Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae Use of penicillin in the extrameningeal infection from Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Amauri Lázaro Noda Albelo

2011-12-01

Full Text Available La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos betalactámicos. Se realiza una revisión de los nuevos puntos de corte del Laboratory Standars Institute para sensibilidad a penicilina del patógeno, y se analiza su implicación en la terapéutica actual de la enfermedad extrameníngea por S. pneumoniae.The beta-lactamase resistance of Strepcoccus pneumoniae is relative and may to be overcome if the dose of this type of drugs is increased. The definition of oversensitivity and of resistance of above mentioned bacteria was originally created to predict the infection response of central nervous system (CNS to treatment. The infection outside of the CNS by most of strains of S. pneumoniae responds to habitual dose of betalactamic antibiotics. A review of the new cut points of Laboratory Standards Institute for the sensitivity to pathogen penicillin and its implication in current therapy of extrameningeal disease by S. pneumoniae is analyzed.

Clinical behavior of Streptococcus pneumoniae meningoencephalitis Comportamiento clinico y terapéutico de la meningoencefalitis por Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Raisa Bu-Coifiu Fanego

2009-12-01

Full Text Available OBJECTIVE: There was an increased number of cases of meningoencephalitis caused by Streptococcus pneumoniae, after the successful vaccination campaigns against Neisseria meningitidis and Haemophilus influenzae. This paper aims at describing the clinical characteristics, the laboratory findings, the complications, and the therapeutic management of these patients, who have been suffering from this disease since 1993 to 2006. METHOD: Twelve children with Streptococcus pneumoniae meningoencephalitis admitted to the pediatric hospital of San Miguel del Padron, City of Havana in this period were assessed. RESULTS: Children under one year are the most frequently affected. Septic shock and brain edema were the most severe complications. Three patients died, implying that this disease has a serious course. Early treatment of brain edema is very important to reduce mortality. The elective drugs for treatment of these cases of Streptococcus pneumoniae meningoencephalitis were vancomycin combined with cephalosporin, cefotaxime or ceftriaxone type. CONCLUSION: Patients with Streptococcus pneumoniae meningoencephalitis show clinical characteristics, complications, and sequels that are different to other bacterial meningoencephalitis, meaning that they could be helpful for physicians considering the differential diagnosis of meningoencephalitis.OBJETIVO: Existe un incremento de la meningoencefalitis producida por Streptococcus pneumoniae, después de las campañas exitosas de vacunación contra Neisseria meningitidis y Haemophilus influenzae. El objetivo de este trabajo es describir las caracteristicas clinicas, los hallazgos de laboratorio, las complicaciones y el manejo terapéutico de los pacientes que sufrieron esta enfermedad desde 1993 a 2006. MÉTODO: Se estudiaron doce niños con meningoencefalitis por Streptococcus pneumoniae ingresados en el Hospital Pediátrico de San Miguel del Padrón, Ciudad de La Habana en este periodo. RESULTADOS: Los ni

A reação em cadeia da polimerase na detecção da resistência à penicilina em Streptococcus pneumoniae

OpenAIRE

Zettler,Eduardo Walker; Scheibe,Rosane M.; Dias,Cícero A. G.; Santafé,Patrícia; Moreira,José da Silva; Santos,Diógenes S.; Fritscher,Carlos Cezar

2004-01-01

INTRODUÇÃO: O Streptococcus pneumoniae é o mais freqüente agente etiológico de infecções respiratórias adquiridas na comunidade e sua resistência aos antimicrobianos tem aumentado nos últimos anos. A determinação da resistência é feita rotineiramente por método lento que depende do crescimento em cultura e determinação da concentração inibitória mínima (CIM). A reação em cadeia da polimerase (PCR) detecta os genes responsáveis pela resistência do Streptococcus pneumoniae a penicilina em cerca...

Penicillin-resistant viridans streptococci have obtained altered penicillin-binding protein genes from penicillin-resistant strains of Streptococcus pneumoniae.

OpenAIRE

Dowson, C G; Hutchison, A; Woodford, N; Johnson, A P; George, R C; Spratt, B G

1990-01-01

Penicillin-resistant strains of Streptococcus pneumoniae possess altered forms of penicillin-binding proteins (PBPs) with decreased affinity for penicillin. The PBP2B genes of these strains have a mosaic structure, consisting of regions that are very similar to those in penicillin-sensitive strains, alternating with regions that are highly diverged. Penicillin-resistant strains of viridans groups streptococci (e.g., S. sanguis and S. oralis) that produce altered PBPs have also been reported. ...

Carrier state of Haemophilus influenzae type b (Hib, Streptococcus pneumoniae, Streptococcus pyogenes, Neisseria meningitidis and Corynebacterium diphtheriae among school children in Pokhara, Nepal

Directory of Open Access Journals (Sweden)

Dharm Raj Bhatta

2014-02-01

Full Text Available Objective: To determine the incidence of carrier state of Haemophilus influenzae type b, Streptococcus pneumoniae (S. pneumoniae, Streptococcus pyogenes, Neisseria meningitidis and Corynebacterium diphtheriae among school children. Methods: Specimen from posterior pharyngeal wall and tonsils were collected on calcium alginate coated swabs from 1 02 participants. Processing of specimen and antimicrobial susceptibility testing was done by standard procedures. Results: Potential pathogens isolated in our study were S. pneumoniae (14.7%, Staphylococcus aureus (12.7%, Corynebacterium diphtheriae (3.9%, Streptococcus pyogenes (3.9% and Haemophilus influenzae (1.9%. Important findings in antibiogram include high resistance of S. pneumoniae to penicillin (73% and resistance of Staphylococcus aureus to oxacillin (23%. Conclusions: Pharyngeal colonization by S. pneumoniae among school children was found high and there is need of introduction of pneumococcal vaccines among children. Despite expected universal vaccination, pharyngeal colonization by Corynebacterium diphtheriae is possible and there is possibility of transmission.

Analysis of invasive pneumonia-causing strains of Streptococcus pneumoniae: serotypes and antimicrobial susceptibility.

Science.gov (United States)

Yoshioka, Cristina R M; Martinez, Marina B; Brandileone, Maria C C; Ragazzi, Selma B; Guerra, Maria L L S; Santos, Silvia R; Shieh, Huei H; Gilio, Alfredo E

2011-01-01

To identify the most common pneumococcal serotypes in children hospitalized with invasive pneumonia, correlate isolated serotypes with those included in conjugate vaccines, and ascertain the sensitivity of the isolated pneumococcal strains to penicillin and other antibiotics. From January 2003 to October 2008, a retrospective study of hospitalized children with a diagnosis of Streptococcus pneumoniae pneumonia was conducted at the university hospital of Universidade de São Paulo. Criteria for inclusion were: age greater than 29 days and less than 15 years, radiological and clinical diagnosis of pneumonia, and isolation of Streptococcus pneumoniae in blood cultures and/or pleural effusion. The study included 107 children. The most common serotypes were 14 (36.5%), 1 (16%), 5 (14.6%), 6B (6.3%) and 3 (4.2%). The proportion of identified serotypes contained in the heptavalent, 10-valent and 13-valent conjugate vaccines was 53.1, 86.5, and 96.9%, respectively. Pneumococcal strains were sensitive to penicillin (minimum inhibitory concentration, MIC ≤ 2 µg/mL) in 100 cases (93.5%) and displayed intermediate resistance (MIC = 4 µg/mL) in 7 cases (6.5%). No strains were penicillin-resistant (MIC ≥ 8 µg/mL) according to the Clinical and Laboratory Standards Institute 2008 standards. Tested isolates were highly sensitive to vancomycin, rifampicin, ceftriaxone, clindamycin, erythromycin, and chloramphenicol. Our results confirm a significant potential impact of conjugate vaccines, mainly 10-valent and 13-valent, on invasive pneumonia. Furthermore, susceptibility testing results show that penicillin is still the treatment of choice for invasive pneumonia in our setting.

Streptococcus pneumoniae urinary tract infection in pedeatrics.

Science.gov (United States)

Pougnet, Richard; Sapin, Jeanne; De Parscau, Loïc; Pougnet, Laurence

2017-06-01

Streptococcus pneumoniae infections in children are most often lung infections or meningitis. Urinary tract infections are much rarer. We present the case of a urinary tract infection with Streptococcus pneumoniae. The clinical picture was classical. The urine culture showed the presence of Streptococcus pneumoniae in urine (10 4 UFC/mL; with 2 × 10 4 leucocytes/mL). The literature mentions a few cases of such infections. In some studies, the prevalence of Streptococcus pneumoniae in urine of children is less than 1%. Those children mostly present abnormalities of urinary tract. In our case, urinary ultrasound scan have shown the presence of an ectopic kidney in this child. The discussion between the clinician and the biologist has contributed to the discovery of this renal anomaly.

Penicillin resistance and serotype distribution of Streptococcus pneumoniae in Ghanaian children less than six years of age

DEFF Research Database (Denmark)

Dayie, Nicholas T. K. D.; Arhin, Reuben E.; Newman, Mercy J.

2013-01-01

Background: The objective of this study was to determine the prevalence of nasopharyngeal carriage, serotype distribution, and penicillin resistance of Streptococcus pneumoniae in children 2 mu g/ml and were classified as fully penicillin resistant with 45% of the isolates having intermediate...... serotypes detected. The two penicillin resistant isolates (MIC 32 mu g/ml) were serotypes included in both PCV-13 and PPV-23. A nationwide monitoring system of penicillin susceptibility patterns and pneumococcal serotypes is recommended....

Drug Resistance Mechanisms of Mycoplasma pneumoniae to Macrolide Antibiotics

Directory of Open Access Journals (Sweden)

Xijie Liu

2014-01-01

Full Text Available Throat swabs from children with suspected Mycoplasma pneumoniae (M. pneumoniae infection were cultured for the presence of M. pneumoniae and its species specificity using the 16S rRNA gene. Seventy-six M. pneumoniae strains isolated from 580 swabs showed that 70 were erythromycin resistant with minimum inhibitory concentrations (MIC around 32–512 mg/L. Fifty M. pneumoniae strains (46 resistant, 4 sensitive were tested for sensitivity to tetracycline, ciprofloxacin, and gentamicin. Tetracycline and ciprofloxacin had some effect, and gentamicin had an effect on the majority of M. pneumoniae strains. Domains II and V of the 23S rRNA gene and the ribosomal protein L4 and L22 genes, both of which are considered to be associated with macrolide resistance, were sequenced and the sequences were compared with the corresponding sequences in M129 registered with NCBI and the FH strain. The 70 resistant strains all showed a 2063 or 2064 site mutation in domain V of the 23S rRNA but no mutations in domain II. Site mutations of L4 or L22 can be observed in either resistant or sensitive strains, although it is not known whether this is associated with drug resistance.

Antimicrobial resistance and serotyping of Streptococcus pneumoniae isolated from pediatric patients in Belo Horizonte, MG, Brazil Resistência antimicrobiana e sorotipagem de Streptococcus pneumoniae isolado de pacientes pediátricos em Belo Horizonte, MG

Directory of Open Access Journals (Sweden)

Ana Paula Gomes de Oliveira Magalhães

2003-07-01

Full Text Available Thirty one Streptococcus pneumoniae invasive strains were isolated from a pediatric population in Belo Horizonte from June, 1999 to May, 2001. Penicillin, trimethoprim-sulfamethoxazole, tetracycline and chloramphenicol resistance rates for the isolates were 41.9, 58.1, 25.8 and 3.2%, respectively. Intermediate penicillin resistant (MICs between 0.1 and 1.0 µg/ml and resistant (MICs > 2.0 µg/ml isolates occured at rates of 38.7 and 3.2%, respectively. Resistance to erythromycin, ofloxacin, rifampin or vancomicyn was not detected. Ten S. pneumoniae serotypes (14, 5, 10 A, 6B, 15B, 18C, 6 A, 18 A, 19 A and 19 F were identified. Serotype 14 (12 out of 31 was predominant among the isolates. Penicillin and trimethoprim-sulfamethoxazole resistance was more common in 14 and 6B serotypes.Trinta e três linhagens invasivas do S. pneumoniae foram isoladas a partir de pacientes pediátricos em Belo Horizonte, MG, Brasil, de junho de 1999 a maio de 2001. As taxas de resistência à penicilina, ao trimetoprim-sultametoxazol, tetraciclina e cloranfenicol foram respectivamente, 41, 9; 58,1 e 3,2%. A resistência intermediária à penicilina (MICs entre 0,1 e 1,0 µg/ml e resistência total (MICs>2.0 µg/ml ocorreram, respectivamente, nas porcentagens de 38,7 e 3,2%. Não foi detectada resistência à eritromicina, ofloxacin, rifampina e vancomicina. Foram identificados 9 sorotipos do S. pneumoniae (14, 5, 10 , 6B, 15B, 18C, 6 A, 18 19 A e 19F entre os isolados. O sorotipo 14 (12 de 31 foi predominate entre os isolados. A resistência à penicilina e ao trimetoprim-sulfametoxazol estava sempre associada aos sorotipos 14 e 6B.

Streptococcus pneumoniae aislados de infecciones invasivas: serotipos y resistencia antimicrobiana Streptococcus pneumoniae isolated from invasive infections: serotypes and antimicrobial resistance

Directory of Open Access Journals (Sweden)

Gladys Antonia Cueto Montoya

2007-03-01

Full Text Available Las meningoencefalitis bacterianas constituyen una enfermedad invasiva importante, quizás no tanto por su frecuencia, como por la gravedad de su cuadro. Los cambios en la epidemiología de los síndromes neurológicos infecciosos en Cuba a partir de la vacunación contra meningococo BC y Haemophilus influenzae b han hecho que el Streptococcus pneumoniae constituya el agente causal más frecuente. Debido al incremento de la resistencia de este microorganismo a los antibióticos habituales, se realizaron modificaciones al régimen terapéutico convencional, fundamentalmente en las meningitis pediátricas. Es necesario lograr el aislamiento en cultivo de este agente para conocer los serotipos más frecuentes en el país, y lograr una vacuna neumocócica conjugada, así como para la vigilancia de las cepas frente a los antimicrobianos.The bacterial meningoencephalitis is an important invasive disease, not only because of its frequency, but also because of the severity of its picture. The changes in the epidemiology of the neurological infectious syndromes in Cuba starting from the vaccination against meningococcus BC and Haemophilus infuenzae b have made that Streptococcus pneumoniae be the most frequent causal agent. Due to the increase of the resistance of this microorganism to habitual antibiotics, modifications were made in the conventional therapeutic regimen, mainly in the pediatric meningitis. It is necessary to achieve the isolation in culture of this agent to know the most common serotypes in the country, to attain a conjugated pneumococcal vaccine, and to keep the surveillance of the strains against the antimicrobials.

streptococcus pneumoniae , klebsiella pneumoniae proteus vulgaris

African Journals Online (AJOL)

DR. AMINU

2-20mm) on Streptococcus pneumoniae and Proteus vulgaris when compared to the ... The result from this preliminary study suggests that the plant contains active compounds that .... Veterinary and Medical Laboratory Technology, Vom,. Jos.

99mTcN-gatifloxacin dithiocarbamate complex. A novel multi-drug-resistance Streptococcus pneumoniae (MRSP) infaction radiotracer

International Nuclear Information System (INIS)

Syed Qaiser Shah; Mohammad Rafiullah Khan

2011-01-01

Gatifloxacin (GTN) was derivatized to its dithiocarbamate derivative and its radiolabeling with technetium-99m ( 99m Tc) using the [ 99m Tc≡N] 2+ core was investigated. The appropriateness of the 99m TcN - gatifloxacin dithiocarbamate ( 99m TcN - GTND) complex as a potential multi-drug-resistance Streptococcus pneumoniae (MRSP) infection radiotracer was evaluated in terms of stability in saline, serum, in vitro binding with MRSP and biodistribution in artificially MRSP infected Male Wistar Rats (MWR). In saline the 99m TcN - GTND complex showed more than 90% labeling yield up to 4 h with a maximum yield of 98.25 ± 0.20%, after reconstitution. In serum the 99m TcN - GTND complex showed stability up to 16 h of incubation with the appearance of insignificant 15.95% undesirable side products. The 99m TcN - GTND complex demonstrated saturated in vitro binding with MRSP with a maximum value of 75.50 ± 1.00% (at 90 min). In MWR model of group A, almost six times higher uptake of the labeled GTND was monitored in the muscle of MWR infected with live MRSP as compared to the inflamed and normal muscles. Based on the higher labeling yield in saline, in vitro stability in serum, saturated in vitro binding with live MRSP and promising biodistribution in MWR model we recommend 99m TcN - gatifloxacin dithiocarbamate complex as a potential MRSP infection radiotracer. (author)

Nasopharyngeal carriage of Streptococcus pneumonia in pneumonia-prone age groups in Semarang, Java Island, Indonesia.

Science.gov (United States)

Farida, Helmia; Severin, Juliëtte A; Gasem, M Hussein; Keuter, Monique; Wahyono, Hendro; van den Broek, Peterhans; Hermans, Peter W M; Verbrugh, Henri A

2014-01-01

Streptococcus pneumoniae is a worldwide occurring pathogen Nasopharyngeal carriage of Streptococcus pneumoniae precedes pneumonia and other pneumococcal diseases in the community. Little is known about S. pneumoniae carriage in Indonesia, complicating strategies to control pneumococcal diseases. We investigated nasopharyngeal carriage of S. pneumoniae in Semarang, Indonesia. A population-based survey was performed in Semarang, Indonesia. Nasopharyngeal swabs and questionnaires were taken from 496 healthy young (6-60 month-old) children and 45-70 year-old adults. Forty-three percent of children aged 6-60 months and 11% of adults aged 45-75 years carried S. pneumoniae. Determinants of carriage were being a child (OR 7.7; 95% CI = 4.5-13.0), passive smoking (OR 2.1; 95% CI = 1.3-3.4), and contact with toddler(s) at home (OR 3.0; 95% CI = 1.9-4.7). The most frequent serotypes found were 6A/B and 15B/C. The current commercially available vaccines cover <50% serotypes found in children. Twenty-four percent of S. pneumoniae strains were penicillin non-susceptible, and 45% were resistant to cotrimoxazol. The limited coverage of commercially available vaccines against the serotypes found in this population, and the high proportion of non-susceptibility to penicillin and cotrimoxazol suggest the need for region-specific information and strategies to control S. pneumoniae.

Determination of Serotypes and Antibiotic Resistance in Streptococcus Pneumoniae

Directory of Open Access Journals (Sweden)

Deniz Akgun Karapinar

2016-01-01

Full Text Available Aim: In this study, the distribution of serogroup/serotype and antibiotic susceptibility testing of Streptococcus pneumoniae strains, recovered from pediatric and adult patients were evaluated. Material and Method: A total of 80 clinical isolates recovered from 19 pediatric and 61 adult patients were performed by latex aglutination method and antibiotic susceptibility tests in Istanbul University, Istanbul Faculty of Medicine, Medical Microbiology Laboratories. Results: Sixty-two strains (76 %, were serogroup/serotyped and 18 (23 % strains couldn%u2019t serogroup/serotyped. The most frequent identified serogroups were 19, 14, 23, 6, 4 in pediatrics, and 3, 19, 23 and 9 in adults. In adults, serogroups 3, 9, 5, 8, 18, 1, 15 were determined, but these serogroups weren%u2019t found in pediatrics. Vaccine serotypes rates were found as 53 % in pediatric and as 85 % in adults. The serogroups 2, 7, 10, 11, 12, 17, 20, 22, 33 were not detected, which are available in vaccine serotypes. Only 1 (1 % strain was found to exhibit low level resistance to penicillin and high level resistance wasn%u2019t found in any strain. Resistant results for trimethoprim-sulfamethoxazole, erythromycin, chloramphenicol and ofloxacin were found as 45 (56 %, 22 (27.5 %, 7 (9 %, 2 (2.5 %, respectively. All strains were found susceptible to vancomycin, linezolid and levofloxacin. The most resistant serogroups were 19, 23, 9 and 14 in the tested antibiotics. Multidrug resistance was found in 9 (11 % strains and these strains were found as serogroups 19, 23, 9, 6 and 14. Discussion: The epidemiological studies are important that the distribution of serotype and antibiotic resistance vary depending on many factors like age, and geographic region.

Colonização e resistência antimicrobiana de Streptococcus pneumoniae isolado em nasofaringe de crianças com rinofaringite aguda Nasopharyngeal colonization and antimicrobial resistance of Streptococcus pneumoniae isolated in children with acute rinofaringitis

Directory of Open Access Journals (Sweden)

Lêda Lúcia M. Ferreira

2001-06-01

ças com infecção respiratória alta podem ser usados na vigilância da resistência antimicrobiana numa determinada comunidade.OBJECTIVE: to determine the prevalence and risk factors for nasopharyngeal colonization by, and to evaluate antimicrobial susceptibility of Streptococcus pneumoniae strains in children with acute rhinopharyngitis. METHODS: we collected nasopharyngeal swab specimens from 400 children aged 3 months to 5 years and with clinical status of acute rhinopharyngitis from June 16, 1997 to May 20, 1998 at the outpatient clinics of two hospitals in the city of São Paulo. Nasopharyngeal specimens were collected pernasally using a calcium alginate swab and plated immediately after collection onto trypticose soy agar with 5% sheep blood and garamicin 5 mcg/ml. Penicillin susceptibility was determined by oxacillin 1 mcg disk screening test and the minimal inhibitory concentration by the E-test. RESULTS: Pneumococci were recovered from 139 children, indicating a colonization prevalence of 35%. The risk factors analyzed indicated that the colonization was more prevalent in children attending day-care centers, children with siblings younger than 5 years, and children with recent use of antimicrobial agents. The prevalence of penicillin non-susceptible strains was of 16 % (20 strains. All strains were intermediately resistant (0.1mcg/ ml < MIC < 1.0 mcg/ ml. Out of the penicillin intermediately resistant strains, 7 (37% showed intermediate resistance to cotrimoxazol and 2 (11% full resistance to trimethoprim-sulfamethoxazole. No strains were resistant to ceftriaxone, amoxicillin, clarithromicin, or chloramphenicol. CONCLUSIONS: our findings indicate that the prevalence of nasopharyngeal colonization by Streptococcus pneumoniae in children with upper respiratory infections was of 34.8%. Children attending day-care centers and children with younger siblings showed higher levels of colonization The results of prevalence of bacterial resistance were similar to those

[Antibiotic resistance analysis of Streptococcus pneumoniae isolates from the hospitalized children in Shanxi Children's Hospital from 2012 to 2014].

Science.gov (United States)

Ge, L L; Han, Z Y; Liu, A H; Zhu, L; Meng, J H

2017-02-02

Objective: To investigate the antibiotic resistance status of Streptococcus pneumoniae isolates from hospitalized children in Shanxi Children's Hospital. Method: E-test and Kirby-Bauer methods were applied to determine drug sensitivity of the isolates collected from the body fluid specimens of hospitalized children in Shanxi Children's Hospital from January 2012 to December 2014. The antimicrobial sensitivity and minimum inhibitory concentration (MIC) of Streptococcus pneumoniae to the conventional antibiotics were analyzed, in order to compare the annual trends of non-invasive isolates, while the differentiation of sensitivity from specimens. The comparison of rates was performed by Chi-squared test and Fisher's exact test. Result: A total of 671 isolates of streptococcus pneumoniae were obtained, which could be divided as non-invasive isolates(607), invasive isolates from non-cerebrospinal fluid(non-CSF)(40) and invasive isolates from cerebrospinal fluid(CSF)(24). The antimicrobial sensitivity(isolates(%)) of the 671 isolates were respectively vancomycin 671(100.0%), linezolid 671(100.0%), levofloxacin 665(99.1%), penicillin 595(88.7%), ceftriaxone 516(76.9%), cefotaxime 512(76.3%), sulfamethoxazole-trimethoprin(SMZ-TMP) 103(15.4%), clindamycin 28(4.2%), tetracycline 26(3.9%), erythromycin 12(1.8%). From 2012 to 2014, the susceptibility rates of non-invasive isolates to penicillin every year were 95.0%(96/101), 97.3%(110/113), 87.3%(343/393), respectively, and there was significant difference among the three years(χ(2)=13.266, P penicillin were 0.064, 2.000, 6.000 in 2012, which grew up to 1.000, 3.000, 16.000 in 2014. There was no significant difference in the susceptibility rate of non-invasive isolates to ceftriaxone and cefotaxime during these three years, (χ(2)=1.172, 1.198, both P >0.05). On the other hand, the values of MIC(50, )MIC(90) and the maximum value of MIC(mg/L) of ceftriaxone and cefotaxime both increased from 0.500, 2.000, 8.000 in 2012 to 0

Case Report of Necrotizing Fasciitis Associated with Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Lei Jiao

2016-01-01

Full Text Available Necrotizing fasciitis, caused by Streptococcus pneumoniae, is an extremely rare and life-threatening bacterial soft tissue infection. We report a case of early necrotizing fasciitis associated with Streptococcus pneumoniae infection in a 26-year-old man who was immunocompromised with mixed connective tissue disease. The patient presented with acute, painful, erythematous, and edematous skin lesions of his right lower back, which rapidly progressed to the right knee. The patient underwent surgical exploration, and a diagnosis of necrotizing fasciitis was confirmed by pathological evidence of necrosis of the fascia and neutrophil infiltration in tissue biopsies. Cultures of fascial tissue biopsies and blood samples were positive for Streptococcus pneumoniae. To our knowledge, this is the first report of necrotizing fasciitis resulting from Streptococcus pneumoniae diagnosed at early phase; the patient recovered well without surgical debridement.

Whole genome analysis of linezolid resistance in Streptococcus pneumoniae reveals resistance and compensatory mutations

Directory of Open Access Journals (Sweden)

Légaré Danielle

2011-10-01

Full Text Available Abstract Background Several mutations were present in the genome of Streptococcus pneumoniae linezolid-resistant strains but the role of several of these mutations had not been experimentally tested. To analyze the role of these mutations, we reconstituted resistance by serial whole genome transformation of a novel resistant isolate into two strains with sensitive background. We sequenced the parent mutant and two independent transformants exhibiting similar minimum inhibitory concentration to linezolid. Results Comparative genomic analyses revealed that transformants acquired G2576T transversions in every gene copy of 23S rRNA and that the number of altered copies correlated with the level of linezolid resistance and cross-resistance to florfenicol and chloramphenicol. One of the transformants also acquired a mutation present in the parent mutant leading to the overexpression of an ABC transporter (spr1021. The acquisition of these mutations conferred a fitness cost however, which was further enhanced by the acquisition of a mutation in a RNA methyltransferase implicated in resistance. Interestingly, the fitness of the transformants could be restored in part by the acquisition of altered copies of the L3 and L16 ribosomal proteins and by mutations leading to the overexpression of the spr1887 ABC transporter that were present in the original linezolid-resistant mutant. Conclusions Our results demonstrate the usefulness of whole genome approaches at detecting major determinants of resistance as well as compensatory mutations that alleviate the fitness cost associated with resistance.

Penicillin-Resistant trend of Streptococcus pneumoniae in Asia: A systematic review.

Science.gov (United States)

Mamishi, Setareh; Moradkhani, Sepideh; Mahmoudi, Shima; Hosseinpour-Sadeghi, Reihaneh; Pourakbari, Babak

2014-08-01

The high prevalence of resistance to penicillin by Streptococcus pneumoniaeis considered as a great concern, particularly in Asian countries. The aim of this study was to investigate the changing trend of penicillin-resistant S. pneumoniae (PRSP) in Asia over a 20 years period. A review of the literature was conducted using the PubMed database, Google Scholar, Scopus, two Persian scientific search engines "Scientific Information Database" (www.sid.ir), and "Mag Iran" (www.magiran.com) through 1993 to 2013. Our study provides a unique chance to investigate the changing trend in PSSP in Asia over a 20 years period. Susceptibility rates among different centers in each country varied widely. In Malaysia, the PSSP rate decreased from 97.2% in 1995-1996 to 69% in 2000. In Singapore, PSSP levels decreased from 72.6% in 1997 to 30.5% in 2007-2008. In Iran, PSSP ranged from 0% to 100%. In Taiwan, the rate of PSSP was 60.3% in 1995 and countries such as Vietnam, Singapore, Philippines, Pakistan, Nepal, Kuwait, Korea and Indonesia.

Streptococcus pneumoniae necrotizing fasciitis in systemic lupus erythematosus.

Science.gov (United States)

Sánchez, A; Robaina, R; Pérez, G; Cairoli, E

2016-04-01

Necrotizing fasciitis is a rapidly progressive destructive soft tissue infection with high mortality. Streptococcus pneumoniae as etiologic agent of necrotizing fasciitis is extremely unusual. The increased susceptibility to Streptococcus pneumoniae infection in patients with systemic lupus erythematosus is probably a multifactorial phenomenon. We report a case of a patient, a 36-year-old Caucasian female with 8-year history of systemic lupus erythematosus who presented a fatal Streptococcus pneumoniae necrotizing fasciitis. The role of computed tomography and the high performance of blood cultures for isolation of the causative microorganism are emphasized. Once diagnosis is suspected, empiric antibiotic treatment must be prescribed and prompt surgical exploration is mandatory. © The Author(s) 2015.

Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 - 2012.

Science.gov (United States)

Moore, Catrin E; Giess, Adam; Soeng, Sona; Sar, Poda; Kumar, Varun; Nhoung, Pheakdey; Bousfield, Rachel; Turner, Paul; Stoesser, Nicole; Day, Nicholas P J; Parry, Christopher M

2016-01-01

The 13-valent pneumococcal vaccine (PCV13) was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD). Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation. All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing. There were 90 Cambodian children hospitalized with IPD with a median (IQR) age of 2.3 years (0.9-6.2). The case fatality was 15.6% (95% CI 8-23). Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%), 23F (8/50; 16%), 14 (6/50; 12%), 5 (5/50; 10%) and 19A (3/50; 6%). Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing. This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel sequence types and resistotypes.

Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 - 2012.

Directory of Open Access Journals (Sweden)

Catrin E Moore

Full Text Available The 13-valent pneumococcal vaccine (PCV13 was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD. Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation.All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing.There were 90 Cambodian children hospitalized with IPD with a median (IQR age of 2.3 years (0.9-6.2. The case fatality was 15.6% (95% CI 8-23. Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%, 23F (8/50; 16%, 14 (6/50; 12%, 5 (5/50; 10% and 19A (3/50; 6%. Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing.This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel sequence types and resistotypes.

MALDI-TOF mass spectrometry for differentiation between Streptococcus pneumoniae and Streptococcus pseudopneumoniae.

Science.gov (United States)

van Prehn, Joffrey; van Veen, Suzanne Q; Schelfaut, Jacqueline J G; Wessels, Els

2016-05-01

We compared the Vitek MS and Microflex MALDI-TOF mass spectrometry platform for species differentiation within the Streptococcus mitis group with PCR assays targeted at lytA, Spn9802, and recA as reference standard. The Vitek MS correctly identified 10/11 Streptococcus pneumoniae, 13/13 Streptococcus pseudopneumoniae, and 12/13 S. mitis/oralis. The Microflex correctly identified 9/11 S. pneumoniae, 0/13 S. pseudopneumoniae, and 13/13 S. mitis/oralis. MALDI-TOF is a powerful tool for species determination within the mitis group. Diagnostic accuracy varies depending on platform and database used. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Bacteremia with Streptococcus pneumoniae

DEFF Research Database (Denmark)

Christensen, J S; Jensen, T G; Kolmos, H J

2012-01-01

We conducted a hospital-based cohort study among adult patients with first-time Streptococcus pneumoniae bacteremia (SPB) from 2000 through 2008. Patients were identified in a population-based bacteremia database and followed up for mortality through the Danish Civil Registration System (CRS...

Gene Regulation in Streptococcus pneumoniae: interplay between nutrition and virulence

NARCIS (Netherlands)

W.T. Hendriksen (Wouter)

2010-01-01

textabstractStreptococcus pneumoniae (the pneumococcus) is a Gram-positive bacterium, which belongs to the species of streptococci. Other pathogenic bacteria belonging to this class include Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus suis, Streptococcus uberis, Streptococcus

Antibiotic resistant profile of Streptococcus pneumoniae from the ...

African Journals Online (AJOL)

The isolates were subjected to antimicrobial susceptibility testing using the disc diffusion method. Results: S. pneumoniae was isolated from 37(42.04%) of the 88 samples. Isolates showed the highest resistance of 12 (32.43%) to erythromycin and lowest resistance of 4(10.81%) to ciprofloxacin. The resistance profiles for ...

[Macrolide-resistant Streptococcus pneumoniae on the islands of Gran Canaria and Lanzarote (Spain): molecular mechanisms and serogroup relationships].

Science.gov (United States)

Artiles, Fernando; Horcajada-Herrera, Iballa; Noguera-Catalán, Javier; Alamo-Antúnez, Isabel; Bordes-Benítez, Ana; Lafarga-Capuz, Bernardo

2007-11-01

Macrolide resistance in Streptococcus pneumoniae is coded by the ermB and mefA/E genes. The aim of this study was to determine the status of macrolide-resistance, the molecular mechanisms involved, the serogroup relationships, and the level of co-resistance in S. pneumoniae isolates from Gran Canaria and Lanzarote, in the Canary Islands, Spain. Macrolide resistance phenotypes were investigated in 261 S. pneumoniae clinical isolates over a two-year period (2004 and 2005). Genotypes were determined by PCR (detection of ermB and mefA/E genes). Overall macrolide resistance was 40.6% (106 isolates); 79.2% (84) of resistant isolates presented the MLSB phenotype (98.8% harbored the ermB gene), with a predominance of serogroup 19, and 20.8% (22) presented the M phenotype (77.3% displayed the mefA/E gene), all associated with serogroup 14. Worthy of note, the M phenotype was found in 8 invasive isolates from Lanzarote (80%) all from serogroup 14. The ermB and mefA/E genes were detected in 7 isolates belonging to serogroup 19. Absence of co-resistance was observed most frequently in serogroup 14 (66.7%). Co-resistance with penicillin G, tetracycline, and trimethoprim-sulfamethoxazole was associated with serogroup 19 (36.8%). Two isolates (0.8%) were resistant to telithromycin. The frequency of macrolide resistance mechanisms in the Canary Islands is different from that observed in the rest of Spain, particularly in Lanzarote, where 80% of isolates harbored the mefA/E gene and belonged to serogroup 14.

Factors associated with colonization of Streptococcus pneumoniae ...

African Journals Online (AJOL)

with schooling and presence chronic diseases. ... Streptococcus pneumoniae is a leading cause of serious community-acquired infections such as ... large number of individuals are still suffering from infections caused by these bacteria, especially ... samples of children with severe pneumonia (Nantanda et al., 2008).

Alta prevalência de crianças portadoras de Streptococcus pneumoniae resistentes à penicilina em creches públicas High prevalence of children colonized with penicillin-resistant Streptococcus pneumoniae in public day-care centers

Directory of Open Access Journals (Sweden)

Patrícia A. G. Velasquez

2009-12-01

Full Text Available OBJETIVOS: Investigar a prevalência de Streptococcus pneumoniae (pneumococos na nasofaringe de crianças sadias atendidas em creches municipais da cidade de Umuarama (PR. Avaliar a susceptibilidade aos antimicrobianos dos pneumococos isolados. MÉTODOS: Secreção da nasofaringe de 212 crianças foi coletada no período de abril a outubro de 2008. Após semeadura dos espécimes em ágar sangue e incubação a 37 °C por 24-48 horas, as colônias suspeitas de pertencerem a S. pneumoniae foram identificadas pela α-hemólise, sensibilidade à optoquina e bile solubilidade. A susceptibilidade à penicilina foi investigada pelos testes de disco-difusão e de diluição. A susceptibilidade aos demais antimicrobianos indicados no tratamento das infecções pneumocócicas foi realizada por disco-difusão RESULTADOS: A prevalência de pneumococos na nasofaringe foi de 43,4% (92/212, sendo maior em crianças com idade entre 2 e 5 anos (p = 0,0005. Não houve diferença significativa entre os sexos. Resistência intermediária e resistência plena à penicilina foram encontradas respectivamente em 34,8 (32/92 e 22,8% (21/92 dos isolados. Sessenta e sete amostras (72,8% foram resistentes ao sulfametoxazol-trimetoprim, oito (8,7% à eritromicina e seis (6,5% à tetraciclina. Uma amostra apresentou resistência à clindamicina (1,1%, e outra ao cloranfenicol (1,1%. Todas as amostras foram sensíveis a levofloxacina, ofloxacina, rifampicina, telitromicina, linezolide e vancomicina. Nove amostras foram consideradas multirresistentes, por apresentarem resistência a três ou mais classes de antimicrobianos. CONCLUSÕES: O presente estudo registrou uma alta prevalência de crianças portadoras sadias de amostras de S. pneumoniae resistentes à penicilina que podem constituir importantes reservatórios desse patógeno na comunidade.OBJECTIVES: To investigate the prevalence of Streptococcus pneumoniae (pneumococci in the nasopharynx of healthy children enrolled

Detection and quantification of Streptococcus pneumoniae from ...

African Journals Online (AJOL)

The aim of this study was to develop a real time polymerase chain reaction (PCR) for quantitative detection of Streptococcus pneumoniae from clinical respiratory specimens. Initially, 184 respiratory specimens from patients with community acquired pneumonia (CAP) (n = 129) and 55 cases with hospital associated ...

Antimicrobial resistance in Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis and group A beta-haemolytic streptococci in 2002-2003. Results of the multinational GRASP Surveillance Program

DEFF Research Database (Denmark)

Beekmann, Susan E; Heilmann, Kris P; Richter, Sandra S

2005-01-01

A multinational surveillance study, GRASP, was conducted between November 2002 and April 2003 with the aim of assessing rates of antimicrobial resistance among 2656 isolates of Streptococcus pneumoniae, 2486 isolates of group A beta-haemolytic streptococci, 1358 isolates of Haemophilus influenzae...... and 1047 of Moraxella catarrhalis from 20 countries in Europe, eastern Asia and southern Africa. Conspicuous differences between various countries were noted in the S. pneumoniae resistance rates observed for penicillin (0-79.2%) and erythromycin (4-66%), along with other antimicrobials. The percentage...... of MDR strains was above 25% in 8 of the 20 countries studied. Group A streptococcal macrolide resistance rates ranged from 0% to 35% by country, while rates of beta-lactamase production ranged from 0% to 39% for H. influenzae and 80-100% for M. catarrhalis. Antibiotic resistance in S. pneumoniae remains...

Multidrug Resistance in Non-PCV13 Serotypes of Streptococcus pneumoniae in Northern Japan, 2014.

Science.gov (United States)

Kawaguchiya, Mitsuyo; Urushibara, Noriko; Kobayashi, Nobumichi

2017-03-01

Since the implementation of routine PCV13 immunization in Japan, nonvaccine serotypes (NVTs) have been increasing among clinical isolates of Streptococcus pneumoniae. In this study, susceptibility to 18 antibiotics was tested for all the 231 isolates with NVTs, which were collected from children Japan in 2014 (July-November). High resistance rates were observed for macrolides (>90.9%), tetracycline (91.3%), and clindamycin (75.3%), while penicillin (PEN) nonsusceptibility (PNSP; MIC ≥0.12 μg/ml) was detected in 42.9% of the pneumococci [39.4%; PEN-intermediate S. pneumoniae (PISP), 3.5%; PEN-resistant S. pneumoniae (PRSP)]. All serotype 15A isolates were PRSP (MIC, ≥2 μg/ml) or PISP, and PNSP was prevalent in also serotypes 23A (96.9%), 6C (41%), and 35B (33.3%). Overall, 42.0% of the isolates showed multidrug resistance (MDR). Sequence types (STs) determined for 20 PNSP isolates with NVTs were ST63 (15A), STs 242 or 5832 (6C), STs 338 or 5242 (23A), and ST558 (35B). All the PNSP isolates possessed tet(M), and erm(B) or mefA(A/E), and 70% of them were gPRSP having three altered genes pbp1a, pbp2x, and pbp2b. Among alterations in transpeptidase-coding region of penicillin-binding proteins (PBPs), two substitutions of T 371 S in the STMK motif and TSQF 574-577 NTGY in PBP1a were common to all PRSP isolates. The present study showed the spread of PNSP in NVTs 15A, 23A, 6C, and 35B, and the emergence of the MDR international clone Sweden 15A -ST63 in northern Japan.

Drug treatment of pneumococcal pneumonia in the elderly.

Science.gov (United States)

Neralla, Sridhar; Meyer, Keith C

2004-01-01

Streptococcus pneumoniae has been recognised as a major cause of pneumonia since the time of Sir William Osler. Drug-resistant S. pneumoniae (DRSP), which have gradually become resistant to penicillins as well as more recently developed macrolides and fluoroquinolones, have emerged as a consequence of indiscriminate use of antibacterials coupled with the ability of the pneumococcus to adapt to a changing antibacterial milieu. Pneumococci use cell wall choline components to bind platelet-activating factor receptors, colonise mucosal surfaces and evade innate immune defenses. Numerous virulence factors that include hyaluronidase, neuraminidase, iron-binding proteins, pneumolysin and autolysin then facilitate cytolysis of host cells and allow tissue invasion and bloodstream dissemination. Changes in pneumococcal cell wall penicillin-binding proteins account for resistance to penicillins, mutations in the ermB gene cause high-level macrolide resistance and mutations in topoisomerase IV genes coupled with GyrA gene mutations alter DNA gyrase and lead to high-level fluoroquinolone resistance. Risk factors for lower respiratory tract infections in the elderly include age-associated changes in oral clearance, mucociliary clearance and immune function. Other risks for developing pneumonia include poor nutrition, hypoalbuminaemia, bedridden status, aspiration, recent viral infection, the presence of chronic organ dysfunction syndromes including parenchymal lung disease and recent antibacterial therapy. Although the incidence of infections caused by DRSP is rising, the effect of an increase in the prevalence of resistant pneumococci on mortality is not clear. When respiratory infections occur, rapid diagnosis and prompt, empirical administration of appropriate antibacterial therapy that ensures adequate coverage of DRSP is likely to increase the probability of a successful outcome when treating community-acquired pneumonia in elderly patients, particularly those with multiple

Genome-wide identification of Streptococcus pneumoniae genes essential for bacterial replication during experimental meningitis

DEFF Research Database (Denmark)

Molzen, T E; Burghout, P; Bootsma, H J

2010-01-01

Meningitis is the most serious of invasive infections caused by the Gram-positive bacterium Streptococcus pneumoniae. Vaccines protect only against a limited number of serotypes, and evolving bacterial resistance to antimicrobials impedes treatment. Further insight into the molecular pathogenesis...... as targets for future therapy and prevention of pneumococcal meningitis, since their mutants were attenuated in both models of infection as well as in competitive growth in human cerebrospinal fluid in vitro.......Meningitis is the most serious of invasive infections caused by the Gram-positive bacterium Streptococcus pneumoniae. Vaccines protect only against a limited number of serotypes, and evolving bacterial resistance to antimicrobials impedes treatment. Further insight into the molecular pathogenesis...... genes mutants of which had become attenuated or enriched, respectively, during infection. The results point to essential roles for capsular polysaccharides, nutrient uptake, and amino acid biosynthesis in bacterial replication during experimental meningitis. The GAF phenotype of a subset of identified...

Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 – 2012

Science.gov (United States)

Giess, Adam; Soeng, Sona; Sar, Poda; Kumar, Varun; Nhoung, Pheakdey; Bousfield, Rachel; Turner, Paul; Stoesser, Nicole; Day, Nicholas P. J.; Parry, Christopher M.

2016-01-01

Background The 13-valent pneumococcal vaccine (PCV13) was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD). Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation. Methods All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing. Results There were 90 Cambodian children hospitalized with IPD with a median (IQR) age of 2.3 years (0.9–6.2). The case fatality was 15.6% (95% CI 8–23). Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%), 23F (8/50; 16%), 14 (6/50; 12%), 5 (5/50; 10%) and 19A (3/50; 6%). Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing. Conclusions This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel

Telithromycin resistance in Streptococcus pneumoniae is conferred by a deletion in the leader sequence of erm(B) that increases rRNA methylation

DEFF Research Database (Denmark)

Wolter, Nicole; Smith, Anthony M; Farrell, David J

2008-01-01

A telithromycin-resistant clinical isolate of Streptococcus pneumoniae (strain P1501016) has been found to contain a version of erm(B) that is altered by a 136-bp deletion in the leader sequence. By allele replacement mutagenesis, a second strain of S. pneumoniae (PC13) with a wild-type erm(B) gene...... was transformed to the telithromycin-resistant phenotype by introduction of the mutant erm(B) gene. Whereas the wild-type PC13 strain showed slight telithromycin resistance only after induction by erythromycin (telithromycin MIC increased from 0.06 to 0.5 microg/ml), the transformed PC13 strain is constitutively...... resistant (MIC of 16 mug/ml). Expression of erm(B) was quantified by real-time reverse transcription-PCR in the presence of erythromycin or telithromycin; erm(B) expression was significantly higher in the transformed PC13 strain than the wild-type strain. Furthermore, the transformed strain had...

Prevalence of penicillin and erythromycin resistance among invasive Streptococcus pneumoniae isolates reported by laboratories in the southern and eastern Mediterranean region.

Science.gov (United States)

Borg, M A; Tiemersma, E; Scicluna, E; van de Sande-Bruinsma, N; de Kraker, M; Monen, J; Grundmann, H

2009-03-01

Information about the epidemiology of resistance in Streptococcus pneumoniae within southern and eastern countries of the Mediterranean region is incomplete, as reports have been sporadic and difficult to compare. Over a 36-month period, from 2003 to 2005, the ARMed project collected 1298 susceptibility test results of invasive isolates of S. pneumoniae from blood and spinal fluid cultures routinely processed within 59 participating laboratories situated in Algeria, Cyprus, Egypt, Jordan, Lebanon, Malta, Morocco, Tunisia and Turkey. Overall, 26% (335) of isolates were reported as non-susceptible to penicillin, with the highest proportions being reported from Algeria (44%) and Lebanon (40%). During the same time period, the highest proportions of pneumococci that were not susceptible to erythromycin were reported from Malta (46%) and Tunisia (39%). Proportions of dual non-susceptibility in excess of 5% were found in laboratories in Algeria, Tunisia, Lebanon, Jordan and Turkey. ARMed data on the antimicrobial resistance epidemiology of S. pneumoniae in the southern and eastern Mediterranean region provided evidence of high rates of resistance, especially to penicillin. This evidence calls for a greater focus on the identification of relevant drivers of resistance and on the implemention of effective practices in order to address the problem of resistence.

The Importance of TLR2 and Macrophages in Modulating a Humoral Response after Encountering Streptococcus pneumoniae

Science.gov (United States)

2008-03-26

Chapter 3 Submited as: Sam Vasilevsky, Jesus Colino, Roman Puliaev, David H. Canaday, and Clifford M...general microbiology 138:249- 259. 7. Musher , D. M. 1992. Infections caused by Streptococcus pneumoniae: clinical spectrum, pathogenesis, immunity, and...Pneumonia and Its Implications for Antimicrobial Resistance Chest 115:1-2. 230. Musher , D. M., I. Alexandraki, E. A. Graviss, N. Yanbeiy, A. Eid, L

Nasopharyngeal carriage, antibiogram & serotype distribution of Streptococcus pneumoniae among healthy under five children

Directory of Open Access Journals (Sweden)

K.L. Ravi Kumar

2014-01-01

Full Text Available Background & objectives: Information related to nasopharyngeal carriage of Streptococcus pneumoniae among healthy children is scanty in India. This prospective study was undertaken to determine the presence of asymptomatic nasopharyngeal colonization, assess serogroups/types (SGT and drug resistance of S. pneumoniae in children below five years of age. Methods: A total of 109 male and 81 female children in the age group of three months to five years belonging to different socio-economic classes were enrolled. They were recruited across all age groups from those attending paediatric OPD of a tertiary care and research centre for immunization program. Fifty three isolates identified as pneumococci were tested for their antimicrobial susceptibility pattern by Kirby-Bauer′s disc diffusion and E-Test methods. Serotyping was performed by detection of the quelling reaction with specific antiserum. Result: The pneumococcal carriage rate in the study population was 27.9 per cent. The isolation rate was associated with age being higher (49.2% in smaller children (3-12 months and among male (62.2%. The most prevalent SGTs were 19 followed by 10, 14 and 7; 21 per cent of isolates belonging to serotype 10 (n=7 were 11 (n=4 were not covered in any of the conjugate vaccines currently available in Indian market. Resistance to co-trimoxazole, tetracycline, penicillin and erythromycin was observed in 91 per cent (n=48, 36 per cent (n=19, 17 per cent (n=9 and 9 per cent (n=5 isolates, respectively. All the penicillin resistant isolates were found to be intermediately resistant by E-Test. Multidrug resistance was observed in 19 per cent (n=10 isolates. Interpretation & conclusions: High level of antibiotic resistance was present in S. pneumoniae isolated from healthy children below age five. A pneumococcal conjugate vaccine with the prevailing SGTs would help to reduce the pool of antibiotic resistant pneumococci. Continued surveillance of serotypes and tracking

Prevalência de sorotipos e resistência antimicrobiana de cepas invasivas do Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Mantese Orlando C.

2003-01-01

Full Text Available OBJETIVO: Avaliar o perfil de sorotipos e a susceptibilidade aos antimicrobianos de cepas de Streptococcus pneumoniae obtidas em espécimes clínicos de pacientes com doença invasiva, bem como suas implicações na formulação de vacinas pneumocócicas. MÉTODOS: Cepas de pneumococo isoladas no Laboratório de Análises Clínicas do Hospital de Clínicas da Universidade Federal de Uberlândia a partir de amostras clínicas de pacientes com doença invasiva foram identificadas e enviadas ao Instituto Adolfo Lutz em São Paulo para confirmação da identificação, sorotipagem e determinação da susceptibilidade aos antimicrobianos. RESULTADOS: De abril de 1999 a março de 2003, foram isoladas 148 cepas invasivas de pneumococo, sendo 84 (56,7% provenientes de pacientes do sexo masculino. A idade variou de um dia a 88,83 anos, com média de 21,33+25,82 anos e mediana de 4,42 anos. Os diagnósticos clínicos mais comuns foram pneumonia (91 casos; 61,4%, meningite (32 casos; 21,6% e bacteremia sem foco evidente (15 casos; 10,1%. As principais fontes de recuperação foram sangue (76 amostras; 51,3%, líquido pleural (39; 26,3% e liquor (30; 20,2%. No total, foram identificados 23 diferentes sorotipos entre 143 amostras testadas, sendo os mais comuns os seguintes: 14, 3, 1, 5, 6A, 6B e 18C. Dentre 30 (20,2% cepas oxacilina-resistentes, 23 (15,5% confirmaram a resistência à penicilina (12,8% com nível intermediário e 2,7%, com nível pleno, que esteve restrita aos sorotipos 14, 23F, 19A e 6B, predominando em indivíduos com até dois anos de idade (p = 0,0008. Foi detectada susceptibilidade diminuída ao cotrimoxazol (63,4%, à eritromicina (8,3%, à clindamicina (8,7% e à ofloxacina (0,8%. A resistência à cefotaxima foi detectada em três das 30 cepas testadas (2% das 148, todas elas com resistência confirmada à penicilina. Não foi observada resistência a cloranfenicol, rifampicina ou vancomicina. CONCLUSÕES: A resistência �

Seeing Streptococcus pneumoniae, a Common Killer Bacteria

DEFF Research Database (Denmark)

Kjærgaard, Rikke Schmidt; Andersen, Ebbe Sloth

2014-01-01

Look around you. The diversity and complexity of life on earth is overwhelming and data continues to grow. In our desire to understand and explain everything scientifically from molecular evolution to supernovas we depend on visual representations. This paper investigates visual representations...... of the bacteria Streptococcus pneumoniae by use of ink, watercolours and computer graphics. We propose a novel artistic visual rendering of Streptococcus pneumoniae and ask what the value of these kind of representations are compared to traditional scientific data. We ask if drawings and computer......-assisted representations can add to our scientific knowledge about this dangerous bacteria. Is there still a role for the scientific illustrator in the scientific process and synthesis of scientific knowledge?...

Impacto de Streptococcus pneumoniae en las neumonías del niño latinoamericano Impact of Streptococcus pneumoniae in pneumonias of Latin American children

Directory of Open Access Journals (Sweden)

María Hortal

2000-09-01

Full Text Available La neumonía adquirida en la comunidad es una de las principales causas de morbilidad y mortalidad en la infancia. Estudios realizados en países en desarrollo indican que los cuadros de neumonía más graves se asocian a causas bacterianas, con predominio de Streptococcus pneumoniae, seguido por Haemophilus influenzae tipo b. El manejo de esas infecciones en los menores de 2 años se ve dificultado por la carencia de vacunas apropiadas y por la disminución de la susceptibilidad de S. pneumoniae a la penicilina y a otros antibióticos. En 1993, por iniciativa del Sistema Regional de Vacunas (SIREVA de la Organización Panamericana de la Salud y con la financiación de la Agencia Canadiense para el Desarrollo Internacional (Canadian International Development Agency: CIDA, se diseñó un estudio para identificar los tipos capsulares de S. pneumoniae que causan enfermedad invasora en los niños latinoamericanos menores de 5 años, con el propósito de determinar tanto la composición ideal de una vacuna conjugada que pudiera emplearse en la Región como la susceptibilidad a la penicilina de los aislados de S. pneumoniae. La iniciativa fue aceptada por Argentina, Brasil, Colombia, Chile, México y Uruguay. En este informe se analiza la información sobre la neumonía por S. pneumoniae generada en los países participantes. Se captaron 3 393 niños con infecciones sistémicas por S. pneumoniae, de las cuales 1 578 correspondían a neumonías. El análisis se concentró en los 1 409 casos de neumonía de Argentina, Brasil, Colombia, México y Uruguay. La distribución por edades evidenció un franco predominio de los menores de 2 años (63,8%. Se identificaron 12 tipos capsulares prevalentes, de los cuales los serotipos 14, 5 y 1 ocuparon los tres primeros lugares en la mayoría de los países. En el período 1993-1998, la resistencia a la penicilina aumentó en los cinco países; al comienzo del estudio, los mayores porcentajes correspondieron a M�

Serotype-specific mortality from invasive Streptococcus pneumoniae disease revisited

DEFF Research Database (Denmark)

Martens, Pernille; Worm, Signe Westring; Lundgren, Bettina

2004-01-01

Serotype-specific mortality from invasive Streptococcus pneumoniae disease revisited.Martens P, Worm SW, Lundgren B, Konradsen HB, Benfield T. Department of Infectious Diseases 144, Hvidovre University Hospital, DK-2650 Hvidovre, Denmark. pernillemartens@yahoo.com BACKGROUND: Invasive infection...... with Streptococcus pneumoniae (pneumococci) causes significant morbidity and mortality. Case series and experimental data have shown that the capsular serotype is involved in the pathogenesis and a determinant of disease outcome. METHODS: Retrospective review of 464 cases of invasive disease among adults diagnosed...

Streptococcus pneumoniae and Pseudomonas aeruginosa pneumonia induce distinct host responses.

Science.gov (United States)

McConnell, Kevin W; McDunn, Jonathan E; Clark, Andrew T; Dunne, W Michael; Dixon, David J; Turnbull, Isaiah R; Dipasco, Peter J; Osberghaus, William F; Sherman, Benjamin; Martin, James R; Walter, Michael J; Cobb, J Perren; Buchman, Timothy G; Hotchkiss, Richard S; Coopersmith, Craig M

2010-01-01

Pathogens that cause pneumonia may be treated in a targeted fashion by antibiotics, but if this therapy fails, then treatment involves only nonspecific supportive measures, independent of the inciting infection. The purpose of this study was to determine whether host response is similar after disparate infections with similar mortalities. Prospective, randomized controlled study. Animal laboratory in a university medical center. Pneumonia was induced in FVB/N mice by either Streptococcus pneumoniae or two different concentrations of Pseudomonas aeruginosa. Plasma and bronchoalveolar lavage fluid from septic animals was assayed by a microarray immunoassay measuring 18 inflammatory mediators at multiple time points. The host response was dependent on the causative organism as well as kinetics of mortality, but the pro-inflammatory and anti-inflammatory responses were independent of inoculum concentration or degree of bacteremia. Pneumonia caused by different concentrations of the same bacteria, Pseudomonas aeruginosa, also yielded distinct inflammatory responses; however, inflammatory mediator expression did not directly track the severity of infection. For all infections, the host response was compartmentalized, with markedly different concentrations of inflammatory mediators in the systemic circulation and the lungs. Hierarchical clustering analysis resulted in the identification of five distinct clusters of the host response to bacterial infection. Principal components analysis correlated pulmonary macrophage inflammatory peptide-2 and interleukin-10 with progression of infection, whereas elevated plasma tumor necrosis factor sr2 and macrophage chemotactic peptide-1 were indicative of fulminant disease with >90% mortality within 48 hrs. Septic mice have distinct local and systemic responses to Streptococcus pneumoniae and Pseudomonas aeruginosa pneumonia. Targeting specific host inflammatory responses induced by distinct bacterial infections could represent a

NEW VIRULENCE FACTORS OF STREPTOCOCCUS PNEUMONIAE

NARCIS (Netherlands)

Hermans, Peter Wilhelmus Maria; Bootsma, Jeanette Hester; Burghout, Pieter Jan; Kuipers, Oscar; Bijlsma, Johanna Jacoba Elisabeth; Kloosterman, Tomas Gerrit; Andersen, Christian O.

2011-01-01

The present invention provides proteins/genes, which are essential for survival, and consequently, for virulence of Streptococcus pneumoniae in vivo, and thus are ideal vaccine candidates for a vaccine preparation against pneumococcal infection. Further, also antibodies against said protein(s) are

Lung abscess due to Streptococcus pneumoniae: a case series and brief review of the literature.

Science.gov (United States)

Nicolini, Antonello; Cilloniz, Catia; Senarega, Renata; Ferraioli, Gianluca; Barlascini, Cornelius

2014-01-01

Anaerobes used to be the most common cause of community-acquired lung abscess, and Streptococcus species used to be the second most common cause. In recent years, this has been changing. Klebsiella pneumoniae is now an increasing cause of community- acquired lung abscess, but Streptococcus species continue to be major pathogens. Necrotizing pneumonia has generally been regarded as a rare complication of pneumococcal infection in adults. Type 3 Streptococcus pneumoniae was the single most common type implicated in necrosis; however, many other serotypes were implicated. This entity predominately infects children, but is present also in adults. Lung abscess in adults due to Streptococcus pneumoniae is not common. In this regard we present a case series of pulmonary cavitation due to Streptococcus pneumoniae and discuss the possible pathogenic mechanism of the disease.

Epidemiological study on the penicillin resistance of clinical Streptococcus pneumoniae isolates identified as the common sequence types.

Science.gov (United States)

Gao, Wei; Shi, Wei; Chen, Chang-hui; Wen, De-nian; Tian, Jin; Yao, Kai-hu

2016-10-20

There were some limitation in the current interpretation about the penicillin resistance mechanism of clinical Streptococcus pneumoniae isolates at the strain level. To explore the possibilities of studying the mechanism based on the sequence types (ST) of this bacteria, 488 isolates collected in Beijing from 1997-2014 and 88 isolates collected in Youyang County, Chongqing and Zhongjiang County, Sichuan in 2015 were analyzed by penicillin minimum inhibitory concentration (MIC) distribution and annual distribution. The results showed that the penicillin MICs of the all isolates covering by the given ST in Beijing have a defined range, either penicillin MIC penicillin MICs in the first few years after it was identified. The penicillin MIC of isolates identified as common STs and collected in Youyang County, Chongqing and Sichuan Zhongjiang County, including the ST271, ST320 and ST81, was around 0.25~2 mg/L (≥0.25 mg/L). Our study revealed the epidemiological distribution of penicillin MICs of the given STs determined in clinical S. pneumoniae isolates, suggesting that it is reasonable to research the penicillin resistance mechanism based on the STs of this bacteria.

Host-pathogen interaction during Streptococcus pneumoniae colonization and infection

NARCIS (Netherlands)

D. Bogaert (Debby)

2004-01-01

markdownabstract__Abstract__ Streptococcus pneumoniae was discovered by Sternberg and Pasteur in 1880. It took another six years to discover that this microorganism, called the pneumococcus, was the actual cause of bacterial pneumonia . Subsequently, this bacterium has been shown to provoke an

A Visual Review of the Human Pathogen Streptococcus pneumoniae

DEFF Research Database (Denmark)

Engholm, Ditte Høyer; Kilian, Mogens; Goodsell, David

2017-01-01

Being the principal causative agent of bacterial pneumonia, otitis media, meningitis and septicemia, the bacterium Streptococcus pneumoniae is a major global health problem. To highlight the molecular basis of this problem, we have portrayed essential biological processes of the pneumococcal life...

Serotipos prevalentes de Streptococcus pneumoniae colonizadores de nasofaringe, en niños del Distrito Federal Prevalence of Streptococcus pneumoniae serotypes on nasopharyngeal colonization in children of Mexico City

Directory of Open Access Journals (Sweden)

Fortino Solórzano-Santos

2005-07-01

Full Text Available OBJETIVO: Determinar frecuencia, serotipos y susceptibilidad a ocho antimicrobianos en Streptococcus pneumoniae aislados de la nasofaringe de una muestra representativa de niños menores de cinco años de edad residentes en el Distrito Federal. MATERIAL Y MÉTODOS: Estudio transversal, hecho de febrero de 2002 a enero de 2003. Se incluyeron niños de 2 meses a 5 años. A los seleccionados se les tomó una muestra de exudado faríngeo con hisopo de alginato de calcio. Bajo técnicas ya establecidas se realizó identificación, tipificación y susceptibilidad a ocho antimicrobianos de los aislamientos de S. pneumoniae. Se utilizó estadística descriptiva, prueba de Ji cuadrada y razón de momios (IC 95% para los factores de riesgo. RESULTADOS: Se estudiaron 573 niños. En 122/573 (21.4% niños se aisló S. pneumoniae. Los serotipos más frecuentes fueron el 23F, 35, 19F, 11A y 15A; 46% de los serotipos encontrados no son cubiertos con la vacuna heptavalente. Se encontró 12% de susceptibilidad reducida a la penicilina, con 3% de cepas con alta resistencia; la resistencia a eritromicina fue >30% y para trimetoprim-sulfametoxazol (TMP/SMX >40%. No hubo cepas resistentes a vancomicina, cefotaxima, amoxicilina-clavulanato, cloranfenicol o ampicilina. CONCLUSIONES: El porcentaje de serotipos de S. pneumoniae en portadores nasofaríngeos no cubiertos por la vacuna heptavalente es alto, y la resistencia a macrólidos y TMP/SMX es elevada, lo que debe alertar al grupo médico.OBJECTIVE: To determine the frequency, serotypes and susceptibility profiles to eight antimicrobials in Streptococcus pneumoniae nasopharyngeal isolates from a representative sample of children under 5 years of age, residents of Mexico City. PATIENTS AND METHODS: A cross-sectional survey was conducted in 573 children aged 2 months to 5 years. A nasopharyngeal sample was taken. S. pneumoniae identification, capsular serotyping and antimicrobial susceptibility to eight antimicrobials

Characterization of Streptococcus pneumoniae isolates from Austrian companion animals and horses.

Science.gov (United States)

Ginders, Maximilian; Leschnik, Michael; Künzel, Frank; Kampner, Doris; Mikula, Claudia; Steindl, Georg; Eichhorn, Inga; Feßler, Andrea T; Schwarz, Stefan; Spergser, Joachim; Loncaric, Igor

2017-11-14

The aim of the present study was to investigate the genetic relatedness and the antimicrobial resistance profiles of a collection of Austrian Streptococcus pneumoniae isolates from companion animals and horses. A total of 12 non-repetitive isolates presumptively identified as S. pneumoniae were obtained during routinely diagnostic activities between March 2009 and January 2017. Isolates were confirmed as S. pneumoniae by bile solubility and optochin susceptibility testing, matrix-assisted laser desorption-ionization-time of flight (MALDI-TOF) mass spectrometry and sequence analysis of a part recA and the 16S rRNA genes. Isolates were further characterized by pneumolysin polymerase chain reaction (PCR) and genotyped by multilocus sequence typing (MLST). Antimicrobial susceptibility testing was performed and resistance genes were detected by specific PCR assays. All isolates were serotyped. Four sequence types (ST) (ST36, ST3546, ST6934 and ST6937) and four serotypes (3, 19A, 19F and 23F) were detected. Two isolates from twelve displayed a multidrug-resistance pheno- and genotype. This study represents the first comprehensive investigation on characteristics of S. pneumoniae isolates recovered from Austrian companion animals and horses. The obtained results indicate that common human sero- (23F) and sequence type (ST36) implicated in causing invasive pneumococcal disease (IPD) may circulate in dogs. Isolates obtained from other examined animals seem to be host-adapted.

Evolution of Streptococcus pneumoniae and its close commensal relatives

DEFF Research Database (Denmark)

Kilian, Mogens; Poulsen, Knud; Blomqvist, Trinelise

2008-01-01

Streptococcus pneumoniae is a member of the Mitis group of streptococci which, according to 16S rRNA-sequence based phylogenetic reconstruction, includes 12 species. While other species of this group are considered prototypes of commensal bacteria, S. pneumoniae is among the most frequent microbial...

Epidemiological Studies of Potent Environmental Pathogen: Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Nazir A. Brohi

2016-12-01

Full Text Available A general survey for six months was undertaken for the prevalence of environmental bacterium Streptococcus pneumoniae among the different age groups (3-65 years including both sexes from various hospitals of Hyderabad city. Laboratory examinations revealed S. pneumoniae as most potent environmental pathogen from the sputum and throat swabs of old aged patients and children respectively. During observations, 39 specimens were growth positive; the biochemistry of isolates revealed that they were coagulase, catalase and oxidase negative, TSI, gel hydrolysis positive and were able to ferment glucose, lactose, maltose, galactose, fructose, sucrose, starch and raffinose. The results of antimicrobial activity showed that pneumococci were resistant to the cefspan, septran, cravit, pipemetic acid, azomax, bacitracin, and penicillin and a clear zone of inhibition was observed on clithromycin, optochin, cefizox, genatamycin, minocyclin, levoflaxacin, and vancomycin. There were intermediate zone of inhibition found on claforan, nalidixic acid, amoxycillin, fosfomycin, fortum, and erythromycin on Mueller Hinton’s agar after 24 hours incubation

Epidemiological studies of potent environment pathogen streptococcus pneumoniae

International Nuclear Information System (INIS)

Brohi, N.A.; Tunio, S.A.

2016-01-01

A general survey for six months was undertaken for the prevalence of environmental bacterium Streptococcus pneumoniae among the different age groups (3-65 years) including both sexes from various hospitals of Hyderabad city. Laboratory examinations revealed S. pneumoniae as most potent environmental pathogen from the sputum and throat swabs of old aged patients and children respectively. During observations, 39 specimens were growth positive; the biochemistry of isolates revealed that they were coagulase, catalase and oxidase negative, TSI, gel hydrolysis positive and were able to ferment glucose, lactose, maltose, galactose, fructose, sucrose, starch and raffinose. The results of antimicrobial activity showed that pneumococci were resistant to the cefspan, septran, cravit, pipemetic acid, azomax, bacitracin, and penicillin and a clear zone of inhibition was observed on clithromycin, optochin, cefizox, genatamycin, minocyclin, levoflaxacin, and vancomycin. There were intermediate zone of inhibition found on claforan, nalidixic acid, amoxycillin, fosfomycin, fortum, and erythromycin on Mueller Hinton's agar after 24 hours incubation. (author)

Structure of a conjugative element in Streptococcus pneumoniae

Energy Technology Data Exchange (ETDEWEB)

Vijayakumar, M.N.; Priebe, S.D.; Guild, W.R.

1986-06-01

The authors have cloned and mapped a 69-kilobase (kb) region of the chromosome of Streptococcus pneumoniae DP1322, which carries the conjugative Omega(cat-tet) insertion from S. pneumoniae BM6001. This element proved to be 65.5 kb in size. Location of the junctions was facilitated by cloning a preferred target region from the wild-type strain Rx1 recipient genome. This target site was preferred by both the BM6001 element and the cat-erm-tet element from Streptococcus agalactiae B109. Within the BM6001 element cat and tet were separated by 30 kb, and cat was flanked by two copies of a sequence that was also present in the recipient strain Rx1 DNA. Another sequence at least 2.4 kb in size was found inside the BM6001 element and at two places in the Rx1 genome. Its role is unknown. The ends of the BM6001 element appear to be the same as those of the B109 element, both as seen after transfer to S. pneumoniae and as mapped by others in pDP5 after transposition in Streptococcus faecalis. No homology is seen between the ends of the BM6001 element and no evidence found suggesting that it ever circularizes.

Demographic profile of healthy children with nasopharyngeal colonisation of Streptococcus pneumoniae: A research paper

Directory of Open Access Journals (Sweden)

Radhika Raman

2017-01-01

Full Text Available Background: Pneumonia is a preventable cause of mortality in children. Streptococcus pneumoniae colonising the nasopharynx of healthy children can cause invasive diseases and the serotype distribution of colonisation isolates should be an indicator of invasive disease, antibiotic resistance profiles, and potential vaccine coverage. Identifying factors influencing nasopharyngeal colonisation, the serotypes and antimicrobial resistance pattern can improve rational preventive strategies. Objectives: Identify risk factors associated with nasopharyngeal colonisation of S.pneumoniae in healthy children between 6 months to 5 years of age. Determine the serotype and antibiotic sensitivity of S. pneumoniae isolated from nasopharynx of healthy children. Methods: This prospective observational included 500 healthy children, 6months to 5 years of age. Demographic features of the study population, the serotypes and antimicrobial sensitivity pattern of S.Pneumoniae isolated from cultures of nasopharyngeal swabs were subjected to statistical analysis. Results: S. pneumoniae was isolated in 9% of 450 children. Increased nasopharyngeal carriage rate was associated with overcrowding 48.8% and poor ventilation 35.5%. 6B (n=16 was the most common serotype isolated. 69% were serogroups known to cause invasive disease All S. pneumoniae isolates were susceptible to vancomycin and linezolid. Antimicrobial susceptibility of PCV 7 serotypes were greater than non PCV 7 serotypes for almost all antimicrobials tested. Penicillin resistance was 11 % and MDR 51%

Uji Daya Hambat Ekstrak Buah Belimbing Manis (Averrhoa carambola terhadap Pertumbuhan Bakteri Streptococcus pneumoniae secara In Vitro

Directory of Open Access Journals (Sweden)

Rita Risandi

2016-09-01

Full Text Available AbstrakBuah belimbing manis (Averrhoa carambola merupakan salah satu tanaman Indonesia yang diyakini memiliki khasiat obat. Salah satu manfaat yang dapat diambil dari sari buah belimbing manis (Averrhoa carambola adalah dapat mengobati radang tenggorokan. Radang tenggorokan merupakan salah satu infeksi yang disebabkan oleh bakteri Streptococcus pneumoniae. Tujuan penelitian ini adalah menentukan daya hambat ekstrak buah belimbing manis (Averrhoa carambola terhadap pertumbuhan bakteri Streptococcus pneumoniae  secara in vitro. Metode studi ini ialah eksperimental dengan desain postest only control group design yang dilakukan di Laboratorium Biota Sumatera Universitas Andalas dan Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Andalas dari Agustus sampai Oktober 2014. Hasil penelitian menunjukkan bahwa ekstrak buah belimbing manis (Averrhoa carambola dengan konsentrasi yaitu 5%, 10%, 15% dan 20% tidak memiliki daya hambat terhadap pertumbuhan bakteri Streptococcus pneumoniae.  Hal ini terbukti karena tidak terbentuk zona hambat pada agar darah dan tidak terdapat pengaruh lama kontak ekstrak buah belimbing manis (Averrhoa carambola  terhadap pertumbuhan bakteri Streptococcus pneumoniae secara in vitro. Ekstrak buah belimbing manis tidak memiliki efek antibakteri terhadap pertumbuhan bakteri Streptococcus pneumoniae.Kata kunci: ekstrak buah belimbing manis, Streptococcus pneumoniae, daya hambat Abstract             Star fruit (Averrhoa carambola is a Indonesian plant that is believed to have medicinal properties. One of the benefits that can be drawn from the juice of star fruit (Averrhoa carambola is the ability to treat strep throat. Strep throat is a bacterial infection caused by Streptococcus pneumoniae. The objective of this study was to determine the inhibitory extract of star fruit (Averrhoa carambola on the growth of the bacterium Streptococcus pneumoniae in vitro. This was an experimental  research  with design

Streptococcus pneumoniae-associated pneumonia complicated by purulent pericarditis: case series

Energy Technology Data Exchange (ETDEWEB)

Cilloniz, Catia; Torres, Antoni [Servicio de Neumologia, Hospital Clinic de Barcelona, Ciber de Enfermedades Respiratorias (CIBERES), Instituto de Investigacion Biomedica Agusti Pi i Sunyer, Universidad de Barcelona (Spain); Rangel, Ernesto [Facultad de Medicina, Universidad Autonoma de Nayarit, Tepic (Mexico); Barlascini, Cornelius [Servizio di Igiene e Sanita Pubblica, Ospedale Generale di Sestri Levante, Sestri Levante (Italy); Piroddi, Ines Maria Grazia; Nicolini, Antonello, E-mail: antonellonicolini@gmail.com [Servizio di Pneumologia, Ospedale Generale di Sestri Levante, Sestri Levante (Italy)

2015-07-15

Objective: In the antibiotic era, purulent pericarditis is a rare entity. However, there are still reports of cases of the disease, which is associated with high mortality, and most such cases are attributed to delayed diagnosis. Approximately 40-50% of all cases of purulent pericarditis are caused by Gram-positive bacteria, Streptococcus pneumoniae in particular. Methods: We report four cases of pneumococcal pneumonia complicated by pericarditis, with different clinical features and levels of severity. Results: In three of the four cases, the main complication was cardiac tamponade. Microbiological screening (urinary antigen testing and pleural fluid culture) confirmed the diagnosis of severe pneumococcal pneumonia complicated by purulent pericarditis. Conclusions: In cases of pneumococcal pneumonia complicated by pericarditis, early diagnosis is of paramount importance to avoid severe hemodynamic compromise. The complications of acute pericarditis appear early in the clinical course of the infection. The most serious complications are cardiac tamponade and its consequences. Antibiotic therapy combined with pericardiocentesis drastically reduces the mortality associated with purulent pericarditis. (author)

Streptococcus pneumoniae-associated pneumonia complicated by purulent pericarditis: case series

International Nuclear Information System (INIS)

Cilloniz, Catia; Torres, Antoni; Rangel, Ernesto; Barlascini, Cornelius; Piroddi, Ines Maria Grazia; Nicolini, Antonello

2015-01-01

Objective: In the antibiotic era, purulent pericarditis is a rare entity. However, there are still reports of cases of the disease, which is associated with high mortality, and most such cases are attributed to delayed diagnosis. Approximately 40-50% of all cases of purulent pericarditis are caused by Gram-positive bacteria, Streptococcus pneumoniae in particular. Methods: We report four cases of pneumococcal pneumonia complicated by pericarditis, with different clinical features and levels of severity. Results: In three of the four cases, the main complication was cardiac tamponade. Microbiological screening (urinary antigen testing and pleural fluid culture) confirmed the diagnosis of severe pneumococcal pneumonia complicated by purulent pericarditis. Conclusions: In cases of pneumococcal pneumonia complicated by pericarditis, early diagnosis is of paramount importance to avoid severe hemodynamic compromise. The complications of acute pericarditis appear early in the clinical course of the infection. The most serious complications are cardiac tamponade and its consequences. Antibiotic therapy combined with pericardiocentesis drastically reduces the mortality associated with purulent pericarditis. (author)

Development of new synthetic oligosaccharide vaccines : the immunogenicity of oligosaccharide-CRM197 neoconjugates and oligosaccharide/peptide hybrid gold nanoparticles based on the capsular polysaccharide structure of Streptococcus pneumoniae type 14

NARCIS (Netherlands)

Safari, D.

2010-01-01

Streptococcus pneumoniae is a leading cause of bacterial pneumonia, meningitis, and sepsis in children worldwide. Nowadays, the antibiotic resistance of S. pneumoniae bacteria has increased worldwide. This makes treatment of S. pneumoniae infections more difficult and stresses the importance of the

Host population structure and treatment frequency maintain balancing selection on drug resistance

Science.gov (United States)

Baskerville, Edward B.; Colijn, Caroline; Hanage, William; Fraser, Christophe; Lipsitch, Marc

2017-01-01

It is a truism that antimicrobial drugs select for resistance, but explaining pathogen- and population-specific variation in patterns of resistance remains an open problem. Like other common commensals, Streptococcus pneumoniae has demonstrated persistent coexistence of drug-sensitive and drug-resistant strains. Theoretically, this outcome is unlikely. We modelled the dynamics of competing strains of S. pneumoniae to investigate the impact of transmission dynamics and treatment-induced selective pressures on the probability of stable coexistence. We find that the outcome of competition is extremely sensitive to structure in the host population, although coexistence can arise from age-assortative transmission models with age-varying rates of antibiotic use. Moreover, we find that the selective pressure from antibiotics arises not so much from the rate of antibiotic use per se but from the frequency of treatment: frequent antibiotic therapy disproportionately impacts the fitness of sensitive strains. This same phenomenon explains why serotypes with longer durations of carriage tend to be more resistant. These dynamics may apply to other potentially pathogenic, microbial commensals and highlight how population structure, which is often omitted from models, can have a large impact. PMID:28835542

Streptococcus pneumoniae and Haemophilus influenzae as etiological agents of conjunctivitis outbreaks in the region of Ribeirão Preto, SP, Brazil

Directory of Open Access Journals (Sweden)

Marta I. C. MEDEIROS

1998-01-01

Full Text Available In the study of conjunctivitis outbreaks occurring from September 1994 to September 1996 in the region of Ribeirão Preto, conjunctival exudates of 92 patients were cultivated in Instituto Adolfo Lutz Laboratory I, Ribeirão Preto. Most cases occurred in the age range 2-7 years. The etiological agents which were most frequently isolated from the analyzed cases were: Streptococcus pneumoniae and Haemophilus influenzae, in 40.22% and 21.74%, respectively. 51.35% of the S. pneumoniae isolated strains were not typable. The oxacillin-resistant S. pneumoniae strains were submitted to the minimum inhibitory concentration test (MIC and three of them presented intermediate resistance, whereas only one was highly resistant to penicillin.No estudo de surtos de conjuntivite ocorridos no período de setembro de 1994 a setembro de 1996, na região de Ribeirão Preto, foram semeadas no Instituto Adolfo Lutz Laboratório I, Ribeirão Preto, exsudatos conjuntivais de 92 pacientes, sendo que a maioria dos casos estava na faixa etária de 2-7 anos. Os agentes etiológicos mais freqüentemente isolados dos casos analisados foram: Streptococcus pneumoniae e Haemophilus influenzae em 40,22% e 21,74% respectivamente. 51,35% das cepas de S. pneumoniae isoladas foram não tipáveis. As cepas de S. pneumoniae oxacilina resistente foram submetidas ao teste de concentração inibitória mínima (CIM, sendo que três apresentaram resistência intermediária e apenas uma foi altamente resistente à penicilina.

Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia Susceptibility to antimicrobial agents in isolates of invasive Streptococcus pneumoniae in Colombia

Directory of Open Access Journals (Sweden)

Aura Lucía Leal

1999-03-01

Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P A study was done to determine the patterns of susceptibility to antimicrobial agents in isolates of Streptococcus

Streptococcus pneumoniae, mecanismos de resistencia antimicrobiana

Directory of Open Access Journals (Sweden)

Amauri Noda Albelo

2011-09-01

Full Text Available El Streptococcus pneumoniae, principal agente causal de la neumonía comunitaria, líder en la etiología de la otitis media y la meningitis, en las últimas 3 décadas ha incrementado, de manera importante, su resistencia a los agentes terapéuticos más utilizados, como los betalactámicos, macrólidos, azálidos y fluroquinolonas. La versatilidad adaptativa del microorganismo le ha permitido crear mecanismos capaces de sobreponerse a cualquiera de estas agresiones terapéuticas con un grado variable de eficacia. Se realiza una revisión de los mecanismos más importantes implicados en la adquisición de resistencia antimicrobiana por S. pneumoniae, y se precisan algunos de los factores de riesgo implicados en infección por S. pneumoniae resistente.

Lung abscess caused by Streptococcus pneumoniae serotype 6B.

Science.gov (United States)

Ito, Yuhei; Toyoshima, Hirokazu; Suzuki, Takehiro; Iwamoto, Keisuke; Sasano, Hajime; Itani, Hidetoshi; Kondo, Shigeto; Tanigawa, Motoaki

2018-01-01

Lung abscess has been considered to be a rare complication of pneumococcal infection, and most cases are reported to be Streptococcus pneumoniae serotype 3. A 67-year-old man presented with fever and was diagnosed to have lung abscess caused by S. pneumoniae serotype 6B. The minimal inhibitory concentration (MIC) of penicillin for the isolate was 1 μg/mL. He was treated with high-dose intravenous sulbactam/ampicillin as definitive therapy based on susceptibility testing for S. pneumoniae and recovered successfully without surgical intervention. S. pneumoniae serotype 6B can cause lung abscess.

The post-vaccine microevolution of invasive Streptococcus pneumoniae

NARCIS (Netherlands)

Cremers, Amelieke J H; Mobegi, Fredrick M; de Jonge, Marien I; van Hijum, Sacha A F T; Meis, Jacques F; Hermans, Peter W M; Ferwerda, Gerben; Bentley, Stephen D; Zomer, Aldert L

2015-01-01

The 7-valent pneumococcal conjugated vaccine (PCV7) has affected the genetic population of Streptococcus pneumoniae in pediatric carriage. Little is known however about pneumococcal population genomics in adult invasive pneumococcal disease (IPD) under vaccine pressure. We sequenced and serotyped

Correlations between computed tomography findings and clinical manifestations of Streptococcus pneumoniae pneumonia

International Nuclear Information System (INIS)

Yagihashi, Kunihiro; Kurihara, Yasuyuki; Fujikawa, Atsuko; Matsuoka, Shin; Nakajima, Yasuo

2011-01-01

The aim of this study was to characterize the imaging features and compare computed tomography (CT) findings with clinical features of patients with Streptococcus pneumoniae pneumonia. We retrospectively reviewed 75 patients (44 men, 31 women; mean age 67 years) diagnosed with S. pneumoniae pneumonia who underwent chest CT scanning at our institution between January 2007 and August 2008. Diagnoses were based on detection of the S. pneumoniae antigen in urine. Chest CT scans revealed abnormalities in all patients. The predominant opacity patterns were an airspace pneumonia pattern (48%) and a bronchopneumonia pattern (48%), followed by an interstitial pneumonia pattern (4%). Consolidation was observed most frequently (84%) followed by ground glass opacity (82.7%), bronchial wall thickening (61.3%), and centrilobular nodules (49.3%). Airway dilatation (21.6%), pleural effusion (33.3%), lymphadenopathy (34.8%), and pulmonary emphysema (21.3%) were also observed. Pulmonary emphysema was significantly less frequent in patients with the bronchopneumonia pattern than in those without (p=0.007). The clinical features and CT findings did not differ significantly. CT image analysis showed that patients with S. pneumoniae pneumonia exhibited the bronchopneumonia and airspace pneumonia patterns with equal frequency. Bronchopneumonia pattern was less common in patients with preexisting emphysema. (author)

Evolution of Streptococcus pneumoniae and its close commensal relatives

DEFF Research Database (Denmark)

Kilian, Mogens; Poulsen, Knud; Blomqvist, Trinelise

2008-01-01

Streptococcus pneumoniae is a member of the Mitis group of streptococci which, according to 16S rRNA-sequence based phylogenetic reconstruction, includes 12 species. While other species of this group are considered prototypes of commensal bacteria, S. pneumoniae is among the most frequent microbial...... of unique genes and their origin support the model that the entire cluster of S. pneumoniae, S. pseudopneumoniae, and S. mitis lineages evolved from pneumococcus-like bacteria presumably pathogenic to the common immediate ancestor of hominoids. During their adaptation to a commensal life style, most...

Dyrkningsnegativ Streptococcus pneumoniae endokarditis diagnosticeret med polymerasekaedereaktion

DEFF Research Database (Denmark)

Rasmussen, Rasmus Vedby; Kemp, Michael; Bangsborg, Jette Marie

2008-01-01

A 60-year old man was admitted with sepsis and meningitis of unknown aetiology. Underlying aortic valve endocarditis was diagnosed by echocardiography and severe insufficiency led to aortic valve replacement. Application of broad-range PCR to cusp tissue revealed a DNA product, and a diagnosis of...... of Streptococcus pneumoniae endocarditis was obtained by DNA sequencing....

Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children.

Science.gov (United States)

Quintero, B; Araque, M; van der Gaast-de Jongh, C; Escalona, F; Correa, M; Morillo-Puente, S; Vielma, S; Hermans, P W M

2011-01-01

Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5 years of age in Merida, Venezuela, in 2007. The prevalence of S. pneumoniae colonization, S. aureus colonization, and S. pneumoniae-S. aureus co-colonization was 28%, 56%, and 16%, respectively. Pneumococcal serotypes 6B (14%), 19F (12%), 23F (12%), 15 (9%), 6A (8%), 11 (8%), 23A (6%), and 34 (6%) were the most prevalent. Non-respiratory atopy was a risk factor for S. aureus colonization (p = 0.017). Vaccine serotypes were negatively associated with preceding respiratory infection (p = 0.02) and with S. aureus colonization (p = 0.03). We observed a high prevalence of pneumococcal resistance against trimethoprim-sulfamethoxazole (40%), erythromycin (38%), and penicillin (14%). Semi-quantitative measurement of pneumococcal colonization density showed that children with young siblings and low socioeconomic status were more densely colonized (p = 0.02 and p = 0.02, respectively). In contrast, trimethoprim-sulfamethoxazole- and multidrug-resistant-pneumococci colonized children sparsely (p = 0.03 and p = 0.01, respectively). Our data form an important basis to monitor the future impact of pneumococcal vaccination on bacterial colonization, as well as to recommend a rationalized and restrictive antimicrobial use in our community.

[Distribution and drug resistance of the pathogenic bacteria from sputum specimens of 1 125 children with tracheo bronchial foreign bodies].

Science.gov (United States)

Wen, Xin; Su, Jinzhu; Cui, Li; Wang, Juan; Zuo, Lujie

2015-02-01

To analyze the distribution and drug susceptibility of the pathogenic bacteria in the airway secretions in children with tracheobronchial foreign bodies so as to assist physicians in clinical prescription. Sputum specimens of 1 125 children with tracheobronchial foreign bodies were collected in removal of the foreign bodies by rigid bronchoscope, and the drug susceptibility test was performed. Pathogenic bacteria were detected in 218 (19.4%) of 1 125 sputum specimens. Among the pathogenic bacteria, 126 (57.79%) strains were gram-negative bacilli, consisting of 76 (34.86%) strains of Haemophilus influenzae, 10 (4.59%) strains of Escherichia coli, 7 (3.21%) strains of Sewer enterobacter, 7 (3.21%) strains of Pseudomonas aeruginosa, and 6 (2.75%) strains of Klebsiella bacillus; and 92 (42.21%) strains were gram-positive bacilli, consisting of 80 (36.69%) strains of Streptococcus pneumonia and 10 (4.59%) strains of Escherichia coli. Most of detected gram-negative bacilli were highly sensitive to cefepime, ceftazidine, imipenem and amikacin, no strains were resistant to meropenem and ciprofloxacin. None of the detected gram-positive bacilli were resistant to cefepime, vancomycin, levofloxacin and teicoplanin. The Haemophilus influenzae of gram-negative bacilli and the Streptococcus pneumonia of gram-positive bacilli are the main pathogenic bacteria existing in the airway secretions of children with tracheobronchial foreign bodies. The Haemophilus influenzae were highly sensitive to cephalosporin, imipenem and amikacin, and the Streptococcus pneumonia to cefepime, vancomycin, levofloxacin and teicoplanin.

JST Thesaurus Headwords and Synonyms: Streptococcus pneumoniae [MeCab user dictionary for science technology term[Archive

Lifescience Database Archive (English)

Full Text Available MeCab user dictionary for science technology term Streptococcus pneumoniae 名詞 一般 * ...* * * 肺炎球菌 ハイエンキュウキン ハイエンキューキン Thesaurus2015 200906003627228649 C LS07 UNKNOWN_2 Streptococcus pneumoniae

Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children

OpenAIRE

Quintero, B.; Araque, M.; van der Gaast-de Jongh, C.; Escalona, F.; Correa, M.; Morillo-Puente, S.; Vielma, S.; Hermans, P. W. M.

2010-01-01

Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5?years of age in Merida, Venezuela, in 2007. The prevalence of S. pneumoniae colonization, S. aureus colonization, and S. pneumoniae?S. aureus co-colonization was 28%, 56%, and 16%, respectively. Pneumococcal serotypes 6B (14%), 19F (12%), 23F (12%), 15 (9%), 6...

A type IV pilus mediates DNA binding during natural transformation in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Raphaël Laurenceau

Full Text Available Natural genetic transformation is widely distributed in bacteria and generally occurs during a genetically programmed differentiated state called competence. This process promotes genome plasticity and adaptability in Gram-negative and Gram-positive bacteria. Transformation requires the binding and internalization of exogenous DNA, the mechanisms of which are unclear. Here, we report the discovery of a transformation pilus at the surface of competent Streptococcus pneumoniae cells. This Type IV-like pilus, which is primarily composed of the ComGC pilin, is required for transformation. We provide evidence that it directly binds DNA and propose that the transformation pilus is the primary DNA receptor on the bacterial cell during transformation in S. pneumoniae. Being a central component of the transformation apparatus, the transformation pilus enables S. pneumoniae, a major Gram-positive human pathogen, to acquire resistance to antibiotics and to escape vaccines through the binding and incorporation of new genetic material.

Lung abscess due to Streptococcus pneumoniae simulating pulmonary tuberculosis: presentation of two cases

Directory of Open Access Journals (Sweden)

Alessandro Perazzo

2014-03-01

Full Text Available In the past, anaerobes were the most common cause of community-acquired lung abscess; Streptococcus species were the second most common cause. In recent years, this has changed. Klebsiella pneumoniae is now most common cause of community- acquired lung abscess, although Streptococcus species remain pathogen of major importance. We present two cases of pulmonary cavitation due to Streptococcus pneumoniae which resembled pulmonary tuberculosis with regards to their history and radiological findings. These are examples of a common diagnosis presenting in an uncommon way. Our cases had some peculiarities: they had a clinical picture strongly suggestive of pulmonary tuberculosis or lung cancer rather than necrotizing infectious pneumonia in patients with no comorbidities or underlying diseases (including oral or dental pathologies. Radiological findings did not help the clinicians: pulmonary tuberculosis was the first diagnostic hypothesis in both cases. An underlying lung cancer was excluded in the first case only after invasive pulmonary procedures.

Outbreak of Streptococcus pneumoniae in a Psychiatric Unit

Centers for Disease Control (CDC) Podcasts

2012-11-02

Dr. Katherine Fleming-Dutra, an epidemiologist at CDC, discusses her investigation of a Streptococcus pneumoniae outbreak in a pediatric psychiatric unit.  Created: 11/2/2012 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID); National Center for Immunization and Respiratory Diseases (NCIRD).   Date Released: 11/5/2012.

Individual risk factors associated with nasopharyngeal colonization with Streptococcus pneumoniae and Haemophilus influenzae: a Japanese birth cohort study.

Science.gov (United States)

Otsuka, Taketo; Chang, Bin; Shirai, Takatoshi; Iwaya, Atsushi; Wada, Akihito; Yamanaka, Noboru; Okazaki, Minoru

2013-07-01

The first step in a bacterial disease is the establishment of nasopharyngeal carriage. We conducted a birth cohort study to identify factors associated with colonization in healthy children and evaluate the serotype distributions and resistances of Streptococcus pneumoniae/Haemophilus influenzae. Nasopharyngeal cultures were obtained from 349 subjects at 5 time points coinciding with health checkups (4, 7, 10, 18 and 36 months). A total of 551 S. pneumoniae (penicillin resistance rate: 46.3%) and 301 H. influenzae (ampicillin resistance rate: 44.5%) isolates were obtained from 1654 samples. In this study, 47.5% and 60.9% of S. pneumoniae isolates were included in the serotypes of 7- and 13-valent pneumococcal conjugate vaccines, respectively. Analyzing by Cox proportional hazards models, cohabiting older sibling(s) attending day-care (hazard ratios: 2.064-3.518, P rates. This data indicated that introduction of appropriate antimicrobial usage in areas of overuse of antimicrobials could contribute to lower colonization of S. pneumoniae/H. influenzae, resulting in a decrease in the absolute number of resistant isolates. Strategies to control transmission at day-care centers or from older sibling(s) as well as appropriate use of antimicrobials are essential for reducing colonization and the absolute number of resistant isolates.

Prevalence of mef and ermB genes in invasive pediatric erythromycin-resistant Streptococcus pneumoniae isolates from Argentina Prevalencia de los genes mef y ermB en aislamientos invasivos de Streptococcus pneumoniae resistentes a eritromicina recuperados de pacientes pediátricos en Argentina

Directory of Open Access Journals (Sweden)

A. Corso

2009-03-01

Full Text Available During the period 1993-2001, a total of 1,499 pneumococci isolates were recovered through the Argentinean surveillance of Streptococcus pneumoniae causing invasive disease in children under 6 years of age, 3.5% of which were erythromycin resistant. Among the 50 erythromycin-resistant strains available, 58% (n=29 harbored mefA/E genes (15 mefA, 30%; and 14 mefE, 28%, 34% (n=17 ermB, and 6% (n=3 both mefA/E plus ermB genes, while one isolate was negative for all the acquired genes studied. The England14-9 (42%, Poland6B-20 (20% and Spain9v-3 (16% clones were responsible for the emergence of pneumococcal macrolide resistance in pediatric population from Argentina.En el marco del programa de vigilancia regional SIREVA, se analizaron 1499 aislamientos de Streptococcus pneumoniae causantes de enfermedad invasiva en menores de 6 años, recuperados entre 1993 y 2001. Se detectó un 3,5% de resistencia a eritromicina. De los 50 aislamientos resistentes a eritromicina que pudieron ser estudiados, el 58% (n=29 tenían los genes mefA/E (15 mefA, 30% y 14 mefE, 28%, el 34% (n=17 el gen ermB y el 6% (n=3 la combinación de genes mefA/E y ermB. Sólo un aislamiento fue negativo para todos los genes analizados. Los clones internacionales England14-9, Poland6B-20 y Spain9v-3 representaron el 78% del total de aislamientos resistentes (42, 20 y 16%, respectivamente y se consideraron los responsables de la emergencia de la resistencia a macrólidos entre los neumococos que afectan a la población pediátrica de Argentina.

Bright fluorescent Streptococcus pneumoniae for live cell imaging of host-pathogen interactions

NARCIS (Netherlands)

Kjos, M.; Aprianto, R.; Fernandes, V.E.; Andrew, P.W.; Strijp, van J.A.G.; Nijland, R.; Veening, J.W.

2015-01-01

Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people, but at the same time one of the major causes of infectious diseases such as pneumonia, meningitis and sepsis. The shift from commensal to pathogen and its interaction with host cells is poorly understood. One of the

Bright Fluorescent Streptococcus pneumoniae for Live-Cell Imaging of Host-Pathogen Interactions

NARCIS (Netherlands)

Kjos, Morten; Aprianto, Rieza; Fernandes, Vitor E.; Andrew, Peter W.; van Strijp, Jos A. G.; Nijland, Reindert; Veening, Jan-Willem

Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people but, at the same time, one of the major causes of infectious diseases such as pneumonia, meningitis, and sepsis. The shift from commensal to pathogen and its interaction with host cells are poorly understood. One of the

Pneumonia caused by extensive drug-resistant Acinetobacter baumannii among hospitalized patients: genetic relationships, risk factors and mortality.

Science.gov (United States)

Li, Yu Jun; Pan, Chu Zhi; Fang, Chang Quan; Zhao, Zhu Xiang; Chen, Hui Ling; Guo, Peng Hao; Zhao, Zi Wen

2017-05-30

The clonal spread of multiple drug-resistant Acinetobacter baumannii is an emerging problem in China. We analysed the molecular epidemiology of Acinetobacter baumanni isolates at three teaching hospitals and investigated the risk factors, clinical features, and outcomes of hospital-acquired pneumonia caused by extensive drug-resistant Acinetobacter baumannii (XDRAB) infection in Guangzhou, China. Fifty-two A. baumannii isolates were collected. Multilocus sequence typing (MLST) was used to assess the genetic relationships among the isolates. The bla OXA-51-like gene was amplified using polymerase chain reaction (PCR) and sequencing. The resistance phenotypes were determined using the disc diffusion method. A retrospective case-control study was performed to determine factors associated with XDRAB pneumonia. Most of the 52 A. baumannii isolates (N = 37, 71.2%) were collected from intensive care units (ICUs). The respiratory system was the most common bodily site from which A. baumannii was recovered (N = 45, 86.5%). Disc diffusion classified the isolates into 17 multidrug-resistant (MDR) and 35 extensively drug-resistant (XDR) strains. MLST grouped the A. baumannii isolates into 5 existing sequence types (STs) and 7 new STs. ST195 and ST208 accounted for 69.2% (36/52) of the isolates. The clonal relationship analysis showed that ST195 and ST208 belonged to clonal complex (CC) 92. According to the sequence-based typing (SBT) of the bla OXA-51-like gene, 51 A. baumannii isolates carried OXA-66 and the rest carried OXA-199. There were no significant differences with respect to the resistance phenotype between the CC92 and non-CC92 strains (P = 0.767). The multivariate analysis showed that the APACHE II score, chronic obstructive pulmonary disease (COPD) and cardiac disease were independent risk factors for XDRAB pneumonia (P < 0.05). The mortality rate of XDRAB pneumonia was high (up to 42.8%), but pneumonia caused by XDRAB was not associated with in

Induction of prophages by fluoroquinolones in Streptococcus pneumoniae: implications for emergence of resistance in genetically-related clones.

Directory of Open Access Journals (Sweden)

Elena López

Full Text Available Antibiotic resistance in Streptococcus pneumoniae has increased worldwide by the spread of a few clones. Fluoroquinolone resistance occurs mainly by alteration of their intracellular targets, the type II DNA topoisomerases, which is acquired either by point mutation or by recombination. Increase in fluoroquinolone-resistance may depend on the balance between antibiotic consumption and the cost that resistance imposes to bacterial fitness. In addition, pneumococcal prophages could play an important role. Prophage induction by fluoroquinolones was confirmed in 4 clinical isolates by using Southern blot hybridization. Clinical isolates (105 fluoroquinolone-resistant and 160 fluoroquinolone-susceptible were tested for lysogeny by using a PCR assay and functional prophage carriage was studied by mitomycin C induction. Fluoroquinolone-resistant strains harbored fewer inducible prophages (17/43 than fluoroquinolone-susceptible strains (49/70 (P = 0.0018. In addition, isolates of clones associated with fluoroquinolone resistance [CC156 (3/25; CC63 (2/20, and CC81 (1/19], had lower frequency of functional prophages than isolates of clones with low incidence of fluoroquinolone resistance [CC30 (4/21, CC230 (5/20, CC62 (9/21, and CC180 (21/30]. Likewise, persistent strains from patients with chronic respiratory diseases subjected to fluoroquinolone treatment had a low frequency of inducible prophages (1/11. Development of ciprofloxacin resistance was tested with two isogenic strains, one lysogenic and the other non-lysogenic: emergence of resistance was only observed in the non-lysogenic strain. These results are compatible with the lysis of lysogenic isolates receiving fluoroquinolones before the development of resistance and explain the inverse relation between presence of inducible prophages and fluoroquinolone-resistance.

Multidrug-resistant Streptococcus pneumoniae isolates from healthy Ghanaian preschool children

DEFF Research Database (Denmark)

Dayie, Nicholas Tete Kwaku Dzifa; Arhin, Reuben E.; Newman, Mercy J.

2015-01-01

in a previous study, to six antimicrobials was determined by disk diffusion test. Overall, 90.4% of isolates were intermediate penicillin resistant, 99.1% were trimethoprim resistant, 73.0% were tetracycline resistant, and 33.9% were sulfamethoxazole resistant. Low resistance was recorded for erythromycin (2...... of this study was to determine the antibiogram of S. pneumoniae recovered from Ghanaian children younger than six years of age and to what extent resistances were due to the spread of certain sero- and multilocus sequence typing (MLST) types. The susceptibility of 115 pneumococcal isolates, recovered...

Comparison of genes required for H2O2 resistance in Streptococcus gordonii and Streptococcus sanguinis

Science.gov (United States)

Xu, Yifan; Itzek, Andreas

2014-01-01

Hydrogen peroxide (H2O2) is produced by several members of the genus Streptococcus mainly through the pyruvate oxidase SpxB under aerobic growth conditions. The acute toxic nature of H2O2 raises the interesting question of how streptococci cope with intrinsically produced H2O2, which subsequently accumulates in the microenvironment and threatens the closely surrounding population. Here, we investigate the H2O2 susceptibility of oral Streptococcus gordonii and Streptococcus sanguinis and elucidate potential mechanisms of how they protect themselves from the deleterious effect of H2O2. Both organisms are considered primary colonizers and occupy the same intraoral niche making them potential targets for H2O2 produced by other species. We demonstrate that S. gordonii produces relatively more H2O2 and has a greater ability for resistance to H2O2 stress. Functional studies show that, unlike in Streptococcus pneumoniae, H2O2 resistance is not dependent on a functional SpxB and confirms the important role of the ferritin-like DNA-binding protein Dps. However, the observed increased H2O2 resistance of S. gordonii over S. sanguinis is likely to be caused by an oxidative stress protection machinery present even under anaerobic conditions, while S. sanguinis requires a longer period of time for adaptation. The ability to produce more H2O2 and be more resistant to H2O2 might aid S. gordonii in the competitive oral biofilm environment, since it is lower in abundance yet manages to survive quite efficiently in the oral biofilm. PMID:25280752

Detection of Streptococcus pneumoniae in whole blood by PCR.

Science.gov (United States)

Zhang, Y; Isaacman, D J; Wadowsky, R M; Rydquist-White, J; Post, J C; Ehrlich, G D

1995-03-01

Streptococcus pneumoniae is a major cause of bacteremia in both children and adults. Currently, the diagnosis of pneumococcal bacteremia relies on the isolation and identification of the bacteria from blood cultures. We have developed a sensitive assay for the detection of S. pneumoniae in whole blood by the PCR. A specific primer-probe set (JM201 and JM202 primers with JM204 probe) designed from the penicillin-binding protein 2B gene was demonstrated to reproducibly detect between 10 and 100 fg of input purified S. pneumoniae DNA. This assay system was shown to be inclusive for all strains of S. pneumoniae evaluated, including 15 different serotypes and a battery of penicillin-resistant and -sensitive strains. The specificity of this PCR-based assay was demonstrated by its inability to support amplification from a series of human, bacterial, and yeast genomic DNAs. A general specimen preparation method which should be suitable for the purification of DNA from any pathogens in whole blood was developed. With this protocol it was possible to detect S. pneumoniae-specific DNA from whole blood specimens inoculated with as little as 4 CFU/ml. Copurified human blood DNA, ranging from 0 to 4.5 micrograms per PCR, did not affect the sensitivity of S. pneumoniae detection by PCR. A blinded clinical trial was used to compare the PCR-based assay with standard microbiological blood culture for the detection of S. pneumoniae bacteremia in 36 specimens obtained from pediatric patients seen in the emergency room of Children's Hospital of Pittsburgh. With culture as the "gold standard," the PCR-based assay had a sensitivity of 80% (4 of 5 culture-positive specimens were PCR positive) and a specificity of 84% (26 of 31 culture-negative specimens were PCR negative). However, three patients whose specimens were PCR positive and culture negative had histories suggestive of bacteremia, including recent positive blood cultures, treatment with antibiotics, cellulitis, and multiple

Evaluation of a PCR Assay for Detection of Streptococcus pneumoniae in Respiratory and Nonrespiratory Samples from Adults with Community-Acquired Pneumonia

OpenAIRE

Murdoch, David R.; Anderson, Trevor P.; Beynon, Kirsten A.; Chua, Alvin; Fleming, Angela M.; Laing, Richard T. R.; Town, G. Ian; Mills, Graham D.; Chambers, Stephen T.; Jennings, Lance C.

2003-01-01

Streptococcus pneumoniae is the most common cause of community-acquired pneumonia, but it is undoubtedly underdiagnosed. We used a nested PCR assay (targeting the pneumolysin gene) to detect S. pneumoniae DNA in multiple sample types from 474 adults with community-acquired pneumonia and 183 control patients who did not have pneumonia. Plasma or buffy coat samples were PCR positive in only 6 of the 21 patients with positive blood cultures for S. pneumoniae and in 12 other patients (4 of whom h...

Neutrophil evasion strategies by Streptococcus pneumoniae and Staphylococcus aureus.

Science.gov (United States)

Lewis, Megan L; Surewaard, Bas G J

2018-03-01

Humans are well equipped to defend themselves against bacteria. The innate immune system employs diverse mechanisms to recognize, control and initiate a response that can destroy millions of different microbes. Microbes that evade the sophisticated innate immune system are able to escape detection and could become pathogens. The pathogens Streptococcus pneumoniae and Staphylococcus aureus are particularly successful due to the development of a wide variety of virulence strategies for bacterial pathogenesis and they invest significant efforts towards mechanisms that allow for neutrophil evasion. Neutrophils are a primary cellular defense and can rapidly kill invading microbes, which is an indispensable function for maintaining host health. This review compares the key features of Streptococcus pneumoniae and Staphylococcus aureus in epidemiology, with a specific focus on virulence mechanisms utilized to evade neutrophils in bacterial pathogenesis. It is important to understand the complex interactions between pathogenic bacteria and neutrophils so that we can disrupt the ability of pathogens to cause disease.

Streptococcus pneumoniae – caused CAP in hospitalised patients: mortality predictors

Directory of Open Access Journals (Sweden)

Sandra Figueiredo

2008-09-01

Full Text Available Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for microbiological testing using standard culture techniques and urine antigen detection. Pneumonia Severity Index (PSI and British Thoracic Society (BTS CURB-65 scoring tools were evaluated. The statistical treatment was performed using the SPSS 14.0 program. We included 104 patients, 67.3% male, median age 63 years old, mortality 13.4%. There was a significant association between the PSI and CURB-65 score and mortality. Despite advances, CAP is still an important health problem with a high atten - dant morbi-mortality. This study confirms the value of PSI and CURB-65 in the prediction of severe pneumonia. Resumo: A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS - CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0.Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67

Rapid Assessment of Resistance to Antibiotic Inhibitors of Protein Synthesis in the Gram-Positive Pathogens, Enterococcus faecalis and Streptococcus pneumoniae, Based on Evaluation of the Lytic Response.

Science.gov (United States)

Otero, Fátima; Tamayo, María; Santiso, Rebeca; Gosálvez, Jaime; Bou, Germán; Fernández, José Luis

2017-04-01

A novel assay for rapid determination of resistance to antibiotic inhibitors of protein synthesis was developed for the gram-positive pathogens, Enterococcus faecalis and Streptococcus pneumoniae. To this purpose, a lytic response was obtained by a brief incubation with lysozyme or a mixture of lysozyme, Triton X-100, and EDTA for E. faecalis (n = 82) and S. pneumoniae (n = 51), respectively. Lysis was quantified by visualizing the released nucleoids. Antibiotic-susceptible bacteria treated with Clinical and Laboratory Standards Institute (CLSI) breakpoint doses of erythromycin, azithromycin, or doxycycline that inhibited protein synthesis demonstrated a large reduction of lysed cells with respect to the control, that is, without antibiotics. However, cell lysis prevention was much lower in nonsusceptible strains, with unsuccessful inhibition of protein synthesis. ROC analysis showed that a reduction value of ≥35.6% and ≥40.4% discriminates susceptible and nonsusceptible strains for erythromycin and for doxycycline, respectively, in E. faecalis, whereas ≥20.0% is adequate for both macrolides and doxycycline in S. pneumoniae. Resistant stains were identified in 90-120 min with sensitivity and specificity between 91.7% and 100%. This is a proof of concept that evaluation of the lytic response may be a rapid and efficient test for determination of resistance to antibiotic inhibitors of protein synthesis.

Genetic diversity of Streptococcus equi subsp. zooepidemicus and doxycycline resistance in kennelled dogs.

Science.gov (United States)

Chalker, Victoria J; Waller, Andrew; Webb, Katy; Spearing, Emma; Crosse, Patricia; Brownlie, Joe; Erles, Kerstin

2012-06-01

The genetic diversity and antibiotic resistance profiles of 38 Streptococcus equi subsp. zooepidemicus isolates were determined from a kennelled canine population during two outbreaks of hemorrhagic pneumonia (1999 to 2002 and 2007 to 2010). Analysis of the szp gene hypervariable region and the 16S-23S rRNA intergenic spacer region and multilocus sequence typing (MLST) indicated a predominant tetO-positive, doxycycline-resistant ST-10 strain during 1999 to 2002 and a predominant tetM-positive doxycycline-resistant ST-62 strain during 2007 to 2010.

Molecular characterization of multidrug-resistant Klebsiella pneumoniae isolates

Directory of Open Access Journals (Sweden)

Xiang-hua Hou

2015-09-01

Full Text Available Klebsiella pneumoniae is an important cause of healthcare-associated infections worldwide. Selective pressure, the extensive use of antibiotics, and the conjugational transmission of antibiotic resistance genes across bacterial species and genera facilitate the emergence of multidrug-resistant (MDR K. pneumoniae. Here, we examined the occurrence, phenotypes and genetic features of MDR K. pneumoniae isolated from patients in intensive care units (ICUs at the First Affiliated Hospital of Xiamen University in Xiamen, China, from January to December 2011. Thirty-eight MDR K. pneumoniae strains were collected. These MDR K. pneumoniae isolates possessed at least seven antibiotic resistance determinants, which contribute to the high-level resistance of these bacteria to aminoglycosides, macrolides, quinolones and β-lactams. Among these isolates, 24 strains were extended-spectrum β-lactamase (ESBL producers, 2 strains were AmpC producers, and 12 strains were both ESBL and AmpC producers. The 38 MDR isolates also contained class I (28/38 and class II integrons (10/38. All 28 class I-positive isolates contained aacC1, aacC4, orfX, orfX’ and aadA1 genes. β-lactam resistance was conferred through blaSHV (22/38, blaTEM (10/38, and blaCTX-M (7/38. The highly conserved blaKPC-2 (37/38 and blaOXA-23(1/38 alleles were responsible for carbapenem resistance, and a gyrAsite mutation (27/38 and the plasmid-mediated qnrB gene (13/38 were responsible for quinolone resistance. Repetitive-sequence-based PCR (REP-PCR fingerprinting of these MDR strains revealed the presence of five groups and sixteen patterns. The MDR strains from unrelated groups showed different drug resistance patterns; however, some homologous strains also showed different drug resistance profiles. Therefore, REP-PCR-based analyses can provide information to evaluate the epidemic status of nosocomial infection caused by MDR K. pneumoniae; however, this test lacks the power to discriminate some

Pharyngeal colonization and drug resistance profiles of Morraxella catarrrhalis, Streptococcus pneumoniae, Staphylococcus aureus, and Haemophilus influenzae among HIV infected children attending ART Clinic of Felegehiwot Referral Hospital, Ethiopia.

Directory of Open Access Journals (Sweden)

Wondemagegn Mulu

Full Text Available Asymptomatic pharyngeal colonization by potential bacteria is the primary reservoir for bacterial species within a population and is considered a prerequisite for development of major childhood diseases such as sinusitis, otitis media, pneumonia, bacteremia, and meningitis. However, there is dearth of data on the colonization and drug resistance pattern of the main bacterial pathogens in the pharynx of HIV infected children in Ethiopia. Therefore, this study determined the pharyngeal colonization and drug resistance profile of bacterial pathogens in HIV infected children attending ART clinic of Felegehiwot Referral Hospital (FHRH, Amhara Region, Ethiopia.A hospital based cross-sectional study was conducted from May 2016 to June 2017 at the ART clinic of FHRH. A total of 300 HIV infected children were enrolled in the study. Data on socio-demographic characteristics of the study participants were collected with face-to-face interview and patient-card review using structured questionnaire. Bacterial species were identified using standard bacteriological techniques. Drug susceptibility testing was performed using disk diffusion technique. Chi-square test was done to determine associations among variables.The median age of the participants was 11 years. Overall, 153 (51% of children were colonized by respiratory bacteria in their pharynx. Colonization rate was higher in children from mothers who had attained college and above levels of education than others (P = 0.04. It was also higher in children without the sign of malnutrition than others (P = 0.004. The colonization rate of S.aureus, M.catarrhalis, S.pneumoniae and H.influenzae were 88 (29%, 37 (12.3%, 31 (10.3% and 6 (2%, respectively. S.aureus-M.catarrhalis concurrent colonization was found in 14 (4.7% of children. Age (P = 0.03, schooling (P = 0.045 and history of running nose (P = 0.043 were significantly associated with S.aureus colonization. Living in urban setting (P = 0.042 and children

Prevalence and serotype distribution of nasopharyngeal carriage of Streptococcus pneumoniae in China: a meta-analysis.

Science.gov (United States)

Wang, Lin; Fu, Jinjian; Liang, Zhuoxin; Chen, Jichang

2017-12-13

To explore the overall prevalence and serotype distribution of nasopharyngeal carriage of Streptococcus pneumoniae(S. pneumoniae) among healthy children. A search for pneumococcal nasopharyngeal carriage studies including children published up to July 31th, 2016 was conducted to describe carriage in China. The review also describes antibiotic resistance in and serotypes of S. pneumoniae and assesses the impact of vaccination on carriage in this region. Summary measures for overall prevalence, antibiotic resistance, and serotype distributions extracted from the analyzed data were determined with 95% confidence intervals (CIs) using random-effects models. Heterogeneity was assessed using I 2 test statistics. Thirty-seven studies were included in this review, and the majority of studies (64.9%) were located in the pre-introduction period of 7-valent pneumococcal conjugate vaccine (PCV7) in China. The pooled prevalence of S. pneumoniae nasopharyngeal carriage was 21.4% (95% CI: 18.3-24.4%). Carriage was highest in children attending kindergartens [24.5%, (19.7-29.3%)] and decreased with increasing age. Before the introduction of PCV7 into China, the prevalence of S. pneumoniae nasopharyngeal carriage was 25.8% (20.7-30.9%), the pooled carriage of S. pneumoniae sharply dropped into the 14.1% (11.3-16.9%) by PCV7 vaccination period (P China, the penicillin resistance rate in S. pneumoniae isolated from healthy children was 31.9% (21.2-42.6%); however, this rate sharply decreased after the introduction of PCV7 in China [21.6%, (7.4-35.9%)], and the difference between the rates during these two time periods was statistically significant (P value China. PCV7 immunization was found to be associated with reduction of nasopharyngeal colonization of S. pneumoniae. Conjugate vaccination coverage was slightly affected by the introduction of PCV7 into China because of low vaccination rate. The government should implement timely adjusted conjugate vaccination strategies based on

Factors That Cause Trimethoprim Resistance in Streptococcus pyogenes

Science.gov (United States)

Bergmann, René; van der Linden, Mark; Chhatwal, Gursharan S.

2014-01-01

The use of trimethoprim in treatment of Streptococcus pyogenes infections has long been discouraged because it has been widely believed that this pathogen is resistant to this antibiotic. To gain more insight into the extent and molecular basis of trimethoprim resistance in S. pyogenes, we tested isolates from India and Germany and sought the factors that conferred the resistance. Resistant isolates were identified in tests for trimethoprim or trimethoprim-sulfamethoxazole (SXT) susceptibility. Resistant isolates were screened for the known horizontally transferable trimethoprim-insensitive dihydrofolate reductase (dfr) genes dfrG, dfrF, dfrA, dfrD, and dfrK. The nucleotide sequence of the intrinsic dfr gene was determined for resistant isolates lacking the horizontally transferable genes. Based on tentative criteria, 69 out of 268 isolates (25.7%) from India were resistant to trimethoprim. Occurring in 42 of the 69 resistant isolates (60.9%), dfrF appeared more frequently than dfrG (23 isolates; 33.3%) in India. The dfrF gene was also present in a collection of SXT-resistant isolates from Germany, in which it was the only detected trimethoprim resistance factor. The dfrF gene caused resistance in 4 out of 5 trimethoprim-resistant isolates from the German collection. An amino acid substitution in the intrinsic dihydrofolate reductase known from trimethoprim-resistant Streptococcus pneumoniae conferred resistance to S. pyogenes isolates of emm type 102.2, which lacked other aforementioned dfr genes. Trimethoprim may be more useful in treatment of S. pyogenes infections than previously thought. However, the factors described herein may lead to the rapid development and spread of resistance of S. pyogenes to this antibiotic agent. PMID:24492367

Molecular epidemiology of penicillin-nonsusceptible Streptococcus pneumoniae among children in Greece

NARCIS (Netherlands)

D. Bogaert (Debby); G.A. Syrogiannopoulos; I.N. Grivea; R. de Groot (Ronald); N.G. Beratis; P.W.M. Hermans (Peter)

2000-01-01

textabstractA total of 145 penicillin-nonsusceptible Streptococcus pneumoniae strains were isolated from young carriers in Greece and analyzed by antibiotic susceptibility testing, serotyping, restriction fragment end labeling (RFEL), and penicillin-binding protein

Residence of Streptococcus pneumoniae and Moraxella catarrhalis within polymicrobial biofilm promotes antibiotic resistance and bacterial persistence in vivo.

Science.gov (United States)

Perez, Antonia C; Pang, Bing; King, Lauren B; Tan, Li; Murrah, Kyle A; Reimche, Jennifer L; Wren, John T; Richardson, Stephen H; Ghandi, Uma; Swords, W Edward

2014-04-01

Otitis media (OM) is an extremely common pediatric ailment caused by opportunists that reside within the nasopharynx. Inflammation within the upper airway can promote ascension of these opportunists into the middle ear chamber. OM can be chronic/recurrent in nature, and a wealth of data indicates that in these cases, the bacteria persist within biofilms. Epidemiological data demonstrate that most cases of OM are polymicrobial, which may have significant impact on antibiotic resistance. In this study, we used in vitro biofilm assays and rodent infection models to examine the impact of polymicrobial infection with Moraxella catarrhalis and Streptococcus pneumoniae (pneumococcus) on biofilm resistance to antibiotic treatment and persistence in vivo. Consistent with prior work, M. catarrhalis conferred beta-lactamase-dependent passive protection from beta-lactam killing to pneumococci within polymicrobial biofilms. Moreover, pneumococci increased resistance of M. catarrhalis to macrolide killing in polymicrobial biofilms. However, pneumococci increased colonization in vivo by M. catarrhalis in a quorum signal-dependent manner. We also found that co-infection with M. catarrhalis affects middle ear ascension of pneumococci in both mice and chinchillas. Therefore, we conclude that residence of M. catarrhalis and pneumococci within the same biofilm community significantly impacts resistance to antibiotic treatment and bacterial persistence in vivo. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

The Streptococcus pneumoniae Competence Regulatory System Influences Respiratory Tract Colonization ▿

OpenAIRE

Kowalko, J. E.; Sebert, M. E.

2008-01-01

The Streptococcus pneumoniae ComDE two-component signaling system controls the development of genetic competence in the bacterium and affects virulence in models of pneumonia and bacteremia. We have investigated the impact of the competence pathway during colonization of the nasopharynx, the principal ecological niche of the pneumococcus. Previous work showed that deletion of the pneumococcal CiaRH signaling system inhibited colonization and increased expression of genes required for competen...

Nasopharyngeal bacterial carriage and antimicrobial resistance in underfive children with community acquired pneumonia

Directory of Open Access Journals (Sweden)

Cissy B. Kartasasmita

2002-09-01

Full Text Available Pathogens in nasopharynx is a significant risk factor of pneumonia. According to WHO, isolates to be tested for antimicrobial resistance in the community should be obtained from nasopharyngeal (NP swabs. The aim of this study is to know the bacterial patterns of the nasopharynx and cotrimoxazole resistance in under five-year old children with community acquired pneumonia. The study was carried out in 4 primary health clinic (Puskesmas in Majalaya sub-district, Bandung, West Java, Indonesia. All underfive children with cough and/or difficult breathing and classified as having non-severe pneumonia (WHO guidelines were placed in Amies transport medium and stored in a sterile jar, before taken to the laboratory for further examination, in the same day. During this nine month study, 698 children with clinical signs of non-severe pneumonia were enrolled. About 25.4% (177/698 of the nasopharyngeal specimens yielded bacterial isolates; i.e. 120 (67.8% were positive for S pneumoniae, 21 for S epidermidis and alpha streptococcus, 6 for Hafnia alvei, 5 for S aureus, 2 for B catarrhalis, and 1(0.6% for H influenza and Klebsiella, respectively. The antimicrobial resistance test to cotrimoxazole showed that 48.2% of S pneumoniae strain had full resistance and 32.7% showed intermediate resistance to cotrimoxazole. This result is almost similar to the other studies from Asian countries. It seems that H influenza is not a problem in the study area, however, a further study is needed. (Med J Indones 2002; 11: 164-8 Keywords: nasopharyngeal swab, S pneumoniae, cotrimoxazole

Resistencia a antibióticos no betalactámicos de aislamientos invasores de Streptococcus pneumoniae en niños latinoamericanos: SIREVA II, 2000-2005 Resistance to non-beta-lactam antibiotics in the clinical isolates of Streptococcus pneumoniae of children in Latin America: SIREVA II, 2000-2005

Directory of Open Access Journals (Sweden)

Clara Inés Agudelo

2009-04-01

Full Text Available OBJETIVO:Determinar la evolución de la resistencia a la eritromicina, el cloranfenicol, el trimetoprim-sulfametozaxol (SXT y la vancomicina de aislamientos invasores de Streptococcus pneumoniae obtenidos de niños de 10 países de América Latina y del Caribe en seis años de vigilancia. MÉTODOS: Se analizaron 8 993 aislamientos de S. pneumoniae recuperados entre 2000 y 2005 de niños menores de 6 años con infecciones invasoras, procedentes de Argentina, Brasil, Chile, Colombia, Cuba, México, Paraguay, República Dominicana, Uruguay y Venezuela. La sensibilidad a los antibióticos se determinó mediante los métodos establecidos y estandarizados en el proyecto SIREVA. La resistencia a múltiples antibióticos se definió como la resistencia a tres o más familias de antibióticos, de los no betalactámicos analizados en este estudio o de los betalactámicos evaluados en un estudio previo en el que 37,8% de estos aislamientos presentaron sensibilidad disminuida a la penicilina. RESULTADOS: Se encontró algún grado de resistencia al SXT y la eritromicina (56,4% y 15,4% de los aislamientos estudiados, respectivamente y 4,6% presentó alta resistencia al cloranfenicol. Todos los aislamientos fueron sensibles a la vancomicina. Se observó la mayor frecuencia de resistencia al SXT en los aislamientos de neumonía y a la eritromicina en los casos de sepsis (61,6% y 25,5%, respectivamente; P OBJECTIVE: To examine the development of resistance to erythromycin, chloramphenicol, trimethoprim-sulfamethoxazole (TMP-SMZ, and vancomycin of the invasive isolates of Streptococcus pneumoniae obtained from children in 10 Latin American/Caribbean countries during six years of surveillance. METHODS: Analysis of 8 993 isolates of S. pneumoniae recovered in 2000-2005 from children with invasive infections, who were less than 6 years of age, and from Argentina, Brazil, Chile, Colombia, Cuba, Dominican Republic, Mexico, Paraguay, Uruguay, or Venezuela. Antibiotic

Quorum Sensing Regulation of Competence and Bacteriocins in Streptococcus pneumoniae and mutans

Science.gov (United States)

Shanker, Erin; Federle, Michael J.

2017-01-01

The human pathogens Streptococcus pneumoniae and Streptococcus mutans have both evolved complex quorum sensing (QS) systems that regulate the production of bacteriocins and the entry into the competent state, a requirement for natural transformation. Natural transformation provides bacteria with a mechanism to repair damaged genes or as a source of new advantageous traits. In S. pneumoniae, the competence pathway is controlled by the two-component signal transduction pathway ComCDE, which directly regulates SigX, the alternative sigma factor required for the initiation into competence. Over the past two decades, effectors of cellular killing (i.e., fratricides) have been recognized as important targets of the pneumococcal competence QS pathway. Recently, direct interactions between the ComCDE and the paralogous BlpRH pathway, regulating bacteriocin production, were identified, further strengthening the interconnections between these two QS systems. Interestingly, a similar theme is being revealed in S. mutans, the primary etiological agent of dental caries. This review compares the relationship between the bacteriocin and the competence QS pathways in both S. pneumoniae and S. mutans, and hopes to provide clues to regulatory pathways across the genus Streptococcus as a potential tool to efficiently investigate putative competence pathways in nontransformable streptococci. PMID:28067778

Streptococcus pneumoniae Coinfection Is Correlated with the Severity of H1N1 Pandemic Influenza

Science.gov (United States)

Cisterna, Daniel; Savji, Nazir; Bussetti, Ana Valeria; Kapoor, Vishal; Hui, Jeffrey; Tokarz, Rafal; Briese, Thomas; Baumeister, Elsa; Lipkin, W. Ian

2009-01-01

Background Initial reports in May 2009 of the novel influenza strain H1N1pdm estimated a case fatality rate (CFR) of 0.6%, similar to that of seasonal influenza. In July 2009, however, Argentina reported 3056 cases with 137 deaths, representing a CFR of 4.5%. Potential explanations for increased CFR included virus reassortment or genetic drift, or infection of a more vulnerable population. Virus genomic sequencing of 26 Argentinian samples representing both severe and mild disease indicated no evidence of reassortment, mutations associated with resistance to antiviral drugs, or genetic drift that might contribute to virulence. Furthermore, no evidence was found for increased frequency of risk factors for H1N1pdm disease. Methods/Principal Findings We examined nasopharyngeal swab samples (NPS) from 199 cases of H1N1pdm infection from Argentina with MassTag PCR, testing for 33 additional microbial agents. The study population consisted of 199 H1N1pdm-infected subjects sampled between 23 June and 4 July 2009. Thirty-nine had severe disease defined as death (n = 20) or hospitalization (n = 19); 160 had mild disease. At least one additional agent of potential pathogenic importance was identified in 152 samples (76%), including Streptococcus pneumoniae (n = 62); Haemophilus influenzae (n = 104); human respiratory syncytial virus A (n = 11) and B (n = 1); human rhinovirus A (n = 1) and B (n = 4); human coronaviruses 229E (n = 1) and OC43 (n = 2); Klebsiella pneumoniae (n = 2); Acinetobacter baumannii (n = 2); Serratia marcescens (n = 1); and Staphylococcus aureus (n = 35) and methicillin-resistant S. aureus (MRSA, n = 6). The presence of S. pneumoniae was strongly correlated with severe disease. S. pneumoniae was present in 56.4% of severe cases versus 25% of mild cases; more than one-third of H1N1pdm NPS with S. pneumoniae were from subjects with severe disease (22 of 62 S. pneumoniae-positive NPS, p = 0

The Growing Resistance of Klebsiella pneumonia ; the Need to ...

African Journals Online (AJOL)

During the course of her treatment she acquired various infections that led to her exposure to antimicrobials from almost all classes at various times; including bacteremia due to a pan-drug resistant Klebsiella pneumoniae and multi-drug resistant Acinetobacter baumannii. She was successfully treated with a combination of ...

N-acetylglucosamine-Mediated Expression of nagA and nagB in Streptococcus pneumoniae

NARCIS (Netherlands)

Afzal, Muhammad; Shafeeq, Sulman; Manzoor, Irfan; Henriques-Normark, Birgitta; Kuipers, Oscar P

2016-01-01

In this study, we have explored the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylglucosamine (NAG). Transcriptome comparison of S. pneumoniae D39 wild-type grown in chemically defined medium (CDM) in the presence of 0.5% NAG to that grown in the presence of 0.5% glucose

Septic arthritis of shoeulder caused by Streptococcus pneumoniae serotype 23F in a female infant. Report of a case

Directory of Open Access Journals (Sweden)

Flores Nava Gerardo

2014-07-01

Full Text Available We present the case of a female infant previously vaccinated against Streptococcus pneumoniae who developed a septic arthritis in the right shoulder. An artrothomy was performed. The culture of the sy- novial fluid was positive for serotype 23F Streptococcus pneumonia.

Circulation of Streptococcus pneumoniae clone Colombia5 ST289 in nine Latin American countries Circulación de Streptococcus pneumoniae clon Colombia5 ST289 en nueve países de América Latina

Directory of Open Access Journals (Sweden)

Carolina Firacative

2009-04-01

Full Text Available OBJECTIVE: To determine genetic relatedness of clone Colombia5 ST289 with invasive Streptococcus pneumoniae serotype 5 isolates recovered in nine Latin American countries. METHODS: Forty-four invasive S. pneumoniae serotype 5 isolates recovered from children under 5 years of age in Bolivia, Chile, Dominican Republic, Ecuador, Nicaragua, Panama, Paraguay, Peru, and Venezuela were studied. Pulsed-field gel electrophoresis patterns of DNA treated with SmaI restriction enzyme were classified using Tenover's criteria and analyzed with the Fingerprinting II program to determine their genetic relatedness with the Colombian clone. RESULTS: All isolates had a genetic similarity of 78.5% or more with the Colombian clone. Thirteen electrophoretic subtypes derived of pattern A were identified, and five of them (A5, A6, A8, A13, A27 comprised 61.4% of the isolates. CONCLUSIONS: Clone Colombia5 ST289 is disseminated in Latin America. This is important because S. pneumoniae serotype 5 frequently causes invasive disease in the region and is associated with trimethoprim-sulfamethoxazole resistance.OBJETIVO: Determinar la relación genética del clon Colombia5 ST289 con los aislamientos invasores de Streptococcus pneumoniae serotipo 5 provenientes de nueve países latinoamericanos. MÉTODOS: Se estudiaron 45 aislamientos invasores de Streptococcus pneumoniae serotipo 5 procedentes de niños menores de 5 años de Bolivia, Chile, Ecuador, Nicaragua, Panamá, Paraguay, Perú, República Dominicana y Venezuela. Los patrones en electroforesis en gel de campo pulsante del ADN tratado con la enzima de restricción SmaI se clasificaron mediante el criterio de Tenover y se analizaron con el programa Fingerprinting II para determinar su relación genética con el clon colombiano. RESULTADOS: Todos los aislamientos tuvieron una similitud genética de 78,5% o mayor con el clon colombiano. Se identificaron 13 subtipos electroforéticos derivados del patrón A y cinco de ellos

Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae

OpenAIRE

Amauri Lázaro Noda Albelo; Lázaro Arturo Vidal Tallet; Joan Iavier Vidal Casal; Leanet Hernández Álvarez

2011-01-01

La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos beta...

The Proteasome-Ubiquitin System Is Required for Efficient Killing of Intracellular Streptococcus pneumoniae by Brain Endothelial Cells

NARCIS (Netherlands)

Iovino, Federico; Gradstedt, Henrik; Bijlsma, Jetta J.

2014-01-01

Streptococcus pneumoniae (pneumococcus) is a Gram-positive bacterium that causes serious invasive diseases, such as pneumonia, bacteremia, and meningitis, with high morbidity and mortality throughout the world. Before causing invasive disease, S. pneumoniae encounters cellular barriers, which are

Dominance of multidrug-resistant Denmark(14)-32 (ST230) clone among Streptococcus pneumoniae serotype 19A isolates causing pneumococcal disease in Bulgaria from 1992 to 2013.

Science.gov (United States)

Setchanova, Lena Petrova; Alexandrova, Alexandra; Dacheva, Daniela; Mitov, Ivan; Kaneva, Radka; Mitev, Vanio

2015-02-01

A pneumococcal conjugate vaccine (PCV10) was introduced in Bulgarian national immunization program since April 2010. Clonal composition based on pulsed-field gel electrophoresis and multilocus sequence typing genotyping of 52 serotype 19A Streptococcus pneumoniae isolates was analyzed. These were invasive and respiratory isolates collected between 1992 and 2013 from both children (78.8% clone. The most frequent sequence type (ST) was ST230 (48.1%) and together with four other closely related STs (15.4%), belonging to ST1611, ST276, ST7466, and ST2013, which were single- and double-locus variants; they were included in the main CC230. The disappearance of highly drug-resistant ST663 clone and emergence of new clones as CC320 and CC199 was also observed among the rest 19A isolates. A comparison of clonal composition between invasive and noninvasive isolates did not show a great genetic diversity among both kinds of isolates. Continuous surveillance of serotype 19A population following the introduction of PCV10 is essential to evaluate the impact of the vaccine on the epidemiology of this serotype.

Methylation of 23S rRNA nucleotide G748 by RlmAII methyltransferase renders Streptococcus pneumoniae telithromycin susceptible.

Science.gov (United States)

Takaya, Akiko; Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

2013-08-01

Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmA(II), which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmA(II) to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmA(II) renders S. pneumoniae TEL susceptible.

Streptococcus pneumoniae aislados durante 2002-2006: serotipos y resistencia antibiótica. Correlación con las vacunas existentes

Directory of Open Access Journals (Sweden)

José María Guevara-Duncan

2008-03-01

Full Text Available Objetivos: Identificar los serotipos de S. pneumoniae aislados, correlacionándolos con los incluidos en las vacunas existentes y su resistencia antimicrobiana. Diseño: Estudio descriptivo, observacional y longitudinal. Lugar: Instituto de Medicina Tropical Daniel A. Carrión, Facultad de Medicina, UNMSM. Material biológico: Cepas de Streptococcus pneumoniae. Intervenciones: Cuarenta Streptococcus pneumoniae de nuestro cepario, aislados entre el 2002 y 2006, fueron serotipificados en el Instituto de Salud Carlos III en Madrid -España; 15 fueron invasivos, 11 aislados de infecciones localizadas, 6 de portadores y 8 eran multiresistentes. Principales medidas de resultados: Protección de las vacunas existentes en nuestro medio a las infecciones causadas por Streptococcus pneumoniae. Resultados: Hubo 14 serotipos diferentes y los serogrupos más identificados fueron 23, 19 y 6. El 28,6% estaba contenido en la vacuna 7-valente, 42,9% en la 9-valente, 50% en la 11-valente y el 71,4% en la 23-valente; 57,5% fue resistente a la penicilina y 30% a eritromicina. El grupo de Streptococcus invasivo resultó más sensible a los antibióticos que los otros grupos. Los serotipos asociados a multirresistencia fueron 19F y 23F. Conclusiones: Ninguna de las vacunas protege a todas las infecciones causadas por Streptococcus pneumoniae, en nuestro medio.

Genetic diversity of penicillin-binding protein 2B and 2X genes from Streptococcus pneumoniae in South Africa.

OpenAIRE

Smith, A M; Klugman, K P; Coffey, T J; Spratt, B G

1993-01-01

Streptococcus pneumoniae (the pneumococcus) is believed to have developed resistance to penicillin by the production of altered forms of penicillin-binding proteins (PBPs) that have decreased affinity for penicillin. Sixty-eight clinical isolates of serogroup 6 and 19 pneumococci (MICs, < 0.015 to 8 micrograms/ml) were randomly selected from hospitals across South Africa which are at substantial geographic distance from each other. The polymerase chain reaction was used to isolate the penicil...

Phylogenetic analysis of emergent Streptococcus pneumoniae serotype 22F causing invasive pneumococcal disease using whole genome sequencing.

Directory of Open Access Journals (Sweden)

Walter H B Demczuk

Full Text Available Since implementation of the 13-valent polyvalent conjugate vaccine (PCV13 in Canada during 2010, the proportion of PCV13 serotypes causing invasive pneumococcal disease (IPD has declined from 55% (n = 1492 in 2010 to 31% (n = 764 in 2014. A concurrent increase of non-PCV13 serotypes has occurred and 22F has become the most prevalent serotype in Canada increasing from 7% (n = 183 to 11% (n = 283. Core single nucleotide variant phylogenetic analysis was performed on 137 Streptococcus pneumoniae serotype 22F isolates collected across Canada from 2005-2015. Six phylogenetic lineages (n = 117 were identified among a serotype 22F/ST433 clonal complex (CC, including a recently expanding erythromycin-resistant clone. Erythromycin-resistance was observed in 25 isolates possessing ermB, mef or a 23S rRNA A2061G point mutation; 2 penicillin-resistant isolates had recombinant pbp1a, pbp2a and/or pbp2x; 3 tetracycline-resistant isolates contained tetM; and 1 isolate was multidrug-resistant. Virulence factor analysis indicated a high level of homogeneity among the 22F/ST433 clonal complex strains. A group of 6 phylogenetic outlier strains had differing MLST, antimicrobial resistance and molecular profiles suggestive of capsule switching events. While capsule switch events among S. pneumoniae serotype 22F has been observed, increasing prevalence of S. pneumoniae serotype 22F can be attributed to an evolving homogenous clone expanding nationally through local transmission events.

Unusual Manifestation of Severe Conjugated Hyperbilirubinemia in an Infant with Streptococcus pneumoniae-associated Hemolytic Uremic Syndrome

Directory of Open Access Journals (Sweden)

Jung-Pin Chen

2007-01-01

Full Text Available Streptococcus pneumoniae is an uncommon etiologic organism in children with hemolytic uremic syndrome (HUS. Historically, severe S. pneumoniae-associated HUS usually has a poor clinical outcome. The clinical manifestations of marked jaundice and hepatic dysfunction in this form of HUS are extremely rare. We report a 10-month-old female infant with S. pneumoniae-associated HUS who had the unusual manifestation of severely elevated conjugated bilirubin and hepatic transaminases. Screening for viral hepatitis was negative, and evidence of biliary obstruction and hepatotoxic drug exposure was also absent. The patient was treated with antihypertensive agents for 2.5 months and required peritoneal dialysis for a period of 26 days. Hepatic function returned to normal on the 8th day of hospitalization. Renal function was mildly impaired at 1-year follow-up. Our report suggests that severe conjugated hyperbilirubinemia is a rare manifestation of S. pneumoniae-associated HUS in children. It is important for pediatricians that pneumococcal infection with severe hematologic and renal disorders should be investigated for evidence of S. pneumoniae-associated HUS. [J Formos Med Assoc 2007;106(2 Suppl:S17-S22

Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

NARCIS (Netherlands)

W.T. Hendriksen (Wouter); N. Silva (Nuno); H.J. Bootsma (Hester); C.E. Blue (Clare); G.K. Paterson (Gavin); A.R. Kerr (Alison); A.S. de Jong (Arjan); O.P. Kuipers (Oscar); P.W.M. Hermans (Peter); T.J. Mitchell

2007-01-01

textabstractRecent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we

Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

NARCIS (Netherlands)

Hendriksen, Wouter T.; Silva, Nuno; Bootsma, Hester J.; Blue, Clare E.; Paterson, Gavin K.; Kerr, Alison R.; de Jong, Anne; Kuipers, Oscar P.; Hermans, Peter W. M.; Mitchell, Tim J.

Recent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we found that

N-acetylgalatosamine-Mediated Regulation of the aga Operon by AgaR in Streptococcus pneumoniae

NARCIS (Netherlands)

Afzal, Muhammad; Shafeeq, Sulman; Ahmed, Hifza; Kuipers, Oscar P

2016-01-01

Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa). Transcriptome comparison of S. pneumoniae D39 grown in NAGaM17 (0.5% NAGa + M17) to that grown in GM17 (0.5% Glucose + M17) revealed the elevated expression of various carbon metabolic

Streptococcus pneumoniae Supragenome Hybridization Arrays for Profiling of Genetic Content and Gene Expression.

Science.gov (United States)

Kadam, Anagha; Janto, Benjamin; Eutsey, Rory; Earl, Joshua P; Powell, Evan; Dahlgren, Margaret E; Hu, Fen Z; Ehrlich, Garth D; Hiller, N Luisa

2015-02-02

There is extensive genomic diversity among Streptococcus pneumoniae isolates. Approximately half of the comprehensive set of genes in the species (the supragenome or pangenome) is present in all the isolates (core set), and the remaining is unevenly distributed among strains (distributed set). The Streptococcus pneumoniae Supragenome Hybridization (SpSGH) array provides coverage for an extensive set of genes and polymorphisms encountered within this species, capturing this genomic diversity. Further, the capture is quantitative. In this manner, the SpSGH array allows for both genomic and transcriptomic analyses of diverse S. pneumoniae isolates on a single platform. In this unit, we present the SpSGH array, and describe in detail its design and implementation for both genomic and transcriptomic analyses. The methodology can be applied to construction and modification of SpSGH array platforms, as well to other bacterial species as long as multiple whole-genome sequences are available that collectively capture the vast majority of the species supragenome. Copyright © 2015 John Wiley & Sons, Inc.

Streptococcus pneumoniae: A Cause of Primary Lung Abscess in a Child

OpenAIRE

MacDonald, Kelly S; de Carvalho, Volia M; Liebert, Lawrence; Embree, Joanne E

1993-01-01

A case of primary pneumococcal lung abscess in a five-year-old child is described. Secondary anaerobic infection as a cause of cavitation was excluded by bronchoscopic culture of the cavity. Streptococcus pneumoniae is a rare but recognized cause of lung abscess in healthy children.

Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism

NARCIS (Netherlands)

Paixão, Laura; Caldas, José; Kloosterman, Tomas G; Kuipers, Oscar P; Vinga, Susana; Neves, Ana R

2015-01-01

Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonized by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose

SUSCEPTIBILITY OF RESPIRATORY ISOLATES OF STREPTOCOCCUS PNEUMONIAE ISOLATED FROM CHILDREN HOSPITALIZED IN THE CLINICAL CENTER NIS.

Science.gov (United States)

Dinić, Marina M; Mladenović Antić, Snezana; Kocić, Branislava; Stanković Dordević, Dobrila; Vrbić, Miodrag; Bogdanović, Milena

2016-01-01

Streptococcus pneumoniae is one of the most common causes of respiratory infections. The aim was to study the susceptibility to antimicrobial agents of respiratory isolates ofStreptococcus pneumoniae obtained from hospitalized children. A total of 190 respiratory pneumococcal isolates obtained from children aged from 0 to 14 years were isolated and identified by using standard microbiological methods. Susceptibility to oxacillin, erythromycin, clindamycin, tetracycline, cotrimoxazole, ofloxacin and rifampicin was tested by disc diffusion method. Minimal inhibitory concentrations for amoxicillin and ceftriaxone were determined by means of E test. The macrolide-resistant phenotype was detected by double disc diffusion test. All tested isolates were susceptible to amoxicillin and ceftriaxone. The minimal amoxicillin concentration inhibiting the growth of 50% of isolates and of 90% of isolates was 0.50 microg/ml and 1.0 microg/ml, respectively and the minimal ceftriaxone concentration inhibiting the growth of 50% of isolates and of 90% of isolates was 0.25 microg/ml and 0.50 microg/ml, respectively. Susceptibility to erythromycin and clindamycin was observed in 21.6% and 29.47% of isolates, respectively. The resistence to macrolides-M phenotype was detected in 10.07% of isolates and constitutive macrolide-lincosamide-streptogramin phenotype (constitutive MLS phenotype) was found in 89.93% of isolates. All tested isolates were susceptible to ofloxacin and rifampicin. Amoxicillin could be the therapy of choice in pediatric practice. The macrolides should not be recommended for the empirical therapy of pneumococcal respiratory tract infection in our local area.

Streptococcus pneumoniae-induced ototoxicity in organ of Corti explant cultures.

Science.gov (United States)

Perny, Michael; Solyga, Magdalena; Grandgirard, Denis; Roccio, Marta; Leib, Stephen L; Senn, Pascal

2017-07-01

Hearing loss remains the most common long-term complication of pneumococcal meningitis (PM) reported in up to 30% of survivors. Streptococcus pneumoniae have been shown to possess different ototoxic properties. Here we present a novel ex vivo experimental setup to examine in detail the pattern of hair cell loss upon exposure to different S. pneumoniae strains, therefore recapitulating pathogen derived aspects of PM-induced hearing loss. Our results show a higher susceptibility towards S. pneumoniae-induced cochlear damage for outer hair cells (OHC) compared to inner hair cells (IHC), which is consistent with in vivo data. S. pneumoniae-induced hair cell loss was both time and dose-dependent. Moreover, we have found significant differences in the level of cell damage between tissue from the basal and the apical turns. This shows that the higher vulnerability of hair cells located at high frequency regions observed in vivo cannot be explained solely by the spatial organisation and bacterial infiltration from the basal portion of the cochlea. Using a wild type D39 strain and a mutant defective for the pneumolysin (PLY) gene, we also have shown that the toxin PLY is an important factor involved in ototoxic damages. The obtained results indicate that PLY can cause both IHC and OHC loss. Finally, we are reporting here for the first time a higher vulnerability of HC located at the basal and middle cochlear region to pneumolysin-induced damage. The detailed description of the susceptibility of hair cells to Streptococcus pneumoniae provided in this report can in the future determine the choice and the development of novel otoprotective therapies during pneumococcal meningitis. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

[Ceftaroline fosamil in community-acquired and nosocomial pneumonia].

Science.gov (United States)

Calbo, Esther; Zaragoza, Rafael

2014-03-01

Community-acquired pneumonia (CAP) is a common infection in developed countries and causes a large number of hospital admissions and deaths. In recent years, the incidence of this disease has increased, caused by progressive population aging. Following the introduction of the conjugate vaccine against Streptococcus pneumoniae, there have been significant epidemiological changes that require close monitoring because of the possible emergence of new patterns of resistance. This article aims to review the role of ceftaroline fosamil, a new parenteral cephalosporin with antibacterial activity against Gram-negative and Gram-positive pathogens, in the treatment of pneumonia. Several in vitro and in vivo studies have shown the efficacy of ceftaroline fosamil against penicillin-resistant S. pneumoniae and methicillin-resistant Staphylococcus aureus (MRSA). Additionally, ceftaroline has shown similar efficacy and safety to ceftriaxone in the treatment of community-acquired pneumonia with severe prognosis (prognostic severity index III and IV) in two phase III clinical trials. Although a non-inferiority design was used for these clinical trials, some data suggest a superior efficacy of ceftaroline, with earlier clinical response and higher cure rate in infections caused by S. pneumoniae, making this drug particularly interesting for critically-ill patients admitted to the intensive care unit. Ceftaroline may also be considered for empirical and directed treatment of MRSA pneumonia. Copyright © 2014 Elsevier España, S.L. All rights reserved.

Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia

OpenAIRE

Aura Lucía Leal; Castañeda Elizabeth

1999-01-01

Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medell...

Frequency of Streptococcus pneumonia and Haemophilus influenza in acute exacerbation of chronic obstructive airway disease and their sensitivity to levofloxacin

International Nuclear Information System (INIS)

Furqan, S.; Paracha, S.A.U.

2014-01-01

Objective: To determine the frequency of Streptococcus pneumoniae and Haemophilus influenzae in acute exacerbation of chronic obstructive pulmonary disease and their sensitivity to levofloxacin. Methods: The cross-sectional study was conducted at the Department of Medicine, AbbasiShaheed Hospital, Karachi, between July 2009 and January 2010. Patients already diagnosed with chronic obstructive pulmonary disease and admitted with symptoms of acute exacerbation were included in the study and their sputum samples were sent for microbiological evaluation. SPSS 16 was used for statistical analysis. Results: Of the total 105 patients in the study, 90 (85.17%) were males. Overall mean age at presentation was 62+-10.2 years. S. pneumoniae was isolated from sputum culture of 33 (31.4%) patients, while 13 (12.4%) patients showed growth of H. influenzae. Out of the 33 sputum specimens of S. pneumoniae, 32 (97.0%) were sensitive to levofloxacin, while 1 (3.0%) was resistant. All the 13 isolates of H. influenzae were sensitive to levofloxacin. Conclusion: S. pneumoniae and H. influenzae are still the most prevalent organisms isolated in acute exacerbation of chronic obstructive pulmonary disease in our population. Levofloxacin is still considered a highly sensitive antibiotic against these common micro-organisms in our population, but S. pneumoniae has started developing resistance against levofloxacin. Therefore, intermittent surveillance regarding development of resistance pattern of common micro-organisms against commonly prescribed antibiotics is required. (author)

The enhanced pneumococcal LAMP assay: a clinical tool for the diagnosis of meningitis due to Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Dong Wook Kim

Full Text Available BACKGROUND: Streptococcus pneumoniae is a leading cause of invasive bacterial disease in developed and developing countries. We studied the loop-mediated isothermal amplification (LAMP technique to assess its suitability for detecting S. pneumoniae nucleic acid in cerebrospinal fluid (CSF. METHODOLOGY/PRINCIPAL FINDINGS: We established an improved LAMP assay targeting the lytA gene (Streptococcus pneumoniae [Sp] LAMP. The analytical specificity of the primers was validated by using 32 reference strains (10 Streptococcus and seven non-Streptococcus species plus 25 clinical alpha-hemolytic streptococcal strains, including four S. pneumoniae strains and 21 other strains (3 S. oralis, 17 S. mitis, and one Streptococcus species harboring virulence factor-encoding genes (lytA or ply. Within 30 minutes, the assay could detect as few as 10 copies of both purified DNA and spiked CSF specimens with greater sensitivity than conventional polymerase chain reaction (PCR. The linear determination range for this assay is 10 to 1,000,000 microorganisms per reaction mixture using real-time turbidimetry. We evaluated the clinical sensitivity and specificity of the Sp LAMP assay using 106 randomly selected CSF specimens from children with suspected meningitis in Korea, China and Vietnam. For comparison, CSF specimens were also tested against conventional PCR and culture tests. The detection rate of the LAMP method was substantially higher than the rates of PCR and culture tests. In this small sample, relative to the LAMP assay, the clinical sensitivity of PCR and culture tests was 54.5% and 33.3%, respectively, while clinical specificity of the two tests was 100%. CONCLUSIONS/SIGNIFICANCE: Compared to PCR, Sp LAMP detected S. pneumoniae with higher analytical and clinical sensitivity. This specific and sensitive LAMP method offers significant advantages for screening patients on a population basis and for diagnosis in clinical settings.

Internamento devido a PAC por Streptococcus pneumoniae - Avaliação de factores de mortalidade Streptococcus pneumoniae - caused CAP in hospitalised patients: mortality predictors

Directory of Open Access Journals (Sweden)

Sandra Figueiredo

2008-10-01

Full Text Available A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS - CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0. Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67,3% do sexo masculino. O estudo revelou existir uma associação com significado estatístico entre os resultados de PSI e CURB-65 e a evolução para a mortalidade. Apesar da melhoria dos meios diagnósticos e profilácticos, e da terapêutica antibiótica, a pneumonia pneumocócica permanece uma entidade de grande morbilidade e mortalidade. O valor preditivo das normas PSI e CURB-65 foi confirmado nesta população de doentes, documentando uma correlação entre o número de factores de risco e a evolução da doença.Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for microbiological testing using standard culture techniques and urine antigen detection. Pneumonia Severity Index (PSI and British Thoracic Society

Streptococcus pneumoniae sepsis as the initial presentation of systemic lupus erythematosus

Directory of Open Access Journals (Sweden)

Erdem I

2016-09-01

Full Text Available Ilknur Erdem,1 Senay Elbasan Omar,1 Ridvan Kara Ali,1 Hayati Gunes,2 Aynur Eren Topkaya2 1Department of Infectious Diseases, 2Department of Medical Microbiology, Faculty of Medicine, Namik Kemal University, Tekirdag, Turkey Objective: Infections are among the most important causes of morbidity and mortality in patients with systemic lupus erythematosus (SLE but are rare initial presentation of the disease. Therefore, in this study, we describe a case of Streptococcus pneumoniae sepsis in a young woman with previously undiagnosed SLE. Case report: A 23-year-old female patient was admitted to our outpatient clinic complaining of high fever (40°C, chills, fatigue, generalized myalgia, and cough with brown sputum for 5 days. Blood cultures grew gram-positive coccus defined as S. pneumoniae using standard procedures. Antinuclear antibody was positive at a titer of 1/1,000, and anti-double-stranded DNA was positive at 984 IU/mL. She was diagnosed with SLE. Her respiratory symptoms and pleural effusion were considered to be due to pulmonary manifestation of SLE. Conclusion: The underlying immunosuppression caused by SLE could have predisposed the patient to invasive pneumococcal disease. It may also occur as a primary presenting feature, although a rare condition. Keywords: Streptococcus pneumoniae, sepsis, systemic lupus erythematosus

Determination of Trimethoprim-Sulfamethoxazole Resistance in Streptococcus pneumoniae by Using the E Test with Mueller-Hinton Agar Supplemented with Sheep or Horse Blood May Be Unreliable

Science.gov (United States)

Lovgren, M.; Dell’Acqua, L.; Palacio, R.; Echániz-Aviles, G.; Soto-Noguerón, A.; Castañeda, E.; Agudelo, C. I.; Heitmann, I.; Brandileone, M. C.; Zanella, R. C.; Rossi, A.; Pace, J.; Talbot, J. A.

1999-01-01

An international, multicenter study compared trimethoprim-sulfamethoxazole MICs for 743 Streptococcus pneumoniae isolates (107 to 244 isolates per country) by E test, using Mueller-Hinton agar supplemented with 5% defibrinated horse blood or 5% defibrinated sheep blood, with MICs determined by the National Committee for Clinical Laboratory Standards broth microdilution reference method. Agreement within 1 log2 dilution and minor error rates were 69.3 and 15.5%, respectively, on sheep blood-supplemented agar and 76.9 and 13.6%, respectively, with horse blood as the supplement. Significant interlaboratory variability was observed. E test may not be a reliable method for determining the resistance of pneumococci to trimethoprim-sulfamethoxazole. PMID:9854095

The Small Molecule DAM Inhibitor, Pyrimidinedione, Disrupts Streptococcus pneumoniae Biofilm Growth In Vitro.

Directory of Open Access Journals (Sweden)

Mukesh Kumar Yadav

Full Text Available Streptococcus pneumoniae persist in the human nasopharynx within organized biofilms. However, expansion to other tissues may cause severe infections such as pneumonia, otitis media, bacteremia, and meningitis, especially in children and the elderly. Bacteria within biofilms possess increased tolerance to antibiotics and are able to resist host defense systems. Bacteria within biofilms exhibit different physiology, metabolism, and gene expression profiles than planktonic cells. These differences underscore the need to identify alternative therapeutic targets and novel antimicrobial compounds that are effective against pneumococcal biofilms. In bacteria, DNA adenine methyltransferase (Dam alters pathogenic gene expression and catalyzes the methylation of adenine in the DNA duplex and of macromolecules during the activated methyl cycle (AMC. In pneumococci, AMC is involved in the biosynthesis of quorum sensing molecules that regulate competence and biofilm formation. In this study, we examine the effect of a small molecule Dam inhibitor, pyrimidinedione, on Streptococcus pneumoniae biofilm formation and evaluate the changes in global gene expression within biofilms via microarray analysis. The effects of pyrimidinedione on in vitro biofilms were studied using a static microtiter plate assay, and the architecture of the biofilms was viewed using confocal and scanning electron microscopy. The cytotoxicity of pyrimidinedione was tested on a human middle ear epithelium cell line by CCK-8. In situ oligonucleotide microarray was used to compare the global gene expression of Streptococcus pneumoniae D39 within biofilms grown in the presence and absence of pyrimidinedione. Real-time RT-PCR was used to study gene expression. Pyrimidinedione inhibits pneumococcal biofilm growth in vitro in a concentration-dependent manner, but it does not inhibit planktonic cell growth. Confocal microscopy analysis revealed the absence of organized biofilms, where cell

Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children

NARCIS (Netherlands)

Quintero, B.; Araque, M.; Gaast-de Jongh, C.E. van der; Escalona, F.; Correa, M.; Morillo-Puente, S.; Vielma, S.; Hermans, P.W.M.

2011-01-01

Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5 years of age in Merida, Venezuela, in 2007. The prevalence of

Acute suppurative parotitis caused by Streptococcus pneumoniae in an HIV-infected man.

Science.gov (United States)

Guzman Vinasco, Luis; Bares, Sara; Sandkovsky, Uriel

2015-03-02

We report a case of a 32-year-old man who presented with progressive unilateral parotid gland enlargement and subsequently tested positive for HIV. A CT scan of the neck performed with contrast showed a phlegmon in the region of the right parotid tail measuring approximately 2.5×2.4 cm. Cultures of the aspirated fluid grew Streptococcus pneumoniae and the S. pneumoniae urinary antigen test was also positive. The patient underwent surgical debridement and received antimicrobial therapy with complete resolution of the parotitis. Parotitis caused by S. pneumoniae is rare, and HIV infection should be suspected in any case of invasive pneumococcal disease. 2015 BMJ Publishing Group Ltd.

Fallos vacunales a vacunas conjugadas de Streptococcus pneumoniae y Haemophilus influenzae tipo b

Directory of Open Access Journals (Sweden)

Gonzalo Angulo

2016-11-01

Full Text Available Haemophilus influenzae type b and Streptococcus pneumoniae are the main cause agents of otitis, pneumonia, sepsis and meningitis, affecting mainly children under 5 years. Conjugate vaccines for encapsulated germs have dramatically decreased, the various diseases caused by these germs. Despite the decrease in morbidity and mortality, vaccine failures were observed. Children who experienced vaccine failures to Haemophilus influenzae type b had associated comorbidities more frequently than the general population (prematurity, HIV, Down syndrome, tumors, etc.. Nevertheless, most of these children have no medical history or immunological disorders. There is no consensus on whether all patients with vaccine failures should be assessed immunologically and how. There are recommendations to indicate a booster dose to patients with certain comorbidities and patients experiencing vaccine failure even in the absence of theses. Of the vaccine preparations available for Haemophilus influenzae type b association with acellular Bordetella pertussis proved to be less immunogenic and is currently being discouraged. Streptococcus pneumoniae serotypes 6B and 19F are less immunogenics and explain most of the vaccine failures in some series.

A necrotic lung ball caused by co-infection with Candida and Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Yokoyama T

2011-12-01

Full Text Available Toshinobu Yokoyama, Jun Sasaki, Keita Matsumoto, Chie Koga, Yusuke Ito, Yoichiro Kaku, Morihiro Tajiri, Hiroki Natori, Masashi HirokawaDivision of Respirology, Neurology and Rheumatology, Department of Internal Medicine, Kurume University School of Medicine, Kurume, JapanIntroduction: A necrotic lung ball is a rare radiological feature that is sometimes seen in cases of pulmonary aspergillosis. This paper reports a rare occurrence of a necrotic lung ball in a young male caused by Candida and Streptococcus pneumoniae.Case report: A 28-year-old male with pulmonary candidiasis was found to have a lung ball on computed tomography (CT of the chest. The patient was treated with ß-lactams and itraconazole and then fluconazole, which improved his condition (as found on a following chest CT scan and serum ß-D-glucan level. The necrotic lung ball was suspected to have been caused by co-infection with Candida and S. pneumoniae.Conclusion: A necrotic lung ball can result from infection by Candida and/or S. pneumoniae, indicating that physicians should be aware that patients may still have a fungal infection of the lungs that could result in a lung ball, even when they do not have either Aspergillus antibodies or antigens.Keywords: lung ball, necrotic lung ball, Candida, Streptococcus pneumoniae

Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Amauri Lázaro Noda Albelo

2011-12-01

Full Text Available La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos betalactámicos. Se realiza una revisión de los nuevos puntos de corte del Laboratory Standars Institute para sensibilidad a penicilina del patógeno, y se analiza su implicación en la terapéutica actual de la enfermedad extrameníngea por S. pneumoniae.

Influence of impaired lipoprotein biogenesis on surface and exoproteome of Streptococcus pneumoniae

NARCIS (Netherlands)

Pribyl, Thomas; Moche, Martin; Dreisbach, Annette; Bijlsma, Jetta J E; Saleh, Malek; Abdullah, Mohammed R; Hecker, Michael; van Dijl, Jan Maarten; Becher, Dörte; Hammerschmidt, Sven

2014-01-01

Surface proteins are important for the fitness and virulence of the Gram-positive pathogen Streptococcus pneumoniae. They are crucial for interaction of the pathogen with its human host during infection. Therefore, the analysis of the pneumococcal surface proteome is an important task that requires

Extended spectrum β-lactamase producing Escherichia coli and Klebsiella pneumoniae: critical tools for antibiotic resistance pattern.

Science.gov (United States)

Padmini, Nagarajan; Ajilda, Antony Alex Kennedy; Sivakumar, Natesan; Selvakumar, Gopal

2017-06-01

Drug resistance is a phenomenon where by an organism becomes fully or partially resistant to drugs or antibiotics being used against it. Antibiotic resistance poses an exacting intimidation for people with underlying medical immune conditions or weakened immune systems. Infections caused by the enzyme extended spectrum β-lactamase (ESBL) producing multi drug resistance (MDR) Enterobacteriaceae especially Escherichia coli and Klebsiella pneumoniae are resistant to a broad range of beta lactams, including third generation cephalosporins. Among all the pathogens, these two MDR E. coli and K. pneumoniae have emerged as one of the world's greatest health threats in past two decades. The nosocomial infections caused by these ESBL producing MDR E. coli and K. pneumoniae complicated the therapy and limit treatment options. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Principles of Antibiotic Management of Community-Acquired Pneumonia.

Science.gov (United States)

Bender, Michael T; Niederman, Michael S

2016-12-01

Community-acquired pneumonia (CAP) encompasses a broad spectrum of disease severity and may require outpatient, inpatient, or intensive care management. Successful treatment hinges on expedient delivery of appropriate antibiotic therapy tailored to both the likely offending pathogens and the severity of disease. This review summarizes key principles in starting treatment and provides recommended empiric therapy regimens for each site of care. In addition, we discuss the antimicrobial and anti-inflammatory role macrolides play in CAP, as well as specific information for managing individual CAP pathogens such as community-acquired methicillin-resistant Staphylococcus aureus and drug-resistant Streptococcus pneumoniae . We also examine several novel antibiotics being developed for CAP and review the evidence guiding duration of therapy and current best practices for the transition of hospitalized patients from intravenous antibiotics to oral therapy. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

Streptococcus pneumoniae enhances human respiratory syncytial virus infection in vitro and in vivo

NARCIS (Netherlands)

D.T. Nguyen (Tien); R.P.L. Louwen (Rogier); Elberse, K. (Karin); G. van Amerongen (Geert); S. Yüksel (Selma); A. Luijendijk (Ad); A.D.M.E. Osterhaus (Albert); W.P. Duprex (William Paul); R.L. de Swart (Rik)

2015-01-01

textabstractHuman respiratory syncytial virus (HRSV) and Streptococcus pneumoniae are important causative agents of respiratory tract infections. Both pathogens are associated with seasonal disease outbreaks in the pediatric population, and can often be detected simultaneously in infants

Transcriptional attenuation controls macrolide inducible efflux and resistance in Streptococcus pneumoniae and in other Gram-positive bacteria containing mef/mel(msr(D)) elements.

Science.gov (United States)

Chancey, Scott T; Bai, Xianhe; Kumar, Nikhil; Drabek, Elliott F; Daugherty, Sean C; Colon, Thomas; Ott, Sandra; Sengamalay, Naomi; Sadzewicz, Lisa; Tallon, Luke J; Fraser, Claire M; Tettelin, Hervé; Stephens, David S

2015-01-01

Macrolide resistance, emerging in Streptococcus pneumoniae and other Gram-positive bacteria, is increasingly due to efflux pumps encoded by mef/mel(msr) operons found on discrete mobile genetic elements. The regulation of mef/mel(msr) in these elements is not well understood. We identified the mef(E)/mel transcriptional start, localized the mef(E)/mel promoter, and demonstrated attenuation of transcription as a mechanism of regulation of macrolide-inducible mef-mediated macrolide resistance in S. pneumoniae. The mef(E)/mel transcriptional start site was a guanine 327 bp upstream of mef(E). Consensus pneumococcal promoter -10 (5'-TATACT-3') and -35 (5'-TTGAAC-3') boxes separated by 17 bp were identified 7 bp upstream of the start site. Analysis of the predicted secondary structure of the 327 5' region identified four pairs of inverted repeats R1-R8 predicted to fold into stem-loops, a small leader peptide [MTASMRLR, (Mef(E)L)] required for macrolide induction and a Rho-independent transcription terminator. RNA-seq analyses provided confirmation of transcriptional attenuation. In addition, expression of mef(E)L was also influenced by mef(E)L-dependent mRNA stability. The regulatory region 5' of mef(E) was highly conserved in other mef/mel(msr)-containing elements including Tn1207.1 and the 5612IQ complex in pneumococci and Tn1207.3 in Group A streptococci, indicating a regulatory mechanism common to a wide variety of Gram-positive bacteria containing mef/mel(msr) elements.

Carriage of Streptococcus pneumoniae 3 Years after Start of Vaccination Program, the Netherlands

NARCIS (Netherlands)

Spijkerman, J.; van Gils, E.J.M.; Veenhoven, R.H.; Hak, E.; Yzerman, E.P.F.; van den Ende, A.; Wijmenga-Monsuur, A.J.; van den Dobbelsteen, G.P.J.M.; Sanders, E.A.M.

2011-01-01

To evaluate the effectiveness of the 7-valent pneumococcal conjugate vaccine (PCV7) program, we conducted a cross-sectional observational study on nasopharyngeal carriage of Streptococcus pneumoniae 3 years after implementation of the program in the Netherlands. We compared pneumococcal serotypes in

Overview of antimicrobial options for Mycoplasma pneumoniae pneumonia: focus on macrolide resistance.

Science.gov (United States)

Cao, Bin; Qu, Jiu-Xin; Yin, Yu-Dong; Eldere, Johan Van

2017-07-01

Community-acquired pneumonia (CAP) is a common infectious disease affecting children and adults of any age. Mycoplasma pneumoniae has emerged as leading causative agent of CAP in some region, and the abrupt increasing resistance to macrolide that widely used for management of M. pneumoniae has reached to the level that it often leads to treatment failures. We aim to discuss the drivers for development of macrolide-resistant M. pneumoniae, antimicrobial stewardship and also the potential treatment options for patients infected with macrolide-resistant M. pneumonia. The articles in English and Chinese published in Pubmed and in Asian medical journals were selected for the review. M. pneumoniae can develop macrolide resistance by point mutations in the 23S rRNA gene. Inappropriate and overuse of macrolides for respiratory tract infections may induce the resistance rapidly. A number of countries have introduced the stewardship program for restricting the use of macrolide. Tetracyclines and fluoroquinolones are highly effective for macrolide-resistant strains, which may be the substitute in the region of high prevalence of macrolide-resistant M. pneumoniae. The problem of macrolide resistant M. pneumonia is emerging. Antibiotic stewardship is needed to inhibit the inappropriate use of macrolide and new antibiotics with a more acceptable safety profile for all ages need to be explored. © 2015 John Wiley & Sons Ltd.

AdcAII of Streptococcus pneumoniae Affects Pneumococcal Invasiveness.

Directory of Open Access Journals (Sweden)

Lindsey R Brown

Full Text Available Across bacterial species, metal binding proteins can serve functions in pathogenesis in addition to regulating metal homeostasis. We have compared and contrasted the activities of zinc (Zn2+-binding lipoproteins AdcA and AdcAII in the Streptococcus pneumoniae TIGR4 background. Exposure to Zn2+-limiting conditions resulted in delayed growth in a strain lacking AdcAII (ΔAdcAII when compared to wild type bacteria or a mutant lacking AdcA (ΔAdcA. AdcAII failed to interact with the extracellular matrix protein laminin despite homology to laminin-binding proteins of related streptococci. Deletion of AdcA or AdcAII led to significantly increased invasion of A549 human lung epithelial cells and a trend toward increased invasion in vivo. Loss of AdcAII, but not AdcA, was shown to negatively impact early colonization of the nasopharynx. Our findings suggest that expression of AdcAII affects invasiveness of S. pneumoniae in response to available Zn2+ concentrations.

Bilateral Acromioclavicular Septic Arthritis as an Initial Presentation of Streptococcus pneumoniae Endocarditis

Directory of Open Access Journals (Sweden)

Neda Hashemi-Sadraei

2014-01-01

Full Text Available Infective endocarditis (IE is infrequently associated with septic arthritis. Moreover, septic arthritis of the acromioclavicular (AC joint is rarely reported in the literature. We report a case of Streptococcus pneumoniae IE in a patient who presented with bilateral AC joint septic arthritis and we review the literature on the topic.

Serotype distribution and antibiotic susceptibility of Streptococcus pneumoniae strains in the south of Tunisia: A five-year study (2012–2016 of pediatric and adult populations

Directory of Open Access Journals (Sweden)

Sonia Ktari

2017-12-01

Full Text Available Objectives: To analyze the serotype distribution of Streptococcus pneumoniae clinical isolates collected in the south of Tunisia over a 5-year period in different age groups and to assess their antimicrobial susceptibility patterns. Methods: A total of 305 non-duplicate S. pneumoniae isolates were collected between January 2012 and December 2016 at the university hospital in Sfax, Tunisia. All isolates were serotyped by multiplex PCR. The antibiotic susceptibility of all isolates was determined using the disk diffusion test or Etest assay. Results: Among the 305 pneumococcal isolates, 76 (24.9% were invasive and 229 (75.1% were non-invasive. The most common serotypes were 19F (20%, 14 (16.7%, 3 (9.2%, 23F (7.5%, 19A (5.9%, and 6B (5.9%. Potential immunization coverage rates for pneumococcal conjugate vaccines PCV7, PCV10, and PCV13 were 58%, 59.3%, and 78.7%, respectively. Three-quarters (75.3% of pneumococcal isolates were non-susceptible to penicillin. The resistance rate to erythromycin was 71.4%. Only two isolates were resistant to levofloxacin. Conclusions: 19F and 14 were the most prevalent serotypes in the south of Tunisia. The inclusion of a PCV in the immunization program could be useful for reducing the burden of pneumococcal diseases. The high resistance rate to penicillin and macrolides is alarming. Prudent use of antibiotics is crucial to prevent the selection of multidrug-resistant pneumococci. Keywords: Streptococcus pneumoniae, Antibiotic, Serotype, PCV, Tunisia

Identification of proteins in Streptococcus pneumoniae by reverse vaccinology and genetic diversity of these proteins in clinical isolates.

Science.gov (United States)

Argondizzo, Ana Paula Corrêa; da Mota, Fabio Faria; Pestana, Cristiane Pinheiro; Reis, Joice Neves; de Miranda, Antonio Basílio; Galler, Ricardo; Medeiros, Marco Alberto

2015-02-01

Streptococcus pneumoniae is a major cause of morbidity and mortality worldwide. Virulence-associated proteins common and conserved among all capsular types now represent the best strategy to combat pneumococcal infections. Our aim was to identify conserved targets in pneumococci that showed positive prediction for lipoprotein and extracellular subcellular location using bioinformatics programs and verify the distribution and the degree of conservation of these targets in pneumococci. These targets can be considered potential vaccine candidate to be evaluated in the future. A set of 13 targets were analyzed and confirmed the presence in all pneumococci tested. These 13 genes were highly conserved showing around >96 % of amino acid and nucleotide identity, but they were also present and show high identity in the closely related species Streptococcus mitis, Streptococcus oralis, and Streptococcus pseudopneumoniae. S. oralis clusters away from S. pneumoniae, while S. pseudopneumoniae and S. mitis cluster closer. The divergence between the selected targets was too small to be observed consistently in phylogenetic groups between the analyzed genomes of S. pneumoniae. The proteins analyzed fulfill two of the initial criteria of a vaccine candidate: targets are present in a variety of different pneumococci strains including different serotypes and are conserved among the samples evaluated.

Nonclonal Emergence of Colistin-Resistant Klebsiella pneumoniae Isolates from Blood Samples in South Korea ▿

Science.gov (United States)

Suh, Ji-Yoeun; Son, Jun Seong; Chung, Doo Ryeon; Peck, Kyong Ran; Ko, Kwan Soo; Song, Jae-Hoon

2010-01-01

In vitro activities of colistin and other drugs were tested against 221 Klebsiella pneumoniae isolates that were collected between 2006 and 2007 in nine tertiary care South Korean hospitals from patients with bacteremia. The clonality of colistin-resistant K. pneumoniae (CRKP) isolates was assessed by multilocus sequence typing (MLST). We found that 15 isolates (6.8%) were resistant to colistin. MLST showed that CRKP isolates were nonclonal, with colistin resistance in K. pneumoniae occurring independently and not by clonal spreading. PMID:19752282

Pyruvate Oxidase Influences the Sugar Utilization Pattern and Capsule Production in Streptococcus pneumoniae

NARCIS (Netherlands)

Carvalho, Sandra M.; Farshchi Andisi, Vahid; Gradstedt, Henrik; Neef, Jolanda; Kuipers, Oscar P.; Neves, Ana R.; Bijlsma, Jetta J. E.

2013-01-01

Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence,

Meropenem susceptibility of Neisseria meningitidis and Streptococcus pneumoniae from meningitis patients in The Netherlands

NARCIS (Netherlands)

van de Beek, D.; Hensen, E. F.; Spanjaard, L.; de Gans, J.; Enting, R. H.; Dankert, J.

1997-01-01

In-vitro susceptibility of 299 Neisseria meningitidis and 157 Streptococcus pneumoniae strains from meningitis patients in The Netherlands in 1993 and 1994 to meropenem was determined using the Etest. Susceptibility to penicillin, ceftriaxone, and chloramphenicol was also determined. Rifampicin

Characterization of a Multipeptide Lantibiotic Locus in Streptococcus pneumoniae.

Science.gov (United States)

Maricic, Natalie; Anderson, Erica S; Opipari, AnneMarie E; Yu, Emily A; Dawid, Suzanne

2016-01-26

Bacterial communities are established through a combination of cooperative and antagonistic interactions between the inhabitants. Competitive interactions often involve the production of antimicrobial substances, including bacteriocins, which are small antimicrobial peptides that target other community members. Despite the nearly ubiquitous presence of bacteriocin-encoding loci, inhibitory activity has been attributed to only a small fraction of gene clusters. In this study, we characterized a novel locus (the pld locus) in the pathogen Streptococcus pneumoniae that drives the production of a bacteriocin called pneumolancidin, which has broad antimicrobial activity. The locus encodes an unusual tandem array of four inhibitory peptides, three of which are absolutely required for antibacterial activity. The three peptide sequences are similar but appear to play distinct roles in regulation and inhibition. A modification enzyme typically found in loci encoding a class of highly modified bacteriocins called lantibiotics was required for inhibitory activity. The production of pneumolancidin is controlled by a two-component regulatory system that is activated by the accumulation of modified peptides. The locus is located on a mobile element that has been found in many pneumococcal lineages, although not all elements carry the pld genes. Intriguingly, a minimal region containing only the genes required for pneumolancidin immunity was found in several Streptococcus mitis strains. The pneumolancidin-producing strain can inhibit nearly all pneumococci tested to date and provided a competitive advantage in vivo. These peptides not only represent a unique strategy for bacterial competition but also are an important resource to guide the development of new antimicrobials. Successful colonization of a polymicrobial host surface is a prerequisite for the subsequent development of disease for many bacterial pathogens. Bacterial factors that directly inhibit the growth of neighbors

Exploring the Genome and Phenotype of Multi-Drug Resistant Klebsiella pneumoniae of Clinical Origin

OpenAIRE

João Anes; Daniel Hurley; Marta Martins; Séamus Fanning; Séamus Fanning

2017-01-01

Klebsiella pneumoniae is an important nosocomial pathogen with an extraordinary resistant phenotype due to a combination of acquired resistant-elements and efflux mechanisms. In this study a detailed molecular characterization of 11 K. pneumoniae isolates of clinical origin was carried out. Eleven clinical isolates were tested for their susceptibilities, by disk diffusion and broth microdilution and interpreted according to CLSI guidelines. Efflux activity was determined by measuring the extr...

[Examination about utility of a Streptococcus pneumoniae capsular antigen swiftness search kit urine in a pneumonia patient].

Science.gov (United States)

Hashikita, Giichi; Yamaguti, Toshiyuki; Tachi, Yoshimi; Kishi, Etsuko; Kawamura, Toru; Takahashi, Shun; Arai, Yukie; Koyama, Sachie; Huruhata, Toshihumi; Itabashi, Akira; Oka, Yoko; Yamazaki, Tsutomu; Maesaki, Sigefumi

2005-01-01

We investigated the usefullness of Binax NOW urine antigen test, an immunochromatographic assay that binds any soluble Streptococcus pneumoniae antigen (C polysaccharide) for the diagnosis of penumoniae form September 2003 to March 2005. We used 372 samples form the patinets with pneumoniae diagnosed for blood or sputum cultuter or gram-stained sputum smear. Out of 24 culture positive specimens, Binax NOW urine antigen test, showed positive in 18 (75%) specimens. The sensitivity of sputum and blood culture was 71.7% and 83.3%, respectively. Binax NOW urine antigen test was seemed false positives in 55 samples, false negatives in 6 samples. The specificity of Binax NOW urine antigen test was evaluated 84.1%. Overall agreement among tests was 83.6%. When compared to culture, false negative urine antigen may be the result of colonizing S. pneumoniae in sputum or pneumonia caused by an agent other than S. pneumoniae. CRP values for cases were both urine antigen and culture were positive ranged from 40 mg/dl to 10 mg/dl while urine antigen and culture negative cases were predominantly less than 10 mg/dl. Positive blood and pleural fluid culture cases were consistently associated with strongly positive urine antigen tests. Non-agreement between urine antigen, culture, and microscopy may be the result of specimen quality, labile nature of S. pneumoniae and antimicrobial therapy.

Frequency of resistance to penicillin and erythromycin of pneumococcal strains that caused ottis media

OpenAIRE

Jovanović Luka; Isailović Katarina; Opavski Nataša

2017-01-01

Introduction: Streptococcus pneumoniae is an important human pathogen and the most common cause of acute otitis media (AOM), especially in children. It is also a common cause of community acquired pneumonia, sepsis and bacterial meningitis. Drug of choice in the treatment of these disease are beta lactam antibiotics, and the first alternative are macrolides. The increasing prevalence of resistance to penicillin and macrolides, among pneumococci, has considerably complicated the treatment. Aim...

[Predictors of drug-resistant pathogens in community-onset pneumonia: Are factors considered in health-care-associated pneumonia useful in the emergency department?

Science.gov (United States)

Torres Bonafonte, Olga H; Gil Olivas, Eva; Pérez Macho, Estefanía; Pacho Pacho, Cristina; Mateo Roca, Miriam; Casademont Pou, Jordi; Ruiz Hidalgo, Domingo

2017-10-01

To analyze factors related to drug-resistant pathogens (DRPs) in community-onset pneumonia (COP) and whether previously suggested criteria are useful in our emergency-department. Prospective 1-year study of adults coming to the emergency department for COP. We assessed the usefulness of criteria used in health-care-associated pneumonia (HCAP), as well the Shorr index, the Barthel index, and clinical suspicion of resistant pathogens. Data were analyzed by multiple logistic regression and the area under the receiver operating characteristic curve (AUC). We included 139 patients with a mean (SD) age of 75.9 (15.3) years; 63.3% were men. Forty-nine COP patients (35.2%) were at risk for DRP-caused pneumonia according to HCAP criteria; 43 (30.9%) according to the Shorr index, and 56 (40.3%) according to the Aliberti index. A score of less than 60 derived from the Barthel index was recorded for 25 patients (18%). Clinical suspicion of a DRP was recorded for 11 (7.9%). A DRP was isolated in 5 patients (3.6%) (3, Pseudomonas aeruginosa; 2, methicillin-resistant Staphylococcus aureus). Multiple logistic regression analysis identified 2 predictors of DRP-caused COP: hospital admission within the last 90 days (odds ratio [OR], 8.92; 95% CI, 1.92-41.45) and initial arterial blood oxygen saturation (OR, 0.85; 95% CI, 0.74-0.98). The AUC was 0.91 (95% CI, 0.85-0.98). The model identified 22 patients (16.8%) at risk for DRP-caused pneumonia. The positive and negative predictive values were 20% and 99.1%, respectively, for the model 90-day period (vs 8.7% and 98.9%, respectively, for criteria used in HCAP). Hospitalization within the 90-day period before a COP emergency and arterial blood oxygen saturation were good predictors of DRP in our setting. Criteria of DRP in HCAP, on the other hand, had lower ability to identify patients at risk in COP.

The Three Major Spanish Clones of Penicillin-Resistant Streptococcus pneumoniae Are the Most Common Clones Recovered in Recent Cases of Meningitis in Spain

Science.gov (United States)

Enright, Mark C.; Fenoll, Asunción; Griffiths, David; Spratt, Brian G.

1999-01-01

One hundred six isolates of Streptococcus pneumoniae recovered in Spain from patients with meningitis in 1997 and 1998 were characterized by multilocus sequence typing. A heterogeneous collection of genotypes was associated with meningitis in Spain: 65 different sequence types were resolved and, even at a genetic distance of 0.43, there were 37 distinct lineages. Thirty-eight percent of the isolates, including all isolates of serotypes 6B, 9V, 14, and 23F, were resistant to penicillin, and 24% of the isolates were members of the three major Spanish penicillin-resistant or multidrug-resistant clones of serotypes 6B, 9V, and 23F or serotype variants of these clones. These three clones (MICs, 1 to 2 μg of penicillin/ml) were the most common clones associated with pneumococcal meningitis in Spain during 1997 and 1998. Only two of the other clones associated with meningitis were penicillin resistant (MICs, 0.12 to 0.5 μg/ml). One of the two most prevalent penicillin-susceptible clones causing meningitis (serotype 3) has not been detected outside of Spain, whereas the other (serotype 18C) has been recovered from patients with meningitis in the United Kingdom, The Netherlands, and Denmark. The prevalence of meningitis caused by isolates of the three major Spanish penicillin-resistant or multiply antibiotic-resistant clones, which are now globally distributed, is disturbing and clearly establishes their ability to cause life-threatening disease. PMID:10488179

Antimicrobial resistance patterns of colonizing Streptococcus pneumoniae among young child-mother pairs in the rural highlands of the Peruvian Andes

Science.gov (United States)

Howard, Leigh; Edwards, Kathryn; Griffin, Marie; Gil, Ana; Minaya, Gina; Mercado, Erik; Ochoa, Theresa; Lanata, Claudio; Grijalva, Carlos G

2017-01-01

Abstract Background Despite widespread use of pneumococcal conjugate vaccines (PCVs), Streptococcus pneumoniae (pneumococcus) remains an important cause of pneumonia. Prior to widespread PCV use, we found a high prevalence of nasopharyngeal (NP) colonization with pneumococcus resistant to multiple antibiotic classes among young children in the rural highlands of Peru. We sought to confirm contemporary resistance profiles among young children, their mothers, and animal contacts in the post-PCV era. Methods We enrolled eligible members of Peruvian households whose children had participated in our previous study. Mothers were questioned about antibiotic use for themselves and their children age <3 years. NP samples were collected from children, mothers, and their animal contacts including cows, guinea pigs, and dogs, when available. Samples were cultured for pneumococcus using standard methods and routine disk antibiotic susceptibility testing was performed. Drinking water and milk samples were tested, when available, for the presence of β-lactam and tetracycline residues (IDEXX Β-Tetra testing kit; Westbrook, ME). Results Members of 47 households were enrolled, including 50 children and 47 mothers (3 sibling pairs). The median (IQR) age of children was 1.2 years (0.6-2.2) and number of household members was 5 (4-6). Sixteen of 50 (32%) children and 7/47 (15%) mothers had received antibiotics in the prior 6 months (Fig 1). Pneumococcus was detected in 31/50 (62%) children, 9/47 (19%) mothers, and 1/31 (3%) guinea pigs. Pneumococci were not detected in dogs (n = 29) or cows (n = 7). Resistance to multiple classes of antibiotics, including TMP-SMX, tetracyclines, and β-lactams, was common among children and adults (Fig 2). No antibiotic residues were detected in water (n = 41) or milk (n = 7) samples. Conclusion Pneumococcal colonization was common among young children, less prevalent among adults, and rare among animals. Resistance to macrolides and

Clonal relationships among penicillin-susceptible, multiresistant serotype 6B Streptococcus pneumoniae isolates recovered in Greece and France.

Science.gov (United States)

Syrogiannopoulos, G A; Doit, C; Grivea, I N; Geslin, P; Bingen, E

2001-01-01

In January 1996 the emergence of penicillin-susceptible, multiresistant serotype 6B Streptococcus pneumoniae isolates resistant to chloramphenicol, tetracycline, erythromycin, clindamycin and trimethoprim-sulfamethoxazole was observed in young carriers in the city of Patras, located in the southwestern region of Greece. Later, a significant spread of pneumococci with this unusual phenotype was noted in carriers living in various other areas of the country. Using restriction fragment length polymorphism of the ribosomal RNA genes, clonal relationships were found between these Greek strains and serotype 6B penicillin-susceptible, multiresistant pneumococci isolated in France between January 1992 and September 1996. The French and Greek isolates appear to have a common ancestry.

Prevalence of multiple drug resistant Streptococcus suis in and around Guwahati, India

Directory of Open Access Journals (Sweden)

Mrinalee Devi

2017-05-01

Full Text Available Aim: This study was conducted to determine the prevalence and antimicrobial susceptibility of Streptococcus suis and their resistance patterns isolated from both clinically healthy carriers and diseased pigs in and around Guwahati, Assam, India. Materials and Methods: A total of 497 samples were collected during October, 2012, to April, 2014, from clinically healthy (n=67 and diseased (n=230 pigs of varying age and either sex maintained under organized and unorganized farming systems. Samples were processed for isolation and identification of S. suis by biochemical characterization and polymerase chain reaction targeting the housekeeping gene glutamate dehydrogenase. In vitro antimicrobial susceptibility of the recovered isolates against nine antibiotic groups comprising 17 antimicrobial agents was studied by standard method. Results: Of the 497 samples examined, 7 (1.41% isolates were confirmed to be S. suis of which 5 (1.87% and 2 (0.87% were derived from clinically healthy and diseased pigs, respectively. All the isolates were susceptible to gentamicin, amikacin, and erythromycin (100% followed by the penicillin group and enrofloxacin (85.71%, ceftriaxone, doxycycline HCL, ofloxacin and chloramphenicol (71.43%, to kanamycin, clindamycin and co-trimoxazole (42.85%. The isolates showed least susceptibility to cefalexin, tetracycline and streptomycin (28.57%. All the five S. suis isolates from clinically healthy pigs were susceptible to penicillin G, amoxyclav, doxycycline HCl, gentamicin, amikacin and erythromycin, 80.00% isolates susceptible to ampicillin, enrofloxacin and ofloxacin, 60.00% to ceftriaxone, kanamycin and chloramphenicol, 40% to cefalexin, tetracycline, clindamycin and co-trimoxazole, respectively. Only 20.00% isolates were susceptible to streptomycin. Both the isolates recovered from diseased pigs were susceptible to ampicillin, ceftriaxone, gentamicin, amikacin, enrofloxacin, erythromycin, and clindamycin. On the other hand

Concurrent Infection with Hepatitis C Virus and Streptococcus pneumoniae.

Science.gov (United States)

Marrie, Thomas J; Tyrrell, Gregory J; Majumdar, Sumit R; Eurich, Dean T

2017-07-01

Little is known about concurrent infection with hepatitis C virus (HCV) and Streptococcus pneumoniae, which causes invasive pneumococcal disease (IPD). We hypothesized that co-infection with HCV and S. pneumoniae would increase risk for death and complications. We captured sociodemographic and serologic data for adults with IPD in a population-based cohort study in northern Alberta, Canada, during 2000-2014. IPD patients infected with HCV were compared with IPD patients not infected with HCV for risk of in-hospital deaths and complications by using multivariable logistic regression. A total of 355 of 3,251 patients with IPD were co-infected with HCV. The in-hospital mortality rate was higher for IPD patients infected with HCV. Prevalence of most IPD-related complications (e.g., cellulitis, acute kidney injury, mechanical ventilation) was also higher in HCV-infected patients. Infection with HCV is common in patients with IPD, and HCV is independently associated with an increased risk for serious illness and death.

Physical structure and genetic expression of the sulfonamide-resistance plasmid pLS80 and its derivatives in Streptococcus pneumoniae and Bacillus subtilis

Energy Technology Data Exchange (ETDEWEB)

Lopez, P.; Espinosa, M.; Lacks, S.A.

1984-01-01

The 10-kb chromosomal fragment of Streptococcus pneumoniae cloned in pLS80 contains the sul-d allele of the pneumococcal gene for dihydropteroate synthase. As a single copy in the chromosome this allele confers resistance to sulfanilamide at 0.2 mg/ml; in the multicopy plasmid it confers resistance to 2.0 mg/ml. The sul-d mutation was mapped by restriction analysis to a 0.4-kb region. A spontaneous deletion beginning approx. 1.5 kb to the right of the sul-d mutation prevented gene function, possibly by removing a promoter. This region could be restored by chromosomal facilitation and be demonstrated in the plasmid by selection for sulfonamide resistance. Under selection for a vector marker, tetracycline resistance, only the deleted plasmid was detectable, apparently as a result of plasmid segregation and the advantageous growth rates of cells with smaller plasmids. When such cells were selected for sulfonamide resistance, the deleted region returned to the plasmid, presumably by equilibration between the chromosome and the plasmid pool, to give a low frequency (approx. 10/sup -3/) of cells resistant to sulfanilamide at 2.0 mg/ml. Models for the mechanisms of chromosomal facilitation and equilibration are proposed. Several derivatives of pLS80 could be transferred to Bacillus subtilis, where they conferred resistance to sulfanilamide at 2 mg/ml, thereby demonstrating cross-species expression of the pneumococcal gene. Transfer of the plasmids to B. subtilis gave rise to large deletions to the left of the sul-d marker, but these deletions did not interfere with the sul-d gene function. Restriction maps of pLS80 and its variously deleted derivatives are presented.

Feasibility and Safety of Local Treatment with Recombinant Human Tissue Factor Pathway Inhibitor in a Rat Model of Streptococcus pneumoniae Pneumonia.

Directory of Open Access Journals (Sweden)

Florry E van den Boogaard

Full Text Available Pulmonary coagulopathy is intrinsic to pulmonary injury including pneumonia. Anticoagulant strategies could benefit patients with pneumonia, but systemic administration of anticoagulant agents may lead to suboptimal local levels and may cause systemic hemorrhage. We hypothesized nebulization to provide a safer and more effective route for local administration of anticoagulants. Therefore, we aimed to examine feasibility and safety of nebulization of recombinant human tissue factor pathway inhibitor (rh-TFPI in a well-established rat model of Streptococcus (S. pneumoniae pneumonia. Thirty minutes before and every 6 hours after intratracheal instillation of S. pneumonia causing pneumonia, rats were subjected to local treatment with rh-TFPI or placebo, and sacrificed after 42 hours. Pneumonia was associated with local as well as systemic activation of coagulation. Nebulization of rh-TFPI resulted in high levels of rh-TFPI in bronchoalveolar lavage fluid, which was accompanied by an attenuation of pulmonary coagulation. Systemic rh-TFPI levels remained undetectable, and systemic TFPI activity and systemic coagulation were not affected. Histopathology revealed no bleeding in the lungs. We conclude that nebulization of rh-TFPI seems feasible and safe; local anticoagulant treatment with rh-TFPI attenuates pulmonary coagulation, while not affecting systemic coagulation in a rat model of S. pneumoniae pneumonia.

The alpha-tocopherol form of vitamin E boosts elastase activity of human PMNs and their ability to kill Streptococcus pneumoniae

Science.gov (United States)

Despite the availability of vaccines, Streptococcus pneumoniae remains a leading cause of life-threatening infections such as pneumonia, bacteremia and meningitis. Polymorphonuclear leukocytes (PMNs) are a key determinant of disease course, because optimal host defense requires an initial robust pul...

Crystallization and preliminary X-ray crystallographic studies of DnaJ from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Zhao, Shasha; Jin, Li; Niu, Siqiang; Yang, Wei; Zhang, Shaocheng; Guo, Zhen; Zhang, Hongpeng; Huang, Ailong; Yin, Yibing; Wang, Deqiang

2013-01-01

DnaJ from Streptococcus pneumoniae (SpDnaJ) is involved in the infectious disease process and is being developed as a potential vaccine to prevent bacterial infection. Here the expression, purification, crystallization and preliminary crystallographic analysis of SpDnaJ are reported. DnaJ, cooperating with DnaK and GrpE, promotes the folding of unfolded hydrophobic polypeptides, dissociates protein complexes and translocates protein across membranes. Additionally, DnaJ from Streptococcus pneumoniae (SpDnaJ) is involved in the infectious disease process and is being developed as a potential vaccine to prevent bacterial infection. Here the expression, purification, crystallization and preliminary crystallographic analysis of SpDnaJ are reported. The crystals belong to space groups I222 or I2 1 2 1 2 1 and the diffraction resolution is 3.0 Å with unit-cell parameters a = 47.68, b = 104.45, c = 234.57 Å. The crystal most likely contains one molecule in the asymmetric unit, with a V M value of 3.24 Å 3 Da −1 and a solvent content of 62.1%

Comparative study of five different DNA fingerprint techniques for molecular typing of Streptococcus pneumoniae strains

NARCIS (Netherlands)

P.W.M. Hermans (Peter); M. Sluijter (Marcel); T. Hoogenboezem (Theo); H. Heersma; A.F. van Belkum (Alex); R. de Groot (Ronald)

1995-01-01

textabstractThe aim of this study was to identify the strengths and weaknesses of five DNA fingerprint methods for epidemiological typing of Streptococcus pneumoniae. We investigated the usefulness of (i) ribotyping, (ii) BOX fingerprinting with the BOX repetitive sequence of S.

Important Mutations Contributing to High-Level Penicillin Resistance in Taiwan19F-14, Taiwan23F-15, and Spain23F-1 of Streptococcus pneumoniae Isolated from Taiwan.

Science.gov (United States)

Liu, Esther Yip-Mei; Chang, Jen-Chang; Lin, Jung-Chung; Chang, Feng-Yee; Fung, Chang-Phone

2016-12-01

Penicillin-resistant Streptococcus pneumoniae is a serious concern worldwide. In this study, we analyzed the cause of β-lactam resistance in pandemic multidrug-resistant clones. A total of 41 penicillin-nonsusceptible clinical isolates were collected from 1996 to 2012. Sero- and molecular typing confirmed that these isolates were clonal types of Taiwan 19F -14, Taiwan 23F -15, and Spain 23F -1. Sero-switching was found in four isolates. All isolates were multidrug resistant. Sequencing analysis of the penicillin binding proteins (PBPs) was performed on PBP1a, 2b, and 2x, and a large number of mutations were identified in comparing to clinical penicillin-susceptible isolates and the recipient strain R6 used for homologous recombination. The T 451 A substitution was the key amino acid in PBP2b that contributed to penicillin resistance. T 338 A in PBP2x played a role in resistance and reached the highest level of resistance when combined with other mutations in PBP2x. High-level penicillin resistance could not be obtained without the combination of mutations in PBP1a with PBP2b and 2x. The amino acid substitutions in PBP1a, 2b, and 2x were the crucial factors for β-lactam resistance.

Evaluation of a PCR Assay for Detection of Streptococcus pneumoniae in Respiratory and Nonrespiratory Samples from Adults with Community-Acquired Pneumonia

Science.gov (United States)

Murdoch, David R.; Anderson, Trevor P.; Beynon, Kirsten A.; Chua, Alvin; Fleming, Angela M.; Laing, Richard T. R.; Town, G. Ian; Mills, Graham D.; Chambers, Stephen T.; Jennings, Lance C.

2003-01-01

Streptococcus pneumoniae is the most common cause of community-acquired pneumonia, but it is undoubtedly underdiagnosed. We used a nested PCR assay (targeting the pneumolysin gene) to detect S. pneumoniae DNA in multiple sample types from 474 adults with community-acquired pneumonia and 183 control patients who did not have pneumonia. Plasma or buffy coat samples were PCR positive in only 6 of the 21 patients with positive blood cultures for S. pneumoniae and in 12 other patients (4 of whom had no other laboratory evidence of S. pneumoniae infection). Buffy coat samples from two control patients (neither having evidence of S. pneumoniae infection), but no control plasma samples, were PCR positive. Although pneumococcal antigen was detected in the urine from 120 of 420 (29%) patients, only 4 of 227 (2%) urine samples tested were PCR positive. Overall, 256 of 318 (81%) patients had PCR-positive sputum samples, including 58 of 59 samples from which S. pneumoniae was cultured. Throat swab samples from 229 of 417 (55%) patients were PCR positive and, in those who produced sputum, 96% also had positive PCR results from sputum. Throat swabs from 73 of 126 (58%) control patients were also PCR positive. We conclude that the pneumolysin PCR assay adds little to existing diagnostic tests for S. pneumoniae and is unable to distinguish colonization from infection when respiratory samples are tested. PMID:12517826

Predictors of mortality in patients with extensively drug-resistant Acinetobacter baumannii pneumonia receiving colistin therapy.

Science.gov (United States)

Choi, Ik Sung; Lee, Yu Ji; Wi, Yu Mi; Kwan, Byung Soo; Jung, Kae Hwa; Hong, Woong Pyo; Kim, June Myong

2016-08-01

The ratio of the area under the free (unbound) concentration-time curve to minimum inhibitory concentration (fAUC/MIC) was proposed to be the pharmacokinetic/pharmacodynamic index most strongly linked to the antibacterial effect of colistin against Acinetobacter baumannii. A retrospective study of patients who received colistin to treat pneumonia caused by extensively drug-resistant (XDR) A. baumannii over a 4-year period was performed to assess the impact of the colistin MIC on mortality. A total of 227 patients were included in the analysis. The 7-day and 14-day mortality rates of patients with XDR A. baumannii pneumonia receiving colistin therapy were 15.0% and 23.8%, respectively. In the multivariate analysis, Acute Physiology and Chronic Health Evaluation (APACHE) II score, days from index culture to first dose of colistin, underlying tumour and septic shock at presentation were independent predictors of mortality in patients with XDR A. baumannii pneumonia receiving colistin therapy. In the univariate analysis, the colistin dose based on ideal body weight (IBW) correlated with patient outcome. Therefore, the use of IBW appeared to be more appropriate to calculate the colistin dosage. In addition, these results highlight the clinical significance of colistin MIC in patients with XDR A. baumannii pneumonia receiving colistin therapy. Although MICs were in the 'susceptible' range, patients infected with isolates with high colistin MICs showed a poorer clinical response rate than patients infected with isolates with low colistin MICs. Further clinical studies are needed to evaluate the roles of colistin MIC for predicting mortality in XDR A. baumannii pneumonia with a high colistin MIC. Copyright © 2016 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

Streptococcus pneumoniae biofilm formation and dispersion during colonization and disease

Science.gov (United States)

Chao, Yashuan; Marks, Laura R.; Pettigrew, Melinda M.; Hakansson, Anders P.

2015-01-01

Streptococcus pneumoniae (the pneumococcus) is a common colonizer of the human nasopharynx. Despite a low rate of invasive disease, the high prevalence of colonization results in millions of infections and over one million deaths per year, mostly in individuals under the age of 5 and the elderly. Colonizing pneumococci form well-organized biofilm communities in the nasopharyngeal environment, but the specific role of biofilms and their interaction with the host during colonization and disease is not yet clear. Pneumococci in biofilms are highly resistant to antimicrobial agents and this phenotype can be recapitulated when pneumococci are grown on respiratory epithelial cells under conditions found in the nasopharyngeal environment. Pneumococcal biofilms display lower levels of virulence in vivo and provide an optimal environment for increased genetic exchange both in vitro and in vivo, with increased natural transformation seen during co-colonization with multiple strains. Biofilms have also been detected on mucosal surfaces during pneumonia and middle ear infection, although the role of these biofilms in the disease process is debated. Recent studies have shown that changes in the nasopharyngeal environment caused by concomitant virus infection, changes in the microflora, inflammation, or other host assaults trigger active release of pneumococci from biofilms. These dispersed bacteria have distinct phenotypic properties and transcriptional profiles different from both biofilm and broth-grown, planktonic bacteria, resulting in a significantly increased virulence in vivo. In this review we discuss the properties of pneumococcal biofilms, the role of biofilm formation during pneumococcal colonization, including their propensity for increased ability to exchange genetic material, as well as mechanisms involved in transition from asymptomatic biofilm colonization to dissemination and disease of otherwise sterile sites. Greater understanding of pneumococcal biofilm

Post-infective transverse myelitis following Streptococcus pneumoniae meningitis with radiological features of acute disseminated encephalomyelitis: a case report

Directory of Open Access Journals (Sweden)

Williams Thomas

2012-09-01

Full Text Available Abstract Introduction Post-infectious autoimmune demyelination of the central nervous system is a rare neurological disorder typically associated with exanthematous viral infections. We report an unusual presentation of the condition and a previously undocumented association with Streptococcus pneumonia meningitis. Case presentation A 50-year-old Caucasian woman presented to our facility with an acute myelopathy three days after discharge following acute Streptococcus pneumoniae meningitis. Imaging studies of the spine ruled out an infective focus and no other lesions were seen within the cord. Diffuse, bilateral white matter lesions were seen within the cerebral hemispheres, and our patient was diagnosed as having a post-infective demyelination syndrome that met the diagnostic criteria for an acute transverse myelitis. Our patient clinically and radiologically improved following treatment with steroids. Conclusions The novel association of a Streptococcus pneumoniae infection with post-infectious autoimmune central nervous system demyelination should alert the reader to the potentially causative role of this common organism, and gives insights into the pathogenesis. The unusual dissociation between the clinical presentation and the location of the radiological lesions should also highlight the potential for the condition to mimic the presentation of others, and stimulates debate on the definitions of acute transverse myelitis and acute disseminated encephalomyelitis, and their potential overlap.

C3b/iC3b deposition on Streptococcus pneumoniae is not affected by HIV infection.

Directory of Open Access Journals (Sweden)

Catherine Hyams

2010-01-01

Full Text Available Streptococcus pneumoniae is a common cause of infection in both HIV positive patients and those with complement deficiencies. We hypothesised that HIV positive individuals might exhibit reduced opsonisation of pneumococcus with complement due to reduced levels of S. pneumoniae specific IgG. We discovered no difference in C3 deposition on S. pneumoniae between HIV positive or negative individuals, and furthermore C3 deposition remained unchanged as HIV progressed towards AIDS. We found no correlation between C3 deposition on S. pneumoniae and CD4 cell count in HIV infected individuals. Hence we have demonstrated no failure of complement immunity in HIV positive patients.

Expression of Streptococcus pneumoniae Bacteriocins Is Induced by Antibiotics via Regulatory Interplay with the Competence System

NARCIS (Netherlands)

Kjos, Morten; Miller, Eric; Slager, Jelle; Lake, Frank B; Gericke, Oliver; Roberts, Ian S; Rozen, Daniel E; Veening, Jan-Willem

2016-01-01

Pneumococcal bacteriocins (pneumocins) are antibacterial toxins that mediate intra-species competition within the human host. However, the triggers of pneumocin expression are poorly understood. Using RNA-sequencing, we mapped the regulon of the pneumocin cluster (blp) of Streptococcus pneumoniae

Strain-specific impact of PsaR of Streptococcus pneumoniae on global gene expression and virulence.

NARCIS (Netherlands)

Hendriksen, W.T.; Bootsma, H.J.; Diepen, A. van; Estevao, S.; Kuipers, O.P.; Groot, R. de; Hermans, P.W.M.

2009-01-01

Previous studies have indicated that PsaR of Streptococcus pneumoniae is a manganese-dependent regulator, negatively affecting the expression of at least seven genes. Here, we extended these observations by transcriptome and proteome analysis of psaR mutants in strains D39 and TIGR4. The microarray

Structure of the Streptococcus pneumoniae Surface Protein and Adhesin PfbA

OpenAIRE

Suits, Michael D.; Boraston, Alisdair B.

2013-01-01

PfbA (plasmin- and fibronectin-binding protein A) is an extracellular Streptococcus pneumoniae cell-wall attached surface protein that binds to fibronectin, plasmin, and plasminogen. Here we present a structural analysis of the surface exposed domains of PfbA using a combined approach of X-ray crystallography and small-angle X-ray scattering (SAXS). The crystal structure of the PfbA core domain, here called PfbAβ, determined to 2.28 Å resolution revealed an elongated 12-stranded parallel β-he...

The secondary resistome of multidrug-resistant Klebsiella pneumoniae.

Science.gov (United States)

Jana, Bimal; Cain, Amy K; Doerrler, William T; Boinett, Christine J; Fookes, Maria C; Parkhill, Julian; Guardabassi, Luca

2017-02-15

Klebsiella pneumoniae causes severe lung and bloodstream infections that are difficult to treat due to multidrug resistance. We hypothesized that antimicrobial resistance can be reversed by targeting chromosomal non-essential genes that are not responsible for acquired resistance but essential for resistant bacteria under therapeutic concentrations of antimicrobials. Conditional essentiality of individual genes to antimicrobial resistance was evaluated in an epidemic multidrug-resistant clone of K. pneumoniae (ST258). We constructed a high-density transposon mutant library of >430,000 unique Tn5 insertions and measured mutant depletion upon exposure to three clinically relevant antimicrobials (colistin, imipenem or ciprofloxacin) by Transposon Directed Insertion-site Sequencing (TraDIS). Using this high-throughput approach, we defined three sets of chromosomal non-essential genes essential for growth during exposure to colistin (n = 35), imipenem (n = 1) or ciprofloxacin (n = 1) in addition to known resistance determinants, collectively termed the "secondary resistome". As proof of principle, we demonstrated that inactivation of a non-essential gene not previously found linked to colistin resistance (dedA) restored colistin susceptibility by reducing the minimum inhibitory concentration from 8 to 0.5 μg/ml, 4-fold below the susceptibility breakpoint (S ≤ 2 μg/ml). This finding suggests that the secondary resistome is a potential target for developing antimicrobial "helper" drugs that restore the efficacy of existing antimicrobials.

Novel role for the Streptococcus pneumoniae toxin pneumolysin in the assembly of biofilms.

Science.gov (United States)

Shak, Joshua R; Ludewick, Herbert P; Howery, Kristen E; Sakai, Fuminori; Yi, Hong; Harvey, Richard M; Paton, James C; Klugman, Keith P; Vidal, Jorge E

2013-09-10

Streptococcus pneumoniae is an important commensal and pathogen responsible for almost a million deaths annually in children under five. The formation of biofilms by S. pneumoniae is important in nasopharyngeal colonization, pneumonia, and otitis media. Pneumolysin (Ply) is a toxin that contributes significantly to the virulence of S. pneumoniae and is an important candidate as a serotype-independent vaccine target. Having previously demonstrated that a luxS knockout mutant was unable to form early biofilms and expressed less ply mRNA than the wild type, we conducted a study to investigate the role of Ply in biofilm formation. We found that Ply was expressed in early phases of biofilm development and localized to cellular aggregates as early as 4 h postinoculation. S. pneumoniae ply knockout mutants in D39 and TIGR4 backgrounds produced significantly less biofilm biomass than wild-type strains at early time points, both on polystyrene and on human respiratory epithelial cells, cultured under static or continuous-flow conditions. Ply's role in biofilm formation appears to be independent of its hemolytic activity, as S. pneumoniae serotype 1 strains, which produce a nonhemolytic variant of Ply, were still able to form biofilms. Transmission electron microscopy of biofilms grown on A549 lung cells using immunogold demonstrated that Ply was located both on the surfaces of pneumococcal cells and in the extracellular biofilm matrix. Altogether, our studies demonstrate a novel role for pneumolysin in the assembly of S. pneumoniae biofilms that is likely important during both carriage and disease and therefore significant for pneumolysin-targeting vaccines under development. The bacterium Streptococcus pneumoniae (commonly known as the pneumococcus) is commonly carried in the human nasopharynx and can spread to other body sites to cause disease. In the nasopharynx, middle ear, and lungs, the pneumococcus forms multicellular surface-associated structures called biofilms

Multi-drug resistant Ewingella Americana

International Nuclear Information System (INIS)

Bukhari, Syed Z.; Ashshi, Ahmad M.; Hussain, Waleed M.; Fatani, Mohammad I.

2008-01-01

We report a case of pneumonia due to multi-drug resistant Ewingella Americana in a young patient admitted in the Intensive Care Unit of Hera General Hospital, Makkah, Saudi Arabia with severe head injury in a road traffic accident. He was an Indonesian pilgrim who had traveled to the Kingdom of Saudi Arabia to perform Hajj in December 2007. Ewingella Americana was identified to be the pathogen of pneumonia with clinical signs and symptoms along with positive radiological findings. (author)

Association between nasopharyngeal load of Streptococcus pneumoniae, viral coinfection, and radiologically confirmed pneumonia in Vietnamese children.

Science.gov (United States)

Vu, Huong Thi Thu; Yoshida, Lay Myint; Suzuki, Motoi; Nguyen, Hien Anh Thi; Nguyen, Cat Dinh Lien; Nguyen, Ai Thi Thuy; Oishi, Kengo; Yamamoto, Takeshi; Watanabe, Kiwao; Vu, Thiem Dinh

2011-01-01

The interplay between nasopharyngeal bacterial carriage, viral coinfection, and lower respiratory tract infections (LRTIs) is poorly understood. We explored this association in Vietnamese children aged less than 5 years. A hospital-based case-control study of pediatric LRTIs was conducted in Nha Trang, Vietnam. A total of 550 hospitalized children (274 radiologically confirmed pneumonia [RCP] and 276 other LRTIs) were enrolled and 350 healthy controls were randomly selected from the community. Polymerase chain reaction-based methods were used to measure bacterial loads of Streptococcus pneumoniae (SP), Haemophilus influenzae, and Moraxella catarrhalis and to detect 13 respiratory viruses and bacterial serotypes in nasopharyngeal samples of study participants. The median nasopharyngeal bacterial load of SP was substantially higher in children with RCP compared with healthy controls or children with other LRTIs (P RCP or other LRTIs groups. An increased load of SP in the nasopharynx was associated with RCP, viral coinfection, and presence of pneumococcal capsule.

Silica desiccant packets for storage and transport of Streptococcus pneumoniae and other clinically relevant species.

Directory of Open Access Journals (Sweden)

Casey L Pell

Full Text Available Bacterial isolates are often transported between laboratories for research and diagnostic purposes. Silica desiccant packets (SDPs, which are inexpensive and do not require freezing, were evaluated for storage and recovery of bacterial isolates. Conditions such as inoculum size, swab type and temperature of storage were investigated using ten Streptococcus pneumoniae isolates. The optimized protocol was then tested using 49 additional S. pneumoniae isolates representing 40 serogroups. Overall, S. pneumoniae growth was considered satisfactory (>100 colony forming units for 98/109 (89.9% and 20/20 (100% swabs after 14 days at room temperature or 28 days at 4° C, respectively. Storage in SDPs did not impact on the ability of S. pneumoniae isolates to be subsequently serotyped. When the survival of nine other clinically relevant bacterial species was tested, seven were viable after 28 days at room temperature, the exceptions being Neisseria gonorrhoeae and Haemophilus influenzae. SDPs are suitable for transport and short-term storage of bacterial species including S. pneumoniae.

Total synthesis of a Streptococcus pneumoniae serotype 12F CPS repeating unit hexasaccharide

Directory of Open Access Journals (Sweden)

Peter H. Seeberger

2017-01-01

Full Text Available The Gram-positive bacterium Streptococcus pneumoniae causes severe disease globally. Vaccines that prevent S. pneumoniae infections induce antibodies against epitopes within the bacterial capsular polysaccharide (CPS. A better immunological understanding of the epitopes that protect from bacterial infection requires defined oligosaccharides obtained by total synthesis. The key to the synthesis of the S. pneumoniae serotype 12F CPS hexasaccharide repeating unit that is not contained in currently used glycoconjugate vaccines is the assembly of the trisaccharide β-D-GalpNAc-(1→4-[α-D-Glcp-(1→3]-β-D-ManpNAcA, in which the branching points are equipped with orthogonal protecting groups. A linear approach relying on the sequential assembly of monosaccharide building blocks proved superior to a convergent [3 + 3] strategy that was not successful due to steric constraints. The synthetic hexasaccharide is the starting point for further immunological investigations.

Identification of the smallest structure capable of evoking opsonophagocytic antibodies against Streptococcus pneumoniae type 14

NARCIS (Netherlands)

Safari, D.; Dekker, H.A.T.; Joosten, J.A.; Michalik, D.; de Souza, A.C.; Adamo, R.; Lahmann, M.; Oscarson, S.; Kamerling, J.P.|info:eu-repo/dai/nl/070433941; Snippe, H.

2008-01-01

Synthetic overlapping oligosaccharide fragments of Streptococcus pneumoniae serotype 14 capsular polysaccharide (Pn14PS), {6)-[β-D-Galp-(14)-]β-D-GlcpNAc-(13)-β-D-Galp-(14)-β-D-Glcp-(1}n, were conjugated to CRM197 protein and injected into mice to determine the smallest immunogenic structure. The

Antimicrobial Resistance of Hypervirulent Klebsiella pneumoniae: Epidemiology, Hypervirulence-Associated Determinants, and Resistance Mechanisms

Directory of Open Access Journals (Sweden)

Chang-Ro Lee

2017-11-01

Full Text Available Klebsiella pneumoniae is one of the most clinically relevant species in immunocompromised individuals responsible for community-acquired and nosocomial infections, including pneumonias, urinary tract infections, bacteremias, and liver abscesses. Since the mid-1980s, hypervirulent K. pneumoniae, generally associated with the hypermucoviscosity phenotype, has emerged as a clinically significant pathogen responsible for serious disseminated infections, such as pyogenic liver abscesses, osteomyelitis, and endophthalmitis, in a generally younger and healthier population. Hypervirulent K. pneumoniae infections were primarily found in East Asia and now are increasingly being reported worldwide. Although most hypervirulent K. pneumoniae isolates are antibiotic-susceptible, some isolates with combined virulence and resistance, such as the carbapenem-resistant hypervirulent K. pneumoniae isolates, are increasingly being detected. The combination of multidrug resistance and enhanced virulence has the potential to cause the next clinical crisis. To better understand the basic biology of hypervirulent K. pneumoniae, this review will provide a summarization and discussion focused on epidemiology, hypervirulence-associated factors, and antibiotic resistance mechanisms of such hypervirulent strains. Epidemiological analysis of recent clinical isolates in China warns the global dissemination of hypervirulent K. pneumoniae strains with extensive antibiotic resistance in the near future. Therefore, an immediate response to recognize the global dissemination of this hypervirulent strain with resistance determinants is an urgent priority.

Molecular epidemiology and drug resistant mechanism in carbapenem-resistant Klebsiella pneumoniae isolated from pediatric patients in Shanghai, China.

Science.gov (United States)

Zhang, Xingyu; Chen, Di; Xu, Guifeng; Huang, Weichun; Wang, Xing

2018-01-01

Infection by carbapenem-resistant Klebsiella pneumoniae (CR-KP) is a public health challenge worldwide, in particular among children, which was associated with high morbidity and mortality rates. There was limited data in pediatric populations, thus this study aimed to investigate molecular epidemiology and drug resistant mechanism of CR-KP strains from pediatric patients in Shanghai, China. A total of 41 clinical CR-KP isolates from sputum, urine, blood or drainage fluid were collected between July 2014 and May 2015 in Shanghai Children's Medical Center. Multilocus sequence typing (MLST), antibiotic susceptibility testing, PCR amplification and sequencing of the drug resistance associated genes were applied to all these isolates. MLST analysis revealed 16 distinct STs identified within the 41 isolates, among which the most frequently represented were ST11(19.5%),ST25(14.6%),ST76(14.6%),ST37(9.8%).One new ST was first identified. All CR-KP isolates showed MDR phenotypes and were resistance to ceftazidime, imipenem, piperacillin / tazobactam, ceftriaxone, ampicillin /sulbactam, aztreonam. They were confirmed as carbapenemase producer, NDM-1 (56.1%, 23/41), IMP (26.8%, 11/41), KPC-2 (22.0%, 9/41) were detected. Of note, two isolates carried simultaneously both NDM-1 and IMP-4. All CR-KP strains contained at least one of extended spectrum β-lactamase genes tested(TEM, SHV, OXA-1, CTX-M group) and six isolates carried both ESBL and AmpC genes(DHA-1). Among the penicllinase and β-lactamase genes, the most frequently one is SHV(92.7%,38/41), followed by TEM-1(68.3%,28/41), CTX-M-14(43.9%,18/41), CTX-M-15(43.9%,14/41), OXA-1(14.6%,6/41). In the present study, NDM-1-producing isolates was the predominant CR-KP strains in children, follow by IMP and KPC-producing strains. NDM-1and IMP-4 were more frequent than KPC-2 and showed a multiclonal background. Those suggested carbapenem-resistant in children is diverse, and certain resistance mechanisms differ from prevalent

Risk factors and outcomes of carbapenem-resistant Klebsiella pneumoniae infections

Directory of Open Access Journals (Sweden)

Eleonora Pistella

2016-12-01

Full Text Available In the nosocomial setting, antimicrobial-resistant Enterobacteriaceae are a growing challenge, and alarming trends in resistance are currently reported all over the world. Isolates of Enterobacteriaceae producing ampC β-lactamases and extended spectrum β-lactamases are endemic in many hospitals, and are frequently resistant also to other classes of antibiotics, such as fluoroquinolones and aminoglycosides. The risk of infections due to multi-drug resistant strains should be considered also for outpatients who have had recent contact with the health system. Both nosocomial and health-care associated infections should be treated with a combination of antibiotics active against multi-drug resistant Gram negative and methicillin-resistant Staphylococcus aureus. In the absence of effective antimicrobial stewardship programs, this aggressive therapeutic approach might lead to abuse of broad-spectrum antibiotics, with consequent increase in resistances. To contain the possible antibiotic overuse, several decisional strategies, often based on risk-score systems supporting the clinical decisions, have been proposed. In this context of high antibiotic selection pressure, carbapenem-resistant pathogens recently began to spread in many hospitals. Carbapenem-resistant Klebsiella pneumoniae, as well as carbapenem-resistant Acinetobacter baumannii and P. aeruginosa, represent the new major challenges to patient safety. Against these organisms the initial empiric treatment is generally ineffective. The poor clinical outcome associated with carbapenem- resistant K. pneumoniae infections is probably due to the delete in the beginning of an appropriate antibiotic treatment, rather than to the increased virulence of pathogens. Only few therapeutic options are available, including colistin, tigecycline, aminoglycosides and carbapenems in selected cases. Several combinations of these antibiotics have been used, but no ideal regimen has been currently established.

Bactericidal effect of bovine lactoferrin and synthetic peptide lactoferrin chimera in Streptococcus pneumoniae and the decrease in luxS gene expression by lactoferrin

NARCIS (Netherlands)

León-Sicairos, N.; Angulo-Zamudio, U.A.; Vidal, J.E.; López-Torres, C.A.; Bolscher, J.G.M.; Nazmi, K.; Reyes-Cortes, R.; Reyes-López, M.; de la Garza, M.; Canizalez-Román, A.

2014-01-01

Streptococcus pneumoniae (pneumococcus) is responsible for nearly one million child deaths annually. Pneumococcus causes infections such as pneumonia, otitis media, meningitis, and sepsis. The human immune system includes antibacterial peptides and proteins such as lactoferrin (LF), but its activity

[Investigation of antimicrobial resistance of Klebsiella pneumoniae and Pseudomonas aeruginosa isolates from rat-like animals around a hospital in Guangzhou].

Science.gov (United States)

Zhong, Xue-Shan; Ge, Jing; Chen, Shao-Wei; Xiong, Yi-Quan; Zheng, Xue-Yan; Qiu, Min; Huo, Shu-Ting; Chen, Qing

2016-05-01

To investigate antimicrobial resistance of Klebsiella pneumoniae and Pseudomonas aeruginosa isolates in fecal samples from rat-like animals. Rat-like animals were captured using cages around a hospital and the neighboring residential area between March and October, 2015. K. pneumoniae and P. aeruginosa were isolated from the fecal samples of the captured animals. Antimicrobial susceptibility test was performed according to the guidelines of Clinical and Laboratory Standards Institute (2014). A total of 329 rat-like animals were captured, including 205 Suncus murinus, 111 Rattus norvegicus, 5 Rattus flavipectus and 8 Mus musculus. The positivity rates of K. pneumoniae and P. aeruginosa were 78.4% and 34.7% in the fecal samples from the captured animals, respectively. K. pneumoniae isolates from Suncus murinus showed a high resistance to ampicillin, cephazolin, nitrofurantoin, piperacillin and cefotaxime (with resistance rates of 100%, 51.2%, 44.2%, 37.2%, and 23.3%, respectively), and K. pneumoniae isolates from Rattus spp. showed a similar drug-resistance profile. The prevalence rates of multidrug resistance and ESBLs were 40.9% and 10.7%, respectively. P. aeruginosa from both Suncus murinus and Rattus spp. exhibited the highest resistance rates to aztreonam (12.4% and 16.0%, respectively), followed by penicillins and fluoroquinolones. P. aeruginosa isolates were susceptible to cephems, aminoglycosides and carbapenems (with resistance rates below 5%). K. pneumoniae and P. aeruginosa isolated from rat-like animals showed drug-resistance profiles similar to those of the strains isolated from clinical patients, suggesting that the possible transmission of K. pneumoniae and P. aeruginosa between rat-like animals and human beings.

A visual review of the human pathogen Streptococcus pneumoniae.

Science.gov (United States)

Engholm, Ditte Høyer; Kilian, Mogens; Goodsell, David S; Andersen, Ebbe Sloth; Kjærgaard, Rikke Schmidt

2017-11-01

Being the principal causative agent of bacterial pneumonia, otitis media, meningitis and septicemia, the bacterium Streptococcus pneumoniae is a major global health problem. To highlight the molecular basis of this problem, we have portrayed essential biological processes of the pneumococcal life cycle in eight watercolor paintings. The paintings are done to a consistent nanometer scale based on currently available data from structural biology and proteomics. In this review article, the paintings are used to provide a visual review of protein synthesis, carbohydrate metabolism, cell wall synthesis, cell division, teichoic acid synthesis, virulence, transformation and pilus synthesis based on the available scientific literature within the field of pneumococcal biology. Visualization of the molecular details of these processes reveals several scientific questions about how molecular components of the pneumococcal cell are organized to allow biological function to take place. By the presentation of this visual review, we intend to stimulate scientific discussion, aid in the generation of scientific hypotheses and increase public awareness. A narrated video describing the biological processes in the context of a whole-cell illustration accompany this article. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

EFFECT OF TOBRACEF IN CARBAPENEM RESISTANT PNEUMONIA INFECTION

OpenAIRE

A. Ahmad, V.K. Dwivedi * , and M. Chaudhary

2010-01-01

To determine ef ect of Tobracef and imipenem drug on antioxidant enzyme actvity and lipid peroxidation leveland some biochemical parametrs in carbapenem resistant pneumonia infection rat model. Total 40 rats wereselected and diveded into 4 groups of 10 rats each. Group I was control group; group II was infected via A.baumanni bacterial strain. Group III and IV were infected plus treated group with tobracef and imipenemdrugs.Our results showed that a significant (p

Análise das cepas de Streptococcus pneumoniae causadores de pneumonia invasiva: sorotipos e sensibilidade aos antimicrobianos

Directory of Open Access Journals (Sweden)

Cristina R. M. Yoshioka

2011-02-01

Full Text Available OBJETIVOS: Identificar os sorotipos de pneumococo mais frequentemente isolados de crianças internadas com pneumonia invasiva, comparar os sorotipos com os incluídos em vacinas conjugadas e analisar sua sensibilidade aos antimicrobianos mais utilizados na faixa etária pediátrica. MÉTODOS: Estudo descritivo, retrospectivo das pneumonias pneumocócicas identificadas em crianças internadas no hospital universitário da Universidade de São Paulo, no período de janeiro de 2003 a outubro de 2008. Os critérios de inclusão foram: faixa etária de 29 dias até 15 anos incompletos com diagnóstico clínico e radiológico de pneumonia e com cultura de sangue e/ou líquido pleural com crescimento de Streptococcus pneumoniae. RESULTADOS: Foram incluídas no estudo 107 crianças. Os sorotipos mais frequentes foram: 14 (36,5%, 1 (16,7%, 5 (14,6%, 6B (6,3% e 3 (4,2%. A proporção de sorotipos contidos na vacina conjugada heptavalente seria de 53,1%, na vacina 10-valente de 86,5% e na 13-valente seria de 96,9%. De acordo com os padrões do Clinical and Laboratory Standards Institute 2008, 100 cepas (93,5% de pneumococos foram sensíveis à penicilina (concentração inibitória mínima, CIM 8 µg/mL. Verificamos alta taxa de sensibilidade para as cepas testadas para vancomicina, rifampicina, ceftriaxone, clindamicina, cloranfenicol e eritromicina. CONCLUSÕES: Nossos resultados confirmam um expressivo impacto potencial das vacinas conjugadas, principalmente pela 10-valente e 13-valente, sobre os casos de pneumonias invasivas. Os resultados de sensibilidade à penicilina evidenciam que a opção terapêutica de escolha para o tratamento das pneumonias invasivas continua sendo a penicilina.

The Host Immune Response to Streptococcus pneumoniae: Bridging Innate and Adaptive Immunity

Science.gov (United States)

2006-07-06

P.J. (1989) Effect of Streptococcus pneumoniae on human respiratory epithelium in vitro. Infect. Immun. 57: 2006-2013. Stoop, J.N., van der Molen ...antibiotics. Clin. Microbiol. Rev. 3: 171-196. Knapp, S., Wieland, C.W., van ’t Veer, C., Takeuchi, O., Akira, S., Florquin, S., and van der Poll...R.G., Baan, C.C., van der Laan, L.J., Kuipers, E.J., Kusters, J.G., and Janssen, H.L. (2005) Regulatory T cells contribute to the impaired immune

Internamento devido a PAC por Streptococcus pneumoniae – Avaliação de factores de mortalidade

Directory of Open Access Journals (Sweden)

Sandra Figueiredo

2008-09-01

Full Text Available Resumo: A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS -CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0.Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67,3% do sexo masculino. O estudo revelou existir uma associação com significado estatístico entre os resultados de PSI e CURB-65 e a evolução para a mortalidade.Apesar da melhoria dos meios diagnósticos e profilácticos, e da terapêutica antibiótica, a pneumonia pneumocócica permanece uma entidade de grande morbilidade e mortalidade. O valor preditivo das normas PSI e CURB-65 foi confirmado nesta população de doentes, documentando uma correlação entre o número de factores de risco e a evolução da doença.Rev Port Pneumol 2008; XIV (5: 601-615 Abstract: Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for

Impact of the factor V Leiden mutation on the outcome of pneumococcal pneumonia: a controlled laboratory study

NARCIS (Netherlands)

Schouten, Marcel; van 't Veer, Cornelis; Roelofs, Joris Jth; Levi, Marcel; van der Poll, Tom

2010-01-01

Introduction: Streptococcus (S.) pneumoniae is the most common cause of community-acquired pneumonia. The factor V Leiden (FVL) mutation results in resistance of activated FV to inactivation by activated protein C and thereby in a prothrombotic phenotype. Human heterozygous FVL carriers have been

Roles of the Essential Protein FtsA in Cell Growth and Division in Streptococcus pneumoniae

Czech Academy of Sciences Publication Activity Database

Mura, Andrea; Fadda, D.; Perez, A.J.; Danforth, M.L.; Musu, D.; Rico, A.I.; Krupka, M.; Denapaite, D.; Tsui, H-Ch.T.; Winkler, M.E.; Branny, Pavel; Vicente, M.; Margolin, W.; Massidda, O.

2017-01-01

Roč. 199, č. 3 (2017), č. článku UNSP e00608. ISSN 0021-9193 R&D Projects: GA ČR GAP302/12/0256; GA MŠk LH12055 Institutional support: RVO:61388971 Keywords : FtsA * Gram-positive cocci * Streptococcus pneumoniae Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.143, year: 2016

Time and dose-dependent risk of pneumococcal pneumonia following influenza: a model for within-host interaction between influenza and Streptococcus pneumoniae

OpenAIRE

Shrestha, Sourya; Foxman, Betsy; Dawid, Suzanne; Aiello, Allison E.; Davis, Brian M.; Berus, Joshua; Rohani, Pejman

2013-01-01

A significant fraction of seasonal and in particular pandemic influenza deaths are attributed to secondary bacterial infections. In animal models, influenza virus predisposes hosts to severe infection with both Streptococcus pneumoniae and Staphylococcus aureus. Despite its importance, the mechanistic nature of the interaction between influenza and pneumococci, its dependence on the timing and sequence of infections as well as the clinical and epidemiological consequences remain unclear. We e...

LocZ is a new cell division protein involved in proper septum placement in Streptococcus pneumoniae

Czech Academy of Sciences Publication Activity Database

Holečková, Nela; Doubravová, Linda; Massidda, Orietta; Molle, Virginie; Buriánková, Karolína; Benada, Oldřich; Kofroňová, Olga; Ulrych, Aleš; Branny, Pavel

2015-01-01

Roč. 6, č. 1 (2015), s. 1-13 ISSN 2150-7511 R&D Projects: GA ČR GAP207/12/1568; GA ČR GAP302/12/0256 Institutional support: RVO:61388971 Keywords : cell division * septum placement * Streptococcus pneumoniae Subject RIV: EE - Microbiology, Virology Impact factor: 6.975, year: 2015

UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

NARCIS (Netherlands)

Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

CRH Affects the Phenotypic Expression of Sepsis-Associated Virulence Factors by Streptococcus pneumoniae Serotype 1 In vitro

Directory of Open Access Journals (Sweden)

Colette G. Ngo Ndjom

2017-06-01

Full Text Available Sepsis is a life-threatening health condition caused by infectious pathogens of the respiratory tract, and accounts for 28–50% of annual deaths in the US alone. Current treatment regimen advocates the use of corticosteroids as adjunct treatment with antibiotics, for their broad inhibitory effect on the activity and production of pro-inflammatory mediators. However, despite their use, corticosteroids have not proven to be able to reverse the death incidence among septic patients. We have previously demonstrated the potential for neuroendocrine factors to directly influence Streptococcus pneumoniae virulence, which may in turn mediate disease outcome leading to sepsis and septic shock. The current study investigated the role of Corticotropin-releasing hormone (CRH in mediating key markers of pneumococcal virulence as important phenotypic determinants of sepsis and septic shock risks. In vitro cultures of serotype 1 pneumococcal strain with CRH promoted growth rate, increased capsule thickness and penicillin resistance, as well as induced pneumolysin gene expression. These results thus provide significant insights of CRH–pathogen interactions useful in understanding the underlying mechanisms of neuroendocrine factor's role in the onset of community acquired pneumonias (CAP, sepsis and septic shock.

Characterization of a Streptococcus suis tet(O/W/32/O)-carrying element transferable to major streptococcal pathogens.

Science.gov (United States)

Palmieri, Claudio; Magi, Gloria; Mingoia, Marina; Bagnarelli, Patrizia; Ripa, Sandro; Varaldo, Pietro E; Facinelli, Bruna

2012-09-01

Mosaic tetracycline resistance determinants are a recently discovered class of hybrids of ribosomal protection tet genes. They may show different patterns of mosaicism, but their final size has remained unaltered. Initially thought to be confined to a small group of anaerobic bacteria, mosaic tet genes were then found to be widespread. In the genus Streptococcus, a mosaic tet gene [tet(O/W/32/O)] was first discovered in Streptococcus suis, an emerging drug-resistant pig and human pathogen. In this study, we report the molecular characterization of a tet(O/W/32/O) gene-carrying mobile element from an S. suis isolate. tet(O/W/32/O) was detected, in tandem with tet(40), in a circular 14,741-bp genetic element (39.1% G+C; 17 open reading frames [ORFs] identified). The novel element, which we designated 15K, also carried the macrolide resistance determinant erm(B) and an aminoglycoside resistance four-gene cluster including aadE (streptomycin) and aphA (kanamycin). 15K appeared to be an unstable genetic element that, in the absence of recombinases, is capable of undergoing spontaneous excision under standard growth conditions. In the integrated form, 15K was found inside a 54,879-bp integrative and conjugative element (ICE) (50.5% G+C; 55 ORFs), which we designated ICESsu32457. An ∼1.3-kb segment that apparently served as the att site for excision of the unstable 15K element was identified. The novel ICE was transferable at high frequency to recipients from pathogenic Streptococcus species (S. suis, Streptococcus pyogenes, Streptococcus pneumoniae, and Streptococcus agalactiae), suggesting that the multiresistance 15K element can successfully spread within streptococcal populations.

Delineation of Streptococcus dysgalactiae, its subspecies, and its clinical and phylogenetic relationship to Streptococcus pyogenes

DEFF Research Database (Denmark)

Jensen, Anders; Kilian, Mogens

2011-01-01

The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered...

Validation of an immunodiagnostic assay for detection of 13 Streptococcus pneumoniae serotype-specific polysaccharides in human urine.

Science.gov (United States)

Pride, Michael W; Huijts, Susanne M; Wu, Kangjian; Souza, Victor; Passador, Sherry; Tinder, Chunyan; Song, Esther; Elfassy, Arik; McNeil, Lisa; Menton, Ronald; French, Roger; Callahan, Janice; Webber, Chris; Gruber, William C; Bonten, Marc J M; Jansen, Kathrin U

2012-08-01

To improve the clinical diagnosis of pneumococcal infection in bacteremic and nonbacteremic community-acquired pneumonia (CAP), a Luminex technology-based multiplex urinary antigen detection (UAD) diagnostic assay was developed and validated. The UAD assay can simultaneously detect 13 different serotypes of Streptococcus pneumoniae by capturing serotype-specific S. pneumoniae polysaccharides (PnPSs) secreted in human urine. Assay specificity is achieved by capturing the polysaccharides with serotype-specific monoclonal antibodies (MAbs) on spectrally unique microspheres. Positivity for each serotype was based on positivity cutoff values calculated from a standard curve run on each assay plate together with positive- and negative-control urine samples. The assay is highly specific, since significant signals are detected only when each PnPS was paired with its homologous MAb-coated microspheres. Validation experiments demonstrated excellent accuracy and precision. The UAD assay and corresponding positivity cutoff values were clinically validated by assessing 776 urine specimens obtained from patients with X-ray-confirmed CAP. The UAD assay demonstrated 97% sensitivity and 100% specificity using samples obtained from patients with bacteremic, blood culture-positive CAP. Importantly, the UAD assay identified Streptococcus pneumoniae (13 serotypes) in a proportion of individuals with nonbacteremic CAP, a patient population for which the pneumococcal etiology of CAP was previously difficult to assess. Therefore, the UAD assay provides a specific, noninvasive, sensitive, and reproducible tool to support vaccine efficacy as well as epidemiological evaluation of pneumococcal disease, including CAP, in adults.

Radiolabeling of gemifloxacin with technetium-99m and biological evaluation in artificially Streptococcus pneumoniae infected rats

International Nuclear Information System (INIS)

Syed Qaiser Shah; Muhammad Rafiullah Khan

2011-01-01

In the current investigation complexation of the gemifloxacin (GIN) with technetium-99 m ( 99m Tc) and its biological evaluation in artificially Streptococcus pneumoniae (S. pneumoniae) infected rats was assessed as potential S. pneumoniae infection radiotracer. Radiochemically the 99m Tc-GIN complex was further analyzed in terms of stability in saline, in vitro stability in serum at 37 deg C, in vitro binding with S. pneumoniae and biodistribution in artificially S. pneumoniae (living and heat killed) infected rats. The complex was found 97.25 ± 0.25% radiochemically stable in saline at 30 min after reconstitution. The stability of the 99m Tc-GIN complex was decreased to 90.50 ± 0.20% within 240 min after reconstitution. In serum the 99m Tc-GIN complex showed stable profile with the appearance of 18.85% free tracer within 16 h of incubation. The 99m Tc-GIN complex showed saturated in vitro binding with S. pneumoniae after different intervals. Almost five fold uptake was observed in living S. pneumoniae infected muscle of the rats as compared to the inflamed and normal muscle. No significant difference in the uptake of heat killed S. pneumoniae infected, inflamed and normal muscles of the rats. The high RCP yield in saline, in vitro permanence in serum, in vitro binding with living S. pneumoniae and biodistribution in artificially S. pneumoniae infected rats we recommend the 99m Tc-GIN as potential S. pneumoniae infection radiotracer. (author)

Changed Expression of Cytoskeleton Proteins During Lung Injury in a Mouse Model of Streptococcus pneumoniae Infection

Directory of Open Access Journals (Sweden)

Mario Ferrer-Navarro

2018-05-01

Full Text Available Infections by Streptococcus pneumoniae are a major cause of morbidity and mortality worldwide, often causing community-acquired pneumonia, otitis media and also bacteremia and meningitis. Studies on S. pneumoniae are mainly focused on its virulence or capacity to evade the host immune system, but little is known about the injury caused in lungs during a pneumococcal infection. Herein we investigated this issue comparing the proteome profile of lungs from S. pneumoniae-infected mice with control mice by means of difference gel electrophoresis (DIGE technology. In order to obtain reliable results three biological replicas were used, and four technical replicas were carried out in each biological replica. Proteomic comparison was performed at two time points: 24 and 48 h post infection. A total of 91 proteins were identified with different abundance. We found important changes in the protein profiles during pneumococcal infection mainly associated with regulation of vesicle-mediated transport, wound healing, and cytoskeleton organization. In conclusion, the results obtained show that the cytoskeleton of the host cell is modified in S. pneumoniae infection.

Platelet Endothelial Cell Adhesion Molecule-1, a Putative Receptor for the Adhesion of Streptococcus pneumoniae to the Vascular Endothelium of the Blood-Brain Barrier

NARCIS (Netherlands)

Iovino, Federico; Molema, Grietje; Bijlsma, Jetta J. E.

The Gram-positive bacterium Streptococcus pneumoniae is the main causative agent of bacterial meningitis. S. pneumoniae is thought to invade the central nervous system via the bloodstream by crossing the vascular endothelium of the blood-brain barrier. The exact mechanism by which pneumococci cross

Resistance to K. pneumoniae in young children with congenital heart defects

Directory of Open Access Journals (Sweden)

V. N. Ilina

2015-10-01

Full Text Available Klebsiella pneumoniae is one of the leading agents of nosocomial infections (NI. In Russia, Klebsiella pneumoniae is the third in frequency of gram-negative pathogen NI. For a long time one of the major clinically relevant mechanisms of acquired resistance to K. pneumoniae is multidrug resistance caused by extended spectrum -lactamase production (ESBL. Carbapenems show the greatest resistance to the action of ESB. However, now there exist registered strains of K.pneumoniae resistant to carbapenems. In connection with this in 2008 we conducted a prospective study on resistance to K. pneumoniae in young children being treated at ICU. It was found out that resistance to III-IV-generation cephalosporines, fluoroquinolones, aminoglycosides is determined by production of ESBL, while resistance to carbapenems occurs due to reduction of permeability of cell membranes, in combination with production of ESBL. Some features of patients colonized with multidrug-resistant strains of K. pneumoniae are described.

A Multi-Scale Computational Study on the Mechanism of Streptococcus pneumoniae Nicotinamidase (SpNic)

OpenAIRE

Ion, Bogdan; Kazim, Erum; Gauld, James

2014-01-01

Nicotinamidase (Nic) is a key zinc-dependent enzyme in NAD metabolism that catalyzes the hydrolysis of nicotinamide to give nicotinic acid. A multi-scale computational approach has been used to investigate the catalytic mechanism, substrate binding and roles of active site residues of Nic from Streptococcus pneumoniae (SpNic). In particular, density functional theory (DFT), molecular dynamics (MD) and ONIOM quantum mechanics/molecular mechanics (QM/MM) methods have been employed. The o...

Purpura fulminans associated with Streptococcus pneumoniae septicemia in an asplenic pediatric patient.

Science.gov (United States)

Konda, S; Zell, D; Milikowski, C; Alonso-Llamazares, J

2013-09-01

Purpura fulminans is a rapidly progressive syndrome of small-vessel thrombosis and hemorrhagic necrosis of the skin accompanied by disseminated intravascular coagulation. We describe a case of Streptococcus pneumoniae septicemia in an asplenic 5-year-old boy on oral tacrolimus, with a past medical history of multivisceral organ transplantation and subsequent development of purpura fulminans on his chest and distal extremities. The acute infectious form of purpura fulminans is usually caused by gram-negative bacteria. Cases secondary to gram-positive encapsulated bacteria usually occur when individuals are immuno-suppressed or have anatomic or functional asplenia. Our patient had both, which likely increased his susceptibility, and he responded well to antimicrobial therapy in addition to prophylactic coverage in the setting of his immunosuppression. We review the literature for similar cases due to S. pneumoniae in the pediatric population and discuss the etiology and treatment of purpura fulminans. Copyright © 2011 Elsevier España, S.L. and AEDV. All rights reserved.

Recent epidemiology of Streptococcus pneumoniae in nasopharynxes of Korean children with acute otitis media.

Science.gov (United States)

Han, Seung Beom; Kim, Jong-Hyun; Kang, Jin Han; Ma, Sang Hyuk; Kim, Chun Soo; Kim, Kyung-Hyo; Kim, Hwang Min; Choi, Young Youn

2017-03-01

This prospective study was performed to evaluate serotype distribution, multilocus sequence typing, and antibiotic susceptibility of Streptococcus pneumoniae identified in Korean children with acute otitis media (AOM) after the introduction of a 7-valent pneumococcal conjugate vaccine (PCV7). Nasopharyngeal aspirates were collected from children diagnosed with AOM in seven hospitals in Korea. The bacteria identified in these samples and the serotypes, sequence types (STs), and antibiotic susceptibilities of S. pneumoniae isolates were evaluated. A total of 390 children were enrolled, and bacteria were identified in 376 (96.4%) children. S. pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were identified in 155 (39.7%), 127 (32.6%) and 86 (22.1%) children, respectively. Serotype 19A (22.4%) was the most common S. pneumoniae serotype, with serogroups 11 (14.7%) and 15 (13.5%) following. ST320 (23.5%) was the most common ST; ST166 (17.0%) and ST83 (8.5%) followed. The overall susceptibility rates of S. pneumoniae to oral penicillin V and amoxicillin/clavulanate were 2.6% and 53.2%, respectively. The susceptibility rate to cefditoren was 91.0%; however, the rates for other cephalosporins were less than 10.0%. Compared with other serogroups, S. pneumoniae serogroups 19, 11, and 15 showed significantly lower susceptibility rates to all the antibiotics tested. S. pneumoniae serotype 19A, serogroups 11 and 15 were the major nasopharyngeal-colonizing bacteria in Korean children with AOM after the introduction of PCV7. These relatively prevalent serotype/serogroups showed lower antibiotic susceptibility rates. Copyright © 2016. Published by Elsevier Ltd.

Streptococcus pneumonia YlxR at 1.35 Å shows a putative new fold

OpenAIRE

Osipiuk, Jerzy; Górnicki, Piotr; Maj, Luke; Dementieva, Irina; Laskowski, Roman; Joachimiak, Andrzej

2001-01-01

The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 Å. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 Å from orthorhombic crystals using synchrotron radiation and the structure was determined ...

A Community-acquired Lung Abscess Attributable to Streptococcus pneumoniae which Extended Directly into the Chest Wall.

Science.gov (United States)

Ko, Yuki; Tobino, Kazunori; Yasuda, Yuichiro; Sueyasu, Takuto; Nishizawa, Saori; Yoshimine, Kouhei; Munechika, Miyuki; Asaji, Mina; Yamaji, Yoshikazu; Tsuruno, Kosuke; Miyajima, Hiroyuki; Mukasa, Yosuke; Ebi, Noriyuki

We herein report the case of 75-year-old Japanese female with a community-acquired lung abscess attributable to Streptococcus pneumoniae (S. penumoniae) which extended into the chest wall. The patient was admitted to our hospital with a painful mass on the left anterior chest wall. A contrast-enhanced chest computed tomography scan showed a lung abscess in the left upper lobe which extended into the chest wall. Surgical debridement of the chest wall abscess and percutaneous transthoracic tube drainage of the lung abscess were performed. A culture of the drainage specimen yielded S. pneumoniae. The patient showed a remarkable improvement after the initiation of intravenous antibiotic therapy.

Interaction of SIGNR1 expressed by marginal zone macrophages with marginal zone B cells is essential to early IgM responses against Streptococcus pneumoniae

NARCIS (Netherlands)

Koppel, Estella A.; Litjens, Manja; van den Berg, Venice C.; van Kooyk, Yvette; Geijtenbeek, Teunis B. H.

2008-01-01

The spleen plays a pivotal role in the immune defense against encapsulated bacteria such as Streptococcus pneumoniae. Murine splenic marginal zone macrophages express the C-type lectin SIGNR1, which is crucial for the capture of S. pneumoniae from blood. In this study, we demonstrate that SIGNR1 is

Clinical characteristics of pneumonia in bedridden patients receiving home care: a 3-year prospective observational study.

Science.gov (United States)

Ishida, Tadashi; Tachibana, Hiromasa; Ito, Akihiro; Ikeda, Satoshi; Furuta, Kenjiro; Nishiyama, Akihiro; Noyama, Maki; Tokioka, Fumiaki; Yoshioka, Hiroshige; Arita, Machiko

2015-08-01

The aim of the study was to describe the epidemiology, clinical features, antimicrobial treatment, and outcomes of bedridden pneumonia patients receiving home healthcare. A 3-year prospective observational study of poor performance status (PS) 3-4 patients receiving long-term home healthcare and hospitalized at a single center with pneumonia between October 2010 and September 2013 was conducted, and their clinical characteristics were compared with non-bedridden community-acquired pneumonia (CAP) patients. A total of 131 CAP patients with PS 3-4, and 400 CAP patients with PS 0-2 were evaluated. The PS 3-4 patients were older, and exhibited a higher frequency of underlying diseases. Aspiration was thought to be associated with pneumonia in 77.1% of the PS 3-4 patients. Streptococcus pneumoniae was the leading pathogen in both groups, whereas the frequency of streptococci and polymicrobial infections was higher in the PS 3-4 group. The incidence of multidrug-resistant pathogens such as methicillin-resistant Staphylococcus aureus (MRSA) or Pseudomonas aeruginosa was lower than in previous healthcare-associated pneumonia reports. The in-hospital mortality and recurrence rates were significantly higher in the PS 3-4 group than in the good PS group (17.6% vs. 6.0%, p < 0.001 and 15.3% vs. 7.5%, p = 0.008, respectively). The clinical characteristics of pneumonia in poor PS patients were similar to healthcare-associated pneumonia (HCAP), except for the frequency of drug-resistant pathogens. Hence, it might be beneficial to categorize pneumonia in home residents with poor PS separately from pneumonia in CAP patients who were previously healthy or experienced mild comorbidities. Copyright © 2015 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

S-carboxymethylcysteine inhibits adherence of Streptococcus pneumoniae to human alveolar epithelial cells.

Science.gov (United States)

Sumitomo, Tomoko; Nakata, Masanobu; Yamaguchi, Masaya; Terao, Yutaka; Kawabata, Shigetada

2012-01-01

Streptococcus pneumoniae is a major pathogen of respiratory infections that utilizes platelet-activating factor receptor (PAFR) for firm adherence to host cells. The mucolytic agent S-carboxymethylcysteine (S-CMC) has been shown to exert inhibitory effects against infection by several respiratory pathogens including S. pneumoniae in vitro and in vivo. Moreover, clinical studies have implicated the benefits of S-CMC in preventing exacerbation of chronic obstructive pulmonary disease, which is considered to be related to respiratory infections. In this study, to assess whether the potency of S-CMC is attributable to inhibition of pneumococcal adherence to host cells, an alveolar epithelial cell line stimulated with interleukin-1α was used as a model of inflamed epithelial cells. Despite upregulation of PAFR by inflammatory activation, treatment with S-CMC efficiently inhibited pneumococcal adherence to host epithelial cells. In order to gain insight into the inhibitory mechanism, the effects of S-CMC on PAFR expression were also investigated. Following treatment with S-CMC, PAFR expression was reduced at both mRNA and post-transcriptional levels. Interestingly, S-CMC was also effective in inhibiting pneumococcal adherence to cells transfected with PAFR small interfering RNAs. These results indicate S-CMC as a probable inhibitor targeting numerous epithelial receptors that interact with S. pneumoniae.

Impact of carbapenem resistance on the outcome of patients' hospital-acquired bacteraemia caused by Klebsiella pneumoniae.

Science.gov (United States)

Hussein, K; Raz-Pasteur, A; Finkelstein, R; Neuberger, A; Shachor-Meyouhas, Y; Oren, I; Kassis, I

2013-04-01

Carbapenem-resistant Enterobacteriaceae, especially Klebsiella spp., have become a major health problem recently worldwide. Since 2006 the incidence of carbapenem-resistant Klebsiella pneumoniae (CRKP) infections has increased substantially in Israel. Bloodstream infections (BSIs) caused by these strains have been associated with high rates of treatment failure and mortality. This study was designed to identify risk factors for carbapenem resistance among patients with healthcare-related (HCR) K. pneumoniae bacteraemia and predictors of mortality associated with HCR-CRKP bacteraemia compared with carbapenem-susceptible K. pneumoniae (CSKP). In this retrospective case-control study, all cases of K. pneumoniae bacteraemia during 2006-2008 were identified. Resistance patterns, underlying morbidities, risk factors for drug resistance and mortality rates were compared for patients with CRKP and CSKP bacteraemia. Two hundred and fourteen patients with CSKP bacteraemia were compared with 103 patients with CRKP bacteraemia. Severe, chronic comorbidities and prior antibiotic use were more frequent among patients with CRKP bacteraemia. On multivariate analysis prior use of macrolides and antibiotic exposure for ≥14 days remained the only independent factors associated with CRKP bacteraemia. Mortality rates of CRKP patients were significantly higher than those of CSKP patients. On multivariate analyses: bedridden status, chronic liver disease, Charlson comorbidity index ≥5, mechanical ventilation, and haemodialysis remained independently associated with mortality among patients with K. pneumoniae bacteraemia. Carbapenem resistance was not a risk factor for mortality. Previous antibiotic exposure is a risk factor for CRKP-BSI. Mortality among patients with K. pneumoniae bacteraemia is associated with serious comorbidities, but not with carbapenem resistance. Copyright © 2012 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

A Cross-sectional Survey Assessing Carriage of Streptococcus pneumoniae in a Healthy Population in Xinjiang Uygur Autonomous Region of China.

Science.gov (United States)

Xie, Na; Chen, Zhao Yun; Chen, Tao; Zhu, Bing Qing; Xu, Li; Gao, Yuan; Zhang, Ai Yu; Zhao, Pan; Liu, Ji Wen; Shao, Zhu Jun

2018-03-01

The carriage rate and serotype distribution of Streptococcus pneumoniae (S. pneumoniae) in a healthy population in China remains unclear. In this study, we collected the oropharyngeal swabs from 513 individuals in Xinjiang, China. Real-time PCR targeting the lytA gene and 12 serotypes were assessed to identify S. pneumoniae carriage. The total carriage rate of S. pneumoniae was 70.4% (361/513). The most prevalent serotypes were 19B/F, 18B/C, 5, and 6A/B. The highest carriage rate of S. pneumoniae was noted in children aged 6-10 years (88.6%), which merits further attention. The co-colonization rate of two or more S. pneumoniae serotypes was 79.8% (264/331). This study aimed to investigate the baseline pneumococcal carriage rate among healthy individuals in China to improve our understanding of the epidemiology of S. pneumoniae. Copyright © 2018 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

New Aspects of the Interplay between Penicillin Binding Proteins, murM, and the Two-Component System CiaRH of Penicillin-Resistant Streptococcus pneumoniae Serotype 19A Isolates from Hungary.

Science.gov (United States)

Schweizer, Inga; Blättner, Sebastian; Maurer, Patrick; Peters, Katharina; Vollmer, Daniela; Vollmer, Waldemar; Hakenbeck, Regine; Denapaite, Dalia

2017-07-01

The Streptococcus pneumoniae clone Hungary 19A -6 expresses unusually high levels of β-lactam resistance, which is in part due to mutations in the MurM gene, encoding a transferase involved in the synthesis of branched peptidoglycan. Moreover, it contains the allele ciaH232 , encoding the histidine kinase CiaH (M. Müller, P. Marx, R. Hakenbeck, and R. Brückner, Microbiology 157:3104-3112, 2011, https://doi.org/10.1099/mic.0.053157-0). High-level penicillin resistance primarily requires the presence of low-affinity (mosaic) penicillin binding protein (PBP) genes, as, for example, in strain Hu17, a closely related member of the Hungary 19A -6 lineage. Interestingly, strain Hu15 is β-lactam sensitive due to the absence of mosaic PBPs. This unique situation prompted us to investigate the development of cefotaxime resistance in transformation experiments with genes known to play a role in this phenotype, pbp2x , pbp1a , murM , and ciaH , and penicillin-sensitive recipient strains R6 and Hu15. Characterization of phenotypes, peptidoglycan composition, and CiaR-mediated gene expression revealed several novel aspects of penicillin resistance. The murM gene of strain Hu17 ( murM Hu17 ), which is highly similar to murM of Streptococcus mitis , induced morphological changes which were partly reversed by ciaH232. murM Hu17 conferred cefotaxime resistance only in the presence of the pbp2x o f strain Hu17 ( pbp2x Hu17 ). The ciaH232 allele contributed to a remarkable increase in cefotaxime resistance in combination with pbp2x Hu17 and pbp1a of strain Hu17 ( pbp1a Hu17 ), accompanied by higher levels of expression of CiaR-regulated genes, documenting that ciaH232 responds to PBP1a Hu17 -mediated changes in cell wall synthesis. Most importantly, the proportion of branched peptides relative to the proportion of linear muropeptides increased in cells containing mosaic PBPs, suggesting an altered enzymatic activity of these proteins. Copyright © 2017 Schweizer et al.

The putative proteinase maturation protein A of Streptococcus pneumoniae is a conserved surface protein with potential to elicit protective immune responses

NARCIS (Netherlands)

K. Overweg (Karin); A. Kerr; M. Sluijter (Marcel); M.H. Jackson; T.J. Mitchell; A.P. de Jong; R. de Groot (Ronald); P.W.M. Hermans (Peter)

2000-01-01

textabstractSurface-exposed proteins often play an important role in the interaction between pathogenic bacteria and their host. We isolated a pool of hydrophobic, surface-associated proteins of Streptococcus pneumoniae. The opsonophagocytic activity of hyperimmune

Effect of decreased BCAA synthesis through disruption of ilvC gene on the virulence of Streptococcus pneumoniae.

Science.gov (United States)

Kim, Gyu-Lee; Lee, Seungyeop; Luong, Truc Thanh; Nguyen, Cuong Thach; Park, Sang-Sang; Pyo, Suhkneung; Rhee, Dong-Kwon

2017-08-01

Streptococcus pneumoniae (pneumococcus) is responsible for significant morbidity and mortality worldwide. It causes a variety of life-threatening infections such as pneumonia, bacteremia, and meningitis. In bacterial physiology, the metabolic pathway of branched-chain amino acids (BCAAs) plays an important role in virulence. Nonetheless, the function of IlvC, one of the enzymes involved in the biosynthesis of BCAAs, in S. pneumoniae remains unclear. Here, we demonstrated that downregulation of BCAA biosynthesis by ilvC ablation can diminish BCAA concentration and expression of pneumolysin (Ply) and LytA, and subsequently attenuate virulence. Infection with an ilvC mutant showed significantly reduced mortality and colonization in comparison with strain D39 (serotype 2, wild type), suggesting that ilvC can potentiate S. pneumoniae virulence due to adequate BCAA synthesis. Taken together, these results suggest that the function of ilvC in BCAA synthesis is essential for virulence factor and could play an important role in the pathogenesis of respiratory infections.

Dalbavancin Activity When Tested against Streptococcus pneumoniae Isolated in Medical Centers on Six Continents (2011 to 2014).

Science.gov (United States)

Jones, Ronald N; Schuchert, Jason E; Mendes, Rodrigo E

2016-06-01

Dalbavancin, a novel lipoglycopeptide, was approved for use in 2014 by regulatory agencies in the United States and Europe for the treatment of skin and skin structure infections. The activity of dalbavancin was also widely assessed by determination of its activity against Streptococcus pneumoniae clinical isolates collected from patients on six continents monitored during two time intervals (2011 to 2013 and 2014). A total of 18,186 pneumococcal isolates were obtained from 49 nations and submitted to a monitoring laboratory as part of the SENTRY Antimicrobial Surveillance Program for reference susceptibility testing. The potency of dalbavancin against S. pneumoniae was consistent across the years that it was monitored, with the MIC50 and MIC90 being 0.015 and 0.03 μg/ml, respectively, and all isolates were inhibited by ≤0.12 μg/ml. The activity of dalbavancin was not adversely influenced by nonsusceptibility to β-lactams (ceftriaxone or penicillin), macrolides, clindamycin, fluoroquinolones, or tetracyclines or multidrug resistance (MDR). Regional variations in dalbavancin activity were not detected, but S. pneumoniae strains isolated in the Asia-Pacific region were more likely to be nonsusceptible to penicillin and ceftriaxone as well as to be MDR than strains isolated in North or South America and Europe. Direct comparisons of potency illustrated that dalbavancin (MIC50 and MIC90, 0.015 and 0.03 μg/ml, respectively) was 16-fold or more active than vancomycin (MIC50, 0.25 μg/ml), linezolid (MIC50, 1 μg/ml), levofloxacin (MIC50, 1 μg/ml), ceftriaxone (MIC90, 1 μg/ml), and penicillin (MIC90, 2 μg/ml). In conclusion, dalbavancin had potent and consistent activity against this contemporary (2011 to 2014) collection of S. pneumoniae isolates. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Genomic Characterization of Nonclonal mcr-1-Positive Multidrug-Resistant Klebsiella pneumoniae from Clinical Samples in Thailand.

Science.gov (United States)

Srijan, Apichai; Margulieux, Katie R; Ruekit, Sirigade; Snesrud, Erik; Maybank, Rosslyn; Serichantalergs, Oralak; Kormanee, Rosarin; Sukhchat, Prawet; Sriyabhaya, Jossin; Hinkle, Mary; Crawford, John M; McGann, Patrick; Swierczewski, Brett E

2018-05-01

Multidrug-resistant Klebsiella pneumoniae strains are one of the most prevalent causes of nosocomial infections and pose an increasingly dangerous public health threat. The lack of remaining treatment options has resulted in the utilization of older drug classes, including colistin. As a drug of last resort, the discovery of plasmid-mediated colistin resistance by mcr-1 denotes the potential development of pandrug-resistant bacterial pathogens. To address the emergence of the mcr-1 gene, 118 gram-negative Enterobacteriaceae isolated from clinical samples collected at Queen Sirikit Naval Hospital in Chonburi, Thailand were screened for colistin resistance using automated antimicrobial susceptibility testing and conventional PCR screening. Two K. pneumoniae strains, QS17-0029 and QS17-0161, were positive for mcr-1, and both isolates were sequenced to closure using short- and long-read whole-genome sequencing. QS17-0029 carried 16 antibiotic resistance genes in addition to mcr-1, including 2 carbapenemases, bla NDM-1 and bla OXA-232 . QS17-0161 carried 13 antibiotic resistance genes in addition to mcr-1, including the extended-spectrum β-lactamase bla CTX-M-55 . Both isolates carried multiple plasmids, but mcr-1 was located alone on highly similar 33.9 Kb IncX4 plasmids in both isolates. The IncX4 plasmid shared considerable homology to other mcr-1-containing IncX4 plasmids. This is the first report of a clinical K. pneumoniae strain from Thailand carrying mcr-1 as well as the first strain to simultaneously carry mcr-1 and multiple carbapenemase genes (QS17-0029). The identification and characterization of these isolates serves to highlight the urgent need for continued surveillance and intervention in Southeast Asia, where extensively drug-resistant pathogens are being increasingly identified in hospital-associated infections.

Evolution and Diversity of the Antimicrobial Resistance Associated Mobilome in Streptococcus suis: A Probable Mobile Genetic Elements Reservoir for Other Streptococci.

Science.gov (United States)

Huang, Jinhu; Ma, Jiale; Shang, Kexin; Hu, Xiao; Liang, Yuan; Li, Daiwei; Wu, Zuowei; Dai, Lei; Chen, Li; Wang, Liping

2016-01-01

Streptococcus suis is a previously neglected, newly emerging multidrug-resistant zoonotic pathogen. Mobile genetic elements (MGEs) play a key role in intra- and interspecies horizontal transfer of antimicrobial resistance (AMR) determinants. Although, previous studies showed the presence of several MGEs, a comprehensive analysis of AMR-associated mobilome as well as their interaction and evolution has not been performed. In this study, we presented the AMR-associated mobilome and their insertion hotspots in S. suis . Integrative conjugative elements (ICEs), prophages and tandem MGEs were located at different insertion sites, while 86% of the AMR-associated MGEs were inserted at rplL and rum loci. Comprehensive analysis of insertions at rplL and rum loci among four pathogenic Streptococcus species ( Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes , and S. suis ) revealed the existence of different groups of MGEs, including Tn5252, ICE Sp 1108, and TnGBS2 groups ICEs, Φm46.1 group prophage, ICE_ICE and ICE_prophage tandem MGEs. Comparative ICE genomics of ICE Sa 2603 family revealed that module exchange and acquisition/deletion were the main mechanisms in MGEs' expansion and evolution. Furthermore, the observation of tandem MGEs reflected a novel mechanism for MGE diversity. Moreover, an in vitro competition assay showed no visible fitness cost was observed between different MGE-carrying isolates and a conjugation assay revealed the transferability of ICE Sa 2603 family of ICEs. Our statistics further indicated that the prevalence and diversity of MGEs in S. suis is much greater than in other three species which prompted our hypothesis that S. suis is probably a MGEs reservoir for other streptococci. In conclusion, our results showed that acquisition of MGEs confers S. suis not only its capability as a multidrug resistance pathogen, but also represents a paradigm to study the modular evolution and matryoshkas of MGEs.

Evolution and diversity of the antimicrobial resistance associated mobilome in Streptococcus suis: a probable mobile genetic elements reservoir for other streptococci

Directory of Open Access Journals (Sweden)

Jinhu Huang

2016-10-01

Full Text Available Streptococcus suis is a previously neglected, newly emerging multidrug-resistant zoonotic pathogen. Mobile genetic elements (MGEs play a key role in intra- and interspecies horizontal transfer of antimicrobial resistance (AMR determinants. Although previous studies showed the presence of several MGEs, a comprehensive analysis of AMR-associated mobilome as well as their interaction and evolution has not been performed. In this study, we presented the AMR-associated mobilome and their insertion hotspots in S. suis. Integrative conjugative elements (ICEs, prophages and tandem MGEs were located at different insertion sites, while 86% of the AMR-associated MGEs were inserted at rplL and rum loci. Comprehensive analysis of insertions at rplL and rum loci among four pathogenic Streptococcus species (Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, and S. suis revealed the existence of different groups of MGEs, including Tn5252, ICESp1108, and TnGBS2 groups ICEs, Φm46.1 group prophage, ICE_ICE and ICE_prophage tandem MGEs. Comparative ICE genomics of ICESa2603 family revealed that module exchange and acquisition/deletion were the main mechanisms in MGEs’ expansion and evolution. Furthermore, the observation of tandem MGEs reflected a novel mechanism for MGE diversity. Moreover, an in vitro competition assay showed no visible fitness cost was observed between different MGE-carrying isolates and a conjugation assay revealed the transferability of ICESa2603 family of ICEs. Our statistics further indicated that the prevalence and diversity of MGEs in S. suis is much greater than in other three species which prompted our hypothesis that S. suis is probably a MGEs reservoir for other streptococci. In conclusion, our results showed that acquisition of MGEs confers S. suis not only its capability as a multidrug resistance pathogen, but also represents a paradigm to study the modular evolution and matryoshkas of MGEs.

Duodenoscope-Related Outbreak of a Carbapenem-Resistant Klebsiella pneumoniae Identified Using Advanced Molecular Diagnostics.

Science.gov (United States)

Humphries, Romney M; Yang, Shuan; Kim, Stephen; Muthusamy, Venkatara Raman; Russell, Dana; Trout, Alisa M; Zaroda, Teresa; Cheng, Quen J; Aldrovandi, Grace; Uslan, Daniel Zachary; Hemarajata, Peera; Rubin, Zachary Aaron

2017-10-01

Carbapenem-resistant Klebsiella pneumoniae infections are increasingly prevalent in North American hospitals. We describe an outbreak of carbapenem-resistant K. pneumoniae containing the blaOXA-232 gene transmitted by contaminated duodenoscopes during endoscopic retrograde cholangiopancreatography (ERCP) procedures. An outbreak investigation was performed when 9 patients with blaOXA-232 carbapenem-resistant K. pneumoniae infections were identified at a tertiary care hospital. The investigation included 2 case-control studies, review of duodenoscope reprocessing procedures, and culture of devices. Carbapenem-resistant Enterobacteriacieae (CRE) isolates were evaluated with polymerase chain reaction analysis for carbapenemase genes, and isolates with the blaOXA-232 gene were subjected to whole-genome sequencing and chromosome single-nucleotide polymorphism analysis. On recognition of ERCP as a key risk factor for infection, targeted patient notification and CRE screening cultures were performed. Molecular testing ultimately identified 17 patients with blaOxa-232 carbapenem-resistant K. pneumoniae isolates, including 9 with infections, 7 asymptomatic carriers who had undergone ERCP, and 1 additional patient who had been hospitalized in India and was probably the initial carrier. Two case-control studies established a point-source outbreak associated with 2 specific duodenoscopes. A field investigation of the use, reprocessing, and storage of deuodenoscopes did not identify deviations from US Food and Drug Administration or manufacturer recommendations for reprocessing. This outbreak demonstrated the previously underappreciated potential for duodenoscopes to transmit disease, even after undergoing high-level disinfection according to manufacturers' guidelines.

Predictors of Pseudomonas and methicillin-resistant Staphylococcus aureus in hospitalized patients with healthcare-associated pneumonia.

Science.gov (United States)

Metersky, Mark L; Frei, Christopher R; Mortensen, Eric M

2016-01-01

Patients with healthcare-associated pneumonia (HCAP) are at high risk of infection with multidrug-resistant (MDR) pathogens. Factors discriminating infection with MDR Gram-negative (MDR-GN) organism from infection with methicillin-resistant Staphylococcus aureus (MRSA) are not well understood and patients are often treated for both organisms. This study was performed to determine risk factors predicting pneumonia due to Pseudomonas versus MRSA. Veterans age ≥65 hospitalized with HCAP between 2002 and 2012 were identified from the Veterans Affairs administrative databases. Patients were identified with Pseudomonas pneumonia, MRSA pneumonia or neither according to the International Classification of Diseases, 9th Revision, Clinical Modification codes. We assessed unadjusted and adjusted associations of patient characteristics and HCAP due to Pseudomonas or MRSA. Of the 61,651 patients with HCAP, 1156 (1.9%) were diagnosed with Pseudomonas pneumonia, 641 (1.0%) with MRSA pneumonia and 59,854 (97.1%) with neither. MRSA pneumonia was positively associated with male gender, age >74, diabetes, chronic obstructive pulmonary disease (COPD), recent nursing home or hospital stay, recent exposure to fluoroquinolone or antibiotics treating Gram-positive organisms, and severe pneumonia. MRSA pneumonia was negatively associated with complicated diabetes. Pseudomonas pneumonia was positively associated with recent hospital stay, immunocompromise, COPD, hemiplegia, recent exposure to inhaled corticosteroids, β-lactam/cephalosporin/carbapenem antibiotics, antibiotics against Gram-positive organisms, 'other antibiotics' and severe pneumonia. Pseudomonas pneumonia was negatively associated with age >84, higher socioeconomic status, drug abuse and diabetes. Patient characteristics may assist in identifying patients at risk for HCAP due to Pseudomonas or MRSA. © 2015 Asian Pacific Society of Respirology.

Clonal emergence of Klebsiella pneumoniae ST14 co-producing OXA-48-type and NDM carbapenemases with high rate of colistin resistance in Dubai, United Arab Emirates.

Science.gov (United States)

Moubareck, Carole Ayoub; Mouftah, Shaimaa F; Pál, Tibor; Ghazawi, Akela; Halat, Dalal H; Nabi, Anju; AlSharhan, Mouza A; AlDeesi, Zulfa O; Peters, Christabel C; Celiloglu, Handan; Sannegowda, Manjunath; Sarkis, Dolla K; Sonnevend, Ágnes

2018-03-09

Few studies have addressed the molecular epidemiology of carbapenem resistant Enterobacteriaceae (CRE) isolates in the Arabian Peninsula, and such investigations have been missing from Dubai, a major economical, tourism and medical centre of the region. The antibiotic susceptibility, the carbapenemase type produced, and the clonality of 89 CRE strains isolated in five major Dubai hospitals in June 2015 - June 2016 were determined. Thirty three percent of the collection of 70 K. pneumoniae, 13 E. coli and 6 other Enterobacteriaceae were extremely drug resistant, 27% were resistant to colistin, and 4.5% (four K. pneumoniae isolates) were resistant to all antibiotics tested. The colistin resistance rate in K. pneumoniae was 31.4%. None of the isolates carried mobile colistin resistance genes. Seventy-seven isolates produced carbapenemase: 53.3% OXA-48-like, 24.7% NDM, and 22.1% both OXA-48-like and NDM, respectively. PFGE clustered 50% of K. pneumoniae into a 35-membered group, which showed significant association with double carbapenemase production, with extreme drug resistance, and with being isolated from Emirati patients. Members of the cluster belonged to sequence type ST14. The rate of colistin resistance in K. pneumoniae ST14 was 37.1% vs. 27.1% of K. pneumoniae isolates outside of the cluster. Two of the panresistant K. pneumoniae isolates also belonged to ST14, whereas the other two were ST15 and ST231, respectively. In conclusion, beyond the overall high colistin resistance rate in CRE, the emergence of a highly resistant clone of K. pneumoniae ST14 in all Dubai hospitals investigated is a serious problem requiring immediate attention. Copyright © 2018. Published by Elsevier B.V.

[Increasing incidence of community-acquired pneumonia caused by atypical microorganisms].

Science.gov (United States)

Tazón-Varela, M A; Alonso-Valle, H; Muñoz-Cacho, P; Gallo-Terán, J; Piris-García, X; Pérez-Mier, L A

2017-09-01

Knowing the most common microorganisms in our environment can help us to make proper empirical treatment decisions. The aim is to identify those microorganisms causing community-acquired pneumonia. An observational, descriptive and prospective study was conducted, including patients over 14 years with a clinical and radiographic diagnosis of community-acquired pneumonia during a 383 consecutive day period. A record was made of sociodemographic variables, personal history, prognostic severity scales, progress, and pathogenic agents. The aetiological diagnosis was made using blood cultures, detection of Streptococcus pneumoniae and Legionella pneumophila urinary antigens, sputum culture, influenza virus and Streptococcus pyogenes detection. Categorical variables are presented as absolute values and percentages, and continuous variables as their means and standard deviations. Of the 287 patients included in the study (42% women, mean age 66±22 years), 10.45% died and 70% required hospital admission. An aetiological diagnosis was achieved in 43 patients (14.98%), with 16 microorganisms found in 59 positive samples. The most frequently isolated pathogen was Streptococcus pneumonia (24/59, 41%), followed by gram-negative enteric bacilli, Klebsiella pneumonia, Escherichia coli, Serratia marcescens and Enterobacter cloacae isolated in 20% of the samples (12/59), influenza virus (5/59, 9%), methicillin-resistant Staphylococcus aureus (3/59, 5%), Pseudomonas aeruginosa (2/59, 3%), Moraxella catarrhalis (2/59, 3%), Legionella pneumophila (2/59, 3%), and Haemophilus influenza (2/59, 3%). Polymicrobial infections accounted for 14% (8/59). A high percentage of atypical microorganisms causing community-acquired pneumonia were found. Copyright © 2016 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España, S.L.U. All rights reserved.

Meningitis and pneumonia in Guatemalan children: the importance of Haemophilus influenzae type b and Streptococcus pneumoniae Meningitis y neumonía en niños guatemaltecos: importancia de Haemophilus influenzae tipo b y de Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Edwin J. Asturias

2003-12-01

Full Text Available OBJECTIVE: To determine the epidemiology of Haemophilus influenzae type b (Hib and Streptococcus pneumoniae invasive infections in hospitalized Guatemalan children. This is an important issue since Hib vaccine has not been incorporated into the routine immunization program in Guatemala and information from hospital records in 1995 indicated a low incidence of Hib and S. pneumoniae as causes of meningitis and invasive infections. METHODS: Children who were hospitalized in Guatemala City with clinical signs compatible with bacterial infections were evaluated for evidence of Hib or S. pneumoniae infection. Normally sterile body fluids were cultured, and antigen detection was performed on cerebrospinal fluid (CSF and pleural fluid. RESULTS: Of 1 203 children 1-59 months of age hospitalized over a 28-month period, 725 of them (60.3% had a primary diagnosis of pneumonia, 357 (29.7% of meningitis, 60 (5.0% of cellulitis, and 61 (5.1% of sepsis and other conditions. Hib was identified in 20.0% of children with meningitis and S. pneumoniae in 12.9%. The average annual incidence of Hib meningitis was 13.8 cases per 100 000 children under 5 years of age, and 32.4% of meningitides caused by Hib and 58.7% of S. pneumoniae meningitides occurred prior to 6 months of age. Case fatality rates were 14.1%, 37.0%, and 18.0%, respectively, for children with Hib, S. pneumoniae, and culture-negative and antigen-negative meningitis. Prior antibiotic therapy was common and was associated with significant reductions in CSF-culture-positive results for children with other evidence of Hib or S. pneumoniae meningitis. CONCLUSIONS: Improvements in case detection, culture methods, and latex agglutination for antigen detection in CSF resulted in identification of Hib and S. pneumoniae as important causes of severe disease in Guatemalan children. Using a cutoff of > 10 white blood cells per cubic millimeter in CSF would improve the sensitivity for detection of bacterial

Uptake of extracellular DNA: Competence induced pili in natural transformation of Streptococcus pneumoniae

Science.gov (United States)

Muschiol, Sandra; Balaban, Murat; Normark, Staffan; Henriques-Normark, Birgitta

2015-01-01

Transport of DNA across bacterial membranes involves complex DNA uptake systems. In Gram-positive bacteria, the DNA uptake machinery shares fundamental similarities with type IV pili and type II secretion systems. Although dedicated pilus structures, such as type IV pili in Gram-negative bacteria, are necessary for efficient DNA uptake, the role of similar structures in Gram-positive bacteria is just beginning to emerge. Recently two essentially very different pilus structures composed of the same major pilin protein ComGC were proposed to be involved in transformation of the Gram-positive bacterium Streptococcus pneumoniae – one is a long, thin, type IV pilus-like fiber with DNA binding capacity and the other one is a pilus structure that was thicker, much shorter and not able to bind DNA. Here we discuss how competence induced pili, either by pilus retraction or by a transient pilus-related opening in the cell wall, may mediate DNA uptake in S. pneumoniae. PMID:25640084

Purification, crystallization and preliminary X-ray analysis of 3-hydroxy-3-methylglutaryl-coenzyme A reductase of Streptococcus pneumoniae

International Nuclear Information System (INIS)

Zhang, Liping; Feng, Lingling; Zhou, Li; Gui, Jie; Wan, Jian; Hu, Xiaopeng

2010-01-01

3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase of Streptococcus pneumoniae has been cloned, overexpressed and purified to homogeneity using Ni–NTA affinity chromatography. Crystals were obtained using the hanging-drop vapour-diffusion method. Class II 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductases are potential targets for novel antibiotic development. In order to obtain a precise structural model for use in virtual screening and inhibitor design, HMG-CoA reductase of Streptococcus pneumoniae was cloned, overexpressed and purified to homogeneity using Ni–NTA affinity chromatography. Crystals were obtained using the hanging-drop vapour-diffusion method. A complete data set was collected from a single frozen crystal on a home X-ray source. The crystal diffracted to 2.3 Å resolution and belonged to the orthorhombic space group C222 1 , with unit-cell parameters a = 773.4836, b = 90.3055, c = 160.5592 Å, α = β = γ = 90°. Assuming the presence of two molecules in the asymmetric unit, the solvent content was estimated to be 54.1% (V M = 2.68 Å 3 Da −1 )

CLINICAL ISOLATES OF MECA, METHICILLIN, VANCOMYCIN RESISTANCE S. AUREUS; ESBLs PRODUCING K.PNEUMONIA, E.COLI, P. AUREGENOSA FROM VARIOUS CLINICAL SOURCE AND ITS ANTIMICROBIAL RESISTANCE PATTERNS

Directory of Open Access Journals (Sweden)

Ismail Mahmud Ali, Amirthalingam R

2015-01-01

Full Text Available Background and Objective: Antimicrobial resistance has turned into a key medical and public health crisis globally since the injudicious use of magic bullets (drugs. Aim of this study is focused on the clinical isolate and their percentages of resistant to antibiotics in gram positive bacteria such as MRSA, VRSA, and MSSA are common causes of nosocomical, skin structure infections, bacteremia and infection of other systems; ESBLs producing Enterobacteriaceae (E. coli, Klebsiella spp. is common agent of urinary tract, bloodstream, pulmonary and intra-abdominal infections and carbapenem resistant P. aeruginosa with its complete antimicrobial patterns which are currently practiced in this population. Methods: There are one hundred and fourteen (114 various clinical isolates, isolated from various clinical samples like throat swab, urine, pus, sputum, and blood culture, identified as specific isolate with resistance patterns were analyzed by BD phoenix-100 the auto analyzer. Results: Off 114 clinical isolate, 6 mecA-mediated resistance (cefoxitin>8mgc/ml, 11 methicillin resistance, 18 β lactam/βlactamase inhibitor, 12 methicillin sensitive and 3 vancomycin (>16µg/ml resistance S. aureus have been isolated from overall 50 isolate of S.aureus. In addition, there are 27 P.aeruginosa, 15 ESBLs from overall of 25 K. pneumoniae and 7 ESBLs out of 12 Escherichia coli species have been isolated. The resistance and susceptibility pattern percentages have been graphically represented for each isolates. Conclusion: Current study revealed that the drug classes of β lactam/βlactamase inhibitor having high resistance rate with S.aureus, P.aureginosa, K. pneumoniae and E. coli isolate. Also, some of other drug classes such as cepham and tetracycline having higher resistance rate with P.aureginosa and K.pneumoniae. In addition, the vancomycin resistances S. aureus have been isolated and reported as first time in this population.

Population biology of Streptococcus pneumoniae in West Africa: multilocus sequence typing of serotypes that exhibit different predisposition to invasive disease and carriage.

Directory of Open Access Journals (Sweden)

Eric S Donkor

Full Text Available Little is known about the population biology of Streptococcus pneumoniae in developing countries, although the majority of pneumococcal infections occur in this setting. The aim of the study was to apply MLST to investigate the population biology of S. pneumoniae in West Africa.Seventy three invasive and carriage S. pneumoniae isolates from three West African countries including The Gambia, Nigeria and Ghana were investigated. The isolates covered seven serotypes (1, 3, 5, 6A, 11, 14, 23F and were subjected to multilocus sequence typing and antibiotic susceptibility testing.Overall, 50 different sequence types (STs were identified, of which 38% (29 were novel. The most common ST was a novel clone-ST 4012 (6.5%, and some clones including STs 913, 925, 1737, 2160 and 3310 appeared to be specific to the study region. Two STs including ST 63 and ST 4012 were associated with multiple serotypes indicating a history of serotype switching. ST 63 was associated with serotypes 3 and 23F, while ST 4012 was associated with serotypes 6A and 23. eBURST analyses using the stringent 6/7 identical loci definition grouped the 50 STs into 5 clonal complexes and 65 singletons, expressing a high level of genetic diversity among the isolates. Compared to the other serotypes, serotypes 1 and 5 isolates appeared to be more clonal. Internationally recognized antibiotic resistant clones of S. pneumoniae were generally absent in the population investigated and the only multidrug resistant isolate identified (1/66 belong to the Pneumocococcal Epidemiology Network clone ST 63.The pneumococcal population in West Africa is quite divergent, and serotypes that are common in invasive disease (such as serotypes 1 and 5 are more likely to be clonal than serotypes that are common in carriage.

The response regulator YycF inhibits expression of the fatty acid biosynthesis repressor FabT in Streptococcus pneumoniae

NARCIS (Netherlands)

Mohedano, Maria L.; Amblar, Mónica; La Fuente, De Alicia; Wells, Jerry M.; López, Paloma

2016-01-01

The YycFG (also known as WalRK, VicRK, MicAB, or TCS02) two-component system (TCS) is highly conserved among Gram-positive bacteria with a low G+C content. In Streptococcus pneumoniae the YycF response regulator has been reported to be essential due to its control of pcsB gene expression.

The alpha-tocopherol form of vitamin E reverses age-associated susceptibility to Streptococcus pneumoniae lung infection by modulating pulmonary neutrophil recruitment

Science.gov (United States)

Streptococcus pneumonia infections are an important cause of morbidity and mortality in older patients. Uncontrolled neutrophil-driven pulmonary inflammation exacerbates this disease. To test whether the alpha-tocopherol (alpha-Toc) form of vitamin E, a regulator of immunity, can modulate neutrophil...

The cGAS/STING Pathway Detects Streptococcus pneumoniae but Appears Dispensable for Antipneumococcal Defense in Mice and Humans.

Science.gov (United States)

Ruiz-Moreno, Juan Sebastian; Hamann, Lutz; Jin, Lei; Sander, Leif E; Puzianowska-Kuznicka, Monika; Cambier, John; Witzenrath, Martin; Schumann, Ralf R; Suttorp, Norbert; Opitz, Bastian

2018-03-01

Streptococcus pneumoniae is a frequent colonizer of the upper respiratory tract and a leading cause of bacterial pneumonia. The innate immune system senses pneumococcal cell wall components, toxin, and nucleic acids, which leads to production of inflammatory mediators to initiate and control antibacterial defense. Here, we show that the cGAS (cyclic GMP-AMP [cGAMP] synthase)-STING pathway mediates detection of pneumococcal DNA in mouse macrophages to primarily stimulate type I interferon (IFN) responses. Cells of human individuals carrying HAQ TMEM173 , which encodes a common hypomorphic variant of STING, were largely or partly defective in inducing type I IFNs and proinflammatory cytokines upon infection. Subsequent analyses, however, revealed that STING was dispensable for restricting S. pneumoniae during acute pneumonia in mice. Moreover, explorative analyses did not find differences in the allele frequency of HAQ TMEM173 in nonvaccinated pneumococcal pneumonia patients and healthy controls or an association of HAQ TMEM173 carriage with disease severity. Together, our results indicate that the cGAS/STING pathway senses S. pneumoniae but plays no major role in antipneumococcal immunity in mice and humans. Copyright © 2018 American Society for Microbiology.

TLR-mediated inflammatory responses to Streptococcus pneumoniae are highly dependent on surface expression of bacterial lipoproteins.

Science.gov (United States)

Tomlinson, Gillian; Chimalapati, Suneeta; Pollard, Tracey; Lapp, Thabo; Cohen, Jonathan; Camberlein, Emilie; Stafford, Sian; Periselneris, Jimstan; Aldridge, Christine; Vollmer, Waldemar; Picard, Capucine; Casanova, Jean-Laurent; Noursadeghi, Mahdad; Brown, Jeremy

2014-10-01

Streptococcus pneumoniae infections induce inflammatory responses that contribute toward both disease pathogenesis and immunity, but the host-pathogen interactions that mediate these effects are poorly defined. We used the surface lipoprotein-deficient ∆lgt pneumococcal mutant strain to test the hypothesis that lipoproteins are key determinants of TLR-mediated immune responses to S. pneumoniae. We show using reporter assays that TLR2 signaling is dependent on pneumococcal lipoproteins, and that macrophage NF-κB activation and TNF-α release were reduced in response to the ∆lgt strain. Differences in TNF-α responses between Δlgt and wild-type bacteria were abrogated for macrophages from TLR2- but not TLR4-deficient mice. Transcriptional profiling of human macrophages revealed attenuated TLR2-associated responses to ∆lgt S. pneumoniae, comprising many NF-κB-regulated proinflammatory cytokine and chemokine genes. Importantly, non-TLR2-associated responses were preserved. Experiments using leukocytes from IL-1R-associated kinase-4-deficient patients and a mouse pneumonia model confirmed that proinflammatory responses were lipoprotein dependent. Our data suggest that leukocyte responses to bacterial lipoproteins are required for TLR2- and IL-1R-associated kinase-4-mediated inflammatory responses to S. pneumoniae. Copyright © 2014 The Authors.

Risk factors for cefotaxime resistance in children with pneumonia

OpenAIRE

A. A. Made Sucipta; Ida Bagus Subanada; Samik Wahab

2012-01-01

Background Pneumonia is a health problem in developing countries, often caused by bacterial agents. The widespread use of cefotaxime, a third-generation of cephalosporin to increased incidence of resistance to this antibiotic. Several studies have reported on risk factors associated with resistance to cefotaxime. Objective To oidentify risk factors for cefoxime resistence in children with pneumonia. Methods We performed a case-control study at Sanglah Hospital between January 2006-Dec...

LuxS impacts on LytA-dependent autolysis and on competence in Streptococcus pneumoniae.

Science.gov (United States)

Romao, Susana; Memmi, Guido; Oggioni, Marco R; Trombe, Marie-Claude

2006-02-01

The ubiquitous protein LuxS with S-ribosylhomocysteinase activity is involved in S-adenosyl methionine detoxification, C-1 unit recycling and the production of autoinducers that allow the cell to sense and respond to cell density. Independent reports describe the impact of LuxS deficiency on Streptococcus pneumoniae virulence in the mouse. In vitro, LuxS deficiency confers discrete phenotypes. A combined approach using genetic dissection and mixed-culture experiments allowed the involvement of LuxS in the developmental physiology of S. pneumoniae to be investigated. Functional LuxS was found to be related on the one hand to down-regulation of competence, and on the other hand to attenuation of autolysis in cultures entering stationary phase. The competence phenotype of luxS mutant bacteria was complemented by media conditioned by competence-defective ComAB0 bacteria, but not by BSA. The autolytic phenotype was complemented by BSA, but not by conditioned supernatants. It is suggested that the impact of LuxS on competence, but not on autolysis, involves cell-cell communication. The phenotype of luxS mutant strains reveals a hierarchy in the competence regulatory networks of S. pneumoniae.

Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Paterson, Neil G.; Riboldi-Tunicliffe, Alan; Mitchell, Timothy J.; Isaacs, Neil W.

2006-01-01

The choline-binding protein CbpI from S. pneumoniae has been purified and crystallized and diffraction data have been collected to 3.5 Å resolution. The choline-binding protein CbpI from Streptococcus pneumoniae is a 23.4 kDa protein with no known function. The protein has been successfully purified initially using Ni–NTA chromatography and to homogeneity using Q-Sepharose ion-exchange resin as an affinity column. CbpI was crystallized using PEG 3350 as a precipitant and X-ray crystallographic analysis showed that the crystals belonged to the tetragonal space group P4, with unit-cell parameters a = b = 83.31, c = 80.29 Å, α = β = γ = 90°. The crystal contains two molecules in the asymmetric unit with a solvent content of 55.7% (V M = 2.77 Å 3 Da −1 ) and shows a diffraction limit of 3.5 Å

Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae

Energy Technology Data Exchange (ETDEWEB)

Paterson, Neil G., E-mail: neison@chem.gla.ac.uk; Riboldi-Tunicliffe, Alan [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Mitchell, Timothy J. [Division of Infection and Immunity (IBLS), Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Isaacs, Neil W. [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom)

2006-07-01

The choline-binding protein CbpI from S. pneumoniae has been purified and crystallized and diffraction data have been collected to 3.5 Å resolution. The choline-binding protein CbpI from Streptococcus pneumoniae is a 23.4 kDa protein with no known function. The protein has been successfully purified initially using Ni–NTA chromatography and to homogeneity using Q-Sepharose ion-exchange resin as an affinity column. CbpI was crystallized using PEG 3350 as a precipitant and X-ray crystallographic analysis showed that the crystals belonged to the tetragonal space group P4, with unit-cell parameters a = b = 83.31, c = 80.29 Å, α = β = γ = 90°. The crystal contains two molecules in the asymmetric unit with a solvent content of 55.7% (V{sub M} = 2.77 Å{sup 3} Da{sup −1}) and shows a diffraction limit of 3.5 Å.

Multicentre in-vitro evaluation of the susceptibility of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis to ciprofloxacin, clarithromycin, co-amoxiclav and sparfloxacin

NARCIS (Netherlands)

HoogkampKorstanje, JAA; DirksGo, SIS; Kabel, P; Manson, WL; Stobberingh, EE; Vreede, RW; Davies, BI

Seven laboratories, including a reference laboratory, tested the susceptibility of Moraxella catarrhalis, Streptococcus pneumoniae and Haemophilus influenzae strains to ciprofloxacin, clarithromycin, co-amoxiclav and sparfloxacin with the Etest. A total of 976 strains were collected. The results

Characterization of a Multipeptide Lantibiotic Locus in Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Natalie Maricic

2016-01-01

Full Text Available Bacterial communities are established through a combination of cooperative and antagonistic interactions between the inhabitants. Competitive interactions often involve the production of antimicrobial substances, including bacteriocins, which are small antimicrobial peptides that target other community members. Despite the nearly ubiquitous presence of bacteriocin-encoding loci, inhibitory activity has been attributed to only a small fraction of gene clusters. In this study, we characterized a novel locus (the pld locus in the pathogen Streptococcus pneumoniae that drives the production of a bacteriocin called pneumolancidin, which has broad antimicrobial activity. The locus encodes an unusual tandem array of four inhibitory peptides, three of which are absolutely required for antibacterial activity. The three peptide sequences are similar but appear to play distinct roles in regulation and inhibition. A modification enzyme typically found in loci encoding a class of highly modified bacteriocins called lantibiotics was required for inhibitory activity. The production of pneumolancidin is controlled by a two-component regulatory system that is activated by the accumulation of modified peptides. The locus is located on a mobile element that has been found in many pneumococcal lineages, although not all elements carry the pld genes. Intriguingly, a minimal region containing only the genes required for pneumolancidin immunity was found in several Streptococcus mitis strains. The pneumolancidin-producing strain can inhibit nearly all pneumococci tested to date and provided a competitive advantage in vivo. These peptides not only represent a unique strategy for bacterial competition but also are an important resource to guide the development of new antimicrobials.

Evaluation of antibacterial efficacy of anise wastes against some multidrug resistant bacterial isolates

Directory of Open Access Journals (Sweden)

Mohamed Khaled Ibrahim

2017-01-01

Full Text Available Antibiotic resistance in bacteria is becoming a serious problem, especially after the emergence of multidrug-resistant strains. To overcome this problem, new and effective antibacterials or resistance modulators are highly needed and plant kingdom represents a valuable source of these compounds. In this study we investigated the antibacterial and resistance modulatory activity of Aniseeds waste Residue Extract (ASWRE and Star Anise Waste Residue Extract (SAWRE (post-distillation against 100 isolates belonging to two Gram positive (Streptococcus pneumoniae and Staphylococcus aureus and four Gram negative bacteria (Klebsiella pneumoniae, Escherichia coli, Acinetobacter baumannii and Pseudomonas aeruginosa. Phenolic compounds of anise wastes were determined by HPLC. The antibacterial activity of anise waste extracts assays were performed by using inhibition zone diameters, MIC and MBC. Evaluation of synergy interaction between anise waste extracts and certain known antibacterial drugs like Cephradine, Chloramphenicol, Tetracycline and Amoxicillin was carried out using disc diffusion method, MIC and the fractional inhibitory concentrations (FIC. The results showed that HPLC method has been developed for the determination of 25 phenolic compounds from waste extracts. Both ASWRE and SAWRE have significant antibacterial activity against all of the test bacteria. SAWRE was found to have higher amounts of phenolic compounds contents that might be responsible for their comparatively higher antibacteria activity than ASWRE. Irradiation at 10 and 30 kGy did not significantly affect the antibacterial activity of both ASWRE and SAWRE. The combination of anise waste extracts and the tested antibiotics mostly showed synergistic effect. Synergistic interaction was most expressed against Streptococcus pneumoniae (Sp1 and Staphylococcus aureus (Sa1 by Tetracycline and chloramphenicol; Pseudomonas aeruginosa (P2, Klebsiella pneumoniae (K3, Acinetobacter baumannii

Polyamine transporter potABCD is required for virulence of encapsulated but not nonencapsulated Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Haley R Pipkins

Full Text Available Streptococcus pneumoniae is commonly found in the human nasopharynx and is the causative agent of multiple diseases. Since invasive pneumococcal infections are associated with encapsulated pneumococci, the capsular polysaccharide is the target of licensed pneumococcal vaccines. However, there is an increasing distribution of non-vaccine serotypes, as well as nonencapsulated S. pneumoniae (NESp. Both encapsulated and nonencapsulated pneumococci possess the polyamine oligo-transport operon (potABCD. Previous research has shown inactivation of the pot operon in encapsulated pneumococci alters protein expression and leads to a significant reduction in pneumococcal murine colonization, but the role of the pot operon in NESp is unknown. Here, we demonstrate deletion of potD from the NESp NCC1 strain MNZ67 does impact expression of the key proteins pneumolysin and PspK, but it does not inhibit murine colonization. Additionally, we show the absence of potD significantly increases biofilm production, both in vitro and in vivo. In a chinchilla model of otitis media (OM, the absence of potD does not significantly affect MNZ67 virulence, but it does significantly reduce the pathogenesis of the virulent encapsulated strain TIGR4 (serotype 4. Deletion of potD also significantly reduced persistence of TIGR4 in the lungs but increased persistence of PIP01 in the lungs. We conclude the pot operon is important for the regulation of protein expression and biofilm formation in both encapsulated and NCC1 nonencapsulated Streptococcus pneumoniae. However, in contrast to encapsulated pneumococcal strains, polyamine acquisition via the pot operon is not required for MNZ67 murine colonization, persistence in the lungs, or full virulence in a model of OM. Therefore, NESp virulence regulation needs to be further established to identify potential NESp therapeutic targets.

Risk factors for the development of pneumonia in acute psychotropic drugs poisoning

Directory of Open Access Journals (Sweden)

Vučinić Slavica

2005-01-01

Full Text Available Background/Aim. Pneumonia is the most frequent complication in acute psychotropic drugs poisoning, which results in substantial morbidity and mortality, but which also increases the costs of treatment. Risk factors for pneumonia are numerous: age, sex, place of the appearance of pneumonia, severity of underlying disease, airway instrumentation (intubation, reintubation, etc. The incidence of pneumonia varies in poisoning caused by the various groups of drugs. The aim of this study was to determine the incidence and risk factors for pneumonia in the patients with acute psychotropic drugs poisoning. Methods. A group of 782 patients, out of which 614 (78.5% with psychotropic and 168 (21.5% nonpsychotropic drug poisoning were analyzed prospectively during a two-year period. The diagnosis of pneumonia was made according to: clinical presentation, new and persistent pulmonary infiltrates on chest radiography, positive nonspecific parameters of inflammation, and the microbiological confirmation of causative microorganisms. To analyze predisposing risk factors for pneumonia, the following variables were recorded: sex, age, underlying diseases, endotracheal intubation, coma, severity of poisoning with different drugs, histamine H2 blockers, corticosteroids, mechanical ventilation, central venous catheter. The univariate analysis for pneumonia risk factors in all patients, and for each group separately was done. The multivariate analysis was performed using the logistic regression technique. Results. Pneumonia was found in 94 (12.02% of the patients, 86 of which (91.5% in psychotropic and 8 (8.5% in nonpsychotropic drug poisoning. In the psychotropic drug group, pneumonia was the most frequent in antidepressant (47%, and the rarest in benzodiazepine poisoning (3.8%. A statistically significant incidence of pneumonia was found in the patients with acute antidpressant poisoning (p < 0.001. Univariate analysis showed statistical significance for the

A Case of Macrolide-Refractory Mycoplasma pneumoniae Pneumonia in Pregnancy Treated with Garenoxacin

Directory of Open Access Journals (Sweden)

Yoko Matsuda

2017-01-01

Full Text Available Pneumonia in pregnancy is associated with adverse maternal and foetal outcomes, and intensive treatment with appropriate antibiotics is essential. However, cases caused by pathogens that are resistant to antibiotics suitable for the developing foetus are challenging. We herein report a case of macrolide-refractory Mycoplasma pneumoniae pneumonia in pregnancy. A 40-year-old multigravida with twin pregnancy complained of cough and fever at 13 weeks of gestation and was diagnosed with pneumonia. Even though empiric treatment with ceftriaxone and oral azithromycin was started, her condition deteriorated rapidly. The findings of chest computed tomography suggested Mycoplasma pneumoniae pneumonia. Since azithromycin did not work, this strain was considered to be macrolide-refractory. Garenoxacin, an oral quinolone, was selected and was dramatically effective. The use of quinolone could be justified with the emergence of drug-resistant bacterial/atypical pneumonia and in the maternal life-threatening condition.

Capsular Polysaccharide Expression in Commensal Streptococcus Species

DEFF Research Database (Denmark)

Skov Sørensen, Uffe B; Yao, Kaihu; Yang, Yonghong

2016-01-01

Expression of a capsular polysaccharide is considered a hallmark of most invasive species of bacteria, including Streptococcus pneumoniae, in which the capsule is among the principal virulence factors and is the basis for successful vaccines. Consequently, it was previously assumed that capsule....... pneumoniae evolved by import of cps fragments from commensal Streptococcus species, resulting in a mosaic of genes of different origins. The demonstrated antigenic identity of at least eight of the numerous capsular polysaccharide structures expressed by commensal streptococci with recognized serotypes of S...... of Streptococcus pneumoniae and is the basis for successful vaccines against infections caused by this important pathogen. Contrasting with previous assumptions, this study showed that expression of capsular polysaccharides by the same genetic mechanisms is a general property of closely related species...

[INHALED ANTIBIOTICS IN TREATMENT OF NOSOCOMIAL PNEUMONIA].

Science.gov (United States)

Kuzovlev, A N; Moroz, V V; Golubev, A M

2015-01-01

Nosocomial pneumonia is the most common infection in intensive care units. Currently the problem of resistance of noso-comial pathogens to miost of antibiotics is crucial. Using of inhaled antibiotics in combination with intravenous drugs is eff ective and safe method for treatment of nosocomial pneumonia. The literature review describes current opportunities of ihhaled antibiotic therapy of nosocomial pneumonia, descriptions of drugs, the advantages and disadvantages of this treatment. Special attention is paid for using inhaled aminoglycosides for nosocomial pneumonia.

Strain-specific impact of PsaR of Streptococcus pneumoniae on global gene expression and virulence

OpenAIRE

Hendriksen, Wouter T.; Bootsma, Hester J.; van Diepen, Angela; Estevao, Silvia; Kuipers, Oscar P.; de Groot, Ronald; Hermans, Peter W. M.

2009-01-01

Previous studies have indicated that PsaR of Streptococcus pneumoniae is a manganese-dependent regulator, negatively affecting the expression of at least seven genes. Here, we extended these observations by transcriptome and proteome analysis of psaR mutants in strains D39 and TIGR4. The microarray analysis identified three shared PsaR targets: the psa operon, pcpA and prtA. In addition, we found 31 genes to be regulated by PsaR in D39 only, most strikingly a cellobiose-specific phosphotrains...

Antibacterial activity of combined medicinal plants extract against multiple drug resistant strains

Directory of Open Access Journals (Sweden)

Rafiqul Islam

2015-06-01

Full Text Available Objective: To find out the combined antibacterial efficacy of Aegle marmelos, Aphanamixis polystachya, Cuscuta reflexa and Aesclynomene indica against bacterial pathogens. Methods: Antibacterial potency of combined plant extracts has been tested against Bacillus subtilis IFO 3026, Sarcina lutea IFO 3232, Xanthomonas campestris IAM 1671, Escherichia coli IFO 3007, Klebsiella pneumoniae ATTC 10031, Proteus vulgaris MTCC 321 and Pseudomonas denitrificans KACC 32026 by disc diffusion assay. Commercially available standard antibiotic discs were also used to find out antibiotic resistance pattern of test organisms. Results: Among the test organisms, Escherichia coli, Proteus vulgaris, Klebsiella pneumoniae and Proteus denitrificans showed resistance against multiple commercially available antibiotics. On the other hand, these multiple drug resistant organisms showed susceptibility against combined plant extracts. Conclusions: These combined plants extracts showed synergistic antibacterial activity and could lead to new antibacterial drug designing.

Single- and multistep resistance selection studies on the activity of retapamulin compared to other agents against Staphylococcus aureus and Streptococcus pyogenes.

Science.gov (United States)

Kosowska-Shick, Klaudia; Clark, Catherine; Credito, Kim; McGhee, Pamela; Dewasse, Bonifacio; Bogdanovich, Tatiana; Appelbaum, Peter C

2006-02-01

Retapamulin had the lowest rate of spontaneous mutations by single-step passaging and the lowest parent and selected mutant MICs by multistep passaging among all drugs tested for all Staphylococcus aureus strains and three Streptococcus pyogenes strains which yielded resistant clones. Retapamulin has a low potential for resistance selection in S. pyogenes, with a slow and gradual propensity for resistance development in S. aureus.

1Osagie RN, 2 Oseyi FE, 1Eyaufe AA, 3Eigbefoh J., 4Ireye FO ...

African Journals Online (AJOL)

Uwaifoh

2012-07-31

Jul 31, 2012 ... Due to reported incidence of antibiotic resistance, this study ... Streptococcus pneumoniae (35.3%) and Staphylococcus spp ..... Virulence factors, plasmid profiling and curing analysis of multi-drug resistant S. aureus and.

PENICILLIN-BINDING PROTEIN 2X OF STREPTOCOCCUS-PNEUMONIAE - EXPRESSION IN ESCHERICHIA-COLI AND PURIFICATION OF A SOLUBLE ENZYMATICALLY ACTIVE DERIVATIVE

NARCIS (Netherlands)

LAIBLE, G; KECK, W; LURZ, R; MOTTL, H; FRERE, JM; JAMIN, M; HAKENBECK, R

1992-01-01

A 2.5-kb DNA fragment including the structural gene coding for the penicillin-binding protein 2x (PBP 2x) of Streptococcus pneumoniae has been cloned into the vector pJDC9 and expressed in Escherichia coli. Mapping of RNA polymerase binding sites by electron microscopy indicated that the pbpX

Pyruvate oxidase influences the sugar utilization pattern and capsule production in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Sandra M Carvalho

Full Text Available Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence, oxidative stress survival and death in stationary phase. Under semi-aerobic conditions, transcriptomic and metabolite profiling analysis of a spxB mutant grown on glucose showed minor changes compared to the wild type, apart from the significant induction of two operons involved in carbohydrate uptake and processing. This induction leads to a change in the sugar utilization capabilities of the bacterium, as indicated by the analysis of the growth profiles of the D39 parent and spxB mutant on alternative carbohydrates. Metabolic analysis and growth experiments showed that inactivation of SpxB has no effect on the glucose fermentation pattern, except under aerobic conditions. More importantly, we show that mutation of spxB results in the production of increased amounts of capsule, the major virulence factor of S. pneumoniae. Part of this increase can be attributed to induction of capsule operon (cps transcription. Therefore, we propose that S. pneumoniae utilizes pyruvate oxidase as an indirect sensor of the oxygenation of the environment, resulting in the adaption of its nutritional capability and the amount of capsule to survive in the host.

Pyruvate oxidase influences the sugar utilization pattern and capsule production in Streptococcus pneumoniae.

Science.gov (United States)

Carvalho, Sandra M; Farshchi Andisi, Vahid; Gradstedt, Henrik; Neef, Jolanda; Kuipers, Oscar P; Neves, Ana R; Bijlsma, Jetta J E

2013-01-01

Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence, oxidative stress survival and death in stationary phase. Under semi-aerobic conditions, transcriptomic and metabolite profiling analysis of a spxB mutant grown on glucose showed minor changes compared to the wild type, apart from the significant induction of two operons involved in carbohydrate uptake and processing. This induction leads to a change in the sugar utilization capabilities of the bacterium, as indicated by the analysis of the growth profiles of the D39 parent and spxB mutant on alternative carbohydrates. Metabolic analysis and growth experiments showed that inactivation of SpxB has no effect on the glucose fermentation pattern, except under aerobic conditions. More importantly, we show that mutation of spxB results in the production of increased amounts of capsule, the major virulence factor of S. pneumoniae. Part of this increase can be attributed to induction of capsule operon (cps) transcription. Therefore, we propose that S. pneumoniae utilizes pyruvate oxidase as an indirect sensor of the oxygenation of the environment, resulting in the adaption of its nutritional capability and the amount of capsule to survive in the host.

[Antibiotic susceptibility of Staphylococcus aureus and Streptococcus pneumoniae in healthy carrier individuals in primary care in Barcelona area].

Science.gov (United States)

Llor, Carles; Boada, Albert; Pons-Vigués, Mariona; Grenzner, Elisabet; Juvé, Rosa; Almeda, Jesús

2018-01-01

The information available on antibiotic resistance patterns are generally based on specimens from hospitalised individuals. This study was aimed at evaluating the antibiotic resistance rate of nasal carriage strains of Staphylococcus aureus and Streptococcus pneumoniae in healthy individuals, in accordance with age and gender, attended in Primary Care Centres (PCC). Cross-sectional study. Seven PCC in the Barcelona area. Healthy nasal carriers aged 4years or more who did not present with any sign of infectious disease, and had not taken any antibiotic or had been hospitalised in the previous 3months. A total of 3,969 nasal swabs valid for identification were collected between 2010 and 2011 and were sent to one central microbiological laboratory for isolation of both pathogens. Resistance to common antibiotics was determined on the basis of the current European Committee on Antimicrobial Susceptibility Testing guidelines on cut-off points. The prevalence of methicillin-resistant S.aureus was 1.3% (95%CI: 0.5-2.1%), with resistance rates of 87.1% to phenoxymethylpenicillin and 11.6% to azithromycin, with no significant differences with age and gender. A total of 2.4% (95CI%: 0.1-4.7%) of the pneumococcal strains were highly resistant to both phenoxymethylpenicillin and macrolides, whereas the highest resistance rates were to cefaclor (53.3%), followed by tetracycline (20%) and cefuroxime (12.1%). These pathogens have lower resistance rates in the community than in the hospital setting. Primary Care physicians must be more aware of the current antimicrobial resistance, in order to ensure prudent use of antibiotics. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

Directory of Open Access Journals (Sweden)

Helen Hencida Thangamony

2018-01-01

Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

Phosphorylation of the Streptococcus pneumoniae cell wall biosynthesis enzyme MurC by a eukaryotic-like Ser/Thr kinase.

Science.gov (United States)

Falk, Shaun P; Weisblum, Bernard

2013-03-01

Streptococcus pneumoniae contains a single Ser/Thr kinase-phosphatase pair known as StkP-PhpP. Here, we report the interaction of StkP-PhpP with S. pneumoniae UDP-N-acetylmuramoyl:L-alanine ligase, MurC, an enzyme that synthesizes an essential intermediate of the cell wall peptidoglycan pathway. Combinatorial phage display using StkP as target selected the peptide sequence YEVCGSDTVGC as an interacting partner and subsequently confirmed by ELISA. The phage peptide sequence YEVCGSDTVGC aligns closely with the MurC motif spanning S. pneumoniae amino acid coordinates 31-37. We show that MurC is phosphorylated by StkP and that phosphoMurC is dephosphorylated by PhpP. These data suggest a link between StkP-PhpP with the coordinated regulation of cell wall biosynthesis via MurC. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

A European study on the relationship between antimicrobial use and antimicrobial resistance

NARCIS (Netherlands)

Bronzwaer, SLAM; Cars, O; Buchholz, U; Molstad, S; Goettsch, W; Veldhuijzen, IK; Kool, JL; Sprenger, MJW; Degener, JE

In Europe, antimicrobial resistance has been monitored since 1998 by the European Antimicrobial Resistance Surveillance System (EARSS). We examined the relationship between penicillin nonsusceptibility of invasive isolates of Streptococcus pneumoniae and antibiotic sales. Information was collected

Incidence of multidrug-resistant, extensively drug-resistant and pan-drug-resistant bacteria in children hospitalized at Dr. Hasan Sadikin general hospital Bandung Indonesia

Science.gov (United States)

Adrizain, R.; Suryaningrat, F.; Alam, A.; Setiabudi, D.

2018-03-01

Antibiotic resistance has become a global issue, with 700,000 deaths attributable to multidrug-resistance (MDR) occurring each year. Centers for Disease Control and Prevention (CDC) show rapidly increasing rates of infection due to antibiotic-resistant bacteria. The aim of the study isto describe the incidence of MDR, extensively drug-resistant (XDR) and pan drug-resistant (PDR) in Enterococcus spp., Staphylococcus aureus, K. pneumonia, Acinetobacter baumanii, P. aeruginosin, and Enterobacter spp. (ESKAPE) pathogens in children admitted to Dr. Hasan Sadikin Hospital. All pediatric patients having blood culture drawn from January 2015 to December 2016 were retrospectively studied. Data include the number of drawn blood culture, number of positive results, type of bacteria, sensitivity pattern. International standard definitions for acquired resistance by ECDC and CDC was used as definitions for MDR, XDR and PDR bacteria. From January 2015 to December 2016, 299 from 2.542 (11.7%) blood culture was positive, with Staphylococcus aureus, Enterococcus spp., Enterobacteriaceae, Pseudomonas aeruginosa, Acinetobacter spp., respectively 5, 6, 24, 5, 20 with total 60 (20%). The MDR and XDR pathogen found were 47 and 13 patients, respectively.

Construction of improved tools for protein localization studies in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Mafalda X Henriques

Full Text Available We have constructed a set of plasmids that allow efficient expression of both N- and C-terminal fusions of proteins of interest to fluorescent proteins mCherry, Citrine, CFP and GFP in the Gram-positive pathogen Streptococcus pneumoniae. In order to improve expression of the fluorescent fusions to levels that allow their detection by fluorescence microscopy, we have introduced a 10 amino acid tag, named i-tag, at the N-terminal end of the fluorescent proteins. This caused increased expression due to improved translation efficiency and did not interfere with the protein localization in pneumococcal bacteria. Localizing fluorescent derivatives of FtsZ, Wzd and Wze in dividing bacteria validated the developed tools. The availability of the new plasmids described in this work should greatly facilitate studies of protein localization in an important clinical pathogen.

Risk factors for the development of pneumonia in acute psychotropic drugs poisoning

OpenAIRE

Vučinić Slavica

2005-01-01

Background/Aim. Pneumonia is the most frequent complication in acute psychotropic drugs poisoning, which results in substantial morbidity and mortality, but which also increases the costs of treatment. Risk factors for pneumonia are numerous: age, sex, place of the appearance of pneumonia, severity of underlying disease, airway instrumentation (intubation, reintubation, etc). The incidence of pneumonia varies in poisoning caused by the various groups of drugs. The aim of this study was to det...

Mechanisms of genome evolution of Streptococcus.

Science.gov (United States)

Andam, Cheryl P; Hanage, William P

2015-07-01

The genus Streptococcus contains 104 recognized species, many of which are associated with human or animal hosts. A globally prevalent human pathogen in this group is Streptococcus pneumoniae (the pneumococcus). While being a common resident of the upper respiratory tract, it is also a major cause of otitis media, pneumonia, bacteremia and meningitis, accounting for a high burden of morbidity and mortality worldwide. Recent findings demonstrate the importance of recombination and selection in driving the population dynamics and evolution of different pneumococcal lineages, allowing them to successfully evade the impacts of selective pressures such as vaccination and antibiotic treatment. We highlight the ability of pneumococci to respond to these pressures through processes including serotype replacement, capsular switching and horizontal gene transfer (HGT) of antibiotic resistance genes. The challenge in controlling this pathogen also lies in the exceptional genetic and phenotypic variation among different pneumococcal lineages, particularly in terms of their pathogenicity and resistance to current therapeutic strategies. The widespread use of pneumococcal conjugate vaccines, which target only a small subset of the more than 90 pneumococcal serotypes, provides us with a unique opportunity to elucidate how the processes of selection and recombination interact to generate a remarkable level of plasticity and heterogeneity in the pneumococcal genome. These processes also play an important role in the emergence and spread of multi-resistant strains, which continues to pose a challenge in disease control and/or eradication. The application of population of genomic approaches at different spatial and temporal scales will help improve strategies to control this global pathogen, and potentially other pathogenic streptococci. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

The fitness cost of antibiotic resistance in Streptococcus pneumoniae: insight from the field.

Directory of Open Access Journals (Sweden)

M Cyrus Maher

Full Text Available Laboratory studies have suggested that antibiotic resistance may result in decreased fitness in the bacteria that harbor it. Observational studies have supported this, but due to ethical and practical considerations, it is rare to have experimental control over antibiotic prescription rates.We analyze data from a 54-month longitudinal trial that monitored pneumococcal drug resistance during and after biannual mass distribution of azithromycin for the elimination of the blinding eye disease, trachoma. Prescription of azithromycin and antibiotics that can create cross-resistance to it is rare in this part of the world. As a result, we were able to follow trends in resistance with minimal influence from unmeasured antibiotic use. Using these data, we fit a probabilistic disease transmission model that included two resistant strains, corresponding to the two dominant modes of resistance to macrolide antibiotics. We estimated the relative fitness of these two strains to be 0.86 (95% CI 0.80 to 0.90, and 0.88 (95% CI 0.82 to 0.93, relative to antibiotic-sensitive strains. We then used these estimates to predict that, within 5 years of the last antibiotic treatment, there would be a 95% chance of elimination of macrolide resistance by intra-species competition alone.Although it is quite possible that the fitness cost of macrolide resistance is sufficient to ensure its eventual elimination in the absence of antibiotic selection, this process takes time, and prevention is likely the best policy in the fight against resistance.

Frequent beneficial mutations during single-colony serial transfer of Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Kathleen E Stevens

2011-08-01

Full Text Available The appearance of new mutations within a population provides the raw material for evolution. The consistent decline in fitness observed in classical mutation accumulation studies has provided support for the long-held view that deleterious mutations are more common than beneficial mutations. Here we present results of a study using a mutation accumulation design with the bacterium Streptococcus pneumoniae in which the fitness of the derived populations increased. This rise in fitness was associated specifically with adaptation to survival during brief stationary phase periods between single-colony population bottlenecks. To understand better the population dynamics behind this unanticipated adaptation, we developed a maximum likelihood model describing the processes of mutation and stationary-phase selection in the context of frequent population bottlenecks. Using this model, we estimate that the rate of beneficial mutations may be as high as 4.8×10(-4 events per genome for each time interval corresponding to the pneumococcal generation time. This rate is several orders of magnitude higher than earlier estimates of beneficial mutation rates in bacteria but supports recent results obtained through the propagation of small populations of Escherichia coli. Our findings indicate that beneficial mutations may be relatively frequent in bacteria and suggest that in S. pneumoniae, which develops natural competence for transformation, a steady supply of such mutations may be available for sampling by recombination.

Nonencapsulated Streptococcus pneumoniae causes otitis media during single-species infection and during polymicrobial infection with nontypeable Haemophilus influenzae.

Science.gov (United States)

Murrah, Kyle A; Pang, Bing; Richardson, Stephen; Perez, Antonia; Reimche, Jennifer; King, Lauren; Wren, John; Swords, W Edward

2015-07-01

Streptococcus pneumoniae strains lacking capsular polysaccharide have been increasingly reported in carriage and disease contexts. Since most cases of otitis media involve more than one bacterial species, we aimed to determine the capacity of a nonencapsulated S. pneumoniae clinical isolate to induce disease in the context of a single-species infection and as a polymicrobial infection with nontypeable Haemophilus influenzae. Using the chinchilla model of otitis media, we found that nonencapsulated S. pneumoniae colonizes the nasopharynx following intranasal inoculation, but does not readily ascend into the middle ear. However, when we inoculated nonencapsulated S. pneumoniae directly into the middle ear, the bacteria persisted for two weeks post-inoculation and induced symptoms consistent with chronic otitis media. During coinfection with nontypeable H. influenzae, both species persisted for one week and induced polymicrobial otitis media. We also observed that nontypeable H. influenzae conferred passive protection from killing by amoxicillin upon S. pneumoniae from within polymicrobial biofilms in vitro. Therefore, based on these results, we conclude that nonencapsulated pneumococci are a potential causative agent of chronic/recurrent otitis media, and can also cause mutualistic infection with other opportunists, which could complicate treatment outcomes. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

An Update on the Management Of Hospital-Acquired Pneumonia in the Elderly

Directory of Open Access Journals (Sweden)

Chao-Hsien Lee

2008-12-01

Full Text Available Pneumonia is the leading cause of infection-related death and represents the fifth cause of mortality in the elderly. There are several reported risk factors for acquiring pneumonia at an older age, such as alcoholism, lung and heart diseases, nursing home residence, and swallowing disorders. Hospital-acquired pneumonia (HAP is reviewed, with an emphasis on multidrug-resistant (MDR bacterial pathogens, such as Pseudomonas aeruginosa, Acinetobacter species, and methicillin-resistant Staphylococcus aureus. The clinical characteristics of pneumonia in the elderly differ substantially compared with younger patients, and the severity of the disease is strongly associated with increased age and age-related comorbid disorders. Streptococcus pneumoniae is the pathogen most frequently responsible for pneumonia in the elderly with early HAP without risk factors for MDR; enteric Gram-negative rods should be considered in nursing home-associated pneumonia, as well as anaerobes in patients with aspiration pneumonia. Special attention should be given to preventive measures such as vaccination, oral care, and nutrition. The management of HAP should be instituted early with: appropriate use of antibiotics in adequate doses; avoidance of excessive use of antibiotics by de-escalation of initial antibiotic therapy, based on microbiologic cultures and the clinical response of the patient; and reduction of the duration of treatment to the minimum effective period.

[Bacteremic pneumococcal pneumonia].

Science.gov (United States)

Pineda Solas, V; Pérez Benito, A; Domingo Puiggros, M; Larramona Carrera, H; Segura Porta, F; Fontanals Aymerich, D

2002-11-01

Streptococcus pneumonia is the most common bacterial cause of community-acquired pneumonia in children. The reference standard for etiological diagnosis is isolation of S. pneumoniae from blood Since the advent of conjugate vaccines, disease caused by this organism can now be prevented. Many studies have been performed of the global incidence of invasive pneumococcal infections and of pneumococcal meningitis but few studies investigated bacteremic pneumococcal pneumonia and its complications in children. To determine the incidence, patient characteristics, clinical signs, laboratory data, percentage and days of hospitalization, response to antibiotic treatment, antibiotic resistance, complications and causal serogroups of bacteremic pneumococcal pneumonia in our environment in order to estimate requirements for systematic vaccination programs. From January 1990 to May 2001, data on all pediatric cases of invasive pneumococcal infections diagnosed in our hospital were collected. Several characteristics of patients with bacteremic pneumococcal pneumonia were analyzed. Bacteremic pneumococcal pneumonia was diagnosed in patients with positive blood or pleural fluid cultures for S. pneumoniae and radiographically evident pulmonary infiltrate. The incidence of both types of pneumonia were determined according to population census data. All S. pneumonia strains were sent to the Pneumococci Reference Laboratory of the Instituto Carlos III in Madrid for serotyping. We estimated the serotype coverage of the pneumococcal 7-valent conjugate vaccine according to the serotypes included in this vaccine and their distribution. Forty cases of bacteremic pneumococcal pneumonia were diagnosed, yielding an incidence of 17,10 and 5 cases per 10(5) children aged less than 2, 4 and 15 years old respectively. The mean age was 50 months and 43% were aged less than 4 years. Peaks occurred in January, March, April and May. A total of 77.5% of the patients were admitted to hospital and the

Deletion analysis of Streptococcus pneumoniae late competence genes distinguishes virulence determinants that are dependent or independent of competence induction

OpenAIRE

Zhu, Luchang; Lin, Jingjun; Kuang, Zhizhou; Vidal, Jorge E.; Lau, Gee W.

2015-01-01

The competence regulon of Streptococcus pneumoniae (pneumococcus) is crucial for genetic transformation. During competence development, the alternative sigma factor ComX is activated, which in turn, initiates transcription of 80 “late” competence genes. Interestingly, only 16 late genes are essential for genetic transformation. We hypothesized that these late genes that are dispensable for competence are beneficial to pneumococcal fitness during infection. These late genes were systematically...

Postantibiotic effects and postantibiotic sub-MIC effects of tilmicosin, erythromycin and tiamulin on erythromycin-resistant Streptococcus suis.

Science.gov (United States)

Wang, Liping; Zhang, Yuanshu

2009-10-01

The postantibiotic effects (PAEs) and postantibiotic sub-MIC effects (PA SMEs) of tilmicosin, erythromycin and tiamulin on erythromycin-susceptible and erythromycin-resistant strains of Streptococcus suis (M phenotype) were investigated in vitro. Tilmicosin and tiamulin induced significantly longer PAE and PA SME against both erythromycin-susceptible and erythromycin-resistant strains than did erythromycin. The durations of PAE and PA SMEs were proportional to the concentrations of drugs used for exposure. The PA SMEs were substantially longer than PAEs on S. suis (P<0.05) regardless of the antimicrobial used for exposure. The results indicated that the PAE and PA SME could help in the design of efficient control strategies for infection especially caused by erythromycin-resistant S. suis and that they may provide additional valuable information for the rational drug use in clinical practice.

Influence of impaired lipoprotein biogenesis on surface and exoproteome of Streptococcus pneumoniae.

Science.gov (United States)

Pribyl, Thomas; Moche, Martin; Dreisbach, Annette; Bijlsma, Jetta J E; Saleh, Malek; Abdullah, Mohammed R; Hecker, Michael; van Dijl, Jan Maarten; Becher, Dörte; Hammerschmidt, Sven

2014-02-07

Surface proteins are important for the fitness and virulence of the Gram-positive pathogen Streptococcus pneumoniae. They are crucial for interaction of the pathogen with its human host during infection. Therefore, the analysis of the pneumococcal surface proteome is an important task that requires powerful tools. In this study, two different methods, an optimized biotinylation approach and shaving with trypsin beads, were applied to study the pneumococcal surface proteome and to identify surface-exposed protein domains, respectively. The identification of nearly 95% of the predicted lipoproteins and 75% of the predicted sortase substrates reflects the high coverage of the two classical surface protein classes accomplished in this study. Furthermore, the biotinylation approach was applied to study the impact of an impaired lipoprotein maturation pathway on the cell envelope proteome and exoproteome. Loss of the lipoprotein diacylglyceryl transferase Lgt leads to striking changes in the lipoprotein distribution. Many lipoproteins disappear from the surface proteome and accumulate in the exoproteome. Further insights into lipoprotein processing in pneumococci are provided by immunoblot analyses of bacterial lysates and corresponding supernatant fractions. Taken together, the first comprehensive overview of the pneumococcal surface and exoproteome is presented, and a model for lipoprotein processing in S. pneumoniae is proposed.

Exposure to welding fumes and lower airway infection with Streptococcus pneumoniae.

Science.gov (United States)

Suri, Reetika; Periselneris, Jimstan; Lanone, Sophie; Zeidler-Erdely, Patti C; Melton, Geoffrey; Palmer, Keith T; Andujar, Pascal; Antonini, James M; Cohignac, Vanessa; Erdely, Aaron; Jose, Ricardo J; Mudway, Ian; Brown, Jeremy; Grigg, Jonathan

2016-02-01

Welders are at increased risk of pneumococcal pneumonia. The mechanism for this association is not known. The capacity of pneumococci to adhere to and infect lower airway cells is mediated by host-expressed platelet-activating factor receptor (PAFR). We sought to assess the effect of mild steel welding fumes (MS-WF) on PAFR-dependent pneumococcal adhesion and infection to human airway cells in vitro and on pneumococcal airway infection in a mouse model. The oxidative potential of MS-WF was assessed by their capacity to reduce antioxidants in vitro. Pneumococcal adhesion and infection of A549, BEAS-2B, and primary human bronchial airway cells were assessed by means of quantitative bacterial culture and expressed as colony-forming units (CFU). After intranasal instillation of MS-WF, mice were infected with Streptococcus pneumoniae, and bronchoalveolar lavage fluid (BALF) and lung CFU values were determined. PAFR protein levels were assessed by using immunofluorescence and immunohistochemistry, and PAFR mRNA expression was assessed by using quantitative PCR. PAFR was blocked by CV-3988, and oxidative stress was attenuated by N-acetylcysteine. MS-WF exhibited high oxidative potential. In A549 and BEAS-2B cells MS-WF increased pneumococcal adhesion and infection and PAFR protein expression. Both CV-3988 and N-acetylcysteine reduced MS-WF-stimulated pneumococcal adhesion and infection of airway cells. MS-WF increased mouse lung PAFR mRNA expression and increased BALF and lung pneumococcal CFU values. In MS-WF-exposed mice CV-3988 reduced BALF CFU values. Hypersusceptibility of welders to pneumococcal pneumonia is in part mediated by the capacity of welding fumes to increase PAFR-dependent pneumococcal adhesion and infection of lower airway cells. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. All rights reserved.

Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism

Directory of Open Access Journals (Sweden)

Laura ePaixão

2015-10-01

Full Text Available Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonised by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose is the prevailing sugar. As a result during progression from colonisation to disease S. pneumoniae has to cope with a pronounced shift in carbohydrate nature and availability. Thus, we set out to assess the pneumococcal response to sugars found in glycans and the influence of glucose (Glc on this response at the transcriptional, physiological and metabolic levels. Galactose (Gal, N-acetylglucosamine (GlcNAc and mannose (Man affected the expression of 8 to 14% of the genes covering cellular functions including central carbon metabolism and virulence. The pattern of end-products as monitored by in vivo 13C-NMR is in good agreement with the fermentation profiles during growth, while the pools of phosphorylated metabolites are consistent with the type of fermentation observed (homolactic vs. mixed and regulation at the metabolic level. Furthermore, the accumulation of α-Gal6P and Man6P indicate metabolic bottlenecks in the metabolism of Gal and Man, respectively. Glc added to cells actively metabolizing other sugar(s was readily consumed and elicited a metabolic shift towards a homolactic profile. The transcriptional response to Glc was large (over 5% of the genome. In central carbon metabolism (most represented category, Glc exerted mostly negative regulation. The smallest response to Glc was observed on a sugar mix, suggesting that exposure to varied sugars improves the fitness of S. pneumoniae. The expression of virulence factors was negatively controlled by Glc in a sugar-dependent manner. Overall, our results shed new light on the link between carbohydrate metabolism, adaptation to host niches and virulence.

Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism.

Science.gov (United States)

Paixão, Laura; Caldas, José; Kloosterman, Tomas G; Kuipers, Oscar P; Vinga, Susana; Neves, Ana R

2015-01-01

Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonized by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose is the prevailing sugar. As a result during progression from colonization to disease S. pneumoniae has to cope with a pronounced shift in carbohydrate nature and availability. Thus, we set out to assess the pneumococcal response to sugars found in glycans and the influence of glucose (Glc) on this response at the transcriptional, physiological, and metabolic levels. Galactose (Gal), N-acetylglucosamine (GlcNAc), and mannose (Man) affected the expression of 8 to 14% of the genes covering cellular functions including central carbon metabolism and virulence. The pattern of end-products as monitored by in vivo (13)C-NMR is in good agreement with the fermentation profiles during growth, while the pools of phosphorylated metabolites are consistent with the type of fermentation observed (homolactic vs. mixed) and regulation at the metabolic level. Furthermore, the accumulation of α-Gal6P and Man6P indicate metabolic bottlenecks in the metabolism of Gal and Man, respectively. Glc added to cells actively metabolizing other sugar(s) was readily consumed and elicited a metabolic shift toward a homolactic profile. The transcriptional response to Glc was large (over 5% of the genome). In central carbon metabolism (most represented category), Glc exerted mostly negative regulation. The smallest response to Glc was observed on a sugar mix, suggesting that exposure to varied sugars improves the fitness of S. pneumoniae. The expression of virulence factors was negatively controlled by Glc in a sugar-dependent manner. Overall, our results shed new light on the link between carbohydrate metabolism, adaptation to host niches and virulence.

Determination of antibiotic resistance profile in Klebsiella pneumonia strains isolated from urinary tract infections of patients hospitalized in Peyambaran hospital (Tehran-Iran

Directory of Open Access Journals (Sweden)

Marzieh Tavakol

2017-04-01

Full Text Available Background: Urinary tract infection (UTI is the second prevalent infection in human mostly caused by Escherichia coli and Klebsiella pneumonia. The aim of this study was to determine the antibiotic resistance profile and detect the prevalence of antibiotic resistance encoding genes in K .pneumoniae isolated from UTI. Materials and Methods: Fifty K. pneumonia strains isolated from 122 UTI samples of hospitalized patients in Payambaran Hospital (Tehran, Iran which were subjected to this study (2014 were confirmed by standard biochemical tests. Isolates were tested for susceptibility to 10 antimicrobial drugs by using disk diffusion method. Antibiotic resistance encoding genes frequently include the aadA1, aac(3-IV, sul1, blaSHV, Cat1, cmlA, tetA, tetB, dfrA1, CITM, qnr in isolates were determined by PCR. Results: The highest antibiotic resistance in K. pneumoniae isolates were for Tetracycline and the lowest resistance (2% for Gentamicin and Imipenem. To determine the frequency of antibiotic resistant genes, 64% and 4% of isolates had tetA and Gentamicin-(aac(3-IV resistant genes, respectively. Conclusion: Frequency of antibiotic resistance encoding genes may have important and basic role in the occurrence and transfer of antibiotic resistance which can be due to the indiscriminate use of antibiotics.

Meningitis neonatal e infección puerperal por Streptococcus pneumoniae: Presentación de un caso

Directory of Open Access Journals (Sweden)

Cecilia Ortiz Rodríguez

2003-06-01

Full Text Available Las infecciones neonatales causadas por Streptococcus pneumoniae constituyen un fenómeno raro, poco reportado en la literatura médica; en el presente trabajo se describe el caso de una meningoencefalitis purulenta de aparición precoz, en un neonato nacido por parto eutócico, a termino y de buen peso. Se aisló el microorganismo en la sangre y en el líquido cefalorraquídeo del recién nacido, así como en los loquios de la madre. Las 3 antibiotipias fueron idénticas. La evolución del niño fue desfavorable, el cual falleció a las 81 horas de vida, en un cuadro de fallo multiorgánico. La necropsia corroboró el diagnóstico. La madre desarrolló una endometritis puerperal a los 4 días, con buena evolución.Neonatal infections caused by Streptococcus pneumoniae are a rare phenomenon that is barely reported in the medical literature. The present paper describes a case of early purulent meningoencephalitis occurred in an adequate birthweight neonate born to term eutocic delivery. The microorganism was isolated in the newborn's blood and cerebrospinal fluid as well as in his mother's lochia. The three antibiotypes were identical. The newborn did not recover and died after 81 hours due to a multiple organ failure. Necropsy confirmed the diagnosis. The mother developed puerperal endometritis after 4 days but did recover.

Validation of the Infectious Diseases Society of America/American Thoracic Society criteria to predict severe community-acquired pneumonia caused by Streptococcus pneumoniae.

Science.gov (United States)

Kontou, Paschalina; Kuti, Joseph L; Nicolau, David P

2009-10-01

Severe community-acquired pneumonia (CAP) is usually defined as pneumonia that requires intensive care unit (ICU) admission; the primary pathogen responsible for ICU admission is Streptococcus pneumoniae. In this study, the 2007 Infectious Diseases Society of America/American Thoracic Society (IDSA/ATS) consensus criteria for ICU admission were compared with other severity scores in predicting ICU admission and mortality. We retrospectively studied 158 patients with pneumococcal CAP (1999-2003). Clinical and laboratory features at the emergency department were recorded and used to calculate the 2007 IDSA/ATS rule, the 2001 ATS rule, 2 modified 2007 IDSA/ATS rules, the Pneumonia Severity Index (PSI), and the CURB (confusion, urea, respiratory rate, blood pressure) score. The sensitivity, specificity, positive predictive value, and negative predictive value (NPV) were assessed for the various indices. We also determined the criteria that were independently predictive of ICU admission and of mortality in our population. The 2007 IDSA/ATS criteria performed as well as the 2001 ATS rule in predicting ICU admission both demonstrated high sensitivity (90%) and NPV (97%). For the prediction of mortality, the best tool proved to be the PSI score (sensitivity, 95%; NPV, 99%). The variables associated with ICU admission in this patient population included tachypnea, confusion, Pao(2)/Fio(2) ratio of 250 or lower, and hypotension requiring fluid resuscitation. Mechanical ventilation and PSI class V were independently associated with mortality. This study confirms the usefulness of the new criteria in predicting severe CAP. The 2001 ATS criteria seem an attractive alternative because they are simple and as effective as the 2007 IDSA/ATS criteria.

Dual infection by streptococcus and atypical mycobacteria following Ahmed glaucoma valve surgery.

Science.gov (United States)

Rao, Aparna; Wallang, Batriti; Padhy, Tapas Ranjan; Mittal, Ruchi; Sharma, Savitri

2013-07-01

To report a case of late postoperative endophthalmitis caused by Streptococcus pneumoniae and conjunctival necrosis by Streptococcus pneumoniae and Mycobacterium fortuitum following Ahmed glaucoma valve (AGV) surgery in a young patient. Case report of a 13-year-old boy with purulent exudates and extensive conjunctival necrosis two months following amniotic membrane graft and conjunctival closure (for conjunctival retraction post AGV for secondary glaucoma). The conjunctiva showed extensive necrosis causing exposure of the tube and plate associated with frank exudates in the area adjoining the plate and anterior chamber mandating explantation of the plate along with intravitreal antibiotics. The vitreous aspirate grew Streptococcus pneumoniae while Streptococcus pneumoniae with Mycobacterium fortuitum was isolated from the explanted plate. Despite adequate control of infection following surgery, the final visual outcome was poor owing to disc pallor. Conjunctival necrosis and retraction post-AGV can cause late postoperative co-infections by fulminant and slow-growing organisms. A close follow-up is therefore essential in these cases to prevent sight-threatening complications.

Genomic Analysis of a Pan-Resistant Isolate of Klebsiella pneumoniae, United States 2016.

Science.gov (United States)

de Man, Tom J B; Lutgring, Joseph D; Lonsway, David R; Anderson, Karen F; Kiehlbauch, Julia A; Chen, Lei; Walters, Maroya Spalding; Sjölund-Karlsson, Maria; Rasheed, J Kamile; Kallen, Alexander; Halpin, Alison Laufer

2018-04-03

Antimicrobial resistance is a threat to public health globally and leads to an estimated 23,000 deaths annually in the United States alone. Here, we report the genomic characterization of an unusual Klebsiella pneumoniae , nonsusceptible to all 26 antibiotics tested, that was isolated from a U.S. The isolate harbored four known beta-lactamase genes, including plasmid-mediated bla NDM-1 and bla CMY-6 , as well as chromosomal bla CTX-M-15 and bla SHV-28 , which accounted for resistance to all beta-lactams tested. In addition, sequence analysis identified mechanisms that could explain all other reported nonsusceptibility results, including nonsusceptibility to colistin, tigecycline, and chloramphenicol. Two plasmids, IncA/C2 and IncFIB, were closely related to mobile elements described previously and isolated from Gram-negative bacteria from China, Nepal, India, the United States, and Kenya, suggesting possible origins of the isolate and plasmids. This is one of the first K. pneumoniae isolates in the United States to have been reported to the Centers for Disease Control and Prevention (CDC) as nonsusceptible to all drugs tested, including all beta-lactams, colistin, and tigecycline. IMPORTANCE Antimicrobial resistance is a major public health threat worldwide. Bacteria that are nonsusceptible or resistant to all antimicrobials available are of major concern to patients and the public because of lack of treatment options and potential for spread. A Klebsiella pneumoniae strain that was nonsusceptible to all tested antibiotics was isolated from a U.S. Mechanisms that could explain all observed phenotypic antimicrobial resistance phenotypes, including resistance to colistin and beta-lactams, were identified through whole-genome sequencing. The large variety of resistance determinants identified demonstrates the usefulness of whole-genome sequencing for detecting these genes in an outbreak response. Sequencing of isolates with rare and unusual phenotypes can provide

IL-22 Defect During Streptococcus pneumoniae Infection Triggers Exacerbation of Chronic Obstructive Pulmonary Disease

Directory of Open Access Journals (Sweden)

Muriel Pichavant

2015-11-01

Full Text Available Progression of chronic obstructive pulmonary disease (COPD is linked to episodes of exacerbations caused by bacterial infections due to Streptococcus pneumoniae. Our objective was to identify during COPD, factors of susceptibility to bacterial infections among cytokine network and their role in COPD exacerbations. S. pneumoniae was used to sub-lethally challenge mice chronically exposed to air or cigarette smoke (CS and to stimulate peripheral blood mononuclear cells (PBMC from non-smokers, smokers and COPD patients. The immune response and the cytokine production were evaluated. Delayed clearance of the bacteria and stronger lung inflammation observed in infected CS-exposed mice were associated with an altered production of IL-17 and IL-22 by innate immune cells. This defect was related to a reduced production of IL-1β and IL-23 by antigen presenting cells. Importantly, supplementation with recombinant IL-22 restored bacterial clearance in CS-exposed mice and limited lung alteration. In contrast with non-smokers, blood NK and NKT cells from COPD patients failed to increase IL-17 and IL-22 levels in response to S. pneumoniae, in association with a defect in IL-1β and IL-23 secretion. This study identified IL-17 and IL-22 as susceptibility factors in COPD exacerbation. Therefore targeting such cytokines could represent a potent strategy to control COPD exacerbation.

In vitro activity of fluoroquinolones (gatifloxacin, levofloxacin and trovafloxacin and seven other antibiotics against Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Nicodemo A.C.

2001-01-01

Full Text Available In recent years, the level of resistance of S. pneumoniae to beta-lactam and/or macrolides has increased around the world including some countries in South America. Because of this resistance, it is necessary to test the therapeutic alternatives for treating this pathogen, including the newer quinolones. This study was carried out in order to compare the in vitro activity of fluoroquinolones gatifloxacin, levofloxacin and trovafloxacin, to penicillin G, amoxicillin, amoxicillin-clavulanate, cufuroxime sodium, ceftriaxone, azithromycin and clarithromycin, against 300 strains of S. pneumoniae. Of the 300 samples tested, 18.6% were not susceptible to penicillin (56 strains and 7% (21 strains were resistant to the second generation cephalosporin. Among the macrolides, resistance ranged from 6.7% for clarithromycin to 29.6% for azithromycin. Susceptibility to the newer quinolones was 100% including the 56 strains not susceptible to penicillin. Among the 10 antibiotics evaluated, the fluoroquinolones gatifloxacin, levofloxacin, and trovafloxacin displayed high levels of in vitro activity against S. pneumoniae.

Identification of a patient with Streptococcus pneumoniae bacteremia and meningitis by the polymerase chain reaction (PCR).

Science.gov (United States)

Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D

1995-06-01

A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.

Fluorescence Imaging of Streptococcus pneumoniae with the Helix pomatia agglutinin (HPA As a Potential, Rapid Diagnostic Tool

Directory of Open Access Journals (Sweden)

Mirian Domenech

2017-07-01

Full Text Available Streptococcus pneumoniae is a common human pathogen and a major causal agent of life-threatening infections that can either be respiratory or non-respiratory. It is well known that the Helix pomatia (edible snail agglutinin (HPA lectin shows specificity for terminal αGalNAc residues present, among other locations, in the Forssman pentasaccharide (αGalNAc1→3βGalNAc1→3αGal1→4βGal1→4βGlc. Based on experiments involving choline-independent mutants and different growth conditions, we propose here that HPA recognizes the αGalNAc terminal residues of the cell wall teichoic and lipoteichoic acids of S. pneumoniae. In addition, experimental evidence showing that pneumococci can be specifically labeled with HPA when growing as planktonic cultures as well as in mixed biofilms of S. pneumoniae and Haemophilus influenzae has been obtained. It should be underlined that pneumococci were HPA-labeled despite of the presence of a capsule. Although some non-pneumococcal species also bind the agglutinin, HPA-binding combined with fluorescence microscopy constitutes a suitable tool for identifying S. pneumoniae and, if used in conjunction with Gram staining and/or other suitable technique like antigen detection, it may potentially facilitate a fast and accurate diagnosis of pneumococcal infections.

Nasopharyngeal carriage of Streptococcus pneumoniae and other bacteria in the 7th year after implementation of the pneumococcal conjugate vaccine in the Netherlands

NARCIS (Netherlands)

Bosch, Astrid A T M; van Houten, Marlies A.; Bruin, Jacob P.; Wijmenga-Monsuur, Alienke J.; Trzciński, Krzysztof; Bogaert, Debby; Rots, Nynke Y.; Sanders, Elisabeth A M

2016-01-01

After introduction of the 7-valent pneumococcal conjugate vaccine (PCV7) in the infant national immunization program (NIP) in the Netherlands in 2006, Streptococcus pneumoniae strains of the non-vaccine serotype 19A emerged and became the dominant serotype in carriage in children and their parents.

Carbapenem-resistant Klebsiella pneumoniae colonization in pediatric and neonatal intensive care units: risk factors for progression to infection.

Science.gov (United States)

Akturk, Hacer; Sutcu, Murat; Somer, Ayper; Aydın, Derya; Cihan, Rukiye; Ozdemir, Aslı; Coban, Asuman; Ince, Zeynep; Citak, Agop; Salman, Nuran

2016-01-01

Little is known about factors associated with carbapenem-resistant Klebsiella pneumoniae infections in pediatric patients, who are initally colonized with carbapenem-resistant Klebsiella pneumoniae. A retrospective case-control study was conducted involving pediatric and neonatal intensive care units throughout a five-year period (January 2010-December 2014). Clinical and microbiological data were extracted from Hospital Infection Control Committee reports and patients' medical records. Risk factors were assessed in carbapenem-resistant Klebsiella pneumoniae colonized patients who developed subsequent systemic infection (cases) and compared to carbapenem-resistant Klebsiella pneumoniae colonized patients who did not develop infection (controls). Throughout the study period, 2.6% of patients admitted to neonatal intensive care units and 3.6% of patients admitted to pediatric intensive care units had become colonized with carbapenem-resistant Klebsiella pneumoniae. After a mean of 10.6±1.9 days (median: 7 days, range: 2-38 days) following detection of colonization, 39.0% of the carbapenem-resistant Klebsiella pneumoniae colonized patients in pediatric intensive care units and 18.1% of carbapenem-resistant Klebsiella pneumoniae colonized patients in neonatal intensive care units developed systemic carbapenem-resistant Klebsiella pneumoniae infection. Types of systemic carbapenem-resistant Klebsiella pneumoniae infections included bacteremia (n=15, 62.5%), ventilator-associated pneumonia (n=4, 16.6%), ventriculitis (n=2, 8.3%), intraabdominal infections (n=2, 8.3%), and urinary tract infection (n=1, 4.1%). A logistic regression model including parameters found significant in univariate analysis of carbapenem resistant Klebsiella pneumoniae colonization and carbapenem resistant Klebsiella pneumoniae infection groups revealed underlying metabolic disease (OR: 10.1; 95% CI: 2.7-37.2), previous carbapenem use (OR: 10.1; 95% CI: 2.2-40.1), neutropenia (OR: 13.8; 95% CI: 3

Distribución de serotipos de Streptococcus pneumoniae aislados de infecciones invasoras en el Hospital de Niños de Santa Fe Serotype distribution of Streptococcus pneumoniae isolated from invasive infections at the Hospital de Niños of Santa Fe.

Directory of Open Access Journals (Sweden)

C. Mayoral

2008-03-01

Full Text Available Con la introducción de vacunas conjugadas antineumocócicas se observó, en muchos países, disminución de aislamientos de Streptococcus pneumoniae del serotipo 14 y aumento de aislamientos correspondientes a serotipos no incluidos en esas vacunas. En 1993, el Hospital de Niños de Santa Fe comenzó la vigilancia de la distribución de serotipos de Streptococcus pneumoniae invasores. En este trabajo se estudió la correlación entre serotipo y a patología (neumonía/meningitis, b edad (menor o mayor de dos años, y c CIM de penicilina, para los serotipos aislados en el período 2003-2005. El serotipo predominante fue el 14, seguido del 1, 6B, 18C, 7F, 19F y 5. El serotipo 14 mostró asociación estadísticamente significativa con valores de CIM de penicilina entre 0,5 y 2 mg/l, no así con alguna patología, aunque se lo halló con mayor frecuencia en neumonías que en meningitis. Los serotipos 14 y 1 prevalecieron en niños menores y mayores de 2 años, respectivamente. La CIM de penicilina = 2 mg/l se observó más en neumonías que en meningitis. La frecuencia relativa de los diferentes serotipos hallados fue semejante a la observada en el período 1993-99; no obstante, los serotipos 18C, 4, 12F y 22F no se habían encontrado antes. La aparición de nuevos serotipos convierte en importante la vigilancia, dada la necesidad de formular vacunas que los incluyan y que efectivamente prevengan las infecciones neumocócicas más comunes.The serotype distribution of Streptococcus pneumoniae varies through time. The introduction of pneumococcal conjugate vaccines showed a decreased prevalence of pneumococcal invasive isolates belonging to serotype 14 and an increase of serotypes not therein included. In 1993, the Hospital de Niños of Santa Fe began surveillance of the serotype distribution of invasive S. pneumoniae disease. In the period 2003 - 2005, 76 isolates were analysed by studying the correlation between serotype and pathology, age and MIC

Infection by Streptococcus pneumoniae in children with or without radiologically confirmed pneumonia

Directory of Open Access Journals (Sweden)

Dafne C. Andrade

2018-01-01

Conclusions: Among children with clinical diagnosis of community‐acquired pneumonia submitted to chest radiograph, those with radiologically confirmed pneumonia present a higher rate of infection by S. pneumoniae when compared with those with a normal chest radiograph.

Antibiotic Resistances of Yogurt Starter Cultures Streptococcus thermophilus and Lactobacillus bulgaricus

OpenAIRE

Sozzi, Tommaso; Smiley, Martin B.

1980-01-01

Twenty-nine strains of Lactobacillus bulgaricus and 15 strains of Streptococcus thermophilus were tested for resistance to 35 antimicrobial agents by using commercially available sensitivity disks. Approximately 35% of the isolates had uncharacteristic resistance patterns.

Postantibiotic effects and postantibiotic sub-MIC effects of tilmicosin, erythromycin and tiamulin on erythromycin-resistant Streptococcus suis

Directory of Open Access Journals (Sweden)

Liping Wang

2009-12-01

Full Text Available The postantibiotic effects (PAEs and postantibiotic sub-MIC effects (PA SMEs of tilmicosin, erythromycin and tiamulin on erythromycin-susceptible and erythromycin-resistant strains of Streptococcus suis (M phenotype were investigated in vitro. Tilmicosin and tiamulin induced significantly longer PAE and PA SME against both erythromycin-susceptible and erythromycin-resistant strains than did erythromycin. The durations of PAE and PA SMEs were proportional to the concentrations of drugs used for exposure. The PA SMEs were substantially longer than PAEs on S. suis (P<0.05 regardless of the antimicrobial used for exposure. The results indicated that the PAE and PA SME could help in the design of efficient control strategies for infection especially caused by erythromycin-resistant S. suis and that they may provide additional valuable information for the rational drug use in clinical practice.

Focus on JNJ-Q2, a novel fluoroquinolone, for the management of community-acquired bacterial pneumonia and acute bacterial skin and skin structure infections

Directory of Open Access Journals (Sweden)

Jones TM

2016-06-01

Full Text Available Travis M Jones,1,2 Steven W Johnson,1,3 V Paul DiMondi,1,4 Dustin T Wilson,1,2 1Department of Pharmacy Practice, College of Pharmacy and Health Sciences, Campbell University, Buies Creek, 2Department of Pharmacy, Duke University Hospital, Durham, 3Department of Pharmacy, Forsyth Medical Center, Novant Health, Winston-Salem, 4Department of Pharmacy, Durham VA Medical Center, Durham, NC, USA Abstract: JNJ-Q2 is a novel, fifth-generation fluoroquinolone that has excellent in vitro and in vivo activity against a variety of Gram-positive and Gram-negative organisms. In vitro studies indicate that JNJ-Q2 has potent activity against pathogens responsible for acute bacterial skin and skin structure infections (ABSSSI and community-acquired bacterial pneumonia (CABP, such as Staphylococcus aureus and Streptococcus pneumoniae. JNJ-Q2 also has been shown to have a higher barrier to resistance compared to other agents in the class and it remains highly active against drug-resistant organisms, including methicillin-resistant S. aureus, ciprofloxacin-resistant methicillin-resistant S. aureus, and drug-resistant S. pneumoniae. In two Phase II studies, the efficacy of JNJ-Q2 was comparable to linezolid for ABSSSI and moxifloxacin for CABP. Furthermore, JNJ-Q2 was well tolerated, with adverse event rates similar to or less than other fluoroquinolones. With an expanded spectrum of activity and low potential for resistance, JNJ-Q2 shows promise as an effective treatment option for ABSSSI and CABP. Considering its early stage of development, the definitive role of JNJ-Q2 against these infections and its safety profile will be determined in future Phase III studies. Keywords: JNJ-Q2, fluoroquinolone, ABSSSI, CABP, MRSA

Toward repurposing ciclopirox as an antibiotic against drug-resistant Acinetobacter baumannii, Escherichia coli, and Klebsiella pneumoniae.

Science.gov (United States)

Carlson-Banning, Kimberly M; Chou, Andrew; Liu, Zhen; Hamill, Richard J; Song, Yongcheng; Zechiedrich, Lynn

2013-01-01

Antibiotic-resistant infections caused by gram-negative bacteria are a major healthcare concern. Repurposing drugs circumvents the time and money limitations associated with developing new antimicrobial agents needed to combat these antibiotic-resistant infections. Here we identified the off-patent antifungal agent, ciclopirox, as a candidate to repurpose for antibiotic use. To test the efficacy of ciclopirox against antibiotic-resistant pathogens, we used a curated collection of Acinetobacter baumannii, Escherichia coli, and Klebsiella pneumoniae clinical isolates that are representative of known antibiotic resistance phenotypes. We found that ciclopirox, at 5-15 µg/ml concentrations, inhibited bacterial growth regardless of the antibiotic resistance status. At these same concentrations, ciclopirox reduced growth of Pseudomonas aeruginosa clinical isolates, but some of these pathogens required higher ciclopirox concentrations to completely block growth. To determine how ciclopirox inhibits bacterial growth, we performed an overexpression screen in E. coli. This screen revealed that galE, which encodes UDP-glucose 4-epimerase, rescued bacterial growth at otherwise restrictive ciclopirox concentrations. We found that ciclopirox does not inhibit epimerization of UDP-galactose by purified E. coli GalE; however, ΔgalU, ΔgalE, ΔrfaI, or ΔrfaB mutant strains all have lower ciclopirox minimum inhibitory concentrations than the parent strain. The galU, galE, rfaI, and rfaB genes all encode enzymes that use UDP-galactose or UDP-glucose for galactose metabolism and lipopolysaccharide (LPS) biosynthesis. Indeed, we found that ciclopirox altered LPS composition of an E. coli clinical isolate. Taken together, our data demonstrate that ciclopirox affects galactose metabolism and LPS biosynthesis, two pathways important for bacterial growth and virulence. The lack of any reported fungal resistance to ciclopirox in over twenty years of use in the clinic, its excellent safety

Identification of Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid by multiplex real-time PCR.

Science.gov (United States)

Sanz, Juan Carlos; Ríos, Esther; Rodríguez-Avial, Iciar; Ramos, Belén; Marín, Mercedes; Cercenado, Emilia

2017-08-14

The aim was to evaluate the utility of a multiplex real-time PCR to detect Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid (PF). A collection of 81 PF samples was used. Sixty were considered positive for S. pneumoniae according to previous results (54 by an in-house lytA gene PCR and eight by universal rRNA PCR). The sensitivity for detection of the lytA, plyA and psaA genes by multiplex PCR was 100% (60/60), 98.3% (59/60) and 91.7% (55/60), respectively. The detection of all three genes was negative in 21 samples formerly confirmed as negative for S. pneumoniae (100% specificity) by the other procedures (9 by in-house lytA PCR and 12 by rRNA PCR). The use of this multiplex PCR may be a useful option to identify S. pneumoniae directly in PF samples. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

Prevalence, characterization and clinical significance of Klebsiella pneumoniae carbapenemase (KPC producing Klebsiella pneumoniae

Directory of Open Access Journals (Sweden)

: Sarita Nayak, Suman Singh, Soeb Jankhwala, Riddhi Pradhan

2014-11-01

Full Text Available Klebsiella peumoniae, a capsulated gram negative bacillus is responsible for causing life threatening infections in humans. Carbapenems are the drug of choice for serious infection caused by multidrug resistant Klebsiella pneumoniae. The emergence of carbapenem resistance has made it extremely difficult to treat such infections resulting in significant morbidity and mortality. Aims: To study the prevalence of carbapenem resistance using ertapenem as a marker and to detect Klebsiella pneumoniae Carbapenemase (KPC producing Klebsiella pneumoniae as a mechanism of resistance. Material and Methods: The study included 102 patients from which Klebsiella pneumoniae isolated. Identification and antibiotic susceptibility testing of Klebsiella pneumoniae was performed on miniAPI (Analytical Profile Index, Semiautomated bacterial identification system according to Clinical and Laboratory Standards Institute (CLSI guidelines of 2011. The modified Hodge test was performed for detection of Carbapenemase production. Patient’s clinical and demographic details along with risk factors and co-morbid conditions, type of response to antimicrobial therapy and mortality were collected. Results: The prevalence of carbapenem resistance was found to be 30.41% with 16.6% KPC producing Klebsiella pneumoniae. The co-morbid conditions like immunocompromised state (p =0.042, prior antibiotics therapy (p=0.047, previous hospitalization (p =0.021, intensive care unit stay (p=0.047 and use of indwelling devices (p =0.013 were found to be significantly associated with carbapenem resistance. Adverse clinical outcomes (death or worsening among patients infected with ertapenem resistant patients was found to be statistically significant than ertapenem sensitive strains (p =0.008. Conclusions: A high degree of carbapenem resistance in present study is alarming and poses therapeutic dilemmas for clinicians. Initiating timely and appropriate infection control measures along with a

Streptococcus pneumoniae eradicates preformed Staphylococcus aureus biofilms through a mechanism requiring physical contact

Directory of Open Access Journals (Sweden)

Faidad Khan

2016-09-01

Full Text Available Staphylococcus aureus (Sau strains are a main cause of disease, including nosocomial infections which have been linked to the production of biofilms and the propagation of antibiotic resistance strains such as methicillin-resistant Staphylococcus aureus (MRSA. A previous study found that Streptococcus pneumoniae (Spn strains kill planktonic cultures of Sau strains. In this work, we have further evaluated in detail the eradication of Sau biofilms and investigated ultrastructural interactions of the biofilmicidal effect. Spn strain D39, which produces the competence stimulating peptide 1 (CSP1, reduced Sau biofilms within 8 h of inoculation, while TIGR4, producing CSP2, eradicated Sau biofilms and planktonic cells within 4 h. Differences were not attributed to pherotypes as other Spn strains producing different pheromones eradicated Sau within 4 h. Experiments using Transwell devices, which physically separated both species growing in the same well, demonstrated that direct contact between Spn and Sau was required to efficiently eradicate Sau biofilms and biofilm-released planktonic cells. Physical contact-mediated killing of Sau was not related to production of hydrogen peroxide as an isogenic TIGR4spxB mutant eradicated Sau bacteria within 4 h. Confocal micrographs confirmed eradication of Sau biofilms by TIGR4 and allowed us to visualize ultrastructural point of contacts between Sau and Spn. A time-course study further demonstrated spatial colocalization of Spn chains and Sau tetrads as early as 30 min post-inoculation (Pearson’s coefficient >0.72. Finally, precolonized biofilms produced by Sau strain Newman, or MRSA strain USA300, were eradicated by mid-log phase cultures of washed TIGR4 bacteria within 2 h post-inoculation. In conclusion, Spn strains rapidly eradicate pre-colonized Sau aureus biofilms, including those formed by MRSA strains, by a mechanism(s requiring bacterium-bacterium contact, but independent from the production of

Penicillin dust exposure and penicillin resistance among pharmaceutical workers in Tehran, Iran.

Science.gov (United States)

Farshad, Ali Asghar; Enferadi, Mojtaba; Bakand, Shahnaz; Jamshidi Orak, Rouhangiz; Mirkazemi, Roksana

2016-07-01

Antimicrobial resistance (AMR) adversely impacts the prevention and treatment of a wide range of infections and is considered as a serious threat to global public health. Occupational-related AMR is a neglected area of research. To assess exposure to penicillin dust, penicillin active materials, and to report the frequency of penicillin resistance among pharmaceutical workers in Tehran, Iran. A quasi-experimental study was conducted among workers on a penicillin production line in a pharmaceutical company (n = 60) and workers in a food producing company (n = 60). Data were collected via survey, air sampling, and throat swab. The mean overall concentrations of penicillin dust and penicillin active material were 6.6 and 4.3 mg/m 3 , respectively, in the pharmaceutical industry. Streptococcus pneumoniae (S. pneumoniae) was detected in 45% (27) individuals in the exposed group, 92.6% of which showed penicillin resistance. Resistance was significantly higher among workers in penicillin production line (p = 0.014). High level of AMR among workers in penicillin production line is a health risk for the workers as well as society as a whole through the spread of drug resistant micro-organisms.

Peptide deformylase as an antibacterial drug target: target validation and resistance development.

Science.gov (United States)

Apfel, C M; Locher, H; Evers, S; Takács, B; Hubschwerlen, C; Pirson, W; Page, M G; Keck, W

2001-04-01

New inhibitors of peptide deformylase (PDF) which are very potent against the isolated enzyme and show a certain degree of antibacterial activity have recently been synthesized by our group. Several lines of experimental evidence indicate that these inhibitors indeed interfere with the target enzyme in the bacterial cell. (i) The inhibition of Escherichia coli growth could be counteracted by overexpression of PDF from different organisms, including E. coli, Streptococcus pneumoniae, and Haemophilus influenzae. Conversely, reduced expression of PDF in S. pneumoniae resulted in an increased susceptibility to the inhibitors. (ii) Proteome analysis on two-dimensional gels revealed a shift for many proteins towards lower pI in the presence of PDF inhibitors, as would be expected if the proteins still carry their N-formyl-Met terminus. (iii) PDF inhibitors show no antimicrobial activity against E. coli under conditions that make growth independent of formylation and deformylation. The antibacterial activity in E. coli was characterized as bacteriostatic. Furthermore, the development of resistance in E. coli was observed to occur with high frequency (10(-7)). Resistant mutants show a reduced growth rate, and DNA sequence analysis revealed mutations in their formyl transferase gene. Taking all these aspects into account, we conclude that PDF may not be an optimal target for broad-spectrum antibacterial agents.

A novel computational method identifies intra- and inter-species recombination events in Staphylococcus aureus and Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Lisa Sanguinetti

Full Text Available Advances in high-throughput DNA sequencing technologies have determined an explosion in the number of sequenced bacterial genomes. Comparative sequence analysis frequently reveals evidences of homologous recombination occurring with different mechanisms and rates in different species, but the large-scale use of computational methods to identify recombination events is hampered by their high computational costs. Here, we propose a new method to identify recombination events in large datasets of whole genome sequences. Using a filtering procedure of the gene conservation profiles of a test genome against a panel of strains, this algorithm identifies sets of contiguous genes acquired by homologous recombination. The locations of the recombination breakpoints are determined using a statistical test that is able to account for the differences in the natural rate of evolution between different genes. The algorithm was tested on a dataset of 75 genomes of Staphylococcus aureus and 50 genomes comprising different streptococcal species, and was able to detect intra-species recombination events in S. aureus and in Streptococcus pneumoniae. Furthermore, we found evidences of an inter-species exchange of genetic material between S. pneumoniae and Streptococcus mitis, a closely related commensal species that colonizes the same ecological niche. The method has been implemented in an R package, Reco, which is freely available from supplementary material, and provides a rapid screening tool to investigate recombination on a genome-wide scale from sequence data.

Molecular Detection of Streptococcus pneumoniae on Dried Blood Spots from Febrile Nigerian Children Compared to Culture.

Directory of Open Access Journals (Sweden)

Pui-Ying Iroh Tam

Full Text Available Nigeria has one of the highest burdens of pneumococcal disease in the world, but accurate surveillance is lacking. Molecular detection of infectious pathogens in dried blood spots (DBS is an ideal method for surveillance of infections in resource-limited settings because of its low cost, minimal blood volumes involved, and ease of storage at ambient temperature. Our study aim was to evaluate a Streptococcus pneumoniae real-time polymerase chain reaction (rt-PCR assay on DBS from febrile Nigerian children on Whatman 903 and FTA filter papers, compared to the gold standard of culture.Between September 2011 to May 2015, blood was collected from children 5 years of age or under who presented to six hospital study sites throughout northern and central Nigeria with febrile illness, and inoculated into blood culture bottles or spotted onto Whatman 903 or FTA filter paper. Culture and rt-PCR were performed on all samples.A total of 537 DBS specimens from 535 children were included in the study, of which 15 were culture-positive for S. pneumoniae. The rt-PCR assay detected S. pneumoniae in 12 DBS specimens (2.2%. One positive rt-PCR result was identified in a culture-negative specimen from a high-risk subject, and two positive rt-PCR results were negative on repeat testing. Six culture-confirmed cases of S. pneumoniae bacteremia were missed. Compared to culture, the overall sensitivities of Whatman 903 and FTA DBS for detection of S. pneumoniae were 57.1% (95% CI 18.4-90.1% and 62.5% (95% CI 24.5-91.5%, respectively. Nonspecific amplification was noted in an additional 22 DBS (4.1%. Among these, six were positive for a non-S. pneumoniae pathogen on culture.Rt-PCR was able to detect S. pneumoniae from clinical DBS specimens, including from a culture-negative specimen. Our findings show promise of this approach as a surveillance diagnostic, but also raise important cautionary questions. Several DBS specimens were detected as S. pneumoniae by rt-PCR despite

Molecular Detection of Streptococcus pneumoniae on Dried Blood Spots from Febrile Nigerian Children Compared to Culture.

Science.gov (United States)

Iroh Tam, Pui-Ying; Hernandez-Alvarado, Nelmary; Schleiss, Mark R; Hassan-Hanga, Fatimah; Onuchukwu, Chuma; Umoru, Dominic; Obaro, Stephen K

2016-01-01

Nigeria has one of the highest burdens of pneumococcal disease in the world, but accurate surveillance is lacking. Molecular detection of infectious pathogens in dried blood spots (DBS) is an ideal method for surveillance of infections in resource-limited settings because of its low cost, minimal blood volumes involved, and ease of storage at ambient temperature. Our study aim was to evaluate a Streptococcus pneumoniae real-time polymerase chain reaction (rt-PCR) assay on DBS from febrile Nigerian children on Whatman 903 and FTA filter papers, compared to the gold standard of culture. Between September 2011 to May 2015, blood was collected from children 5 years of age or under who presented to six hospital study sites throughout northern and central Nigeria with febrile illness, and inoculated into blood culture bottles or spotted onto Whatman 903 or FTA filter paper. Culture and rt-PCR were performed on all samples. A total of 537 DBS specimens from 535 children were included in the study, of which 15 were culture-positive for S. pneumoniae. The rt-PCR assay detected S. pneumoniae in 12 DBS specimens (2.2%). One positive rt-PCR result was identified in a culture-negative specimen from a high-risk subject, and two positive rt-PCR results were negative on repeat testing. Six culture-confirmed cases of S. pneumoniae bacteremia were missed. Compared to culture, the overall sensitivities of Whatman 903 and FTA DBS for detection of S. pneumoniae were 57.1% (95% CI 18.4-90.1%) and 62.5% (95% CI 24.5-91.5%), respectively. Nonspecific amplification was noted in an additional 22 DBS (4.1%). Among these, six were positive for a non-S. pneumoniae pathogen on culture. Rt-PCR was able to detect S. pneumoniae from clinical DBS specimens, including from a culture-negative specimen. Our findings show promise of this approach as a surveillance diagnostic, but also raise important cautionary questions. Several DBS specimens were detected as S. pneumoniae by rt-PCR despite growth of

Etiology of community-acquired pneumonia in hospitalized patients in Jordan

International Nuclear Information System (INIS)

Al-Ali, Musa K.; Batchoun, R. G.; Al-Nour, Tariq M.

2006-01-01

To ascertain the causative organisms of community acquired pneumonia (Cap) in Jordanian patients requiring hospital admission. A prospective study of both adults and children admitted to Princess Basma and Princess Rahma Teaching Hospitals in Irbid, Jordan with a diagnosis of CAP over a 6-month period from April to October 2002. A total of 35 adult patients were admitted with a mean age of 47 years, and 63 children with a mean age of 3 years. A pathogen was isolated from 25 (71%) adults, and from 17 (27%) children, and sputum cultures gave the best diagnostic yield. In adults Streptococcus pneumoniae was the most common isolate (26%), followed by Chlamydia pneumoniae (23%), Haemophilus influenzae (17%), Mycoplasma pneumoniae (9%), and Legionella pneumophila and Klebsiella pneumoniae (6%) each. Seven of the 9 gram negative isolates were from patients with some co morbid illness. While in children, Chlamydia pneumoniae was the most common (14%), followed by Mycoplasma pneumoniae (6%), and Streptococcus pneumoniae, Haemophilus influenzae, and Pseudomonas aeruginosa (3%) each. Streptococcus pneumoniae and atypical microorganisms are the most common cause of CAP in previously healthy adults; while in those with associated co morbid illness, gram negative organisms are the likely cause. In children, the overall detection rate of causative organisms was low with atypical microorganisms being the most common. (author)

Frequency of resistance to penicillin and erythromycin of pneumococcal strains that caused ottis media

Directory of Open Access Journals (Sweden)

Jovanović Luka

2017-01-01

Full Text Available Introduction: Streptococcus pneumoniae is an important human pathogen and the most common cause of acute otitis media (AOM, especially in children. It is also a common cause of community acquired pneumonia, sepsis and bacterial meningitis. Drug of choice in the treatment of these disease are beta lactam antibiotics, and the first alternative are macrolides. The increasing prevalence of resistance to penicillin and macrolides, among pneumococci, has considerably complicated the treatment. Aim: The aim of this study was to determine susceptibility of pneumococcal isolates from pediatric AOM in Serbia to antibiotics. Material and methods: Antimicrobial susceptibility testing of 61 pneumococcal AOM was performed, collected from December 2014 to December 2015, using disk diffusion method and E test. Macrolide resistance profile was determined by double disk diffusion test. Results: In our study, 40 strains (65.6% showed reduced sensitivity to penicillin and erythromycin. There were 9 (14.8% high resistant isolates to penicillin, while 31 (50.8% showed reduced susceptibility. The most frequent resistance phenotype was cMLS. Co-resistance to penicillin and macrolides was found in 14.8% strains. Conclusion: Our results showed high resistance rate of S. pneumoniae, which causes AOM among children, to penicillin and macrolides. Further active surveillance of pneumococcal susceptibility to antibiotics is necessary, and use of these medications in empirical therapy should be limited.

Septicaemia models using Streptococcus pneumoniae and Listeria monocytogenes: understanding the role of complement properdin.

Science.gov (United States)

Dupont, Aline; Mohamed, Fatima; Salehen, Nur'Ain; Glenn, Sarah; Francescut, Lorenza; Adib, Rozita; Byrne, Simon; Brewin, Hannah; Elliott, Irina; Richards, Luke; Dimitrova, Petya; Schwaeble, Wilhelm; Ivanovska, Nina; Kadioglu, Aras; Machado, Lee R; Andrew, Peter W; Stover, Cordula

2014-08-01

Streptococcus pneumoniae and Listeria monocytogenes, pathogens which can cause severe infectious disease in human, were used to infect properdin-deficient and wildtype mice. The aim was to deduce a role for properdin, positive regulator of the alternative pathway of complement activation, by comparing and contrasting the immune response of the two genotypes in vivo. We show that properdin-deficient and wildtype mice mounted antipneumococcal serotype-specific IgM antibodies, which were protective. Properdin-deficient mice, however, had increased survival in the model of streptococcal pneumonia and sepsis. Low activity of the classical pathway of complement and modulation of FcγR2b expression appear to be pathogenically involved. In listeriosis, however, properdin-deficient mice had reduced survival and a dendritic cell population that was impaired in maturation and activity. In vitro analyses of splenocytes and bone marrow-derived myeloid cells support the view that the opposing outcomes of properdin-deficient and wildtype mice in these two infection models is likely to be due to a skewing of macrophage activity to an M2 phenotype in the properdin-deficient mice. The phenotypes observed thus appear to reflect the extent to which M2- or M1-polarised macrophages are involved in the immune responses to S. pneumoniae and L. monocytogenes. We conclude that properdin controls the strength of immune responses by affecting humoral as well as cellular phenotypes during acute bacterial infection and ensuing inflammation.

Importance of Bacterial Replication and Alveolar Macrophage-Independent Clearance Mechanisms during Early Lung Infection with Streptococcus pneumoniae

Science.gov (United States)

Camberlein, Emilie; Cohen, Jonathan M.; José, Ricardo; Hyams, Catherine J.; Callard, Robin; Chimalapati, Suneeta; Yuste, Jose; Edwards, Lindsey A.; Marshall, Helina; van Rooijen, Nico; Noursadeghi, Mahdad

2015-01-01

Although the importance of alveolar macrophages for host immunity during early Streptococcus pneumoniae lung infection is well established, the contribution and relative importance of other innate immunity mechanisms and of bacterial factors are less clear. We have used a murine model of S. pneumoniae early lung infection with wild-type, unencapsulated, and para-amino benzoic acid auxotroph mutant TIGR4 strains to assess the effects of inoculum size, bacterial replication, capsule, and alveolar macrophage-dependent and -independent clearance mechanisms on bacterial persistence within the lungs. Alveolar macrophage-dependent and -independent (calculated indirectly) clearance half-lives and bacterial replication doubling times were estimated using a mathematical model. In this model, after infection with a high-dose inoculum of encapsulated S. pneumoniae, alveolar macrophage-independent clearance mechanisms were dominant, with a clearance half-life of 24 min compared to 135 min for alveolar macrophage-dependent clearance. In addition, after a high-dose inoculum, successful lung infection required rapid bacterial replication, with an estimated S. pneumoniae doubling time of 16 min. The capsule had wide effects on early lung clearance mechanisms, with reduced half-lives of 14 min for alveolar macrophage-independent and 31 min for alveolar macrophage-dependent clearance of unencapsulated bacteria. In contrast, with a lower-dose inoculum, the bacterial doubling time increased to 56 min and the S. pneumoniae alveolar macrophage-dependent clearance half-life improved to 42 min and was largely unaffected by the capsule. These data demonstrate the large effects of bacterial factors (inoculum size, the capsule, and rapid replication) and alveolar macrophage-independent clearance mechanisms during early lung infection with S. pneumoniae. PMID:25583525

Inhaled Antibiotics in the Treatment of Nosocomial Pneumonia

OpenAIRE

A. N. Kuzovlev; V. V. Moroz; A. M. Golubev; S. G. Polovnikov

2013-01-01

Nosocomial pneumonia is the most common nosocomial infection in intensive care units. Rational antibiotic therapy is the basis for the treatment of nosocomial pneumonia. There is currently a challenge of the pathogens of nosocomial pneumonia being resistant to most of the antibiotics recommended for its treatment. Inhaled antibiotics used in combination with systemic drugs are an effective and safe treatment for nosocomial pneumonia. This review of literature characterizes the current possibi...

Recurrent Streptococcus Pneumoniae Meningitis in a Child with Split Hand and Foot Malformation and Undiagnosed Mondini Dysplasia.

Science.gov (United States)

Katarzyna, Mazur-Melewska; Jarosław, Szydłowski; Katarzyna, Jończyk-Potoczna; Wojciech, Służewski; Magdalena, Figlerowicz

Recurrent bacterial meningitis is a life-threatening infection of the central nervous system that is mostly connected with anatomical abnormalities of the skull, chronic parameningeal infections and immunodeficiencies. It's rarely seen, but when it occurs an extensive investigation should be carried out to discover the responsible factor, so that further episodes can be prevented. We report on a child with split hand and foot (SHFM), confirmed incorrect karyotype 46, XY, t(7:12)(q21.2;q21.3) and a fourth episode of fulminant meningitis caused by penicillin-resistant Streptococcus pneumoniae . After a broad evaluation of factors predisposing to recurrent meningitis, the undiagnosed malformation of his inner and middle ears - Mondini dysplasia was found. We suggest examining all children with SHFM for hearing impairment before they develop recurrent meningitis. The time when the radiological procedure for searching for inner ear dysplasia should be performed could be a controversial issue: before or after the first episode of meningitis. From the epidemiological point of view, high-resolution computer tomography scanning of the temporal bones should be considered after the diagnosis of deafness in a child with SHFM related to 7q21 deletion.

Pathogen infection distribution and drug resistance analysis of patients with severe liver disease

Directory of Open Access Journals (Sweden)

Xi CHEN

2018-04-01

Full Text Available Objective　To explore the infection distribution and drug resistance of pathogens in patients with severe liver disease, and provide reference for clinical medication. Methods　Retrospective analysis of the microbiological specimens from patients with severe liver disease in Department of Infection of our hospital from August 2014 to November 2016 and the drug susceptibility testing were carried out by means of K-B disc diffusion method after bacterial culturing, and the distribution and drug resistance of pathogens were analyzed. Results　Totally 17 of 73 patients with severe liver disease developed hospital infection (23.3%. 104 strains of bacteria were isolated and 78 strains out of them were multidrug-resistant bacteria (75.0%. Among them, 28(26.9% strains were gram-positive coccus, mainly consisting of Staphylococcus aureus and Staphylococcus epidermidis, and 58(55.8% were gram-negative coccus, mainly composed of Escherichia coli, Klebsiella pneumonia and Acinetobacter baumannii, and 18(17.3% strains fungi. S.aureus and enterococci were resistant to penicillin, erythromycin and levofloxacin, the resistance rates were above 80.0%, but had low resistance rates to vancomycin, teicoplanin and tigecycline. The resistance rates of E.coli and K.pneumoniae to piperacillin, cefazolin and cefuroxime sodium were above 85.0%, but they had lower resistance rates to tigecycline and amikacin. Acinetobacter baumannii was 100% resistant to piperacillin and tazobactam, ceftazidime, imipenem and amikacin, but had low resistance to tigecycline and minocycline. Conclusions　Multi-drug resistant bacteria are the main bacterial pathogens in patients with severe liver disease and have a high resistance rate to commonly used antibiotics, empirical treatment in the population at high risk of multidrug-resistant bacteria infections requires the use of broad-spectrum or high-grade antibiotics (e.g. carbapenems or tigecycline and drugs against specific pathogenic

N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Muhammad Afzal

2016-09-01

Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

Polarity of recombination in transformation of Streptococcus pneumoniae.

Science.gov (United States)

Pasta, F; Sicard, M A

1999-03-16

In transformation of Streptococcus pneumoniae DNA enters the cell as single-strand fragments and integrates into the chromosome by homologous recombination. Deletions and insertions of a few hundred base pairs frequently stop the recombination process of a donor strand. In this work we took advantage of such interruptions of recombination to compare the transformation efficiencies of the segments 5'- and 3'-ward from a deletion. The deletion was created in the center of a fragment of the ami locus, and sites around the deletion were labeled by a frameshift generating a restriction site. Heteroduplexes were constructed containing two restriction sites on one strand and two different ones on the complementary strand. ami+ bacteria were transformed with such heteroduplexes. ami- transformants were isolated and individually underwent amplification of the transformed ami region. We have obtained two kinds of amplification products: short when the deletion was integrated, long when recombination stops at the deletion. Each long fragment was tested by the four restriction enzymes to detect which strand and which side of the deletion had recombined. We found that 80% of the cuts were located 5' to the deletion, showing that, in vivo, the 5' side is strongly favored by recombination. Further results suggest that exchanges occurring from 5' to 3' relative to the donor strand are more efficient than in the opposite direction, thus accounting for the 5' preference.

Dynamics of Lung Defense in Pneumonia: Resistance, Resilience, and Remodeling

Science.gov (United States)

Quinton, Lee J.; Mizgerd, Joseph P.

2015-01-01

Pneumonia is initiated by microbes in the lung, but physiological processes integrating responses across diverse cell types and organ systems dictate the outcome of respiratory infection. Resistance, or actions of the host to eradicate living microbes, in the lungs involves a combination of innate and adaptive immune responses triggered by air-space infection. Resilience, or the ability of the host tissues to withstand the physiologically damaging effects of microbial and immune activities, is equally complex, precisely regulated, and determinative. Both immune resistance and tissue resilience are dynamic and change throughout the lifetime, but we are only beginning to understand such remodeling and how it contributes to the incidence of severe pneumonias, which diminishes as childhood progresses and then increases again among the elderly. Here, we review the concepts of resistance, resilience, and remodeling as they apply to pneumonia, highlighting recent advances and current significant knowledge gaps. PMID:25148693

Nasopharyngeal bacterial carriage and antimicrobial resistance in underfive children with community acquired pneumonia

Directory of Open Access Journals (Sweden)

Cissy B. Kartasasmita

2001-12-01

Full Text Available Lung puncture is the best way to determine the etiology of pneumonia since it yields the highest rate of positive cultures. However, this procedure is difficult, especially for a study in the community. According to WHO, isolates to be tested for antimicrobial resistance in the community should be obtained from nasopharyngeal (NP swabs. Previous studies support the use of NP isolates to determine antimicrobial resistance patterns of isolates from children with pneumonia. The aim of our study was to know the bacterial patterns of the nasopharynx in underfive children with community acquired pneumonia and their antimicrobial resistance. The study was carried out in 4 Primary Health Clinics in Majalaya sub-district, Bandung, Indonesia. All underfives with cough or difficult breathing and classified as having non-severe pneumonia (WHO guidelines, were included in the study. Nasopharyngeal swabs (CDC/WHO Manual were obtained by the doctor, the swabs were placed in Amies transport medium and stored in a sterile jar before taken to the laboratory in the same day. All children were treated with co-trimoxazole. During the nine month study, 698 children with clinical signs of non-severe pneumonia were enrolled. About 25% of the nasopharyngeal specimens yielded bacterial isolates; the two most frequently found were S. pneumoniae and S. epidermidis. The antimicrobial resistance test to co-trimoxazole showed 48.2% S. pneumoniae strain had full resistance and 32.7% showed intermediate resistance to co-trimoxazole. This result is almost similar to other studies from Asian countries. It seems that H. influenzae is not a problem in the study area; however, further studies are needed.

Mechanisms of methicillin-resistant Staphylococcus aureus pneumonia-induced intestinal epithelial apoptosis.

Science.gov (United States)

Perrone, Erin E; Jung, Enjae; Breed, Elise; Dominguez, Jessica A; Liang, Zhe; Clark, Andrew T; Dunne, W Michael; Burd, Eileen M; Coopersmith, Craig M

2012-07-01

Methicillin-resistant Staphylococcus aureus (MRSA) pneumonia-induced sepsis is a common cause of morbidity in the intensive care unit. Although pneumonia is initiated in the lungs, extrapulmonary manifestations occur commonly. In light of the key role the intestine plays in the pathophysiology of sepsis, we sought to determine whether MRSA pneumonia induces intestinal injury. FVB/N mice were subjected to MRSA or sham pneumonia and killed 24 h later. Septic animals had a marked increase in intestinal epithelial apoptosis by both hematoxylin-eosin and active caspase 3 staining. Methicillin-resistant S. aureus-induced intestinal apoptosis was associated with an increase in the expression of the proapoptotic proteins Bid and Bax and the antiapoptotic protein Bcl-xL in the mitochondrial pathway. In the receptor-mediated pathway, MRSA pneumonia induced an increase in Fas ligand but decreased protein levels of Fas, FADD, pFADD, TNF-R1, and TRADD. To assess the functional significance of these changes, MRSA pneumonia was induced in mice with genetic manipulations in proteins in either the mitochondrial or receptor-mediated pathways. Both Bid-/- mice and animals with intestine-specific overexpression of Bcl-2 had decreased intestinal apoptosis compared with wild-type animals. In contrast, Fas ligand-/- mice had no alterations in apoptosis. To determine if these findings were organism-specific, similar experiments were performed in mice subjected to Pseudomonas aeruginosa pneumonia. Pseudomonas aeruginosa induced gut apoptosis, but unlike MRSA, this was associated with increased Bcl-2 and TNF-R1 and decreased Fas. Methicillin-resistant S. aureus pneumonia thus induces organism-specific changes in intestinal apoptosis via changes in both the mitochondrial and receptor-mediated pathways, although the former may be more functionally significant.

Susceptibilidad antimicrobiana de Streptococcus pneumoniae colonizante de nasofaringe en niños colombianos con neumonía

Directory of Open Access Journals (Sweden)

Aura Lucía Leal

1997-04-01

Full Text Available Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia en 7 (6%. Solo 1 de los 19 aislamientos resistentes a penicilina mostró también resistencia a la ceftriaxona. Se observó sensibilidad disminuida a la eritromicina en 3 aislamientos (3%, al cloranfenicol en 6 (5% y al cotrimoxazol (trimetoprima + sulfametoxazol en 46 (40%. Se encontró multirresistencia en 7 aislamientos (6%. El serotipo con sensibilidad disminuida a la penicilina que se halló con mayor frecuencia fue el 23F (68,4%. Se observó una asociación entre la edad, el uso previo de antibióticos y la colonización con S. pneumoniae con susceptibilidad disminuida a la penicilina o multirresistencia. Este estudio confirma la presencia de resistencia antimicrobiana de S. pneumoniae en Colombia y resalta la importancia del uso racional de los antibióticos y de la implementación de la vigilancia epidemiológica sobre este agente.

Antibacterial activity of Euphorbia hirta against Streptococcus ...

African Journals Online (AJOL)

This investigation was conducted to determine the in-vitro effect of aqueous, ethanol and methanol crude extracts of Euphorbia hirta at concentrations ranging from 10mg/ml – 100mg/ml against three pathogenic bacteria (Streptococcus pneumoniae, Klebsiella pneumoniae and Proteus vulgaris) using cup plate method.

Meningitis caused by streptococci other than Streptococcus pneumoniae: a retrospective clinical study

DEFF Research Database (Denmark)

Møller, Kirsten; Harder, Eva; Wandall, Johan

1999-01-01

We reviewed the medical records of 26 patients (median age 62 years, range 5-76 years) admitted to our institution during 1978-98 with acute bacterial meningitis (ABM) caused by streptococci other than Streptococcus pneumoniae (comprising 1.9% of all patients with ABM). 19 cases were community......-acquired and 7 were nosocomial. 73% had comorbid or predisposing conditions and 73% had an identifiable extracerebral focus; only in 2 patients no comorbid disease, primary focus or predisposing condition was present. Five patients had cerebral abscesses, and 5 had endocarditis. Beta-haemolytic streptococci were...... grown in 14 cases (serotype A: 4, B: 5, C: 1, G: 4) and were predominant among patients with endocarditis, whereas alpha- or non-haemolytic strains grew in 12 cases (S. mitis: 4, S. constellatus: 2, E. faecalis: 2, S. bovis: 1, unspecified: 3) and were predominant in patients with a brain abscess...

Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Feroze Ahmed Ganaie

2015-01-01

Full Text Available Rapid diagnosis of Streptococcus pneumoniae can play a significant role in decreasing morbidity and mortality of infection. The accurate diagnosis of pneumococcal disease is hampered by the difficulties in growing the isolates from clinical specimens and also by misidentification. Molecular methods have gained popularity as they offer improvement in the detection of causative pathogens with speed and ease. The present study aims at validating and standardising the use of 4 oligonucleotide primer-probe sets (pneumolysin [ply], autolysin [lytA], pneumococcal surface adhesion A [psaA] and Spn9802 [DNA fragment] in a single-reaction mixture for the detection and discrimination of S. pneumoniae. Here, we validate a quantitative multiplex real-time PCR (qmPCR assay with a panel consisting of 43 S. pneumoniae and 29 non-pneumococcal isolates, 20 culture positive, 26 culture negative and 30 spiked serum samples. A standard curve was obtained using S. pneumoniae ATCC 49619 strain and glyceraldehyde 3-phosphate dehydrogenase (GAPDH gene was used as an endogenous internal control. The experiment showed high sensitivity with lower limit of detection equivalent to 4 genome copies/µl. The efficiency of the reaction was 100% for ply, lytA, Spn9802 and 97% for psaA. The test showed sensitivity and specificity of 100% with culture isolates and serum specimens. This study demonstrates that qmPCR analysis of sera using 4 oligonucleotide primers appears to be an appropriate method for the genotypic identification of S. pneumoniae infection.

Synergistic activity of synthetic N-terminal peptide of human lactoferrin in combination with various antibiotics against carbapenem-resistant Klebsiella pneumoniae strains.

Science.gov (United States)

Morici, P; Florio, W; Rizzato, C; Ghelardi, E; Tavanti, A; Rossolini, G M; Lupetti, A

2017-10-01

The spread of multi-drug resistant (MDR) Klebsiella pneumoniae strains producing carbapenemases points to a pressing need for new antibacterial agents. To this end, the in-vitro antibacterial activity of a synthetic N-terminal peptide of human lactoferrin, further referred to as hLF1-11, was evaluated against K. pneumoniae strains harboring different carbapenemase genes (i.e. OXA-48, KPC-2, KPC-3, VIM-1), with different susceptibility to colistin and other antibiotics, alone or in combination with conventional antibiotics (gentamicin, tigecycline, rifampicin, clindamycin, and clarithromycin). An antimicrobial peptide susceptibility assay was used to assess the bactericidal activity of hLF1-11 against the different K. pneumoniae strains tested. The synergistic activity was evaluated by a checkerboard titration method, and the fractional inhibitory concentration (FIC) index was calculated for the various combinations. hLF1-11 was more efficient in killing a K. pneumoniae strain susceptible to most antimicrobials (including colistin) than a colistin-susceptible strain and a colistin-resistant MDR K. pneumoniae strain. In addition, hLF1-11 exhibited a synergistic effect with the tested antibiotics against MDR K. pneumoniae strains. The results of this study indicate that resistance to hLF1-11 and colistin are not strictly associated, and suggest an hLF1-11-induced sensitizing effect of K. pneumoniae to antibiotics, especially to hydrophobic antibiotics, which are normally not effective on Gram-negative bacteria. Altogether, these data indicate that hLF1-11 in combination with antibiotics is a promising candidate to treat infections caused by MDR-K. pneumoniae strains.

Serotype Distribution and Antimicrobial Sensitivity Profile of Streptococcus pneumoniae Carried in Healthy Toddlers before PCV13 Introduction in Niamey, Niger.

Directory of Open Access Journals (Sweden)

Sani Ousmane

Full Text Available To mitigate the burden of pneumococcal infections in Niger, a 13-valent pneumococcal vaccine, PCV13, was introduced for routine child vaccination in July 2014. In order to provide pre-vaccine baseline data and allow appreciation of changes on carriage due to vaccination, we analyzed retrospectively pneumococcal isolates obtained from healthy, 0 to 2 year old children prior to the vaccine introduction.From June 5, 2007, to May 26, 2008, 1200 nasopharyngeal swabs were collected from healthy 0 to 2 year old children and analyzed by standard microbiological methods. Serotyping was done by SM-PCR and the data were analyzed with R version 2.15.0 (2012-03-30.Streptococcus pneumoniae was detected in 654/1200 children (54.5% among whom 339 (51.8% were males. The ages of the study subjects varied from few days to 26 months (mean = 7.1, median = 6, 95% CI [6.8-7.4]. Out of 654 frozen isolates, 377 (54.8% were able to be re-grown and analyzed. In total, 32 different serogroups/serotypes were detected of which, the most prevalent were 6/(6A/6B/6C/6D (15.6%, 23F (10.6%, 19F (9.3%, 14 (9%, 19A (5.6%, 23B (4.0%, 25F/38 (3.7%, 18/(18A/18B/18C/18F (2.9% and PCR non-typeable (16.4%. Eleven serogroups/serotypes accounting for 57.3% (216/377 were of PCV13 types. Of the 211/377 (56% isolates tested for drug sensitivity, 23/211 (10.9%, 24/211 (11.4%, 9/211(4.3% and 148/210 (70.5% were respectively resistance to oxacillin, chloramphenicol, erythromycin and tetracycline. Thirteen of the oxacillin resistant isolates were additionally multidrug-resistant. No resistance was however detected to gentamycin500μg and to fluoroquinolones (ø Norfloxacin5μg 3 months and presence in family of more than one sibling aged 3 months and presence in family of children aged < 6 years were significant factors for pneumococcal carriage. The present data should help understanding post vaccine introduction changes in pneumococcal carriage and infections for better action.

Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva.

Science.gov (United States)

Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato

2018-01-01

Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

Efficacy of some synthetic antibiotics on Streptococcus pneumoniae ...

African Journals Online (AJOL)

Effects of some synthetic antibiotics on Streptococcus pnemoniae and Proteus mirabilis isolated from cultured Clarias gariepinus, an important food fish raised in a concrete tank was carried out to ascertain their remedies on mortalities of the Clarias gariepinus adult fish. Streptococcus pnemoniae and Proteus mirabilis were ...

First emergence of acrAB and oqxAB mediated tigecycline resistance in clinical isolates of Klebsiella pneumoniae pre-dating the use of tigecycline in a Chinese hospital.

Directory of Open Access Journals (Sweden)

Xue Zhong

Full Text Available Tigecycline is one of the few therapeutic options for treating infections caused by some multi-drug resistant pathogens, such as Klebsiella pneumoniae. However, tigecycline-resistant K. pneumoniae has been discovered recently in China. From 2009 to 2013, nine tigecycline-resistant K. pneumoniae isolates were identified in our hospital. Six of nine strains were identified before using tigecycline. To investigate the efflux-mediated resistance mechanisms of K. pneumoniae, the expression of efflux pump genes (acrA, acrB, tolC, oqxA and oqxB and pump regulators (acrR, marA, soxS, rarA, rob and ramA were examined by real-time RT-PCR. Molecular typing of the tigecycline resistant strains was performed. ST11 was the predominant clone of K. pneumoniae strains, while ST1414 and ST1415 were novel STs. Efflux pump inhibitor (EPI-carbonyl cyanide chlorophenylhydrazone (CCCP was able to reverse the resistance patterns of 5 resistant K. pneumoniae strains. In comparison with strain A111, a tigecycline-susceptible strain (negative control, we found that the expression levels of efflux pump genes and pump regulators were higher in a majority of resistant strains. Higher expression levels of regulators rarA (2.41-fold, 9.55-fold, 28.44-fold and 18.31-fold, respectively and pump gene oqxB (3.87-fold, 31.96-fold, 50.61-fold and 29.45-fold, respectively were observed in four tigecycline resistant strains (A363, A361, A368, A373, respectively. Increased expression of acrB was associated with ramA and marA expression. To our knowledge, studies on tigecycline resistance mechanism in K. pneumoniae are limited especially in China. In our study, we found that both efflux pump AcrAB-TolC and OqxAB contributed to tigecycline resistance in K. pneumoniae isolates.

Effect of Xylitol on Growth of Streptococcus pneumoniae in the Presence of Fructose and Sorbitol

Science.gov (United States)

Tapiainen, Terhi; Kontiokari, Tero; Sammalkivi, Laura; Ikäheimo, Irma; Koskela, Markku; Uhari, Matti

2001-01-01

Xylitol is effective in preventing acute otitis media by inhibiting the growth of Streptococcus pneumoniae. To clarify this inhibition we used fructose, which is known to block similar growth inhibition observed in Streptococcus mutans. In addition, we evaluated the efficacy of sorbitol in inhibiting the growth of pneumococci, as sorbitol is widely used for indications similar to those for which xylitol is used. The addition of 5% xylitol to the growth medium resulted in marked growth inhibition, an effect which was totally eliminated in the presence of 1, 2.5, or 5% fructose but not in the presence of 1 or 5% glucose, 1% galactose, or 1% sucrose. This finding implies that xylitol-induced inhibition of pneumococcal growth is mediated via the fructose phosphotransferase system in a way similar to that in which mutans group streptococcal growth is inhibited. The addition of sorbitol at concentrations of 1, 2.5, or 5% to the growth medium did not affect the growth of pneumococci and neither inhibited nor enhanced the xylitol-induced growth impairment. Thus, it seems that xylitol is the only commercially used sugar substitute proven to have an antimicrobial effect on pneumococci. PMID:11120960

Streptococcus pneumoniae-Induced Oxidative Stress in Lung Epithelial Cells Depends on Pneumococcal Autolysis and Is Reversible by Resveratrol.

Science.gov (United States)

Zahlten, Janine; Kim, Ye-Ji; Doehn, Jan-Moritz; Pribyl, Thomas; Hocke, Andreas C; García, Pedro; Hammerschmidt, Sven; Suttorp, Norbert; Hippenstiel, Stefan; Hübner, Ralf-Harto

2015-06-01

Streptococcus pneumoniae is the most common cause of community-acquired pneumonia worldwide. During pneumococcal pneumonia, the human airway epithelium is exposed to large amounts of H2O2 as a product of host and pathogen oxidative metabolism. Airway cells are known to be highly vulnerable to oxidant damage, but the pathophysiology of oxidative stress induced by S. pneumoniae and the role of nuclear factor erythroid 2-related factor 2 (Nrf2)-mediated antioxidant systems of the host are not well characterized. For gluthation/gluthathion disulfide analysis BEAS-2B cells, primary broncho-epithelial cells (pBEC), explanted human lung tissue and mouse lungs were infected with different S. pneumoniae strains (D39, A66, R6x, H2O2/pneumolysin/LytA- deficient mutants of R6x). Cell death was proven by LDH assay and cell viability by IL-8 ELISA. The translocation of Nrf2 and the expression of catalase were shown via Western blot. The binding of Nrf2 at the catalase promoter was analyzed by ChIP. We observed a significant induction of oxidative stress induced by S. pneumoniae in vivo, ex vivo, and in vitro. Upon stimulation, the oxidant-responsive transcription factor Nrf2 was activated, and catalase was upregulated via Nrf2. The pneumococci-induced oxidative stress was independent of S. pneumoniae-derived H2O2 and pneumolysin but depended on the pneumococcal autolysin LytA. The Nrf2 inducer resveratrol, as opposed to catalase, reversed oxidative stress in lung epithelial cells. These observations indicate a H2O2-independent induction of oxidative stress in lung epithelial cells via the release of bacterial factors of S. pneumoniae. Resveratrol might be an option for prevention of acute lung injury and inflammatory responses observed in pneumococcal pneumonia. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Immunotolerance during bacterial pneumonia and sepsis

NARCIS (Netherlands)

Hoogerwerf, J.J.

2010-01-01

Bacterial pneumonia and sepsis are a major cause of morbidity and mortality worldwide. Massive use of antibiotics promotes pathogen resistance, and, as a consequence, the incidence of drug-resistant bacteria is increasing. Therefore, it is of the utmost importance to expand our comprehension of host

Susceptibility of S. pneumoniae to various antibiotics among strains isolated from patients and healthy carriers in different regions of Brazil (1999-2000

Directory of Open Access Journals (Sweden)

F. Rossi

Full Text Available Resistance of microbes to commonly used antibiotics became a major concern at the end of the last century. Because Streptococcus pneumoniae is the most common pathogen in respiratory infections, we conducted microbiological assessment of drug susceptibility patterns among strains collected from two different population groups: 1 adult and pediatric patients (375 isolates with different infections, and 2 healthy children in day care centers (< 5 years old; 350 isolates. High level resistance to penicillin was not identified in either group. Intermediate resistance levels were similar in both groups (adults: 9.9%; children: 9.2%. The Central West region of Brazil tended to have lower susceptibility of S.pneumoniae from infected adults and children to penicillin (81% vs. 93% in the South and 90% in the Southeast, tetracycline (64% vs. 80% and 76%, and trimethoprim/sulfamethoxazole (14% vs. 34%. Susceptibility was similar among strains from nasal cultures of healthy children tested in each of 4 regions of Brazil. All isolates were susceptible to cefaclor, cefotaxime and amoxacillin/clavulanate. This study, in two distinct populations, allowed characterization of local microbiological resistance patterns. This data is expected to be of use in guiding empiric therapy in the different regions of Brazil.

Associations of Streptococcus suis serotype 2 ribotype profiles with clinical disease and antimicrobial resistance

DEFF Research Database (Denmark)

Rasmussen, S. R.; Aarestrup, Frank Møller; Jensen, N. E.

1999-01-01

A total of 122 Streptococcus suis serotype 2 strains were characterized thoroughly by comparing clinical and pathological observations, ribotype profiles, and antimicrobial resistance. Twenty-one different ribotype profiles were found and compared by cluster analysis, resulting in the identificat......A total of 122 Streptococcus suis serotype 2 strains were characterized thoroughly by comparing clinical and pathological observations, ribotype profiles, and antimicrobial resistance. Twenty-one different ribotype profiles were found and compared by cluster analysis, resulting...

Stress-triggered signaling affecting survival or suicide of Streptococcus pneumoniae.

Science.gov (United States)

Cortes, Paulo R; Piñas, Germán E; Cian, Melina B; Yandar, Nubia; Echenique, Jose

2015-01-01

Streptococcus pneumoniae is a major human pathogen that can survive to stress conditions, such as the acidic environment of inflammatory foci, and tolerates lethal pH through a mechanism known as the acid tolerance response. We previously described that S. pneumoniae activates acidic-stress induced lysis in response to acidified environments, favoring the release of cell wall compounds, DNA and virulence factors. Here, we demonstrate that F(0)F(1)-ATPase is involved in the response to acidic stress. Chemical inhibitors (DCCD, optochin) of this proton pump repressed the ATR induction, but caused an increased ASIL. Confirming these findings, mutants of the subunit c of this enzyme showed the same phenotypes as inhibitors. Importantly, we demonstrated that F(0)F(1)-ATPase and ATR are necessary for the intracellular survival of the pneumococcus in macrophages. Alternatively, a screening of two-component system (TCS) mutants showed that ATR and survival in pneumocytes were controlled in contrasting ways by ComDE and CiaRH, which had been involved in the ASIL mechanism. Briefly, CiaRH was essential for ATR (ComE represses activation) whereas ComE was necessary for ASIL (CiaRH protects against induction). They did not regulate F0F1-ATPase expression, but control LytA expression on the pneumococcal surface. These results suggest that both TCSs and F(0)F(1)-ATPase control a stress response and decide between a survival or a suicide mechanism by independent pathways, either in vitro or in pneumocyte cultures. This biological model contributes to the current knowledge about bacterial response under stress conditions in host tissues, where pathogens need to survive in order to establish infections. Copyright © 2014 Elsevier GmbH. All rights reserved.

Inhaled Antibiotics in the Treatment of Nosocomial Pneumonia

Directory of Open Access Journals (Sweden)

A. N. Kuzovlev

2013-01-01

Full Text Available Nosocomial pneumonia is the most common nosocomial infection in intensive care units. Rational antibiotic therapy is the basis for the treatment of nosocomial pneumonia. There is currently a challenge of the pathogens of nosocomial pneumonia being resistant to most of the antibiotics recommended for its treatment. Inhaled antibiotics used in combination with systemic drugs are an effective and safe treatment for nosocomial pneumonia. This review of literature characterizes the current possibilities of inhaled antibiotic therapy for nosocomial pneumonia in detail and describes medicaments and the advantages and disadvantages of this treatment option. Despite insufficient evidence in circumstances where the microorganisms are polyresistant and where the design of novel antibiotics shows no promise, the use of inhaled antibiotics is an important alternative in the treatment of severe nosocomial pneumonia caused by polyresistant gram-negative bacteria. Key words: nosocomial pneumonia, antibiotic therapy, inhaled antibiotics, resistance.

Prophage spontaneous activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Margarida Carrolo

Full Text Available Streptococcus pneumoniae (pneumococcus is able to form biofilms in vivo and previous studies propose that pneumococcal biofilms play a relevant role both in colonization and infection. Additionally, pneumococci recovered from human infections are characterized by a high prevalence of lysogenic bacteriophages (phages residing quiescently in their host chromosome. We investigated a possible link between lysogeny and biofilm formation. Considering that extracellular DNA (eDNA is a key factor in the biofilm matrix, we reasoned that prophage spontaneous activation with the consequent bacterial host lysis could provide a source of eDNA, enhancing pneumococcal biofilm development. Monitoring biofilm growth of lysogenic and non-lysogenic pneumococcal strains indicated that phage-infected bacteria are more proficient at forming biofilms, that is their biofilms are characterized by a higher biomass and cell viability. The presence of phage particles throughout the lysogenic strains biofilm development implicated prophage spontaneous induction in this effect. Analysis of lysogens deficient for phage lysin and the bacterial major autolysin revealed that the absence of either lytic activity impaired biofilm development and the addition of DNA restored the ability of mutant strains to form robust biofilms. These findings establish that limited phage-mediated host lysis of a fraction of the bacterial population, due to spontaneous phage induction, constitutes an important source of eDNA for the S. pneumoniae biofilm matrix and that this localized release of eDNA favors biofilm formation by the remaining bacterial population.

Meningitis caused by Neisseria Meningitidis, Hemophilus Influenzae Type B and Streptococcus Pneumoniae during 2005–2012 in Turkey

Science.gov (United States)

Ceyhan, Mehmet; Gürler, Nezahat; Ozsurekci, Yasemin; Keser, Melike; Aycan, Ahmet Emre; Gurbuz, Venhar; Salman, Nuran; Camcioglu, Yildiz; Dinleyici, Ener Cagri; Ozkan, Sengul; Sensoy, Gulnar; Belet, Nursen; Alhan, Emre; Hacimustafaoglu, Mustafa; Celebi, Solmaz; Uzun, Hakan; Faik Oner, Ahmet; Kurugol, Zafer; Ali Tas, Mehmet; Aygun, Denizmen; Oncel, Eda Karadag; Celik, Melda; Yasa, Olcay; Akin, Fatih; Coşkun, Yavuz

2014-01-01

Successful vaccination policies for protection from bacterial meningitis are dependent on determination of the etiology of bacterial meningitis. Cerebrospinal fluid (CSF) samples were obtained prospectively from children from 1 month to ≤ 18 years of age hospitalized with suspected meningitis, in order to determine the etiology of meningitis in Turkey. DNA evidence of Neisseria meningitidis (N. meningitidis), Streptococcus pneumoniae (S. pneumoniae), and Hemophilus influenzae type b (Hib) was detected using multiplex polymerase chain reaction (PCR). In total, 1452 CSF samples were evaluated and bacterial etiology was determined in 645 (44.4%) cases between 2005 and 2012; N. meningitidis was detected in 333 (51.6%), S. pneumoniae in 195 (30.2%), and Hib in 117 (18.1%) of the PCR positive samples. Of the 333 N. meningitidis positive samples 127 (38.1%) were identified as serogroup W-135, 87 (26.1%) serogroup B, 28 (8.4%) serogroup A and 3 (0.9%) serogroup Y; 88 (26.4%) were non-groupable. As vaccines against the most frequent bacterial isolates in this study are available and licensed, these results highlight the need for broad based protection against meningococcal disease in Turkey. PMID:25483487

Purification, crystallization and preliminary X-ray diffraction analysis of RafE, a sugar-binding lipoprotein from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Paterson, Neil G.; Riboldi-Tunnicliffe, Alan; Mitchell, Timothy J.; Isaacs, Neil W.

2006-01-01

The mature form of RafE has been expressed, purified and crystallized. X-ray diffraction data have been collected to 3.65 and 2.90 Å resolution from native and selenomethionine-derivative crystals, respectively. Streptococcus pneumoniae contains a large number of sugar-transport systems and the system responsible for raffinose uptake has recently been identified. The substrate-binding protein component of this system shares strong sequence homology with the multiple sugar metabolism substrate-binding protein MsmE from S. mutans and contains a lipoprotein-attachment site at cysteine residue 23. A truncated form (residues 24–419) of RafE from S. pneumoniae was cloned and overexpressed in Escherichia coli. Native and selenomethionine-labelled protein have been crystallized in the hexagonal space group P6 1 22. Diffraction data have been successfully phased to 2.90 Å using Se SAD data and model building is in progress

Crystallization and preliminary crystallographic analysis of the transpeptidase domain of penicillin-binding protein 2B from Streptococcus pneumoniae

Energy Technology Data Exchange (ETDEWEB)

Yamada, Mototsugu, E-mail: mototsugu-yamada@meiji.co.jp; Watanabe, Takashi; Baba, Nobuyoshi; Miyara, Takako; Saito, Jun; Takeuchi, Yasuo [Pharmaceutical Research Center, Meiji Seika Kaisha Ltd, 760 Morooka-cho, Kohoku-ku, Yokohama 222-8567 (Japan)

2008-04-01

The selenomethionyl-substituted transpeptidase domain of penicillin-binding protein (PBP) 2B from S. pneumoniae was isolated from a limited proteolysis digest of the soluble form of recombinant PBP 2B and then crystallized. MAD data were collected to 2.4 Å resolution. Penicillin-binding protein (PBP) 2B from Streptococcus pneumoniae catalyzes the cross-linking of peptidoglycan precursors that occurs during bacterial cell-wall biosynthesis. A selenomethionyl (SeMet) substituted PBP 2B transpeptidase domain was isolated from a limited proteolysis digest of a soluble form of recombinant PBP 2B and then crystallized. The crystals belonged to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 86.39, c = 143.27 Å. Diffraction data were collected to 2.4 Å resolution using the BL32B2 beamline at SPring-8. The asymmetric unit contains one protein molecule and 63.7% solvent.

Crystallization and preliminary crystallographic analysis of the transpeptidase domain of penicillin-binding protein 2B from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Yamada, Mototsugu; Watanabe, Takashi; Baba, Nobuyoshi; Miyara, Takako; Saito, Jun; Takeuchi, Yasuo

2008-01-01

The selenomethionyl-substituted transpeptidase domain of penicillin-binding protein (PBP) 2B from S. pneumoniae was isolated from a limited proteolysis digest of the soluble form of recombinant PBP 2B and then crystallized. MAD data were collected to 2.4 Å resolution. Penicillin-binding protein (PBP) 2B from Streptococcus pneumoniae catalyzes the cross-linking of peptidoglycan precursors that occurs during bacterial cell-wall biosynthesis. A selenomethionyl (SeMet) substituted PBP 2B transpeptidase domain was isolated from a limited proteolysis digest of a soluble form of recombinant PBP 2B and then crystallized. The crystals belonged to space group P4 3 2 1 2, with unit-cell parameters a = b = 86.39, c = 143.27 Å. Diffraction data were collected to 2.4 Å resolution using the BL32B2 beamline at SPring-8. The asymmetric unit contains one protein molecule and 63.7% solvent

Purification, crystallization and preliminary X-ray diffraction analysis of RafE, a sugar-binding lipoprotein from Streptococcus pneumoniae

Energy Technology Data Exchange (ETDEWEB)

Paterson, Neil G., E-mail: neison@chem.gla.ac.uk; Riboldi-Tunnicliffe, Alan [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Mitchell, Timothy J. [Division of Infection and Immunity (IBLS), Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Isaacs, Neil W. [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom)

2006-07-01

The mature form of RafE has been expressed, purified and crystallized. X-ray diffraction data have been collected to 3.65 and 2.90 Å resolution from native and selenomethionine-derivative crystals, respectively. Streptococcus pneumoniae contains a large number of sugar-transport systems and the system responsible for raffinose uptake has recently been identified. The substrate-binding protein component of this system shares strong sequence homology with the multiple sugar metabolism substrate-binding protein MsmE from S. mutans and contains a lipoprotein-attachment site at cysteine residue 23. A truncated form (residues 24–419) of RafE from S. pneumoniae was cloned and overexpressed in Escherichia coli. Native and selenomethionine-labelled protein have been crystallized in the hexagonal space group P6{sub 1}22. Diffraction data have been successfully phased to 2.90 Å using Se SAD data and model building is in progress.

Differential recognition and hydrolysis of host carbohydrate antigens by Streptococcus pneumoniae family 98 glycoside hydrolases.

Science.gov (United States)

Higgins, Melanie A; Whitworth, Garrett E; El Warry, Nahida; Randriantsoa, Mialy; Samain, Eric; Burke, Robert D; Vocadlo, David J; Boraston, Alisdair B

2009-09-18

The presence of a fucose utilization operon in the Streptococcus pneumoniae genome and its established importance in virulence indicates a reliance of this bacterium on the harvesting of host fucose-containing glycans. The identities of these glycans, however, and how they are harvested is presently unknown. The biochemical and high resolution x-ray crystallographic analysis of two family 98 glycoside hydrolases (GH98s) from distinctive forms of the fucose utilization operon that originate from different S. pneumoniae strains reveal that one enzyme, the predominant type among pneumococcal isolates, has a unique endo-beta-galactosidase activity on the LewisY antigen. Altered active site topography in the other species of GH98 enzyme tune its endo-beta-galactosidase activity to the blood group A and B antigens. Despite their different specificities, these enzymes, and by extension all family 98 glycoside hydrolases, use an inverting catalytic mechanism. Many bacterial and viral pathogens exploit host carbohydrate antigens for adherence as a precursor to colonization or infection. However, this is the first evidence of bacterial endoglycosidase enzymes that are known to play a role in virulence and are specific for distinct host carbohydrate antigens. The strain-specific distribution of two distinct types of GH98 enzymes further suggests that S. pneumoniae strains may specialize to exploit host-specific antigens that vary from host to host, a factor that may feature in whether a strain is capable of colonizing a host or establishing an invasive infection.

Resistencia a los antibacterianos en América Latina: consecuencias para la infectología Antibacterial drug resistance in Latin America: consequences for infectious disease control

Directory of Open Access Journals (Sweden)

José María Casellas

2011-12-01

antibióticos, existen varias opciones para tratar infecciones por bacterias grampositivas. La situación terapéutica no es igual para las infecciones por enterobacterias y por bacilos gram­negativos no fermentadores, donde las opciones resultan aún insuficientes para el tratamiento adecuado de los pacientes.Antibacterial drug resistance is a particularly significant issue in Latin America. This article explores antimicrobial resistance in three classes of clinically important bacteria: gram-positive bacteria, enterobacteria, and nonfermenting gram-negative bacilli. The gram-positive bacteria frequently responsible for infections in humans are for the most part cocci: staphylococci, streptococci (including pneumococci, and enterococci, in both community and hospital settings. This situation is no different in the Region of the Americas. Among the gram-positive bacteria, the causative agents of bacteremia are most commonly strains of coagulase-negative Staphylococcus, followed by enterococci. This report explores the resistance of these species to different antimicrobial drugs, resistance mechanisms in community and hospital strains, and new drugs for treating infections caused by these bacteria. In Latin America, antimicrobial resistance in Enterococcus strains is still a minor problem compared to the situation in the United States. The strains of the genus Streptococcus isolated from respiratory infections are still sensitive to penicillin. Furthermore, the resistance of enterobacteria is extremely important in the Region, particularly because of the broad dissemination of CTX-M extended-spectrum beta-lactamases (ESBL, some of which originated in Latin America. This article analyzes the resistance of Streptococcus pneumoniae, beta­hemolytic streptococci, and viridans group streptococci. Among the nonfermenting gram-negative bacilli, while Pseudomonas aeruginosa strains remain the leading cause of bacteremia, infections caused by strains of Acinetobacter spp. have

Mechanisms and impact of genetic recombination in the evolution of Streptococcus pneumoniae.

Science.gov (United States)

Chaguza, Chrispin; Cornick, Jennifer E; Everett, Dean B

2015-01-01

Streptococcus pneumoniae (the pneumococcus) is a highly recombinogenic bacterium responsible for a high burden of human disease globally. Genetic recombination, a process in which exogenous DNA is acquired and incorporated into its genome, is a key evolutionary mechanism employed by the pneumococcus to rapidly adapt to selective pressures. The rate at which the pneumococcus acquires genetic variation through recombination is much higher than the rate at which the organism acquires variation through spontaneous mutations. This higher rate of variation allows the pneumococcus to circumvent the host innate and adaptive immune responses, escape clinical interventions, including antibiotic therapy and vaccine introduction. The rapid influx of whole genome sequence (WGS) data and the advent of novel analysis methods and powerful computational tools for population genetics and evolution studies has transformed our understanding of how genetic recombination drives pneumococcal adaptation and evolution. Here we discuss how genetic recombination has impacted upon the evolution of the pneumococcus.

A modified Janus cassette (Sweet Janus to improve allelic replacement efficiency by high-stringency negative selection in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Yuan Li

Full Text Available The Janus cassette permits marker-free allelic replacement or knockout in streptomycin-resistant Streptococcus pneumoniae (pneumococcus through sequential positive and negative selection. Spontaneous revertants of Janus can lead to high level of false-positives during negative selection, which necessitate a time-consuming post-selection screening process. We hypothesized that an additional counter-selectable marker in Janus would decrease the revertant frequency and reduce false-positives, since simultaneous reversion of both counter-selectable makers is much less likely. Here we report a modified cassette, Sweet Janus (SJ, in which the sacB gene from Bacillus subtilis conferring sucrose sensitivity is added to Janus. By using streptomycin and sucrose simultaneously as selective agents, the frequency of SJ double revertants was about 105-fold lower than the frequency of Janus revertants. Accordingly, the frequency of false-positives in the SJ-mediated negative selection was about 100-fold lower than what was seen for Janus. Thus, SJ enhances negative selection stringency and can accelerate allelic replacement in pneumococcus, especially when transformation frequency is low due to strain background or suboptimal transformation conditions. Results also suggested the sacB gene alone can function as a counter-selectable marker in the Gram-positive pneumococcus, which will have the advantage of not requiring a streptomycin-resistant strain for allelic replacement.

Global forecast of antimicrobial resistance in invasive isolates of Escherichia coli and Klebsiella pneumoniae.

Science.gov (United States)

Alvarez-Uria, Gerardo; Gandra, Sumanth; Mandal, Siddhartha; Laxminarayan, Ramanan

2018-03-01

To project future antimicrobial resistance (AMR) in Escherichia coli and Klebsiella pneumoniae. Mixed linear models were constructed from a sample of countries with AMR data in the ResistanceMap database. Inverse probability weighting methods were used to account for countries without AMR data. The estimated prevalence of AMR in 2015 was 64.5% (95% confidence interval (CI) 42-87%) for third-generation cephalosporin-resistant (3GCR) Escherichia coli, 5.8% (95% CI 1.8-9.7%) for carbapenem-resistant (CR) E. coli, 66.9% (95% CI 47.1-86.8%) for 3GCR Klebsiella pneumoniae, and 23.4% (95% CI 7.4-39.4%) for CR K. pneumoniae. The projected AMR prevalence in 2030 was 77% (95% CI 55-99.1%) for 3GCR E. coli, 11.8% (95% CI 3.7-19.9%) for CR E. coli, 58.2% (95% CI 50.2-66.1%) for 3GCR K. pneumoniae, and 52.8% (95% CI 16.3-89.3%) for CR K. pneumoniae. The models suggest that third-generation cephalosporins and carbapenems could be ineffective against a sizeable proportion of infections by E. coli and K. pneumoniae in most parts of the world by 2030, supporting both the need to enhance stewardship efforts and to prioritize research and development of new antibiotics for resistant Enterobacteriaceae. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Meningoencephalitis caused by Streptococcus pneumoniae: a diagnostic and therapeutic challenge. Diagnosis with diffusion-weighted MRI leading to treatment with corticosteroids

International Nuclear Information System (INIS)

Jorens, Philippe G.; Demey, Hendrik E.; Parizel, Paul M.; Smets, Katrien; Jadoul, Kris; Verbeek, M.M.; Wevers, R.A.; Cras, Patrick

2005-01-01

Streptococcus pneumoniae is a common cause of bacterial meningitis but only rarely causes other infections such as brain abscess, encephalitis, encephalomyelitis or meningoencephalitis. We report on three adult patients with meningoencephalitis caused by S. pneumoniae. In all three, CT and MRI revealed widespread brain lesions, suggesting extensive parenchymal injury. Diffusion-weighted MRI showed lesions with restricted diffusion, reflecting local areas of ischaemia with cytotoxic oedema secondary to an immunologically mediated necrotising vasculitis and thrombosis. High levels of markers of neuronal, glial and myelin damage were found in the cerebrospinal fluid. According to the literature, brain parenchyma lesions in adults with pneumococcal meningoencephalitis are often associated with death or severe neurological deficit. Our patients were treated with pulse doses of glucocorticoids: this resulted in dramatic clinical improvement and an excellent final neurological recovery. (orig.)

Meningoencephalitis caused by Streptococcus pneumoniae: a diagnostic and therapeutic challenge. Diagnosis with diffusion-weighted MRI leading to treatment with corticosteroids

Energy Technology Data Exchange (ETDEWEB)

Jorens, Philippe G.; Demey, Hendrik E. [University Hospital of Antwerp, UZA, Department of Intensive Care Medicine, Edegem (Belgium); Parizel, Paul M. [University of Antwerp, Department of Radiology, Edegem (Belgium); Smets, Katrien [University of Antwerp, Department of Neurology, Edegem (Belgium); General Hospital AZ Middelares, Department of Neurology, Sint-Niklaas (Belgium); Jadoul, Kris [General Hospital AZ Middelares, Department of Neurology, Sint-Niklaas (Belgium); Verbeek, M.M.; Wevers, R.A. [University Hospital of Nijmegen, Laboratory of Paediatrics and Neurology, Nijmegen (Netherlands); Cras, Patrick [University of Antwerp, Department of Neurology, Edegem (Belgium)

2005-10-01

Streptococcus pneumoniae is a common cause of bacterial meningitis but only rarely causes other infections such as brain abscess, encephalitis, encephalomyelitis or meningoencephalitis. We report on three adult patients with meningoencephalitis caused by S. pneumoniae. In all three, CT and MRI revealed widespread brain lesions, suggesting extensive parenchymal injury. Diffusion-weighted MRI showed lesions with restricted diffusion, reflecting local areas of ischaemia with cytotoxic oedema secondary to an immunologically mediated necrotising vasculitis and thrombosis. High levels of markers of neuronal, glial and myelin damage were found in the cerebrospinal fluid. According to the literature, brain parenchyma lesions in adults with pneumococcal meningoencephalitis are often associated with death or severe neurological deficit. Our patients were treated with pulse doses of glucocorticoids: this resulted in dramatic clinical improvement and an excellent final neurological recovery. (orig.)

Genetic Characterization of Carbapenem-Resistant Enterobacteriaceae and the Spread of Carbapenem-Resistant Klebsiella pneumonia ST340 at a University Hospital in Thailand

Science.gov (United States)

Netikul, Thidarat; Kiratisin, Pattarachai

2015-01-01

Carbapenem-resistant Enterobacteriaceae (CRE) has increasingly spread worldwide in the past decade. The prevalence and characteristics of CRE in Thailand are unknown. In this study, we conducted a 2-year surveillance of CRE among 12,741 clinical isolates of Enterobacteriaceae at the largest university hospital in Thailand with molecular characterization of beta-lactamase (bla) genes, including carbapenemase genes. The CRE prevalence was 1.4%. blaKPC-13 and blaIMP-14a were the only carbapenemase genes detected among these CRE isolates. blaKPC-13 gene was found in a single isolate of Escherichia coli, Enterobacter cloacae and Citrobacter freundii, and blaIMP-14a was found in four isolates of Klebsiella pneumoniae. Carbapenem-resistant K. pneumoniae (CRKP) isolates were resistant to multiple carbapenems at a higher ratio than other CRE species, and thus were further characterized for resistance phenotypes, bla genotypes and molecular epidemiology. Most CRKP isolates harboured multiple bla genes, especially those related to extended-spectrum beta-lactamases. Seven CRKP isolates were resistant to all tested carbapenems, and showed decreased ompK35 and/or ompK36 porin gene expression. Molecular typing of CRKP based on pulsed-field gel electrophoresis (PFGE) demonstrated several unrelated clones. Multilocus sequence typing (MLST) was partially concordant with PFGE results and revealed that ST340, a member of drug-resistant K. pneumoniae clonal complex 258, was the most predominant clone, followed by ST48, ST11 and ST273. The novel ST1645 was identified from this study. ST340 has neither been shown to be predominated among CRKP from other studies, nor been reported in Thailand. Therefore, it emphases a critical concern to monitor and control the spread of CRKP. PMID:26407326

CT features of legionella pneumonia, compared with streptococcal pneumonia. A collaborative study

International Nuclear Information System (INIS)

Tokuda, Hitoshi; Sakai, Fumikazu; Goto, Hajime

2007-01-01

Legionella pneumophila pneumonia (LPP) is of serious concern for chest physicians for its potential lethality and difficulty of diagnosis. In spite of widespread use of urine antigen detection method, it remains one of the most difficult-to-treat disease among community acquired pneumonia. We investigated CT images of 38 cases of LPP, comparing them with wide spread Streptococcus pneumoniae pneumonia (SPP). We find that sharply demarcated consolidation scattered in ground-glass opacity is the most striking and pathognomonic feature of LPP, which is rarely found in SPP. Bronchiolitis was not found in LPP, while it is a relatively common finding in SPP, which could be the second clue of differentiation of these two diseases. (author)

ROLE OF STREPTOCOCCUS PNEUMONIAE IN THE STRUCTURE OF BACTERIAL INFECTIONS IN THE CHILDREN HOSPITALIZED TO INPATIENT HOSPITALS IN MOSCOW IN 2011–2012

Directory of Open Access Journals (Sweden)

A. A. Baranov

2013-01-01

Full Text Available Data on the spread of Streptococcus pneumoniae serotypes in the RF are extremely limited. 3 pneumococcal conjugated vaccines are approved inRussia; however, neither has yet been employed in the framework of the national population immunization program. At the same time, it is the dataon the serotype range of pneumococcal infections that may be considered the prognostic efficacy criterion for the national vaccination programs.The objective of this research is identification of the circulating S. pneumoniae serotypes and spread of pneumococcal etiology infections in the structure of bacterial infections in the infants hospitalized to 5 inpatient hospital of Moscow in 2011–2012. The trial involved 864 patients in tote. Vast majority of patients (86% had acute purulent otitis media and sinusitis. Community-acquired pneumonia was diagnosed in 9% of patients, sepsis and bacteremia — in 3.6%; purulent meningitis — 1.2% of patients. It has been revealed that S. pneumoniae is the primary pathogen in the structure of nasopharyngeal carriage in the children under 5 years of age hospitalized with acute bacterial infections, and the primary bacterial causative agent of acute otitis media at this age. Nasopharyngeal pneumococcal carriage analysis revealed the prevalent serotypes — 19F, 14, 23F, 3, 6A and B; they were present in 3/4 of all cases; 19F was the most frequent (> 20%. Diversity of the S. pneumoniae serotypes detected in middle ear liquid was less significant — 17 serotypes (in comparison with 24 serotypes in nasopharynx. The 5 prevalent serotypes were 19F, 3, 14, 23F, 6B and 19A (> 75% in tote. Detection rate of serotypes 3 and 19A in middle ear liquid significantly exceeded the detection rate of these serotypes in case of nasopharyngeal carriage. The study of invasive infections revealed serotypes 14, 23F, 3 and 15C. These data may be used as a benchmark for future monitoring and evaluation of effect of PCV vaccines on epidemiology of

Antibiotic treatment and the diagnosis of Streptococcus pneumoniae in lower respiratory tract infections in adults

DEFF Research Database (Denmark)

Korsgaard, Jens; Møller, Jens Kjølseth; Kilian, Mogens

2005-01-01

OBJECTIVE: To analyze the possible influence of antibiotic treatment on the results of different diagnostic tests for the diagnosis of lower respiratory tract infections with Streptococcus pneumoniae. MATERIAL AND METHODS: A prospective cohort of 159 unselected adult immunocompetent patients...... admitted to Silkeborg County Hospital in Denmark with community-acquired lower respiratory tract infections underwent microbiological investigations with fiber-optic bronchoscopy with bronchoalveolar lavage, blood and sputum culture and urine antigen test for type-specific polysaccharide capsular antigens...... was positive in both systems, making a total of 22 patients with documented pneumococcal infection. As a positive culture test was dependent on the absence of antibiotic treatment, whereas a positive urine antigen test depended on antibiotic treatment within 48 hours, the two tests were complementary...

Cloning, expression, purification, crystallization and preliminary X-ray analysis of the pilus-associated sortase C from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Neiers, F.; Madhurantakam, C.; Fälker, S.; Normark, S.; Henriques-Normark, B.; Achour, A.

2008-01-01

Crystallization conditions and preliminary X-ray diffraction analysis of the S. pneumoniae-derived pilus-associated protein sortase C are reported. The pilus-associated sortase C from Streptococcus pneumoniae (SrtC or Srt-2) acts as a polymerase for the pilus subunit proteins RrgA and RrgB. Here, the crystallization and preliminary X-ray diffraction analysis of three crystal forms of SrtC are reported. One crystal form belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 48.9, b = 96.9, c = 98.9 Å, α = β = γ = 90°. The other two crystal forms belong to space group P222, with unit-cell parameters a = 48.8, b = 97.2, c = 99.2 Å, α = β = γ = 90° and a = 48.6, b = 96.5, c = 98.8 Å, α = β = γ = 90°, respectively. Preliminary analysis indicates the presence of two molecules in the asymmetric unit of the crystal for all three forms

Extended Spectrum β-Lactamase (ESBL) in Klebsiella Pneumoniae ...

African Journals Online (AJOL)

Pseudomonas aeruginosa, Streptococcus Pneumoniae and Serratia spp. Two of the children died in spite of early use of appropriate antibiotics as determined by antibiotic susceptibility testing. Phenotypic and molecualr investigation showed extended-spectrum β-lactamase (ESBL) producing K. pneumoniae to be ...

Multicenter evaluation of resistance patterns of Klebsiella pneumoniae, Escherichia coli, Salmonella spp and Shigella spp isolated from clinical specimens in Brazil: RESISTNET surveillance program

Directory of Open Access Journals (Sweden)

Carmen Paz Oplustil

Full Text Available Surveillance programs are essential to detect the increase of antimicrobial resistance, and several different programs are being conducted in many countries. The RESISTNET is a surveillance program for bacterial resistance against several antimicrobial agents initiated in 1998 among Latin American countries. In Brazil, several centers were invited to join this surveillance and a total of 11 centers (6 from São Paulo and 5 from other states participated in the study. All results were analyzed using the WHONET program. A total of 894 Escherichia coli, 386 Klebsiella pneumoniae, 70 Shigella spp and 57 Salmonella spp strains were analyzed in this study from April, 1998, to April, 1999. Susceptibility testing was performed by the disk diffusion method using NCCLS 1998 guidelines for several different drugs. For all strains, imipenem was the most effective drug (100% of the strains were susceptible. Klebsiella pneumoniae presented a high resistance rate to ampicillin (96.4%. The rate of probable ESBL producers among K. pneumoniae strains was 36.3%, most of them being isolated from catheters (58.8%. Among all Escherichia coli strains analyzed, the highest resistance rate was found for trimethoprim/sulfamethoxazole (46.9% and the majority of the resistant strains were isolated from urine samples (47.8%. Among Salmonella spp, the resistance rates were low for all antibiotics tested. For Shigella spp strains there was a high resistance to trimethoprim/sulfamethoxazole (80.0%. No resistance to ceftriaxone was observed in these strains. Surveillance of antimicrobial resistance is critical for the successful management of infectious diseases. The results of this survey show significant resistance rates among these bacteria which are responsible for several types of human infections.

Components of Streptococcus pneumoniae suppress allergic airways disease and NKT cells by inducing regulatory T cells.

Science.gov (United States)

Thorburn, Alison N; Foster, Paul S; Gibson, Peter G; Hansbro, Philip M

2012-05-01

Asthma is an allergic airways disease (AAD) caused by dysregulated immune responses and characterized by eosinophilic inflammation, mucus hypersecretion, and airway hyperresponsiveness (AHR). NKT cells have been shown to contribute to AHR in some mouse models. Conversely, regulatory T cells (Tregs) control aberrant immune responses and maintain homeostasis. Recent evidence suggests that Streptococcus pneumoniae induces Tregs that have potential to be harnessed therapeutically for asthma. In this study, mouse models of AAD were used to identify the S. pneumoniae components that have suppressive properties, and the mechanisms underlying suppression were investigated. We tested the suppressive capacity of type-3-polysaccharide (T3P), isolated cell walls, pneumolysoid (Ply) and CpG. When coadministered, T3P + Ply suppressed the development of: eosinophilic inflammation, Th2 cytokine release, mucus hypersecretion, and AHR. Importantly, T3P + Ply also attenuated features of AAD when administered during established disease. We show that NKT cells contributed to the development of AAD and also were suppressed by T3P + Ply treatment. Furthermore, adoptive transfer of NKT cells induced AHR, which also could be reversed by T3P + Ply. T3P + Ply-induced Tregs were essential for the suppression of NKT cells and AAD, which was demonstrated by Treg depletion. Collectively, our results show that the S. pneumoniae components T3P + Ply suppress AAD through the induction of Tregs that blocked the activity of NKT cells. These data suggest that S. pneumoniae components may have potential as a therapeutic strategy for the suppression of allergic asthma through the induction of Tregs and suppression of NKT cells.

Repurposing salicylanilide anthelmintic drugs to combat drug resistant Staphylococcus aureus.

Science.gov (United States)

Rajamuthiah, Rajmohan; Fuchs, Beth Burgwyn; Conery, Annie L; Kim, Wooseong; Jayamani, Elamparithi; Kwon, Bumsup; Ausubel, Frederick M; Mylonakis, Eleftherios

2015-01-01

Staphylococcus aureus is a Gram-positive bacterium that has become the leading cause of hospital acquired infections in the US. Repurposing Food and Drug Administration (FDA) approved drugs for antimicrobial therapy involves lower risks and costs compared to de novo development of novel antimicrobial agents. In this study, we examined the antimicrobial properties of two commercially available anthelmintic drugs. The FDA approved drug niclosamide and the veterinary drug oxyclozanide displayed strong in vivo and in vitro activity against methicillin resistant S. aureus (minimum inhibitory concentration (MIC): 0.125 and 0.5 μg/ml respectively; minimum effective concentration: ≤ 0.78 μg/ml for both drugs). The two drugs were also effective against another Gram-positive bacteria Enterococcus faecium (MIC 0.25 and 2 μg/ml respectively), but not against the Gram-negative species Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter aerogenes. The in vitro antimicrobial activity of niclosamide and oxyclozanide were determined against methicillin, vancomycin, linezolid or daptomycin resistant S. aureus clinical isolates, with MICs at 0.0625-0.5 and 0.125-2 μg/ml for niclosamide and oxyclozanide respectively. A time-kill study demonstrated that niclosamide is bacteriostatic, whereas oxyclozanide is bactericidal. Interestingly, oxyclozanide permeabilized the bacterial membrane but neither of the anthelmintic drugs exhibited demonstrable toxicity to sheep erythrocytes. Oxyclozanide was non-toxic to HepG2 human liver carcinoma cells within the range of its in vitro MICs but niclosamide displayed toxicity even at low concentrations. These data show that the salicylanilide anthelmintic drugs niclosamide and oxyclozanide are suitable candidates for mechanism of action studies and further clinical evaluation for treatment of staphylococcal infections.

Frequency, Antimicrobial Resistance and Genetic Diversity of Klebsiella pneumoniae in Food Samples.

Directory of Open Access Journals (Sweden)

Yumei Guo

Full Text Available This study aimed to assess the frequency of Klebsiella pneumoniae in food samples and to detect antibiotic resistance phenotypes, antimicrobial resistance genes and the molecular subtypes of the recovered isolates. A total of 998 food samples were collected, and 99 (9.9% K. pneumoniae strains were isolated; the frequencies were 8.2% (4/49 in fresh raw seafood, 13.8% (26/188 in fresh raw chicken, 11.4% (34/297 in frozen raw food and 7.5% (35/464 in cooked food samples. Antimicrobial resistance was observed against 16 antimicrobials. The highest resistance rate was observed for ampicillin (92.3%, followed by tetracycline (31.3%, trimethoprim-sulfamethoxazole (18.2%, and chloramphenicol (10.1%. Two K. pneumoniae strains were identified as extended-spectrum β-lactamase (ESBL-one strain had three beta-lactamases genes (blaSHV, blaCTX-M-1, and blaCTX-M-10 and one had only the blaSHV gene. Nineteen multidrug-resistant (MDR strains were detected; the percentage of MDR strains in fresh raw chicken samples was significantly higher than in other sample types (P<0.05. Six of the 18 trimethoprim-sulfamethoxazole-resistant strains carried the folate pathway inhibitor gene (dhfr. Four isolates were screened by PCR for quinolone resistance genes; aac(6'-Ib-cr, qnrB, qnrA and qnrS were detected. In addition, gyrA gene mutations such as T247A (Ser83Ile, C248T (Ser83Phe, and A260C (Asp87Ala and a parC C240T (Ser80Ile mutation were identified. Five isolates were screened for aminoglycosides resistance genes; aacA4, aacC2, and aadA1 were detected. Pulsed-field gel electrophoresis-based subtyping identified 91 different patterns. Our results indicate that food, especially fresh raw chicken, is a reservoir of antimicrobial-resistant K. pneumoniae, and the potential health risks posed by such strains should not be underestimated. Our results demonstrated high prevalence, antibiotic resistance rate and genetic diversity of K. pneumoniae in food in China. Improved

Tigecycline Resistant Klebsiella pneumoniae Isolated from Austrian River Water

Directory of Open Access Journals (Sweden)

Alexander Hladicz

2017-10-01

Full Text Available Abstract: Antibiotic-resistant bacteria are spreading worldwide in medical settings but also in the environment. These resistant bacteria illustrate a major health problem in our times, and last-line antibiotics such as tigecycline represent an ultimate therapy option. Reports on tigecycline non-susceptible Enterobacteriaceae are presented with regard to medical settings but are rare with that for the environment. The aim of this study was to characterize two tigecycline non-susceptible Klebsiella pneumoniae isolates from the river Mur, and to question the resistance mechanism. The screening for chromosomal mutations revealed a deletion and a silent point mutation in one isolate and a point mutation in the other isolate all within the ramR allele. RamR acts as repressor and prevents overexpression of ramA. These mutations are likely to cause a resistant phenotype due to the overexpression of AcrAB-TolC. MLST revealed that the isolates belonged to two unrelated MLST types (ST2392 and ST2394. Both isolates only revealed resistance to tigecycline and tetracycline. This is one of the rare reports of tigecycline-resistant Klebsiella pneumoniae from surface water. The presence of two genetically different isolates suggests that the river water may bear substances that favor mutations that can lead to this efflux pump-driven resistance.

Streptococcus pneumoniae PspC Subgroup Prevalence in Invasive Disease and Differences in Contribution to Complement Evasion.

Science.gov (United States)

van der Maten, Erika; van den Broek, Bryan; de Jonge, Marien I; Rensen, Kim J W; Eleveld, Marc J; Zomer, Aldert L; Cremers, Amelieke J H; Ferwerda, Gerben; de Groot, Ronald; Langereis, Jeroen D; van der Flier, Michiel

2018-04-01

The pneumococcal capsular serotype is an important determinant of complement resistance and invasive disease potential, but other virulence factors have also been found to contribute. Pneumococcal surface protein C (PspC), a highly variable virulence protein that binds complement factor H to evade C3 opsonization, is divided into two subgroups: choline-bound subgroup I and LPxTG-anchored subgroup II. The prevalence of different PspC subgroups in invasive pneumococcal disease (IPD) and functional differences in complement evasion are unknown. The prevalence of PspC subgroups in IPD isolates was determined in a collection of 349 sequenced strains of Streptococcus pneumoniae isolated from adult patients. pspC deletion mutants and isogenic pspC switch mutants were constructed to study differences in factor H binding and complement evasion in relation to capsule thickness. Subgroup I pspC was far more prevalent in IPD isolates than subgroup II pspC The presence of capsule was associated with a greater ability of bound factor H to reduce complement opsonization. Pneumococcal subgroup I PspC bound significantly more factor H and showed more effective complement evasion than subgroup II PspC in isogenic encapsulated pneumococci. We conclude that variation in the PspC subgroups, independent of capsule serotypes, affects pneumococcal factor H binding and its ability to evade complement deposition. Copyright © 2018 American Society for Microbiology.

A new mosaic integrative and conjugative element from Streptococcus agalactiae carrying resistance genes for chloramphenicol (catQ) and macrolides [mef(I) and erm(TR)].

Science.gov (United States)

Morici, Eleonora; Simoni, Serena; Brenciani, Andrea; Giovanetti, Eleonora; Varaldo, Pietro E; Mingoia, Marina

2017-01-01

To investigate the genetic basis of catQ-mediated chloramphenicol resistance in Streptococcus agalactiae. Two clinical strains of catQ-positive chloramphenicol-resistant S. agalactiae (Sag236 and Sag403) were recently isolated, typed (MLST, PFGE pulsotypes, capsular types) and their antibiotic resistances investigated by phenotypic and genotypic approaches. Several molecular methods (PCR mapping, restriction assays, Southern blotting, sequencing and sequence analysis, conjugal transfer assays) were used to determine the genetic context of catQ and characterize a genetic element detected in the isolates. Sag236 and Sag403 shared the same ST (ST19), but exhibited a different capsular type (III and V, respectively) and pulsotype. Both harboured the macrolide resistance genes mef(I) and erm(TR) and the tetracycline resistance gene tet(M). Accordingly, they were resistant to chloramphenicol, erythromycin and tetracycline. catQ and mef(I) were associated in an IQ module that was indistinguishable in Sag236 and Sag403. In mating assays, chloramphenicol and erythromycin resistance proved transferable, at low frequency, only from Sag236. Transconjugants carried not only catQ and mef(I), but also erm(TR), suggesting a linkage of the three resistance genes in a mobile element, which, though seemingly non-mobile, was also detected in Sag403. The new element (designated ICESag236, ∼110 kb) results from recombination of two integrative and conjugative elements (ICEs) originally described in different streptococcal species: S. agalactiae ICESagTR7, carrying erm(TR); and Streptococcus pneumoniae ICESpn529IQ, carrying the prototype IQ module. These findings strengthen the notion that widespread streptococcal ICEs may form mosaics that enhance their diversity and spread, broaden their host range and carry new cargo genes. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions

In vitro activity of potential old and new drugs against multidrug-resistant gram-negatives.

Science.gov (United States)

Rizek, Camila; Ferraz, Juliana Rosa; van der Heijden, Inneke Marie; Giudice, Mauro; Mostachio, Anna Karina; Paez, Jorge; Carrilho, Claudia; Levin, Anna Sara; Costa, Silvia F

2015-02-01

The aim of this study was to evaluate the in vitro susceptibility of MDR gram-negatives bacteria to old drugs such as polymyxin B, minocycline and fosfomycin and new drugs such as tigecycline. One hundred and fifty-three isolates from 4 Brazilian hospitals were evaluated. Forty-seven Acinetobacter baumannii resistant to carbapenens harboring adeB, blaOxA23, blaOxA51, blaOxA143 and blaIMP genes, 48 Stenotrophomonas maltophilia including isolates resistant to levofloxacin and/or trimethoprim-sulfamethoxazole harboring sul-1, sul-2 and qnrMR and 8 Serratia marcescens and 50 Klebsiella pneumoniae resistant to carbapenens harboring blaKPC-2 were tested to determine their minimum inhibitory concentrations (MICs) by microdilution to the following drugs: minocycline, ampicillin-sulbactam, tigecycline, and polymyxin B and by agar dilution to fosfomycin according with breakpoint criteria of CLSI and EUCAST (fosfomycin). In addition, EUCAST fosfomycin breakpoint for Pseudomonas spp. was applied for Acinetobacter spp and S. maltophilia, the FDA criteria for tigecycline was used for Acinetobacter spp and S. maltophilia and the Pseudomonas spp polymyxin B CLSI criterion was used for S. maltophilia. Tigecycline showed the best in vitro activity against the MDR gram-negative evaluated, followed by polymyxin B and fosfomycin. Polymyxin B resistance among K. pneumoniae was detected in 6 isolates, using the breakpoint of MIC > 8 ug/mL. Two of these isolates were resistant to tigecycline. Minocycline was tested only against S. maltophilia and A. baumannii and showed excellent activity against both. Fosfomycin seems to not be an option to treat infections due to the A. baumannii and S. maltophilia isolates according with EUCAST breakpoint, on the other hand, showed excellent activity against S. marcescens and K. pneumoniae. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Heat-resistant, extended-spectrum β-lactamase-producing Klebsiella pneumoniae in endoscope-mediated outbreak

DEFF Research Database (Denmark)

Jørgensen, S.B.; Bojer, Martin Saxtorph; Boll, E.J.

2016-01-01

disinfection in a decontaminator designated for such use. The genetic marker clpK, which increases microbial heat resistance, has previously been described in K. pneumoniae outbreak strains. Aim To investigate the role of clpK in biofilm formation and heat-shock stability in the outbreak strain. Methods...... construction and heat-shock assays. Findings Five patients and one intubation endoscope contained K. pneumoniae with the same amplified fragment length polymorphism pattern. The outbreak strain contained the clpK genetic marker, which rendered the strain its increased heat resistance. The survival rate....... Heat resistance of certain K. pneumoniae strains may facilitate survival in biofilms on medical equipment and hence increase the potential of those strains to persist and disperse in the hospital environment....

Live Streptococcus pneumoniae, Haemophilus influenzae, and Neisseria meningitidis activate the inflammatory response trhough Toll-like receptors 2, 4, and 9 in species-specific patterns

DEFF Research Database (Denmark)

Mogensen, T.H.; Paludan, Søren Riis; Kilian, Mogens

2006-01-01

activation by live bacteria. Here, we demonstrate that live Streptococcus pneumoniae, Haemophilus influenzae type b, and Neisseria meningitidis, the three principal causes of bacterial meningitis, use distinct sets of TLRs to trigger the inflammatory response. Using human embryonic kidney 293 cell lines......, each overexpressing one type of TLR, we found that S. pneumoniae triggered activation of the transcription factor nuclear factor-kappaB and expression of interleukin-8, only in cells expressing TLR2 or -9. The same response was evoked by H. influenzae in cells expressing TLR2 or -4 and by N...... and confirmed the essential role of these TLRs and also identified differential functions of TLRs in activation of the inflammatory response. Collectively, we here demonstrate that S. pneumoniae, H. influenzae, and N. meningitidis each activate several TLRs in species-specific patterns and show that infection...

Natural Genetic Transformation Generates a Population of Merodiploids in Streptococcus pneumoniae

Science.gov (United States)

Zomer, Aldert; Bootsma, Hester J.; Prudhomme, Marc; Granadel, Chantal; Hermans, Peter W. M.; Polard, Patrice; Martin, Bernard; Claverys, Jean-Pierre

2013-01-01

Partial duplication of genetic material is prevalent in eukaryotes and provides potential for evolution of new traits. Prokaryotes, which are generally haploid in nature, can evolve new genes by partial chromosome duplication, known as merodiploidy. Little is known about merodiploid formation during genetic exchange processes, although merodiploids have been serendipitously observed in early studies of bacterial transformation. Natural bacterial transformation involves internalization of exogenous donor DNA and its subsequent integration into the recipient genome by homology. It contributes to the remarkable plasticity of the human pathogen Streptococcus pneumoniae through intra and interspecies genetic exchange. We report that lethal cassette transformation produced merodiploids possessing both intact and cassette-inactivated copies of the essential target gene, bordered by repeats (R) corresponding to incomplete copies of IS861. We show that merodiploidy is transiently stimulated by transformation, and only requires uptake of a ∼3-kb DNA fragment partly repeated in the chromosome. We propose and validate a model for merodiploid formation, providing evidence that tandem-duplication (TD) formation involves unequal crossing-over resulting from alternative pairing and interchromatid integration of R. This unequal crossing-over produces a chromosome dimer, resolution of which generates a chromosome with the TD and an abortive chromosome lacking the duplicated region. We document occurrence of TDs ranging from ∼100 to ∼900 kb in size at various chromosomal locations, including by self-transformation (transformation with recipient chromosomal DNA). We show that self-transformation produces a population containing many different merodiploid cells. Merodiploidy provides opportunities for evolution of new genetic traits via alteration of duplicated genes, unrestricted by functional selective pressure. Transient stimulation of a varied population of merodiploids by

Natural genetic transformation generates a population of merodiploids in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Calum Johnston

Full Text Available Partial duplication of genetic material is prevalent in eukaryotes and provides potential for evolution of new traits. Prokaryotes, which are generally haploid in nature, can evolve new genes by partial chromosome duplication, known as merodiploidy. Little is known about merodiploid formation during genetic exchange processes, although merodiploids have been serendipitously observed in early studies of bacterial transformation. Natural bacterial transformation involves internalization of exogenous donor DNA and its subsequent integration into the recipient genome by homology. It contributes to the remarkable plasticity of the human pathogen Streptococcus pneumoniae through intra and interspecies genetic exchange. We report that lethal cassette transformation produced merodiploids possessing both intact and cassette-inactivated copies of the essential target gene, bordered by repeats (R corresponding to incomplete copies of IS861. We show that merodiploidy is transiently stimulated by transformation, and only requires uptake of a ~3-kb DNA fragment partly repeated in the chromosome. We propose and validate a model for merodiploid formation, providing evidence that tandem-duplication (TD formation involves unequal crossing-over resulting from alternative pairing and interchromatid integration of R. This unequal crossing-over produces a chromosome dimer, resolution of which generates a chromosome with the TD and an abortive chromosome lacking the duplicated region. We document occurrence of TDs ranging from ~100 to ~900 kb in size at various chromosomal locations, including by self-transformation (transformation with recipient chromosomal DNA. We show that self-transformation produces a population containing many different merodiploid cells. Merodiploidy provides opportunities for evolution of new genetic traits via alteration of duplicated genes, unrestricted by functional selective pressure. Transient stimulation of a varied population of

Serotype distribution of Streptococcus pneumoniae isolated from patients with invasive pneumococcal disease in Brazil before and after ten-pneumococcal conjugate vaccine implementation.

Science.gov (United States)

dos Santos, Silvia R; Passadore, Lilian F; Takagi, Elizabeth H; Fujii, Cristiane M; Yoshioka, Cristina R M; Gilio, Alfredo E; Martinez, Marina B

2013-12-09

The ten-pneumococcal conjugate vaccine (PCV10) was introduced into the national immunization program for childhood vaccination schedules by the Brazilian Health Public Service in March 2010. The aim of this study was to compare Streptococcus pneumoniae serotype distribution, antibiotic resistance patterns, and potential coverage before (January 2006-June 2010) and after (July 2010-September 2012) PCV10 introduction. The incidence of invasive pneumococcal disease (IPD), patient demographics, and disease characteristics were recorded. This study was conducted at the University Hospital of Sao Paulo University in Brazil from January 2006 to September 2012. Serotyping was performed using multiplex PCR typing, and antimicrobial sensitivity by Clinical and Laboratory Standards Institute (CLSI). A total of 259 S. pneumoniae strains were isolated from patients with IPD. The ages of the patients ranged from 3 months to 95 years old. The strains were isolated from cerebrospinal fluid, pleural fluid, and blood. The incidence of IPD among patients at HU-USP changed after the introduction of PCV10. The overall incidence of IPD was 3.42 cases per 1000 admissions in the vaccine pre- implementation period and of 2.99 cases per 1000 admissions in the vaccine post-implementation period. The incidence of IPD among children<2 y.o. attended at HU-USP changed significantly after the introduction of PCV10, from 20.30 to 3.97 of incidence. The incidence of PCV10- serotypes decrease from 16.47 to 0.44 in the same age, before and after PC10 implementation, respectively. Moreover, it was possible to realize the sensitivity to penicillin among isolates increased significantly in the post-vaccine period. Data from this study suggest that PCV10 contributed to decrease with PID rate among children less than 2 y.o. The resistance rate among pneumococcal isolates also could be observed since serotypes with greater resistance to beta lactam antibiotics were not easily isolated after vaccination

Transport of Streptococcus pneumoniae capsular polysaccharide in MHC Class II tubules.

Directory of Open Access Journals (Sweden)

Tom Li Stephen

2007-03-01

Full Text Available Bacterial capsular polysaccharides are virulence factors and are considered T cell-independent antigens. However, the capsular polysaccharide Sp1 from Streptococcus pneumoniae serotype 1 has been shown to activate CD4(+ T cells in a major histocompatibility complex (MHC class II-dependent manner. The mechanism of carbohydrate presentation to CD4(+ T cells is unknown. We show in live murine dendritic cells (DCs that Sp1 translocates from lysosomal compartments to the plasma membrane in MHCII-positive tubules. Sp1 cell surface presentation results in reduction of self-peptide presentation without alteration of the MHCII self peptide repertoire. In DM-deficient mice, retrograde transport of Sp1/MHCII complexes resulting in T cell-dependent immune responses to the polysaccharide in vitro and in vivo is significantly reduced. The results demonstrate the capacity of a bacterial capsular polysaccharide antigen to use DC tubules as a vehicle for its transport as an MHCII/saccharide complex to the cell surface for the induction of T cell activation. Furthermore, retrograde transport requires the functional role of DM in self peptide-carbohydrate exchange. These observations open new opportunities for the design of vaccines against microbial encapsulated pathogens.

Characteristics and Management of Community-Acquired Pneumonia in the Era of Global Aging

Directory of Open Access Journals (Sweden)

Catia Cillóniz

2018-04-01

Full Text Available Community-acquired pneumonia (CAP can occur at any time of life, but its incidence and risk of death are linked to increasing age. CAP in the elderly is a major health problem associated with high rates of readmission, morbidity, and mortality. Since the clinical presentation of pneumonia in the elderly may be atypical, clinicians should suspect pneumonia in older patients presenting symptoms such as falls and altered mental status, fatigue, lethargy, delirium, anorexia, in order to avoid the complications associated with delayed diagnosis and therapy. Streptococcus pneumoniae remains the most frequently reported pathogen in this population. However, particular attention should be paid to patients with risk factors for multidrug resistant pathogens, because a large proportion of elderly persons present multimorbidity. Vaccination is one of the most important preventive approaches for CAP in the elderly. In addition, lifestyle-tailored interventions for different modifiable risk factors will help to reduce the risk of pneumonia in elderly persons. Surveillance of etiological pathogens may improve vaccination policies in this population.

Trends in Expanded-Spectrum Cephalosporin-Resistant Escherichia coli and Klebsiella pneumoniae among Dutch Clinical Isolates, from 2008 to 2012.

Directory of Open Access Journals (Sweden)

Matthijs van der Steen

Full Text Available We investigated time trends in extended-spectrum cephalosporin-resistant Escherichia coli and Klebsiella pneumoniae isolates from different patient settings in The Netherlands from 2008-2012. E. coli and K. pneumoniae isolates from blood and urine samples of patients > = 18 years were selected from the Dutch Infectious Disease Surveillance System-Antimicrobial Resistance (ISIS-AR database. We used multivariable Poisson regression to study the rate per year of blood stream infections by susceptible and resistant isolates, and generalized estimating equation (GEE log-binomial regression for trends in the proportion of extended-spectrum cephalosporin-resistant isolates. Susceptibility data of 197,513 E. coli and 38,244 K. pneumoniae isolates were included. The proportion of extended-spectrum cephalosporin-resistant E. coli and K. pneumoniae isolates from urine and blood samples increased in all patient settings, except for K. pneumoniae isolates from patients admitted to intensive care units. For K. pneumoniae, there was a different time trend between various patient groups (p<0.01, with a significantly higher increase in extended-spectrum cephalosporin-resistant isolates from patients attending a general practitioner than in isolates from hospitalized patients. For E. coli, the increasing time trends did not differ among different patient groups. This nationwide study shows a general increase in extended-spectrum cephalosporin-resistant E. coli and K. pneumoniae isolates. However, differences in trends between E. coli en K. pneumoniae underline the importance of E. coli as a community-pathogen and its subsequent influence on hospital resistance level, while for K. pneumoniae the level of resistance within the hospital seems less influenced by the resistance trends in the community.

Comparison of clinical characteristics between healthcare-associated pneumonia and community-acquired pneumonia in patients admitted to secondary hospitals

Directory of Open Access Journals (Sweden)

Jong Hoo Lee

Full Text Available BACKGROUND: Since healthcare-associated pneumonia (HCAP is heterogeneous, clinical characteristics and outcomes are different from region to region. There can also be differences between HCAP patients hospitalized in secondary or tertiary hospitals. This study aimed to evaluate the clinical characteristics of HCAP patients admitted into secondary community hospitals. METHODS: This was a retrospective study conducted in patients with HCAP or community-acquired pneumonia (CAP hospitalized in two secondary hospitals between March 2009 and January 2011. RESULTS: Of a total of 303 patients, 96 (31.7% had HCAP. 42 patients (43.7% resided in a nursing home or long-term care facility, 36 (37.5% were hospitalized in an acute care hospital for > 2 days within 90 days, ten received outpatient intravenous therapy, and eight attended a hospital clinic or dialysis center. HCAP patients were older. The rates of patients with CURB65 scores of 3 or more (22.9% vs. 9.1%; p = 0.001 and PSI class IV or more (82.2% vs. 34.7%; p < 0.001 were higher in the HCAP group. Drug-resistant pathogens were more frequently detected in the HCAP group (23.9% vs. 0.4%; p < 0.001. However, Streptococcus pneumoniae was the most common pathogen in both groups. The rates of antibiotic change, use of inappropriate antibiotics, and failure of initial antibiotic therapy in the HCAP group were significantly higher. Although the overall survival rate of the HCAP group was significantly lower (82.3% vs. 96.8%; p < 0.001, multivariate analyses failed to show that HCAP itself was a prognostic factor for mortality (p = 0.826. Only PSI class IV or more was associated with increased mortality (p = 0.005. CONCLUSIONS: HCAP should be distinguished from CAP because of the different clinical features. However, the current definition of HCAP does not appear to be a prognostic for death. In addition, the use of broad-spectrum antibiotics for HCAP should be reassessed because S. pneumoniae was most

Alterations in Outer Membrane Permeability Favor Drug-Resistant Phenotype of Klebsiella pneumoniae

Czech Academy of Sciences Publication Activity Database

Pulzová, L.; Navrátilová, Lucie; Comor, L.

2017-01-01

Roč. 23, č. 4 (2017), s. 413-420 ISSN 1076-6294 Institutional support: RVO:61389030 Keywords : drug resistance * efflux pumps * influx * Klebsiella * porin Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 2.306, year: 2016

ST37 Klebsiella pneumoniae: development of carbapenem resistance in vivo during antimicrobial therapy in neonates.

Science.gov (United States)

Li, Pengling; Wang, Min; Li, Xianping; Hu, Feihu; Yang, Min; Xie, Yixin; Cao, Wei; Xia, Xiaomeng; Zheng, Rong; Tian, Jingjing; Zhang, Kan; Chen, Fang; Tang, Aiguo

2017-08-01

To investigate the mechanism leading to in vivo carbapenem resistance development in Klebsiella pneumoniae. Carbapenemase was detected using the modified carbapenem inactivation method. β-lactamases resistant genes were identified by PCR and sequencing. Clonal relatedness was evaluated by random amplified polymorphic DNA and multiple locus sequence typing. The relationship between sequence typing and resistant genes was analyzed by using the chi-squared test. All ST37 carbapenem-resistant isolates were bla OXA-1 positive and all ST37 carbapenem-sensitive isolates were bla OXA-1 negative at Stage I. A significant relationship between carbapenem resistance and bla OXA-1 was observed. The bla OXA-1 -positive rate was significantly higher in ST37 K. pneumoniae than others. This is the first study about the development of carbapenem resistance in vivo potentially mediated by bla OXA-1 in ST37 K. pneumoniae among neonates.

Trivalent pneumococcal protein recombinant vaccine protects against lethal Streptococcus pneumoniae pneumonia and correlates with phagocytosis by neutrophils during early pathogenesis.

Science.gov (United States)

Xu, Qingfu; Surendran, Naveen; Verhoeven, David; Klapa, Jessica; Ochs, Martina; Pichichero, Michael E

2015-02-18

Due to the fact that current polysaccharide-based pneumococcal vaccines have limited serotype coverage, protein-based vaccine candidates have been sought for over a decade to replace or complement current vaccines. We previously reported that a trivalent Pneumococcal Protein recombinant Vaccine (PPrV), showed protection against pneumonia and sepsis in an infant murine model. Here we investigated immunological correlates of protection of PPrV in the same model. C57BL/6J infant mice were intramuscularly vaccinated at age 1-3 weeks with 3 doses of PPrV, containing pneumococcal histidine triad protein D (PhtD), pneumococcal choline binding protein A (PcpA), and detoxified pneumolysin mutant PlyD1. 3-4 weeks after last vaccination, serum and lung antibody levels to PPrV components were measured, and mice were intranasally challenged with a lethal dose of Streptococcus pneumoniae (Spn) serotype 6A. Lung Spn bacterial burden, number of neutrophils and alveolar macrophages, phagocytosed Spn by granulocytes, and levels of cytokines and chemokines were determined at 6, 12, 24, and 48h after challenge. PPrV vaccination conferred 83% protection against Spn challenge. Vaccinated mice had significantly elevated serum and lung antibody levels to three PPrV components. In the first stage of pathogenesis of Spn induced pneumonia (6-24h after challenge), vaccinated mice had lower Spn bacterial lung burdens and more phagocytosed Spn in the granulocytes. PPrV vaccination led to lower levels of pro-inflammatory cytokines IL-6, IL-1β, and TFN-α, and other cytokines and chemokines (IL-12, IL-17, IFN-γ, MIP-1b, MIP-2 and KC, and G-CSF), presumably due to a lower lung bacterial burden. Trivalent PPrV vaccination results in increased serum and lung antibody levels to the vaccine components, a reduction in Spn induced lethality, enhanced early clearance of Spn in lungs due to more rapid and thorough phagocytosis of Spn by neutrophils, and correspondingly a reduction in lung inflammation

Streptococcus pneumoniae bacteraemia due to parotitis in a patient with systemic sclerosis and secondary Sjögren's syndrome.

Science.gov (United States)

Yii, Irene Yuen Lin; Tan, Jamie Bee Xian; Fong, Warren Weng Seng

2016-10-01

Invasive pneumococcal disease is an uncommon and notifiable disease in Singapore. It is often associated with significant morbidity and mortality. We report a rare case of invasive pneumococcal bacteraemia due to parotitis in a patient with systemic sclerosis and secondary Sjögren's syndrome. We also present a retrospective review of Streptococcus pneumoniae bacteraemia cases in Singapore General Hospital from January 2011 to April 2016. A 59-year-old Malay lady with a history of systemic sclerosis with secondary Sjögren's syndrome presented with fever and left parotid gland swelling. Clinical examination revealed poor salivary pooling and left parotid swelling without fluctuance. Ultrasound of the left parotid gland confirmed acute parotitis without evidence of abscess or sialolithiasis. Blood cultures were positive for S. pneumoniae . She was diagnosed to have invasive pneumococcal bacteraemia secondary to acute parotitis, and treated with intravenous benzylpenicillin with clearance of bacteraemia after 3 days. Upon discharge, her antibiotics were changed to intravenous ceftriaxone to facilitate outpatient parenteral antibiotic therapy for another 2 weeks. She responded favourably to antibiotics at follow-up, with no complications from the bacteraemia. A review of the microbiological records of the Singapore General Hospital revealed 116 cases of pneumococcal bacteraemia, most (80.3 %) of which were due to pneumonia. None were due to parotitis. S. pneumoniae parotitis and subsequent bacteraemia is rare. Prompt recognition of the disease and appropriate use of antibiotics are important. This case highlights that close communication between healthcare workers (microbiologist, rheumatologist and infectious disease specialist) is essential in ensuring good clinical outcomes in patients with a potentially fatal disease.

Isolation of Streptococcus tigurinus - a novel member of Streptococcus mitis group from a case of periodontitis.

Science.gov (United States)

Dhotre, Shree V; Mehetre, Gajanan T; Dharne, Mahesh S; Suryawanshi, Namdev M; Nagoba, Basavraj S

2014-08-01

Streptococcus tigurinus is a new member of the Streptococcus viridians group and is closely related to Streptococcus mitis, Streptococcus pneumoniae, Streptococcus pseudopneumoniae, Streptococcus oralis, and Streptococcus infantis. The type strain AZ_3a(T) of S. tigurinus was originally isolated from a patient with infective endocarditis. Accurate identification of S. tigurinus is facilitated only by newer molecular methods like 16S rRNA gene analysis. During the course of study on bacteraemia and infective endocarditis with reference to periodontitis and viridians group of streptococci, a strain of S. tigurinus isolated from subgingival plaque of a patient with periodontitis identified by 16S rRNA gene analysis, which was originally identified as Streptococcus pluranimalium by Vitek 2. Confirmation by 16S rRNA gene analysis showed 99.39% similarity (1476/1485 bp) with S. tigurinus AZ_3a(T) (AORU01000002). To the best of our knowledge, this is the first report of isolation of S. tigurinus from the oral cavity of a periodontitis patient. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Características laboratoriais das ceratites e conjuntivites causadas por Streptococcus sp Laboratorial findings of Streptococcus keratitis and conjunctivitis

Directory of Open Access Journals (Sweden)

Helena Parente Solari

2004-10-01

Full Text Available OBJETIVOS: Analisar os resultados laboratoriais de conjuntivites e ceratites com cultura positiva para Streptococcus sp, avaliando a incidência das diferentes espécies e os dados dos antibiogramas. MÉTODOS: Estudo retrospectivo de revisão de prontuários de pacientes encaminhados ao laboratório de Doenças Externas do Departamento de Oftalmologia da UNIFESP com resultado de cultivo bacteriano positivo de córnea ou conjuntiva e com identificação de alguma cepa do gênero Streptococcus sp, no período de janeiro de 1995 a dezembro de 2001. Analisou-se idade do paciente, espécie de Streptococcus e os testes de sensibilidade aos seguintes antibióticos: cefalotina, amicacina, gentamicina, tobramicina, ciprofloxacina, lomefloxacina, ofloxacina, norfloxacina e vancomicina. RESULTADOS: As espécies mais encontradas foram Streptococcus pneumoniae e Streptococcus viridans. Com relação aos antibióticos, a sensibilidade foi maior à cefalotina, às quinolonas e à vancomicina. CONCLUSÕES: Considerando-se os antibióticos tópicos comercialmente disponíveis, as quinolonas apresentam melhor espectro de ação quando comparadas aos aminoglicosídios.PURPOSE: To evaluate laboratorial findings of Streptococcus keratitis and conjunctivitis, analyzing the different species and the results of bacterial susceptibility to an antibiotics. METHODS: Retrospective study of the records from the External Disease Laboratory of the Ophthalmology Department of the Federal University of São Paulo, with conjunctival or corneal positive bacterial culture for Streptococcus sp, between January 1995 and December 2001. The collected data were age, Streptococcus species and the bacterial susceptibility to the following antibiotics: cephalotin, amikacin, gentamicin, tobramicin, ciprofloxacin, lomefloxacin, ofloxacin, norfloxacin and vancomicin. RESULTS: The most frequent species were Streptococcus pneumoniae and Streptococcus viridans. Regarding bacterial

Competence in Streptococcus pneumoniae is regulated by the rate of ribosomal decoding errors.

Science.gov (United States)

Stevens, Kathleen E; Chang, Diana; Zwack, Erin E; Sebert, Michael E

2011-01-01

Competence for genetic transformation in Streptococcus pneumoniae develops in response to accumulation of a secreted peptide pheromone and was one of the initial examples of bacterial quorum sensing. Activation of this signaling system induces not only expression of the proteins required for transformation but also the production of cellular chaperones and proteases. We have shown here that activity of this pathway is sensitively responsive to changes in the accuracy of protein synthesis that are triggered by either mutations in ribosomal proteins or exposure to antibiotics. Increasing the error rate during ribosomal decoding promoted competence, while reducing the error rate below the baseline level repressed the development of both spontaneous and antibiotic-induced competence. This pattern of regulation was promoted by the bacterial HtrA serine protease. Analysis of strains with the htrA (S234A) catalytic site mutation showed that the proteolytic activity of HtrA selectively repressed competence when translational fidelity was high but not when accuracy was low. These findings redefine the pneumococcal competence pathway as a response to errors during protein synthesis. This response has the capacity to address the immediate challenge of misfolded proteins through production of chaperones and proteases and may also be able to address, through genetic exchange, upstream coding errors that cause intrinsic protein folding defects. The competence pathway may thereby represent a strategy for dealing with lesions that impair proper protein coding and for maintaining the coding integrity of the genome. The signaling pathway that governs competence in the human respiratory tract pathogen Streptococcus pneumoniae regulates both genetic transformation and the production of cellular chaperones and proteases. The current study shows that this pathway is sensitively controlled in response to changes in the accuracy of protein synthesis. Increasing the error rate during

Study of Klebsiella pneumoniae strains resistant to carbapenems isolated from blood in eastern Liguria

Directory of Open Access Journals (Sweden)

Giulia Carnesecchi

2012-12-01

Full Text Available Objectives. Study of multi-resistant Klebsiella pneumoniae strains isolated from blood cultures collected from in-patients of hospitals located in eastern Liguria, and evaluation of the susceptibility to carbapenems and other antibiotics by E-test and automated methods. Methods. At the Laboratory of Clinical Microbiology, of Lavagna Hospital in eastern Liguria, 397 Klebsiella pneumoniae strains were collected from in-patients from different wards of hospitals sites, during the year 2011. They included 115 isolates from blood cultures (aerobic and anaerobic and various biological materials. All strains were tested in the laboratory for their susceptibility to antibiotics. Results. Of the 115 strains of Klebsiella pneumoniae collected from blood cultures 59.1% showed resistance to imipenem, ertapenem, meropenem. Conclusions. The data show a high incidence of resistance to carbapenems in Klebsiella pneumoniae isolated from blood cultures.This is important to implement surveillance programs for control and prevention, but also reduce the intake of antibiotics when they are not strictly necessary.

Cloning, recombinant production, crystallization and preliminary X-ray diffraction analysis of a family 101 glycoside hydrolase from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Gregg, Katie J.; Boraston, Alisdair B.

2009-01-01

The catalytic module of a family 101 glycoside hydrolase from S. pneumoniae was cloned, recombinantly produced and crystallized. Streptococcus pneumoniae is a serious human pathogen that is responsible for a wide range of diseases including pneumonia, meningitis, septicaemia and otitis media. The full virulence of this bacterium is reliant on carbohydrate processing and metabolism, as revealed by biochemical and genetic studies. One carbohydrate-processing enzyme is a family 101 glycoside hydrolase (SpGH101) that is responsible for catalyzing the liberation of galactosyl β1,3-N-acetyl-d-galactosamine (Galβ1,3GalNAc) α-linked to serine or threonine residues of mucin-type glycoproteins. The 124 kDa catalytic module of this enzyme (SpGH101CM) was cloned and overproduced in Escherichia coli and purified. Crystals were obtained in space group P2 1 and diffracted to 2.0 Å resolution, with unit-cell parameters a = 81.86, b = 88.91, c = 88.77 Å, β = 112.46°. SpGH101CM also qualitatively displayed good activity towards the synthetic substrate p-nitrophenyl-2-acetamido-2-deoxy-3-O-(β-d-galactopyranosyl) -α-d-galactopyranoside, which is consistent with the classification of this enzyme as an endo-α-N-acetylgalactosaminidase

Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis.

Science.gov (United States)

Abdeldaim, Guma M K; Strålin, Kristoffer; Korsgaard, Jens; Blomberg, Jonas; Welinder-Olsson, Christina; Herrmann, Björn

2010-12-03

Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR) for detection of S. pneumoniae (9802 gene fragment), H. influenzae (omp P6 gene) and N. meningitidis (ctrA gene). The method was evaluated on bronchoalveolar lavage (BAL) samples from 156 adults with lower respiratory tract infection (LRTI) and 31 controls, and on 87 cerebrospinal fluid (CSF) samples from meningitis patients. The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis) in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 10⁵ genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively.In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both bacteria. The PCR provides increased

Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis

Directory of Open Access Journals (Sweden)

Welinder-Olsson Christina

2010-12-01

Full Text Available Abstract Background Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR for detection of S. pneumoniae (9802 gene fragment, H. influenzae (omp P6 gene and N. meningitidis (ctrA gene. The method was evaluated on bronchoalveolar lavage (BAL samples from 156 adults with lower respiratory tract infection (LRTI and 31 controls, and on 87 cerebrospinal fluid (CSF samples from meningitis patients. Results The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 105 genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively. In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both

Evaluación de un medio para la conservación de Streptococcus pneumoniae a partir de muestras nasofaríngeas

Directory of Open Access Journals (Sweden)

Nacxiry Fonseca

2000-09-01

Full Text Available La Organización Mundial de la Salud (OMS llegó a un consenso. en 1998, acerca de la metodologia general para el estudio de portadores de Streptococcus pneumoniae Esta metodología incluía un nuevo medio para el transporte y el almacenamiento de muestras nasofaringeas, compuesto portriptona, glucosa, glicerol y leche descremada, denominado STGG. Este medio fue evaluado oor nuestro laboratorio, en marzo de 1999. en un grupo de 15 niños menores de 5 años asistentes a una guarderia de Bogotá. Se les tomó una muestia nasofaringea que se colocó en el medio STGG y, posteriormente, se valoró el crecimiento de S. pneumoniae en cuatro momentos diferentes: 0, 5 , 10 y 30 días después de la toma de la muestra. La recuperación inicial de S. pneumoniae fue de 73% (11/15. En todas las 11 muestras de las que se obtuvo un crecimiento inicial, fue posible recuperar S. pneumoniae en los diferentes tiempos de observación, aún en las muestras con crecimiento en un solo cuadrante. En el tiempo 0 y a los 30 días, 7 de las 11 muestras presentaron un crecimiento de abundante a moderado. Con los datos obtenidos, se logró demostrar que el medio STGG es capaz de mantener, a largo plazo, la viabilidad de S. pneumoniae en muestras nasofaringeas de niños portadores de este microorganismo.

Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia

Directory of Open Access Journals (Sweden)

Aura Lucía Leal

1999-03-01

Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P < 0,0001. Los resultados de este estudio indican la necesidad de mantener una vigilancia activa de los patrones de

Radiographic features of Mycoplasma pneumoniae pneumonia: differential diagnosis and performance timing

International Nuclear Information System (INIS)

Miyashita, Naoyuki; Sugiu, Tadaaki; Kawai, Yasuhiro; Oda, Keiko; Yamaguchi, Tetsuya; Ouchi, Kazunobu; Kobashi, Yoshihiro; Oka, Mikio

2009-01-01

The Japanese Respiratory Society guidelines propose a differential diagnosis for atypical pneumonia and bacterial pneumonia using a scoring system for the selection of appropriate antibiotic. In order to improve this scoring system, the guidelines are seeking new specific parameter. The purpose of this study was to clarify the pattern of abnormalities with Mycoplasma pneumoniae pneumonia on chest computed tomography (CT) and whether the radiographic findings could distinguish M. pneumoniae pneumonia from Streptococcus pneumoniae pneumonia. A retrospective review was performed of the CT findings of 64 cases and 68 cases where M. pneumoniae and S. pneumoniae, respectively, were the only pathogen identified by the panel of diagnostic tests used. Of the 64 patients with M. pneumoniae pneumonia, bronchial wall thickening was observed most frequently (81%), followed by centrilobular nodules (78%), ground-glass attenuation (78%), and consolidation (61%). Bronchial wall thickening and centrilobular nodules were observed more often in M. pneumoniae patients than in S. pneumoniae patients (p < 0.0001). The presence of bilateral bronchial wall thickening or centrilobular nodules was only seen in patients with M. pneumoniae pneumonia. Using the scoring system of the Japanese Respiratory Society guidelines and chest CT findings, 97% of M. pneumoniae patients were suspected to be M. pneumoniae pneumonia without serology. When comparing the CT findings between early stage and progressed stage in the same patients with severe pneumonia, the radiographic features of early stage M. pneumoniae pneumonia were not observed clearly in the progressed stage. The present results indicate that the diagnosis of M. pneumoniae pneumonia would appear to be reliable when found with a combination of bronchial wall thickening and centrilobular nodules in the CT findings. However, these CT findings are not observed in progressed severe M. pneumoniae pneumonia patients

Intranasal delivery of nanoparticle-based vaccine increases protection against S. pneumoniae

Energy Technology Data Exchange (ETDEWEB)

Mott, Brittney [University of North Texas Health Science Center, Department of Molecular Biology and Immunology (United States); Thamake, Sanjay [Radio-Isotope Therapy of America Foundation (United States); Vishwanatha, Jamboor; Jones, Harlan P., E-mail: harlan.jones@unthsc.edu [University of North Texas Health Science Center, Department of Molecular Biology and Immunology (United States)

2013-05-15

Nanoparticle (NP) technologies are becoming commonplace in the development of vaccine delivery systems to protect against various diseases. The current study determined the efficacy of intranasal delivery of a 234 {+-} 87.5 nm poly lactic-co-glycolic acid nanoparticle vaccine construct in establishing protection against experimental respiratory pneumococcal infection. Nanoparticles encapsulating heat-killed Streptococcus pneumoniae (NP-HKSP) were retained in the lungs 11 days following nasal administration compared to empty NP. Immunization with NP-HKSP produced significant resistance against S. pneumoniae infection compared to administration of HKSP alone. Increased protection correlated with a significant increase in antigen-specific Th1-associated IFN-{gamma} cytokine response by pulmonary lymphocytes. This study establishes the efficacy of NP-based technology as a non-invasive and targeted approach for nasal-pulmonary immunization against pulmonary infections.

Intranasal delivery of nanoparticle-based vaccine increases protection against S. pneumoniae

International Nuclear Information System (INIS)

Mott, Brittney; Thamake, Sanjay; Vishwanatha, Jamboor; Jones, Harlan P.

2013-01-01

Nanoparticle (NP) technologies are becoming commonplace in the development of vaccine delivery systems to protect against various diseases. The current study determined the efficacy of intranasal delivery of a 234 ± 87.5 nm poly lactic-co-glycolic acid nanoparticle vaccine construct in establishing protection against experimental respiratory pneumococcal infection. Nanoparticles encapsulating heat-killed Streptococcus pneumoniae (NP-HKSP) were retained in the lungs 11 days following nasal administration compared to empty NP. Immunization with NP-HKSP produced significant resistance against S. pneumoniae infection compared to administration of HKSP alone. Increased protection correlated with a significant increase in antigen-specific Th1-associated IFN-γ cytokine response by pulmonary lymphocytes. This study establishes the efficacy of NP-based technology as a non-invasive and targeted approach for nasal-pulmonary immunization against pulmonary infections.

Intranasal delivery of nanoparticle-based vaccine increases protection against S. pneumoniae

Science.gov (United States)

Mott, Brittney; Thamake, Sanjay; Vishwanatha, Jamboor; Jones, Harlan P.

2013-05-01

Nanoparticle (NP) technologies are becoming commonplace in the development of vaccine delivery systems to protect against various diseases. The current study determined the efficacy of intranasal delivery of a 234 ± 87.5 nm poly lactic-co-glycolic acid nanoparticle vaccine construct in establishing protection against experimental respiratory pneumococcal infection. Nanoparticles encapsulating heat-killed Streptococcus pneumoniae (NP-HKSP) were retained in the lungs 11 days following nasal administration compared to empty NP. Immunization with NP-HKSP produced significant resistance against S. pneumoniae infection compared to administration of HKSP alone. Increased protection correlated with a significant increase in antigen-specific Th1-associated IFN-γ cytokine response by pulmonary lymphocytes. This study establishes the efficacy of NP-based technology as a non-invasive and targeted approach for nasal-pulmonary immunization against pulmonary infections.

Conservative sex and the benefits of transformation in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Daniel J P Engelmoer

Full Text Available Natural transformation has significant effects on bacterial genome evolution, but the evolutionary factors maintaining this mode of bacterial sex remain uncertain. Transformation is hypothesized to have both positive and negative evolutionary effects on bacteria. It can facilitate adaptation by combining beneficial mutations into a single individual, or reduce the mutational load by exposing deleterious alleles to natural selection. Alternatively, it may expose transformed cells to damaged or otherwise mutated environmental DNA and is energetically expensive. Here, we examine the long-term effects of transformation in the naturally competent species Streptococcus pneumoniae by evolving populations of wild-type and competence-deficient strains in chemostats for 1000 generations. Half of these populations were exposed to periodic mild stress to examine context-dependent benefits of transformation. We find that competence reduces fitness gain under benign conditions; however, these costs are reduced in the presence of periodic stress. Using whole genome re-sequencing, we show that competent populations fix fewer new mutations and that competence prevents the emergence of mutators. Our results show that during evolution in benign conditions competence helps maintain genome stability but is evolutionary costly; however, during periods of stress this same conservativism enables cells to retain fitness in the face of new mutations, showing for the first time that the benefits of transformation are context dependent.

Risk of fracture and pneumonia from acid suppressive drugs.