 1655 contributed its multidrug resistance to fluoroquinolones, macrolides, tetracycline and aminoglycosides. The combination of multiple virulence genes may work together to confer the relative higher virulence in C. jejuni 1655. The co-existence of mobile gene elements (e.g. pTet and CRISPR-Cas system in C. jejuni 1655 may play an important role in the gene transfer and immune defense. The present study provides basic information of phenotypic and genomic features of C. jejuni 1655, a strain recently isolated from a chicken displaying multidrug resistance and relatively high level of virulence.

  4. [Establishment of human multidrug-resistant lung carcinoma cell line (D6/MVP)].

    Science.gov (United States)

    Ma, Sheng-lin; Feng, Jian-guo; Gu, Lin-hui; Ling, Yu-tian

    2003-03-01

    To establish human multidrug-resistant lung carcinoma cell line (D6/MVP) with its characteristics studied. Intermittent administration of high-dose MMC, VDS and DDP (MVP) was used to induce human lung carcinoma cell line (D6) to a multidrug-resistant variety (D6/MVP). MTT assay was used to study the multidrug resistance of D6/MVP to multianticarcinogen. Flow cytometry was used to study the cell cycle distribution and the expression of P-gp, multidrug resistance-associated protein (MRP) and GSH/GST. 1. D6/MVP was resistant to many anti-tumor agents, with the IC(50) 13.3 times higher and the drug resistance 2 - 6 times higher than D6, 2. The multiplication time of D6/MVP was prolonged and the cell number of S-phase decreased while that of G1- and G(2)-phase increased and 3. The expression of P-gp and MRP was enhanced significantly (96.2% vs 51.7%), but the expression of GSH/GST kept stable. D6/MVP is a multidrug-resistant cell line possessing the basic characteristics of drug-resistance.

  5. Comparative genomic analysis of multidrug-resistant Streptococcus pneumoniae isolates

    Directory of Open Access Journals (Sweden)

    Pan F

    2018-05-01

    Full Text Available Fen Pan,1 Hong Zhang,1 Xiaoyan Dong,2 Weixing Ye,3 Ping He,4 Shulin Zhang,4 Jeff Xianchao Zhu,5 Nanbert Zhong1,2,6 1Department of Clinical Laboratory, Shanghai Children’s Hospital, Shanghai Jiaotong University, Shanghai, China; 2Department of Respiratory, Shanghai Children’s Hospital, Shanghai Jiaotong University, Shanghai, China; 3Shanghai Personal Biotechnology Co., Ltd, Shanghai, China; 4Department of Medical Microbiology and Immunology, Shanghai Jiao Tong University School of Medicine, Shanghai, China; 5Zhejiang Bioruida Biotechnology co. Ltd, Zhejiang, China; 6New York State Institute for Basic Research in Developmental Disabilities, Staten Island, NY, USA Introduction: Multidrug resistance in Streptococcus pneumoniae has emerged as a serious problem to public health. A further understanding of the genetic diversity in antibiotic-resistant S. pneumoniae isolates is needed. Methods: We conducted whole-genome resequencing for 25 pneumococcal strains isolated from children with different antimicrobial resistance profiles. Comparative analysis focus on detection of single-nucleotide polymorphisms (SNPs and insertions and deletions (indels was conducted. Moreover, phylogenetic analysis was applied to investigate the genetic relationship among these strains. Results: The genome size of the isolates was ~2.1 Mbp, covering >90% of the total estimated size of the reference genome. The overall G+C% content was ~39.5%, and there were 2,200–2,400 open reading frames. All isolates with different drug resistance profiles harbored many indels (range 131–171 and SNPs (range 16,103–28,128. Genetic diversity analysis showed that the variation of different genes were associated with specific antibiotic resistance. Known antibiotic resistance genes (pbps, murMN, ciaH, rplD, sulA, and dpr were identified, and new genes (regR, argH, trkH, and PTS-EII closely related with antibiotic resistance were found, although these genes were primarily annotated

  6. Molecular characterization of multidrug-resistant Klebsiella pneumoniae isolates

    Directory of Open Access Journals (Sweden)

    Xiang-hua Hou

    2015-09-01

    Full Text Available Klebsiella pneumoniae is an important cause of healthcare-associated infections worldwide. Selective pressure, the extensive use of antibiotics, and the conjugational transmission of antibiotic resistance genes across bacterial species and genera facilitate the emergence of multidrug-resistant (MDR K. pneumoniae. Here, we examined the occurrence, phenotypes and genetic features of MDR K. pneumoniae isolated from patients in intensive care units (ICUs at the First Affiliated Hospital of Xiamen University in Xiamen, China, from January to December 2011. Thirty-eight MDR K. pneumoniae strains were collected. These MDR K. pneumoniae isolates possessed at least seven antibiotic resistance determinants, which contribute to the high-level resistance of these bacteria to aminoglycosides, macrolides, quinolones and β-lactams. Among these isolates, 24 strains were extended-spectrum β-lactamase (ESBL producers, 2 strains were AmpC producers, and 12 strains were both ESBL and AmpC producers. The 38 MDR isolates also contained class I (28/38 and class II integrons (10/38. All 28 class I-positive isolates contained aacC1, aacC4, orfX, orfX’ and aadA1 genes. β-lactam resistance was conferred through blaSHV (22/38, blaTEM (10/38, and blaCTX-M (7/38. The highly conserved blaKPC-2 (37/38 and blaOXA-23(1/38 alleles were responsible for carbapenem resistance, and a gyrAsite mutation (27/38 and the plasmid-mediated qnrB gene (13/38 were responsible for quinolone resistance. Repetitive-sequence-based PCR (REP-PCR fingerprinting of these MDR strains revealed the presence of five groups and sixteen patterns. The MDR strains from unrelated groups showed different drug resistance patterns; however, some homologous strains also showed different drug resistance profiles. Therefore, REP-PCR-based analyses can provide information to evaluate the epidemic status of nosocomial infection caused by MDR K. pneumoniae; however, this test lacks the power to discriminate some

  7. Investigation of 3′-debenzoyl-3′-(3-([124I]-iodobenzoyl))paclitaxel analog as a radio-tracer to study multidrug resistance in vivo

    International Nuclear Information System (INIS)

    Sajjad, M.; Riaz, U.; Yao, R.; Bernacki, R.J.; Abouzied, M.; Erb, D.A.; Chaudhary, N.D.; Veith, J.M.; Georg, G.I.; Nabi, H.A.

    2012-01-01

    A study was carried out to identify a suitable radioactive paclitaxel analog and to use it to investigate tumor multidrug resistance in vivo. 3′-Debenzoyl-3′-(3-([ 124 I]-iodobenzoyl))paclitaxel was prepared by aromatic iodination of 3′-debenzoyl-3′-(3-trimethylstannylbenzoyl)paclitaxel. Uptake of the labeled paclitaxel analog in nude mice bearing tumor with the paclitaxel sensitive cancer cell lines MCF7 and MDA-435/LCC6(WT), and multidrug resistant cell lines NCI/ADR-RES and MDA-435/LCC6(MDR), was studied. There was no difference in drug level between the sensitive and resistant MDA-435/LCC6 tumors at 6 h post-injection. However, at 6 h, there was a significant increase in drug level for the MCF7 tumor as compared with the NCI/ADR-RES tumor, presumably due to increased drug retention. At 24 h, drug uptake/retention was significantly higher in both sensitive tumor cell lines as compared to their drug resistant counterparts. Pretreatment of mice with MDR transport modulators, Cyclosporine or tRA 96029, did not increase the level of labeled paclitaxel analog in the drug resistant MDA-435/LCC6(MDR) tumor. On the other hand, at 24 h Cyclosporine apparently increased analog level in the drug sensitive MDA-435/LCC6(WT) tumor, aiding drug imaging studies. - Highlights: ► 3′-Debenzoyl-3′-(3-iodobenzoyl)paclitaxel cytotoxicity was comparable to paclitaxel. ► 3′-Debenzoyl-3′-(3-([ 124 I]-iodobenzoyl)paclitaxel was synthesized. ► Uptake of the drug was higher in sensitive tumor compared to the resistant tumor. ► The Pgp-modulators had a positive effect on drug-sensitive tumor. ► The sensitive tumor was visible in images obtained using micoPET.

  8. Double trouble: Prevalence and factors associated with tuberculosis and diabetes comorbidity in Bangladesh

    NARCIS (Netherlands)

    Sarker, M.; Barua, M.; Guerra, F.; Saha, A.; Aftab, A.; Latif, A.H.M.; Islam, S.; Islam, A.

    2016-01-01

    Background: Diabetes among tuberculosis patients increases the risk of tuberculosis treatment failure, death, and development of multidrug-resistant tuberculosis. Yet, there is no data is available in Bangladesh on the prevalence of diabetes among tuberculosis patients. The objective of the current

  9. Draft genome sequence of a multidrug-resistant Chryseobacterium indologenes isolate from Malaysia

    Directory of Open Access Journals (Sweden)

    Choo Yee Yu

    2016-03-01

    Full Text Available Chryseobacterium indologenes is an emerging pathogen which poses a threat in clinical healthcare setting due to its multidrug-resistant phenotype and its common association with nosocomial infections. Here, we report the draft genome of a multidrug-resistant C. indologenes CI_885 isolated in 2014 from Malaysia. The 908,704-kb genome harbors a repertoire of putative antibiotic resistance determinants which may elucidate the molecular basis and underlying mechanisms of its resistant to various classes of antibiotics. The genome sequence has been deposited in DDBJ/EMBL/GenBank under the accession number LJOD00000000. Keywords: Chryseobacterium indologenes, Genome, Multi-drug resistant, blaIND, Next generation sequencing

  10. The commensal infant gut meta-mobilome as a potential reservoir for persistent multidrug resistance integrons.

    Science.gov (United States)

    Ravi, Anuradha; Avershina, Ekaterina; Foley, Steven L; Ludvigsen, Jane; Storrø, Ola; Øien, Torbjørn; Johnsen, Roar; McCartney, Anne L; L'Abée-Lund, Trine M; Rudi, Knut

    2015-10-28

    Despite the accumulating knowledge on the development and establishment of the gut microbiota, its role as a reservoir for multidrug resistance is not well understood. This study investigated the prevalence and persistence patterns of an integrase gene (int1), used as a proxy for integrons (which often carry multiple antimicrobial resistance genes), in the fecal microbiota of 147 mothers and their children sampled longitudinally from birth to 2 years. The study showed the int1 gene was detected in 15% of the study population, and apparently more persistent than the microbial community structure itself. We found int1 to be persistent throughout the first two years of life, as well as between mothers and their 2-year-old children. Metagenome sequencing revealed integrons in the gut meta-mobilome that were associated with plasmids and multidrug resistance. In conclusion, the persistent nature of integrons in the infant gut microbiota makes it a potential reservoir of mobile multidrug resistance.

  11. Potential strategies for the eradication of multidrug-resistant Gram-negative bacterial infections.

    Science.gov (United States)

    Huwaitat, Rawan; McCloskey, Alice P; Gilmore, Brendan F; Laverty, Garry

    2016-07-01

    Antimicrobial resistance is one of the leading threats to society. The increasing burden of multidrug-resistant Gram-negative infection is particularly concerning as such bacteria are demonstrating resistance to nearly all currently licensed therapies. Various strategies have been hypothesized to treat multidrug-resistant Gram-negative infections including: targeting the Gram-negative outer membrane; neutralization of lipopolysaccharide; inhibition of bacterial efflux pumps and prevention of protein folding. Silver and silver nanoparticles, fusogenic liposomes and nanotubes are potential strategies for extending the activity of licensed, Gram-positive selective, antibiotics to Gram-negatives. This may serve as a strategy to fill the current void in pharmaceutical development in the short term. This review outlines the most promising strategies that could be implemented to solve the threat of multidrug-resistant Gram-negative infections.

  12. CD44-engineered mesoporous silica nanoparticles for overcoming multidrug resistance in breast cancer

    International Nuclear Information System (INIS)

    Wang, Xin; Liu, Ying; Wang, Shouju; Shi, Donghong; Zhou, Xianguang; Wang, Chunyan; Wu, Jiang; Zeng, Zhiyong; Li, Yanjun; Sun, Jing; Wang, Jiandong; Zhang, Longjiang; Teng, Zhaogang; Lu, Guangming

    2015-01-01

    Graphical abstract: - Highlights: • CD44-engineered mesoporous silica nanoparticles are synthesized. • The mechanism of CD44-engineered mesoporous silica nanoparticles is revealed. • This new delivery system increased the drug accumulation in vitro and in vivo. • This new delivery system offers an effective approach to treat multidrug resistance. - Abstract: Multidrug resistance is a major impediment for the successful chemotherapy in breast cancer. CD44 is over-expressed in multidrug resistant human breast cancer cells. CD44 monoclonal antibody exhibits anticancer potential by inhibiting proliferation and regulating P-glycoprotein-mediated drug efflux activity in multidrug resistant cells. Thereby, CD44 monoclonal antibody in combination with chemotherapeutic drug might be result in enhancing chemosensitivity and overcoming multidrug resistance. The purpose of this study is to investigate the effects of the CD44 monoclonal antibody functionalized mesoporous silica nanoparticles containing doxorubicin on human breast resistant cancer MCF-7 cells. The data showed that CD44-modified mesoporous silica nanoparticles increased cytotoxicity and enhanced the downregulation of P-glycoprotein in comparison to CD44 antibody. Moreover, CD44-engineered mesoporous silica nanoparticles provided active target, which promoted more cellular uptake of DOX in the resistant cells and more retention of DOX in tumor tissues than unengineered counterpart. Animal studies of the resistant breast cancer xenografts demonstrated that CD44-engineered drug delivery system remarkably induced apoptosis and inhibited the tumor growth. Our results indicated that the CD44-engineered mesoporous silica nanoparticle-based drug delivery system offers an effective approach to overcome multidrug resistance in human breast cancer

  13. Hospital costs of nosocomial multi-drug resistant Pseudomonas aeruginosa acquisition

    Directory of Open Access Journals (Sweden)

    Morales Eva

    2012-05-01

    Full Text Available Abstract Background We aimed to assess the hospital economic costs of nosocomial multi-drug resistant Pseudomonas aeruginosa acquisition. Methods A retrospective study of all hospital admissions between January 1, 2005, and December 31, 2006 was carried out in a 420-bed, urban, tertiary-care teaching hospital in Barcelona (Spain. All patients with a first positive clinical culture for P. aeruginosa more than 48 h after admission were included. Patient and hospitalization characteristics were collected from hospital and microbiology laboratory computerized records. According to antibiotic susceptibility, isolates were classified as non-resistant, resistant and multi-drug resistant. Cost estimation was based on a full-costing cost accounting system and on the criteria of clinical Activity-Based Costing methods. Multivariate analyses were performed using generalized linear models of log-transformed costs. Results Cost estimations were available for 402 nosocomial incident P. aeruginosa positive cultures. Their distribution by antibiotic susceptibility pattern was 37.1% non-resistant, 29.6% resistant and 33.3% multi-drug resistant. The total mean economic cost per admission of patients with multi-drug resistant P. aeruginosa strains was higher than that for non-resistant strains (15,265 vs. 4,933 Euros. In multivariate analysis, resistant and multi-drug resistant strains were independently predictive of an increased hospital total cost in compared with non-resistant strains (the incremental increase in total hospital cost was more than 1.37-fold and 1.77-fold that for non-resistant strains, respectively. Conclusions P. aeruginosa multi-drug resistance independently predicted higher hospital costs with a more than 70% increase per admission compared with non-resistant strains. Prevention of the nosocomial emergence and spread of antimicrobial resistant microorganisms is essential to limit the strong economic impact.

  14. Hospital costs of nosocomial multi-drug resistant Pseudomonas aeruginosa acquisition.

    Science.gov (United States)

    Morales, Eva; Cots, Francesc; Sala, Maria; Comas, Mercè; Belvis, Francesc; Riu, Marta; Salvadó, Margarita; Grau, Santiago; Horcajada, Juan P; Montero, Maria Milagro; Castells, Xavier

    2012-05-23

    We aimed to assess the hospital economic costs of nosocomial multi-drug resistant Pseudomonas aeruginosa acquisition. A retrospective study of all hospital admissions between January 1, 2005, and December 31, 2006 was carried out in a 420-bed, urban, tertiary-care teaching hospital in Barcelona (Spain). All patients with a first positive clinical culture for P. aeruginosa more than 48 h after admission were included. Patient and hospitalization characteristics were collected from hospital and microbiology laboratory computerized records. According to antibiotic susceptibility, isolates were classified as non-resistant, resistant and multi-drug resistant. Cost estimation was based on a full-costing cost accounting system and on the criteria of clinical Activity-Based Costing methods. Multivariate analyses were performed using generalized linear models of log-transformed costs. Cost estimations were available for 402 nosocomial incident P. aeruginosa positive cultures. Their distribution by antibiotic susceptibility pattern was 37.1% non-resistant, 29.6% resistant and 33.3% multi-drug resistant. The total mean economic cost per admission of patients with multi-drug resistant P. aeruginosa strains was higher than that for non-resistant strains (15,265 vs. 4,933 Euros). In multivariate analysis, resistant and multi-drug resistant strains were independently predictive of an increased hospital total cost in compared with non-resistant strains (the incremental increase in total hospital cost was more than 1.37-fold and 1.77-fold that for non-resistant strains, respectively). P. aeruginosa multi-drug resistance independently predicted higher hospital costs with a more than 70% increase per admission compared with non-resistant strains. Prevention of the nosocomial emergence and spread of antimicrobial resistant microorganisms is essential to limit the strong economic impact.

  15. The emergence and outbreak of multidrug-resistant typhoid fever in China.

    Science.gov (United States)

    Yan, Meiying; Li, Xinlan; Liao, Qiaohong; Li, Fang; Zhang, Jing; Kan, Biao

    2016-06-22

    Typhoid fever remains a severe public health problem in developing countries. The emergence of resistant typhoid, particularly multidrug-resistant typhoid infections, highlights the necessity of monitoring the resistance characteristics of this invasive pathogen. In this study, we report a typhoid fever outbreak caused by multidrug-resistant Salmonella enterica serovar Typhi strains with an ACSSxtT pattern. Resistance genes conferring these phenotypes were harbored by a large conjugative plasmid, which increases the threat of Salmonella Typhi and thus requires close surveillance for dissemination of strains containing such genes.

  16. Multidrug resistance in Pseudomonas aeruginosa isolated from nosocomial respiratory and urinary infections in Aleppo, Syria.

    Science.gov (United States)

    Mahfoud, Maysa; Al Najjar, Mona; Hamzeh, Abdul Rezzak

    2015-02-19

    Pseudomonas aeruginosa represents a serious clinical challenge due to its frequent involvement in nosocomial infections and its tendency towards multidrug resistance. This study uncovered antibiotic susceptibility patterns in 177 isolates from inpatients in three key hospitals in Aleppo, the largest city in Syria. Exceptionally low susceptibility to most routinely used antibiotics was uncovered; resistance to ciprofloxacin and gentamicin was 64.9% and 70.3%, respectively. Contrarily, susceptibility to colistin was the highest (89.1%). Multidrug resistance was rife, found at a rate of 53.67% among studied P. aeruginosa isolates.

  17. Draft Genome Sequences of Six Multidrug-Resistant Clinical Strains of Acinetobacter baumannii, Isolated at Two Major Hospitals in Kuwait.

    Science.gov (United States)

    Nasser, Kother; Mustafa, Abu Salim; Khan, Mohd Wasif; Purohit, Prashant; Al-Obaid, Inaam; Dhar, Rita; Al-Fouzan, Wadha

    2018-04-19

    Acinetobacter baumannii is an important opportunistic pathogen in global health care settings. Its dissemination and multidrug resistance pose an issue with treatment and outbreak control. Here, we present draft genome assemblies of six multidrug-resistant clinical strains of A. baumannii isolated from patients admitted to one of two major hospitals in Kuwait. Copyright © 2018 Nasser et al.

  18. Tuberculosis relapse in Vietnam is significantly associated with Mycobacterium tuberculosis Beijing genotype infections

    NARCIS (Netherlands)

    Huyen, Mai N. T.; Buu, Tran N.; Tiemersma, Edine; Lan, Nguyen T. N.; Dung, Nguyen H.; Kremer, Kristin; Soolingen, Dick V.; Cobelens, Frank G. J.

    2013-01-01

    In Vietnam, the Mycobacterium tuberculosis Beijing genotype is associated with multi-drug resistance and is emerging. A possible explanation for this genotype's success is an increased rate of relapse. In a prospective cohort study, isolates from patients with smear-positive tuberculosis were

  19. Mycobacterium tuberculosis, Beijing genotype strains not associated with radiological presentation of pulmonary tuberculosis

    NARCIS (Netherlands)

    Borgdorff, Martien W.; van Deutekom, Henk; de Haas, Petra E. W.; Kremer, Kristin; van Soolingen, Dick

    2004-01-01

    Mycobacterium tuberculosis strains of the Beijing genotype have been involved in various outbreaks of multidrug-resistant tuberculosis. Some studies suggest that the infection with the Beijing genotype is associated with a different host immune response. Since this might also lead to a different

  20. The Reversal Effects of 3-Bromopyruvate on Multidrug Resistance In Vitro and In Vivo Derived from Human Breast MCF-7/ADR Cells

    OpenAIRE

    Wu, Long; Xu, Jun; Yuan, Weiqi; Wu, Baojian; Wang, Hao; Liu, Guangquan; Wang, Xiaoxiong; Du, Jun; Cai, Shaohui

    2014-01-01

    Purpose P-glycoprotein mediated efflux is one of the main mechanisms for multidrug resistance in cancers, and 3-Bromopyruvate acts as a promising multidrug resistance reversal compound in our study. To test the ability of 3-Bromopyruvate to overcome P-glycoprotein-mediated multidrug resistance and to explore its mechanisms of multidrug resistance reversal in MCF-7/ADR cells, we evaluate the in vitro and in vivo modulatory activity of this compound. Methods The in vitro and in vivo activity wa...

  1. Role of multidrug resistance protein (MRP) in glutathione S-conjugate transport in mammalian cells

    NARCIS (Netherlands)

    Müller, M.; de Vries, E. G.; Jansen, P. L.

    1996-01-01

    The human multidrug resistance protein (MRP), a 190-kDa member of the ABC-protein superfamily, is an ATP-dependent glutathione S-conjugate carrier (GS-X pump) and is present in membranes of many, if not all, cells. Overexpression of MRP in tumor cells contributes to resistance to natural product

  2. Role of multidrug resistance protein (MRP) in glutathione S-conjugate transport in mammalian cells

    NARCIS (Netherlands)

    Muller, M; deVries, EGE; Jansen, PLM

    1996-01-01

    The human multidrug resistance protein (MRP), a 190-kDa member of the ABC-protein superfamily, is an ATP-dependent glutathione S-conjugate carrier (GS-X pump) and is present in membranes of many, if not all, cells, Overexpression of MRP in tumor cells contributes to resistance to natural product

  3. Tigecycline use in two cases with multidrug-resistant Acinetobacter baumannii meningitis.

    Science.gov (United States)

    Tutuncu, E Ediz; Kuscu, Ferit; Gurbuz, Yunus; Ozturk, Baris; Haykir, Asli; Sencan, Irfan

    2010-09-01

    The treatment of post-surgical meningitis due to multidrug-resistant (MDR) Acinetobacter baumannii is a therapeutic dilemma. The cases of two patients with MDR A. baumannii meningitis secondary to surgical site infections, successfully treated with combination regimens including tigecycline, are presented. Copyright © 2009 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  4. The human multidrug resistance-associated protein MRP is a plasma membrane drug-efflux pump

    NARCIS (Netherlands)

    Zaman, G. J.; Flens, M. J.; van Leusden, M. R.; de Haas, M.; Mülder, H. S.; Lankelma, J.; Pinedo, H. M.; Scheper, R. J.; Baas, F.; Broxterman, H. J.

    1994-01-01

    The multidrug-resistance associated protein MRP is a 180- to 195-kDa membrane protein associated with resistance of human tumor cells to cytotoxic drugs. We have investigated how MRP confers drug resistance in SW-1573 human lung carcinoma cells by generating a subline stably transfected with an

  5. Multidrug resistance gene expression is controlled by steroid hormones in the secretory epithelium of the uterus

    NARCIS (Netherlands)

    Arceci, R. J.; Baas, F.; Raponi, R.; Horwitz, S. B.; Housman, D.; Croop, J. M.

    1990-01-01

    The multidrug resistance (mdr) gene family has been shown to encode a membrane glycoprotein, termed the P-glycoprotein, which functions as a drug efflux pump with broad substrate specificity. This multigene family is expressed in a tissue-specific fashion in a wide variety of normal and neoplastic

  6. Antibacterial activities of ethanol extracts of Philippine medicinal plants against multidrug-resistant bacteria

    Directory of Open Access Journals (Sweden)

    Demetrio L. Valle Jr.

    2015-07-01

    Conclusions: P. betle had the greatest potential value against both Gram-negative and Gram-positive multidrug-resistant bacteria. Favorable antagonistic activities were also exhibited by the ethanol extracts of Psidium guajava, Phyllanthus niruri and Ehretia microphylla.

  7. Vital and dispensable roles of Plasmodium multidrug resistance transporters during blood- and mosquito-stage development

    NARCIS (Netherlands)

    Rijpma, S.R.; Velden, M. van der; Annoura, T.; Matz, J.M.; Kenthirapalan, S.; Kooij, T.W.; Matuschewski, K.; Gemert, G.J.A. van; Vegte-Bolmer, M.G. van de; Siebelink-Stoter, R.; Graumans, W.; Ramesar, J.; Klop, O.; Russel, F.G.; Sauerwein, R.W.; Janse, C.J.; Franke-Fayard, B.M.; Koenderink, J.B.

    2016-01-01

    Multidrug resistance (MDR) proteins belong to the B subfamily of the ATP Binding Cassette (ABC) transporters, which export a wide range of compounds including pharmaceuticals. In this study, we used reverse genetics to study the role of all seven Plasmodium MDR proteins during the life cycle of

  8. Multidrug-Resistant Bacteroides fragilis Bacteremia in a US Resident: An Emerging Challenge

    Directory of Open Access Journals (Sweden)

    Cristian Merchan

    2016-01-01

    Full Text Available We describe a case of Bacteroides fragilis bacteremia associated with paraspinal and psoas abscesses in the United States. Resistance to b-lactam/b-lactamase inhibitors, carbapenems, and metronidazole was encountered despite having a recent travel history to India as the only possible risk factor for multidrug resistance. Microbiological cure was achieved with linezolid, moxifloxacin, and cefoxitin.

  9. Physiological characterisation of the efflux pump system of antibiotic-susceptible and multidrug-resistant

    OpenAIRE

    Martins , A.; Spengler , G.; Martins , M.; Rodrigues , L.; Viveiros , M.; Davin-Regli , A.; Chevalier , J.; Couto , I.; Pagès , J.M.; Amaral , L.

    2010-01-01

    Abstract Enterobacter aerogenes predominates among Enterobacteriaceae species that are increasingly reported as producers of extended-spectrum ?-lactamases. Although this mechanism of resistance to ?-lactams is important, other mechanisms bestowing a multidrug-resistant (MDR) phenotype in this species are now well documented. Among these mechanisms is the overexpression of efflux pumps that extrude structurally unrelated antibiotics prior to their reaching their targets. Interestin...

  10. Antifolate resistance mediated by the multidrug resistance proteins MRP1 and MRP2

    NARCIS (Netherlands)

    Hooijberg, J. H.; Broxterman, H. J.; Kool, M.; Assaraf, Y. G.; Peters, G. J.; Noordhuis, P.; Scheper, R. J.; Borst, P.; Pinedo, H. M.; Jansen, G.

    1999-01-01

    Transfection of multidrug resistance proteins (MRPs) MRP1 and MRP2 in human ovarian carcinoma 2008 cells conferred a marked level of resistance to short-term (1-4 h) exposure to the polyglutamatable antifolates methotrexate (MTX; 21-74-fold), ZD1694 (4-138-fold), and GW1843 (101-156-fold). Evidence

  11. Fecal Microbiota Transplantation Inhibits Multidrug-Resistant Gut Pathogens: Preliminary Report Performed in an Immunocompromised Host.

    Science.gov (United States)

    Biliński, Jarosław; Grzesiowski, Paweł; Muszyński, Jacek; Wróblewska, Marta; Mądry, Krzysztof; Robak, Katarzyna; Dzieciątkowski, Tomasz; Wiktor-Jedrzejczak, Wiesław; Basak, Grzegorz W

    2016-06-01

    Colonization of the gastrointestinal tract with multidrug-resistant (MDR) bacteria is a consequence of gut dysbiosis. We describe the successful utilization of fecal microbiota transplantation to inhibit Klebsiella pneumoniae MBL(+) and Escherichia coli ESBL(+) gut colonization in the immunocompromised host as a novel tool in the battle against MDR microorganisms. ClinicalTrials.gov identifier NCT02461199.

  12. Synthesis, Antiproliferative, and Multidrug Resistance Reversal Activities of Heterocyclic α,β-Unsaturated Carbonyl Compounds.

    Science.gov (United States)

    Sun, Ju-Feng; Hou, Gui-Ge; Zhao, Feng; Cong, Wei; Li, Hong-Juan; Liu, Wen-Shuai; Wang, Chunhua

    2016-10-01

    A series of heterocyclic α,β-unsaturated carbonyl compounds (1a-1d, 2a-2d, 3a-3d, 4a-3d, and 5a-5d) with 1,5-diaryl-3-oxo-1,4-pentadienyl pharmacophore were synthesized for the development of anticancer and multidrug resistance reverting agents. The antiproliferative activities were tested against nine human cancer cell lines. Approximately 73% of the IC50 values were below 5 μm, while 35% of these figures were submicromolar, and compounds 3a-3d with 4-trifluoro methyl in the arylidene benzene rings were the most potent, since their IC50 values are between 0.06 and 3.09 μm against all cancer cell lines employed. Meanwhile, their multidrug resistance reversal properties and cellular uptake were further examined. The data displayed that all of these compounds could reverse multidrug resistance, particularly, compounds 3a and 4a demonstrated both potent multidrug resistance reverting properties and strong antiproliferative activities, which can be taken as leading molecules for further research of dual effect agents in tumor chemotherapy. © 2016 John Wiley & Sons A/S.

  13. Isolation and characterization of antimicrobial compounds in plant extracts against multidrug-resistant Acinetobacter baumannii.

    Directory of Open Access Journals (Sweden)

    Yoko Miyasaki

    Full Text Available The number of fully active antibiotic options that treat nosocomial infections due to multidrug-resistant Acinetobacter baumannii (A. baumannii is extremely limited. Magnolia officinalis, Mahonia bealei, Rabdosia rubescens, Rosa rugosa, Rubus chingii, Scutellaria baicalensis, and Terminalia chebula plant extracts were previously shown to have growth inhibitory activity against a multidrug-resistant clinical strain of A. baumannii. In this study, the compounds responsible for their antimicrobial activity were identified by fractionating each plant extract using high performance liquid chromatography, and determining the antimicrobial activity of each fraction against A. baumannii. The chemical structures of the fractions inhibiting >40% of the bacterial growth were elucidated by liquid chromatography/mass spectrometry analysis and nuclear magnetic resonance spectroscopy. The six most active compounds were identified as: ellagic acid in Rosa rugosa; norwogonin in Scutellaria baicalensis; and chebulagic acid, chebulinic acid, corilagin, and terchebulin in Terminalia chebula. The most potent compound was identified as norwogonin with a minimum inhibitory concentration of 128 µg/mL, and minimum bactericidal concentration of 256 µg/mL against clinically relevant strains of A. baumannii. Combination studies of norwogonin with ten anti-Gram negative bacterial agents demonstrated that norwogonin did not enhance the antimicrobial activity of the synthetic antibiotics chosen for this study. In conclusion, of all identified antimicrobial compounds, norwogonin was the most potent against multidrug-resistant A. baumannii strains. Further studies are warranted to ascertain the prophylactic and therapeutic potential of norwogonin for infections due to multidrug-resistant A. baumannii.

  14. Geraniol Restores Antibiotic Activities against Multidrug-Resistant Isolates from Gram-Negative Species▿ †

    Science.gov (United States)

    Lorenzi, Vannina; Muselli, Alain; Bernardini, Antoine François; Berti, Liliane; Pagès, Jean-Marie; Amaral, Leonard; Bolla, Jean-Michel

    2009-01-01

    The essential oil of Helichrysum italicum significantly reduces the multidrug resistance of Enterobacter aerogenes, Escherichia coli, Pseudomonas aeruginosa, and Acinetobacter baumannii. Combinations of the two most active fractions of the essential oil with each other or with phenylalanine arginine β-naphthylamide yield synergistic activity. Geraniol, a component of one fraction, significantly increased the efficacy of β-lactams, quinolones, and chloramphenicol. PMID:19258278

  15. Distribution and physiology of ABC-Type transporters contributing to multidrug resistance in bacteria

    NARCIS (Netherlands)

    Lubelski, Jacek; Konings, Wil N.; Driessen, Arnold J. M.

    Membrane proteins responsible for the active efflux of structurally and functionally unrelated drugs were first characterized in higher eukalyotes. To date, a vast number of transporters contributing to multidrug resistance (MDR transporters) have been reported for a large variety of organisms.

  16. Prevalence of multidrug resistant pathogens in children with urinary tract infection: a retrospective analysis

    Directory of Open Access Journals (Sweden)

    Srinivasan S, Madhusudhan NS

    2014-11-01

    Full Text Available Urinary tract infection (UTI is one of the commonest medical problems in children. It can distress the child and may cause kidney damage. Prompt diagnosis and effective treatment can prevent complications in the child. But treatment of UTI in children has now become a challenge due to the emergence of multidrug resistant bacteria. Aims & Objectives: To know the bacteriological profile and susceptibility pattern of urinary tract infections in children and to know the prevalence of multidrug resistant uropathogens. Materials & Methods: A retrospective analysis was done on all paediatric urine samples for a period of one year. A total of 1581 samples were included in the study. Antimicrobial susceptibility testing was done on samples showing significant growth by Kirby-Bauer disc diffusion method. Statistical analysis: Prevalence and pattern were analyzed using proportions and percentages. Results: E.coli was the most predominant organism (56% causing UTI in children followed by Klebsiella sp (17%. Fifty three percent of gram negative organisms isolated from children were found to be multidrug resistant. Majority of E. coli isolates were found to be highly resistant to Ampicillin (91% and Cotrimoxazole (82% and highly sensitive to Imipenem (99% and Amikacin (93%. Conclusion: Paediatric UTI was common in children less than 5 years of age. Gram negative bacteria (E. coli and Klebsiella sp were more common than gram positive bacteria. Our study revealed that multidrug resistance was higher in E.coli.

  17. Surgical aspects of pulmonary tuberculosis: an update.

    Science.gov (United States)

    Dewan, Ravindra Kumar; Pezzella, A Thomas

    2016-10-01

    Tuberculosis remains a major global medical challenge and concern. In the world's population of over 7.4 billion people, 8.6 million are estimated to be infected with Mycobacterium tuberculosis; another 2.2 billion have latent tuberculosis. There is an annual incidence of 16,000 new cases in the USA and 7-8 million new cases worldwide, of which 440,000 are multidrug-resistant or extensively multidrug-resistant, mainly in developing countries or emerging economies. According to the World Health Organization, the incidence of tuberculosis is 133 cases per 100,000 of the population; 3.3% new cases are drug resistant and 20% are already treated cases. Of the drug-resistant cases, 9.7% are extensively drug-resistant. The annual global mortality attributable to tuberculosis is over 1.3 million people. The association with HIV/AIDS in 430,000 people has compounded the global concern and challenge. This review presents the historical indications for surgical treatment of tuberculosis, reviews the current literature and clinical experience, and collates this into increased awareness and contemporary understanding of the indications and need for surgery in primary active tuberculosis, adjuvant surgical therapy for multidrug-resistant tuberculosis, and the complications of chronic tuberculosis sequelae or previous tuberculosis surgery. © The Author(s) 2016.

  18. Treatment of Multidrug-Resistant Leukemia Cells by Novel Artemisinin-, Egonol-, and Thymoquinone-Derived Hybrid Compounds

    Directory of Open Access Journals (Sweden)

    Lisa Gruber

    2018-04-01

    Full Text Available Two major obstacles for successful cancer treatment are the toxicity of cytostatics and the development of drug resistance in cancer cells during chemotherapy. Acquired or intrinsic drug resistance is responsible for almost 90% of treatment failure. For this reason, there is an urgent need for new anticancer drugs with improved efficacy against cancer cells, and with less toxicity on normal cells. There are impressive examples demonstrating the success of natural plant compounds to fight cancer, such as Vinca alkaloids, taxanes, and anthracyclines. Artesunic acid (ARTA, a drug for malaria treatment, also exerts cytotoxic activity towards cancer cells. Multidrug resistance often results from drug efflux pumps (ABC-transporters that reduce intracellular drug levels. Hence, it would be interesting to know, whether ARTA could overcome drug resistance of tumor cells, and in what way ABC-transporters are involved. Different derivatives showing improved features concerning cytotoxicity and pharmacokinetic behavior have been developed. Considering both drug sensitivity and resistance, we chose a sensitive and a doxorubicin-resistant leukemia cell line and determined the killing effect of ARTA on these cells. Molecular docking and doxorubicin efflux assays were performed to investigate the interaction of the derivatives with P-glycoprotein. Using single-cell gel electrophoresis (alkaline comet assay, we showed that the derivatives of ARTA induce DNA breakage and accordingly programmed cell death, which represents a promising strategy in cancer treatment. ARTA activated apoptosis in cancer cells by the iron-mediated generation of reactive oxygen species (ROS. In conclusion, ARTA derivatives may bear the potential to be further developed as anticancer drugs.

  19. Intraventricular ciprofloxacin usage in treatment of multidrug-resistant central nervous system infections: report of four cases

    Directory of Open Access Journals (Sweden)

    Ayse Karaaslan

    2014-12-01

    Full Text Available In recent years, multidrug-resistant microorganisms appear as important nosocomial pathogens which treatment is quite difficult. As sufficient drug levels could not be achieved in cerebrospinal fluid during intravenous antibiotic therapy for central nervous system infections and due to multidrug-resistance treatment alternatives are limited. In this study, four cases of central nervous system infections due to multidrug-resistant microorganisms who were successfully treated with removal of the devices and intraventricular ciprofloxacin are presented. In conclusion, intraventricular ciprofloxacin can be used for treatment of central nervous system infections if the causative microorganism is sensitive to the drug and no other alternative therapy is available.

  20. Trends of anti-tuberculosis drug resistance pattern in new cases and previously treated cases of extrapulmonary tuberculosis cases in referral hospitals in northern India

    Directory of Open Access Journals (Sweden)

    A K Maurya

    2012-01-01

    Full Text Available Background: Drug-resistant tuberculosis is one of major current challenges to global public health. The transmission of resistant strains is increasing as a burden of multidrug-resistant tuberculosis (MDR-TB patients in extra pulmonary tuberculosis (EPTB cases in India. Aim and Objectives: The aim was to study trends of anti-tuberculosis drug resistance pattern in new cases and previously treated cases of EPTB in referral hospitals in northern India. Study Design and Setting: A prospectively observational study and referral medical institutions in northern India. Materials and Methods: All EPTB specimens were processed for Ziehl Neelsen staining, BACTEC culture and BACTEC NAP test for Mycobacterium tuberculosis complex. All M. tuberculosis complex isolates were performed for radiometric-based drug susceptibility pattern against streptomycin, isoniazid, rifampicin and ethambutol using the 1% proportion method. Results: We found that 165/756 (20.5% isolates were identified as M. tuberculosis complex by the NAP test. We observed that 39.9% were resistant to first-line antitubercular drugs. The resistance rate was higher in previously treated patients: H (30.3%, R (16.3%, E (15.7% and S (16.3%. MDR-TB was observed in 13.4%, but, in new cases, this was 11.4% and 19.1% of the previously treated patients (P<0.05. Conclusion: MDR-TB is gradually increased in EPTB cases and predominant resistance to previous treated cases of EPTB. The molecular drug sensitivity test (DST method can be an early decision for chemotherapy in MDR-TB patients. The International Standards of TB Care need to be used by the RNTCP and professional medical associations as a tool to improve TB care in the country.

  1. Drug Susceptibility of Mycobacterium tuberculosis Beijing Genotype and Association with MDR TB

    Science.gov (United States)

    ten Kate, Marian T.; de Knegt, Gerjo J.; Kremer, Kristin; Aarnoutse, Rob E.; Boeree, Martin J.; Verbrugh, Henri A.; van Soolingen, Dick; Bakker-Woudenberg, Irma A.J.M.

    2012-01-01

    To determine differences in the ability of Mycobacterium tuberculosis strains to withstand antituberculosis drug treatment, we compared the activity of antituberculosis drugs against susceptible Beijing and East-African/Indian genotype M. tuberculosis strains. Beijing genotype strains showed high rates of mutation within a wide range of drug concentrations, possibly explaining this genotype’s association with multidrug-resistant tuberculosis. PMID:22469099

  2. Mycobacterial diversity causing multi- and extensively drug-resistant tuberculosis in Djibouti, Horn of Africa.

    Science.gov (United States)

    Millán-Lou, M I; Ollé-Goig, J E; Tortola, M T; Martin, C; Samper, S

    2016-02-01

    On detecting a high prevalence of multidrug-resistant tuberculosis (TB) in Djibouti, 32 Mycobacterium tuberculosis isolates of patients hospitalised in the TB referral centre of the capital were genotyped. A high variety of M. tuberculosis lineages, including lineage 1, Indo-Oceanic, lineage 2, East-Asian, lineage 3, East-African Indian and lineage 4, Euro-American, were detected.

  3. Prevalence of drug resistant tuberculosis in Arsi Zone, Ethiopia ...

    African Journals Online (AJOL)

    Background: Wide spread of occurrence of multi-drug resistance tuberculosis is becoming a major challenge to effective tuberculosis control. Thus, it is imperative to monitor the sensitivity of anti-TB drugs regularly. Objective: To determine the prevalence resistance to anti-TB drugs in a well established control program area ...

  4. Community-acquired multidrug-resistant Gram-negative bacterial infective endocarditis.

    Science.gov (United States)

    Naha, Sowjanya; Naha, Kushal; Acharya, Vasudev; Hande, H Manjunath; Vivek, G

    2014-08-05

    We describe two cases of bacterial endocarditis secondary to multidrug-resistant Gram-negative organisms. In both cases, the diagnosis was made in accordance with the modified Duke's criteria and confirmed by histopathological analysis. Furthermore, in both instances there were no identifiable sources of bacteraemia and no history of contact with hospital or other medical services prior to the onset of symptoms. The patients were managed in similar fashion with prolonged broad-spectrum antibiotic therapy and surgical intervention and made complete recoveries. These cases highlight Gram-negative organisms as potential agents for endocarditis, as well as expose the dissemination of such multidrug-resistant bacteria into the community. The application of an integrated medical and surgical approach and therapeutic dilemmas encountered in managing these cases are described. 2014 BMJ Publishing Group Ltd.

  5. [Antimicrobial therapy in severe infections with multidrug-resistant Gram-negative bacterias].

    Science.gov (United States)

    Duszyńska, Wiesława

    2010-01-01

    Multidrug-resistant Gram-negative bacteria pose a serious and rapidly emerging threat to patients in healthcare settings, and are especially prevalent and problematic in intensive therapy units. Recently, the emergence of pandrug-resistance in Gram-negative bacteria poses additional concerns. This review examines the clinical impact and epidemiology of multidrug-resistant Gram-negative bacteria as a cause of increased morbidity and mortality among ITU patients. Beta-lactamases, cephalosporinases and carbapenemases play the most important role in resistance to antibiotics. Despite the tendency to increased resistance, carbapenems administered by continuous infusion remain the most effective drugs in severe sepsis. Drug concentration monitoring, albeit rarely used in practice, is necessary to ensure an effective therapeutic effect.

  6. Characterization of putative multidrug resistance transporters of the major facilitator-superfamily expressed in Salmonella Typhi

    DEFF Research Database (Denmark)

    Shaheen, Aqsa; Ismat, Fouzia; Iqbal, Mazhar

    2015-01-01

    Multidrug resistance mediated by efflux pumps is a well-known phenomenon in infectious bacteria. Although much work has been carried out to characterize multidrug efflux pumps in Gram-negative and Gram-positive bacteria, such information is still lacking for many deadly pathogens. The aim...... of this study was to gain insight into the substrate specificity of previously uncharacterized transporters of Salmonella Typhi to identify their role in the development of multidrug resistance. S. Typhi genes encoding putative members of the major facilitator superfamily were cloned and expressed in the drug......-hypersensitive Escherichia coli strain KAM42, and tested for transport of 25 antibacterial compounds, including representative antibiotics of various classes, antiseptics, dyes and detergents. Of the 15 tested putative transporters, STY0901, STY2458 and STY4874 exhibited a drug-resistance phenotype. Among these, STY4874...

  7. Surveillance of multidrug resistant suppurative infection causing bacteria in hospitalized patients in an Indian tertiary care hospital

    Directory of Open Access Journals (Sweden)

    Nabakishore Nayak

    2014-01-01

    Conclusions: Of these S. aureus, particularly the methicillin resistant strain predominates, followed by strains of S. pyogenes and P. aeruginosa that were in the higher proportions of multidrug resistance.

  8. Andrographolide: A potent antituberculosis compound that targets Aminoglycoside 2'-N-acetyltransferase in Mycobacterium tuberculosis.

    Science.gov (United States)

    Prabu, Amudha; Hassan, Sameer; Prabuseenivasan; Shainaba, A S; Hanna, L E; Kumar, Vanaja

    2015-09-01

    Tuberculosis (TB) still remains a major challenging infectious disease. The increased rate of emergence of multi-drug resistant and extensively-drug resistant strains of the organism has further complicated the situation, resulting in an urgent need for new anti-TB drugs. Antimycobacterial activity of Andrographis paniculata was evaluated using a rapid LRP assay and the probable targets were identified by docking analysis. The methanolic extract of A. paniculata showed maximum antimycobacterial activity at 250μg/ml against all the tested strains of M. tuberculosis (H37Rv, MDR, and drug sensitive). Based on bioassay guided fractionation, andrographolide was identified as the potent molecule. With the docking analysis, both ICDH (Isocitrate Dehydrogenase) and AAC (Aminoglycoside 2'-N-acetyltransferase) were predicted as targets of andrographolide in M. tuberculosis. Molecular simulation revealed that, ICDH showed low binding affinity to andrographolide. However, for AAC, the andrographolide was observed to be well within the active site after 10ns of molecular simulation. This suggests that ACC (PDB ID 1M4I) could be the probable target for andrographolide. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Development of novel strategies to combat multidrug resistance mediated by efflux transporters and intracellular bacteria

    OpenAIRE

    Kuriakose, Jerrin

    2014-01-01

    Multidrug resistance (MDR) is the condition where cancer cells or microorganisms cease to respond to multiple drugs. MDR conferred by efflux transporters, that deprive the bioavailability of drugs at their site of action, are a threat to cancer and malarial chemotherapy. Specifically, the mammalian ABC transporter Pglycoprotein (P-gp) has undermined many drugs in treatment of cancer and other disease states. Mutations in the parasitic transporter Plasmodium falciparum chloroquine resistance t...

  10. Multidrug-resistant Bacteroides fragilis group on the rise in Europe?

    DEFF Research Database (Denmark)

    Hartmeyer, G N; Sóki, J; Nagy, E

    2012-01-01

    We report a case of multidrug-resistance (MDR) in a strain of Bacteroides fragilis from a blood culture and abdominal fluid in a Danish patient. The patient had not been travelling for several years and had not received antibiotics prior to the present case. We also summarize the cases that have...... been reported to date of MDR B. fragilis group in Europe. As far as we know, a case like this with MDR B. fragilis has not been described in Scandinavia before....

  11. Multidrug-Resistant Candida haemulonii and C. auris, Tel Aviv, Israel

    OpenAIRE

    Ben-Ami, Ronen; Berman, Judith; Novikov, Ana; Bash, Edna; Shachor-Meyouhas, Yael; Zakin, Shiri; Maor, Yasmin; Tarabia, Jalal; Schechner, Vered; Adler, Amos; Finn, Talya

    2017-01-01

    Candida auris and C. haemulonii are closely related, multidrug-resistant emerging fungal pathogens that are not readily distinguishable with phenotypic assays. We studied C. auris and C. haemulonii clinical isolates from 2 hospitals in central Israel. C. auris was isolated in 5 patients with nosocomial bloodstream infection, and C. haemulonii was found as a colonizer of leg wounds at a peripheral vascular disease clinic. Liberal use of topical miconazole and close contact among patients were ...

  12. Inhibition of bacterial multidrug resistance by celecoxib, a cyclooxygenase-2 inhibitor.

    Science.gov (United States)

    Kalle, Arunasree M; Rizvi, Arshad

    2011-01-01

    Multidrug resistance (MDR) is a major problem in the treatment of infectious diseases and cancer. Accumulating evidence suggests that the cyclooxygenase-2 (COX-2)-specific inhibitor celecoxib would not only inhibit COX-2 but also help in the reversal of drug resistance in cancers by inhibiting the MDR1 efflux pump. Here, we demonstrate that celecoxib increases the sensitivity of bacteria to the antibiotics ampicillin, kanamycin, chloramphenicol, and ciprofloxacin by accumulating the drugs inside the cell, thus reversing MDR in bacteria.

  13. Survival and evolution of a large multidrug resistance plasmid in new clinical bacterial hosts

    DEFF Research Database (Denmark)

    Porse, Andreas; Schønning, Kristian; Munck, Christian

    2016-01-01

    sequencing to show that the long-term persistence and molecular integrity of the plasmid is highly influenced by multiple factors within a 25 kb plasmid region constituting a host-dependent burden. In the E. coli hosts investigated here, improved plasmid stability readily evolves via IS26 mediated deletions...... consistently followed by all evolved E. coli lineages exposes a trade-off between horizontal and vertical transmission that may ultimately limit the dissemination potential of clinical multidrug resistance plasmids in these hosts....

  14. Photochemical internalisation of chemotherapy potentiates killing of multidrug-resistant breast and bladder cancer cells

    OpenAIRE

    Adigbli, D. K.; Wilson, D. G. G.; Farooqui, N.; Sousi, E.; Risley, P.; Taylor, I.; MacRobert, A. J.; Loizidou, M.

    2007-01-01

    Multidrug resistance (MDR) is the major confounding factor in adjuvant solid tumour chemotherapy. Increasing intracellular amounts of chemotherapeutics to circumvent MDR may be achieved by a novel delivery method, photochemical internalisation (PCI). PCI consists of the co-administration of drug and photosensitiser; upon light activation the latter induces intracellular release of organelle-bound drug. We investigated whether co-administration of hypericin ( photosensitiser) with mitoxantrone...

  15. Photochemical internalisation of chemotherapy potentiates killing of multidrug-resistant breast and bladder cancer cells

    OpenAIRE

    Adigbli, D K; Wilson, D G G; Farooqui, N; Sousi, E; Risley, P; Taylor, I; MacRobert, A J; Loizidou, M

    2007-01-01

    Multidrug resistance (MDR) is the major confounding factor in adjuvant solid tumour chemotherapy. Increasing intracellular amounts of chemotherapeutics to circumvent MDR may be achieved by a novel delivery method, photochemical internalisation (PCI). PCI consists of the co-administration of drug and photosensitiser; upon light activation the latter induces intracellular release of organelle-bound drug. We investigated whether co-administration of hypericin (photosensitiser) with mitoxantrone ...

  16. Priorities in the prevention and control of multidrug-resistant Enterobacteriaceae in hospitals.

    LENUS (Irish Health Repository)

    Khan, A S

    2012-10-01

    Multidrug-resistant Enterobacteriaceae (MDE) are a major public health threat due to international spread and few options for treatment. Furthermore, unlike meticillin-resistant Staphylococcus aureus (MRSA), MDE encompass several genera and multiple resistance mechanisms, including extended-spectrum beta-lactamases and carbapenemases, which complicate detection in the routine diagnostic laboratory. Current measures to contain spread in many hospitals are somewhat ad hoc as there are no formal national or international guidelines.

  17. Influence of multidrug resistance on 18F-FCH cellular uptake in a glioblastoma model

    International Nuclear Information System (INIS)

    Vanpouille, Claire; Jeune, Nathalie le; Clotagatide, Anthony; Dubois, Francis; Kryza, David; Janier, Marc; Perek, Nathalie

    2009-01-01

    Multidrug resistance, aggressiveness and accelerated choline metabolism are hallmarks of malignancy and have motivated the development of new PET tracers like 18 F-FCH, an analogue of choline. Our aim was to study the relationship of multidrug resistance of cultured glioma cell lines and 18 F-FCH tracer uptake. We used an in vitro multidrug-resistant (MDR) glioma model composed of sensitive parental U87MG and derived resistant cells U87MG-CIS and U87MG-DOX. Aggressiveness, choline metabolism and transport were studied, particularly the expression of choline kinase (CK) and high-affinity choline transporter (CHT1). FCH transport studies were assessed in our glioblastoma model. As expected, the resistant cell lines express P-glycoprotein (Pgp), multidrug resistance-associated protein isoform 1 (MRP1) and elevated glutathione (GSH) content and are also more mobile and more invasive than the sensitive U87MG cells. Our results show an overexpression of CK and CHT1 in the resistant cell lines compared to the sensitive cell lines. We found an increased uptake of FCH (in % of uptake per 200,000 cells) in the resistant cells compared to the sensitive ones (U87MG: 0.89±0.14; U87MG-CIS: 1.27±0.18; U87MG-DOX: 1.33±0.13) in line with accelerated choline metabolism and aggressive phenotype. FCH uptake is not influenced by the two ATP-dependant efflux pumps: Pgp and MRP1. FCH would be an interesting probe for glioma imaging which would not be effluxed from the resistant cells by the classic MDR ABC transporters. Our results clearly show that FCH uptake reflects accelerated choline metabolism and is related to tumour aggressiveness and drug resistance. (orig.)

  18. A case of acute postoperative keratitis after deep anterior lamellar keratoplasty by multidrug resistant Klebsiella

    Directory of Open Access Journals (Sweden)

    Leena Bajracharya

    2015-01-01

    Full Text Available A healthy lady of 42 years underwent deep anterior lamellar keratoplasty for granular dystrophy. The very next day, it was complicated by development of infectious keratitis. The organism was identified as multidrug resistant Klebsiella pneumoniae. Donor corneal button may be implicated in the transmission of infection in an otherwise uneventful surgery and follow-up. Nosocomial infections are usually severe, rapidly progressive and difficult to treat. Finally, the lady had to undergo therapeutic penetrating keratoplasty for complete resolution of infection.

  19. The commensal infant gut meta-mobilome as a potential reservoir for persistent multidrug resistance integrons

    OpenAIRE

    Anuradha Ravi; Ekaterina Avershina; Steven L. Foley; Jane Ludvigsen; Ola Storrø; Torbjørn Øien; Roar Johnsen; Anne L. McCartney; Trine M. L’Abée-Lund; Knut Rudi

    2015-01-01

    Despite the accumulating knowledge on the development and establishment of the gut microbiota, its role as a reservoir for multidrug resistance is not well understood. This study investigated the prevalence and persistence patterns of an integrase gene (int1), used as a proxy for integrons (which often carry multiple antimicrobial resistance genes), in the fecal microbiota of 147 mothers and their children sampled longitudinally from birth to 2 years. The study showed the int1 gene was detect...

  20. Polymorphisms in Plasmodium falciparum chloroquine resistance transporter and multidrug resistance 1 genes

    DEFF Research Database (Denmark)

    Venkatesan, Meera; Gadalla, Nahla B; Stepniewska, Kasia

    2014-01-01

    Adequate clinical and parasitologic cure by artemisinin combination therapies relies on the artemisinin component and the partner drug. Polymorphisms in the Plasmodium falciparum chloroquine resistance transporter (pfcrt) and P. falciparum multidrug resistance 1 (pfmdr1) genes are associated...... with decreased sensitivity to amodiaquine and lumefantrine, but effects of these polymorphisms on therapeutic responses to artesunate-amodiaquine (ASAQ) and artemether-lumefantrine (AL) have not been clearly defined. Individual patient data from 31 clinical trials were harmonized and pooled by using standardized...

  1. Synthesis of multidrug resistance modulator LY335979 labeled with deuterium and tritium

    International Nuclear Information System (INIS)

    Czeskis, B.A.

    1997-01-01

    DIDEUTERO AND DITRITIOISOTOPOMERS OF THE MULTIDRUG RESISTANCE MODULATOR LY335979 WERE PREPARED BY INITIAL BROMINATION OF 5-HYDROXYQUINOLINE UNDER ACIDIC CONDITIONS FOLLOWED BY MITSUNOBU COUPLING OF 6,8-DIBROMO-5-HYDROXYQUINOLINE WITH (S)-GLYCIDOL. OPENING OF THE RESULTING EPOXIDE WITH DIBENZOSUBERYLPIPERAZINE LY335995 RESULTED IN DIBROMOANALOG OF LY335979, WHICH WAS FINALLY REDUCTIVELY DEBROMINATED WITH DEUTERIUM OR TRITIUM IN THE PRESENCE OF PALLADIUM ON CARBON. (AUTHOR)

  2. Individualizing Risk of Multidrug-Resistant Pathogens in Community-Onset Pneumonia

    OpenAIRE

    Falcone, Marco; Russo, Alessandro; Giannella, Maddalena; Cangemi, Roberto; Scarpellini, Maria Gabriella; Bertazzoni, Giuliano; Alarc?n, Jos? Mart?nez; Taliani, Gloria; Palange, Paolo; Farcomeni, Alessio; Vestri, Annarita; Bouza, Emilio; Violi, Francesco; Venditti, Mario

    2015-01-01

    Introduction The diffusion of multidrug-resistant (MDR) bacteria has created the need to identify risk factors for acquiring resistant pathogens in patients living in the community. Objective To analyze clinical features of patients with community-onset pneumonia due to MDR pathogens, to evaluate performance of existing scoring tools and to develop a bedside risk score for an early identification of these patients in the Emergency Department. Patients and Methods This was an open, observation...

  3. Molecular characterization of multidrug-resistant Shigella spp. of food origin.

    Science.gov (United States)

    Ahmed, Ashraf M; Shimamoto, Tadashi

    2015-02-02

    Shigella spp. are the causative agents of food-borne shigellosis, an acute enteric infection. The emergence of multidrug-resistant clinical isolates of Shigella presents an increasing challenge for clinicians in the treatment of shigellosis. Several studies worldwide have characterized the molecular basis of antibiotic resistance in clinical Shigella isolates of human origin, however, to date, no such characterization has been reported for Shigella spp. of food origin. In this study, we characterized the genetic basis of multidrug resistance in Shigella spp. isolated from 1600 food samples (800 meat products and 800 dairy products) collected from different street venders, butchers, retail markets, and slaughterhouses in Egypt. Twenty-four out of 27 Shigella isolates (88.9%) showed multidrug resistance phenotypes to at least three classes of antimicrobials. The multidrug-resistant Shigella spp. were as follows: Shigella flexneri (66.7%), Shigella sonnei (18.5%), and Shigella dysenteriae (3.7%). The highest resistance was to streptomycin (100.0%), then to kanamycin (95.8%), nalidixic acid (95.8%), tetracycline (95.8%), spectinomycin (93.6%), ampicillin (87.5%), and sulfamethoxazole/trimethoprim (87.5%). PCR and DNA sequencing were used to screen and characterize integrons and antibiotic resistance genes. Our results indicated that 11.1% and 74.1% of isolates were positive for class 1 and class 2 integrons, respectively. Beta-lactamase-encoding genes were identified in 77.8% of isolates, and plasmid-mediated quinolone resistance genes were identified in 44.4% of isolates. These data provide useful information to better understand the molecular basis of antimicrobial resistance in Shigella spp. To the best of our knowledge, this is the first report of the molecular characterization of antibiotic resistance in Shigella spp. isolated from food. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Regulation of Multidrug Resistance Proteins by Genistein in a Hepatocarcinoma Cell Line: Impact on Sorafenib Cytotoxicity

    OpenAIRE

    Rigalli, Juan Pablo; Ciriaci, Nadia; Arias, Agostina; Ceballos, Mar?a Paula; Villanueva, Silvina Stella Maris; Luquita, Marcelo Gabriel; Mottino, Aldo Domingo; Ghanem, Carolina In?s; Catania, Viviana Alicia; Ruiz, Mar?a Laura

    2015-01-01

    Hepatocellular carcinoma (HCC) is the fifth most frequent cancer worldwide. Sorafenib is the only drug available that improves the overall survival of HCC patients. P-glycoprotein (P-gp), Multidrug resistance-associated proteins 2 and 3 (MRP2 and 3) and Breast cancer resistance protein (BCRP) are efflux pumps that play a key role in cancer chemoresistance. Their modulation by dietary compounds may affect the intracellular accumulation and therapeutic efficacy of drugs that are substrates of t...

  5. Identification and characterization of SSE15206, a microtubule depolymerizing agent that overcomes multidrug resistance

    KAUST Repository

    Manzoor, Safia

    2018-02-13

    Microtubules are highly dynamic structures that form spindle fibres during mitosis and are one of the most validated cancer targets. The success of drugs targeting microtubules, however, is often limited by the development of multidrug resistance. Here we describe the discovery and characterization of SSE15206, a pyrazolinethioamide derivative [3-phenyl-5-(3,4,5-trimethoxyphenyl)-4,5-dihydro-1H-pyrazole-1-carbothioamide] that has potent antiproliferative activities in cancer cell lines of different origins and overcomes resistance to microtubule-targeting agents. Treatment of cells with SSE15206 causes aberrant mitosis resulting in G2/M arrest due to incomplete spindle formation, a phenotype often associated with drugs that interfere with microtubule dynamics. SSE15206 inhibits microtubule polymerization both in biochemical and cellular assays by binding to colchicine site in tubulin as shown by docking and competition studies. Prolonged treatment of cells with the compound results in apoptotic cell death [increased Poly (ADP-ribose) polymerase cleavage and Annexin V/PI staining] accompanied by p53 induction. More importantly, we demonstrate that SSE15206 is able to overcome resistance to chemotherapeutic drugs in different cancer cell lines including multidrug-resistant KB-V1 and A2780-Pac-Res cell lines overexpressing MDR-1, making it a promising hit for the lead optimization studies to target multidrug resistance.

  6. Multidrug Resistant Salmonella typhi in Asymptomatic Typhoid Carriers among Food Handlers in Namakkal District, Tamil Nadu

    Directory of Open Access Journals (Sweden)

    Senthilkumar B

    2005-01-01

    Full Text Available Purpose: to screen Salmonella typhi in asymptomatic typhoid carriers and to find out drug resistance and ability of the strains to transmit drug resistance to other bacteria. Methods: Cultural characters, biochemical tests, antibiotic sensitivity test (disc diffusion, agarose gel electrophoresis, and conjugation protocols were done. Thirty five stool samples were collected from the suspected food handlers for the study. Results: Among 35 samples, (17.14% yielded a positive result. Out of these 4 (20.0% were women and 2 (13.33% were men. The isolates were tested with a number of conventional antibiotics viz, amikacin, amoxicillin, ampicillin, chloramphenicol, ciprofloxacin, co-trimaxazole, rifampicin, gentamicin, nalidixic acid, ofloxacin and tetracycline. Five isolates were having the multidrug resistant character. Four (66.66% multidrug resistant isolates were found to have plasmids, while one (16.66% multidrug resistant isolate had no plasmid and the chromosome encoded the resistance. Only one strain (16.66% showed single antibiotic resistance in the study and had no plasmid DNA. The molecular weights of the plasmids were determined and found to be 120 kb.The mechanism of spreading of drug resistance through conjugation process was analyzed. In the conjugation studies, the isolates having R+ factor showed the transfer of drug resistance through conjugation, which was determined by the development of antibiotic resistance in the recipients. Conclusion: This study shows that drug resistant strains are able to transfer genes encoding drug resistance.

  7. Green Tea Catechin-Based Complex Micelles Combined with Doxorubicin to Overcome Cardiotoxicity and Multidrug Resistance

    Science.gov (United States)

    Cheng, Tangjian; Liu, Jinjian; Ren, Jie; Huang, Fan; Ou, Hanlin; Ding, Yuxun; Zhang, Yumin; Ma, Rujiang; An, Yingli; Liu, Jianfeng; Shi, Linqi

    2016-01-01

    Chemotherapy for cancer treatment has been demonstrated to cause some side effects on healthy tissues and multidrug resistance of the tumor cells, which greatly limits therapeutic efficacy. To address these limitations and achieve better therapeutic efficacy, combination therapy based on nanoparticle platforms provides a promising approach through delivering different agents simultaneously to the same destination with synergistic effect. In this study, a novel green tea catechin-based polyion complex (PIC) micelle loaded with doxorubicin (DOX) and (-)-Epigallocatechin-3-O-gallate (EGCG) was constructed through electrostatic interaction and phenylboronic acid-catechol interaction between poly(ethylene glycol)-block-poly(lysine-co-lysine-phenylboronic acid) (PEG-PLys/PBA) and EGCG. DOX was co-loaded in the PIC micelles through π-π stacking interaction with EGCG. The phenylboronic acid-catechol interaction endowed the PIC micelles with high stability under physiological condition. Moreover, acid cleavability of phenylboronic acid-catechol interaction in the micelle core has significant benefits for delivering EGCG and DOX to same destination with synergistic effects. In addition, benefiting from the oxygen free radicals scavenging activity of EGCG, combination therapy with EGCG and DOX in the micelle core could protect the cardiomyocytes from DOX-mediated cardiotoxicity according to the histopathologic analysis of hearts. Attributed to modulation of EGCG on P-glycoprotein (P-gp) activity, this kind of PIC micelles could effectively reverse multidrug resistance of cancer cells. These results suggested that EGCG based PIC micelles could effectively overcome DOX induced cardiotoxicity and multidrug resistance. PMID:27375779

  8. New Roads Leading to Old Destinations: Efflux Pumps as Targets to Reverse Multidrug Resistance in Bacteria

    Directory of Open Access Journals (Sweden)

    Gabriella Spengler

    2017-03-01

    Full Text Available Multidrug resistance (MDR has appeared in response to selective pressures resulting from the incorrect use of antibiotics and other antimicrobials. This inappropriate application and mismanagement of antibiotics have led to serious problems in the therapy of infectious diseases. Bacteria can develop resistance by various mechanisms and one of the most important factors resulting in MDR is efflux pump-mediated resistance. Because of the importance of the efflux-related multidrug resistance the development of new therapeutic approaches aiming to inhibit bacterial efflux pumps is a promising way to combat bacteria having over-expressed MDR efflux systems. The definition of an efflux pump inhibitor (EPI includes the ability to render the bacterium increasingly more sensitive to a given antibiotic or even reverse the multidrug resistant phenotype. In the recent years numerous EPIs have been developed, although so far their clinical application has not yet been achieved due to their in vivo toxicity and side effects. In this review, we aim to give a short overview of efflux mediated resistance in bacteria, EPI compounds of plant and synthetic origin, and the possible methods to investigate and screen EPI compounds in bacterial systems.

  9. Understanding institutional stakeholders’ perspectives on multidrug-resistant bacterial organism at the end of life: a qualitative study

    Science.gov (United States)

    Heckel, Maria; Herbst, Franziska A; Adelhardt, Thomas; Tiedtke, Johanna M; Sturm, Alexander; Stiel, Stephanie; Ostgathe, Christoph

    2017-01-01

    Background Information lacks about institutional stakeholders’ perspectives on management approaches of multidrug-resistant bacterial organism in end-of-life situations. The term “institutional stakeholder” includes persons in leading positions with responsibility in hospitals’ multidrug-resistant bacterial organism management. They have great influence on how strategies on multidrug-resistant bacterial organism management approaches in institutions of the public health system are designed. This study targeted institutional stakeholders’ individual perspectives on multidrug-resistant bacterial organism colonization or infection and isolation measures at the end of life. Methods Between March and December 2014, institutional stakeholders of two study centers, a German palliative care unit and a geriatric ward, were queried in semistructured interviews. Interviews were audiotaped, transcribed verbatim, and analyzed qualitatively with the aid of the software MAXQDA for qualitative data analysis using principles of Grounded Theory. In addition, two external stakeholders were interviewed to enrich data. Results Key issues addressed by institutional stakeholders (N=18) were the relevance of multidrug-resistant bacterial organism in palliative and geriatric care, contradictions between hygiene principles and patients’ and family caregivers’ needs and divergence from standards, frame conditions, and reflections on standardization of multidrug-resistant bacterial organism end-of-life care procedures. Results show that institutional stakeholders face a dilemma between their responsibility in protecting third persons and ensuring patients’ quality of life. Until further empirical evidence establishes a clear multidrug-resistant bacterial organism management approach in end-of-life care, stakeholders suggest a case-based approach. Conclusion The institutional stakeholders’ perspectives and their suggestion of a case-based approach advance the development

  10. Understanding institutional stakeholders' perspectives on multidrug-resistant bacterial organism at the end of life: a qualitative study.

    Science.gov (United States)

    Heckel, Maria; Herbst, Franziska A; Adelhardt, Thomas; Tiedtke, Johanna M; Sturm, Alexander; Stiel, Stephanie; Ostgathe, Christoph

    2017-01-01

    Information lacks about institutional stakeholders' perspectives on management approaches of multidrug-resistant bacterial organism in end-of-life situations. The term "institutional stakeholder" includes persons in leading positions with responsibility in hospitals' multidrug-resistant bacterial organism management. They have great influence on how strategies on multidrug-resistant bacterial organism management approaches in institutions of the public health system are designed. This study targeted institutional stakeholders' individual perspectives on multidrug-resistant bacterial organism colonization or infection and isolation measures at the end of life. Between March and December 2014, institutional stakeholders of two study centers, a German palliative care unit and a geriatric ward, were queried in semistructured interviews. Interviews were audiotaped, transcribed verbatim, and analyzed qualitatively with the aid of the software MAXQDA for qualitative data analysis using principles of Grounded Theory. In addition, two external stakeholders were interviewed to enrich data. Key issues addressed by institutional stakeholders (N=18) were the relevance of multidrug-resistant bacterial organism in palliative and geriatric care, contradictions between hygiene principles and patients' and family caregivers' needs and divergence from standards, frame conditions, and reflections on standardization of multidrug-resistant bacterial organism end-of-life care procedures. Results show that institutional stakeholders face a dilemma between their responsibility in protecting third persons and ensuring patients' quality of life. Until further empirical evidence establishes a clear multidrug-resistant bacterial organism management approach in end-of-life care, stakeholders suggest a case-based approach. The institutional stakeholders' perspectives and their suggestion of a case-based approach advance the development process of a patient-, family-, staff-, and institutional

  11. Prevalence and factors associated with tuberculosis treatment ...

    African Journals Online (AJOL)

    2014-03-01

    Mar 1, 2014 ... health care, HIV co-infection and multi-drug resistant tuberculosis (MDRTB) are ... and default, are a public health concern as they are at risk for clinical ..... national recording systems in Brazil, 2003-2008. PLoS. One 2012 ...

  12. Tuberculosis

    International Nuclear Information System (INIS)

    Aleksandrova, A.V.

    1983-01-01

    Classification of clinical forms of tuberculosis of respiratory organs is m ade. It is shown, that diagnosis, determination of the clinical form of pulmona ry tuberculosis, extent and phase of the process are mainly based on the data of roentgenologic studies and in certain cases tomography is preferable. Roentgenologic picture of primary tuberculosis, tuberculosis of intrathoracis l ymp nodes, dissemenated tuberculosis, focal and infiltrative tuberculosis of lungs, tuberculomas of lungs, cavernous and fibrocavernous form of pulmonary tub erculosis, cirrhotic tuberculosis of lungs, tuberculosis of upper respiratory tracks, tuberculous pleurite and tuberculosis of respiratory organs, combined wi th dust occupational diseases, has been described

  13. Tuberculosis--triumph and tragedy.

    Science.gov (United States)

    Singh, M M

    2003-03-01

    Tuberculosis has been making havoc worldwide with an 11.9 million cases to be involved by the year 2005. In India, about 2 million cases are infected every year. Regarding triumphs and tragedies in the control of tuberculosis some points as follows are discussed. (1) Tuberculosis Control Programmes from National Tuberculosis Programme (NTP) to Revised National Tuberculosis Control Programme (RNTCP) and Directly Observed Treatment, Short course (DOTS). (2) Problem of multidrug resistance (MDR) tuberculosis and (3) HIV and tuberculosis. DOTS being largely based on Indian research. It is now being applied worldwide. MDR is strictly a man made problem. Poor prescriptions, poor case management, lack of coordinated education and haphazard treatment research result in drug resistance. Treatment of MDR is difficult. The drug acceptability, tolerance and toxicity have to be considered. HIV and tuberculosis form a deadly duo. They mean more cases, more costs and more national losses.

  14. Drug resistance-related mutations in multidrug-resistant Mycobacterium tuberculosis isolates from diverse geographical regions

    Directory of Open Access Journals (Sweden)

    Senia Rosales-Klintz

    2012-01-01

    Conclusion: This study confirms that there are significant geographical differences in the distribution of resistance-related mutations and suggests that an increased understanding of such differences in the specific distribution of resistance conferring mutations is crucial for development of new, generally applicable, molecular tools for rapid diagnosis of drug-resistant TB. The fact that a narrower distribution of mutations in high MDR-TB prevalence settings was seen suggests that much of the problems in these settings can be a result of an ongoing transmission of certain MDR-TB strains.

  15. Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco

    OpenAIRE

    Zakham, Fathiah; Chaoui, Imane; Echchaoui, Amina Hadbae; Chetioui, Fouad; Elmessaoudi, My Driss; Ennaji, My Mustapha; Abid, Mohammed; Mzibri, Mohammed El

    2013-01-01

    Fathiah Zakham,1,4 Imane Chaoui,1 Amina Hadbae Echchaoui,2 Fouad Chetioui,3 My Driss Elmessaoudi,3 My Mustapha Ennaji,4 Mohammed Abid,2 Mohammed El Mzibri11Unité de Biologie et Recherché Médicale, Centre National de l'Energie, des Sciences et des Techniques Nucléaires (CNESTEN), Rabat, 2Laboratoire de Génétique Mycobacterienne, Institut Pasteur, Tangier, 3Laboratoire de Tuberculose Institut Pasteur, Casablanca, 4Laborat...

  16. Adverse reactions among patients being treated for multi-drug resistant tuberculosis at Abbassia Chest Hospital

    Directory of Open Access Journals (Sweden)

    Mohammad A. Tag El Din

    2015-10-01

    Conclusions: There is a relation between both tobacco smoking and drug addiction, and MDR TB. The most common type of resistance is acquired resistance because of lack of adherence to treatment or inappropriate treatment. The most common co-morbidities associated with MDR TB are diabetes and chronic obstructive lung diseases. The most important predictors of patients’ outcome are sputum conversion, number of previous TB treatment and presence of co-morbidities.

  17. Chest X-ray patterns of pulmonary multidrug-resistant tuberculosis in ...

    African Journals Online (AJOL)

    2016-03-18

    Mar 18, 2016 ... On evaluation of the chest X-ray patterns, 22 children (48.9%) had ≥2 findings on the chest X-ray, and 10 (22.2%) had no. †, World Health Organization. WHO case definitions of HIV for surveillance and revised clinical staging and immunological classification of HIV-related disease in adults and children.

  18. Molecular epidemiology of TB – Its impact on multidrug-resistant tuberculosis control in China☆

    Directory of Open Access Journals (Sweden)

    Biao Xu

    2015-01-01

    Results: In total, 238 bacteriologic confirmed pulmonary TB patients from DQ and 393 from GY diagnosed between 2008 and 2011 were recruited in the study. Of the 631 isolates, 220 (34.9% were resistant to at least one anti-TB drug, including 95 (15.1% simultaneously resistant to isoniazid and rifampicin or MDR, albeit with the similar distribution between DQ and GY (32/238 vs. 63/393; p, 0.378. The MIRU-VNTR genotyping revealed 35 isolates from DQ and 86 from GY exhibited 15 and 32 clustering patterns with four patterns shared between two counties. Compared with GY county, DQ had a significantly lower clustering proportion in MTB isolates susceptible to first-line drugs (25/167 vs. 46/198; p, 0.047 and total drug resistant TB isolates (12/71 vs. 44/149; p, 0.044, but a similar clustering proportion in MDR-TB isolates (8/32 vs. 18/63; p, 0.712. A significant higher clustering proportion was observed in the previously treated patients in both counties, but in the sputum smear-positive patients with cavitaries only in GY. Comparing the previously treated patients between the two counties, the proportion of MDR-TB and clustering proportion exhibited a similar distribution, while the average age of previously treated patients in DQ is significantly older than that in GY. Conclusions: A lower proportion of recent transmissions was observed in the county with long-term DOTS implementation. However, DOTS itself might not have worked enough on blocking the recent transmission of MDR-TB. This observation suggests the urgent needs of implementing the Stop-TB strategies; in particular, accelerating the use of rapid molecularbasedTBdiagnosisand drug susceptibility testing, providing active case findings in a high risk population of MDR-TB and enhancing infection control in high MDR-TB burden countries.

  19. New-Onset Psychosis in a Multi-Drug Resistant Tuberculosis Patient ...

    African Journals Online (AJOL)

    He also displayed negativisim with paranoid delusions and insomnia. He was managed by a psychiatrist with anti-psychotic drugs. The dose of cycloserine was also reduced while that of pyridoxine was increased. He remained in a state of periodic confusion and psychosis for nine days after which his condition ameliorated ...

  20. Prevalence and characterization of multidrug-resistant zoonotic Enterobacter spp. in poultry of Bangladesh.

    Science.gov (United States)

    Nandi, Shuvro Prokash; Sultana, Munawar; Hossain, M Anwar

    2013-05-01

    Poultry and poultry products are major contributors of zoonotic pathogens. Limited data are available on Enterobacter spp. as a potent zoonotic pathogen in poultry. The present study is a first endeavor on the emergence of multidrug-resistant zoonotic Enterobacter spp. and its prevalence arising from poultry in Bangladesh. Cloacal swabs from poultry samples of five different farms at Savar, Dhaka, Bangladesh were collected and from 106 isolates, 18 presumptive Enterobacter spp. were obtained. Antibiogram using 19 used antibiotics belonging to 15 major groups revealed that all of the 18 isolates were completely resistant to penicillin and rifampicin, but differed in their drug resistance pattern against ampicillin (94.4%), clindamycin (94.4%), erythromycin (94.4%), vancomycin (88.9%), sulfonamides (72.2%), imipenem (66.6%), streptomycin (55.6%), nitrofurantoin (33.3%), doxycycline (33.3%), tetracyclines (33.3%), cefepime (11.1%), and gentamicin (5.6%). All Enterobacter spp. were found to be plasmid free, implying that multidrug-resistant properties are chromosomal borne. The vanA and sulI were detected by polymerase chain reaction assay in 17 and 13 isolates, respectively. Amplified ribosomal DNA restriction analysis and randomly amplified polymorphic DNA distributed the 18 multidrug-resistant Enterobacter spp. into three genotypes. Phylogenetic analysis of the representatives of the three genotypes using partial 16S rRNA gene sequence (approximately 900 bp) showed that the genotypically diverse groups belonged to Enterobacter hormaechei, E. cloacae, and E. cancerogenus, respectively. The clinical significance of the close relative Enterobacter spp. is indicative of their zoonotic potential. Therefore, urgent intervention is required to limit the emergence and spread of these bacteria in poultry feed as well as prudent use of antibiotics among poultry farmers in Bangladesh.

  1. Glycyrrhiza glabra HPLC fractions: identification of Aldehydo Isoophiopogonone and Liquirtigenin having activity against multidrug resistant bacteria.

    Science.gov (United States)

    Rahman, Hazir; Khan, Ilyas; Hussain, Anwar; Shahat, Abdelaaty Abdelaziz; Tawab, Abdul; Qasim, Muhammad; Adnan, Muhammad; Al-Said, Mansour S; Ullah, Riaz; Khan, Shahid Niaz

    2018-05-02

    Medicinal plants have been founded as traditional herbal medicine worldwide. Most of the plant's therapeutic properties are due to the presence of secondary metabolites such as alkaloids, glycosides, tannins and volatile oil. The present investigation analyzed the High-Pressure Liquid Chromatography (HPLC) fractions of Glycyrrhiza glabra (Aqueous, Chloroform, Ethanol and Hexane) against multidrug resistant human bacterial pathogens (Escherichia coli, Acinetobacter baumannii, Staphylococcus aureus and Pseudomonas aeruginosa). All the fractions showed antibacterial activity, were subjected to LC MS/MS analysis for identification of bioactive compounds. Among total HPLC fractions of G. glabra (n = 20), three HPLC fractions showed potential activity against multidrug resistant (MDR) bacterial isolates. Fraction 1 (F1) of aqueous extracts, showed activity against A. baumannii (15 ± 0.5 mm). F4 from hexane extract of G. glabra showed activity against S. aureus (10 ± 0.2 mm). However, F2 from ethanol extract exhibited activity against S. aureus (10 ± 0.3 mm). These active fractions were further processed by LC MS/MS analysis for the identification of compounds. Ellagic acid was identified in the F1 of aqueous extract while 6-aldehydo-isoophiopogonone was present in F4 of hexane extract. Similarly, Liquirtigenin was identified in F2 of ethanol. Glycyrrhiza glabra extracts HPLC fractions showed anti-MDR activity. Three bioactive compounds were identified in the study. 6-aldehydo-isoophiopogonone and Liquirtigenin were for the first time reported in G. glabra. Further characterization of the identified compounds will be helpful for possible therapeutic uses against infectious diseases caused by multidrug resistant bacteria.

  2. Genome evolution and plasticity of Serratia marcescens, an important multidrug-resistant nosocomial pathogen.

    Science.gov (United States)

    Iguchi, Atsushi; Nagaya, Yutaka; Pradel, Elizabeth; Ooka, Tadasuke; Ogura, Yoshitoshi; Katsura, Keisuke; Kurokawa, Ken; Oshima, Kenshiro; Hattori, Masahira; Parkhill, Julian; Sebaihia, Mohamed; Coulthurst, Sarah J; Gotoh, Naomasa; Thomson, Nicholas R; Ewbank, Jonathan J; Hayashi, Tetsuya

    2014-08-01

    Serratia marcescens is an important nosocomial pathogen that can cause an array of infections, most notably of the urinary tract and bloodstream. Naturally, it is found in many environmental niches, and is capable of infecting plants and animals. The emergence and spread of multidrug-resistant strains producing extended-spectrum or metallo beta-lactamases now pose a threat to public health worldwide. Here we report the complete genome sequences of two carefully selected S. marcescens strains, a multidrug-resistant clinical isolate (strain SM39) and an insect isolate (strain Db11). Our comparative analyses reveal the core genome of S. marcescens and define the potential metabolic capacity, virulence, and multidrug resistance of this species. We show a remarkable intraspecies genetic diversity, both at the sequence level and with regards genome flexibility, which may reflect the diversity of niches inhabited by members of this species. A broader analysis with other Serratia species identifies a set of approximately 3,000 genes that characterize the genus. Within this apparent genetic diversity, we identified many genes implicated in the high virulence potential and antibiotic resistance of SM39, including the metallo beta-lactamase and multiple other drug resistance determinants carried on plasmid pSMC1. We further show that pSMC1 is most closely related to plasmids circulating in Pseudomonas species. Our data will provide a valuable basis for future studies on S. marcescens and new insights into the genetic mechanisms that underlie the emergence of pathogens highly resistant to multiple antimicrobial agents. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. The demise of multidrug-resistant HIV-1: the national time trend in Portugal.

    Science.gov (United States)

    Vercauteren, Jurgen; Theys, Kristof; Carvalho, Ana Patricia; Valadas, Emília; Duque, Luis Miguel; Teófilo, Eugénio; Faria, Telo; Faria, Domitília; Vera, José; Aguas, Maria João; Peres, Susana; Mansinho, Kamal; Vandamme, Anne-Mieke; Camacho, Ricardo Jorge

    2013-04-01

    Despite a decreasing mortality and morbidity in treated HIV-1 patients, highly active antiretroviral treatment (HAART) can still fail due to the development of drug resistance. Especially, multidrug-resistant viruses pose a threat to efficient therapy. We studied the changing prevalence of multidrug resistance (MDR) over time in a cohort of HIV-1-infected patients in Portugal. We used data of 8065 HIV-1-infected patients followed from July 2001 up to April 2012 in 22 hospitals located in Portugal. MDR at a specific date of sampling was defined as no more than one fully active drug (excluding integrase and entry inhibitors) at that time authorized by the Portuguese National Authority of Medicines and Health Products (INFARMED), as interpreted with the Rega algorithm version 8.0.2. A generalized linear mixed model was used to study the time trend of the prevalence of MDR. We observed a statistically significant decrease in the prevalence of MDR over the last decade, from 6.9% (95% CI: 5.7-8.4) in 2001-03, 6.0% (95% CI: 4.9-7.2) in 2003-05, 3.7% (95% CI: 2.8-4.8) in 2005-07 and 1.6% (95% CI: 1.1-2.2) in 2007-09 down to 0.6% (95% CI: 0.3-0.9) in 2009-12 [OR=0.80 (95% CI: 0.75-0.86); P<0.001]. In July 2011 the last new case of MDR was seen. The prevalence of multidrug-resistant HIV-1 is decreasing over time in Portugal, reflecting the increasing efficiency of HAART and the availability of new drugs. Therefore, in designing a new drug, safety and practical aspects, e.g. less toxicity and ease of use, may need more attention than focusing mainly on efficacy against resistant strains.

  4. High prevalence of multidrug-resistant MRSA in a tertiary care hospital of northern India

    Directory of Open Access Journals (Sweden)

    Hare Krishna Tiwari

    2008-11-01

    Full Text Available Hare Krishna Tiwari1, Darshan Sapkota2, Malaya Ranjan Sen11Department of Microbiology, Institute of Medical Sciences, Banaras Hindu University, Varanasi, UP, India; 2Department of Microbiology, Universal College of Medical Sciences, Bhairahawa, NepalAbstract: Methicillin-resistant Staphylococcus aureus (MRSA is an important nosocomial and community pathogen. The objectives of this study were to estimate the prevalence of multidrug-resistant MRSA strains in clinical specimens and to investigate the sensitivity pattern of these strains against various antibiotics used for treating hospitalized and out patients. Strains were identified using standard procedures, and their sensitivity pattern was investigated using such techniques as disc diffusion, minimum inhibitory concentration (MIC, and the mecA gene PCR. Among 783 isolates of S. aureus, 301 (38.44% were methicillin-resistant, of which 217 (72.1% were found to be multidrug-resistant. Almost all MRSA strains were resistant to penicillin, 95.68% were resistant to cotrimoxazole, 92.36% were resistant to chloramphenicol, 90.7% were resistant to norfloxacin, 76.1% were resistant to tetracycline, and 75.75% were resistant to ciprofloxacin. Vancomycin was the most effective drug, with only 0.33% of MRSA strains being resistant to it. It is concluded that antibiotics other than vancomycin can be used as anti-MRSA agents after a sensitivity test so as to preclude the emergence of resistance to it and that prevailing problems in chemotherapy will escalate unless indiscriminate and irrational usage of antibiotics is checked.Keywords: multidrug-resistant MRSA, prevalence, India

  5. Spread of multidrug-resistant Escherichia coli harboring integron via swine farm waste water treatment plant.

    Science.gov (United States)

    Park, Jin-Hyeong; Kim, Young-Ji; Binn-Kim; Seo, Kun-Ho

    2018-03-01

    Wastewater treatment plants (WWTPs) that release treated wastewater into the environment have emerged as a major threat to public health. In this study, we investigated Escherichia coli load and antibiotic-resistance profiles across different treatment processes at a swine farm WWTP. The frequency of the detection of class 1 and 2 integrons, and their association with antibiotic resistance, were also analyzed. Samples were obtained at each of five sampling sites that represented each processing step within the WWTP. The largest decrease in E. coli load was observed during the anaerobic digestion step (from 4.86 to 2.89log CFU/mL). Isolates resistant to β-lactam antibiotics were efficiently removed after a series of treatment steps, whereas the proportions of isolates resistant to non-β-lactam antibiotics and multidrug-resistant strains were maintained across treatments. The occurrence of integron-positive strains was not significantly different at the various sampling sites (43.4-70%; p>0.05). Of the class 1 integron-positive isolates, 17.9% harbored the integron-associated gene cassettes aadA2, aadA12, aadA22, and dfrA15. To the best of our knowledge, this is the first description of a class 1 integron containing the aadA12 gene cassette from a swine farm and the presence of a class 1 integron containing dfrA15 in E. coli. This suggests that novel antibiotic-resistance gene cassette arrays could be generated in swine farm WWTPs. Moreover, 75% of integron-positive strains were categorized as multidrug resistant, whereas only 15.4% of integron-negative strains were multidrug resistant (pswine farm WWTPs in terms of the spread of antibiotic-resistant bacteria to the aquatic environment. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Inhibiting fungal multidrug resistance by disrupting an activator-Mediator interaction.

    Science.gov (United States)

    Nishikawa, Joy L; Boeszoermenyi, Andras; Vale-Silva, Luis A; Torelli, Riccardo; Posteraro, Brunella; Sohn, Yoo-Jin; Ji, Fei; Gelev, Vladimir; Sanglard, Dominique; Sanguinetti, Maurizio; Sadreyev, Ruslan I; Mukherjee, Goutam; Bhyravabhotla, Jayaram; Buhrlage, Sara J; Gray, Nathanael S; Wagner, Gerhard; Näär, Anders M; Arthanari, Haribabu

    2016-02-25

    Eukaryotic transcription activators stimulate the expression of specific sets of target genes through recruitment of co-activators such as the RNA polymerase II-interacting Mediator complex. Aberrant function of transcription activators has been implicated in several diseases. However, therapeutic targeting efforts have been hampered by a lack of detailed molecular knowledge of the mechanisms of gene activation by disease-associated transcription activators. We previously identified an activator-targeted three-helix bundle KIX domain in the human MED15 Mediator subunit that is structurally conserved in Gal11/Med15 Mediator subunits in fungi. The Gal11/Med15 KIX domain engages pleiotropic drug resistance transcription factor (Pdr1) orthologues, which are key regulators of the multidrug resistance pathway in Saccharomyces cerevisiae and in the clinically important human pathogen Candida glabrata. The prevalence of C. glabrata is rising, partly owing to its low intrinsic susceptibility to azoles, the most widely used antifungal agent. Drug-resistant clinical isolates of C. glabrata most commonly contain point mutations in Pdr1 that render it constitutively active, suggesting that this transcriptional activation pathway represents a linchpin in C. glabrata multidrug resistance. Here we perform sequential biochemical and in vivo high-throughput screens to identify small-molecule inhibitors of the interaction of the C. glabrata Pdr1 activation domain with the C. glabrata Gal11A KIX domain. The lead compound (iKIX1) inhibits Pdr1-dependent gene activation and re-sensitizes drug-resistant C. glabrata to azole antifungals in vitro and in animal models for disseminated and urinary tract C. glabrata infection. Determining the NMR structure of the C. glabrata Gal11A KIX domain provides a detailed understanding of the molecular mechanism of Pdr1 gene activation and multidrug resistance inhibition by iKIX1. We have demonstrated the feasibility of small-molecule targeting of a

  7. Hypoxia-inducible factor-1α induces multidrug resistance protein in colon cancer

    Directory of Open Access Journals (Sweden)

    Lv Y

    2015-07-01

    Full Text Available Yingqian Lv, Shan Zhao, Jinzhu Han, Likang Zheng, Zixin Yang, Li Zhao Department of Oncology, The Second Hospital, Hebei Medical University, Shijiazhuang, Hebei Province, People’s Republic of China Abstract: Multidrug resistance is the major cause of chemotherapy failure in many solid tumors, including colon cancer. Hypoxic environment is a feature for all solid tumors and is important for the development of tumor resistance to chemotherapy. Hypoxia-inducible factor (HIF-1α is the key transcription factor that mediates cellular response to hypoxia. HIF-1α has been shown to play an important role in tumor resistance; however, the mechanism is still not fully understood. Here, we found that HIF-1α and the drug resistance-associated gene multidrug resistance associated protein 1 (MRP1 were induced by treatment of colon cancer cells with the hypoxia-mimetic agent cobalt chloride. Inhibition of HIF-1α by RNA interference and dominant-negative protein can significantly reduce the induction of MRP1 by hypoxia. Bioinformatics analysis showed that a hypoxia response element is located at -378 to -373 bp upstream of the transcription start site of MRP1 gene. Luciferase reporter assay combined with mutation analysis confirmed that this element is essential for hypoxia-mediated activation of MRP gene. Furthermore, RNA interference revealed that HIF-1α is necessary for this hypoxia-driven activation of MRP1 promoter. Importantly, chromatin immunoprecipitation analysis demonstrated that HIF-1α could directly bind to this HRE site in vivo. Together, these data suggest that MRP1 is a downstream target gene of HIF-1α, which provides a potential novel mechanism for HIF-1α-mediated drug resistance in colon cancer and maybe other solid tumors as well. Keywords: hypoxia, hypoxia-inducible factor-1α, multidrug resistance associated protein, transcriptional regulation, chemotherapy tolerance

  8. In Vitro activity of novel glycopolymer against clinical isolates of multidrug-resistant Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Vidya P Narayanaswamy

    Full Text Available The incidence of multidrug-resistant (MDR organisms, including methicillin-resistant Staphylococcus aureus (MRSA, is a serious threat to public health. Progress in developing new therapeutics is being outpaced by antibiotic resistance development, and alternative agents that rapidly permeabilize bacteria hold tremendous potential for treating MDR infections. A new class of glycopolymers includes polycationic poly-N (acetyl, arginyl glucosamine (PAAG is under development as an alternative to traditional antibiotic strategies to treat MRSA infections. This study demonstrates the antibacterial activity of PAAG against clinical isolates of methicillin and mupirocin-resistant Staphylococcus aureus. Multidrug-resistant S. aureus was rapidly killed by PAAG, which completely eradicated 88% (15/17 of all tested strains (6-log reduction in CFU in ≤ 12-hours at doses that are non-toxic to mammalian cells. PAAG also sensitized all the clinical MRSA strains (17/17 to oxacillin as demonstrated by the observed reduction in the oxacillin MIC to below the antibiotic resistance breakpoint. The effect of PAAG and standard antibiotics including vancomycin, oxacillin, mupirocin and bacitracin on MRSA permeability was studied by measuring propidium iodide (PI uptake by bacterial cells. Antimicrobial resistance studies showed that S. aureus developed resistance to PAAG at a rate slower than to mupirocin but similar to bacitracin. PAAG was observed to resensitize drug-resistant S. aureus strains sampled from passage 13 and 20 of the multi-passage resistance study, reducing MICs of mupirocin and bacitracin below their clinical sensitivity breakpoints. This class of bacterial permeabilizing glycopolymers may provide a new tool in the battle against multidrug-resistant bacteria.

  9. Carbapenem Susceptibility and Multidrug-Resistance in Pseudomonas aeruginosa Isolates in Egypt.

    Science.gov (United States)

    Hashem, Hany; Hanora, Amro; Abdalla, Salah; Shawky, Alaa; Saad, Alaa

    2016-11-01

    Resistant Pseudomonas aeruginosa is a serious concern for antimicrobial therapy, as the common isolates exhibit variable grades of resistance, involving beta-lactamase enzymes, beside native defense mechanisms. The present study was designed to determine the occurrence of Metallo-β- Lactamases (MBL) and Amp C harboring P. aeruginosa isolates from Suez Canal university hospital in Ismailia, Egypt. A total of 147 P. aeruginosa isolates, recovered from 311 patients during a 10-month period, were collected between May 2013 and February 2014; the isolates were collected from urine, wound and sputum. Minimum inhibitory concentration (MIC) determined by agar dilution methods was ≥2 μg/mL for meropenem and imipenem. Identification of P. aeruginosa was confirmed using API 20NE. Metallo-β- Lactamases and Amp C were detected based on different phenotypic methods. Overall, 26.5% of P. aeruginosa isolates (39/147) were carbapenem resistant isolates. Furthermore, 64.1% (25/39) were MBL producers, these isolates were screened by the combined disc and disc diffusion methods to determine the ability of MBL production. Both MBL and Amp C harbored P. aeruginosa isolates were 28% (7/25). Sixty-four percent of P. aeruginosa isolates were multidrug resistant (MDR) (16/25). The sensitivity toward polymyxin, imipenem, norfloxacin, piperacillin-tazobactam and gentamicin was 99%, 91%, 88%, 82% and 78%, respectively. The resistance rate towards cefotaxime, ceftazidime, cefepime, aztreonam and meropenem was 98.6%, 86%, 71.4%, 34% and 30%, respectively. Multidrug resistance was significantly associated with MBL production in P. aeruginosa . Early detection of MBL-producing P. aeruginosa and hospital antibiotic policy prescription helps proper antimicrobial therapy and avoidance of dissemination of these multidrug resistance isolates.

  10. Genetic relatedness and molecular characterization of multidrug resistant Acinetobacter baumannii isolated in central Ohio, USA

    Directory of Open Access Journals (Sweden)

    Tadesse Daniel

    2009-06-01

    Full Text Available Abstract Background Over the last decade, nosocomial infections due to Acinetobacter baumannii have been described with an increasing trend towards multidrug resistance, mostly in intensive care units. The aim of the present study was to determine the clonal relatedness of clinical isolates and to elucidate the genetic basis of imipenem resistance. Methods A. baumannii isolates (n = 83 originated from two hospital settings in central Ohio were used in this study. Pulsed-field gel electrophoresis genotyping and antimicrobial susceptibility testing for clinically relevant antimicrobials were performed. Resistance determinants were characterized by using different phenotypic (accumulation assay for efflux and genotypic (PCR, DNA sequencing, plasmid analysis and electroporation approaches. Results The isolates were predominantly multidrug resistant (>79.5% and comprised of thirteen unique pulsotypes, with genotype VII circulating in both hospitals. The presence of blaOXA-23 in 13% (11/83 and ISAba1 linked blaOXA-66 in 79.5% (66/83 of clinical isolates was associated with high level imipenem resistance. In this set of OXA producing isolates, multidrug resistance was bestowed by blaADC-25, class 1 integron-borne aminoglycoside modifying enzymes, presence of sense mutations in gyrA/parC and involvement of active efflux (with evidence for the presence of adeB efflux gene. Conclusion This study underscores the major role of carbapenem-hydrolyzing class D β-lactamases, and in particular the acquired OXA-23, in the dissemination of imipenem-resistant A. baumannii. The co-occurrence of additional resistance determinant could also be a significant threat.

  11. In Vitro activity of novel glycopolymer against clinical isolates of multidrug-resistant Staphylococcus aureus.

    Science.gov (United States)

    Narayanaswamy, Vidya P; Giatpaiboon, Scott A; Uhrig, John; Orwin, Paul; Wiesmann, William; Baker, Shenda M; Townsend, Stacy M

    2018-01-01

    The incidence of multidrug-resistant (MDR) organisms, including methicillin-resistant Staphylococcus aureus (MRSA), is a serious threat to public health. Progress in developing new therapeutics is being outpaced by antibiotic resistance development, and alternative agents that rapidly permeabilize bacteria hold tremendous potential for treating MDR infections. A new class of glycopolymers includes polycationic poly-N (acetyl, arginyl) glucosamine (PAAG) is under development as an alternative to traditional antibiotic strategies to treat MRSA infections. This study demonstrates the antibacterial activity of PAAG against clinical isolates of methicillin and mupirocin-resistant Staphylococcus aureus. Multidrug-resistant S. aureus was rapidly killed by PAAG, which completely eradicated 88% (15/17) of all tested strains (6-log reduction in CFU) in ≤ 12-hours at doses that are non-toxic to mammalian cells. PAAG also sensitized all the clinical MRSA strains (17/17) to oxacillin as demonstrated by the observed reduction in the oxacillin MIC to below the antibiotic resistance breakpoint. The effect of PAAG and standard antibiotics including vancomycin, oxacillin, mupirocin and bacitracin on MRSA permeability was studied by measuring propidium iodide (PI) uptake by bacterial cells. Antimicrobial resistance studies showed that S. aureus developed resistance to PAAG at a rate slower than to mupirocin but similar to bacitracin. PAAG was observed to resensitize drug-resistant S. aureus strains sampled from passage 13 and 20 of the multi-passage resistance study, reducing MICs of mupirocin and bacitracin below their clinical sensitivity breakpoints. This class of bacterial permeabilizing glycopolymers may provide a new tool in the battle against multidrug-resistant bacteria.

  12. Characterization of an IncA/C Multidrug Resistance Plasmid in Vibrio alginolyticus.

    Science.gov (United States)

    Ye, Lianwei; Li, Ruichao; Lin, Dachuan; Zhou, Yuanjie; Fu, Aisi; Ding, Qiong; Chan, Edward Wai Chi; Yao, Wen; Chen, Sheng

    2016-05-01

    Cephalosporin-resistant Vibrio alginolyticus was first isolated from food products, with β-lactamases encoded by blaPER-1, blaVEB-1, and blaCMY-2 being the major mechanisms mediating their cephalosporin resistance. The complete sequence of a multidrug resistance plasmid, pVAS3-1, harboring the blaCMY-2 and qnrVC4 genes was decoded in this study. Its backbone exhibited genetic homology to known IncA/C plasmids recoverable from members of the family Enterobacteriaceae, suggesting its possible origin in Enterobacteriaceae. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  13. Several Virulence Factors of Multidrug-Resistant Staphylococcus aureus Isolates From Hospitalized Patients in Tehran

    Directory of Open Access Journals (Sweden)

    Abdolmajid Ghasemian

    2015-05-01

    Full Text Available Background: Biofilm formation plays an important role in resistance of Staphylococcus aureus isolates; especially multidrug-resistant isolates are a threat to healthcare settings. Objectives: The aims of this study were to detect biofilm formation and presence of several related genes among multidrug-resistant (MDR isolates of Staphylococcus aureus. Patients and Methods: A total Of 209 S. aureus strains were isolated from patients and identified by conventional diagnostic tests. The multidrug-resistant MRSA isolates were detected by antibiotic susceptibility test. The phenotypic biofilm formation was detected by micro-titre tissue plate assay. The polymerase chain reaction (PCR was performed to detect the mecA, Staphylococcal Cassette Chromosome mec (SCCmec types, accessory gene regulatory (agr genes, the icaADBC and several genes encoding staphylococcal surface proteins including clfAB, fnbAB, fib, eno, can, ebps and bbp genes with specific primers. Results: Sixty-four (30.6% isolates were methicillin-resistant, among which thirty-six (56.2% were MDR. These isolates were resistant to amoxicillin, tetracycline, ciprofloxacin, gentamicin, erythromycin and trimethoprim-sulfamethoxazole (except to 6 isolates. All the isolates were susceptible to vancomycin and linezolid. All the MDR-MRSA harbored SCCmec type III. All the MDR- MRSA isolates were strong biofilm producers in the phenotypic test. The majority of MDR- MRSA was belonged to agrI (67%, n = 24, followed by agr II (17%, n = 6, agrIV (11%, n = 4 and agrIII (5.5%, n = 2. The frequency of icaADBC genes were 75% (n = 27, 61% (n = 22, 72% (n = 26 and 72% (n = 26, respectively. Furthermore, the prevalence of clfA, clfB, fnbA, fnbB, fib, can, eno, ebps and bbp genes was 100%, 100%, 67%, 56%, 80%, 63%, 78%, 7% and 0%, respectively. Furthermore, approximately all the MRSA was strong biofilm producers. Conclusions: Multidrug-resistant isolates produced biofilm strongly and the majority harbored most

  14. Multidrug resistance among different serotypes of clinical Salmonella isolates in Taiwan

    DEFF Research Database (Denmark)

    Lauderdale, T. L.; Aarestrup, Frank Møller; Chen, P. C.

    2006-01-01

    (41%) and was highly prevalent in Salmonella enterica serotype Typhimurium (72.7%, 176/242) the most common serotype. Additional resistance to trimethoprim was present in 155 (19.4% overall) of the ACSSuT R-type isolates from several serotypes. Reduced susceptibility to fluoroquinolone (FQ...... multiresistant to other antimicrobials. Studies are needed to determine the sources of different multidrug-resistant serotypes. Continued national surveillance is underway to monitor changes in resistance trends and to detect further emergence of resistant Salmonella serotypes in Taiwan. (c) 2006 Elsevier Inc...

  15. Thermodynamic secrets of multidrug resistance: A new take on transport mechanisms of secondary active antiporters.

    Science.gov (United States)

    Zhang, Xuejun C; Liu, Min; Lu, Guangyuan; Heng, Jie

    2018-03-01

    Multidrug resistance (MDR) presents a growing challenge to global public health. Drug extrusion transporters play a critical part in MDR; thus, their mechanisms of substrate recognition are being studied in great detail. In this work, we review common structural features of key transporters involved in MDR. Based on our membrane potential-driving hypothesis, we propose a general energy-coupling mechanism for secondary-active antiporters. This putative mechanism provides a common framework for understanding poly-specificity of most-if not all-MDR transporters. © 2017 The Protein Society.

  16. A portable 3D printer system for the diagnosis and treatment of multidrug-resistant bacteria

    OpenAIRE

    Glatzel, Stefan; Hezwani, Mohammed; Kitson, Philip J.; Gromski, Piotr S.; Schürer, Sophie; Cronin, Leroy

    2016-01-01

    Summary: Multidrug-resistant bacteria are a major threat to human health, but broad-spectrum\\ud antibiotics are losing efficacy. There is a need to screen a given drug against\\ud a bacterial infection outside of the laboratory. To address this need, we have designed\\ud and built an inexpensive and easy-to-use 3D-printer-based system that\\ud allows easily readable quantitative tests for the performance of antibacterial\\ud drugs. The platform creates a sterile diagnostic device by using 3D prin...

  17. Tumor-targeted micelle-forming block copolymers for overcoming of multidrug resistance

    Czech Academy of Sciences Publication Activity Database

    Braunová, Alena; Kostka, Libor; Sivák, Ladislav; Cuchalová, Lucie; Hvězdová, Zuzana; Laga, Richard; Filippov, Sergey K.; Černoch, Peter; Pechar, Michal; Janoušková, Olga; Šírová, Milada; Etrych, Tomáš

    2017-01-01

    Roč. 245, 10 January (2017), s. 41-51 ISSN 0168-3659 R&D Projects: GA MZd(CZ) NV16-28600A; GA MŠk(CZ) LO1507; GA MŠk(CZ) LQ1604; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61389013 ; RVO:61388971 Keywords : multidrug resistance * P-glycoprotein inhibitor * EPR effect Subject RIV: CD - Macromolecular Chemistry; EE - Microbiology, Virology (MBU-M) OBOR OECD: Polymer science; Microbiology (MBU-M) Impact factor: 7.786, year: 2016

  18. Studies on tridecaptin B(1), a lipopeptide with activity against multidrug resistant Gram-negative bacteria.

    Science.gov (United States)

    Cochrane, Stephen A; Lohans, Christopher T; van Belkum, Marco J; Bels, Manon A; Vederas, John C

    2015-06-07

    Previously other groups had reported that Paenibacillus polymyxa NRRL B-30507 produces SRCAM 37, a type IIA bacteriocin with antimicrobial activity against Campylobacter jejuni. Genome sequencing and isolation of antimicrobial compounds from this P. polymyxa strain show that the antimicrobial activity is due to polymyxins and tridecaptin B1. The complete structural assignment, synthesis, and antimicrobial profile of tridecaptin B1 is reported, as well as the putative gene cluster responsible for its biosynthesis. This peptide displays strong activity against multidrug resistant Gram-negative bacteria, a finding that is timely to the current problem of antibiotic resistance.

  19. Utility of lytic bacteriophage in the treatment of multidrug-resistant Pseudomonas aeruginosa septicemia in mice

    Directory of Open Access Journals (Sweden)

    Vinodkumar C

    2008-07-01

    Full Text Available Drug resistance is the major cause of increase in morbidity and mortality in neonates. One thousand six hundred forty-seven suspected septicemic neonates were subjected for microbiological analysis over a period of 5 years. Forty-two P. aeruginosa were isolated and the antibiogram revealed that 28 P. aeruginosa were resistant to almost all the common drugs used (multidrug-resistant. The emergence of antibiotic-resistant bacterial strains is one of the most critical problems of modern medicine. As a result, a novel and most effective approaches for treating infection caused by multidrug-resistant bacteria are urgently required. In this context, one intriguing approach is to use bacteriophages (viruses that kill bacteria in the treatment of infection caused by drug-resistant bacteria. In the present study, the utility of lytic bacteriophages to rescue septicemic mice with multidrug-resistant (MDR P. aeruginosa infection was evaluated. MDR P. aeruginosa was used to induce septicemia in mice by intraperitoneal (i.p. injection of 10 7 CFU. The resulting bacteremia was fatal within 48 hrs. The phage strain used in this study had lytic activity against a wide range of clinical isolates of MDR P. aeruginosa. A single i.p. injection of 3 x 10 9 PFU of the phage strain, administered 45 min after the bacterial challenge, was sufficient to rescue 100% of the animals. Even when treatment was delayed to the point where all animals were moribund, approximately 50% of them were rescued by a single injection of this phage preparation. The ability of this phage to rescue septicemic mice was demonstrated to be due to the functional capabilities of the phage and not to a nonspecific immune effect. The rescue of septicemic mice could be affected only by phage strains able to grow in vitro on the bacterial host used to infect the animals and when such strains are heat-inactivated, they lose their ability to rescue the infected mice. Multidrug-resistant bacteria have

  20. The application of 99Tcm-MIBI scintimammography to diagnose multidrug resistance of breast cancer

    International Nuclear Information System (INIS)

    Cheng Bing

    2002-01-01

    The author discussed the main mechanism of multidrug resistance of breast cancer tissues, and the correlation between technetium-99m sestamibi ( 99 Tc m -MIBI) breast imaging results, with the expression of drug resistance proteins P-glycoprotein and glutathione-S-transferase-π in human breast cancer. Through not all the results reported before matched each other, as a kind of a noninvasive simple functional test imaging technology in vitro, SPECT can be used to diagnose P-glycoprotein expression in breast cancer, and can be used to predict chemotherapy response

  1. Advantage and limitations of nitrofurantoin in multi-drug resistant Indian scenario

    Directory of Open Access Journals (Sweden)

    Laishram Shakti

    2015-01-01

    Full Text Available Infections caused by antibiotic resistant pathogens are of significant concern and are associated with higher mortality and morbidity. Nitrofurantoin is a broad-spectrum bactericidal antibiotic and is effectively used to treat urinary tract infections (UTIs caused by E. coli, Klebsiella sp., Enterobacter sp., Enterococcus sp. and Staphylococcus aureus. It interfere with the synthesis of cell wall, bacterial proteins and DNA of both Gram positive and Gram negative pathogens. Nitrofurantoin has been used successfully for treatment and prophylaxis of acute lower urinary tract infections. With the emergence of antibiotic resistance, nitrofurantoin has become the choice of agent for treating UTIs caused by multi-drug resistant pathogens.

  2. MarA-like regulator of multidrug resistance in Yersinia pestis.

    Science.gov (United States)

    Udani, Rupa A; Levy, Stuart B

    2006-09-01

    MarA47(Yp) from Yersinia pestis, showing 47% identity to Escherichia coli MarA in its N terminus, caused resistance to antibiotics and to organic solvents when expressed in both E. coli and Y. pestis. Resistance was linked to increased expression of the AcrAB multidrug efflux pump. In four of five spontaneous multidrug-resistant mutants of Y. pestis independently selected by growth on tetracycline, the marA47(Yp) gene was overexpressed. The findings suggest that marA47(Yp) is a marA ortholog in Y. pestis.

  3. Can Brazil play a more important role in global tuberculosis drug production? An assessment of current capacity and challenges.

    Science.gov (United States)

    Gemal, Andre; Keravec, Joel; Menezes, Alexandre; Trajman, Anete

    2013-03-27

    Despite the existence of effective treatment, tuberculosis is still a global public health issue. The World Health Organization recommends a six-month four-drug regimen in fixed-dose combination formulation to treat drug sensitive tuberculosis, and long course regimens with several second-line drugs to treat multi-drug resistant tuberculosis. To achieve the projected tuberculosis elimination goal by 2050, it will be essential to ensure a non-interrupted supply of quality-assured tuberculosis drugs. However, quality and affordable tuberculosis drug supply is still a significant challenge for National Tuberculosis Programs. Quality drug production requires a combination of complex steps. The first challenge is to guarantee the quality of tuberculosis active pharmaceutical ingredients, then ensure an adequate manufacturing process, according to international standards, to guarantee final product's safety, efficacy and quality. Good practices for storage, transport, distribution and quality control procedures must follow. In contrast to other high-burden countries, Brazil produces tuberculosis drugs through a strong network of public sector drug manufacturers regulated by a World Health Organization-certified national sanitary authority. The installed capacity for production surpasses the 71,000 needed treatments in the country. However, in order to be prepared to act as a global supplier, important bottlenecks are to be overcome. This article presents an in-depth analysis of the current status of production of tuberculosis drugs in Brazil and the bottlenecks and opportunities for the country to sustain national demand and play a role as a potential global supplier. Raw material and drug production, quality control, international certification and pre-qualification, political commitment and regulatory aspects are discussed, as well recommendations for tackling these bottlenecks. This discussion becomes more important as new drugs and regimens to treat tuberculosis are

  4. Identification of multi-drug resistant Pseudomonas aeruginosa clinical isolates that are highly disruptive to the intestinal epithelial barrier

    Directory of Open Access Journals (Sweden)

    Shevchenko Olga

    2006-06-01

    Full Text Available Abstract Background Multi-drug resistant Pseudomonas aeruginosa nosocomial infections are increasingly recognized worldwide. In this study, we focused on the virulence of multi-drug resistant clinical strains P. aeruginosa against the intestinal epithelial barrier, since P. aeruginosa can cause lethal sepsis from within the intestinal tract of critically ill and immuno-compromised patients via mechanisms involving disruption of epithelial barrier function. Methods We screened consecutively isolated multi-drug resistant P. aeruginosa clinical strains for their ability to disrupt the integrity of human cultured intestinal epithelial cells (Caco-2 and correlated these finding to related virulence phenotypes such as adhesiveness, motility, biofilm formation, and cytotoxicity. Results Results demonstrated that the majority of the multi-drug resistant P. aeruginosa clinical strains were attenuated in their ability to disrupt the barrier function of cultured intestinal epithelial cells. Three distinct genotypes were found that displayed an extreme epithelial barrier-disrupting phenotype. These strains were characterized and found to harbor the exoU gene and to display high swimming motility and adhesiveness. Conclusion These data suggest that detailed phenotypic analysis of the behavior of multi-drug resistant P. aeruginosa against the intestinal epithelium has the potential to identify strains most likely to place patients at risk for lethal gut-derived sepsis. Surveillance of colonizing strains of P. aeruginosa in critically ill patients beyond antibiotic sensitivity is warranted.

  5. Pharmacological modification of multi-drug resistance (MDR) in vitro detected by a novel fluorometric microculture cytotoxicity assay. Reversal of resistance and selective cytotoxic actions of cyclosporin A and verapamil on MDR leukemia T-cells.

    Science.gov (United States)

    Larsson, R; Nygren, P

    1990-07-15

    A novel fluorometric microculture cytotoxicity assay (FMCA), based on measurements of fluorescein diacetate (FDA) hydrolysis and DNA staining by Hoechst 33342, was used for drug sensitivity testing and detection of resistance reversal in acute lymphoblastic leukemia (ALL) cell lines. The 72-hr assay was found to be sensitive, reproducible and linearly related to the number of viable cells within a broad range of cell concentrations. At clinically achievable drug concentrations, the calcium channel blocker Verapamil (ver) and the immunosuppressant Cyclosporin A (csA) were found to partly reverse acquired Vincristine (vcr) resistance in multi-drug resistant (MDR) T-ALL L100 cells with little or no effect on the drug-sensitive parental L0 cell line. By combining the fluorometric indices, we found that low concentrations of csA were growth-inhibitory, whereas higher concentrations (greater than 10 micrograms/ml) were progressively cytotoxic for drug-sensitive L0 cells. In MDR L100 cells, on the other hand, csA produced significant cell kill even at low drug concentrations. Ver had no effects on sensitive L0 cells but showed considerable cytotoxic action towards MDR L100 cells. There was no apparent relationship between drug reversal of vcr resistance and the cytotoxic actions of the drug per se since the calcium channel blocker diltiazem (dil) significantly potentiated the actions of vcr on MDR L100 cells without being more toxic to these cells (compared to vcr-sensitive L0 cells).

  6. Membrane microparticles mediate transfer of P-glycoprotein to drug sensitive cancer cells.

    Science.gov (United States)

    Bebawy, M; Combes, V; Lee, E; Jaiswal, R; Gong, J; Bonhoure, A; Grau, G E R

    2009-09-01

    Multidrug resistance (MDR), a significant impediment to the successful treatment of cancer clinically, has been attributed to the overexpression of P-glycoprotein (P-gp), a plasma membrane multidrug efflux transporter. P-gp maintains sublethal intracellular drug concentrations by virtue of its drug efflux capacity. The cellular regulation of P-gp expression is currently known to occur at either pre- or post-transcriptional levels. In this study, we identify a 'non-genetic' mechanism whereby microparticles (MPs) serve as vectors in the acquisition and spread of MDR. MPs isolated from drug-resistant cancer cells (VLB(100)) were co-cultured with drug sensitive cells (CCRF-CEM) over a 4 h period to allow for MP binding and P-gp transfer. Presence of P-gp on MPs was established using flow cytometry (FCM) and western blotting. Whole-cell drug accumulation assays using rhodamine 123 and daunorubicin (DNR) were carried out to validate the transfer of functional P-gp after co-culture. We establish that MPs shed in vitro from drug-resistant cancer cells incorporate cell surface P-gp from their donor cells, effectively bind to drug-sensitive recipient cells and transfer functional P-gp to the latter. These findings serve to substantially advance our understanding of the molecular basis for the emergence of MDR in cancer clinically and lead to new treatment strategies which target and inhibit MP mediated transfer of P-gp during the course of treatment.

  7. Surveillance of extensively drug-resistant tuberculosis in Europe, 2003-2007.

    NARCIS (Netherlands)

    Devaux, I.; Manissero, D.; Fernandez de la Hoz, K.; Kremer, K.; Soolingen, D. van

    2010-01-01

    This paper describes the results of second-line drug (SLD) susceptibility tests among multidrug-resistant tuberculosis (MDR TB) cases reported in 20 European countries aiming to identify extensively drug-resistant tuberculosis (XDR TB) cases. A project on molecular surveillance of MDR TB cases was

  8. Beijing Lineage of MDR Mycobacterium tuberculosis in Bulgaria, 2007-2011

    NARCIS (Netherlands)

    Panaiotov, Stefan; Bachiyska, Elizabeta; Yordanova, Stanislava; Atanasova, Yuliana; Brankova, Nadia; Levterova, Viktoria; Sengstake, Sarah; Anthony, Richard; Bergval, Indra; Sola, Christophe; Kantardjiev, Todor

    2014-01-01

    To assess the spread of the Mycobacterium tuberculosis Beijing genotype among patients with multidrug-resistant and extensively resistant tuberculosis in Bulgaria, we genotyped 188 (72%) of 261 microbiologically confirmed resistant isolates obtained during 2007-2011. The estimated prevalence of the

  9. Isolation and partial characterization of soils actinomycetes with antimicrobial activity against multidrug-resistant bacteria

    Directory of Open Access Journals (Sweden)

    Romina Belén Parada

    2017-07-01

    Full Text Available Two hundred and thirty four actinobacteria strains were isolated from Argentinian and Peruvian soil in order to evaluate the antimicrobial activity against multidrug resistant bacteria On the basis of their antagonist activity against methicillin-resistant Staphylococcus aureus (MRSA and two vancomycin-resistant Enterococcus (EVR-Van A and  EVR Van B,13 strains were selected. The presence of NRPS, PKS-I and PKS-II genes were also investigated by PCR techniques. Among the 13 selected actinobacteria, strain AC69C displayed the higher activity in diffusion tests in solid medium and was further evaluated for the production of antagonist metabolites in liquid media. The best results were obtained using fermentation broth with carbohydrates, when starch and glucose were used in combination. Antimicrobial activities of 640 arbitrary units (AU, 320 AU, 320 AU and 80 AU were obtained against EVR-Van A, EVR-Van B, Listeria monocytogenes ATCC7644 and MRSA, respectively. PCR amplification of 16S rRNA gene and subsequent phylogenetic analysis of AC69C strain displayed a 100 % homology with Streptomyces antibioticus NRRL B-1701. It was not possible to establish a correlation between the amplified genes and antimicrobial activity of the 13 selected strains. The results of this work show the wide distribution of actinobacteria in soil and the importance of the isolation of strain to screen novel active metabolites against multidrug resistant bacteria of clinical origin.

  10. [Potential antimicrobial drug interactions in clinical practice: consequences of polypharmacy and multidrug resistance].

    Science.gov (United States)

    Martínez-Múgica, Cristina

    2015-12-01

    Polypharmacy is a growing problem nowadays, which can increase the risk of potential drug interactions, and result in a loss of effectiveness. This is particularly relevant to the anti-infective therapy, especially when infection is produced by resistant bacteria, because therapeutic options are limited and interactions can cause treatment failure. All antimicrobial prescriptions were retrospectively reviewed during a week in the Pharmacy Department, in order to detect potential drug-interactions and analysing their clinical significance. A total of 314 antimicrobial prescriptions from 151 patients were checked. There was at least one potential interaction detected in 40% of patients, being more frequent and severe in those infected with multidrug-resistant microorganisms. Drugs most commonly involved were quinolones, azoles, linezolid and vancomycin. Potential drug interactions with antimicrobial agents are a frequent problem that can result in a loss of effectiveness. This is why they should be detected and avoided when possible, in order to optimize antimicrobial therapy, especially in case of multidrug resistant infections.

  11. Role of the Caenorhabditis elegans multidrug resistance gene, mrp-4, in gut granule differentiation.

    Science.gov (United States)

    Currie, Erin; King, Brian; Lawrenson, Andrea L; Schroeder, Lena K; Kershner, Aaron M; Hermann, Greg J

    2007-11-01

    Caenorhabditis elegans gut granules are lysosome-related organelles with birefringent contents. mrp-4, which encodes an ATP-binding cassette (ABC) transporter homologous to mammalian multidrug resistance proteins, functions in the formation of gut granule birefringence. mrp-4(-) embryos show a delayed appearance of birefringent material in the gut granule but otherwise appear to form gut granules properly. mrp-4(+) activity is required for the extracellular mislocalization of birefringent material, body-length retraction, and NaCl sensitivity, phenotypes associated with defective gut granule biogenesis exhibited by embryos lacking the activity of GLO-1/Rab38, a putative GLO-1 guanine nucleotide exchange factor GLO-4, and the AP-3 complex. Multidrug resistance protein (MRP)-4 localizes to the gut granule membrane, consistent with it playing a direct role in the transport of molecules that compose and/or facilitate the formation of birefringent crystals within the gut granule. However, MRP-4 is also present in oocytes and early embryos, and our genetic analyses indicate that its site of action in the formation of birefringent material may not be limited to just the gut granule in embryos. In a search for genes that function similarly to mrp-4(+), we identified WHT-2, another ABC transporter that acts in parallel to MRP-4 for the formation of birefringent material in the gut granule.

  12. Detection and characterisation of multi-drug resistance protein 1 (MRP-1) in human mitochondria.

    Science.gov (United States)

    Roundhill, E A; Burchill, S A

    2012-03-13

    Overexpression of plasma membrane multi-drug resistance protein 1 (MRP-1) can lead to multidrug resistance. In this study, we describe for the first time the expression of mitochondrial MRP-1 in untreated human normal and cancer cells and tissues. MRP-1 expression and subcellular localisation in normal and cancer cells and tissues was examined by differential centrifugation and western blotting, and immunofluorescence microscopy. Viable mitochondria were isolated and MRP-1 efflux activity measured using the calcein-AM functional assay. MRP-1 expression was increased using retroviral infection and specific overexpression confirmed by RNA array. Cell viability was determined by trypan blue exclusion and annexin V-propidium iodide labelling of cells. MRP-1 was detected in the mitochondria of cancer and normal cells and tissues. The efflux activity of mitochondrial MRP-1 was more efficient (55-64%) than that of plasma membrane MRP-1 (11-22%; PMRP-1 expression resulted in a preferential increase in mitochondrial MRP-1, suggesting selective targeting to this organelle. Treatment with a non-lethal concentration of doxorubicin (0.85 nM, 8 h) increased mitochondrial and plasma membrane MRP-1, increasing resistance to MRP-1 substrates. For the first time, we have identified MRP-1 with efflux activity in human mitochondria. Mitochondrial MRP-1 may be an exciting new therapeutic target where historically MRP-1 inhibitor strategies have limited clinical success.

  13. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Science.gov (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  14. 20(S)-Protopanaxadiol (PPD) analogues chemosensitize multidrug-resistant cancer cells to clinical anticancer drugs.

    Science.gov (United States)

    Liu, Junhua; Wang, Xu; Liu, Peng; Deng, Rongxin; Lei, Min; Chen, Wantao; Hu, Lihong

    2013-07-15

    Novel 20(S)-protopanoxadiol (PPD) analogues were designed, synthesized, and evaluated for the chemosensitizing activity against a multidrug resistant (MDR) cell line (KBvcr) overexpressing P-glycoprotein (P-gp). Structure-activity relationship analysis showed that aromatic substituted aliphatic amine at the 24-positions (groups V) effectively and significantly sensitized P-gp overexpressing multidrug resistant (MDR) cells to anticancer drugs, such as docetaxel (DOC), vincristine (VCR), and adriamycin (ADM). PPD derivatives 12 and 18 showed 1.3-2.6 times more effective reversal ability than verapamil (VER) for DOC and VCR. Importantly, no cytotoxicity was observed by the active PPD analogues (5μM) against both non-MDR and MDR cells, suggesting that PPD analogues serve as novel lead compounds toward a potent and safe resistance modulator. Moreover, a preliminary mechanism study demonstrated that the chemosensitizing activity of PPD analogues results from inhibition of P-glycoprotein (P-gp) overexpressed in MDR cancer cells. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. Detection of VIM-2-, IMP-1- and NDM-1-producing multidrug resistant Pseudomonas aeruginosa in Malaysia.

    Science.gov (United States)

    Liew, Siew Mun; Rajasekaram, Ganeswrei; Puthucheary, Savithri D; Chua, Kek Heng

    2018-02-09

    The increasing incidence of carbapenem-resistant Pseudomonas aeruginosa along with the discovery of novel metallo-β-lactamases (MBLs) is of concern. In this study, the isolation of Malaysian MBL-producing P. aeruginosa clinical strains was investigated. Fifty-three P. aeruginosa clinical strains were isolated from different patients in Sultanah Aminah Hospital, Johor Bahru, Malaysia in 2015. Antimicrobial susceptibility test was conducted. Minimum inhibitory concentrations (MICs) of imipenem and meropenem were determined by Etest. The carbapenem-resistant strains were screened for MBL production by IMP-EDTA double disk synergy test (DDST), MBL imipenem/imipenem-inhibitor (IP/IPI) Etest and polymerase chain reaction (PCR). Genotyping was performed by multilocus sequence typing (MLST) analysis. Three (5.7%) clinical strains were identified as MBL producers. Multidrug resistance was observed in the three strains, and two were resistant to all the antimicrobials tested. Sequencing analysis confirmed the three strains to harbour carbapenemase genes: one with bla IMP-1 , one with bla VIM-2 and the other with bla NDM-1 genes. These multidrug resistant strains were identified as sequence type (ST) 235 and ST308. None of the bla IMP-1 and bla NDM-1 genes have been reported in Malaysian P. aeruginosa. The emergence of imipenemase 1 (IMP-1)- and New Delhi metallo-β-lactamase 1 (NDM-1)-producing P. aeruginosa in Malaysia maybe travel-associated. Copyright © 2018. Published by Elsevier Ltd.

  16. Bioprospecting marine actinomycetes for multidrug-resistant pathogen control from Rameswaram coastal area, Tamil Nadu, India.

    Science.gov (United States)

    Wahaab, Femina; Subramaniam, Kalidass

    2018-01-01

    A potent Streptomyces bacillaris strain RAM25C4 was isolated for controlling methicillin-resistant Staphylococcus aureus and multidrug-resistant bacteria such as Staphylococcus aureus, Acinetobacter baumannii, and Pseudomonas aeruginosa. A total of 131 actinomycetes were isolated from the Rameswaram coastal region, Tamil Nadu, India. Among 131 actinomycetes, maximum number of actinomycetes (55%) isolated at the distance of 3-6 m from seashore. Out of 131 actinomycetes, 85% of the actinomycetes exhibited different degree of antagonistic activity against test pathogens. The antagonistic activity evaluated using actinomycetes direct culture filtrate and culture filtrate extracts. Among these culture filtrate, extracts had supreme antagonistic activity against multidrug-resistant bacteria and the solvent ethyl acetate was the best for extracting secondary metabolites from actinomycetes. In HPTLC analysis, the presence of macrolides, terpenoids, and quinolones was identified in RAM25C4 extract. In GC-MS analysis, various potent compounds such as phenolic compound-2,6-di-tert-butylphenol, alkaloid compound-1H, 5H, pyrrolo (1' 2':3, 4) imidazo, and quinolone compound-1,4-benzenediol, 2,5-bis(1,1-dimethylethyl) were identified in the ethyl acetate extract of RAM25C4. The phylogenetic analysis of 16S rRNA gene sequence of RAM25C4 isolate was deposited in NCBI with name Streptomyces bacillaris strain RAM25C4 and accession number KM513543.

  17. Non-cytotoxic nanomaterials enhance antimicrobial activities of cefmetazole against multidrug-resistant Neisseria gonorrhoeae.

    Directory of Open Access Journals (Sweden)

    Lan-Hui Li

    Full Text Available The emergence and spread of antibiotic-resistant Neisseria gonorrhoeae has led to difficulties in treating patients, and novel strategies to prevent and treat this infection are urgently needed. Here, we examined 21 different nanomaterials for their potential activity against N. gonorrhoeae (ATCC 49226. Silver nanoparticles (Ag NPs, 120 nm showed the greatest potency for reducing N. gonorrhoeae colony formation (MIC: 12.5 µg/ml and possessed the dominant influence on the antibacterial activity with their properties of the nanoparticles within a concentration range that did not induce cytotoxicity in human fibroblasts or epithelial cells. Electron microscopy revealed that the Ag NPs significantly reduced bacterial cell membrane integrity. Furthermore, the use of clinical isolates of multidrug-resistant N. gonorrhoeae showed that combined treatment with 120 nm Ag NPs and cefmetazole produced additive effects. This is the first report to screen the effectiveness of nanomaterials against N. gonorrhoeae, and our results indicate that 120 nm Ag NPs deliver low levels of toxicity to human epithelial cells and could be used as an adjuvant with antibiotic therapy, either for topical use or as a coating for biomaterials, to prevent or treat multidrug-resistant N. gonorrhoeae.

  18. Risk Factors for Multidrug-resistant Pseudomonas aeruginosa Among Hospitalized Patients at a Malaysian Hospital

    International Nuclear Information System (INIS)

    Mohd, N.M.D.; Nurnajwa, M.H.; Lay, J.; Teoh, J.C.; Syafinaz, A.N.; Niazlin, M.T.

    2015-01-01

    A case-control study was conducted based on medical cases of 100 hospitalized patients with Pseudomonas aeruginosa-isolation at a Malaysian hospital. Cases with 50 multidrug-resistant P. aeruginosa MDRPA and 50 non-multidrug-resistant P. aeruginosa (NMDRPA) were randomly included and compared with socio-demographic and clinical data of the patients, using Chi-square and Fisher's exact tests as the statistical tool. Analysis found no significant association between MDRPA with ages, gender and ethnicity of patients (p>0.050). Other risk factors being investigated were invasive procedure, immunosuppression, bedridden and clinical diagnosis such as central nervous- and respiratory-system disorder, as well as antibiotic exposure during hospitalization and duration of hospital stay with only the last two were found to have significant association (p=0.035 and 0.019, respectively). Some other studies also reported a similar association indicating that the two factors could serve as an important predictive tool for isolation of MDRPA. More studies involving a larger sampling size are warranted to establish the association. (author)

  19. Factors influencing survival in patients with multidrug-resistant Acinetobacter baumannii infection

    Directory of Open Access Journals (Sweden)

    Mariana Lima Prata-Rocha

    Full Text Available Multidrug-resistant (MDR Acinetobacter baumannii (Acb is a rapidly emerging pathogen in healthcare settings. The aim of this study was to evaluate the predictors of poor outcome in patients with MDR Acb. This is the first report documenting factors influencing survival in patients with MDR Acb in this tertiary hospital. This study is a prospective of the hospital epidemiology database. A total of 73 patients with 84 Acb isolates were obtained between August 2009 and October 2010 in this hospital. In the present study, the 30-day mortality rate was 39.7%. Of 84 Acb isolates, 50 (59% were MDR, nine (11% were pan-resistant, and 25 (30% were non-MDR. The non-MDR isolates were used as the control group. The factors significantly associated with multidrug resistance included previous surgeries, presence of comorbidity (renal disease, use of more than two devices, parenteral nutrition, and inappropriate antimicrobial therapy. Significant predictors of 30-day mortality in the univariate analysis included pneumonia, diabetes mellitus, renal disease, use of more than two devices, and inappropriate antimicrobial therapy administered within two days of the onset of infection. The factors associated with mortality in patients with MDR Acb infection in this study were: age > 60 years, pneumonia, diabetes mellitus, renal disease, use of more than two invasive procedures, and inappropriate antimicrobial therapy. Vigilance is needed to prevent outbreaks of this opportunistic and deadly pathogen.

  20. Dominance of multidrug resistant CC271 clones in macrolide-resistant streptococcus pneumoniae in Arizona

    Directory of Open Access Journals (Sweden)

    Bowers Jolene R

    2012-01-01

    Full Text Available Abstract Background Rates of resistance to macrolide antibiotics in Streptococcus pneumoniae are rising around the world due to the spread of mobile genetic elements harboring mef(E and erm(B genes and post-vaccine clonal expansion of strains that carry them. Results Characterization of 592 clinical isolates collected in Arizona over a 10 year period shows 23.6% are macrolide resistant. The largest portion of the macrolide-resistant population, 52%, is dual mef(E/erm(B-positive. All dual-positive isolates are multidrug-resistant clonal lineages of Taiwan19F-14, mostly multilocus sequence type 320, carrying the recently described transposon Tn2010. The remainder of the macrolide resistant S. pneumoniae collection includes 31% mef(E-positive, and 9% erm(B-positive strains. Conclusions The dual-positive, multidrug-resistant S. pneumoniae clones have likely expanded by switching to non-vaccine serotypes after the heptavalent pneumococcal conjugate vaccine release, and their success limits therapy options. This upsurge could have a considerable clinical impact in Arizona.

  1. The culturable soil antibiotic resistome: a community of multi-drug resistant bacteria.

    Science.gov (United States)

    Walsh, Fiona; Duffy, Brion

    2013-01-01

    Understanding the soil bacterial resistome is essential to understanding the evolution and development of antibiotic resistance, and its spread between species and biomes. We have identified and characterized multi-drug resistance (MDR) mechanisms in the culturable soil antibiotic resistome and linked the resistance profiles to bacterial species. We isolated 412 antibiotic resistant bacteria from agricultural, urban and pristine soils. All isolates were multi-drug resistant, of which greater than 80% were resistant to 16-23 antibiotics, comprising almost all classes of antibiotic. The mobile resistance genes investigated, (ESBL, bla NDM-1, and plasmid mediated quinolone resistance (PMQR) resistance genes) were not responsible for the respective resistance phenotypes nor were they present in the extracted soil DNA. Efflux was demonstrated to play an important role in MDR and many resistance phenotypes. Clinically relevant Burkholderia species are intrinsically resistant to ciprofloxacin but the soil Burkholderia species were not intrinsically resistant to ciprofloxacin. Using a phenotypic enzyme assay we identified the antibiotic specific inactivation of trimethoprim in 21 bacteria from different soils. The results of this study identified the importance of the efflux mechanism in the soil resistome and variations between the intrinsic resistance profiles of clinical and soil bacteria of the same family.

  2. The culturable soil antibiotic resistome: a community of multi-drug resistant bacteria.

    Directory of Open Access Journals (Sweden)

    Fiona Walsh

    Full Text Available Understanding the soil bacterial resistome is essential to understanding the evolution and development of antibiotic resistance, and its spread between species and biomes. We have identified and characterized multi-drug resistance (MDR mechanisms in the culturable soil antibiotic resistome and linked the resistance profiles to bacterial species. We isolated 412 antibiotic resistant bacteria from agricultural, urban and pristine soils. All isolates were multi-drug resistant, of which greater than 80% were resistant to 16-23 antibiotics, comprising almost all classes of antibiotic. The mobile resistance genes investigated, (ESBL, bla NDM-1, and plasmid mediated quinolone resistance (PMQR resistance genes were not responsible for the respective resistance phenotypes nor were they present in the extracted soil DNA. Efflux was demonstrated to play an important role in MDR and many resistance phenotypes. Clinically relevant Burkholderia species are intrinsically resistant to ciprofloxacin but the soil Burkholderia species were not intrinsically resistant to ciprofloxacin. Using a phenotypic enzyme assay we identified the antibiotic specific inactivation of trimethoprim in 21 bacteria from different soils. The results of this study identified the importance of the efflux mechanism in the soil resistome and variations between the intrinsic resistance profiles of clinical and soil bacteria of the same family.

  3. Novel nanostructured enoxaparin sodium-PLGA hybrid carriers overcome tumor multidrug resistance of doxorubicin hydrochloride.

    Science.gov (United States)

    Wang, Jia; Wu, Lei; Kou, Longfa; Xu, Meng; Sun, Jin; Wang, Yongjun; Fu, Qiang; Zhang, Peng; He, Zhonggui

    2016-11-20

    Novel enoxaparin sodium-PLGA hybrid nanocarries (EPNs) were successfully designed for sustained delivery of hydrophilic cationic doxorubicin hydrochloride (DOX) and to overcome multidrug resistance (MDR). By incorporation of the negative polymer of enoxaparin sodium (ES), DOX was highly encapsulated into EPNs with an encapsulation efficiency of 92.49%, and ES effectively inhibited the proliferation of HUVEC cell lines. The in vivo pharmacokinetics study after intravenous injection indicated that DOX-loaded EPNs (DOX-EPNs) exhibited a higher area under the curve (AUC) and a longer half-life (t 1/2 ) in comparison with DOX solution (DOX-Sol). The biodistribution study demonstrated that DOX-EPNs increased the DOX level in plasma and decreased the accumulation of DOX in liver and spleen. Compared with DOX-Sol, DOX-EPNs increased the cytotoxicity in P-gp over-expressing MCF-7/Adr cells, attributed to the higher intracellular efficiency of DOX produced by the EPNs. DOX-EPNs entered into resistant tumor cells by multiple endocytosis pathways, which resulted in overcoming the multidrug resistance of MCF-7/Adr cells by escaping the efflux induced by P-gp transporters. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Multidrug Resistance Acinetobacter Bacteremia Secondary to Ventilator-Associated Pneumonia: Risk Factors and Outcome.

    Science.gov (United States)

    Brotfain, Evgeni; Borer, Abraham; Koyfman, Leonid; Saidel-Odes, Lisa; Frenkel, Amit; Gruenbaum, Shaun E; Rosenzweig, Vsevolod; Zlotnik, Alexander; Klein, Moti

    2017-10-01

    Acinetobacter baumannii is a multidrug resistant (MDR), gram-negative bacterium commonly implicated in ventilator-associated pneumonia (VAP) in critically ill patients. Patients in the intensive care unit (ICU) with VAP often subsequently develop A baumannii bacteremia, which may significantly worsen outcomes. In this study, we retrospectively reviewed the clinical and laboratory records of 129 ICU patients spanning 6 years with MDR A baumannii VAP; 46 (35%) of these patients had concomitant MDR A baumannii bacteremia. The ICU mortality rate was higher in patients with VAP having A baumannii bacteremia compared to nonbacteremic patients (32.4% vs 9.6% respectively, P 65 years, an Acute Physiology and Chronic Health Evaluation II (APACHE-II) score higher than 20, a Sequential Organ Failure Assessment (SOFA) score higher than 7 on the day of bacteremia, and the presence of comorbid disease (chronic obstructive pulmonary disease [COPD] and chronic renal failure) were found to be independent risk factors for in-hospital mortality in this population. Multidrug resistant A baumannii was not an independent risk factor for mortality. Although the presence of comorbid diseases (COPD and chronic renal failure) and severity of disease (APACHE > 20 and SOFA >7) were found to be independent risk factors for ICU mortality, MDR A baumannii bacteremia was not an independent risk factor for mortality in our critically ill population.

  5. Development of hydroxyapatite-chitosan gel sunscreen combating clinical multidrug-resistant bacteria

    Science.gov (United States)

    Morsy, Reda; Ali, Sameh S.; El-Shetehy, Mohamed

    2017-09-01

    The several harmful effects on infected human skin resulting from exposure to the sun's UV radiation generate an interest in the development of a multifunctional hydroxyapatite-chitosan (HAp-chitosan) gel that works as an antibacterial sunscreen agent for skin care. In this work, HAp-chitosan gel was synthesized via coprecipitation method by dissolving chitosan in phosphoric acid and adding HAp. The characteristics of HAp-chitosan composite were investigated by conventional techniques, such as XRD, FTIR, and SEM techniques, while its sunscreen property was investigated by UV-spectroscopy. In addition to the influence of the gel on bacterial cell morphology, the antibacterial activity of HAp-chitosan gel against clinical multidrug resistant skin pathogens, such as Staphylococcus aureus, Klebsiella pneumoniae, and Pseudomonas aeruginosa has been studied. The results revealed the formation of HAp-chitosan gel having nanosized particles, which confers protection against UV-radiation. The antibacterial activity records showed that chitosan-HAp gel exhibits a significant effect on the growth and ultrastructure of multi-drug resistant bacterial activities. Therefore, the chitosan-HAp gel is promising for skin health care as an antibacterial sunscreen.

  6. Multi-drug resistant Acinetobacter infections in critically injured Canadian forces soldiers

    Directory of Open Access Journals (Sweden)

    Brisebois Ronald

    2007-08-01

    Full Text Available Abstract Background Military members, injured in Afghanistan or Iraq, have returned home with multi-drug resistant Acinetobacter baumannii infections. The source of these infections is unknown. Methods Retrospective study of all Canadian soldiers who were injured in Afghanistan and who required mechanical ventilation from January 1 2006 to September 1 2006. Patients who developed A. baumannii ventilator associated pneumonia (VAP were identified. All A. baumannii isolates were retrieved for study patients and compared with A. baumannii isolates from environmental sources from the Kandahar military hospital using pulsed-field gel electrophoresis (PFGE. Results During the study period, six Canadian Forces (CF soldiers were injured in Afghanistan, required mechanical ventilation and were repatriated to Canadian hospitals. Four of these patients developed A. baumannii VAP. A. baumannii was also isolated from one environmental source in Kandahar – a ventilator air intake filter. Patient isolates were genetically indistinguishable from each other and from the isolates cultured from the ventilator filter. These isolates were resistant to numerous classes of antimicrobials including the carbapenems. Conclusion These results suggest that the source of A. baumannii infection for these four patients was an environmental source in the military field hospital in Kandahar. A causal linkage, however, was not established with the ventilator. This study suggests that infection control efforts and further research should be focused on the military field hospital environment to prevent further multi-drug resistant A. baumannii infections in injured soldiers.

  7. ANTIMICROBIAL ACTIVITY OF PINEAPPLE (ANANAS COMOSUS L. MERR EXTRACT AGAINST MULTIDRUG-RESISTANT OF PSEUDOMONAS AERUGINOSA: AN IN VITRO STUDY

    Directory of Open Access Journals (Sweden)

    Rahmat Sayyid Zharfan

    2017-08-01

    Full Text Available Pseudomonas aeruginosa is the main cause of nosocomial infection which is responsible for 10% of hospital-acquired infection. Pseudomonas aeruginosa tends to mutate and displays potential for development of antibiotic resistance. Approximately, 10% of global bacterial isolates are found as Multidrug-resistant Pseudomonas aeruginosa. Pseudomonas aeruginosa have a quite tremendous severity index, especially on pneumonia and urinary tract infections, even sepsis, which 50% mortality rate. Pineapple (Ananas comosus L. Merr has antimicrobial properties. The active antimicrobial compounds in Ananas comosus L. Merr include saponin and bromelain. This research aims to find the potency of antimicrobial effect of pineapple (Ananas comosus L. Merr extract towards Multidrug-resistant Pseudomonas aeruginosa. Multidrug-resistant Pseudomonas aeruginosa specimen is obtained from patient’s pus in orthopaedic department, Dr Soetomo Public Hospital, Surabaya. Multidrug-resistant Pseudomonas aeruginosa specimen is resistant to all antibiotic agents except cefoperazone-sulbactam. This research is conducted by measuring the Minimum Inhibitory Concentration (MIC through dilution test with Mueller-Hinton broth medium. Pineapple extract (Ananas comosus L. Merr. is dissolved in aquadest, then poured into test tube at varying concentrations (6 g/ml; 3 g/ml; 1.5 g/ml; 0.75 g/ml, 0.375 g/ml; and 0.1875 g/ml. After 24 hours’ incubation, samples are plated onto nutrient agar plate, to determine the Minimum Bactericidal Concentration (MBC. The extract of pineapple (Ananas comosus L. Merr has antimicrobial activities against Multidrug-resistant Pseudomonas aeruginosa. Minimum Inhibitory Concentration (MIC could not be determined, because turbidity changes were not seen. The Minimum Bactericidal Concentration (MBC of pineapple extract (Ananas comosus L. Merr to Multidrug-resistant Pseudomonas aeruginosa is 0.75 g/ml. Further study of in vivo is needed.

  8. Radiologic diagnosis of lung tuberculosis

    International Nuclear Information System (INIS)

    Eisenhuber, E.; Mostbeck, G.; Bankier, A.; Stadler, A.; Rumetshofer, R.

    2007-01-01

    The radiologic knowledge of tuberculosis-associated lung disease is an essential tool in the clinical diagnosis of tuberculosis. Chest radiography is the primary imaging method, but the importance of CT is still increasing, as CT is more sensitive in the detection of cavitation, of hilar and mediastinal lymphadenopathie, of endobronchial spread and of complications in the course of the disease. In addition, CT has been proven as a valuable technique in the assessment of tuberculosis activity, especially in patients where M. tuberculosis has not been detected in the sputum or in patients with multidrug-resistant tuberculosis. Depending on the immune status of the patient, the morphologic spectrum of tuberculosis is quite variable. Early diagnosis of tuberculosis is essential to prevent further spread of the disease. (orig.) [de

  9. Add-On Therapy with Ertapenem in Infections with Multidrug Resistant Gram-Negative Bacteria: Pediatric Experience

    Directory of Open Access Journals (Sweden)

    Sevgen Tanır Basaranoglu

    2017-01-01

    Full Text Available Optimal therapy for infections with carbapenem resistant GNB is not well established due to the weakness of data. Patients presenting with bloodstream infections caused by multidrug resistant Klebsiella pneumoniae were treated with a combination treatment. Optimal therapy for infections with carbapenem resistant Gram-negative bacteria is a serious problem in pediatric patients. We presented three cases who were successfully treated with addition of ertapenem to the combination treatment for bacteremia with multidrug resistant Klebsiella pneumoniae. Dual carbapenem treatment approach is a new approach for these infections and requires more data in children.

  10. Performance of the Abbott RealTime MTB RIF/INH resistance assay when used to test Mycobacterium tuberculosis specimens from Bangladesh

    Directory of Open Access Journals (Sweden)

    Kostera J

    2018-05-01

    Full Text Available Joshua Kostera, Gregor Leckie, Klara Abravaya, Hong Wang Abbott Molecular, Abbott Laboratories, Des Plaines, IL, USA Introduction: The Abbott RealTime MTB RIF/INH Resistance Assay (RT MTB RIF/INH is an assay for the detection of rifampicin (RIF- and/or isoniazid (INH-resistant Mycobacterium tuberculosis (MTB. The assay can be used to test sputum, bronchial alveolar lavage, and N-Acetyl-L-Cysteine (NALC/NaOH pellets prepared from these samples. The assay can be used in direct testing mode, or in reflex mode following a MTB positive result produced by its companion assay, Abbott RT MTB. Methods: In this study, the direct testing mode was used to test paired sputum and NALC/NaOH pellets prepared from sputum collected from Bangladesh TB patients. One hundred and thirty two paired samples were tested. Results: The RT MTB RIF/INH inhibition rate was 0%. One hundred and twenty-two paired samples had results above the assay limit of detection and were analyzed by comparing with results from phenotypic drug sensitivity testing, GeneXpert MTB/RIF (Xpert, and MTBDR plus (Hain. RT MTB RIF/INH results were in good agreement with those of GeneXpert and Hain. Conclusion: The ability of this assay to detect RIF and INH resistance may contribute to the global control of multidrug resistant tuberculosis. Keywords: tuberculosis, rifampicin, isoniazid, resistance

  11. Active surveillance for asymptomatic colonisation by multidrug-resistant bacteria in patients transferred to a tertiary care hospital in the occupied Palestinian territory.

    Science.gov (United States)

    Taha, Adham Abu; Daoud, Ayman; Zaid, Sawsan; Sammour, Sajida; Belleh, Maram; Daifi, Refqa

    2018-02-21

    Active surveillance is important in infection control programmes, allowing the detection of patients colonised with multi-drug resistant organisms and preventing the spread of multi-drug resistant organisms. The aim of this study was to determine the rate of asymptomatic colonisation with multi-drug resistant organisms and the prevalence of each organism in patients transferred to An-Najah National University Hospital, Nablus, occupied Palestinian territory. Patients transferred from other hospitals between January and December, 2015, were screened at time of admission by taking nasal, groin, and axillary swabs. Swabs were cultured and assessed for the presence of multi-drug resistant organisms (extended spectrum β-lactamase producers, Pseudomonas aeroginosae, Acinetobacter baumannii, methicillin-resistant Staphylococcus aureus, vancomycin-resistant enterococcus, and carbapenem-resistant enterobacteriaceae. Of the 822 screened patients, 265 (32%) had infections with multi-drug resistant organisms. 394 isolates of multi-drug resistant organisms were obtained: 131 (33%) isolates were extended spectrum β-lactamase producers, 119 (30%) isolates were P aeroginosae, 26 (9%) isolates were A baumannii, 94 (24%) isolates were methicillin-resistant S aureus, 13 (3%) isolates were vancomycin-resistant enterococci, and one (<1%) isolate was carbapenem-resistant enterobacteriaceae. We identified a high prevalence of asymptomatic colonisation with multidrug-resistant bacteria in transferred patients. These findings emphasise the need for a national strategy to combat the spread of multi-drug resistant organisms in the occupied Palestinian territory. An-Najah National University. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. Phenotypic Characterization of Multidrug-resistant Escherichia Coli with Special Reference to Extended-spectrum-beta-lactamases and Metallo-beta-lactamases in a Tertiary Care Center

    Directory of Open Access Journals (Sweden)

    Basudha Shrestha

    2015-06-01

    Conclusions: Beta-lactamase mediated resistance mechanisms are accounting very high in the multidrug resistant isolates of E. coli. Therefore, early detection of beta lactamase mediated resistant strains and their current antibiotic susceptibility pattern is necessary to avoid treatment failure and prevent the spread of MDR. Keywords: e. coli; extended-spectrum-β-lactamase; metallo-β-lactamase; multidrug-resistance.

  13. Tuberculosis

    OpenAIRE

    C. Robert Horsburgh, Jr

    2014-01-01

    This article reviews the published literature on tuberculosis from September 2012 to August 2013 and describes important advances in tuberculosis epidemiology, microbiology, pathology, clinical pharmacology, genetics, treatment and prevention.

  14. The demise of multidrug-resistant HIV-1: the national time trend in Portugal

    Science.gov (United States)

    Vercauteren, Jurgen; Theys, Kristof; Carvalho, Ana Patricia; Valadas, Emília; Duque, Luis Miguel; Teófilo, Eugénio; Faria, Telo; Faria, Domitília; Vera, José; Águas, Maria João; Peres, Susana; Mansinho, Kamal; Vandamme, Anne-Mieke; Camacho, Ricardo Jorge; Mansinho, Kamal; Cláudia Miranda, Ana; Aldir, Isabel; Ventura, Fernando; Nina, Jaime; Borges, Fernando; Valadas, Emília; Doroana, Manuela; Antunes, Francisco; João Aleixo, Maria; João Águas, Maria; Botas, Júlio; Branco, Teresa; Vera, José; Vaz Pinto, Inês; Poças, José; Sá, Joana; Duque, Luis; Diniz, António; Mineiro, Ana; Gomes, Flora; Santos, Carlos; Faria, Domitília; Fonseca, Paula; Proença, Paula; Tavares, Luís; Guerreiro, Cristina; Narciso, Jorge; Faria, Telo; Teófilo, Eugénio; Pinheiro, Sofia; Germano, Isabel; Caixas, Umbelina; Faria, Nancy; Paula Reis, Ana; Bentes Jesus, Margarida; Amaro, Graça; Roxo, Fausto; Abreu, Ricardo; Neves, Isabel

    2013-01-01

    Objectives Despite a decreasing mortality and morbidity in treated HIV-1 patients, highly active antiretroviral treatment (HAART) can still fail due to the development of drug resistance. Especially, multidrug-resistant viruses pose a threat to efficient therapy. We studied the changing prevalence of multidrug resistance (MDR) over time in a cohort of HIV-1-infected patients in Portugal. Patients and methods We used data of 8065 HIV-1-infected patients followed from July 2001 up to April 2012 in 22 hospitals located in Portugal. MDR at a specific date of sampling was defined as no more than one fully active drug (excluding integrase and entry inhibitors) at that time authorized by the Portuguese National Authority of Medicines and Health Products (INFARMED), as interpreted with the Rega algorithm version 8.0.2. A generalized linear mixed model was used to study the time trend of the prevalence of MDR. Results We observed a statistically significant decrease in the prevalence of MDR over the last decade, from 6.9% (95% CI: 5.7–8.4) in 2001–03, 6.0% (95% CI: 4.9–7.2) in 2003–05, 3.7% (95% CI: 2.8–4.8) in 2005–07 and 1.6% (95% CI: 1.1–2.2) in 2007–09 down to 0.6% (95% CI: 0.3–0.9) in 2009–12 [OR = 0.80 (95% CI: 0.75–0.86); P < 0.001]. In July 2011 the last new case of MDR was seen. Conclusions The prevalence of multidrug-resistant HIV-1 is decreasing over time in Portugal, reflecting the increasing efficiency of HAART and the availability of new drugs. Therefore, in designing a new drug, safety and practical aspects, e.g. less toxicity and ease of use, may need more attention than focusing mainly on efficacy against resistant strains. PMID:23228933

  15. Tuberculosis

    OpenAIRE

    Mochammad, Hatta

    2008-01-01

    This book chapter for medical students and researcher Tuberculosis is still one of the leading causes of death by infectious diseases with 2 million deaths per year and 9.2 million new cases of tuberculosis disease annually [1-3]. Besides, more than 2 milliard people are infected with latent tuberculosis infection (LTBI) [1-3]. Despite continuous effort in the prevention, monitoring and treatment of tuberculosis, the disease remains a major health problem in many countries [4-6...

  16. The social determinants of tuberculosis and their association with TB ...

    African Journals Online (AJOL)

    Progress made in TB control through the implementation of the DOTS strategy, has been retarded by factors such as poverty, the HIV pandemic and the advent of multidrug resistant tuberculosis. There is currently an increasing shift in TB control ...

  17. Anti-tuberculosis activities of the crude methanolic extract and ...

    African Journals Online (AJOL)

    Summary: Tuberculosis (TB) is of great public health burden globally especially in developing countries of Africa and Asia . Current TB regimen involves multiple therapies and of long duration leading to poor patient adherence. There is also the challenge of multidrug resistant TB. Hence, there is a need for discovery of new ...

  18. Therapeutic vaccines for tuberculosis-A systematic review

    NARCIS (Netherlands)

    Gröschel, Matthias I.; Prabowo, Satria A.; Cardona, Pere-Joan; Stanford, John L.; van der Werf, Tjip S.

    2014-01-01

    For eradication of tuberculosis (TB) by 2050, the declared aim of the Stop TB Partnership, novel treatment strategies are indispensable. The emerging epidemic of multi-drug resistant (MDR) TB has fuelled the debate about TB vaccines, as increasing numbers of patients can no longer be cured by

  19. Prevalence and risk factors for carriage of multi-drug resistant Staphylococci in healthy cats and dogs

    Science.gov (United States)

    Regula, Gertraud; Petrini, Orlando; Zinsstag, Jakob; Schelling, Esther

    2013-01-01

    We investigated the distribution of commensal staphylococcal species and determined the prevalence of multi-drug resistance in healthy cats and dogs. Risk factors associated with the carriage of multi-drug resistant strains were explored. Isolates from 256 dogs and 277 cats were identified at the species level using matrix-assisted laser desorption ionisation-time of flight mass spectrometry. The diversity of coagulase-negative Staphylococci (CNS) was high, with 22 species in dogs and 24 in cats. Multi-drug resistance was frequent (17%) and not always associated with the presence of the mecA gene. A stay in a veterinary clinic in the last year was associated with an increased risk of colonisation by multi-drug resistant Staphylococci (OR = 2.4, 95% CI: 1.1~5.2, p value LRT = 0.04). When identifying efficient control strategies against antibiotic resistance, the presence of mechanisms other than methicillin resistance and the possible role of CNS in the spread of resistance determinants should be considered. PMID:23820161

  20. Multidrug-resistant Salmonella enterica serovar Typhimurium isolates are resistant to antibiotics that influence their swimming and swarming motility

    Science.gov (United States)

    Motile bacteria utilize one or more strategies for movement, such as darting, gliding, sliding, swarming, swimming, and twitching. The ability to move is considered a virulence factor in many pathogenic bacteria, including Salmonella. Multidrug-resistant (MDR) Salmonella encodes acquired factors t...