Bafetinib (INNO-406) reverses multidrug resistance by inhibiting the efflux function of ABCB1 and ABCG2 transporters

Science.gov (United States)

Zhang, Yun-Kai; Zhang, Guan-Nan; Wang, Yi-Jun; Patel, Bhargav A.; Talele, Tanaji T.; Yang, Dong-Hua; Chen, Zhe-Sheng

2016-05-01

ATP-Binding Cassette transporters are involved in the efflux of xenobiotic compounds and are responsible for decreasing drug accumulation in multidrug resistant (MDR) cells. Discovered by structure-based virtual screening algorithms, bafetinib, a Bcr-Abl/Lyn tyrosine kinase inhibitor, was found to have inhibitory effects on both ABCB1- and ABCG2-mediated MDR in this in-vitro investigation. Bafetinib significantly sensitized ABCB1 and ABCG2 overexpressing MDR cells to their anticancer substrates and increased the intracellular accumulation of anticancer drugs, particularly doxorubicin and [3H]-paclitaxel in ABCB1 overexpressing cells; mitoxantrone and [3H]-mitoxantrone in ABCG2 overexpressing cells, respectively. Bafetinib stimulated ABCB1 ATPase activities while inhibited ABCG2 ATPase activities. There were no significant changes in the expression level or the subcellular distribution of ABCB1 and ABCG2 in the cells exposed to 3 μM of bafetinib. Overall, our study indicated that bafetinib reversed ABCB1- and ABCG2-mediated MDR by blocking the drug efflux function of these transporters. These findings might be useful in developing combination therapy for MDR cancer treatment.

The naphthoquinones, vitamin K3 and its structural analogue plumbagin, are substrates of the multidrug resistance linked ATP binding cassette drug transporter ABCG2.

Science.gov (United States)

Shukla, Suneet; Wu, Chung-Pu; Nandigama, Krishnamachary; Ambudkar, Suresh V

2007-12-01

Vitamin K3 (menadione; 2-methyl-1,4-naphthoquinone) is a structural precursor of vitamins K1 and K2, which are essential for blood clotting. The naturally occurring structural analogue of this vitamin, plumbagin (5-hydroxy-menadione), is known to modulate cellular proliferation, apoptosis, carcinogenesis, and radioresistance. We here report that both vitamin K3 and plumbagin are substrates of the multidrug resistance-linked ATP binding cassette drug transporter, ABCG2. Vitamin K3 and plumbagin specifically inhibited the ABCG2-mediated efflux of mitoxantrone but did not have any effect on the ABCB1-mediated efflux of rhodamine 123. This inhibition of ABCG2 function was due to their interaction at the substrate-binding site(s). Vitamin K3 and plumbagin inhibited the binding of [(125)I]iodoarylazidoprazosin, a substrate of ABCG2, to this transporter in a concentration-dependent manner with IC(50) values of 7.3 and 22.6 micromol/L, respectively, but had no effect on the binding of the photoaffinity analogue to ABCB1. Both compounds stimulated ABCG2-mediated ATP hydrolysis and also inhibited the mitoxantrone-stimulated ATPase activity of the ABCG2 transporter, but did not have any significant effect on the ATPase activity of ABCB1. In a cytotoxicity assay, ABCG2-expressing HEK cells were 2.8- and 2.3-fold resistant to plumbagin and vitamin K3, respectively, compared with the control cells, suggesting that they are substrates of this transporter. Collectively, these data show for the first time that vitamin K3 is a substrate of the ABCG2 transporter. Thus, ABCG2 may have a role in the regulation of vitamin K3 levels in the body. In addition, vitamin K3 and its structural derivative, plumbagin, could potentially be used to modulate ABCG2 function.

Implications of ABCG2 Expression on Irinotecan Treatment of Colorectal Cancer Patients

DEFF Research Database (Denmark)

Nielsen, Dorte Lisbet; Palshof, Jesper Andreas; Bruenner, Nils

2017-01-01

Background: One of the main chemotherapeutic drugs used on a routine basis in patients with metastatic colorectal cancer ((m)CRC) is the topoisomerase-1 inhibitor, irinotecan. However, its usefulness is limited by the pre-existing or inevitable development of resistance. The ATP-binding cassette...... to irinotecan treatment in CRC patients. Results: Few studies have evaluated the association between ABCG2 gene or protein expression and prognosis in CRC patients. Discordant results were reported. The discrepancies might be explained by the use of different criteria for interpretation of results...... (ABC) transporter ABCG2/breast cancer resistance protein (BRCP) through its function in xenobiotic clearance might play an important role in irinotecan resistance. With a goal to evaluate the clinical significance of ABCG2 measurements, we here review the current literature on ABCG2 in relation...

A preliminary study of the relationship between promoter methylation of the ABCG1, GALNT2 and HMGCR genes and coronary heart disease.

Directory of Open Access Journals (Sweden)

Ping Peng

Full Text Available To investigate the association of ABCG1, GALNT2 and HMGCR genes promoter DNA methylation with coronary heart disease (CHD and explore the interaction between their methylation status and the CHD patients' clinical characteristics in Han Chinese population.Methylation-specific polymerase chain reaction (MSP technology was used to examine the role of the aberrant gene promoter methylation in CHD in Han Chinese population. A total of 85 CHD patients and 54 participants without CHD confirmed by angiography were recruited. 82.8% of the participants with ABCG1 gene promoter hypermethylation have CHD, while only 17.4% of the participants without hypermethylation have it. The average age of the participants with GALNT2 gene promoter hypermethylation is 62.10 ± 8.21, while that of the participants without hypermethylation is 57.28 ± 9.87; in the former group, 75.4% of the participants have CHD, compared to only 50% in the latter group. As for the HMGCR gene, the average age of the participants with promoter hypermethylation is 63.24 ± 8.10 and that of the participants without hypermethylation is 57.79 ± 9.55; its promoter hypermethylation is likely to be related to smoking. Our results indicated a significant statistical association of promoter methylation of the ABCG1 gene with increased risk of CHD (OR = 19.966; 95% CI, 7.319-54.468; P*<0.001; P*: adjusted for age, gender, smoking, lipid level, hypertension, and diabetes. Similar results were obtained for that of the GALNT2 gene (OR = 2.978; 95% CI, 1.335-6.646; P* = 0.008, but not of HMGCR gene (OR = 1.388; 95% CI, 0.572-3.371; P*  = 0.469.The present work provides evidence to support the association of promoter DNA methylation status with the risk profile of CHD. Our data indicates that promoter DNA hypermethylation of the ABCG1 and GALNT2 genes, but not the HMGCR gene, is associated with an increased risk of CHD. CHD, smoking and aging are likely to be the important factors influencing DNA

The multidrug transporter ABCG2 (BCRP) is inhibited by plant-derived cannabinoids.

Science.gov (United States)

Holland, M L; Lau, D T T; Allen, J D; Arnold, J C

2007-11-01

Cannabinoids are used therapeutically for the palliation of the adverse side effects associated with cancer chemotherapy. However, cannabinoids also inhibit both the activity and expression of the multidrug transporter, P-glycoprotein in vitro. Here we address the interaction of cannabinol (CBN), cannabidiol (CBD) and delta 9-tetrahydrocannabinol (THC) with the related multidrug transporter, ABCG2. Cannabinoid inhibition of Abcg2/ABCG2 was assessed using flow cytometric analysis of substrate accumulation and ATPase activity assays. The cytotoxicity and chemosensitization by cannabinoids was determined with cell viability assays. Expression of cannabinoid and vanilloid receptors was assessed using reverse transcriptase polymerase chain reaction, and cannabinoid modulation of ABCG2 expression was examined using immunoblotting. CBN, CBD and THC increased the intracellular accumulation of the Abcg2/ABCG2 substrate, mitoxantrone, in an over-expressing cell line. The THC metabolite, (-)-11-nor-9-carboxy-delta 9-THC was much less potent. The plant cannabinoids inhibited both basal and substrate stimulated ATPase activity of human ABCG2. Cannabinoid cytotoxicity occurred in the absence of known cannabinoid cell surface receptors, and only at concentrations higher than those required for Abcg2/ABCG2 inhibition. Sub-toxic concentrations of the cannabinoids resensitized the overexpressing cell line to the cytotoxic effect of Abcg2/ABCG2 substrates, mitoxantrone and topotecan. This occurred in the absence of any effect on ABCG2 expression. Cannabinoids are novel Abcg2/ABCG2 inhibitors, reversing the Abcg2-mediated multidrug-resistant phenotype in vitro. This finding may have implications for the co-administration of cannabinoids with pharmaceuticals that are ABCG2 substrates.

Short communication: The gain-of-function Y581S polymorphism of the ABCG2 transporter increases secretion into milk of danofloxacin at the therapeutic dose for mastitis treatment.

Science.gov (United States)

Otero, J A; Barrera, B; de la Fuente, A; Prieto, J G; Marqués, M; Álvarez, A I; Merino, G

2015-01-01

The ATP-binding cassette transporter ABCG2 restricts the exposure of certain drugs and natural compounds in different tissues and organs. Its expression in the mammary gland is induced during lactation and is responsible for the active secretion of many compounds into milk, including antimicrobial agents. This particular function of ABCG2 may affect drug efficacy against mastitis and the potential presence of drug residues in the milk. Previous in vitro and in vivo studies showed increased transport of several compounds, including fluoroquinolones, by the bovine ABCG2 Y581S polymorphism. Our main purpose was to study the potential effect of this bovine ABCG2 polymorphism on the secretion into milk of the antimicrobial danofloxacin administered at the therapeutic dose of 6mg/kg used for mastitis treatment. In addition, the effect of this polymorphism on the relative mRNA and protein levels of ABCG2 by quantitative real-time PCR and Western blot were studied. Danofloxacin 18% (6mg/kg) was administered to 6 Y/Y homozygous and 5 Y/S heterozygous cows. Danofloxacin levels in milk and milk-to-plasma concentration ratios were almost 1.5- and 2-fold higher, respectively, in Y/S cows compared with the Y/Y cows, showing a higher capacity of this variant to transport danofloxacin into milk. Furthermore, the higher activity of this polymorphism is not linked to higher ABCG2 mRNA or protein levels. These results demonstrate the relevant effect of the Y581S polymorphism of the bovine ABCG2 transporter in the secretion into milk of danofloxacin after administration of 6mg/kg, with potentially important consequences for mastitis treatment and for milk residue handling. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Role of Abcg2 During Mouse Embroyonic Stem Cell Diffferentiation

Science.gov (United States)

Role of Abcg2 During Mouse Embryonic Stem Cell Differentiation. Abcg2 is a multidrug resistance ATP-binding cassette (ABC) transporter whose activity may be considered a hallmark of stem cell plasticity. The role of Abcg2 during early embryogenesis, however, is unclear. Studies...

The cholesterol transporter ABCG1 links cholesterol homeostasis and tumour immunity.

Science.gov (United States)

Sag, Duygu; Cekic, Caglar; Wu, Runpei; Linden, Joel; Hedrick, Catherine C

2015-02-27

ATP-binding cassette transporter G1 (ABCG1) promotes cholesterol efflux from cells and regulates intracellular cholesterol homeostasis. Here we demonstrate a role of ABCG1 as a mediator of tumour immunity. Abcg1(-/-) mice have dramatically suppressed subcutaneous MB49-bladder carcinoma and B16-melanoma growth and prolonged survival. We show that reduced tumour growth in Abcg1(-/-) mice is myeloid cell intrinsic and is associated with a phenotypic shift of the macrophages from a tumour-promoting M2 to a tumour-fighting M1 within the tumour. Abcg1(-/-) macrophages exhibit an intrinsic bias towards M1 polarization with increased NF-κB activation and direct cytotoxicity for tumour cells in vitro. Overall, our study demonstrates that the absence of ABCG1 inhibits tumour growth through modulation of macrophage function within the tumour, and illustrates a link between cholesterol homeostasis and cancer.

Downregulation of hepatic and intestinal ATP-binding-cassette transporters abcg5 and abcg8 expression associated with altered sterol fluxes in rats with streptozotocin-induced diabetes

NARCIS (Netherlands)

Bloks, VW; Bakker-van Waarde, WW; Verkade, HJ; Kema, IP; Havinga, R; Wolters, H; Schaap, FG; Sauer, PJJ; Vink, E; Groen, AK; Kuipers, F

ABSTRACT: P234 Downregulation of Hepatic and Intestinal ATP-Binding-Cassette Transporters Abcg5 and Abcg8 Expression Associated with Altered Sterol Fluxes in Rats with Streptozotocin-Induced Diabetes Vincent W. Bloks, Willie W. Bakker-van Waarde, Henkjan J. Verkade, Ido P. Kema, Rick Havinga, Henk

Pharmacogenomics of the human ABC transporter ABCG2: from functional evaluation to drug molecular design

Science.gov (United States)

Ishikawa, Toshihisa; Tamura, Ai; Saito, Hikaru; Wakabayashi, Kanako; Nakagawa, Hiroshi

2005-10-01

In the post-genome-sequencing era, emerging genomic technologies are shifting the paradigm for drug discovery and development. Nevertheless, drug discovery and development still remain high-risk and high-stakes ventures with long and costly timelines. Indeed, the attrition of drug candidates in preclinical and development stages is a major problem in drug design. For at least 30% of the candidates, this attrition is due to poor pharmacokinetics and toxicity. Thus, pharmaceutical companies have begun to seriously re-evaluate their current strategies of drug discovery and development. In that light, we propose that a transport mechanism-based design might help to create new, pharmacokinetically advantageous drugs, and as such should be considered an important component of drug design strategy. Performing enzyme- and/or cell-based drug transporter, interaction tests may greatly facilitate drug development and allow the prediction of drug-drug interactions. We recently developed methods for high-speed functional screening and quantitative structure-activity relationship analysis to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide a practical tool to screen synthetic and natural compounds, and these data can be applied to the molecular design of new drugs. In this review article, we present an overview on the genetic polymorphisms of human ABC transporter ABCG2 and new camptothecin analogues that can circumvent AGCG2-associated multidrug resistance of cancer.

Upregulated miR-132 in Lgr5+ gastric cancer stem cell-like cells contributes to cisplatin-resistance via SIRT1/CREB/ABCG2 signaling pathway.

Science.gov (United States)

Zhang, Lanfang; Guo, Xiaohe; Zhang, Dezhong; Fan, Yingying; Qin, Lei; Dong, Shuping; Zhang, Lanfang

2017-09-01

Cisplatin resistance has long been a major problem that restricts its use. A novel paradigm in tumor biology suggests that gastric tumor chemo-resistance is driven by gastric cancer stem cell-like (GCSCs). Growing evidence has indicated that microRNAs (miRNAs) contributes to chemo-resistance in gastric cancer (GC). Here, Lgr5 + cells derived from gastric cancer cell lines displayed stem cell-like features. Flow cytometry demonstrated the presence of a variable fraction of Lgr5 in 19 out of 20 GC specimens. By comparing the miRNA expression profiles of Lgr5 + GCSCs and Lrg5 - cells, we established the upregulation of miR-132 in Lgr5 + GCSCs. The enhanced miR-132 expression correlated chemo-resistance in GC patients. Kaplan-Meier survival curve showed that patients with low miR-132 expression survived obviously longer. Functional assays results indicated that miR-132 promoted cisplatin resistance in Lgr5 + GCSCs in vitro and in vivo. Further dual-luciferase reporter gene assays revealed that SIRT1 was the direct target of miR-132. The expression of miR-132 was inversely correlated with SIRT1 in gastric cancer specimens. Furthermore, through PCR array we discovered ABCG2 was one of the downstream targets of SIRT1. Overexpression of SIRT1 down-regulated ABCG2 expression by promoting the de-acetylation of the transcription factor CREB. CREB was further activated ABCG2 via binding to the promoter of ABCG2 to induce transcription. Thus, we concluded that miR-132 regulated SIRT1/CREB/ABCG2 signaling pathway contributing to the cisplatin resistance and might serve as a novel therapeutic target against gastric cancer. © 2017 Wiley Periodicals, Inc.

Structure and function of ABCG2-rich extracellular vesicles mediating multidrug resistance.

Directory of Open Access Journals (Sweden)

Vicky Goler-Baron

2011-01-01

Full Text Available Multidrug resistance (MDR is a major impediment to curative cancer chemotherapy. The ATP-Binding Cassette transporters ABCG2, ABCB1 and ABCC2 form a unique defense network against multiple structurally and functionally distinct chemotherapeutics, thereby resulting in MDR. Thus, deciphering novel mechanisms of MDR and their overcoming is a major goal of cancer research. Recently we have shown that overexpression of ABCG2 in the membrane of novel extracellular vesicles (EVs in breast cancer cells results in mitoxantrone resistance due to its dramatic sequestration in EVs. However, nothing is known about EVs structure, biogenesis and their ability to concentrate multiple antitumor agents. To this end, we here found that EVs are structural and functional homologues of bile canaliculi, are apically localized, sealed structures reinforced by an actin-based cytoskeleton and secluded from the extracellular milieu by the tight junction proteins occludin and ZO-1. Apart from ABCG2, ABCB1 and ABCC2 were also selectively targeted to the membrane of EVs. Moreover, Ezrin-Radixin-Moesin protein complex selectively localized to the border of the EVs membrane, suggesting a key role for the tethering of MDR pumps to the actin cytoskeleton. The ability of EVs to concentrate and sequester different antitumor drugs was also explored. Taking advantage of the endogenous fluorescence of anticancer drugs, we found that EVs-forming breast cancer cells display high level resistance to topotecan, imidazoacridinones and methotrexate via efficient intravesicular drug concentration hence sequestering them away from their cellular targets. Thus, we identified a new modality of anticancer drug compartmentalization and resistance in which multiple chemotherapeutics are actively pumped from the cytoplasm and highly concentrated within the lumen of EVs via a network of MDR transporters differentially targeted to the EVs membrane. We propose a composite model for the structure and

Overcoming Multidrug Resistance via Photodestruction of ABCG2-Rich Extracellular Vesicles Sequestering Photosensitive Chemotherapeutics

Science.gov (United States)

Goler-Baron, Vicky; Assaraf, Yehuda G.

2012-01-01

Multidrug resistance (MDR) remains a dominant impediment to curative cancer chemotherapy. Efflux transporters of the ATP-binding cassette (ABC) superfamily including ABCG2, ABCB1 and ABCC1 mediate MDR to multiple structurally and functionally distinct antitumor agents. Recently we identified a novel mechanism of MDR in which ABCG2-rich extracellular vesicles (EVs) form in between attached neighbor breast cancer cells and highly concentrate various chemotherapeutics in an ABCG2-dependent manner, thereby sequestering them away from their intracellular targets. Hence, development of novel strategies to overcome MDR modalities is a major goal of cancer research. Towards this end, we here developed a novel approach to selectively target and kill MDR cancer cells. We show that illumination of EVs that accumulated photosensitive cytotoxic drugs including imidazoacridinones (IAs) and topotecan resulted in intravesicular formation of reactive oxygen species (ROS) and severe damage to the EVs membrane that is shared by EVs-forming cells, thereby leading to tumor cell lysis and the overcoming of MDR. Furthermore, consistent with the weak base nature of IAs, MDR cells that are devoid of EVs but contained an increased number of lysosomes, highly accumulated IAs in lysosomes and upon photosensitization were efficiently killed via ROS-dependent lysosomal rupture. Combining targeted lysis of IAs-loaded EVs and lysosomes elicited a synergistic cytotoxic effect resulting in MDR reversal. In contrast, topotecan, a bona fide transport substrate of ABCG2, accumulated exclusively in EVs of MDR cells but was neither detected in lysosomes of normal breast epithelial cells nor in non-MDR breast cancer cells. This exclusive accumulation in EVs enhanced the selectivity of the cytotoxic effect exerted by photodynamic therapy to MDR cells without harming normal cells. Moreover, lysosomal alkalinization with bafilomycin A1 abrogated lysosomal accumulation of IAs, consequently preventing

ABCG2 inhibition as a therapeutic approach for overcoming ...

Indian Academy of Sciences (India)

2016-02-16

Feb 16, 2016 ... Breast cancer resistance protein (BCRP, ABCP or MXR)/ATP-binding cassette subfamily G member 2 (ABCG2) was characterized as a multidrug resistance efflux transporter in 1998. ABCG2 physiologically acts as a part of a self- defence mechanism for the organism; it enhances eliminating of toxic ...

ABCG2 Inhibition as a Therapeutic Approach for Overcoming ...

Indian Academy of Sciences (India)

Breast cancer resistance protein (BCRP, ABCP or MXR) / ATP-binding cassette subfamily G member 2 (ABCG2) was characterized as a multidrug resistance efflux transporter in 1998. ABCG2 physiologically acts as a part of a self-defense mechanism for the organism; it enhances eliminating of toxic xenobiotic substances ...

Correlation of HIF-2α, ABCG2 and OCT-4 with chemotherapy resistance in human gastric cancer

Directory of Open Access Journals (Sweden)

Hong-mei ZHANG

2015-11-01

Full Text Available Objective　To investigate the correlation of HIF-2α, ABCG2 and OCT-4 with chemotherapy resistant gastric cancer in humans. Methods　Fifty-two patients who were confirmed to have advanced gastric cancer with the aid of electronic endoscopy and pathology in the Department of Gastroenterology, Affiliated Hospital of Weifang Medical College, were enrolled in the study. According to the effect of FOL-FOX4 chemotherapy that these patients had experienced, they were divided into three groups: CR+PR (complete remission+partial remission group, SD (stable disease group and PD (progressive disease group. The expression levels of HIF-2α, ABCG2, and OCT-4 mRNA and protein were assessed in different groups by using RT-PCR and immunocytochemistry. Results　Two patients achieved CR , 19 achieved PR , 25 showed SD, and 6 showed PD. In other words, CR+PR were seen in 21 patients (40.4%, SD in 25(48.1%, PD in 6(11.5%. In CR+PR group, the expression levels of HIF-2α, ABCG2 and OCT4 mRNA and protein were low, but the above mentioned expressions were significantly increased in SD group and PD group. The expression levels of HIF-2α, ABCG2 and Oct-4 mRNA and protein were highest in the PD group, lower in the SD group, and lowest in the CR + PR groups (all P<0.05. Conclusions　The expression of the markers HIF-2α, ABCG2 and OCT4 in human tumor tissues is related to the effect of chemotherapy for gastric cancer. A high expression of tumor markers is perhaps the main reason for low efficacy of chemotherapy due to drug resistance. DOI: 10.11855/j.issn.0577-7402.2015.10.09

The naphthoquinones, vitamin K3 and its structural analog plumbagin, are substrates of the multidrug resistance-linked ABC drug transporter ABCG2

OpenAIRE

Shukla, Suneet; Wu, Chung-Pu; Nandigama, Krishnamachary; Ambudkar, Suresh V.

2007-01-01

Vitamin K3 (Menadione; 2-methyl-1,4-naphthoquinone) is a structural precursor of vitamins K1 and K2 which are essential for blood clotting. The naturally occurring structural analog of this vitamin, plumbagin (5-hydroxy-menadione), is known to modulate cellular proliferation, apoptosis, carcinogenesis, and radioresistance. We, here, report that both vitamin K3 and plumbagin are substrates of the multidrug resistance-linked ATP binding cassette (ABC) drug transporter, ABCG2. Vitamin K3 and plu...

ABCG2-mediated suppression of chlorin e6 accumulation and photodynamic therapy efficiency in glioblastoma cell lines can be reversed by KO143.

Science.gov (United States)

Abdel Gaber, Sara A; Müller, Patricia; Zimmermann, Wolfgang; Hüttenberger, Dirk; Wittig, Rainer; Abdel Kader, Mahmoud H; Stepp, Herbert

2018-01-01

Photodynamic therapy (PDT) of malignant brain tumors is a promising adjunct to standard treatment, especially if tumor stem cells thought to be responsible for tumor progression and therapy resistance were also susceptible to this kind of treatment. However, some photosensitizers have been reported to be substrates of ABCG2, one of the membrane transporters mediating resistance to chemotherapy. Here we investigate, whether inhibition of ABCG2 can restore sensitivity to photosensitizer chlorin e6-mediated PDT. Accumulation of chlorin e6 in wild type U87 and doxycycline-inducible U251 glioblastoma cells with or without induction of ABCG2 expression or ABCG2 inhibition by KO143 was analyzed using flow cytometry. In U251 cells, ABCG2 was inducible by doxycycline after stable transfection with a tet-on expression plasmid. Tumor sphere cultivation under low attachment conditions was used to enrich for cells with stem cell-like properties. PDT was done on monolayer cell cultures by irradiation with laser light at 665nm. Elevated levels of ABCG2 in U87 cells grown as tumor spheres or in U251 cells after ABCG2 induction led to a 6-fold lower accumulation of chlorin e6 and the light dose needed to reduce cell viability by 50% (LD50) was 2.5 to 4-fold higher. Both accumulation and PDT response can be restored by KO143, an efficient non-toxic inhibitor of ABCG2. Glioblastoma stem cells might escape phototoxic destruction by ABCG2-mediated reduction of photosensitizer accumulation. Inhibition of ABCG2 during photosensitizer accumulation and irradiation promises to restore full susceptibility of this crucial tumor cell population to photodynamic treatment. Copyright © 2017 Elsevier B.V. All rights reserved.

ABCG2 in peptic ulcer: gene expression and mutation analysis.

Science.gov (United States)

Salagacka-Kubiak, Aleksandra; Żebrowska, Marta; Wosiak, Agnieszka; Balcerczak, Mariusz; Mirowski, Marek; Balcerczak, Ewa

2016-08-01

The aim of this study was to evaluate the participation of polymorphism at position C421A and mRNA expression of the ABCG2 gene in the development of peptic ulcers, which is a very common and severe disease. ABCG2, encoded by the ABCG2 gene, has been found inter alia in the gastrointestinal tract, where it plays a protective role eliminating xenobiotics from cells into the extracellular environment. The materials for the study were biopsies of gastric mucosa taken during a routine endoscopy. For genotyping by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) at position C421A, DNA was isolated from 201 samples, while for the mRNA expression level by real-time PCR, RNA was isolated from 60 patients. The control group of healthy individuals consisted of 97 blood donors. The dominant genotype in the group of peptic ulcer patients and healthy individuals was homozygous CC. No statistically significant differences between healthy individuals and the whole group of peptic ulcer patients and, likewise, between the subgroups of peptic ulcer patients (infected and uninfected with Helicobacter pylori) were found. ABCG2 expression relative to GAPDH expression was found in 38 of the 60 gastric mucosa samples. The expression level of the gene varies greatly among cases. The statistically significant differences between the intensity (p = 0.0375) of H. pylori infection and ABCG2 gene expression have been shown. It was observed that the more intense the infection, the higher the level of ABCG2 expression.

A novel ABCG-like transporter of Trypanosoma cruzi is involved in natural resistance to benznidazole

Directory of Open Access Journals (Sweden)

Bianca Zingales

2015-05-01

Full Text Available Benznidazole (BZ is one of the two drugs used for Chagas disease treatment. Nevertheless therapeutic failures of BZ have been reported, which were mostly attributed to variable drug susceptibility among Trypanosoma cruzi strains. ATP-binding cassette (ABC transporters are involved in a variety of translocation processes and some members have been implicated in drug resistance. Here we report the characterisation of the first T. cruzi ABCG transporter gene, named TcABCG1, which is over-expressed in parasite strains naturally resistant to BZ. Comparison of TcABCG1 gene sequence of two TcI BZ-resistant strains with CL Brener BZ-susceptible strain showed several single nucleotide polymorphisms, which determined 11 amino acid changes. CL Brener transfected with TcI transporter genes showed 40-47% increased resistance to BZ, whereas no statistical significant increment in drug resistance was observed when CL Brener was transfected with the homologous gene. Only in the parasites transfected with TcI genes there was 2-2.6-fold increased abundance of TcABCG1 transporter protein. The analysis in wild type strains also suggests that the level of TcABCG1 transporter is related to BZ natural resistance. The characteristics of untranslated regions of TcABCG1 genes of BZ-susceptible and resistant strains were investigated by computational tools.

Purification and biochemical characterization of NpABCG5/NpPDR5, a plant pleiotropic drug resistance transporter expressed in Nicotiana tabacum BY-2 suspension cells.

Science.gov (United States)

Toussaint, Frédéric; Pierman, Baptiste; Bertin, Aurélie; Lévy, Daniel; Boutry, Marc

2017-05-04

Pleiotropic drug resistance (PDR) transporters belong to the ABCG subfamily of ATP-binding cassette (ABC) transporters and are involved in the transport of various molecules across plasma membranes. During evolution, PDR genes appeared independently in fungi and in plants from a duplication of a half-size ABC gene. The enzymatic properties of purified PDR transporters from yeast have been characterized. This is not the case for any plant PDR transporter, or, incidentally, for any purified plant ABC transporter. Yet, plant PDR transporters play important roles in plant physiology such as hormone signaling or resistance to pathogens or herbivores. Here, we describe the expression, purification, enzymatic characterization and 2D analysis by electron microscopy of NpABCG5/NpPDR5 from Nicotiana plumbaginifolia , which has been shown to be involved in the plant defense against herbivores. We constitutively expressed NpABCG5/NpPDR5, provided with a His-tag in a homologous system: suspension cells from Nicotiana tabacum (Bright Yellow 2 line). NpABCG5/NpPDR5 was targeted to the plasma membrane and was solubilized by dodecyl maltoside and purified by Ni-affinity chromatography. The ATP-hydrolyzing specific activity (27 nmol min -1  mg -1 ) was stimulated seven-fold in the presence of 0.1% asolectin. Electron microscopy analysis indicated that NpABCG5/NpPDR5 is monomeric and with dimensions shorter than those of known ABC transporters. Enzymatic data (optimal pH and sensitivity to inhibitors) confirmed that plant and fungal PDR transporters have different properties. These data also show that N. tabacum suspension cells are a convenient host for the purification and biochemical characterization of ABC transporters. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

Phenolic indeno[1,2-b]indoles as ABCG2-selective potent and non-toxic inhibitors stimulating basal ATPase activity

Directory of Open Access Journals (Sweden)

Gozzi GJ

2015-07-01

Full Text Available Gustavo Jabor Gozzi,1,2 Zouhair Bouaziz,3 Evelyn Winter,1,4 Nathalia Daflon-Yunes,1 Mylène Honorat,1 Nathalie Guragossian,3 Christelle Marminon,3 Glaucio Valdameri,1,2 Andre Bollacke,5 Jean Guillon,6 Noël Pinaud,7 Mathieu Marchivie,8 Silvia M Cadena,2 Joachim Jose,5 Marc Le Borgne,3 Attilio Di Pietro11Equipe Labellisée Ligue 2014, BMSSI UMR5086 CNRS/Lyon I University, IBCP, Lyon, France; 2Department of Biochemistry and Molecular Biology, Federal University of Paraná, Curitiba, Paraná, Brazil; 3Faculty of Pharmacy – ISPB, EA 4446 Biomolecules, Cancer and Chemoresistance, Health SFR of East Lyon CNRS UMS3453 - INSERM US7, University of Lyon, Lyon I University, Lyon Cedex 8, France; 4Department of Pharmaceutical Sciences, PGFAR, Federal University of Santa Catarina, Florianopolis, Santa Catarina, Brazil; 5Institute of Pharmaceutical and Medicinal Chemistry, University of Münster, Münster, Germany; 6ARNA Laboratory, Pharmaceutical Sciences UFR, INSERM U869, University of Bordeaux, Bordeaux Cedex, France; 7ISM – CNRS UMR 5255, University of Bordeaux Cedex, France; 8ICMCB CNRS-UPR 9048, University of Bordeaux, Pessac Cedex, FranceAbstract: Ketonic indeno[1,2-b]indole-9,10-dione derivatives, initially designed as human casein kinase II (CK2 inhibitors, were recently shown to be converted into efficient inhibitors of drug efflux by the breast cancer resistance protein ABCG2 upon suited substitutions including a N5-phenethyl on C-ring and hydrophobic groups on D-ring. A series of ten phenolic and seven p-quinonic derivatives were synthesized and screened for inhibition of both CK2 and ABCG2 activities. The best phenolic inhibitors were about threefold more potent against ABCG2 than the corresponding ketonic derivatives, and showed low cytotoxicity. They were selective for ABCG2 over both P-glycoprotein and MRP1 (multidrug resistance protein 1, whereas the ketonic derivatives also interacted with MRP1, and they additionally displayed a lower

[Construction and identification of eukaryotic plasmid pGC-silencer-U6/Neo/GFP/ABCG2].

Science.gov (United States)

Yu, Yanping; Zhang, Song; Kong, Weijia

2010-09-01

To construct three short hairpin RNA (shRNA) interference expression plasmid vectors of human ABCG2 gene, to assay the expression of ABCG2 in a human nasopharyngeal carcinoma (NPC) cell line, CEN-2 cell line, and to detect the RNAi effect of shRNA. Targeting ABCG2 gene sequence, three plasmid expression vectors coding for shRNA and a control vector containing random DNA fragment were constructed. The recombinant plasmids were amplified in Ecoli. DH5 and then identified by restriction digestion, PCR and sequencing. The recombinant plasmids were transfected into CEN-2 cells. ABCG2 expression was assayed by real-time quantitative PCR and Western blot. The construction of pGC-silencer-U6/Neo/GFP/ABCG2 was succeed. The shRNA plasmids significantly down-regulated the ABCG2 expression in CEN-2 cells, at both mRNA level and protein level. Recombinant plasmid 1 had the strongest effect compared with plasmids 2 and 3 (P < 0.05), with an inhibition ratio of 75% at the mRNA level and 68% at the protein level. pGC-silencer-U6/Neo/GFP/ABCG2 has been successfully constructed and it can down-regulate ABCG2 expression after transfected into CEN-2 cells, which could help further studies of ABCG2 functions CEN-2 cell line and contribute to the NPC gene therapy.

Effect of levofloxacin, pazufloxacin, enrofloxacin, and meloxicam on the immunolocalization of ABCG-2 transporter protein in rabbit retina.

Science.gov (United States)

Khan, Adil Mehraj; Rampal, Satyavan; Sood, Naresh Kumar

2018-03-01

Adenosine triphosphate-binding cassette (ABC) sub-family G member-2 (ABCG-2) is a transporter protein, implicated for multi-drug efflux from tissues. This study evaluated the effect of fluoroquinolones; levofloxacin, pazufloxacin and enrofloxacin, and non-steroidal anti-inflammatory drug, meloxicam; on the immunolocalization of ABCG-2 transporter protein of rabbit retinas. Thirty-two male rabbits were randomly divided in to eight groups. Control group was gavaged, 2% benzyl alcohol in 5% dextrose since these chemicals are excipients of the drug preparations used in the treatment groups of this study. Four groups were exclusively gavaged, levofloxacin hemihydrate (10 mg/kg body weight b.i.d 12 h), pazufloxacin mesylate (10 mg/kg body weight b.i.d 12 h), enrofloxacin (20 mg/kg body weight o.d.), and meloxicam (0.2 mg/kg body weight o.d.), respectively. Three other groups were co-gavaged meloxicam with above fluoroquinolones, respectively. These drugs were administered for 21 days. ABCG-2 immunolocalization was mild in the retinas of control and levofloxacin-alone-treated groups. The immunolocalization intensity was significantly higher in meloxicam-alone-treated group when compared to control and levofloxacin-alone-treated groups. Immunolocalization of this transporter increased in the levofloxacin-meloxicam co-treated group when compared to the levofloxacin-alone-treated group. Highest immunolocalization was observed in the enrofloxacin-meloxicam co-treated group although the immunolocalization of all treatment groups, except the levofloxacin-alone-treated group, was significantly higher than the control and levofloxacin-alone-treated groups.

Expressions of ABCG2, CD133, and Podoplanin in Salivary Adenoid Cystic Carcinoma

Directory of Open Access Journals (Sweden)

Wuwei Li

2014-01-01

Full Text Available Adenoid cystic carcinoma (ACC is one of the most common salivary gland malignant tumors with a high risk of recurrence and metastasis. Current studies on cancer stem cells (CSCs have verified that CSCs are the driving force behind tumor initiation and progression, suggesting that new cancer therapies may be established by effectively targeting and killing the CSCs. The primary goal of this study is to investigate the expression patterns of ABCG2, CD133, and podoplanin in ACC of minor salivary glands by immunohistochemistry analysis. We found that ABCG2 was weakly expressed in normal looking salivary gland tissues. A significant upregulation of ABCG2 expression in ACC was observed with a similar expression pattern of Ki-67. CD133 was detected in apical membrane of epithelial cells and podoplanin was expressed positively in myoepithelial cells of both normal looking tissue and ACC. However, no significant difference was found of the expression pattern of CD133 and podoplanin between normal looking tissues and ACC. Our observations suggest that CSCs may exist in quiescent cells with ABCG2 positive staining, which are surrounded by cells with positive expression of ABCG2 and Ki-67 in ACC, and costaining with ABCG2 and Ki-67 may help predict the location of CSCs.

Hedgehog Pathway Inhibitor HhAntag691 Is a Potent Inhibitor of ABCG2/BCRP and ABCB1/Pgp

Directory of Open Access Journals (Sweden)

Yimao Zhang

2009-01-01

Full Text Available HhAntag691 (GDC-0449, a low-molecular weight inhibitor of the tumor-promoting hedgehog (Hh signaling pathway, has been used to treat medulloblastoma in animal models and has recently entered clinical trials for a variety of solid tumors. Here, we show that HhAntag691 inhibits multiple ATP-binding cassette (ABC transporters. ATP-binding cassette transporters are within a family of membrane proteins, the overexpression of which is associated with multidrug resistance, a major impediment to successful cancer treatment. HhAntag691 is a potent inhibitor of two ABC transporters, ABCG2/BCRP and ABCB1/Pgp, and is a mild inhibitor of ABCC1/MRP1. In ABCG2-overexpressing HEK293 cells, HhAntag691 increased retention of the fluorescent ABCG2 substrate BODIPY-prazosin and resensitized these cells to mitoxantrone, an antineoplastic ABCG2 substrate. In Madin-Darby canine kidney II cells engineered to overexpress Pgp or MRP1, HhAntag691 increased the retention of calcein-AM and resensitized them to colchicine. HhAntag691 also resensitized human non-small cell lung carcinoma cells NCI-H460/par and NCI-H460/MX20, which overexpress ABCG2 in response to mitoxantrone, to mitoxantrone, and to topotecan or SN-38. The IC50 values of HhAntag691 for inhibition of ABCG2 and Pgp were ∼1.4 and ∼3.0 µM, respectively. Because ABC transporters are highly expressed at the blood-brain barrier and on many tumor cells, they contribute significantly to treatment failure of many types of cancer, particularly of those within the neuraxis. In addition to its effect on Hh signaling, the ability of HhAntag691 and related compounds to inhibit two key ABC transporters could contribute to their effectiveness in treating malignancies.

Functional non-synonymous variants of ABCG2 and gout risk.

Science.gov (United States)

Stiburkova, Blanka; Pavelcova, Katerina; Zavada, Jakub; Petru, Lenka; Simek, Pavel; Cepek, Pavel; Pavlikova, Marketa; Matsuo, Hirotaka; Merriman, Tony R; Pavelka, Karel

2017-11-01

Common dysfunctional variants of ATP binding cassette subfamily G member 2 (Junior blood group) (ABCG2), a high-capacity urate transporter gene, that result in decreased urate excretion are major causes of hyperuricemia and gout. In the present study, our objective was to determine the frequency and effect on gout of common and rare non-synonymous and other functional allelic variants in the ABCG2 gene. The main cohort recruited from the Czech Republic consisted of 145 gout patients; 115 normouricaemic controls were used for comparison. We amplified, directly sequenced and analysed 15 ABCG2 exons. The associations between genetic variants and clinical phenotype were analysed using the t-test, Fisher's exact test and a logistic and linear regression approach. Data from a New Zealand Polynesian sample set and the UK Biobank were included for the p.V12M analysis. In the ABCG2 gene, 18 intronic (one dysfunctional splicing) and 11 exonic variants were detected: 9 were non-synonymous (2 common, 7 rare including 1 novel), namely p.V12M, p.Q141K, p.R147W, p.T153M, p.F373C, p.T434M, p.S476P, p.D620N and p.K360del. The p.Q141K (rs2231142) variant had a significantly higher minor allele frequency (0.23) in the gout patients compared with the European-origin population (0.09) and was significantly more common among gout patients than among normouricaemic controls (odds ratio = 3.26, P gout (42 vs 48 years, P = 0.0143) and a greater likelihood of a familial history of gout (41% vs 27%, odds ratio = 1.96, P = 0.053). In a meta-analysis p.V12M exerted a protective effect from gout (P gout. Non-synonymous allelic variants of ABCG2 had a significant effect on earlier onset of gout and the presence of a familial gout history. ABCG2 should thus be considered a common and significant risk factor for gout. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Structural basis of small-molecule inhibition of human multidrug transporter ABCG2

DEFF Research Database (Denmark)

Jackson, Scott M; Manolaridis, Ioannis; Kowal, Julia

2018-01-01

requires high-resolution structural insight. Here, we present cryo-EM structures of human ABCG2 bound to synthetic derivatives of the fumitremorgin C-related inhibitor Ko143 or the multidrug resistance modulator tariquidar. Both compounds are bound to the central, inward-facing cavity of ABCG2, blocking...

Endocytosis of ABCG2 drug transporter caused by binding of 5D3 antibody: trafficking mechanisms and intracellular fate.

Science.gov (United States)

Studzian, Maciej; Bartosz, Grzegorz; Pulaski, Lukasz

2015-08-01

ABCG2, a metabolite and xenobiotic transporter located at the plasma membrane (predominantly in barrier tissues and progenitor cells), undergoes a direct progressive endocytosis process from plasma membrane to intracellular compartments upon binding of 5D3 monoclonal antibody. This antibody is specific to an external epitope on the protein molecule and locks it in a discrete conformation within its activity cycle, presumably providing a structural trigger for the observed internalization phenomenon. Using routine and novel assays, we show that ABCG2 is endocytosed by a mixed mechanism: partially via a rapid, clathrin-dependent pathway and partially in a cholesterol-dependent, caveolin-independent manner. While the internalization process is entirely dynamin-dependent and converges initially at the early endosome, subsequent intracellular fate of ABCG2 is again twofold: endocytosis leads to only partial lysosomal degradation, while a significant fraction of the protein is retained in a post-endosomal compartment with the possibility of at least partial recycling back to the cell surface. This externally triggered, conformation-related trafficking pathway may serve as a general regulatory paradigm for membrane transporters, and its discovery was made possible thanks to consistent application of quantitative methods. Copyright © 2015 Elsevier B.V. All rights reserved.

Assessment of ABCG2-mediated transport of pesticides across the rabbit placenta barrier using a novel MDCKII in vitro model

International Nuclear Information System (INIS)

Halwachs, Sandra; Schäfer, Ingo; Kneuer, Carsten; Seibel, Peter; Honscha, Walther

2016-01-01

In humans, the ATP-binding cassette efflux transporter ABCG2 contributes to the fetoprotective barrier function of the placenta, potentially limiting the toxicity of transporter substrates to the fetus. During testing of chemicals including pesticides, developmental toxicity studies are performed in rabbit. Despite its toxicological relevance, ABCG2-mediated transport of pesticides in rabbit placenta has not been yet elucidated. We therefore generated polarized MDCK II cells expressing the ABCG2 transporter from rabbit placenta (rbABCG2) and evaluated interaction of the efflux transporter with selected insecticides, fungicides, and herbicides. The Hoechst H33342 accumulation assay indicated that 13 widely used pesticidal active substances including azoxystrobin, carbendazim, chlorpyrifos, chlormequat, diflufenican, dimethoate, dimethomorph, dithianon, ioxynil, methiocarb, propamocarb, rimsulfuron and toclofos-methyl may be rbABCG2 inhibitors and/or substrates. No such evidence was obtained for chlorpyrifos-methyl, epoxiconazole, glyphosate, imazalil and thiacloprid. Moreover, chlorpyrifos (CPF), dimethomorph, tolclofos-methyl and rimsulfuron showed concentration-dependent inhibition of H33342 excretion in rbABCG2-transduced MDCKII cells. To further evaluate the role of rbABCG2 in pesticide transport across the placenta barrier, we generated polarized MDCKII-rbABCG2 monolayers. Confocal microscopy confirmed correct localization of rbABCG2 protein in the apical plasma membrane. In transepithelial flux studies, we showed the time-dependent preferential basolateral to apical (B > A) directed transport of [ 14 C] CPF across polarized MDCKII-rbABCG2 monolayers which was significantly inhibited by the ABCG2 inhibitor fumitremorgin C (FTC). Using this novel in vitro cell culture model, we altogether showed functional secretory activity of the ABCG2 transporter from rabbit placenta and identified several pesticides like the insecticide CPF as potential rbABCG2 substrates

Assessment of ABCG2-mediated transport of pesticides across the rabbit placenta barrier using a novel MDCKII in vitro model

Energy Technology Data Exchange (ETDEWEB)

Halwachs, Sandra [Institute of Pharmacology, Pharmacy and Toxicology, Faculty of Veterinary Medicine, Universität Leipzig, Leipzig (Germany); Schäfer, Ingo [Molecular Cell Therapy, Center for Biotechnology and Biomedicine, Faculty of Medicine, Universität Leipzig, Leipzig (Germany); Kneuer, Carsten [Federal Institute for Risk Assessment (BfR), Pesticide Safety, Max-Dohrn-Straße 8-10, D-10589 Berlin (Germany); Seibel, Peter [Molecular Cell Therapy, Center for Biotechnology and Biomedicine, Faculty of Medicine, Universität Leipzig, Leipzig (Germany); Honscha, Walther, E-mail: honscha@vetmed.uni-leipzig.de [Institute of Pharmacology, Pharmacy and Toxicology, Faculty of Veterinary Medicine, Universität Leipzig, Leipzig (Germany)

2016-08-15

In humans, the ATP-binding cassette efflux transporter ABCG2 contributes to the fetoprotective barrier function of the placenta, potentially limiting the toxicity of transporter substrates to the fetus. During testing of chemicals including pesticides, developmental toxicity studies are performed in rabbit. Despite its toxicological relevance, ABCG2-mediated transport of pesticides in rabbit placenta has not been yet elucidated. We therefore generated polarized MDCK II cells expressing the ABCG2 transporter from rabbit placenta (rbABCG2) and evaluated interaction of the efflux transporter with selected insecticides, fungicides, and herbicides. The Hoechst H33342 accumulation assay indicated that 13 widely used pesticidal active substances including azoxystrobin, carbendazim, chlorpyrifos, chlormequat, diflufenican, dimethoate, dimethomorph, dithianon, ioxynil, methiocarb, propamocarb, rimsulfuron and toclofos-methyl may be rbABCG2 inhibitors and/or substrates. No such evidence was obtained for chlorpyrifos-methyl, epoxiconazole, glyphosate, imazalil and thiacloprid. Moreover, chlorpyrifos (CPF), dimethomorph, tolclofos-methyl and rimsulfuron showed concentration-dependent inhibition of H33342 excretion in rbABCG2-transduced MDCKII cells. To further evaluate the role of rbABCG2 in pesticide transport across the placenta barrier, we generated polarized MDCKII-rbABCG2 monolayers. Confocal microscopy confirmed correct localization of rbABCG2 protein in the apical plasma membrane. In transepithelial flux studies, we showed the time-dependent preferential basolateral to apical (B > A) directed transport of [{sup 14}C] CPF across polarized MDCKII-rbABCG2 monolayers which was significantly inhibited by the ABCG2 inhibitor fumitremorgin C (FTC). Using this novel in vitro cell culture model, we altogether showed functional secretory activity of the ABCG2 transporter from rabbit placenta and identified several pesticides like the insecticide CPF as potential rbABCG2

Abcg5/Abcg8-independent pathways contribute to hepatobiliary cholesterol secretion in mice

NARCIS (Netherlands)

Plosch, Torsten; van der Veen, Jelske N.; Havinga, Rick; Huijkman, Nicolette C. A.; Bloks, Vincent W.; Kuipers, Folkert

The ATP-binding cassette (ABC) half-transporters ABCG5 and ABCG8 heterodimerize into a functional complex that mediates the secretion of plant sterols and cholesterol by hepatocytes into bile and their apical efflux from enterocytes. We addressed the putative rate-controlling role of Abcg5/Abcg8 in

The breast cancer resistance protein transporter ABCG2 is expressed in the human kidney proximal tubule apical membrane.

NARCIS (Netherlands)

Huls, M.; Brown, C.D.; Windass, A.S.; Sayer, R.; Heuvel, J.J.M.W. van den; Heemskerk, S.; Russel, F.G.M.; Masereeuw, R.

2008-01-01

The Breast Cancer Resistance Protein (BCRP/ABCG2) is a transporter restricting absorption and enhancing excretion of many compounds including anticancer drugs. This transporter is highly expressed in many tissues; however, in human kidney, only the mRNA was found in contrast to the mouse kidney,

Functional characterization of the human multidrug transporter, ABCG2, expressed in insect cells

DEFF Research Database (Denmark)

Ozvegy, C.; Litman, Thomas; Szakacs, G.

2001-01-01

ABCG2 (also called MXR (3), BCRP (4), or ABCP (5) is a recently-identified ABC half-transporter, which causes multidrug resistance in cancer. Here we report that the expression of the ABCG2 protein in Sf9 insect cells resulted in a high-capacity, vanadate-sensitive ATPase activity in isolated...

ROLE OF ATP BINDING CASSETTE SUB-FAMILY MEMBER 2 (ABCG2) IN MOUSE EMBRYONIC STEM CELL DEVELOPMENT.

Science.gov (United States)

ATP binding cassette sub-family member 2 (ABCG2), is a member of the ABC transporter superfamily and a principal xenobiotic transporter. ABCG2 is also highly expressed in certain stem cell populations where it is thought to be related to stem cell plasticity, although the role o...

Development of a model for functional studies of ABCG2 (breast cancer resistance protein) efflux employing a standard BeWo clone (B24).

Science.gov (United States)

Crowe, Andrew; Keelan, Jeffrey A

2012-10-01

Human choriocarcinoma-derived BeWo cells express high levels of breast cancer resistance protein (BCRP/ABCG2) with no functional P-glycoprotein (P-gp) (ABCB1) activity, making them a potential model to study bidirectional ABCG2-mediated drug transport. However, the original BeWo clone (B24) available to researchers does not form confluent monolayers with tight junctions required by the model. Our aim was to adapt culture conditions to attempt to generate confluent BeWo monolayers for drug transport studies using the standard B24 clone. BeWo cells (B24; American Type Culture collection [ATCC]) were cultured in six-well plates or polycarbonate millicell inserts in a number of media formulations, growth supplements, and basement membrane substitutes. Cells were examined for confluence by microscopy, and transepithelial electrical resistance (TEER) was measured daily; monolayer permeability was assessed when TEER had stabilized. Optimal growth rates were achieved in culture conditions consisting of Medium 199 (M199) supplemented with epidermal growth factor (EGF; 20 ng/mL), vitamin supplements, and 10% fetal calf serum (FCS) with collagen coating. A TEER of 170 Ω in 0.6 cm(2) inserts was achieved 2 weeks after seeding under optimal conditions. The cell-impermeable diffusion marker 5(6) carboxy-2,7dichlorodihydrofluorescein (C-DCDHF) had a permeability coefficient of 3.5×10(-6) cm/s, indicative of minimal paracellular permeability. ABCG2 expression, as determined by immunoblotting, remained unaffected by confluency. In conclusion, we describe culture conditions for the B24 BeWo clone that facilitate the formation of monolayers with tighter junctions and reduced paracellular transport compared to previously published models. These growth conditions provide a good model of ABCG2-mediated drug transport in a human placental cell line.

Lack of biliary lipid excretion in the little skate, Raja erinacea, indicates the absence of functional Mdr2, Abcg5, and Abcg8 transporters

NARCIS (Netherlands)

Elferink, Ronald P. J. Oude; Ottenhoff, Roelof; Fricker, Gert; Seward, David J.; Ballatori, Nazzareno; Boyer, James

2004-01-01

The ABC transporters bile salt export pump ( BSEP; encoded by the ABCB11 gene), MDR3 P-glycoprotein (ABCB4), and sterolin 1 and 2 (ABCG5 and ABCG8) are crucial for the excretion of bile salt, phospholipid, and cholesterol, respectively, into the bile of mammals. The current paradigm is that

Effect of Walker A mutation (K86M) on oligomerization and surface targeting of the multidrug resistance transporter ABCG2

DEFF Research Database (Denmark)

Henriksen, Ulla Birk; Gether, Ulrik; Litman, Thomas

2005-01-01

The ATP binding cassette (ABC) half-transporter ABCG2 (MXR/BCRP/ABCP) is associated with mitoxantrone resistance accompanied by cross-resistance to a broad spectrum of cytotoxic drugs. Here we investigate the functional consequences of mutating a highly conserved lysine in the Walker A motif...

Development of imatinib and dasatinib resistance: dynamics of expression of drug transporters ABCB1, ABCC1, ABCG2, MVP, and SLC22A1.

Science.gov (United States)

Gromicho, Marta; Dinis, Joana; Magalhães, Marta; Fernandes, Alexandra R; Tavares, Purificação; Laires, António; Rueff, José; Rodrigues, António Sebastião

2011-10-01

About 20% of patients with chronic myeloid leukemia (CML) do not respond to treatment with imatinib either initially or because of acquired resistance. To study the development of CML drug resistance, an in vitro experimental system comprising cell lines with different resistance levels was established by exposing K562 cells to increasing concentrations of imatinib and dasatinib anticancer agents. The mRNA levels of BCR- ABL1 and of genes involved in drug transport or redistribution (ABCB1, ABCC1, ABCC3, ABCG2, MVP, and SLC22A1) were measured and the ABL1 kinase domain sequenced. Results excluded BCR- ABL1 overexpression and mutations as relevant resistance mechanisms. Most studied transporters were overexpressed in the majority of resistant cell lines. Their expression pattern was dynamic: varying with resistance level and chronic drug exposure. Studied efflux transporters may have an important role at the initial stages of resistance, but after prolonged exposure and for higher doses of drugs other mechanisms might take place.

Localization of the ABCG2 mitoxantrone resistance-associated protein in normal tissues

DEFF Research Database (Denmark)

Fetsch, Patricia A; Abati, Andrea; Litman, Thomas

2006-01-01

was consistently found in alveolar pneumocytes, sebaceous glands, transitional epithelium of bladder, interstitial cells of testes, prostate epithelium, endocervical cells of uterus, squamous epithelium of cervix, small and large intestinal mucosa/epithelial cells, islet and acinar cells of pancreas, zona...... ABCG2 have a significant secretory function. These data suggest a dual function for ABCG2 in some tissues: the excretion of toxins and xenobiotics including anti-cancer agents and a potential, as-yet undefined role in the secretion of endogenous substrates....

ABCG2 inhibition as a therapeutic approach for overcoming

Indian Academy of Sciences (India)

2016-02-16

Feb 16, 2016 ... the permeability of multi-protein channel complexes. (receptors) .... ABCG2 overexpression is likely to be the cause of high- ... with low or absent function. ..... derivatives, is a water-soluble topoisomerase I inhibitor that.

Identification of intra- and intermolecular disulfide bridges in the multidrug resistance transporter ABCG2

DEFF Research Database (Denmark)

Henriksen, Ulla Birk; Fog, Jacob U; Litman, Thomas

2005-01-01

cysteines predicted to be on the extracellular face of ABCG2. Upon mutation of Cys-592 or Cys-608 to alanine (C592A and C608A), ABCG2 migrated as a dimer in SDS-PAGE under non-reducing conditions; however, mutation of Cys-603 to Ala (C603A) caused the transporter to migrate as a single monomeric band....... Despite this change, C603A displayed efficient membrane targeting and preserved transport function. Because the transporter migrated as a dimer in SDS-PAGE, when only Cys-603 was present (C592A-C608A), the data suggest that Cys-603 forms a symmetrical intermolecular disulfide bridge in the ABCG2 homodimer...

Population-specific association between ABCG2 variants and tophaceous disease in people with gout.

Science.gov (United States)

He, Wendy; Phipps-Green, Amanda; Stamp, Lisa K; Merriman, Tony R; Dalbeth, Nicola

2017-03-07

Tophi contribute to musculoskeletal disability, joint damage and poor health-related quality of life in people with gout. The aim of this study was to examine the role of SLC2A9 and ABCG2 variants in tophaceous disease in people with gout. Participants (n = 1778) with gout fulfilling the 1977 American Rheumatism Association (ARA) classification criteria, who were recruited from primary and secondary care, attended a detailed study visit. The presence of palpable tophi was recorded. SLC2A9 rs11942223, ABCG2 rs2231142 and ABCG2 rs10011796 were genotyped. Data were analysed according to tophus status. Compared to participants without tophi, those with tophi were older, had longer disease duration and higher serum creatinine, and were more likely to be of Māori or Pacific (Polynesian) ancestry. SLC2A9 rs11942223 was not associated with tophi. However, the risk alleles for both ABCG2 single nucleotide polymorphisms (SNPs) were present more frequently in those with tophi (OR (95% CI) 1.24 (1.02-1.51) for rs2231142 and 1.33 (1.01-1.74) for rs10011796, p gout.

MDM2 Antagonists Counteract Drug-Induced DNA Damage

Directory of Open Access Journals (Sweden)

Anna E. Vilgelm

2017-10-01

Full Text Available Antagonists of MDM2-p53 interaction are emerging anti-cancer drugs utilized in clinical trials for malignancies that rarely mutate p53, including melanoma. We discovered that MDM2-p53 antagonists protect DNA from drug-induced damage in melanoma cells and patient-derived xenografts. Among the tested DNA damaging drugs were various inhibitors of Aurora and Polo-like mitotic kinases, as well as traditional chemotherapy. Mitotic kinase inhibition causes mitotic slippage, DNA re-replication, and polyploidy. Here we show that re-replication of the polyploid genome generates replicative stress which leads to DNA damage. MDM2-p53 antagonists relieve replicative stress via the p53-dependent activation of p21 which inhibits DNA replication. Loss of p21 promoted drug-induced DNA damage in melanoma cells and enhanced anti-tumor activity of therapy combining MDM2 antagonist with mitotic kinase inhibitor in mice. In summary, MDM2 antagonists may reduce DNA damaging effects of anti-cancer drugs if they are administered together, while targeting p21 can improve the efficacy of such combinations.

Down-regulation of hepatic and intestinal Abcg5 and Abcg8 expression associated with altered sterol fluxes in rats with streptozotocin-induced diabetes

NARCIS (Netherlands)

Bloks, VW; Bakker-van Waarde, WM; Verkade, HJ; Kema, IP; Wolters, H; Vink, E; Groen, AK; Kuipers, F

Aim/hypothesis., Type I diabetes is associated with altered hepatic bile formation and increased intestinal cholesterol absorption. The aim of this study was to evaluate whether altered expression of the ATP-Binding Cassette half-transporters Abcg5 and Abcg8, recently implicated in control of both

Lack of ABCG2 shortens latency of BRCA1-deficient mammary tumors and this is not affected by genistein or resveratrol

NARCIS (Netherlands)

Zander, Serge A. L.; Kersbergen, Ariena; Sol, Wendy; Gonggrijp, Maaike; van de Wetering, Koen; Jonkers, Jos; Borst, Piet; Rottenberg, Sven

2012-01-01

In addition to their role in drug resistance, the ATP-binding cassette (ABC) transporters ABCG2 and ABCB1 have been suggested to protect cells from a broad range of substances that may foster tumorigenesis. Phytoestrogens or their metabolites are substrates of these transporters and the influence of

Mutations of the central tyrosines of putative cholesterol recognition amino acid consensus (CRAC) sequences modify folding, activity, and sterol-sensing of the human ABCG2 multidrug transporter.

Science.gov (United States)

Gál, Zita; Hegedüs, Csilla; Szakács, Gergely; Váradi, András; Sarkadi, Balázs; Özvegy-Laczka, Csilla

2015-02-01

Human ABCG2 is a plasma membrane glycoprotein causing multidrug resistance in cancer. Membrane cholesterol and bile acids are efficient regulators of ABCG2 function, while the molecular nature of the sterol-sensing sites has not been elucidated. The cholesterol recognition amino acid consensus (CRAC, L/V-(X)(1-5)-Y-(X)(1-5)-R/K) sequence is one of the conserved motifs involved in cholesterol binding in several proteins. We have identified five potential CRAC motifs in the transmembrane domain of the human ABCG2 protein. In order to define their roles in sterol-sensing, the central tyrosines of these CRACs (Y413, 459, 469, 570 and 645) were mutated to S or F and the mutants were expressed both in insect and mammalian cells. We found that mutation in Y459 prevented protein expression; the Y469S and Y645S mutants lost their activity; while the Y570S, Y469F, and Y645F mutants retained function as well as cholesterol and bile acid sensitivity. We found that in the case of the Y413S mutant, drug transport was efficient, while modulation of the ATPase activity by cholesterol and bile acids was significantly altered. We suggest that the Y413 residue within a putative CRAC motif has a role in sterol-sensing and the ATPase/drug transport coupling in the ABCG2 multidrug transporter. Copyright © 2014. Published by Elsevier B.V.

Genome-wide Identification and Expression Analysis of Half-size ABCG Genes in Malus × domestica

Directory of Open Access Journals (Sweden)

Juanjuan MA

2018-03-01

Full Text Available Half-size adenosine triphosphate-binding cassette transporter subgroup G (ABCG genes play crucial roles in regulating the movements of a variety of substrates and have been well studied in several plants. However, half-size ABCGs have not been characterized in detail in apple (Malus × domestica Borkh.. Here, we performed a genome-wide identification and expression analysis of the half-size ABCG gene family in apple. A total of 46 apple half-size ABCGs were identified and divided into six clusters according to the phylogenetic analysis. A gene structural analysis showed that most half-size ABCGs in the same cluster shared a similar exon–intron organization. A gene duplication analysis showed that segmental, tandem and whole-genome duplications could account for the expansion of half-size ABCG transporters in M. domestica. Moreover, a promoter scan, digital expression analysis and RNA-seq revealed that MdABCG21 may be involved in root's cytokinin transport and that ABCG17 may be involved in the lateral bud development of M. spectabilis ‘Bly114’ by mediating cytokinin transport. The data presented here lay the foundation for further investigations into the biological and physiological processes and functions of half-size ABCG genes in apple. Keywords: apple, ABCG gene, duplication, gene expression

Antibody validation and scoring guidelines for ABCG2 immunohistochemical staining in formalin-fixed paraffin-embedded colon cancer tissue

DEFF Research Database (Denmark)

Cederbye, Camilla Natasha; Palshof, Jesper Andreas; Hansen, Tine Plato

2016-01-01

cancer (CRC), probably because of the use of different antibodies and scoring approaches. In this study, we systematically studied six commercially available anti-ABCG2 antibodies, using cell lines with up-regulation of ABCG2, and selected one antibody for validation in CRC tissue. Furthermore, we...... sections, especially when more than one core was used. In conclusion, here, we provide validated results to guide future studies on the associations between ABCG2 immunoreactivity in tumor cells and the benefits of chemotherapeutic treatment in patients with CRC...

ABCG2-overexpressing S1-M1-80 cell xenografts in nude mice keep original biochemistry and cell biological properties.

Science.gov (United States)

Wang, Fang; Liang, Yong-Ju; Wu, Xing-Ping; Su, Xiao-Dong; Fu, Li-Wu

2012-03-01

S1-M1-80 cells, derived from human colon carcinoma S1 cells, are mitoxantrone-selected ABCG2-overexpressing cells and are widely used in in vitro studies of multidrug resistance(MDR). In this study, S1-M1-80 cell xenografts were established to investigate whether the MDR phenotype and cell biological properties were maintained in vivo. Our results showed that the proliferation, cell cycle, and ABCG2 expression level in S1-M1-80 cells were similar to those in cells isolated from S1-M1-80 cell xenografts (named xS1-M1-80 cells). Consistently, xS1-M1-80 cells exhibited high levels of resistance to ABCG2 substrates such as mitoxantrone and topotecan, but remained sensitive to the non-ABCG2 substrate cisplatin. Furthermore, the specific ABCG2 inhibitor Ko143 potently sensitized xS1-M1-80 cells to mitoxantrone and topotecan. These results suggest that S1-M1-80 cell xenografts in nude mice retain their original cytological characteristics at 9 weeks. Thus, this model could serve as a good system for further investigation of ABCG2-mediated MDR.

Brain and Testis Accumulation of Regorafenib is Restricted by Breast Cancer Resistance Protein (BCRP/ABCG2) and P-glycoprotein (P-GP/ABCB1).

Science.gov (United States)

Kort, Anita; Durmus, Selvi; Sparidans, Rolf W; Wagenaar, Els; Beijnen, Jos H; Schinkel, Alfred H

2015-07-01

Regorafenib is a novel multikinase inhibitor, currently approved for the treatment of metastasized colorectal cancer and advanced gastrointestinal stromal tumors. We investigated whether regorafenib is a substrate for the multidrug efflux transporters ABCG2 and ABCB1 and whether oral availability, brain and testis accumulation of regorafenib and its active metabolites are influenced by these transporters. We used in vitro transport assays to assess human (h)ABCB1- or hABCG2- or murine (m)Abcg2-mediated active transport at high and low concentrations of regorafenib. To study the single and combined roles of Abcg2 and Abcb1a/1b in oral regorafenib disposition and the impact of Cyp3a-mediated metabolism, we used appropriate knockout mouse strains. Regorafenib was transported well by mAbcg2 and hABCG2 and modestly by hABCB1 in vitro. Abcg2 and to a lesser extent Abcb1a/1b limited brain and testis accumulation of regorafenib and metabolite M2 (brain only) in mice. Regorafenib oral availability was not increased in Abcg2(-/-);Abcb1a/1b(-/-) mice. Up till 2 h, metabolite M5 was undetectable in plasma and organs. Brain and testis accumulation of regorafenib and brain accumulation of metabolite M2 are restricted by Abcg2 and Abcb1a/1b. Inhibition of these transporters may be of clinical relevance for patients with brain (micro)metastases positioned behind an intact blood-brain barrier.

Expression of ABCG2 and Bmi-1 in oral potentially malignant lesions and oral squamous cell carcinoma

International Nuclear Information System (INIS)

Dalley, Andrew J; Pitty, Luke P; Major, Aidan G; AbdulMajeed, Ahmad A; Farah, Camile S

2014-01-01

Early diagnosis is vital for effective treatment of oral squamous cell carcinoma (OSCC). The optimal time for clinical intervention is prior to malignancy when patients present with oral potentially malignant lesions such as leukoplakia or erythroplakia. Transformation rates for oral dysplasia vary greatly and more rigorous methods are needed to predict the malignant potential of oral lesions. We hypothesized that the expression of two putative stem cell markers, ABCG2 and Bmi-1, would correlate with disease severity for non diseased, potentially malignant and OSCC specimens and cell lines derived from an equivalent range of tissues. We compared immunoreactive protein and relative gene expression of ABCG2 and Bmi-1 in eight cell lines derived from source tissues ranging in disease severity from normal (OKF6-TERT2) through mild and moderate/severe dysplasia (DOK, POE-9n) to OSCC (PE/CA-PJ15, SCC04, SCC25, SCC09, SCC15). We also analyzed immunoreactive protein expression of ABCG2 and Bmi-1 in 189 tissue samples with the same range of disease severity. A trend between oral lesion severity to ABCG2 and Bmi-1 immunostain intensity was observed. Flow cytometry of oral cell lines confirmed this trend and gave good correlation with RT-PCR results for ABCG2 (r = 0.919, P = 0.001; Pearson) but not Bmi-1 (r = −0.311). The results provide evidence of increased density of ABCG2 and Bmi-1-positive populations in malignant and oral potentially malignant lesions and derived cell lines, but that intragroup variability within IHC, flow cytometry, and RT-PCR results compromise the diagnostic potential of these techniques for discriminating oral dysplasia from normal tissue or OSCC

PDK2 and ABCG2 genes polymorphisms are correlated with blood glucose levels and uric acid in Tibetan gout patients.

Science.gov (United States)

Ren, Y C; Jin, T B; Sun, X D; Geng, T T; Zhang, M X; Wang, L; Feng, T; Kang, L L; Chen, C

2016-02-11

Previous studies have shown that the PDK2 and ABCG2 genes play important roles in many aspects of gout development in European populations. However, a detailed genotype-phenotype analysis was not performed. The aim of the present study was to investigate the potential association between variants in these two genes and metabolism-related quantitative phenotypes relevant to gout in a Chinese Tibetan population. In total, 316 Chinese Tibetan gout patients were recruited from rheumatology outpatient clinics and 6 single nucleotide polymorphisms in PDK2 and ABCG2 were genotyped, which were possible etiologic variants as identified in the HapMap Chinese Han Beijing population. A significant difference in blood glucose levels was detected between different genotypes of rs2728109 (P = 0.005) in the PDK2 gene. We also detected a significant difference in the mean serum uric levels between different genotypes of rs3114018 (P = 0.004) in the ABCG2 gene. All P values remained significant after Bonferroni's correction for multiple testing. Our data demonstrate potential roles for PDK2 and ABCG2 polymorphisms in the metabolic phenotypes of Tibetan gout patients, which may provide new insights into the etiology of gout. Further studies are required to confirm these findings.

Down-regulation of ABCG2, a urate exporter, by parathyroid hormone enhances urate accumulation in secondary hyperparathyroidism.

Science.gov (United States)

Sugimoto, Ryusei; Watanabe, Hiroshi; Ikegami, Komei; Enoki, Yuki; Imafuku, Tadashi; Sakaguchi, Yoshiaki; Murata, Michiya; Nishida, Kento; Miyamura, Shigeyuki; Ishima, Yu; Tanaka, Motoko; Matsushita, Kazutaka; Komaba, Hirotaka; Fukagawa, Masafumi; Otagiri, Masaki; Maruyama, Toru

2017-03-01

Hyperuricemia occurs with increasing frequency among patients with hyperparathyroidism. However, the molecular mechanism by which the serum parathyroid hormone (PTH) affects serum urate levels remains unknown. This was studied in uremic rats with secondary hyperparathyroidism where serum urate levels were found to be increased and urate excretion in the intestine and kidney decreased, presumably due to down-regulation of the expression of the urate exporter ABCG2 in intestinal and renal epithelial membranes. These effects were prevented by administration of the calcimimetic cinacalcet, a PTH suppressor, suggesting that PTH may down-regulate ABCG2 expression. This was directly tested in intestinal Caco-2 cells where the expression of ABCG2 on the plasma membrane was down-regulated by PTH (1-34) while its mRNA level remained unchanged. Interestingly, an inactive PTH derivative (13-34) had no effect, suggesting that a posttranscriptional regulatory system acts through the PTH receptor to regulate ABCG2 plasma membrane expression. As found in an animal study, additional clinical investigations showed that treatment with cinacalcet resulted in significant reductions in serum urate levels together with decreases in PTH levels in patients with secondary hyperparathyroidism undergoing dialysis. Thus, PTH down-regulates ABCG2 expression on the plasma membrane to suppress intestinal and renal urate excretion, and the effects of PTH can be prevented by cinacalcet treatment. Copyright © 2016 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

Novel understanding of ABC transporters ABCB1/MDR/P-glycoprotein, ABCC2/MRP2, and ABCG2/BCRP in colorectal pathophysiology

DEFF Research Database (Denmark)

Andersen, Vibeke; Svenningsen, Katrine; Knudsen, Lina Almind

2015-01-01

transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1....../Mdr1a, abcc2/Mrp2, abcg2/Bcrp, knock-out mice, tight junction, membrane lipid function. RESULTS: Recently, human studies reported that changes in the levels of ABC transporters were early events in the adenoma-carcinoma sequence leading to CRC. A link between ABCB1, high fat diet and gut microbes...

Lentivirus-ABCG1 instillation reduces lipid accumulation and improves lung compliance in GM-CSF knock-out mice

International Nuclear Information System (INIS)

Malur, Anagha; Huizar, Isham; Wells, Greg; Barna, Barbara P.; Malur, Achut G.; Thomassen, Mary Jane

2011-01-01

but improved significantly after lenti-ABCG1 treatment. Data demonstrate that in vivo instillation of lenti-ABCG1 in GM-CSF KO mice is sufficient to restore pulmonary homeostasis by: (1) upregulating ABCG1; (2) reducing intra and extracellular lipids; and (3) improving lung function. Results suggest that the ABCG1 lipid transporter is the key downstream target of GM-CSF-induced PPARγ necessary for surfactant catabolism.

The Human ABCG1 Transporter Mobilizes Plasma Membrane and Late Endosomal Non-Sphingomyelin-Associated-Cholesterol for Efflux and Esterification

Directory of Open Access Journals (Sweden)

Edward B. Neufeld

2014-12-01

Full Text Available We have previously shown that GFP-tagged human ABCG1 on the plasma membrane (PM and in late endosomes (LE mobilizes sterol on both sides of the membrane lipid bilayer, thereby increasing cellular cholesterol efflux to lipid surfaces. In the present study, we examined ABCG1-induced changes in membrane cholesterol distribution, organization, and mobility. ABCG1-GFP expression increased the amount of mobile, non-sphingomyelin(SM-associated cholesterol at the PM and LE, but not the amount of SM-associated-cholesterol or SM. ABCG1-mobilized non-SM-associated-cholesterol rapidly cycled between the PM and LE and effluxed from the PM to extracellular acceptors, or, relocated to intracellular sites of esterification. ABCG1 increased detergent-soluble pools of PM and LE cholesterol, generated detergent-resistant, non-SM-associated PM cholesterol, and increased resistance to both amphotericin B-induced (cholesterol-mediated and lysenin-induced (SM-mediated cytolysis, consistent with altered organization of both PM cholesterol and SM. ABCG1 itself resided in detergent-soluble membrane domains. We propose that PM and LE ABCG1 residing at the phase boundary between ordered (Lo and disordered (Ld membrane lipid domains alters SM and cholesterol organization thereby increasing cholesterol flux between Lo and Ld, and hence, the amount of cholesterol available for removal by acceptors on either side of the membrane bilayer for either efflux or esterification.

Mechanism of the pharmacokinetic interaction between methotrexate and benzimidazoles: potential role for breast cancer resistance protein in clinical drug-drug interactions

NARCIS (Netherlands)

Breedveld, Pauline; Zelcer, Noam; Pluim, Dick; Sönmezer, Ozgür; Tibben, Matthijs M.; Beijnen, Jos H.; Schinkel, Alfred H.; van Tellingen, Olaf; Borst, Piet; Schellens, Jan H. M.

2004-01-01

The antifolate drug methotrexate (MTX) is transported by breast cancer resistance protein (BCRP; ABCG2) and multidrug resistance-associated protein1-4 (MRP1-4; ABCC1-4). In cancer patients, coadministration of benzimidazoles and MTX can result in profound MTX-induced toxicity coinciding with an

Overexpression of the ATP-binding cassette half-transporter, ABCG2 (Mxr/BCrp/ABCP1), in flavopiridol-resistant human breast cancer cells

DEFF Research Database (Denmark)

Robey, R W; Medina-Pérez, W Y; Nishiyama, K

2001-01-01

We sought to characterize the interactions of flavopiridol with members of the ATP-binding cassette (ABC) transporter family. Cells overexpressing multidrug resistance-1 (MDR-1) and multidrug resistance-associated protein (MRP) did not exhibit appreciable flavopiridol resistance, whereas cell lines...... overexpressing the ABC half-transporter, ABCG2 (MXR/BCRP/ABCP1), were found to be resistant to flavopiridol. Flavopiridol at a concentration of 10 microM was able to prevent MRP-mediated calcein efflux, whereas Pgp-mediated transport of rhodamine 123 was unaffected at flavopiridol concentrations of up to 100...... analysis revealed overexpression of the ABCG2 gene. Western blot confirmed overexpression of ABCG2; neither P-glycoprotein nor MRP overexpression was detected. These results suggest that ABCG2 plays a role in resistance to flavopiridol....

Functional polymorphisms of the ABCG2 gene are associated with gout disease in the Chinese Han male population.

Science.gov (United States)

Zhou, Danqiu; Liu, Yunqing; Zhang, Xinju; Gu, Xiaoye; Wang, Hua; Luo, Xinhua; Zhang, Jin; Zou, Hejian; Guan, Ming

2014-05-22

Gout is a common type of arthritis that is characterized by hyperuricemia, tophi and joint inflammation. Genetic variations in the ABCG2 gene have been reported to influence serum uric acid levels and to participate in the pathogenesis of gout, but no further data have been reported in the Han Chinese population. Peripheral blood DNA was isolated from 352 male patients with gout and 350 gout-free normal male controls. High-resolution melting analysis and Sanger sequencing were performed to identify the genetic polymorphisms V12M, Q141K and Q126X in the ABCG2 gene. Genotype and haplotype analyses were utilized to determine the disease odds ratios (ORs). A prediction model for gout risk using ABCG2 protein function was established based on the genotype combination of Q126X and Q141K. For Q141K, the A allele frequency was 49.6% in the gout patients and 30.9% in the controls (OR 2.20, 95% confidence interval (CI): 1.77-2.74, p=8.99×10⁻¹³). Regarding Q126X, the T allele frequency was 4.7% in the gout patients and 1.7% in the controls (OR 2.91, 95% CI: 1.49-5.68, p=1.57×10⁻³). The A allele frequency for V12M was lower (18.3%) in the gout patients than in the controls (29%) (OR 0.55, 95% CI 0.43-0.71, p=2.55×10⁻⁶). In the order of V12M, Q126X and Q141K, the GCA and GTC haplotypes indicated increased disease risk (OR=2.30 and 2.71, respectively). Patients with mild to severe ABCG2 dysfunction accounted for 78.4% of gout cases. The ABCG2 126X and 141K alleles are associated with an increased risk of gout, whereas 12M has a protective effect on gout susceptibility in the Han Chinese population. ABCG2 dysfunction can be used to evaluate gout risk.

Cellular Localization and Trafficking of the Human ABCG1 Transporter

Science.gov (United States)

Neufeld, Edward B.; O’Brien, Katherine; Walts, Avram D.; Stonik, John A.; Demosky, Steven J.; Malide, Daniela; Combs, Christian A.; Remaley, Alan T.

2014-01-01

We have developed a suitable heterologous cell expression system to study the localization, trafficking, and site(s) of function of the human ABCG1 transporter. Increased plasma membrane (PM) and late endosomal (LE) cholesterol generated by ABCG1 was removed by lipoproteins and liposomes, but not apoA-I. Delivery of ABCG1 to the PM and LE was required for ABCG1-mediated cellular cholesterol efflux. ABCG1 LEs frequently contacted the PM, providing a collisional mechanism for transfer of ABCG1-mobilized cholesterol, similar to ABCG1-mediated PM cholesterol efflux to lipoproteins. ABCG1-mobilized LE cholesterol also trafficked to the PM by a non-vesicular pathway. Transfer of ABCG1-mobilized cholesterol from the cytoplasmic face of LEs to the PM and concomitant removal of cholesterol from the outer leaflet of the PM bilayer by extracellular acceptors suggests that ABCG1 mobilizes cholesterol on both sides of the lipid bilayer for removal by acceptors. ABCG1 increased uptake of HDL into LEs, consistent with a potential ABCG1-mediated cholesterol efflux pathway involving HDL resecretion. Thus, ABCG1 at the PM mobilizes PM cholesterol and ABCG1 in LE/LYS generates mobile pools of cholesterol that can traffic by both vesicular and non-vesicular pathways to the PM where it can also be transferred to extracellular acceptors with a lipid surface. PMID:25405320

Lentivirus-ABCG1 instillation reduces lipid accumulation and improves lung compliance in GM-CSF knock-out mice

Energy Technology Data Exchange (ETDEWEB)

Malur, Anagha; Huizar, Isham [Program in Lung Cell Biology and Translational Research, Division of Pulmonary, Critical Care and Sleep Medicine, East Carolina University, Greenville, NC (United States); Wells, Greg [Department of Microbiology and Immunology, East Carolina University, Greenville, NC (United States); Barna, Barbara P. [Program in Lung Cell Biology and Translational Research, Division of Pulmonary, Critical Care and Sleep Medicine, East Carolina University, Greenville, NC (United States); Malur, Achut G. [Department of Microbiology and Immunology, East Carolina University, Greenville, NC (United States); Thomassen, Mary Jane, E-mail: thomassenm@ecu.edu [Program in Lung Cell Biology and Translational Research, Division of Pulmonary, Critical Care and Sleep Medicine, East Carolina University, Greenville, NC (United States); Department of Microbiology and Immunology, East Carolina University, Greenville, NC (United States)

2011-11-18

analysis of bronchoalveolar lavage fluid. Lung compliance was diminished in untreated GMCSF KO mice but improved significantly after lenti-ABCG1 treatment. Data demonstrate that in vivo instillation of lenti-ABCG1 in GM-CSF KO mice is sufficient to restore pulmonary homeostasis by: (1) upregulating ABCG1; (2) reducing intra and extracellular lipids; and (3) improving lung function. Results suggest that the ABCG1 lipid transporter is the key downstream target of GM-CSF-induced PPAR{gamma} necessary for surfactant catabolism.

Novel understanding of ABC transporters ABCB1/MDR/P-glycoprotein, ABCC2/MRP2, and ABCG2/BCRP in colorectal pathophysiology

DEFF Research Database (Denmark)

Andersen, Vibeke; Svenningsen, Katrine; Almind Knudsen, Lina

2015-01-01

AIM: To evaluate ATP-binding cassette (ABC) transporters in colonic pathophysiology as they had recently been related to colorectal cancer (CRC) development. METHODS: Literature search was conducted on PubMed using combinations of the following terms: ABC transporters, ATP binding cassette...... with glucocorticoids. The evidence for the involvement of ABCC2 and ABCG2 in colonic pathophysiology was weak. CONCLUSION: ABCB1, diet, and gut microbes mutually interact in colonic inflammation, a well-known risk factor for CRC. Further insight may be translated into preventive and treatment strategies....... transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1...

CORRELATION BETWEEN CHEMOTHERAPY RESPONSE AND EXPRESSION PROFILES OF TRANSMEMBRANE PROTEINS: P-GLYCOPROTEIN (ABCB1, MRP2 (ABCC2, BCRP (ABCG2 IN PATIENTS WITH INVASIVE BREAST CANCER

Directory of Open Access Journals (Sweden)

К. Yu. Khristenko

2016-01-01

Full Text Available Overexpression of ABC drug transporters can cause multidrug resistance (MDR in cancer cells, which is a major obstacle in the success of cancer chemotherapy. Our study revealed a correlation between the expression of invasive breast cancer resistance-associated proteins, such as P-glycoprotein (ABCB1, MRP2 (ABCC2, BCRP (ABCG2 in tumor cells and pathologic response to neoadjuvant chemotherapy. The response to neoadjuvant chemotherapy was shown to be associated with a lack of BCRP expression in tumor cells. The pathologic tumor response was correlated with the presence of positive MRP2 expression and the expression level of P-glycoprotein in cells of invasive breast cancer. 

DGAT1 and ABCG2 polymorphism in Indian cattle (Bos indicus and buffalo (Bubalus bubalis breeds

Directory of Open Access Journals (Sweden)

Mishra Bina

2006-11-01

Full Text Available Abstract Background Indian cattle (Bos indicus and riverine buffalo (Bubalus bubalis give a poor yield of milk but it has a high fat and protein percentage compared to taurine cattle. The identification of QTLs (Quantitative Trait Loci on BTA14 and BTA6 and its subsequent fine mapping has led to identification of two non conservative mutations affecting milk production and composition. Our objective was to estimate the frequency of K232A (DGAT1 – diacylglycerol – acyltransferase 1 and Y581S (ABCG2 – ATP binding cassette sub family G member 2 polymorphisms in diverse cattle and buffalo breeds of India having large variation in terms of milk production. Results We screened the reported missense mutations in six cattle and five buffalo breeds. The DGAT1K and ABCG2Y alleles were found to be fixed in Indian cattle and buffalo breeds studied. Conclusion This study provides an indirect evidence that all the Indian cattle and buffalo breeds have fixed alleles with respect to DGAT1 and ABCG2 genes reported to be responsible for higher milk fat yield, higher fat and protein percent.

Interaction with the 5D3 monoclonal antibody is regulated by intramolecular rearrangements but not by covalent dimer formation of the human ABCG2 multidrug transporter

DEFF Research Database (Denmark)

Özvegy-Laczka, Csilla; Laczkó, Rozália; Hegedűs, Csilla

2008-01-01

D3 monoclonal antibody shows a function-dependent reactivity to an extracellular epitope of the ABCG2 transporter. In the current experiments we have further characterized the 5D3-ABCG2 interaction. The effect of chemical cross-linking and the modulation of extracellular S-S bridges...... on the transporter function and 5D3 reactivity of ABCG2 were investigated in depth. We found that several protein cross-linkers greatly increased 5D3 labeling in ABCG2 expressing HEK cells; however, there was no correlation between covalent dimer formation, the inhibition of transport activity, and the increase in 5...

Effect of polymorphisms in the ABCG2, LEPR and SCD1 genes on ...

African Journals Online (AJOL)

Sahand Rayaneh

2016-06-24

Jun 24, 2016 ... Abstract. This study was performed to investigate the association between polymorphisms in the ABCG2 (ATP- binding cassette sub-family G member 2), LEPR (leptin receptor) and SCD1 (stearoyl-coenzyme A desaturase 1) genes and milk production traits in Holstein dairy cows in Iran. The analysis was ...

ABCG2/BCRP decreases the transfer of a food-born chemical carcinogen, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) in perfused term human placenta.

Science.gov (United States)

Myllynen, Päivi; Kummu, Maria; Kangas, Tiina; Ilves, Mika; Immonen, Elina; Rysä, Jaana; Pirilä, Rauna; Lastumäki, Anni; Vähäkangas, Kirsi H

2008-10-15

We have studied the role of ATP binding cassette (ABC) transporters in fetal exposure to carcinogens using 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) a known substrate for ABC transporters as a model compound. In perfusion of human term placenta, transfer of (14)C-PhIP (2 microM) through the placenta resulted in fetal-to-maternal concentration ratio (FM ratio) of 0.72+/-0.09 at 6 h. The specific ABCG2 inhibitor KO143 increased the transfer of (14)C-PhIP from maternal to fetal circulation (FM ratio 0.90+/-0.08 at 6 h, p<0.05) while the ABCC1/ABCC2 inhibitor probenecid had no effect (FM ratio at 6 h 0.75+/-0.10, p=0.84). There was a negative correlation between the expression of ABCG2 protein in perfused tissue and the FM ratio of (14)C-PhIP (R=-0.81, p<0.01) at the end of the perfusion. The expression of ABCC2 protein did not correlate with FM ratio of PhIP (R: -0.11, p=0.76). In addition, PhIP induced the expression of ABC transporters in BeWo cells at mRNA level. In conclusion, our data indicates that ABCG2 decreases placental transfer of (14)C-PhIP in perfused human placenta. Also, PhIP may modify ABC transporter expression in choriocarcinoma cells.

The product of the ABC half-transporter gene ABCG2 (BCRP/MXR/ABCP) is expressed in the plasma membrane

DEFF Research Database (Denmark)

Rocchi, E; Khodjakov, A; Volk, E L

2000-01-01

by Western blot and immunohistochemistry. This protein is highly overexpressed in several drug-resistant cell lines and localizes predominantly to the plasma membrane, instead of to intracellular membranes as seen with all other known half-transporters. Therefore, BCRP/MXR is unique among the ABC half......The products of the ABC gene family can be generally classified as either full-transporters of half-transporters. Full-transporters are expressed in the plasma membrane, whereas half-transporters are usually found in intracellular membranes. Recently, an ABC half-transporter, the ABCG2 gene product......-transporters by being localized to the plasma membrane....

High ABCC2 and Low ABCG2 Gene Expression Are Early Events in the Colorectal Adenoma-Carcinoma Sequence

DEFF Research Database (Denmark)

Andersen, Vibeke; Vogel, Lotte K.; Kopp, Tine Iskov

2015-01-01

Development of colorectal cancer (CRC) may result from a dysfunctional interplay between diet, gut microbes and the immune system. The ABC transport proteins ABCB1 (P-glycoprotein, Multidrug resistance protein 1, MDR1), ABCC2 (MRP2) and ABCG2 (BCRP) are involved in transport of various compounds...

Metabolic Interactions of Purine Derivatives with Human ABC Transporter ABCG2: Genetic Testing to Assess Gout Risk.

Science.gov (United States)

Ishikawa, Toshihisa; Aw, Wanping; Kaneko, Kiyoko

2013-11-04

In mammals, excess purine nucleosides are removed from the body by breakdown in the liver and excretion from the kidneys. Uric acid is the end product of purine metabolism in humans. Two-thirds of uric acid in the human body is normally excreted through the kidney, whereas one-third undergoes uricolysis (decomposition of uric acid) in the gut. Elevated serum uric acid levels result in gout and could be a risk factor for cardiovascular disease and diabetes. Recent studies have shown that human ATP-binding cassette transporter ABCG2 plays a role of renal excretion of uric acid. Two non-synonymous single nucleotide polymorphisms (SNPs), i.e., 421C>A (major) and 376C>T (minor), in the ABCG2 gene result in impaired transport activity, owing to ubiquitination-mediated proteosomal degradation and truncation of ABCG2, respectively. These genetic polymorphisms are associated with hyperuricemia and gout. Allele frequencies of those SNPs are significantly higher in Asian populations than they are in African and Caucasian populations. A rapid and isothermal genotyping method has been developed to detect the SNP 421C>A, where one drop of peripheral blood is sufficient for the detection. Development of simple genotyping methods would serve to improve prevention and early therapeutic intervention for high-risk individuals in personalized healthcare.

The ABCG5/8 Cholesterol Transporter and Myocardial Infarction Versus Gallstone Disease

DEFF Research Database (Denmark)

Stender, Stefan; Frikke-Schmidt, Ruth; Nordestgaard, Børge G

2014-01-01

OBJECTIVES: The study sought to test the hypothesis that genetic variation in ABCG5/8, the transporter responsible for intestinal and hepatobiliary cholesterol efflux, may simultaneously influence plasma and biliary cholesterol levels, and hence risk of myocardial infarction (MI) and gallstone...... disease in opposite directions. BACKGROUND: High plasma levels of low-density lipoprotein (LDL) cholesterol are a causal risk factor for MI, whereas high levels of biliary cholesterol promote gallstone formation. METHODS: A total of 60,239 subjects from Copenhagen were included, including 5,647 with MI...... and 3,174 with symptomatic gallstone disease. Subjects were genotyped for 6 common, nonsynonymous and functional variants in ABCG5/8, and a combined weighted genotype score was calculated. RESULTS: Combined, weighted genotype scores were associated with stepwise decreases in LDL cholesterol of up to 5...

The ABCG2 gene Q141K polymorphism contributes to an increased risk of gout: a meta-analysis of 2185 cases.

Science.gov (United States)

Qiu, Ya; Liu, Hua; Qing, Yufeng; Yang, Min; Tan, Xiaoyao; Zhao, Mingcai; Lin, Monica; Zhou, Jingguo

2014-09-01

Individual genetic association studies examining the relationship between the ABCG2 gene polymorphisms and gout have yielded inconsistent results. This study aims to evaluate the association between the ABCG2 gene variants and gout using meta-analysis. Relevant studies were identified by searching databases extensively. The odds ratio (OR) was calculated using a random-effect or fixed-effect model. A Q statistic was used to evaluate homogeneity, and Egger's test and funnel plot were used to assess publication bias. Subgroup analyses on ethnicities and sex were also performed. A total of 7 studies, including 2185 gout patients and 8028 controls from 5 countries or regions, were included and identified for the current meta-analysis. It was found that the A allele or AA genotype of the ABCG2 Q141K polymorphism (rs2231142) had an increased risk of gout in the general population (A allele, p gout (p gout.

Enzastaurin inhibits ABCB1-mediated drug efflux independently of effects on protein kinase C signalling and the cellular p53 status.

Science.gov (United States)

Michaelis, Martin; Rothweiler, Florian; Löschmann, Nadine; Sharifi, Mohsen; Ghafourian, Taravat; Cinatl, Jindrich

2015-07-10

The PKCβ inhibitor enzastaurin was tested in parental neuroblastoma and rhabdomyosarcoma cell lines, their vincristine-resistant sub-lines, primary neuroblastoma cells, ABCB1-transduced, ABCG2-transduced, and p53-depleted cells. Enzastaurin IC50s ranged from 3.3 to 9.5 μM in cell lines and primary cells independently of the ABCB1, ABCG2, or p53 status. Enzastaurin 0.3125 μM interfered with ABCB1-mediated drug transport. PKCα and PKCβ may phosphorylate and activate ABCB1 under the control of p53. However, enzastaurin exerted similar effects on ABCB1 in the presence or absence of functional p53. Also, enzastaurin inhibited PKC signalling only in concentrations ≥ 1.25 μM. The investigated cell lines did not express PKCβ. PKCα depletion reduced PKC signalling but did not affect ABCB1 activity. Intracellular levels of the fluorescent ABCB1 substrate rhodamine 123 rapidly decreased after wash-out of extracellular enzastaurin, and enzastaurin induced ABCB1 ATPase activity resembling the ABCB1 substrate verapamil. Computational docking experiments detected a direct interaction of enzastaurin and ABCB1. These data suggest that enzastaurin directly interferes with ABCB1 function. Enzastaurin further inhibited ABCG2-mediated drug transport but by a different mechanism since it reduced ABCG2 ATPase activity. These findings are important for the further development of therapies combining enzastaurin with ABC transporter substrates.

Tissue expression pattern of ABCG transporter indicates functional roles in reproduction of Toxocara canis.

Science.gov (United States)

Luo, Yong-Li; Ma, Guang-Xu; Luo, Yong-Fang; Kuang, Ce-Yan; Jiang, Ai-Yun; Li, Guo-Qing; Zhou, Rong-Qiong

2018-03-01

Toxocara canis is a zoonotic parasite with worldwide distribution. ATP-binding cassette (ABC) transporters are integral membrane proteins which involve in a range of biological processes in various organisms. In present study, the full-length coding sequence of abcg-5 gene of T. canis (Tc-abcg-5) was cloned and characterized. A 633 aa polypeptide containing two conserved Walker A and Walker B motifs was predicted from a continuous 1902 nt open reading frame. Quantitative real-time PCR was employed to determine the transcriptional levels of Tc-abcg-5 gene in adult male and female worms, which indicated high mRNA level of Tc-abcg-5 in the reproductive tract of adult female T. canis. Tc-abcg-5 was expressed to produce rabbit polyclonal antiserum against recombinant TcABCG5. Indirect-fluorescence immunohistochemical assays were carried out to detect the tissue distribution of TcABCG5, which showed predominant distribution of TcABCG5 in the uterus (especially in the germ cells) of adult female T. canis. Tissue transcription and expression pattern of Tc-abcg-5 indicated that Tc-abcg-5 might play essential roles in the reproduction of this parasitic nematode.

Metabolic Interactions of Purine Derivatives with Human ABC Transporter ABCG2: Genetic Testing to Assess Gout Risk

Directory of Open Access Journals (Sweden)

Kiyoko Kaneko

2013-11-01

Full Text Available In mammals, excess purine nucleosides are removed from the body by breakdown in the liver and excretion from the kidneys. Uric acid is the end product of purine metabolism in humans. Two-thirds of uric acid in the human body is normally excreted through the kidney, whereas one-third undergoes uricolysis (decomposition of uric acid in the gut. Elevated serum uric acid levels result in gout and could be a risk factor for cardiovascular disease and diabetes. Recent studies have shown that human ATP-binding cassette transporter ABCG2 plays a role of renal excretion of uric acid. Two non-synonymous single nucleotide polymorphisms (SNPs, i.e., 421C>A (major and 376C>T (minor, in the ABCG2 gene result in impaired transport activity, owing to ubiquitination-mediated proteosomal degradation and truncation of ABCG2, respectively. These genetic polymorphisms are associated with hyperuricemia and gout. Allele frequencies of those SNPs are significantly higher in Asian populations than they are in African and Caucasian populations. A rapid and isothermal genotyping method has been developed to detect the SNP 421C>A, where one drop of peripheral blood is sufficient for the detection. Development of simple genotyping methods would serve to improve prevention and early therapeutic intervention for high-risk individuals in personalized healthcare.

SALL4, a stem cell factor, affects the side population by regulation of the ATP-binding cassette drug transport genes.

Directory of Open Access Journals (Sweden)

Ha-Won Jeong

2011-04-01

Full Text Available Our previous work shows that the stem cell factor SALL4 plays a central role in embryonic and leukemic stem cells. In this study, we report that SALL4 expression was higher in drug resistant primary acute myeloid leukemic patients than those from drug-responsive cases. In addition, while overexpression of SALL4 led to drug resistance in cell lines, cells with decreased SALL4 expression were more sensitive to drug treatments than the parental cells. This led to our investigation of the implication of SALL4 in drug resistance and its role in side population (SP cancer stem cells. SALL4 expression was higher in SP cells compared to non-SP cells by 2-4 fold in various malignant hematopoietic cell lines. Knocking down of SALL4 in isolated SP cells resulted in a reduction of SP cells, indicating that SALL4 is required for their self-renewal. The SP phenotype is known to be mediated by members of the ATP-binding cassette (ABC drug transport protein family, such as ABCG2 and ABCA3. Using chromatin-immunoprecipitation (ChIP, quantitative reverse transcription polymerase chain reaction (qRT-PCR and electrophoretic mobility shift assay(EMSA, we demonstrated that SALL4 was able to bind to the promoter region of ABCA3 and activate its expression while regulating the expression of ABCG2 indirectly. Furthermore, SALL4 expression was positively correlated to those of ABCG2 and ABCA3 in primary leukemic patient samples. Taken together, our results suggest a novel role for SALL4 in drug sensitivity, at least in part through the maintenance of SP cells, and therefore may be responsible for drug-resistance in leukemia. We are the first to demonstrate a direct link between stem cell factor SALL4, SP and drug resistance in leukemia.

Expression and Significance of Stem Cell Markers CK19, Notch3, CD133, P75NTR, STRO-1 and ABCG2 in Pulmonary Squamous Carcinomas

Directory of Open Access Journals (Sweden)

Xuyong LIN, , , , ,

2009-04-01

Full Text Available Background and objective Increasing reports showed that some tumor stem cells were selfrenewal and multi-lineage differentiated in tumors, similar to the normal stem cells in human body. The aim of this study is to observe the expression of stem cell markers in lung squamous carcinoma tissues. Methods Fifty-four lung cancer specimens from surgery were analyzed for CK19, Notch3, CD133, P75NTR, STRO-1 and ABCG2 expression by using S-P immunohistochemistry. In addition, ten normal lung tissue samples were included as control. Results CK19, Notch3, CD133 and ABCG2 were expressed in 54 Lung cancer tissues, without expression of P75NTR and STRO-1. The expressionrate of CK19, Notch3, CD133 and ABCG2 was 66.67% (36/54, 87.04% (47/54, 50% (27/54, and 61.11% (33/54 respectively. The levels of expression of Notch3, CD133 and ABCG2 were significantly lower in high differentiation group than those in moderate and low differentiation group (P <0.05. The levels of expression of CK19, CD133 and ABCG2 were significantly higher in lymph node metastasis group than those in non-metastasis group (P <0.05. The percentage of total positive cells of four stem cell markers in serial tissue sections was lower than 2%. Conclusion There was expression ofsome stem cell markers in pulmonary squamous carcinomas, and there was relationship between expression degree withdifferentiation degree and lymph node metastasis.

Multixenobiotic resistance in Mytilus edulis: Molecular and functional characterization of an ABCG2- type transporter in hemocytes and gills.

Science.gov (United States)

Ben Cheikh, Yosra; Xuereb, Benoit; Boulangé-Lecomte, Céline; Le Foll, Frank

2018-02-01

Among the cellular protection arsenal, ABC transporters play an important role in xenobiotic efflux in marine organisms. Two pumps belonging to B and C subfamily has been identified in Mytilus edulis. In this study, we investigated the presence of the third major subtype ABCG2/BCRP protein in mussel tissues. Transcript was expressed in hemocytes and with higher level in gills. Molecular characterization revealed that mussel ABCG2 transporter shares the sequence and organizational structure with mammalian and molluscan orthologs. Overall identity of the predicted amino acid sequence with corresponding homologs from other organisms was between 49% and 98%. Moreover, protein efflux activity was demonstrated using a combination of fluorescent allocrites and specific inhibitors. The accumulation of bodipy prazosin and pheophorbide A was heterogeneous in gills and hemocytes. Most of the used blockers enhanced probe accumulation at different levels, most significantly for bodipy prazosin. Moreover, Mrp classical blocker MK571 showed a polyspecificity. In conclusion, our data demonstrate that several ABC transporters contribute to MXR phenotype in the blue mussel including ABCG2 that forms an active pump in hemocytes and gills. Efforts are needed to distinguish between the different members and to explore their single function and specificity towards allocrites and chemosensitizers. Copyright © 2017 Elsevier B.V. All rights reserved.

Use of peptide antibodies to probe for the mitoxantrone resistance-associated protein MXR/BCRP/ABCP/ABCG2

DEFF Research Database (Denmark)

Litman, Thomas; Jensen, Ulla; Hansen, Alastair

2002-01-01

Recent studies have characterized the ABC half-transporter associated with mitoxantrone resistance in human cancer cell lines. Encoded by the ABCG2 gene, overexpression confers resistance to camptothecins, as well as to mitoxantrone. We developed four polyclonal antibodies against peptides corres...

A gene-wide investigation on polymorphisms in the ABCG2/BRCP transporter and susceptibility to colorectal cancer

Czech Academy of Sciences Publication Activity Database

Campa, D.; Pardini, Barbara; Naccarati, Alessio; Vodičková, Ludmila; Novotný, J.; Försti, A.; Hemminki, K.; Barale, R.; Vodička, Pavel; Canzian, F.

2008-01-01

Roč. 645, 1-2 (2008), s. 56-60 ISSN 0027-5107 R&D Projects: GA ČR GA310/07/1430 Institutional research plan: CEZ:AV0Z50390512; CEZ:AV0Z50390703 Keywords : ABCG2 * Transporter * Colorectal cancer Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.198, year: 2008

Transmembrane Domain Single-Nucleotide Polymorphisms Impair Expression and Transport Activity of ABC Transporter ABCG2

NARCIS (Netherlands)

Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.

2017-01-01

PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the

Arabidopsis ABCG14 protein controls the acropetal translocation of root-synthesized cytokinins

Science.gov (United States)

Zhang, Kewei; Novak, Ondrej; Wei, Zhaoyang; Gou, Mingyue; Zhang, Xuebin; Yu, Yong; Yang, Huijun; Cai, Yuanheng; Strnad, Miroslav; Liu, Chang-Jun

2014-02-01

Cytokinins are a major group of phytohormones regulating plant growth, development and stress responses. However, in contrast to the well-defined polar transport of auxins, the molecular basis of cytokinin transport is poorly understood. Here we show that an ATP-binding cassette transporter in Arabidopsis, AtABCG14, is essential for the acropetal (root to shoot) translocation of the root-synthesized cytokinins. AtABCG14 is expressed primarily in the pericycle and stelar cells of roots. Knocking out AtABCG14 strongly impairs the translocation of trans-zeatin (tZ)-type cytokinins from roots to shoots, thereby affecting the plant’s growth and development. AtABCG14 localizes to the plasma membrane of transformed cells. In planta feeding of C14 or C13-labelled tZ suggests that it acts as an efflux pump and its presence in the cells directly correlates with the transport of the fed cytokinin. Therefore, AtABCG14 is a transporter likely involved in the long-distance translocation of cytokinins in planta.

Dosage of the Abcg1-U2af1 region modifies locomotor and cognitive deficits observed in the Tc1 mouse model of Down syndrome.

Directory of Open Access Journals (Sweden)

Damien Marechal

Full Text Available Down syndrome (DS results from one extra copy of human chromosome 21 and leads to several alterations including intellectual disabilities and locomotor defects. The transchromosomic Tc1 mouse model carrying an extra freely-segregating copy of human chromosome 21 was developed to better characterize the relation between genotype and phenotype in DS. The Tc1 mouse exhibits several locomotor and cognitive deficits related to DS. In this report we analyzed the contribution of the genetic dosage of 13 conserved mouse genes located between Abcg1 and U2af1, in the telomeric part of Hsa21. We used the Ms2Yah model carrying a deletion of the corresponding interval in the mouse genome to rescue gene dosage in the Tc1/Ms2Yah compound mice to determine how the different behavioral phenotypes are affected. We detected subtle changes with the Tc1/Ms2Yah mice performing better than the Tc1 individuals in the reversal paradigm of the Morris water maze. We also found that Tc1/Ms2Yah compound mutants performed better in the rotarod than the Tc1 mice. This data support the impact of genes from the Abcg1-U2af1 region as modifiers of Tc1-dependent memory and locomotor phenotypes. Our results emphasize the complex interactions between triplicated genes inducing DS features.

[ROLE OF SLC2A9 AND ABCG2 GENE POLYMORPHISMS IN ORIGIN OF HYPERURICEMIA AND GOUT].

Science.gov (United States)

Fadieieva, A; Prystupa, L; Pogorelova, O; Kirichenko, N; Dudchenko, I

2016-03-01

The polymorphisms V253I, Q126X, Q141K of SLC2A9 and ABCG2 genes were characterized. GCA и GTC haplotypes of Q126X and Q141K variants can be predictors of gout. The relationship of these polymorphisms with hyperuricaemia according to gender, metabolic syndrome components, with the response to allopurinol was analyzed. It has been established that Q141K polymorphism can directly modulate BCRP-mediated allopurinol and oxypurinol efflux, the K allele is associated with a lower reduction in serum uric acid in response to allopurinol treatment.

The ABCG5 ABCG8 sterol transporter and phytosterols: implications for cardiometabolic disease

Science.gov (United States)

Sabeva, Nadezhda S.; Liu, Jingjing; Graf, Gregory A.

2014-01-01

Purpose of review This review summarizes recent developments in the activity, regulation, and physiology of the ABCG5 ABCG8 (G5G8) transporter and the use of its xenobiotic substrates, phytosterols, as cholesterol lowering agents in the treatment of cardiovascular disease. Recent progress has significant implications for the role of G5G8 and its substrates in complications associated with features of the metabolic syndrome. Recent findings Recent reports expand the clinical presentation of sitosterolemia to include platelet and adrenal dysfunction. The G5G8 sterol transporter is critical to hepatobiliary excretion of cholesterol under nonpathological conditions and has been linked to the cholesterol gallstone susceptibility. Finally, the cardiovascular benefits of cholesterol lowering through the use of phytosterol supplements were offset by vascular dysfunction, suggesting that alternative strategies to reduced cholesterol absorption offer greater benefit. Summary Insulin resistance elevates G5G8 and increases susceptibility to cholesterol gallstones. However, this transporter is critical for the exclusion of phytosterols from the absorptive pathways in the intestine. Challenging the limits of this protective mechanism through phytosterol supplementation diminishes the cardioprotective benefits of cholesterol lowering in mouse models of cardiovascular disease. PMID:19306529

Phytosterol Feeding Causes Toxicity in ABCG5/G8 Knockout Mice

Science.gov (United States)

McDaniel, Allison L.; Alger, Heather M.; Sawyer, Janet K.; Kelley, Kathryn L.; Kock, Nancy D.; Brown, J. Mark; Temel, Ryan E.; Rudel, Lawrence L.

2014-01-01

Plant sterols, or phytosterols, are very similar in structure to cholesterol and are abundant in typical diets. The reason for poor absorption of plant sterols by the body is still unknown. Mutations in the ABC transporters G5 and G8 are known to cause an accumulation of plant sterols in blood and tissues (sitosterolemia). To determine the significance of phytosterol exclusion from the body, we fed wild-type and ABCG5/G8 knockout mice a diet enriched with plant sterols. The high-phytosterol diet was extremely toxic to the ABCG5/G8 knockout mice but had no adverse effects on wild-type mice. ABCG5/G8 knockout mice died prematurely and developed a phenotype that included high levels of plant sterols in many tissues, liver abnormalities, and severe cardiac lesions. This study is the first to report such toxic effects of phytosterol accumulation in ABCG5/G8 knockout mice. We believe these new data support the conclusion that plant sterols are excluded from the body because they are toxic when present at high levels. PMID:23380580

Rice Stomatal Closure Requires Guard Cell Plasma Membrane ATP-Binding Cassette Transporter RCN1/OsABCG5.

Science.gov (United States)

Matsuda, Shuichi; Takano, Sho; Sato, Moeko; Furukawa, Kaoru; Nagasawa, Hidetaka; Yoshikawa, Shoko; Kasuga, Jun; Tokuji, Yoshihiko; Yazaki, Kazufumi; Nakazono, Mikio; Takamure, Itsuro; Kato, Kiyoaki

2016-03-07

Water stress is one of the major environmental stresses that affect agricultural production worldwide. Water loss from plants occurs primarily through stomatal pores. Here, we report that an Oryza sativa half-size ATP-binding cassette (ABC) subfamily G protein, RCN1/OsABCG5, is involved in stomatal closure mediated by phytohormone abscisic acid (ABA) accumulation in guard cells. We found that the GFP-RCN1/OsABCG5-fusion protein was localized at the plasma membrane in guard cells. The percentage of guard cell pairs containing both ABA and GFP-RCN1/OsABCG5 increased after exogenous ABA treatment, whereas they were co-localized in guard cell pairs regardless of whether exogenous ABA was applied. ABA application resulted in a smaller increase in the percentage of guard cell pairs containing ABA in rcn1 mutant (A684P) and RCN1-RNAi than in wild-type plants. Furthermore, polyethylene glycol (drought stress)-inducible ABA accumulation in guard cells did not occur in rcn1 mutants. Stomata closure mediated by exogenous ABA application was strongly reduced in rcn1 mutants. Finally, rcn1 mutant plants had more rapid water loss from detached leaves than the wild-type plants. These results indicate that in response to drought stress, RCN1/OsABCG5 is involved in accumulation of ABA in guard cells, which is indispensable for stomatal closure. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth

Energy Technology Data Exchange (ETDEWEB)

Hsu, Ya-Yun [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Tseng, Yu-Ting [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Lo, Yi-Ching, E-mail: yichlo@kmu.edu.tw [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China)

2013-11-01

Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H{sub 2}O{sub 2} neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS

Berberine, a natural antidiabetes drug, attenuates glucose neurotoxicity and promotes Nrf2-related neurite outgrowth

International Nuclear Information System (INIS)

Hsu, Ya-Yun; Tseng, Yu-Ting; Lo, Yi-Ching

2013-01-01

Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H 2 O 2 neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS production and

Enhanced brain disposition and effects of Δ9-tetrahydrocannabinol in P-glycoprotein and breast cancer resistance protein knockout mice.

Directory of Open Access Journals (Sweden)

Adena S Spiro

Full Text Available The ABC transporters P-glycoprotein (P-gp, Abcb1 and breast cancer resistance protein (Bcrp, Abcg2 regulate the CNS disposition of many drugs. The main psychoactive constituent of cannabis Δ(9-tetrahydrocannabinol (THC has affinity for P-gp and Bcrp, however it is unknown whether these transporters modulate the brain accumulation of THC and its functional effects on the CNS. Here we aim to show that mice devoid of Abcb1 and Abcg2 retain higher brain THC levels and are more sensitive to cannabinoid-induced hypothermia than wild-type (WT mice. Abcb1a/b (-/-, Abcg2 (-/- and wild-type (WT mice were injected with THC before brain and blood were collected and THC concentrations determined. Another cohort of mice was examined for THC-induced hypothermia by measuring rectal body temperature. Brain THC concentrations were higher in both Abcb1a/b (-/- and Abcg2 (-/- mice than WT mice. ABC transporter knockout mice exhibited delayed elimination of THC from the brain with the effect being more prominent in Abcg2 (-/- mice. ABC transporter knockout mice were more sensitive to THC-induced hypothermia compared to WT mice. These results show P-gp and Bcrp prolong the brain disposition and hypothermic effects of THC and offer a novel mechanism for both genetic vulnerability to the psychoactive effects of cannabis and drug interactions between CNS therapies and cannabis.

Arctigenin promotes cholesterol efflux from THP-1 macrophages through PPAR-γ/LXR-α signaling pathway

Energy Technology Data Exchange (ETDEWEB)

Xu, Xiaolin [Department of Cardiothoracic Surgery, Huashan Hospital, Fudan University, Shanghai 200032 (China); Li, Qian [Department of Integrative Medicine and Neurobiology, School of Basic Medical Sciences, Shanghai Medical College, Fudan University, Shanghai (China); Pang, Liewen; Huang, Guoqian; Huang, Jiechun; Shi, Meng; Sun, Xiaotian [Department of Cardiothoracic Surgery, Huashan Hospital, Fudan University, Shanghai 200032 (China); Wang, Yiqing [Department of Cardiothoracic Surgery, Huashan Hospital, Fudan University, Shanghai 200032 (China)

2013-11-15

Highlights: •Arctigenin enhanced cholesterol efflux in oxLDL-loaded THP-1 macrophages. •The expression of ABCA1, ABCG1 and apoE was upregulated in arctigenin-treated cells. •Arctigenin promoted the expression of PPAR-γ and LXR-α. •Inhibition of PPAR-γ or LXR-α reversed arctigenin-mediated biological effects. •Arctigenin promotes cholesterol efflux via activation of PPAR-γ/LXR-α/ABCA1 pathway. -- Abstract: Cholesterol efflux from macrophages is a critical mechanism to prevent the development of atherosclerosis. Here, we sought to investigate the effects of arctigenin, a bioactive component of Arctium lappa, on the cholesterol efflux in oxidized low-density lipoprotein (oxLDL)-loaded THP-1 macrophages. Our data showed that arctigenin significantly accelerated apolipoprotein A-I- and high-density lipoprotein-induced cholesterol efflux in both dose- and time-dependent manners. Moreover, arctigenin treatment enhanced the expression of ATP binding cassette transporter A1 (ABCA1), ABCG1, and apoE, all of which are key molecules in the initial step of cholesterol efflux, at both mRNA and protein levels. Arctigenin also caused a concentration-dependent elevation in the expression of peroxisome proliferator-activated receptor-gamma (PPAR-γ) and liver X receptor-alpha (LXR-α). The arctigenin-mediated induction of ABCA1, ABCG1, and apoE was abolished by specific inhibition of PPAR-γ or LXR-α using small interfering RNA technology. Our results collectively indicate that arctigenin promotes cholesterol efflux in oxLDL-loaded THP-1 macrophages through upregulation of ABCA1, ABCG1 and apoE, which is dependent on the enhanced expression of PPAR-γ and LXR-α.

Arctigenin promotes cholesterol efflux from THP-1 macrophages through PPAR-γ/LXR-α signaling pathway

International Nuclear Information System (INIS)

Xu, Xiaolin; Li, Qian; Pang, Liewen; Huang, Guoqian; Huang, Jiechun; Shi, Meng; Sun, Xiaotian; Wang, Yiqing

2013-01-01

Highlights: •Arctigenin enhanced cholesterol efflux in oxLDL-loaded THP-1 macrophages. •The expression of ABCA1, ABCG1 and apoE was upregulated in arctigenin-treated cells. •Arctigenin promoted the expression of PPAR-γ and LXR-α. •Inhibition of PPAR-γ or LXR-α reversed arctigenin-mediated biological effects. •Arctigenin promotes cholesterol efflux via activation of PPAR-γ/LXR-α/ABCA1 pathway. -- Abstract: Cholesterol efflux from macrophages is a critical mechanism to prevent the development of atherosclerosis. Here, we sought to investigate the effects of arctigenin, a bioactive component of Arctium lappa, on the cholesterol efflux in oxidized low-density lipoprotein (oxLDL)-loaded THP-1 macrophages. Our data showed that arctigenin significantly accelerated apolipoprotein A-I- and high-density lipoprotein-induced cholesterol efflux in both dose- and time-dependent manners. Moreover, arctigenin treatment enhanced the expression of ATP binding cassette transporter A1 (ABCA1), ABCG1, and apoE, all of which are key molecules in the initial step of cholesterol efflux, at both mRNA and protein levels. Arctigenin also caused a concentration-dependent elevation in the expression of peroxisome proliferator-activated receptor-gamma (PPAR-γ) and liver X receptor-alpha (LXR-α). The arctigenin-mediated induction of ABCA1, ABCG1, and apoE was abolished by specific inhibition of PPAR-γ or LXR-α using small interfering RNA technology. Our results collectively indicate that arctigenin promotes cholesterol efflux in oxLDL-loaded THP-1 macrophages through upregulation of ABCA1, ABCG1 and apoE, which is dependent on the enhanced expression of PPAR-γ and LXR-α

Drug promotion practices: A review.

Science.gov (United States)

Jacob, Nilan T

2018-01-18

Over the years, the pharmaceutical industry has been at the forefront of research and innovation in drug discovery and development. The process of drug discovery extending from preclinical studies to multicentric clinical trials and postmarketing phase is a costly affair running into billions of dollars. On the flip side, not all investigational molecules clear the trial phases and get approved, which puts pressure on the manufacturers to maximize the profit from approved drugs. It is in this key area that the practice of drug promotion plays its role. The World Health Organization defines drug promotion as "all informational and persuasive activities by manufacturers and distributors, the effect of which is to influence the prescription, supply, purchase or use of medicinal drugs". With its humble intent of creating awareness among healthcare professionals and updating their knowledge on recent advances in treatment options, drug promotion has been an important tool, but gradually it has evolved to embrace aggressive marketing strategies and sometimes unethical business and scientific practices where the need for profit-making eclipses commitment to patient care and scientific exploration. In this review, we discuss the evolution of drug promotion practices, the various types, its merits and demerits, the influence of drug promotion on physician prescribing behaviour, the role of regulatory bodies, unethical promotional practices and finally summarize with future directions. © 2018 The British Pharmacological Society.

ABCG5 gene responses to treadmill running with or without administration of Pistachio atlantica in female rats

Directory of Open Access Journals (Sweden)

Abbass Ghanbari-Niaki

2014-03-01

Full Text Available   Objective(s: ABC transporters comprise a large family of transmembrane proteins that use the energy provided by ATP hydrolysis to translocate a variety of substrates across biological membranes. All members of the human ABCG subfamily, except for ABCG2, are cholesterol-transporter. The aim of this study was to determine the liver, the small intestine and kidney ABCG5 relative gene expression in response to treadmill-running training in female rats. Materials and Methods: Twenty Wistar rats (6-8 weeks old and 125-135 g weight were used. Animals were randomly assigned to saline-control (SC, saline-training (ST, and Baneh-control (BC, and Baneh-training (BT groups. Training groups did the exercise on a motor-driven treadmill at 25 m/min (0% grade for 60 min/day for eight weeks (5 days/week. Rats were fed orally, with Baneh extraction and saline for six weeks. The two-way ANOVA was employed for statistical analysis.  ABCG5 relative gene expression was detected by Real-time PCR method. Results:The current findings indicate that the Baneh-treated tissues had significantly lower levels of ABCG5 gene expression in the liver, small intestine, and kidneys (P< 0.001, P< 0.003, P< 0.001, respectively, when compared with saline-treated tissues. However, a higher level of gene expression was observed in exercise groups. A lower level of HDL-c but not triglyceride (TG and total cholesterol (TC levels were found in Baneh-treated animals at rest. Conclusion: Exercise training increases ABCG5 relative gene expression in the liver, small intestine and kidney tissues; therefore exercise training may adjust the reduction of ABCG5 relative gene expression in Baneh-training group.

Transcriptome Comparative Profiling of Barley eibi1 Mutant Reveals Pleiotropic Effects of HvABCG31 Gene on Cuticle Biogenesis and Stress Responsive Pathways

Directory of Open Access Journals (Sweden)

Eviatar Nevo

2013-10-01

Full Text Available Wild barley eibi1 mutant with HvABCG31 gene mutation has low capacity to retain leaf water, a phenotype associated with reduced cutin deposition and a thin cuticle. To better understand how such a mutant plant survives, we performed a genome-wide gene expression analysis. The leaf transcriptomes between the near-isogenic lines eibi1 and the wild type were compared using the 22-k Barley1 Affymetrix microarray. We found that the pleiotropic effect of the single gene HvABCG31 mutation was linked to the co-regulation of metabolic processes and stress-related system. The cuticle development involved cytochrome P450 family members and fatty acid metabolism pathways were significantly up-regulated by the HvABCG31 mutation, which might be anticipated to reduce the levels of cutin monomers or wax and display conspicuous cuticle defects. The candidate genes for responses to stress were induced by eibi1 mutant through activating the jasmonate pathway. The down-regulation of co-expressed enzyme genes responsible for DNA methylation and histone deacetylation also suggested that HvABCG31 mutation may affect the epigenetic regulation for barley development. Comparison of transcriptomic profiling of barley under biotic and abiotic stresses revealed that the functions of HvABCG31 gene to high-water loss rate might be different from other osmotic stresses of gene mutations in barley. The transcriptional profiling of the HvABCG31 mutation provided candidate genes for further investigation of the physiological and developmental changes caused by the mutant.

Additive composite ABCG2, SLC2A9 and SLC22A12 scores of high-risk alleles with alcohol use modulate gout risk.

Science.gov (United States)

Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin

2016-09-01

The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.

Association between ABCG1 polymorphism rs1893590 and high-density lipoprotein (HDL) in an asymptomatic Brazilian population.

Science.gov (United States)

Zago, V H S; Scherrer, D Z; Parra, E S; Panzoldo, N B; Alexandre, F; Nakandakare, E R; Quintão, E C R; de Faria, E C

2015-03-01

ATP binding cassette transporter G1 (ABCG1) promotes lipidation of nascent high-density lipoprotein (HDL) particles, acting as an intracellular transporter. SNP rs1893590 (c.-204A > C) of ABCG1 gene has been previously studied and reported as functional over plasma HDL-C and lipoprotein lipase activity. This study aimed to investigate the relationships of SNP rs1893590 with plasma lipids and lipoproteins in a large Brazilian population. Were selected 654 asymptomatic and normolipidemic volunteers from both genders. Clinical and anthropometrical data were taken and blood samples were drawn after 12 h fasting. Plasma lipids and lipoproteins, as well as HDL particle size and volume were determined. Genomic DNA was isolated for SNP rs1893590 detection by TaqMan(®) OpenArray(®) Real-Time PCR Plataform (Applied Biosystems). Mann-Whitney U, Chi square and two-way ANOVA were the used statistical tests. No significant differences were found in the comparison analyses between the allele groups for all studied parameters. Conversely, significant interactions were observed between SNP and age over plasma HDL-C, were volunteers under 60 years with AA genotype had increased HDL-C (p = 0.048). Similar results were observed in the group with body mass index (BMI) m(2), where volunteers with AA genotype had higher HDL-C levels (p = 0.0034), plus an increased HDL particle size (p = 0.01). These findings indicate that SNP rs1893590 of ABCG1 has a significant impact over HDL-C under asymptomatic clinical conditions in an age and BMI dependent way.

Alleviating Promotion of Inflammation and Cancer Induced by Nonsteroidal Anti-Inflammatory Drugs

Directory of Open Access Journals (Sweden)

Anthony M. Kyriakopoulos

2017-01-01

Full Text Available Clinical Relevance. Nonsteroidal Anti-Inflammatory Drugs (NSAIDs including aspirin are of intensive use nowadays. These drugs exert their activity via the metabolism of arachidonic acid (AA by cyclooxygenase inhibition. Though beneficial for health in some instances, both unspecific and specific cyclooxygenase inhibitor activity interfere with AA metabolism producing also proinflammatory lipids that may promote cancer. Materials and Methods. This review is based on available literature on clinical uses, biochemical investigations, molecular medicine, pharmacology, toxicity, and epidemiology-clinical studies on NSAIDs and other drugs that may be used accordingly, which was collected from electronic (SciFinder, Medline, Science Direct, and ACS among others and library searches of books and journals. Results. Relevant literature supports the notion that NDSAID use may also promote proinflammatory biochemical events that are also related to precancerous predisposition. Several agents are proposed that may be employed in immediate future to supplement and optimize treatment with NSAIDs. In this way serious side effects arising from promotion of inflammation and cancer, especially in chronic NSAID users and high risk groups of patients, could be avoided.

DNA methylation of loci within ABCG1 and PHOSPHO1 in blood DNA is associated with future type 2 diabetes risk

DEFF Research Database (Denmark)

Dayeh, Tasnim; Tuomi, Tiinamaija; Almgren, Peter

2016-01-01

Identification of subjects with a high risk of developing type 2 diabetes (T2D) is fundamental for prevention of the disease. Consequently, it is essential to search for new biomarkers that can improve the prediction of T2D. The aim of this study was to examine whether 5 DNA methylation loci...... muscle from diabetic vs. non-diabetic subjects. DNA methylation at the ABCG1 locus cg06500161 in blood DNA was associated with an increased risk for future T2D (OR = 1.09, 95% CI = 1.02-1.16, P-value = 0.007, Q-value = 0.018), while DNA methylation at the PHOSPHO1 locus cg02650017 in blood DNA...... was associated with a decreased risk for future T2D (OR = 0.85, 95% CI = 0.75-0.95, P-value = 0.006, Q-value = 0.018) after adjustment for age, gender, fasting glucose, and family relation. Furthermore, the level of DNA methylation at the ABCG1 locus cg06500161 in blood DNA correlated positively with BMI, HbA1c...

Activation of Liver X Receptor Decreases Atherosclerosis in Ldlr−/− mice in the Absence of ABCA1 and ABCG1 in Myeloid Cells

Science.gov (United States)

Kappus, Mojdeh S.; Murphy, Andrew J.; Abramowicz, Sandra; Ntonga, Vusisizwe; Welch, Carrie L.; Tall, Alan R.; Westerterp, Marit

2014-01-01

Objective Liver X Receptor (LXR) activators decrease atherosclerosis in mice. LXR activators (1) directly up-regulate genes involved in reverse cholesterol transport (RCT) and (2) exert anti-inflammatory effects mediated by transrepression of NFκB target genes. We investigated whether myeloid cell deficiency of ATP-binding cassette transporters A1 and G1 (ABCA1/G1), principal targets of LXR that promote macrophage cholesterol efflux and initiate RCT, would abolish the beneficial effects of LXR activation on atherosclerosis. Approach and Results LXR activator T0901317 (T0) substantially reduced inflammatory gene expression in macrophages lacking ABCA1/G1. Ldlr−/− mice were transplanted with Abca1−/−Abcg1−/− or wild-type bone marrow (BM) and fed a Western-type diet (WTD) for 6 weeks with or without T0 supplementation. Abca1/g1 BM deficiency increased atherosclerotic lesion complexity and inflammatory cell infiltration into the adventitia and myocardium. T0 markedly decreased lesion area, complexity and inflammatory cell infiltration in the Abca1−/−Abcg1−/− BM transplanted mice. To investigate whether this was due to macrophage Abca1/g1 deficiency, Ldlr−/− mice were transplanted with LysmCreAbca1fl/flAbcg1fl/fl or Abca1fl/flAbcg1fl/fl BM and fed WTD with or without the more specific LXR agonist GW3965 for 12 weeks. GW3965 decreased lesion size in both groups and the decrease was more prominent in the LysmCreAbca1fl/flAbcg1fl/fl group. Conclusions The results suggest that anti-inflammatory effects of LXR activators are of key importance to their anti-atherosclerotic effects in vivo independent of cholesterol efflux pathways mediated by macrophage ABCA1/G1. This has implications for the development of LXR activators that lack adverse effects on lipogenic genes while maintaining the ability to trans-repress inflammatory genes. PMID:24311381

Celecoxib sensitizes imatinib-resistant K562 cells to imatinib by inhibiting MRP1-5, ABCA2 and ABCG2 transporters via Wnt and Ras signaling pathways.

Science.gov (United States)

Dharmapuri, Gangappa; Doneti, Ravinder; Philip, Gundala Harold; Kalle, Arunasree M

2015-07-01

Imatinib mesylate, a tyrosine kinase inhibitor, is very effective in the treatment of chronic myeloid leukemia (CML). However, development of resistance to imatinib therapy is also a very common mechanism observed with long-term administration of the drug. Our previous studies have highlighted the role of cyclooxygenase-2 (COX-2) in regulating the expression of multidrug resistant protein-1 (MDR1), P-gp, in imatinib-resistant K562 cells (IR-K562) via PGE2-cAMP-PKC-NF-κB pathway and inhibition of COX-2 by celecoxib, a COX-2 specific inhibitor, inhibits this pathway and reverses the drug resistance. Studies have identified that not only MDR1 but other ATP-binding cassette transport proteins (ABC transporters) are involved in the development of imatinib resistance. Here, we tried to study the role of COX-2 in the regulation of other ABC transporters such as MRP1, MRP2, MRP3, ABCA2 and ABCG2 that have been already implicated in imatinib resistance development. The results of the study clearly indicated that overexpression of COX-2 lead to upregulation of MRP family proteins in IR-K562 cells and celecoxib down-regulated the ABC transporters through Wnt and MEK signaling pathways. The study signifies that celecoxib in combination with the imatinib can be a good alternate treatment strategy for the reversal of imatinib resistance. Copyright © 2015 Elsevier Ltd. All rights reserved.

AMPK Activation Prevents and Reverses Drug-Induced Mitochondrial and Hepatocyte Injury by Promoting Mitochondrial Fusion and Function.

Directory of Open Access Journals (Sweden)

Sun Woo Sophie Kang

Full Text Available Mitochondrial damage is the major factor underlying drug-induced liver disease but whether conditions that thwart mitochondrial injury can prevent or reverse drug-induced liver damage is unclear. A key molecule regulating mitochondria quality control is AMP activated kinase (AMPK. When activated, AMPK causes mitochondria to elongate/fuse and proliferate, with mitochondria now producing more ATP and less reactive oxygen species. Autophagy is also triggered, a process capable of removing damaged/defective mitochondria. To explore whether AMPK activation could potentially prevent or reverse the effects of drug-induced mitochondrial and hepatocellular damage, we added an AMPK activator to collagen sandwich cultures of rat and human hepatocytes exposed to the hepatotoxic drugs, acetaminophen or diclofenac. In the absence of AMPK activation, the drugs caused hepatocytes to lose polarized morphology and have significantly decreased ATP levels and viability. At the subcellular level, mitochondria underwent fragmentation and had decreased membrane potential due to decreased expression of the mitochondrial fusion proteins Mfn1, 2 and/or Opa1. Adding AICAR, a specific AMPK activator, at the time of drug exposure prevented and reversed these effects. The mitochondria became highly fused and ATP production increased, and hepatocytes maintained polarized morphology. In exploring the mechanism responsible for this preventive and reversal effect, we found that AMPK activation prevented drug-mediated decreases in Mfn1, 2 and Opa1. AMPK activation also stimulated autophagy/mitophagy, most significantly in acetaminophen-treated cells. These results suggest that activation of AMPK prevents/reverses drug-induced mitochondrial and hepatocellular damage through regulation of mitochondrial fusion and autophagy, making it a potentially valuable approach for treatment of drug-induced liver injury.

AMPK Activation Prevents and Reverses Drug-Induced Mitochondrial and Hepatocyte Injury by Promoting Mitochondrial Fusion and Function

Science.gov (United States)

Taniane, Caitlin; Farrell, Geoffrey; Arias, Irwin M.; Lippincott-Schwartz, Jennifer; Fu, Dong

2016-01-01

Mitochondrial damage is the major factor underlying drug-induced liver disease but whether conditions that thwart mitochondrial injury can prevent or reverse drug-induced liver damage is unclear. A key molecule regulating mitochondria quality control is AMP activated kinase (AMPK). When activated, AMPK causes mitochondria to elongate/fuse and proliferate, with mitochondria now producing more ATP and less reactive oxygen species. Autophagy is also triggered, a process capable of removing damaged/defective mitochondria. To explore whether AMPK activation could potentially prevent or reverse the effects of drug-induced mitochondrial and hepatocellular damage, we added an AMPK activator to collagen sandwich cultures of rat and human hepatocytes exposed to the hepatotoxic drugs, acetaminophen or diclofenac. In the absence of AMPK activation, the drugs caused hepatocytes to lose polarized morphology and have significantly decreased ATP levels and viability. At the subcellular level, mitochondria underwent fragmentation and had decreased membrane potential due to decreased expression of the mitochondrial fusion proteins Mfn1, 2 and/or Opa1. Adding AICAR, a specific AMPK activator, at the time of drug exposure prevented and reversed these effects. The mitochondria became highly fused and ATP production increased, and hepatocytes maintained polarized morphology. In exploring the mechanism responsible for this preventive and reversal effect, we found that AMPK activation prevented drug-mediated decreases in Mfn1, 2 and Opa1. AMPK activation also stimulated autophagy/mitophagy, most significantly in acetaminophen-treated cells. These results suggest that activation of AMPK prevents/reverses drug-induced mitochondrial and hepatocellular damage through regulation of mitochondrial fusion and autophagy, making it a potentially valuable approach for treatment of drug-induced liver injury. PMID:27792760

Cellular Cholesterol Regulates Ubiquitination and Degradation of the Cholesterol Export Proteins ABCA1 and ABCG1*

Science.gov (United States)

Hsieh, Victar; Kim, Mi-Jurng; Gelissen, Ingrid C.; Brown, Andrew J.; Sandoval, Cecilia; Hallab, Jeannette C.; Kockx, Maaike; Traini, Mathew; Jessup, Wendy; Kritharides, Leonard

2014-01-01

The objective of this study was to examine the influence of cholesterol in post-translational control of ABCA1 and ABCG1 protein expression. Using CHO cell lines stably expressing human ABCA1 or ABCG1, we observed that the abundance of these proteins is increased by cell cholesterol loading. The response to increased cholesterol is rapid, is independent of transcription, and appears to be specific for these membrane proteins. The effect is mediated through cholesterol-dependent inhibition of transporter protein degradation. Cell cholesterol loading similarly regulates degradation of endogenously expressed ABCA1 and ABCG1 in human THP-1 macrophages. Turnover of ABCA1 and ABCG1 is strongly inhibited by proteasomal inhibitors and is unresponsive to inhibitors of lysosomal proteolysis. Furthermore, cell cholesterol loading inhibits ubiquitination of ABCA1 and ABCG1. Our findings provide evidence for a rapid, cholesterol-dependent, post-translational control of ABCA1 and ABCG1 protein levels, mediated through a specific and sterol-sensitive mechanism for suppression of transporter protein ubiquitination, which in turn decreases proteasomal degradation. This provides a mechanism for acute fine-tuning of cholesterol transporter activity in response to fluctuations in cell cholesterol levels, in addition to the longer term cholesterol-dependent transcriptional regulation of these genes. PMID:24500716

Drug-Induced Morphology Switch in Drug Delivery Systems Based on Poly(2-oxazoline)s

Science.gov (United States)

2015-01-01

Defined aggregates of polymers such as polymeric micelles are of great importance in the development of pharmaceutical formulations. The amount of drug that can be formulated by a drug delivery system is an important issue, and most drug delivery systems suffer from their relatively low drug-loading capacity. However, as the loading capacities increase, i.e., promoted by good drug–polymer interactions, the drug may affect the morphology and stability of the micellar system. We investigated this effect in a prominent system with very high capacity for hydrophobic drugs and found extraordinary stability as well as a profound morphology change upon incorporation of paclitaxel into micelles of amphiphilic ABA poly(2-oxazoline) triblock copolymers. The hydrophilic blocks A comprised poly(2-methyl-2-oxazoline), while the middle blocks B were either just barely hydrophobic poly(2-n-butyl-2-oxazoline) or highly hydrophobic poly(2-n-nonyl-2-oxazoline). The aggregation behavior of both polymers and their formulations with varying paclitaxel contents were investigated by means of dynamic light scattering, atomic force microscopy, (cryogenic) transmission electron microscopy, and small-angle neutron scattering. While without drug, wormlike micelles were present, after incorporation of small amounts of drugs only spherical morphologies remained. Furthermore, the much more hydrophobic poly(2-n-nonyl-2-oxazoline)-containing triblock copolymer exhibited only half the capacity for paclitaxel than the poly(2-n-butyl-2-oxazoline)-containing copolymer along with a lower stability. In the latter, contents of paclitaxel of 8 wt % or higher resulted in a raspberry-like micellar core. PMID:24548260

The Promotion of Drug Abuse- PO*

African Journals Online (AJOL)

1974-03-02

Mar 2, 1974 ... experience in modern marketing techniques could develop a promotional campaign to increase drug abuse. ... Drug abuse-identity ... conforms to the same social, intellectual and cultural ... The brand names should also be chosen carefu11y. ... In this market the mass media offer the greatest coverage.

Factors predisposing to coma and delirium: fentanyl and midazolam exposure; CYP3A5, ABCB1, and ABCG2 genetic polymorphisms; and inflammatory factors.

Science.gov (United States)

Skrobik, Yoanna; Leger, Caroline; Cossette, Mariève; Michaud, Veronique; Turgeon, Jacques

2013-04-01

Delirium and sedative-induced coma are described as incremental manifestations of cerebral dysfunction. Both may be associated with sedative or opiate doses and pharmacokinetic or pharmacogenetic variables, such as drug plasma levels (exposure), drug metabolism, and/or their transport across the blood-brain barrier. To compare biological and drug treatment characteristics in patients with coma and/or delirium while in the ICU. In 99 patients receiving IV fentanyl, midazolam, or both, we evaluated drug doses, covariates likely to influence drug effects (age, body mass index, and renal and hepatic dysfunction); delirium risk factors; concomitant administration of CYP3A and P-glycoprotein substrates/inhibitors; ABCB1, ABCG2, and CYP3A5 genetic polymorphisms; and fentanyl and midazolam plasma levels. Delirium and coma were evaluated daily. In patients with only coma (n=15), only delirium (n=7), and neither ever (n=14), we measured plasma levels of tumor necrosis factor-α, interleukin (IL)-1β, IL-1RA, IL-6, IL-8, IL-10, IL-17,macrophage inflammatory protein-1β, and monocyte chemotactic protein-1. Time to first coma was associated with fentanyl and midazolam doses (p=0.03 and p=0.01, respectively). The number of days in coma was associated with the number of days of coadministration of CYP3A inhibitors (r=0.30; p=0.006). Plasma levels of fentanyl were higher in patients with clinical coma (3.7±4.7 vs. 2.0±1.8 ng/mL, p=0.0001) as were midazolam plasma levels (1050±2232 vs. 168±249 ng/mL, p=0.0001). Delirium occurrence was unrelated to midazolam administration, cumulative doses, or serum levels. Days with delirium were associated with days of coadministration of P-glycoprotein inhibitor (r=0.35; p=0.0004). Delirious patients had higher levels of the inflammatory mediator IL-6 than comatose patients (129.3 vs. 35.0 pg/mL, p=0.05). Coma is associated with fentanyl and midazolam exposure; delirium is unrelated to midazolam and may be linked to inflammatory status

Genome-Wide Identification and Expression Profiling of ATP-Binding Cassette (ABC) Transporter Gene Family in Pineapple (Ananas comosus (L.) Merr.) Reveal the Role of AcABCG38 in Pollen Development.

Science.gov (United States)

Chen, Piaojuan; Li, Yi; Zhao, Lihua; Hou, Zhimin; Yan, Maokai; Hu, Bingyan; Liu, Yanhui; Azam, Syed Muhammad; Zhang, Ziyan; Rahman, Zia Ur; Liu, Liping; Qin, Yuan

2017-01-01

Pineapple ( Ananas comosus L .) cultivation commonly relies on asexual reproduction which is easily impeded by many factors in agriculture production. Sexual reproduction might be a novel approach to improve the pineapple planting. However, genes controlling pineapple sexual reproduction are still remain elusive. In different organisms a conserved superfamily proteins known as ATP binding cassette (ABC) participate in various biological processes. Whereas, till today the ABC gene family has not been identified in pineapple. Here 100 ABC genes were identified in the pineapple genome and grouped into eight subfamilies (5 ABCAs , 20 ABCB s, 16 ABCCs , 2 ABCDs , one ABCEs , 5 ABCFs , 42 ABCGs and 9 ABCIs ). Gene expression profiling revealed the dynamic expression pattern of ABC gene family in various tissues and different developmental stages. AcABCA5, AcABCB6, AcABCC4 , AcABCC7 , AcABCC9 , AcABCG26 , AcABCG38 and AcABCG42 exhibited preferential expression in ovule and stamen. Over-expression of AcABCG38 in the Arabidopsis double mutant abcg1-2abcg16-2 partially restored its pollen abortion defects, indicating that AcABCG38 plays important roles in pollen development. Our study on ABC gene family in pineapple provides useful information for developing sexual pineapple plantation which could be utilized to improve pineapple agricultural production.

Carnosol promotes endothelial differentiation under H2O2-induced oxidative stress

Directory of Open Access Journals (Sweden)

Ou Shulin

2017-01-01

Full Text Available Oxidative stress causes deregulation of endothelial cell differentiation. Carnosol is a potent antioxidant and antiinflammatory compound. In the present study, we examined whether the antioxidant effect of carnosol might protect bone marrow stem cells against H2O2-induced oxidative stress and promote endothelial differentiation. We examined cell viability by the MTT assay; oxidative stress and apoptosis were analyzed through changes in ROS levels, apoptotic ratio and caspase-3 activity; changes in protein expression of OCT-4, Flk-1, CD31 and Nrf-2 were assessed by Western blot analysis. H2O2 treatment increased oxidative stress and reduced cell viability, while the stem cell marker OCT-4 and endothelial markers Flk-1, CD31 were significantly downregulated as a result of the treatment with H2O2. Treatment with carnosol improved the antioxidant status, increased OCT-4 expression and promoted endothelial differentiation. This study provides evidence that carnosol could increase the antioxidant defense mechanism and promote endothelial differentiation.

Early sorafenib-induced toxicity is associated with drug exposure and UGTIA9 genetic polymorphism in patients with solid tumors: a preliminary study.

Directory of Open Access Journals (Sweden)

Pascaline Boudou-Rouquette

Full Text Available BACKGROUND: Identifying predictive biomarkers of drug response is of key importance to improve therapy management and drug selection in cancer therapy. To date, the influence of drug exposure and pharmacogenetic variants on sorafenib-induced toxicity remains poorly documented. The aim of this pharmacokinetic/pharmacodynamic (PK/PD study was to investigate the relationship between early toxicity and drug exposure or pharmacogenetic variants in unselected adult outpatients treated with single-agent sorafenib for advanced solid tumors. METHODS: Toxicity was recorded in 54 patients on days 15 and 30 after treatment initiation and sorafenib exposure was assessed in 51 patients. The influence of polymorphisms in CYP3A5, UGT1A9, ABCB1 and ABCG2 was examined in relation to sorafenib exposure and toxicity. Clinical characteristics, drug exposure and pharmacogenetic variants were tested univariately for association with toxicities. Candidate variables with p<0.1 were analyzed in a multivariate analysis. RESULTS: Gender was the sole parameter independently associated with sorafenib exposure (p = 0.0008. Multivariate analysis showed that increased cumulated sorafenib (AUC(cum was independently associated with any grade ≥ 3 toxicity (p = 0.037; UGT1A9 polymorphism (rs17868320 with grade ≥ 2 diarrhea (p = 0.015 and female gender with grade ≥ 2 hand-foot skin reaction (p = 0.018. Using ROC curve, the threshold AUC(cum value of 3,161 mg/L.h was associated with the highest risk to develop any grade ≥ 3 toxicity (p = 0.018. CONCLUSION: In this preliminary study, increased cumulated drug exposure and UGT1A9 polymorphism (rs17868320 identified patients at high risk for early sorafenib-induced severe toxicity. Further PK/PD studies on larger population are warranted to confirm these preliminary results.

Breast cancer resistance protein (Bcrp1/Abcg2) limits net intestinal uptake of quercetin in rats by facilitating apical efflux of glucuronides

NARCIS (Netherlands)

Sesink, A.L.A.; Arts, I.C.W.; Boer, de V.C.J.; Breedveld, P.; Schellens, J.H.M.; Hollman, P.C.H.; Russel, F.G.M.

2005-01-01

The intestinal absorption of the flavonoid quercetin in rats is limited by the secretion of glucuronidated metabolites back into the gut lumen. The objective of this study was to determine the role of the intestinal efflux transporters breast cancer resistance protein (Bcrp1)/Abcg2 and multidrug

Breast cancer resistance protein (Bcrp1/Abcg2) limits net intestinal uptake of quercetin in rats by facilitating apical efflux of glucuronides.

NARCIS (Netherlands)

Sesink, A.L.; Arts, I.C.; Boer, V.C. de; Breedveld, P.; Schellens, J.H.; Hollman, P.C.H.; Russel, F.G.M.

2005-01-01

The intestinal absorption of the flavonoid quercetin in rats is limited by the secretion of glucuronidated metabolites back into the gut lumen. The objective of this study was to determine the role of the intestinal efflux transporters breast cancer resistance protein (Bcrp1)/Abcg2 and multidrug

Molecular mechanisms of drug resistance and tumor promotion involving mammalian ribonucleotide reductase

Energy Technology Data Exchange (ETDEWEB)

Choy, B.B.K.

1991-01-01

Mammalian ribonucleotide reductase is a highly regulated, rate-limiting activity responsible for converting ribonucleoside diphosphates to the deoxyribonucleotide precursors of DNA. The enzyme consists of two nonidentical proteins called M1 and M2, both of which are required for activity. Hydroxyurea is an antitumor agent which inhibits ribonucleotide reductase by interacting with the M2 component specifically at a unique tyrosyl free radical. Studies were conducted on a series of drug resistant mouse cell lines, selected by a step-wise procedure for increasing levels of resistance to the cytotoxic effects of hydroxyurea. Each successive drug selection step leading to the isolation of highly resistant cells was accompanied by stable elevations in cellular resistance and ribonucleotide reductase activity. The drug resistant cell lines exhibited gene amplification of the M2 gene, elevated M2 mRNA, and M2 protein. In addition to M2 gene amplification, posttranscriptional modulation also occurred during the drug selection. Studies of the biosynthesis rates with exogenously added iron suggest a role for iron in regulating the level of M2 protein when cells are cultured in the presence of hydroxyurea. The hydroxyurea-inactivated ribonucleotide reductase protein M2 has a destabilized iron centre, which readily releases iron. Altered expression of ferritin appears to be required for the development of hydroxyurea resistance in nammalian cells. The results show an interesting relationship between the expressions of ribonucleotide reductase and ferritin. The phorbol ester tumor promoter, TPA, is also able to alter the expression of M2. TPA was able to induce M2 mRNA levels transiently up to 18-fold within 1/2 hour. This rapid and large elevation of ribonucleotide reductase suggests that the enzyme may play a role in tumor promotion. Studies of the M2 promoter region were undertaken to better understand the mechanism of TPA induction of M2.

Cognition, learning behaviour and hippocampal synaptic plasticity are not disrupted in mice over-expressing the cholesterol transporter ABCG1

Directory of Open Access Journals (Sweden)

Eadie Brennan D

2009-02-01

Full Text Available Abstract Background Cognitive deficits are a hallmark feature of both Down Syndrome (DS and Alzheimer's Disease (AD. Extra copies of the genes on chromosome 21 may also play an important role in the accelerated onset of AD in DS individuals. Growing evidence suggests an important function for cholesterol in the pathogenesis of AD, particularly in APP metabolism and production of Aβ peptides. The ATP-Binding Cassette-G1 (ABCG1 transporter is located on chromosome 21, and participates in the maintenance of tissue cholesterol homeostasis. Results To assess the role of ABCG1 in DS-related cognition, we evaluated the cognitive performance of mice selectively over-expressing the ABCG1 gene from its endogenous regulatory signals. Both wild-type and ABCG1 transgenic mice performed equivalently on several behavioral tests, including measures of anxiety, as well as on reference and working memory tasks. No deficits in hippocampal CA1 synaptic plasticity as determined with electrophysiological studies were apparent in mice over-expressing ABCG1. Conclusion These findings indicate that although ABCG1 may play a role in maintaining cellular or tissue cholesterol homeostasis, it is unlikely that excess ABCG1 expression contributes to the cognitive deficits in DS individuals.

Terbinafine-induced lichenoid drug eruption.

Science.gov (United States)

Zheng, Yue; Zhang, Jie; Chen, Haiyan; Lai, Wei; Maibach, Howard I

2017-03-01

Drug-induced lichen planus has been induced by antibiotics, anticonvulsants, antidiabetics, antimalarials, antitubercular drugs, antihypertensives, psychiatric drugs, chemotherapeutic agents, diuretic, heavy metals, NSAIDs, etc. Terbinafine, an antifungal agent, is widely used for dermatophyte infections and onychomycosis. Cutaneous adverse effects of terbinafine are rarely reported. Here, we report a case of terbinafine-induced lichenoid drug eruption in a 22-year-old who presented with generalized lichenoid eruption 2 weeks after terbinafine initiation of. The body and lip cleared completely after 8 weeks of drug withdrawal; nail change cleared after 12 weeks.

Total bile acids in the maternal and fetal compartment in relation to placental ABCG2 expression in preeclamptic pregnancies complicated by HELLP syndrome

NARCIS (Netherlands)

Jebbink, Jiska; Veenboer, Geertruda; Boussata, Souad; Keijser, Remco; Kremer, Andreas E.; Elferink, Ronald Oude; van der Post, Joris; Afink, Gijs; Ris-Stalpers, Carrie

2015-01-01

To investigate total bile acid (TBA) levels in maternal (MB) and umbilical cord blood (UCB) in normotensive, preeclamptic (PE), and PE pregnancies complicated by hemolysis elevated liver enzymes and low platelets (HELLP) syndrome in the context of ABCG2 placental gene expression levels, a recently

Genistein and Glyceollin Effects on ABCC2 (MRP2 and ABCG2 (BCRP in Caco-2 Cells

Directory of Open Access Journals (Sweden)

Chandler Schexnayder

2015-12-01

Full Text Available The goal of the present study was to determine the effects of glyceollins on intestinal ABCC2 (ATP Binding Cassette C2, multidrug resistance protein 2, MRP2 and ABCG2 (ATP Binding Cassette G2, breast cancer resistance protein, BCRP function using the Caco-2 cell intestinal epithelial cell model. Glyceollins are soy-derived phytoestrogens that demonstrate anti-proliferative activity in several sources of cancer cells. 5 (and 6-carboxy-2′,7′-dichloroflourescein (CDF was used as a prototypical MRP2 substrate; whereas BODIPY-prazosin provided an indication of BCRP function. Comparison studies were conducted with genistein. Glyceollins were shown to inhibit MRP2-mediated CDF transport, with activity similar to the MRP2 inhibitor, MK-571. They also demonstrated concentration-dependent inhibition BCRP-mediated efflux of BODIPY-prazosin, with a potency similar to that of the recognized BCRP inhibitor, Ko143. In contrast, genistein did not appear to alter MRP2 activity and even provided a modest increase in BCRP efflux of BODIPY-prazosin. In particular, glyceollin inhibition of these two important intestinal efflux transporters suggests the potential for glyceollin to alter the absorption of other phytochemicals with which it might be co-administered as a dietary supplement, as well as alteration of the absorption of pharmaceuticals that may be administered concomitantly.

Endothelial ATP-binding cassette G1 in mouse endothelium protects against hemodynamic-induced atherosclerosis

Energy Technology Data Exchange (ETDEWEB)

Xue, Shanshan [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China); Department of Pediatrics, Baodi District People’s Hospital of Tianjin City, Tianjin, 301800 (China); Wang, Jiaxing [Department of Physiology and Pathophysiology, Peking University Health Science Center, Beijing, 100191 (China); Zhang, Xu; Shi, Ying; Li, Bochuan; Bao, Qiankun [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China); Pang, Wei [Department of Physiology and Pathophysiology, Peking University Health Science Center, Beijing, 100191 (China); Ai, Ding [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China); Zhu, Yi [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China); Department of Physiology and Pathophysiology, Peking University Health Science Center, Beijing, 100191 (China); He, Jinlong, E-mail: hejinlong@tmu.edu.cn [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China)

2016-08-19

Activated vascular endothelium inflammation under persistent hyperlipidemia is the initial step of atherogenesis. ATP-binding cassette G1 (ABCG1) is a crucial factor maintaining sterol and lipid homeostasis by transporting cholesterol efflux to high-density lipoprotein. In this study, we investigated the protective effects of ABCG1 in endothelial inflammation activation during early-stage atherogenesis in mice and the underlying mechanisms. Endothelial cell (EC)-specific ABCG1 transgenic (EC-ABCG1-Tg) mice were generated and cross-bred with low-density lipoprotein receptor–deficient (Ldlr{sup −/−}) mice. After a 4-week Western-type diet, the mice were sacrificed for assessing atherosclerosis. Human umbilical vein ECs were treated with different flows, and ABCG1 was adenovirally overexpressed to investigate the mechanism in vitro. Compared with Ldlr{sup −/−} mouse aortas, EC-ABCG1-Tg/Ldlr{sup −/−} aortas showed decreased early-stage lesions. Furthermore, the lesion area in the EC-ABCG1-Tg/Ldlr{sup −/−} mouse aortic arch but not thoracic aorta was significantly reduced, which suggests a protective role of ABCG1 under atheroprone flow. In vitro, overexpression of ABCG1 attenuated EC activation caused by oscillatory shear stress. Overexpression of ABCG1 blunted cholesterol-activated ECs in vitro. In exploring the mechanisms of ABCG1 attenuating endothelial inflammation, we found that ABCG1 inhibited oscillatory flow-activated nuclear factor kappa B and NLRP3 inflammasome in ECs. ABCG1 may play a protective role in early-stage atherosclerosis by reducing endothelial activation induced by oscillatory shear stress via suppressing the inflammatory response. - Highlights: • EC-ABCG1-Tg mice in a Ldlr{sup −/−} background showed decreased atherosclerosis. • Overexpression of ABCG1 in ECs decreased OSS-induced EC activation. • NLRP3 and NF-κB might be an underlying mechanism of ABCG1 protective role.

Drug-induced hepatic injury

DEFF Research Database (Denmark)

Friis, Henrik; Andreasen, P B

1992-01-01

The Danish Committee on Adverse Drug Reactions received 1100 reports of suspected drug-induced hepatic injury during the decade 1978-1987. The causal relationship between drug and hepatic injury was classified as definite in 57 (5.2%) reports, probable in 989 (89.9%) reports, possible in 50 (4.......5%) reports and unclassifiable in four (0.4%) reports. Hepatic injuries accounted for 5.9% of all adverse drug reactions reported, and 14.7% of the lethal adverse drug reactions. A total of 47.2% were classified as acute cytotoxic, 16.2% as acute cholestatic and 26.9% as abnormal hepatic function. In 52 (4.......7%) cases the hepatic injury was lethal; only 14 (1.3%) cases were chronic. Halothane accounted for 25% of the cases. The incidence of halothane-induced hepatic injury is decreasing, and only one lethal case has been reported since 1981. Next to halothane, sulfasalazine was the drug most often suspected...

Overexpression of AtABCG25 enhances the abscisic acid signal in guard cells and improves plant water use efficiency.

Science.gov (United States)

Kuromori, Takashi; Fujita, Miki; Urano, Kaoru; Tanabata, Takanari; Sugimoto, Eriko; Shinozaki, Kazuo

2016-10-01

In addition to improving drought tolerance, improvement of water use efficiency is a major challenge in plant physiology. Due to their trade-off relationships, it is generally considered that achieving stress tolerance is incompatible with maintaining stable growth. Abscisic acid (ABA) is a key phytohormone that regulates the balance between intrinsic growth and environmental responses. Previously, we identified AtABCG25 as a cell-membrane ABA transporter that export ABA from the inside to the outside of cells. AtABCG25-overexpressing plants showed a lower transpiration phenotype without any growth retardation. Here, we dissected this useful trait using precise phenotyping approaches. AtABCG25 overexpression stimulated a local ABA response in guard cells. Furthermore, AtABCG25 overexpression enhanced drought tolerance, probably resulting from maintenance of water contents over the common threshold for survival after drought stress treatment. Finally, we observed enhanced water use efficiency by overexpression of AtABCG25, in addition to drought tolerance. These results were consistent with the function of AtABCG25 as an ABA efflux transporter. This unique trait may be generally useful for improving the water use efficiency and drought tolerance of plants. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

IND-2, a pyrimido[1″,2″:1,5]pyrazolo[3,4-b]quinoline derivative, circumvents multi-drug resistance and causes apoptosis in colon cancer cells.

Science.gov (United States)

Karthikeyan, Chandrabose; Lee, Crystal; Moore, Joshua; Mittal, Roopali; Suswam, Esther A; Abbott, Kodye L; Pondugula, Satyanarayana R; Manne, Upender; Narayanan, Narayanan K; Trivedi, Piyush; Tiwari, Amit K

2015-02-01

Naturally occurring condensed quinolines have anticancer properties. In efforts to find active analogues, we designed and synthesized eight polycyclic heterocycles with a pyrimido[1″,2″:1,5]pyrazolo[3,4-b]quinoline framework (IND series). The compounds were evaluated for activity against colon (HCT-116 and S1-MI-80), prostate (PC3 and DU-145), breast (MCF-7 and MDAMB-231), ovarian (ov2008 and A2780), and hepatocellular (HepG2) cancer cells and against non-cancerous Madin Darby canine kidney (MDCK), mouse embryonic fibroblast (NIH/3T3), and human embryonic kidney cells (HEK293). IND-2, a 4-chloro-2-methyl pyrimido[1″,2″:1,5]pyrazolo[3,4-b]quinoline, exhibited more than ten-fold selectivity and potent cytotoxic activity against colon cancer cells relative to the other cancer and non-cancer cells. With five additional colon cancer cell lines (HT-29, HCT-15, LS-180, LS-174, and LoVo), IND-2 had similar cytotoxicity and selectivity, and sub-micromolar concentrations caused changes in the morphology of HCT-116 and HCT-15 cells. IND-2 did not activate the transactivating function of the pregnane X receptor (PXR), indicating that it does not induce PXR-regulated ABCB1 or ABCG2 transporters. Indeed, IND-2 was not a substrate of ABCB1 or ABCG2, and it induced cytotoxicity in HEK293 cells overexpressing ABCB1 or ABCG2 to the same extent as in normal HEK293 cells. IND-2 was cytotoxic to resistant colon carcinoma S1-MI-80 cells, approximately three- and five-fold more than SN-38 and topotecan, respectively. In HCT-116 colon cancer cells, IND-2 produced concentration-dependent changes in mitochondrial membrane potential, leading to apoptosis, and sub-micromolar concentrations caused chromosomal DNA fragmentation. These findings suggest that, by increasing apoptosis, IND-2 has potential therapeutic efficacy for colorectal cancer. Copyright © 2014 Elsevier Ltd. All rights reserved.

21 CFR 312.7 - Promotion of investigational drugs.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 5 2010-04-01 2010-04-01 false Promotion of investigational drugs. 312.7 Section 312.7 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS FOR HUMAN USE INVESTIGATIONAL NEW DRUG APPLICATION General Provisions § 312.7 Promotion of...

Constitutive androstane receptor upregulates Abcb1 and Abcg2 at the blood-brain barrier after CITCO activation.

Science.gov (United States)

Lemmen, Julia; Tozakidis, Iasson E P; Bele, Prachee; Galla, Hans-Joachim

2013-03-21

ATP-driven efflux transporters are considered to be the major hurdle in the treatment of central nervous system (CNS) diseases. Abcb1 (P-glycoprotein) and Abcg2 (breast cancer resistance protein/brain multidrug resistance protein) belong to the best known ABC-transporters. These ABC-transporters limit the permeability of the blood-brain barrier and protect the brain against toxic compounds in the blood but on the other hand they also reduce the efficacy of CNS pharmacotherapy. Even after 40 years of extensive research, the regulatory mechanisms of these efflux transporters are still not completely understood. To unravel the efflux transporter regulation, we analyzed the effect of the nuclear receptor CAR (constitutive androstane receptor) on the expression of Abcb1 and Abcg2 in primary cultures of porcine brain capillary endothelial cells (PBCEC). CAR is a xenobiotic-activated transcription factor, which is, like the other important nuclear receptor pregnane X receptor (PXR), highly expressed in barrier tissue and known to be a positive regulator of ABC-transporters. We demonstrate that activation of porcine CAR by the human CAR (hCAR) ligand CITCO (6-(4-chlorophenyl)-imidazo[2,1-b]thiazole-5-carbaldehyde) leads to an up-regulation of both transporters, whereas the mouse-specific CAR ligand TCPOBOP (1,4-bis-[2-(3,5-dichloropyridyloxy)]benzene) had no effect on transporter expression. The stimulation of PBCEC with CITCO caused a significant up-regulation of both efflux-transporters on RNA-level, protein level and transport level. Furthermore the additional application of a CAR inhibitor significantly decreased the transporter expression to control niveau. In conclusion our data prove CAR activation only by the human ligand CITCO leading to an increased ABC-transporter expression and transport activity. Copyright © 2013 Elsevier B.V. All rights reserved.

[Drug-induced oral ulcerations].

Science.gov (United States)

Madinier, I; Berry, N; Chichmanian, R M

2000-06-01

Different side effects of drugs have been described in the oral cavity, including oral ulcerations. Direct contact between drugs and oral mucosa may induce chemical burn or local hypersensitivity. Less frequently, these drug-induced oral ulcerations are part of a complex reaction with cutaneous or systemic manifestations. Sometimes, one or more oral ulcerations appear as the main side-effect of a drug, or exceptionally as solitary lesions. Solitary oral ulcerations usually appear after few weeks of treatment. In most of cases, these lesions resist to conventional treatments, with a rapid healing following the suppression of the responsible drug. This diagnosis is usually difficult, particularly with patients receiving multiple drug therapy. Besides, special attention must be paid to new drugs. Oral ulcerations following symptoms of burning mouth, metallic taste, dysgueusia or agueusia are strongly suggestive of a pharmacological origin. Most of the molecules able to induce solitary oral ulcerations are commonly prescribed in a) rheumatology: NSAI (diclofenac, flurbiprofen, indomethacin, naproxen), long-term rheumatoid arthritis therapy (azathioprine, methotrexate, penicillamine, gold compounds, tiopronin); b) cardiology: angiotensin-converting-enzyme inhibitors (captopril, enalapril), angiotensin 2-receptor antagonist (losartan), anti-angorous (nicorandil), c) psychiatry: antidepressants (fluoxetine, lithium), d) AIDS therapy (foscarnet, zalcitabine).

Cholesterol Transporters ABCA1 and ABCG1 Gene Expression in Peripheral Blood Mononuclear Cells in Patients with Metabolic Syndrome

Directory of Open Access Journals (Sweden)

Zahra Tavoosi

2015-01-01

Full Text Available ABCA1 and ABCG1 genes encode the cholesterol transporter proteins that play a key role in cholesterol and phospholipids homeostasis. This study was aimed at evaluating and comparing ABCA1 and ABCG1 genes expression in metabolic syndrome patients and healthy individuals. This case-control study was performed on 36 patients with metabolic syndrome and the same number of healthy individuals in Hamadan (west of Iran during 2013-2014. Total RNA was extracted from mononuclear cells and purified using RNeasy Mini Kit column. The expression of ABCA1 and ABCG1 genes was performed by qRT-PCR. Lipid profile and fasting blood glucose were measured using colorimetric procedures. ABCG1 expression in metabolic syndrome patients was significantly lower (about 75% compared to that of control group, while for ABCA1 expression, there was no significant difference between the two studied groups. Comparison of other parameters such as HDL-C, FBS, BMI, waist circumference, and systolic and diastolic blood pressure between metabolic syndrome patients and healthy individuals showed significant differences (P<0.05. Decrease in ABCG1 expression in metabolic syndrome patients compared to healthy individuals suggests that hyperglycemia, related metabolites, and hyperlipidemia over the transporter capacity resulted in decreased expression of ABCG1. Absence of a significant change in ABCA1 gene expression between two groups can indicate a different regulation mechanism for ABCA1 expression.

Mechanical Stress Promotes Cisplatin-Induced Hepatocellular Carcinoma Cell Death

Science.gov (United States)

Riad, Sandra; Bougherara, Habiba

2015-01-01

Cisplatin (CisPt) is a commonly used platinum-based chemotherapeutic agent. Its efficacy is limited due to drug resistance and multiple side effects, thereby warranting a new approach to improving the pharmacological effect of CisPt. A newly developed mathematical hypothesis suggested that mechanical loading, when coupled with a chemotherapeutic drug such as CisPt and immune cells, would boost tumor cell death. The current study investigated the aforementioned mathematical hypothesis by exposing human hepatocellular liver carcinoma (HepG2) cells to CisPt, peripheral blood mononuclear cells, and mechanical stress individually and in combination. HepG2 cells were also treated with a mixture of CisPt and carnosine with and without mechanical stress to examine one possible mechanism employed by mechanical stress to enhance CisPt effects. Carnosine is a dipeptide that reportedly sequesters platinum-based drugs away from their pharmacological target-site. Mechanical stress was achieved using an orbital shaker that produced 300 rpm with a horizontal circular motion. Our results demonstrated that mechanical stress promoted CisPt-induced death of HepG2 cells (~35% more cell death). Moreover, results showed that CisPt-induced death was compromised when CisPt was left to mix with carnosine 24 hours preceding treatment. Mechanical stress, however, ameliorated cell death (20% more cell death). PMID:25685789

Mechanical Stress Promotes Cisplatin-Induced Hepatocellular Carcinoma Cell Death

Directory of Open Access Journals (Sweden)

Laila Ziko

2015-01-01

Full Text Available Cisplatin (CisPt is a commonly used platinum-based chemotherapeutic agent. Its efficacy is limited due to drug resistance and multiple side effects, thereby warranting a new approach to improving the pharmacological effect of CisPt. A newly developed mathematical hypothesis suggested that mechanical loading, when coupled with a chemotherapeutic drug such as CisPt and immune cells, would boost tumor cell death. The current study investigated the aforementioned mathematical hypothesis by exposing human hepatocellular liver carcinoma (HepG2 cells to CisPt, peripheral blood mononuclear cells, and mechanical stress individually and in combination. HepG2 cells were also treated with a mixture of CisPt and carnosine with and without mechanical stress to examine one possible mechanism employed by mechanical stress to enhance CisPt effects. Carnosine is a dipeptide that reportedly sequesters platinum-based drugs away from their pharmacological target-site. Mechanical stress was achieved using an orbital shaker that produced 300 rpm with a horizontal circular motion. Our results demonstrated that mechanical stress promoted CisPt-induced death of HepG2 cells (~35% more cell death. Moreover, results showed that CisPt-induced death was compromised when CisPt was left to mix with carnosine 24 hours preceding treatment. Mechanical stress, however, ameliorated cell death (20% more cell death.

Molecular Genetics of Drug-resistance in Epilepsies

Directory of Open Access Journals (Sweden)

Kurupath Radhakrishnan

2015-06-01

Full Text Available Nearly one-third of newly diagnosed patients with epilepsy remain unresponsive to antiepileptic drugs (AEDs, etiopathogenesis of which is poorly understood. The genes encoding the proteins that regulate the pharmacokinetics such as P-glycoprotein [ABCBI], major vault protein [MVP gene] and drug metabolizing enzymes [ABCB1, ABCG2, MVP, CYP2C9, CYP2C19, CYP3A4, CYP3A5, EPHX1, UGT1A1, UGT2B7], and pharmacodynamics such as sodium channels [SCN1A, SCN2A] and GABA receptors [GABRA1, GABRA6, GABRB2, GABRG2] of AEDs are under intense investigation to unravel the mysteries of AED-resistance. However, till today, a consistent and reliable result that could help the clinician either to predict drug resistance or to overcome it has not been forthcoming. The discrepant results may be related to variations in the definition of drug-resistance, heterogeneous patient populations, ethnic variations in the frequency distribution of single nucleotide polymorphisms (SNPs and the selection of SNPs. Understanding of these limitations of existing studies, hopefully, will help in designing better studies. Nearly one-third of newly diagnosed patients with epilepsy remain unresponsive toantiepileptic drugs (AEDs, etiopathogenesis of which is poorly understood. The genesencoding the proteins that regulate the pharmacokinetics such as P-glycoprotein[ABCBI], major vault protein [MVP gene] and drug metabolizing enzymes [ABCB1,ABCG2, MVP, CYP2C9, CYP2C19, CYP3A4, CYP3A5, EPHX1, UGT1A1, UGT2B7],and pharmacodynamics such as sodium channels [SCN1A, SCN2A] and GABAreceptors [GABRA1, GABRA6, GABRB2, GABRG2] of AEDs are under intenseinvestigation to unravel the mysteries of AED-resistance. However, till today, aconsistent and reliable result that could help the clinician either to predict drugresistanceor to overcome it has not been forthcoming. The discrepant results may berelated to variations in the definition of drug-resistance, heterogeneous patientpopulations, ethnic

Arctigenin promotes cholesterol efflux from THP-1 macrophages through PPAR-γ/LXR-α signaling pathway.

Science.gov (United States)

Xu, Xiaolin; Li, Qian; Pang, Liewen; Huang, Guoqian; Huang, Jiechun; Shi, Meng; Sun, Xiaotian; Wang, Yiqing

2013-11-15

Cholesterol efflux from macrophages is a critical mechanism to prevent the development of atherosclerosis. Here, we sought to investigate the effects of arctigenin, a bioactive component of Arctium lappa, on the cholesterol efflux in oxidized low-density lipoprotein (oxLDL)-loaded THP-1 macrophages. Our data showed that arctigenin significantly accelerated apolipoprotein A-I- and high-density lipoprotein-induced cholesterol efflux in both dose- and time-dependent manners. Moreover, arctigenin treatment enhanced the expression of ATP binding cassette transporter A1 (ABCA1), ABCG1, and apoE, all of which are key molecules in the initial step of cholesterol efflux, at both mRNA and protein levels. Arctigenin also caused a concentration-dependent elevation in the expression of peroxisome proliferator-activated receptor-gamma (PPAR-γ) and liver X receptor-alpha (LXR-α). The arctigenin-mediated induction of ABCA1, ABCG1, and apoE was abolished by specific inhibition of PPAR-γ or LXR-α using small interfering RNA technology. Our results collectively indicate that arctigenin promotes cholesterol efflux in oxLDL-loaded THP-1 macrophages through upregulation of ABCA1, ABCG1 and apoE, which is dependent on the enhanced expression of PPAR-γ and LXR-α. Copyright © 2013 Elsevier Inc. All rights reserved.

Idiosyncratic Drug-Induced Liver Injury: Is Drug-Cytokine Interaction the Linchpin?

Science.gov (United States)

Roth, Robert A; Maiuri, Ashley R; Ganey, Patricia E

2017-02-01

Idiosyncratic drug-induced liver injury continues to be a human health problem in part because drugs that cause these reactions are not identified in current preclinical testing and because progress in prevention is hampered by incomplete knowledge of mechanisms that underlie these adverse responses. Several hypotheses involving adaptive immune responses, inflammatory stress, inability to adapt to stress, and multiple, concurrent factors have been proposed. Yet much remains unknown about how drugs interact with the liver to effect death of hepatocytes. Evidence supporting hypotheses implicating adaptive or innate immune responses in afflicted patients has begun to emerge and is bolstered by results obtained in experimental animal models and in vitro systems. A commonality in adaptive and innate immunity is the production of cytokines, including interferon-γ (IFNγ). IFNγ initiates cell signaling pathways that culminate in cell death or inhibition of proliferative repair. Tumor necrosis factor-α, another cytokine prominent in immune responses, can also promote cell death. Furthermore, tumor necrosis factor-α interacts with IFNγ, leading to enhanced cellular responses to each cytokine. In this short review, we propose that the interaction of drugs with these cytokines contributes to idiosyncratic drug-induced liver injury, and mechanisms by which this could occur are discussed. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

Porous Polymer Drug-Eluting Coating Prepared by Radiation Induced Polymerization

Energy Technology Data Exchange (ETDEWEB)

Veres, M.; Tóth, S.; Koós, M. [Research Institute for Solid State Physics and Optics, Budapest (Hungary); Beiler, B. [Institute of Isotopes, HAS, Budapest (Hungary)

2009-07-01

Drug-eluting stents have several advantages over bare metal implants. They eliminate restenosis, the main drawback of bare metal stents. In addition the locally delivered drug is more effective and causes less side-effects. However in some cases dangerous stent thrombosis, inflammatory and allergy reactions were observed after their implantation, which first of all related to the drug-eluting coating. This project is aimed to develop a novel biocompatible nanoporous polymer layer by radiation induced polymerization that is capable of holding and eluting drugs and promotes endothelization after the release of the drug. (author)

Porous Polymer Drug-Eluting Coating Prepared by Radiation Induced Polymerization

International Nuclear Information System (INIS)

Veres, M.; Tóth, S.; Koós, M.; Beiler, B.

2009-01-01

Drug-eluting stents have several advantages over bare metal implants. They eliminate restenosis, the main drawback of bare metal stents. In addition the locally delivered drug is more effective and causes less side-effects. However in some cases dangerous stent thrombosis, inflammatory and allergy reactions were observed after their implantation, which first of all related to the drug-eluting coating. This project is aimed to develop a novel biocompatible nanoporous polymer layer by radiation induced polymerization that is capable of holding and eluting drugs and promotes endothelization after the release of the drug. (author)

[Drug induced diarrhea].

Science.gov (United States)

Morard, Isabelle; Hadengue, Antoine

2008-09-03

Diarrhea is a frequent adverse event involving the most frequently antibiotics, laxatives and NSAI. Drug induced diarrhea may be acute or chronic. It may be due to expected, dose dependant properties of the drug, to immuno-allergic or bio-genomic mechanisms. Several pathophysiological mechanisms have been described resulting in osmotic, secretory or inflammatory diarrhea, shortened transit time, or malabsorption. Histopathological lesions sometimes associated with drug induced diarrhea are usually non specific and include ulcerations, inflammatory or ischemic lesions, fibrous diaphragms, microscopic colitis and apoptosis. The diagnosis of drug induced diarrhea, sometimes difficult to assess, relies on the absence of other obvious causes and on the rapid disappearance of the symptoms after withdrawal of the suspected drug.

PTTG1 attenuates drug-induced cellular senescence.

Directory of Open Access Journals (Sweden)

Yunguang Tong

Full Text Available As PTTG1 (pituitary tumor transforming gene abundance correlates with adverse outcomes in cancer treatment, we determined mechanisms underlying this observation by assessing the role of PTTG1 in regulating cell response to anti-neoplastic drugs. HCT116 cells devoid of PTTG1 (PTTG1(-/- exhibited enhanced drug sensitivity as assessed by measuring BrdU incorporation in vitro. Apoptosis, mitosis catastrophe or DNA damage were not detected, but features of senescence were observed using low doses of doxorubicin and TSA. The number of drug-induced PTTG1(-/- senescent cells increased ∼4 fold as compared to WT PTTG1-replete cells (p<0.001. p21, an important regulator of cell senescence, was induced ∼3 fold in HCT116 PTTG1(-/- cells upon doxorubicin or Trichostatin A treatment. Binding of Sp1, p53 and p300 to the p21 promoter was enhanced in PTTG1(-/- cells after treatment, suggesting transcriptional regulation of p21. p21 knock down abrogated the observed senescent effects of these drugs, indicating that PTTG1 likely suppresses p21 to regulate drug-induced senescence. PTTG1 also regulated SW620 colon cancer cells response to doxorubicin and TSA mediated by p21. Subcutaneously xenografted PTTG1(-/- HCT116 cells developed smaller tumors and exhibited enhanced responses to doxorubicin. PTTG1(-/- tumor tissue derived from excised tumors exhibited increased doxorubicin-induced senescence. As senescence is a determinant of cell responses to anti-neoplastic treatments, these findings suggest PTTG1 as a tumor cell marker to predict anti-neoplastic treatment outcomes.

Chronic hypoxia promotes pulmonary artery endothelial cell proliferation through H2O2-induced 5-lipoxygenase.

Directory of Open Access Journals (Sweden)

Kristi M Porter

Full Text Available Pulmonary Hypertension (PH is a progressive disorder characterized by endothelial dysfunction and proliferation. Hypoxia induces PH by increasing vascular remodeling. A potential mediator in hypoxia-induced PH development is arachidonate 5-Lipoxygenase (ALOX5. While ALOX5 metabolites have been shown to promote pulmonary vasoconstriction and endothelial cell proliferation, the contribution of ALOX5 to hypoxia-induced proliferation remains unknown. We hypothesize that hypoxia exposure stimulates HPAEC proliferation by increasing ALOX5 expression and activity. To test this, human pulmonary artery endothelial cells (HPAEC were cultured under normoxic (21% O2 or hypoxic (1% O2 conditions for 24-, 48-, or 72 hours. In a subset of cells, the ALOX5 inhibitor, zileuton, or the 5-lipoxygenase activating protein inhibitor, MK-886, was administered during hypoxia exposure. ALOX5 expression was measured by qRT-PCR and western blot and HPAEC proliferation was assessed. Our results demonstrate that 24 and 48 hours of hypoxia exposure have no effect on HPAEC proliferation or ALOX5 expression. Seventy two hours of hypoxia significantly increases HPAEC ALOX5 expression, hydrogen peroxide (H2O2 release, and HPAEC proliferation. We also demonstrate that targeted ALOX5 gene silencing or inhibition of the ALOX5 pathway by pharmacological blockade attenuates hypoxia-induced HPAEC proliferation. Furthermore, our findings indicate that hypoxia-induced increases in cell proliferation and ALOX5 expression are dependent on H2O2 production, as administration of the antioxidant PEG-catalase blocks these effects and addition of H2O2 to HPAEC promotes proliferation. Overall, these studies indicate that hypoxia exposure induces HPAEC proliferation by activating the ALOX5 pathway via the generation of H2O2.

Drug-induced thrombocytopenia

DEFF Research Database (Denmark)

Pedersen-Bjergaard, U; Andersen, M; Hansen, P B

1997-01-01

induced by non-cytotoxic drugs is characterised by heterogeneous clinical picture and recovery is generally rapid. Although corticosteroids seem inefficient, we still recommend that severe symptomatic cases of drug-induced thrombocytopenia are treated as idiopathic thrombocytopenic purpura due...

Quercetin suppresses drug-resistant spheres via the p38 MAPK-Hsp27 apoptotic pathway in oral cancer cells.

Directory of Open Access Journals (Sweden)

Su-Feng Chen

Full Text Available BACKGROUND: Treatment failure in oral squamous cell carcinoma (OSCC leading to local recurrence(s and metastases is mainly due to drug resistance. Cancer stem cells (CSCs are thought be responsible for the development of drug resistance. However, the correlations between CSCs, drug resistance, and new strategy against drug resistance in OSCC remain elusive. METHODS: A drug-resistant sphere (DRSP model was generated by using a nonadhesive culture system to induce drug-resistant cells from SCC25 oral cancer cells. A comparative analysis was performed between the parent control cells and DRSPs with a related treatment strategy focusing on the expression of epithelial-mesenchymal transition (EMT-associated markers, drug-resistance-related genes, and CSC properties in vitro, as well as tumorigenicity and the regimen for tumor regression in vivo. RESULTS: Our data show the presence of a phenomenon of EMT with gradual cellular transition from an epithelioid to mesenchymal-like spheroid morphology during induction of drug resistance. The characterization of DRSPs revealed the upregulation of the drug-resistance-related genes ABCG2 and MDR-1 and of CSC-representative markers, suggesting that DRSPs have greater resistance to cisplatin (Cis and stronger CSC properties compared with the control. Moreover, overexpression of phosphorylated heat-shock protein 27 (p-Hsp27 via the activation of p38 MAPK signaling was observed in DRSPs. Knockdown of Hsp27 decreased Cis resistance and induced apoptosis in DRSPs. Furthermore, an inhibitor of Hsp27, quercetin (Qu, suppressed p-Hsp27 expression, with alterations of the EMT signature, leading to the promotion of apoptosis in DRSPs. A xenographic study also confirmed the increase of tumorigenicity in DRSPs. The combination of Qu and Cis can reduce tumor growth and decrease drug resistance in OSCC. CONCLUSIONS: The p38 MAPK-Hsp27 axis plays an important role in CSCs-mediated drug resistance in OSCC. Targeting this axis

Future Challenges and Opportunities in Online Prescription Drug Promotion Research

Science.gov (United States)

Southwell, Brian G.; Rupert, Douglas J.

2016-01-01

Despite increased availability of online promotional tools for prescription drug marketers, evidence on online prescription drug promotion is far from settled or conclusive. We highlight ways in which online prescription drug promotion is similar to conventional broadcast and print advertising and ways in which it differs. We also highlight five key areas for future research: branded drug website influence on consumer knowledge and behavior, interactive features on branded drug websites, mobile viewing of branded websites and mobile advertisements, online promotion and non-US audiences, and social media and medication decisions. PMID:26927597

ΔNp63α induces the expression of FAT2 and Slug to promote tumor invasion

Science.gov (United States)

Dang, Tuyen T.; Westcott, Jill M.; Maine, Erin A.; Kanchwala, Mohammed; Xing, Chao; Pearson, Gray W.

2016-01-01

Tumor invasion can be induced by changes in gene expression that alter cell phenotype. The transcription factor ΔNp63α promotes basal-like breast cancer (BLBC) migration by inducing the expression of the mesenchymal genes Slug and Axl, which confers cells with a hybrid epithelial/mesenchymal state. However, the extent of the ΔNp63α regulated genes that support invasive behavior is not known. Here, using gene expression analysis, ChIP-seq, and functional testing, we find that ΔNp63α promotes BLBC motility by inducing the expression of the atypical cadherin FAT2, the vesicular binding protein SNCA, the carbonic anhydrase CA12, the lipid binding protein CPNE8 and the kinase NEK1, along with Slug and Axl. Notably, lung squamous cell carcinoma migration also required ΔNp63α dependent FAT2 and Slug expression, demonstrating that ΔNp63α promotes migration in multiple tumor types by inducing mesenchymal and non-mesenchymal genes. ΔNp63α activation of FAT2 and Slug influenced E-cadherin localization to cell-cell contacts, which can restrict spontaneous cell movement. Moreover, live-imaging of spheroids in organotypic culture demonstrated that ΔNp63α, FAT2 and Slug were essential for the extension of cellular protrusions that initiate collective invasion. Importantly, ΔNp63α is co-expressed with FAT2 and Slug in patient tumors and the elevated expression of ΔNp63α, FAT2 and Slug correlated with poor patient outcome. Together, these results reveal how ΔNp63α promotes cell migration by directly inducing the expression of a cohort of genes with distinct cellular functions and suggest that FAT2 is a new regulator of collective invasion that may influence patient outcome. PMID:27081041

Data-driven prediction of adverse drug reactions induced by drug-drug interactions.

Science.gov (United States)

Liu, Ruifeng; AbdulHameed, Mohamed Diwan M; Kumar, Kamal; Yu, Xueping; Wallqvist, Anders; Reifman, Jaques

2017-06-08

The expanded use of multiple drugs has increased the occurrence of adverse drug reactions (ADRs) induced by drug-drug interactions (DDIs). However, such reactions are typically not observed in clinical drug-development studies because most of them focus on single-drug therapies. ADR reporting systems collect information on adverse health effects caused by both single drugs and DDIs. A major challenge is to unambiguously identify the effects caused by DDIs and to attribute them to specific drug interactions. A computational method that provides prospective predictions of potential DDI-induced ADRs will help to identify and mitigate these adverse health effects. We hypothesize that drug-protein interactions can be used as independent variables in predicting ADRs. We constructed drug pair-protein interaction profiles for ~800 drugs using drug-protein interaction information in the public domain. We then constructed statistical models to score drug pairs for their potential to induce ADRs based on drug pair-protein interaction profiles. We used extensive clinical database information to construct categorical prediction models for drug pairs that are likely to induce ADRs via synergistic DDIs and showed that model performance deteriorated only slightly, with a moderate amount of false positives and false negatives in the training samples, as evaluated by our cross-validation analysis. The cross validation calculations showed an average prediction accuracy of 89% across 1,096 ADR models that captured the deleterious effects of synergistic DDIs. Because the models rely on drug-protein interactions, we made predictions for pairwise combinations of 764 drugs that are currently on the market and for which drug-protein interaction information is available. These predictions are publicly accessible at http://avoid-db.bhsai.org . We used the predictive models to analyze broader aspects of DDI-induced ADRs, showing that ~10% of all combinations have the potential to induce ADRs

Prescription Drug Promotion from 2001-2014: Data from the U.S. Food and Drug Administration.

Directory of Open Access Journals (Sweden)

Helen W Sullivan

Full Text Available The volume of prescription drug promotion over time is often measured by assessing changes in ad spending. However, this method obscures the fact that some types of advertising are more expensive than others. Another way to measure the changes in prescription drug promotion over time is to assess the number of promotional pieces submitted to the U.S. Food and Drug Administration (FDA. Form FDA 2253 collects information such as the date submitted and the type of material submitted. We analyzed data from Forms FDA 2253 received from 2001-2014. We examined the frequency of submissions by audience (consumer and healthcare professional and type of promotional material. There was a noted increase in prescription drug promotion submissions across all media in the early 2000s. Although non-Internet promotion submissions have since plateaued, Internet promotion continued to increase. These results can help public health advocates and regulators focus attention and resources.

The role of the seven crude drug components in the sleep-promoting effect of Yokukansan.

Science.gov (United States)

Ogawa, Yuko; Fujii, Yuuko; Sugiyama, Reina; Konishi, Tenji

2016-01-11

Yokukansan is a traditional Japanese "Kampo" medicine derived from Yi-Gan San in traditional Chinese medicine. Many studies have been published on its effects and mechanisms. In this study, we focused on the sleep-promoting effects of Yokukansan. Yokukansan composes of seven crude drugs: Uncaria Hook, Bupleurm Root, Cnidium Rhizome, Japanese Angelica Root, Poria Sclerotium, Atractylodes Lancea Rhizome, and Glycyrrhiza. Although each has distinctive effects in isolation, they combine to work as a sleep aid in the Yokukansan formula. We examined the roles of the seven crude drug components in the sleep-promoting effect of Yokukansan. In this study, we used an easy in vivo assay method which we developed previously to screen sleeping substances using thermography. This assay method focuses on the decrease in skin temperature of mice during sleep inducement. By administering the crude drug components of Yokukansan one at a time, it was possible to separate them into two groups: those that caused a decrease in body temperature (Uncaria Hook, Bupleurm Root, Cnidium rhizome, and Japanese Angelica root) and those that did not (Poria Sclerotium, Atractylodes Lancea Rhizome, and Glycyrrhiza). Accordingly, it was thought that the crude drugs causing a drop in body temperature were responsible for promoting sleep, while those in the other group would have no such effect in isolation. To investigate whether the crude drugs that did not cause a decrease in body temperature might be unnecessary for the sleep-promoting effect of Yokukansan, a number of decoctions were prepared using only six of the seven crude drug components, excluding a different crude drug in each case. Results showed that when any of the three components (Poria Sclerotium, Atractylodes Lancea Rhizome, or Glycyrrhiza) of Yokukansan that had no effect on body temperature in isolation were removed from Yokukansan, the resulting extract no longer had any of Yokukansan's sleep-promoting effects. This result

Differences between Drug-Induced and Contrast Media-Induced Adverse Reactions Based on Spontaneously Reported Adverse Drug Reactions.

Science.gov (United States)

Ryu, JiHyeon; Lee, HeeYoung; Suh, JinUk; Yang, MyungSuk; Kang, WonKu; Kim, EunYoung

2015-01-01

We analyzed differences between spontaneously reported drug-induced (not including contrast media) and contrast media-induced adverse reactions. Adverse drug reactions reported by an in-hospital pharmacovigilance center (St. Mary's teaching hospital, Daejeon, Korea) from 2010-2012 were classified as drug-induced or contrast media-induced. Clinical patterns, frequency, causality, severity, Schumock and Thornton's preventability, and type A/B reactions were recorded. The trends among causality tools measuring drug and contrast-induced adverse reactions were analyzed. Of 1,335 reports, 636 drug-induced and contrast media-induced adverse reactions were identified. The prevalence of spontaneously reported adverse drug reaction-related admissions revealed a suspected adverse drug reaction-reporting rate of 20.9/100,000 (inpatient, 0.021%) and 3.9/100,000 (outpatients, 0.004%). The most common adverse drug reaction-associated drug classes included nervous system agents and anti-infectives. Dermatological and gastrointestinal adverse drug reactions were most frequently and similarly reported between drug and contrast media-induced adverse reactions. Compared to contrast media-induced adverse reactions, drug-induced adverse reactions were milder, more likely to be preventable (9.8% vs. 1.1%, p contrast media-induced adverse reactions (56.6%, p = 0.066). Causality patterns differed between the two adverse reaction classes. The World Health Organization-Uppsala Monitoring Centre causality evaluation and Naranjo algorithm results significantly differed from those of the Korean algorithm version II (p contrast media-induced adverse reactions. The World Health Organization-Uppsala Monitoring Centre and Naranjo algorithm causality evaluation afforded similar results.

Glycolysis inhibition inactivates ABC transporters to restore drug sensitivity in malignant cells.

Directory of Open Access Journals (Sweden)

Ayako Nakano

Full Text Available Cancer cells eventually acquire drug resistance largely via the aberrant expression of ATP-binding cassette (ABC transporters, ATP-dependent efflux pumps. Because cancer cells produce ATP mostly through glycolysis, in the present study we explored the effects of inhibiting glycolysis on the ABC transporter function and drug sensitivity of malignant cells. Inhibition of glycolysis by 3-bromopyruvate (3BrPA suppressed ATP production in malignant cells, and restored the retention of daunorubicin or mitoxantrone in ABC transporter-expressing, RPMI8226 (ABCG2, KG-1 (ABCB1 and HepG2 cells (ABCB1 and ABCG2. Interestingly, although side population (SP cells isolated from RPMI8226 cells exhibited higher levels of glycolysis with an increased expression of genes involved in the glycolytic pathway, 3BrPA abolished Hoechst 33342 exclusion in SP cells. 3BrPA also disrupted clonogenic capacity in malignant cell lines including RPMI8226, KG-1, and HepG2. Furthermore, 3BrPA restored cytotoxic effects of daunorubicin and doxorubicin on KG-1 and RPMI8226 cells, and markedly suppressed subcutaneous tumor growth in combination with doxorubicin in RPMI8226-implanted mice. These results collectively suggest that the inhibition of glycolysis is able to overcome drug resistance in ABC transporter-expressing malignant cells through the inactivation of ABC transporters and impairment of SP cells with enhanced glycolysis as well as clonogenic cells.

Pharmacogenetics of drug-induced arrhythmias

DEFF Research Database (Denmark)

De Bruin, Marie L; van Puijenbroek, Eugene P; Bracke, Madelon

2006-01-01

PURPOSE: The bottleneck in pharmacogenetic research on rare adverse drug reactions (ADR) is retrieval of patients. Spontaneous reports of ADRs may form a useful source of patients. We investigated the feasibility of a pharmacogenetic study, in which cases were selected from the database...... of a spontaneous reporting system for ADRs, using drug-induced arrhythmias as an example. METHODS: Reports of drug-induced arrhythmias to proarrhythmic drugs were selected from the database of the Netherlands Pharmacovigilance Centre (1996-2003). Information on the patient's general practitioner (GP) was obtained...... be included in the study, giving an overall participation rate of 9% (4/45). The main reason for GPs not being willing to participate was lack of time. Variants were identified in KCNH2, SCN5A and KCNE1. CONCLUSIONS: Spontaneous reporting systems for ADRs may be used for pharmacogenetic research. The methods...

Drug-induced hair loss.

Science.gov (United States)

2016-05-01

Hair loss can have major psychological consequences. It can be due to a wide variety of causes, including hormonal disorders, dietary factors, infections, inflammation, trauma, emotional factors, and cancer. Drugs can also induce hair loss, by interacting with the hair growth cycle. Drug-induced hair loss may be immediate or delayed, sudden or gradual, and diffuse or localised. It is usually reversible after drug discontinuation. The drugs most often implicated in hair loss are anticancer agents, interferon, azole antifungals, lithium, immunosuppressants, and many other drugs belonging to a variety of pharmacological classes.

Drug-induced apnea.

Science.gov (United States)

Boutroy, M J

1994-01-01

Drugs have been in the past and will in the future still be liable to induce apnea in neonates, infants and older children. At these different stages of development, the child may be abnormally vulnerable to respiratory disorders and apnea, and doses of drugs, without any abnormal side effects in adult patients, can be harmful in younger subjects. Drugs responsible for apnea during development are numerous, but more than half of the problems are induced by sedatives and hypnotics, among which phenothiazines, barbiturates, benzodiazepines (included transplacentally acquired) and general anesthetics are a few. Other pharmacological families are apnea inducers in the neonatal period and childhood: analgesics and opioid narcotics, agents acting at the levels of neuromuscular function and autonomic ganglia, and cardiovascular agents. The pathogenesis of these apneas depends on the disturbance of any mechanism responsible for the respiratory activity: medullary centers and brain stem structures, afferent influx to CNS, sleep stages, upper airways, lungs and respiratory muscles. At key stages such as birth and infancy, drugs may emphasize the particular sensitivity of the mechanisms responsible for inducing apnea. This might explain unexpected respiratory disorders during development.

Unwarranted claims of drug efficacy in pharmaceutical sales visits: are drugs approved on the basis of surrogate outcomes promoted appropriately?

Science.gov (United States)

Habibi, Roojin; Lexchin, Joel; Mintzes, Barbara; Holbrook, Anne

2017-11-01

This study compares physicians' recall of the claims of benefits on cardiovascular disease and diabetes made by pharmaceutical sales representatives for drugs approved on the basis of a surrogate outcome, i.e., an off-label claim, compared with those approved on the basis of a serious morbidity or mortality (clinical) outcome. Physicians in primary care practices in Montreal, Vancouver, Sacramento and Toulouse, who saw sales representatives as part of their usual practice and served a non-referral population, were contacted in blocks of 25 from a randomized list of all physicians practising in the relevant metropolitan area. We compared how frequently physicians reported that sales reps made claims of serious morbidity or mortality (clinically meaningful) benefits for drugs approved on the basis of surrogate outcomes vs. drugs approved on the basis of clinical outcomes. There were 448 promotions for 58 unique brand name cardiovascular and diabetes drugs. Claims of clinically meaningful benefit were reported in 156 (45%) of the 347 promotions for surrogate outcome drugs, constituting unwarranted efficacy claims, i.e., off-label promotion. Claims of clinical benefit were reported in 72 of the 101 promotions (71%) for drugs approved on the basis of clinical outcomes, adjusted OR = 0.3 (95% CI 0.2, 0.6), P sales visit promotions for drugs approved only on the basis of surrogate outcomes extended beyond the regulator-approved efficacy information for the product in almost half of promotions. Unapproved claims of drug efficacy constitute a form of off-label promotion and merit greater attention from regulators. © 2017 The British Pharmacological Society.

Genetic polymorphisms of N-acetyltransferase 2 & susceptibility to antituberculosis drug-induced hepatotoxicity

Directory of Open Access Journals (Sweden)

Surendra K Sharma

2016-01-01

Full Text Available Background & objectives: The N-acetyltransferase 2 (NAT2 gene encodes an enzyme which both activates and deactivates arylamine and other drugs and carcinogens. This study was aimed to investigate the role of NAT2 gene polymorphism in anti-tuberculosis drug-induced hepatotoxicity (DIH. Methods: In this prospective study, polymerase chain reaction-restriction fragment length polymorphism results for NAT2 gene were compared between 185 tuberculosis patients who did not develop DIH and 105 tuberculosis patients who developed DIH while on anti-tuberculosis drugs. Results: Frequency of slow-acetylator genotype was commonly encountered and was not significantly different between DIH (82.8% and non-DIH (77.2% patients. However, the genotypic distribution of variant NAT2FNx015/FNx017 amongst slow-acetylator genotypes was significantly higher in DIH (56% group as compared to non-DIH (39% group (odds ratio 2.02; P=0.006. Interpretation & conclusions: The present study demonstrated no association between NAT2 genotype and DIH in the north Indian patients with tuberculosis.

Drug-drug interactions with sodium-glucose cotransporters type 2 (SGLT2) inhibitors, new oral glucose-lowering agents for the management of type 2 diabetes mellitus.

Science.gov (United States)

Scheen, André J

2014-04-01

Inhibitors of sodium-glucose cotransporters type 2 (SGLT2) reduce hyperglycaemia by decreasing renal glucose threshold and thereby increasing urinary glucose excretion. They are proposed as a novel approach for the management of type 2 diabetes mellitus. They have proven their efficacy in reducing glycated haemoglobin, without inducing hypoglycaemia, as monotherapy or in combination with various other glucose-lowering agents, with the add-on value of promoting some weight loss and lowering arterial blood pressure. As they may be used concomitantly with many other drugs, we review the potential drug-drug interactions (DDIs) regarding the three leaders in the class (dapagliglozin, canagliflozin and empagliflozin). Most of the available studies were performed in healthy volunteers and have assessed the pharmacokinetic interferences with a single administration of the SGLT2 inhibitor. The exposure [assessed by peak plasma concentrations (Cmax) and area under the concentration-time curve (AUC)] to each SGLT2 inhibitor tested was not significantly influenced by the concomitant administration of other glucose-lowering agents or cardiovascular agents commonly used in patients with type 2 diabetes. Reciprocally, these medications did not influence the pharmacokinetic parameters of dapagliflozin, canagliflozin or empagliflozin. Some modest changes were not considered as clinically relevant. However, drugs that could specifically interfere with the metabolic pathways of SGLT2 inhibitors [rifampicin, inhibitors or inducers of uridine diphosphate-glucuronosyltransferase (UGT)] may result in significant changes in the exposure of SGLT2 inhibitors, as shown for dapagliflozin and canagliflozin. Potential DDIs in patients with type 2 diabetes receiving chronic treatment with an SGLT2 inhibitor deserve further attention, especially in individuals treated with several medications or in more fragile patients with hepatic and/or renal impairment.

Localization of the placental BCRP/ABCG2 transporter to lipid rafts: Role for cholesterol in mediating efflux activity.

Science.gov (United States)

Szilagyi, John T; Vetrano, Anna M; Laskin, Jeffrey D; Aleksunes, Lauren M

2017-07-01

The breast cancer resistance protein (BCRP/ABCG2) is an efflux transporter in the placental barrier. By transporting chemicals from the fetal to the maternal circulation, BCRP limits fetal exposure to a range of drugs, toxicants, and endobiotics such as bile acids and hormones. The purpose of the present studies was to 1) determine whether BCRP localizes to highly-ordered, cholesterol-rich lipid raft microdomains in placenta microvillous membranes, and 2) determine the impact of cholesterol on BCRP-mediated placental transport in vitro. BCRP expression was analyzed in lipid rafts isolated from placentas from healthy, term pregnancies and BeWo trophoblasts by density gradient ultracentrifugation. BeWo cells were also tested for their ability to efflux BCRP substrates after treatment with the cholesterol sequestrant methyl-β-cyclodextrin (MβCD, 5 mM, 1 h) or the cholesterol synthesis inhibitor pravastatin (200 μM, 48 h). BCRP was found to co-localize with lipid raft proteins in detergent-resistant, lipid raft-containing fractions from placental microvillous membranes and BeWo cells. Treatment of BeWo cells with MβCD redistributed BCRP protein into higher density non-lipid raft fractions. Repletion of the cells with cholesterol restored BCRP localization to lipid raft-containing fractions. Treatment of BeWo cells with MβCD or pravastatin increased cellular retention of two BCRP substrates, the fluorescent dye Hoechst 33342 and the mycotoxin zearalenone. Repletion with cholesterol restored BCRP transporter activity. Taken together, these data demonstrate that cholesterol may play a critical role in the post-translational regulation of BCRP in placental lipid rafts. Copyright © 2017 Elsevier Ltd. All rights reserved.

Genipin-induced inhibition of uncoupling protein-2 sensitizes drug-resistant cancer cells to cytotoxic agents.

Directory of Open Access Journals (Sweden)

Ryan J Mailloux

2010-10-01

Full Text Available Uncoupling protein-2 (UCP2 is known to suppress mitochondrial reactive oxygen species (ROS production and is employed by drug-resistant cancer cells to mitigate oxidative stress. Using the drug-sensitive HL-60 cells and the drug-resistant MX2 subline as model systems, we show that genipin, a UCP2 inhibitor, sensitizes drug-resistant cells to cytotoxic agents. Increased MX2 cell death was observed upon co-treatment with genipin and different doses of menadione, doxorubicin, and epirubicin. DCFH-DA fluorimetry revealed that the increase in MX2 cell death was accompanied by enhanced cellular ROS levels. The drug-induced increase in ROS was linked to genipin-mediated inhibition of mitochondrial proton leak. State 4 and resting cellular respiratory rates were higher in the MX2 cells in comparison to the HL-60 cells, and the increased respiration was readily suppressed by genipin in the MX2 cells. UCP2 accounted for a remarkable 37% of the resting cellular oxygen consumption indicating that the MX2 cells are functionally reliant on this protein. Higher amounts of UCP2 protein were detected in the MX2 versus the HL-60 mitochondria. The observed effects of genipin were absent in the HL-60 cells pointing to the selectivity of this natural product for drug-resistant cells. The specificity of genipin for UCP2 was confirmed using CHO cells stably expressing UCP2 in which genipin induced an ∼22% decrease in state 4 respiration. These effects were absent in empty vector CHO cells expressing no UCP2. Thus, the chemical inhibition of UCP2 with genipin sensitizes multidrug-resistant cancer cells to cytotoxic agents.

Do advertisements for antihypertensive drugs in Australia promote quality prescribing? A cross-sectional study

Directory of Open Access Journals (Sweden)

Spurling Geoffrey K

2008-05-01

advertisements (2.7% promoted the assessment of cardiovascular risk. Conclusion Print advertisements for antihypertensive medications in Australia provide some, but not all, of the key messages required for guideline-concordant care. These results have implications for the regulation of drug advertising and the continuing education of doctors.

Do advertisements for antihypertensive drugs in Australia promote quality prescribing? A cross-sectional study.

Science.gov (United States)

Montgomery, Brett D; Mansfield, Peter R; Spurling, Geoffrey K; Ward, Alison M

2008-05-20

Antihypertensive medications are widely prescribed by doctors and heavily promoted by the pharmaceutical industry. Despite strong evidence of the effectiveness and cost-effectiveness of thiazide diuretics, trends in both promotion and prescription of antihypertensive drugs favour newer, less cost-effective agents. Observational evidence shows correlations between exposure to pharmaceutical promotion and less ideal prescribing. Our study therefore aimed to determine whether print advertisements for antihypertensive medications promote quality prescribing in hypertension. We performed a cross-sectional study of 113 advertisements for antihypertensive drugs from 4 general practice-oriented Australian medical publications in 2004. Advertisements were evaluated using a quality checklist based on a review of hypertension management guidelines. Main outcome measures included: frequency with which antihypertensive classes were advertised, promotion of thiazide class drugs as first line agents, use of statistical claims in advertisements, mention of harms and prices in the advertisements, promotion of assessment and treatment of cardiovascular risk, promotion of lifestyle modification, and targeting of particular patient subgroups. Thiazides were the most frequently advertised drug class (48.7% of advertisements), but were largely promoted in combination preparations. The only thiazide advertised as a single agent was the most expensive, indapamide. No advertisement specifically promoted any thiazide as a better first-line drug. Statistics in the advertisements tended to be expressed in relative rather than absolute terms. Drug costs were often reported, but without cost comparisons between drugs. Adverse effects were usually reported but largely confined to the advertisements' small print. Other than mentioning drug interactions with alcohol and salt, no advertisements promoted lifestyle modification. Few advertisements (2.7%) promoted the assessment of cardiovascular risk

Direct-to-consumer promotion of prescription drugs. Economic implications for patients, payers and providers.

Science.gov (United States)

Findlay, S D

2001-01-01

Spending on outpatient prescription drugs in the US is accelerating rapidly. Although numerous factors are driving this trend, attention has recently focused on the role played by the marketing, promotion and advertising of pharmaceuticals, in particular direct-to-consumer (DTC) advertising. In 1997, the US Food and Drug Administration (FDA) issued a 'guidance' on such mass media promotion. The guidance altered existing FDA rules and effectively permitted pharmaceutical companies to promote prescription drugs on television and radio without giving detailed or even summary information on indications, efficacy or potential adverse effects. Since then, television commercials, in particular, and print advertisements in consumer magazines and newspapers have proliferated rapidly. Pharmaceutical companies spent $US1.8 billion on DTC advertising in 1999, a 40% increase over 1998. This spending in 1999 was heavily concentrated on about 50 drugs. Evidence is growing that DTC promotion of prescription drugs is: (i) alerting consumers to the existence of new drugs and the conditions they treat; (ii) increasing consumer demand for many drugs; (iii) contributing increasingly to the recent sharp increase in the number of prescriptions being dispensed; (iv) raising sales revenues; and, thus, (v) contributing to the higher pharmaceutical costs of health insurers, government and consumers. The public policy issues surrounding DTC advertisements centre on the following questions: (i) are the advertisements leading to the inappropriate clinical use of some drugs? (ii) are the advertisements inducing both consumers and physicians to choose more costly new brand-name drugs over less expensive, but equally effective, older brand or generic drugs? (iii) do television advertisements for prescription drugs contain a balanced amount of information on benefits versus potential adverse effects? and (iv) will the revenue benefits generated by DTC advertising cause pharmaceutical companies to

Drug-induced Inhibition and Trafficking Disruption of ion Channels: Pathogenesis of QT Abnormalities and Drug-induced Fatal Arrhythmias

Science.gov (United States)

Cubeddu, Luigi X.

2016-01-01

Risk of severe and fatal ventricular arrhythmias, presenting as Torsade de Pointes (TdP), is increased in congenital and acquired forms of long QT syndromes (LQTS). Drug-induced inhibition of K+ currents, IKs, IKr, IK1, and/or Ito, delay repolarization, prolong QT, and increase the risk of TdP. Drug-induced interference with IKr is the most common cause of acquired LQTS/TdP. Multiple drugs bind to KNCH2-hERG-K+ channels affecting IKr, including antiarrythmics, antibiotics, antivirals, azole-antifungals, antimalarials, anticancer, antiemetics, prokinetics, antipsychotics, and antidepressants. Azithromycin has been recently added to this list. In addition to direct channel inhibition, some drugs interfere with the traffic of channels from the endoplasmic reticulum to the cell membrane, decreasing mature channel membrane density; e.g., pentamidine, geldalamicin, arsenic trioxide, digoxin, and probucol. Other drugs, such as ketoconazole, fluoxetine, norfluoxetine, citalopram, escitalopram, donepezil, tamoxifen, endoxifen, atazanavir, and roxitromycin, induce both direct channel inhibition and impaired channel trafficking. Although many drugs prolong the QT interval, TdP is a rare event. The following conditions increase the risk of drug-induced TdP: a) Disease states/electrolyte levels (heart failure, structural cardiac disease, bradycardia, hypokalemia); b) Pharmacogenomic variables (presence of congenital LQTS, subclinical ion-channel mutations, history of or having a relative with history of drug-induced long QT/TdP); c) Pharmacodynamic and kinetic factors (high doses, women, elderly, metabolism inhibitors, combining two or more QT prolonging drugs, drugs that prolong the QT and increase QT dispersion, and drugs with multiple actions on ion channels). Because most of these conditions are preventable, careful evaluation of risk factors and increased knowledge of drug use associated with repolarization abnormalities are strongly recommended. PMID:26926294

[Association of ABCG2 gene C421A polymorphism and susceptibility of primary gout in Han Chinese males].

Science.gov (United States)

Li, Fa-gui; Chu, Yi; Meng, Dong-mei; Tong, Ya-wen

2011-12-01

To assess the association between a C421A single nucleotide polymorphism (SNP) in exon 5 of ATP-binding cassette, sub-family G (WHITE), member 2 (ABCG2) gene and susceptibility of primary gout in Han Chinese males. For 200 male patients with primary gout and 235 controls, the genotype of C421A locus was analyzed by PCR and direct sequencing. Blood glucose, uric acid, total cholesterol, triglycerides, creatinine and urea nitrogen was measured by an automatic biochemical analyzer. Compared with the controls, there was a higher frequency for AA genotype and A allele of the rs2231142 SNP in gout patients (22.5% vs. 8.5% by genotype; 44.9% vs. 32.3% by allele). The association with gout reached significance (chi-square =15.91, Pgout patients were significantly higher than those of controls (Pgout in Han Chinese males.

Mechanistic review of drug-induced steatohepatitis

International Nuclear Information System (INIS)

Schumacher, Justin D.; Guo, Grace L.

2015-01-01

Drug-induced steatohepatitis is a rare form of liver injury known to be caused by only a handful of compounds. These compounds stimulate the development of steatohepatitis through their toxicity to hepatocyte mitochondria; inhibition of beta-oxidation, mitochondrial respiration, and/or oxidative phosphorylation. Other mechanisms discussed include the disruption of phospholipid metabolism in lysosomes, prevention of lipid egress from hepatocytes, targeting mitochondrial DNA and topoisomerase, decreasing intestinal barrier function, activation of the adenosine pathway, increasing fatty acid synthesis, and sequestration of coenzyme A. It has been found that the majority of compounds that induce steatohepatitis have cationic amphiphilic structures; a lipophilic ring structure with a side chain containing a cationic secondary or tertiary amine. Within the last decade, the ability of many chemotherapeutics to cause steatohepatitis has become more evident coining the term chemotherapy-associated steatohepatitis (CASH). The mechanisms behind drug-induced steatohepatitis are discussed with a focus on cationic amphiphilic drugs and chemotherapeutic agents. - Highlights: • Reviewed the mechanisms underlying drug-induced steatohepatitis for many compounds • Mitochondrial dysfunction is critical in the development of drug-induced steatohepatitis. • Majority of drugs that induce steatohepatitis are cationic amphiphilic drugs. • Chemotherapeutics that induce CASH are cationic amphiphilic drugs. • Majority of drugs that induce steatohepatitis are carnitine palmitoyltransferase-I inhibitors.

Mechanistic review of drug-induced steatohepatitis

Energy Technology Data Exchange (ETDEWEB)

Schumacher, Justin D., E-mail: Justin.d.schumacher@rutgers.edu; Guo, Grace L.

2015-11-15

Drug-induced steatohepatitis is a rare form of liver injury known to be caused by only a handful of compounds. These compounds stimulate the development of steatohepatitis through their toxicity to hepatocyte mitochondria; inhibition of beta-oxidation, mitochondrial respiration, and/or oxidative phosphorylation. Other mechanisms discussed include the disruption of phospholipid metabolism in lysosomes, prevention of lipid egress from hepatocytes, targeting mitochondrial DNA and topoisomerase, decreasing intestinal barrier function, activation of the adenosine pathway, increasing fatty acid synthesis, and sequestration of coenzyme A. It has been found that the majority of compounds that induce steatohepatitis have cationic amphiphilic structures; a lipophilic ring structure with a side chain containing a cationic secondary or tertiary amine. Within the last decade, the ability of many chemotherapeutics to cause steatohepatitis has become more evident coining the term chemotherapy-associated steatohepatitis (CASH). The mechanisms behind drug-induced steatohepatitis are discussed with a focus on cationic amphiphilic drugs and chemotherapeutic agents. - Highlights: • Reviewed the mechanisms underlying drug-induced steatohepatitis for many compounds • Mitochondrial dysfunction is critical in the development of drug-induced steatohepatitis. • Majority of drugs that induce steatohepatitis are cationic amphiphilic drugs. • Chemotherapeutics that induce CASH are cationic amphiphilic drugs. • Majority of drugs that induce steatohepatitis are carnitine palmitoyltransferase-I inhibitors.

Genetic and functional identification of the likely causative variant for cholesterol gallstone disease at the ABCG5/8 lithogenic locus

DEFF Research Database (Denmark)

von Kampen, Oliver; Buch, Stephan; Nothnagel, Michael

2013-01-01

The sterolin locus (ABCG5/ABCG8) confers susceptibility for cholesterol gallstone disease in humans. Both the responsible variant and the molecular mechanism causing an increased incidence of gallstones in these patients have as yet not been identified. Genetic mapping utilized patient samples from...... Germany (2,808 cases, 2,089 controls), Chile (680 cases, 442 controls), Denmark (366 cases, 766 controls), India (247 cases, 224 controls), and China (280 cases, 244 controls). Analysis of allelic imbalance in complementary DNA (cDNA) samples from human liver (n = 22) was performed using pyrosequencing....... Transiently transfected HEK293 cells were used for [(3) H]-cholesterol export assays, analysis of protein expression, and localization of allelic constructs. Through fine mapping in German and Chilean samples, an ∼250 kB disease-associated interval could be defined for this locus. Lack of allelic imbalance...

Inhibition of c-Myc overcomes cytotoxic drug resistance in acute myeloid leukemia cells by promoting differentiation.

Directory of Open Access Journals (Sweden)

Xiao-Na Pan

Full Text Available Nowadays, drug resistance still represents a major obstacle to successful acute myeloid leukemia (AML treatment and the underlying mechanism is not fully elucidated. Here, we found that high expression of c-Myc was one of the cytogenetic characteristics in the drug-resistant leukemic cells. c-Myc over-expression in leukemic cells induced resistance to chemotherapeutic drugs, enhanced colony formation capacity and inhibited cell differentiation induced by all-trans retinoic acid (ATRA. Meanwhile, inhibition of c-Myc by shRNA or specific c-Myc inhibitor 10058-F4 rescued the sensitivity to cytotoxic drugs, restrained the colony formation ability and promoted differentiation. RT-PCR and western blotting analysis showed that down-regulation of C/EBPβ contributed to the poor differentiation state of leukemic cells induced by c-Myc over-expression. Importantly, over-expression of C/EBPβ could reverse c-Myc induced drug resistance. In primary AML cells, the c-Myc expression was negatively correlated with C/EBPβ. 10058-F4, displayed anti-proliferative activity and increased cellular differentiation with up-regulation of C/EBPβ in primary AML cells. Thus, our study indicated that c-Myc could be a novel target to overcome drug resistance, providing a new approach in AML therapy.

Neuropeptide Y induces potent migration of human immature dendritic cells and promotes a Th2 polarization.

Science.gov (United States)

Buttari, Brigitta; Profumo, Elisabetta; Domenici, Giacomo; Tagliani, Angela; Ippoliti, Flora; Bonini, Sergio; Businaro, Rita; Elenkov, Ilia; Riganò, Rachele

2014-07-01

Neuropeptide Y (NPY), a major autonomic nervous system and stress mediator, is emerging as an important regulator of inflammation, implicated in autoimmunity, asthma, atherosclerosis, and cancer. Yet the role of NPY in regulating phenotype and functions of dendritic cells (DCs), the professional antigen-presenting cells, remains undefined. Here we investigated whether NPY could induce DCs to migrate, mature, and polarize naive T lymphocytes. We found that NPY induced a dose-dependent migration of human monocyte-derived immature DCs through the engagement of NPY Y1 receptor and the activation of ERK and p38 mitogen-activated protein kinases. NPY promoted DC adhesion to endothelial cells and transendothelial migration. It failed to induce phenotypic DC maturation, whereas it conferred a T helper 2 (Th2) polarizing profile to DCs through the up-regulation of interleukin (IL)-6 and IL-10 production. Thus, during an immune/inflammatory response NPY may exert proinflammatory effects through the recruitment of immature DCs, but it may exert antiinflammatory effects by promoting a Th2 polarization. Locally, at inflammatory sites, cell recruitment could be amplified in conditions of intense acute, chronic, or cold stress. Thus, altered or amplified signaling through the NPY-NPY-Y1 receptor-DC axis may have implications for the development of inflammatory conditions.-Buttari, B., Profumo, E., Domenici, G., Tagliani, A., Ippoliti, F., Bonini, S., Businaro, R., Elenkov, I., Riganò, R. Neuropeptide Y induces potent migration of human immature dendritic cells and promotes a Th2 polarization. © FASEB.

MicroRNA-27a Is Induced by Leucine and Contributes to Leucine-Induced Proliferation Promotion in C2C12 Cells

Directory of Open Access Journals (Sweden)

Guangmang Liu

2013-07-01

Full Text Available Leucine, a branched chain amino acid, is well known to stimulate protein synthesis in skeletal muscle. However, the role of leucine in myoblast proliferation remains unclear. In this study, we found that leucine could promote proliferation of C2C12 cells. Moreover, expressions of miR-27a and myostatin (a bona fide target of miR-27a were upregulated and downregulated, respectively, following leucine treatment. We also found that miR-27a loss-of-function by transfection of a miR-27a inhibitor suppressed the promotion of myoblast proliferation caused by leucine. Our results suggest that miR-27a is induced by leucine and contributes to leucine-induced proliferation promotion of myoblast.

Uninterrupted monitoring of drug effects in human-induced pluripotent stem cell-derived cardiomyocytes with bioluminescence Ca2+ microscopy.

Science.gov (United States)

Suzuki, Kazushi; Onishi, Takahito; Nakada, Chieko; Takei, Shunsuke; Daniels, Matthew J; Nakano, Masahiro; Matsuda, Tomoki; Nagai, Takeharu

2018-05-18

Cardiomyocytes derived from human-induced pluripotent stem cells are a powerful platform for high-throughput drug screening in vitro. However, current modalities for drug testing, such as electrophysiology and fluorescence imaging have inherent drawbacks. To circumvent these problems, we report the development of a bioluminescent Ca 2+ indicator GmNL(Ca 2+ ), and its application in a customized microscope for high-throughput drug screening. GmNL(Ca 2+ ) gives a 140% signal change with Ca 2+ , and can image drug-induced changes of Ca 2+ dynamics in cultured cells. Since bioluminescence requires application of a chemical substrate, which is consumed over ~ 30 min we made a dedicated microscope with automated drug dispensing inside a light-tight box, to control drug addition. To overcome thermal instability of the luminescent substrate, or small molecule, dual climate control enables distinct temperature settings in the drug reservoir and the biological sample. By combining GmNL(Ca 2+ ) with this adaptation, we could image spontaneous Ca 2+ transients in cultured cardiomyocytes and phenotype their response to well-known drugs without accessing the sample directly. In addition, the bioluminescent strategy demonstrates minimal perturbation of contractile parameters and long-term observation attributable to lack of phototoxicity and photobleaching. Overall, bioluminescence may enable more accurate drug screening in a high-throughput manner.

Lack of Abcg1 results in decreased plasma HDL cholesterol levels and increased biliary cholesterol secretion in mice fed a high cholesterol diet

NARCIS (Netherlands)

Wiersma, Harmen; Nijstad, Niels; de Boer, Jan Freark; Out, Ruud; Hogewerf, Wytse; Van Berkel, Theo J.; Kuipers, Folkert; Tietge, Uwe J. F.

Objective: The ATP Binding Cassette transporter G1 (ABCG1) has been implicated in cholesterol efflux towards HDL and reverse cholesterol transport (RCT). Biliary cholesterol secretion is considered as an important step in RCT. The aim of the present study was to determine the consequences of Abcg1

The necrosome promotes pancreatic oncogenesis via CXCL1 and Mincle-induced immune suppression.

Science.gov (United States)

Seifert, Lena; Werba, Gregor; Tiwari, Shaun; Giao Ly, Nancy Ngoc; Alothman, Sara; Alqunaibit, Dalia; Avanzi, Antonina; Barilla, Rocky; Daley, Donnele; Greco, Stephanie H; Torres-Hernandez, Alejandro; Pergamo, Matthew; Ochi, Atsuo; Zambirinis, Constantinos P; Pansari, Mridul; Rendon, Mauricio; Tippens, Daniel; Hundeyin, Mautin; Mani, Vishnu R; Hajdu, Cristina; Engle, Dannielle; Miller, George

2016-04-14

Neoplastic pancreatic epithelial cells are believed to die through caspase 8-dependent apoptotic cell death, and chemotherapy is thought to promote tumour apoptosis. Conversely, cancer cells often disrupt apoptosis to survive. Another type of programmed cell death is necroptosis (programmed necrosis), but its role in pancreatic ductal adenocarcinoma (PDA) is unclear. There are many potential inducers of necroptosis in PDA, including ligation of tumour necrosis factor receptor 1 (TNFR1), CD95, TNF-related apoptosis-inducing ligand (TRAIL) receptors, Toll-like receptors, reactive oxygen species, and chemotherapeutic drugs. Here we report that the principal components of the necrosome, receptor-interacting protein (RIP)1 and RIP3, are highly expressed in PDA and are further upregulated by the chemotherapy drug gemcitabine. Blockade of the necrosome in vitro promoted cancer cell proliferation and induced an aggressive oncogenic phenotype. By contrast, in vivo deletion of RIP3 or inhibition of RIP1 protected against oncogenic progression in mice and was associated with the development of a highly immunogenic myeloid and T cell infiltrate. The immune-suppressive tumour microenvironment associated with intact RIP1/RIP3 signalling depended in part on necroptosis-induced expression of the chemokine attractant CXCL1, and CXCL1 blockade protected against PDA. Moreover, cytoplasmic SAP130 (a subunit of the histone deacetylase complex) was expressed in PDA in a RIP1/RIP3-dependent manner, and Mincle--its cognate receptor--was upregulated in tumour-infiltrating myeloid cells. Ligation of Mincle by SAP130 promoted oncogenesis, whereas deletion of Mincle protected against oncogenesis and phenocopied the immunogenic reprogramming of the tumour microenvironment that was induced by RIP3 deletion. Cellular depletion suggested that whereas inhibitory macrophages promote tumorigenesis in PDA, they lose their immune-suppressive effects when RIP3 or Mincle is deleted. Accordingly, T cells

Coffee induces breast cancer resistance protein expression in Caco-2 cells.

Science.gov (United States)

Isshiki, Marina; Umezawa, Kazuo; Tamura, Hiroomi

2011-01-01

Coffee is a beverage that is consumed world-wide on a daily basis and is known to induce a series of metabolic and pharmacological effects, especially in the digestive tract. However, little is known concerning the effects of coffee on transporters in the gastrointestinal tract. To elucidate the effect of coffee on intestinal transporters, we investigated its effect on expression of the breast cancer resistance protein (BCRP/ABCG2) in a human colorectal cancer cell line, Caco-2. Coffee induced BCRP gene expression in Caco-2 cells in a coffee-dose dependent manner. Coffee treatment of Caco-2 cells also increased the level of BCRP protein, which corresponded to induction of gene expression, and also increased cellular efflux activity, as judged by Hoechst33342 accumulation. None of the major constituents of coffee tested could induce BCRP gene expression. The constituent of coffee that mediated this induction was extractable with ethyl acetate and was produced during the roasting process. Dehydromethylepoxyquinomicin (DHMEQ), an inhibitor of nuclear factor (NF)-κB, inhibited coffee-mediated induction of BCRP gene expression, suggesting involvement of NF-κB in this induction. Our data suggest that daily consumption of coffee might induce BCRP expression in the gastrointestinal tract and may affect the bioavailability of BCRP substrates.

Inflammation induced mTORC2-Akt-mTORC1 signaling promotes macrophage foam cell formation.

Science.gov (United States)

Banerjee, Dipanjan; Sinha, Archana; Saikia, Sudeshna; Gogoi, Bhaskarjyoti; Rathore, Arvind K; Das, Anindhya Sundar; Pal, Durba; Buragohain, Alak K; Dasgupta, Suman

2018-06-05

The transformation of macrophages into lipid loaded foam cells is a critical and early event in the pathogenesis of atherosclerosis. Several recent reports highlighted that induction of TLR4 signaling promotes macrophage foam cell formation; however, the underlying molecular mechanisms have not been clearly elucidated. Here, we found that the TLR4 mediated inflammatory signaling communicated with mTORC2-Akt-mTORC1 metabolic cascade in macrophage and thereby promoting lipid uptake and foam cell formation. Mechanistically, LPS treatment markedly upregulates TLR4 mediated inflammatory pathway which by activating mTORC2 induces Akt phosphorylation at serine 473 and that aggravate mTORC1 dependent scavenger receptors expression and consequent lipid accumulation in THP-1 macrophages. Inhibition of mTORC2 either by silencing Rictor expression or inhibiting its association with mTOR notably prevents LPS induced Akt activation, scavenger receptors expression and macrophage lipid accumulation. Although suppression of mTORC1 expression by genetic knockdown of Raptor did not produce any significant change in Akt S473 phosphorylation, however, incubation with Akt activator in Rictor silenced cells failed to promote scavenger receptors expression and macrophage foam cell formation. Thus, present research explored the signaling pathway involved in inflammation induced macrophage foam cells formation and therefore, targeting this pathway might be useful for preventing macrophage foam cell formation. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Factors affecting drug-induced liver injury: antithyroid drugs as instances

Directory of Open Access Journals (Sweden)

Reza Heidari

2014-09-01

Full Text Available Methimazole and propylthiouracil have been used in the management of hyperthyroidism for more than half a century. However, hepatotoxicity is one of the most deleterious side effects associated with these medications. The mechanism(s of hepatic injury induced by antithyroid agents is not fully recognized yet. Furthermore, there are no specific tools for predicting the occurrence of hepatotoxicity induced by these drugs. The purpose of this article is to give an overview on possible susceptibility factors in liver injury induced by antithyroid agents. Age, gender, metabolism characteristics, alcohol consumption, underlying diseases, immunologic mechanisms, and drug interactions are involved in enhancing antithyroid drugs-induced hepatic damage. An outline on the clinically used treatments for antithyroid drugs-induced hepatotoxicity and the potential therapeutic strategies found to be effective against this complication are also discussed.

[Drug-promoting advertisements in the Dutch Journal of Medicine and Pharmaceutical Weekly: not always evidence based].

Science.gov (United States)

van Eeden, Annelies E; Roach, Rachel E J; Halbesma, Nynke; Dekker, Friedo W

2012-01-01

To determine and compare the foundation of claims in drug-promoting advertisements in a Dutch journal for physicians and a Dutch journal for pharmacists. A cross-sectional study. We included all the drug-promoting advertisements referring to a randomized controlled trial (RCT) we could find on Medline from 2 volumes of the Dutch Journal of Medicine (Nederlands Tijdschrift voor Geneeskunde; NTvG) and the (also Dutch) Pharmaceutical Weekly (Pharmaceutisch Weekblad; PW). The validity of the advertisements (n = 54) and the methodological quality of the referenced RCTs (n = 150) were independently scored by 250 medical students using 2 standardised questionnaires. The advertisements' sources were concealed from the students. Per journal, the percentage of drug-promoting advertisements having a valid claim and the percentage of high-quality RCT references were determined. Average scores on quality and validity were compared between the 2 journals. On a scale of 0-18 points, the mean quality scores of the RCTs differed 0.3 (95% CI: -0.1-0.7) between the NTvG (score: 14.8; SD: 2.2) and the PW (score: 14.5; SD: 2.6). The difference between the validity scores of drug-promoting advertisements in the NTvG (score: 5.8; SD: 3.3) and the PW (score: 5.6; SD: 3.6) was 0.3 (95% CI: -0.3-0.9) on a scale of 0-10 points. For both journals, an average of 15% of drug-promoting advertisements was valid (defined as a validity score of > 8 points); 35% of the RCTs referred to was of good methodological quality (defined as a quality score of > 16 points). The substantiation of many claims in drug-promoting advertisements in the NTvG and the PW was mediocre. There was no difference between the 2 journals.

Future Challenges and Opportunities in Online Prescription Drug Promotion Research Comment on "Trouble Spots in Online Direct-to-Consumer Prescription Drug Promotion: A Content Analysis of FDA Warning Letters".

Science.gov (United States)

Southwell, Brian G; Rupert, Douglas J

2016-01-16

Despite increased availability of online promotional tools for prescription drug marketers, evidence on online prescription drug promotion is far from settled or conclusive. We highlight ways in which online prescription drug promotion is similar to conventional broadcast and print advertising and ways in which it differs. We also highlight five key areas for future research: branded drug website influence on consumer knowledge and behavior, interactive features on branded drug websites, mobile viewing of branded websites and mobile advertisements, online promotion and non-US audiences, and social media and medication decisions. © 2016 by Kerman University of Medical Sciences.

Association of Functional Polymorphism rs2231142 (Q141K) in the ABCG2 Gene With Serum Uric Acid and Gout in 4 US Populations

Science.gov (United States)

Zhang, Lili; Spencer, Kylee L.; Voruganti, V. Saroja; Jorgensen, Neal W.; Fornage, Myriam; Best, Lyle G.; Brown-Gentry, Kristin D.; Cole, Shelley A.; Crawford, Dana C.; Deelman, Ewa; Franceschini, Nora; Gaffo, Angelo L.; Glenn, Kimberly R.; Heiss, Gerardo; Jenny, Nancy S.; Kottgen, Anna; Li, Qiong; Liu, Kiang; Matise, Tara C.; North, Kari E.; Umans, Jason G.; Kao, W. H. Linda

2013-01-01

A loss-of-function mutation (Q141K, rs2231142) in the ATP-binding cassette, subfamily G, member 2 gene (ABCG2) has been shown to be associated with serum uric acid levels and gout in Asians, Europeans, and European and African Americans; however, less is known about these associations in other populations. Rs2231142 was genotyped in 22,734 European Americans, 9,720 African Americans, 3,849 Mexican Americans, and 3,550 American Indians in the Population Architecture using Genomics and Epidemiology (PAGE) Study (2008–2012). Rs2231142 was significantly associated with serum uric acid levels (P = 2.37 × 10−67, P = 3.98 × 10−5, P = 6.97 × 10−9, and P = 5.33 × 10−4 in European Americans, African Americans, Mexican Americans, and American Indians, respectively) and gout (P = 2.83 × 10−10, P = 0.01, and P = 0.01 in European Americans, African Americans, and Mexican Americans, respectively). Overall, the T allele was associated with a 0.24-mg/dL increase in serum uric acid level (P = 1.37 × 10−80) and a 1.75-fold increase in the odds of gout (P = 1.09 × 10−12). The association between rs2231142 and serum uric acid was significantly stronger in men, postmenopausal women, and hormone therapy users compared with their counterparts. The association with gout was also significantly stronger in men than in women. These results highlight a possible role of sex hormones in the regulation of ABCG2 urate transporter and its potential implications for the prevention, diagnosis, and treatment of hyperuricemia and gout. PMID:23552988

Cytochrome P450 2E1 gene polymorphisms/haplotypes and anti-tuberculosis drug-induced hepatitis in a Chinese cohort.

Directory of Open Access Journals (Sweden)

Shaowen Tang

Full Text Available The pathogenic mechanism of anti-tuberculosis (anti-TB drug-induced hepatitis is associated with drug metabolizing enzymes. No tagging single-nucleotide polymorphisms (tSNPs of cytochrome P450 2E1(CYP2E1 in the risk of anti-TB drug-induced hepatitis have been reported. The present study was aimed at exploring the role of tSNPs in CYP2E1 gene in a population-based anti-TB treatment cohort.A nested case-control study was designed. Each hepatitis case was 14 matched with controls by age, gender, treatment history, disease severity and drug dosage. The tSNPs were selected by using Haploview 4.2 based on the HapMap database of Han Chinese in Beijing, and detected by using TaqMan allelic discrimination technology.Eighty-nine anti-TB drug-induced hepatitis cases and 356 controls were included in this study. 6 tSNPs (rs2031920, rs2070672, rs915908, rs8192775, rs2515641, rs2515644 were genotyped and minor allele frequencies of these tSNPs were 21.9%, 23.0%, 19.1%, 23.6%, 20.8% and 44.4% in the cases and 20.9%, 22.7%, 18.9%, 23.2%, 18.2% and 43.2% in the controls, respectively. No significant difference was observed in genotypes or allele frequencies of the 6 tSNPs between case group and control group, and neither of haplotypes in block 1 nor in block 2 was significantly associated with the development of hepatitis.Based on the Chinese anti-TB treatment cohort, we did not find a statistically significant association between genetic polymorphisms of CYP2E1 and the risk of anti-TB drug-induced hepatitis. None of the haplotypes showed a significant association with the development of hepatitis in Chinese TB population.

Drug-induced cholestasis: mechanisms, models, and markers.

Science.gov (United States)

Chatterjee, Sagnik; Annaert, Pieter

2018-04-27

Drug-induced cholestasis is a risk factor in progression of drug candidates, and poses serious health hazard if not detected before going into human. Intrahepatic accumulation of bile acids (BAs) represents a characteristic phenomenon associated with drug-induced cholestasis. The major challenges in obtaining a complete understanding of drug-induced cholestasis lies in the complexity of BA-mediated toxicity mechanisms and the impact of bile acids at different 'targets' such as transporters, enzymes and nuclear receptors. At the same time, it is not trivial to have a relevant in vitro system that recapitulates these features. In addition, lack of sensitive and early preclinical biomarkers, relevant to the clinical situation, complicates proper detection of drug-induced cholestasis. Significant overlap in biomarker signatures between different mechanisms of drug-induced liver injury (DILI) precludes identification of specific mechanisms. Over the last decade the knowledge gaps in drug-induced cholestasis are closing due to growing mechanistic understanding of BA-mediated toxicity at (patho)physiologically relevant BA concentrations. Significant progress has been made in the mechanistic understanding of drug-induced cholestasis and associated toxicity, biomarkers and susceptibility factors. In addition, novel in vitro models are evolving which provide a holistic understanding of processes underlying drug-induced cholestasis. This review summarizes the challenges and recent understandings about drug-induced cholestasis with a potential path forward. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

The wake-promoting drug Modafinil prevents motor impairment in sickness behavior induced by LPS in mice

DEFF Research Database (Denmark)

Zager, Adriano; Brandão, Wesley Nogueira; Margatho, Rafael Oliveira

2018-01-01

The wake-promoting drug Modafinil has been used for many years for treatment of Narcolepsy and Excessive Daytime Sleepiness, due to a dopamine-related psychostimulant action. Recent studies have indicated that Modafinil prevents neuroinflammation in animal models. Thus, the aim of the present stu...

Future Challenges and Opportunities in Online Prescription Drug Promotion Research; Comment on “Trouble Spots in Online Direct-to-Consumer Prescription Drug Promotion: A Content Analysis of FDA Warning Letters”

Directory of Open Access Journals (Sweden)

Brian G. Southwell

2016-03-01

Full Text Available Despite increased availability of online promotional tools for prescription drug marketers, evidence on online prescription drug promotion is far from settled or conclusive. We highlight ways in which online prescription drug promotion is similar to conventional broadcast and print advertising and ways in which it differs. We also highlight five key areas for future research: branded drug website influence on consumer knowledge and behavior, interactive features on branded drug websites, mobile viewing of branded websites and mobile advertisements, online promotion and non-US audiences, and social media and medication decisions.

Study of cancer-specific chimeric promoters induced by irradiation

International Nuclear Information System (INIS)

Xiong Jie; Zhou Yunfeng; Sun Wenjie; Wang Weifeng; Liao Zhengkai; Zhou Fuxiang; Xie Conghua

2010-01-01

Objective: To combine the radio-inducible CArG element with cancer-specific human telomerase reverse transcriptase (hTERT) gene promoter, and to construct the novel chimeric promoters. Methods: The synthetic hTERT promoters containing different number of radio-inducible CArG elements were constructed, and the activities of the promoters in the cancer cells (HeLa, A549, and MHCC97 cells) and nomal cells (hEL cells) were detected by using luciferase-reporter assays after the treatment of irradiation (a single or fractionated irradiation dose). Results: Synthetic promoter containing 6 repeated CArG units was better in radio-inducibility than any other promoters containing different number of CArG units, and nearly maximum levels obtained at 4-6 Gy. The very low activities of the chimeric promoters could be detected in normal hEL cells. A similar level of reporter gene expression was observed after 3 fractionated doses of 2 Gy compared with a single dose of 6 Gy in cancer cells. Conclusions: The cancer-specific chimeric promoter containing 6 CArG elements showes the best radio-response, and the chimeric promoter system has the potential in cancer gene therapy. (authors)

DNA of HeLa cells during caffeine-promoted recovery from X-ray induced G2 arrest

International Nuclear Information System (INIS)

Bases, R.; Mendez, F.; Liebeskind, D.; Elequin, F.; Neubort, S.

1980-01-01

Progression of X-irradiated HeLa cells from G2 arrest through mitosis was promoted by 1mM caffeine. Caffeine promoted the return from abnormally high levels of radiation-induced immunoreactivity to antinucleoside antibodies, which indicates persistent DNA strand separation, to the low levels normally found in G2. With caffeine, the irradiated cells progressed through mitosis, producing daughter cells with the normal G1 content of DNA. Without caffeine, the DNA content of individual radiation-arrested cells retained G2 values and the abnormally high levels of immunoreactivity to antinucleoside antibodies. (author)

Promotion of prescription drugs to consumers and providers, 2001-2010.

Directory of Open Access Journals (Sweden)

Rachel Kornfield

Full Text Available Pharmaceutical firms heavily promote their products and may have changed marketing strategies in response to reductions in new product approvals, restrictions on some forms of promotion, and the expanding role of biologic therapies.We used descriptive analyses of annual cross-sectional data from 2001 through 2010 to examine direct-to-consumer advertising (DTCA (Kantar Media and provider-targeted promotion (IMS Health and SDI, including: (1 inflation-adjusted total promotion spending ($ and percent of sales; (2 distribution by channel (consumer v. provider; and (3 provider specialty both for the industry as a whole and for top-selling biologic and small molecule therapies.Total promotion peaked in 2004 at US$36.1 billion (13.4% of sales. By 2010 it had declined to $27.7B (9.0% of sales. Between 2006 and 2010, similar declines were seen for promotion to providers and DTCA (both by 25%. DTCA's share of total promotion increased from 12% in 2002 to 18% in 2006, but then declined to 16% and remains highly concentrated. Number of products promoted to providers peaked in 2004 at over 3000, and then declined 20% by 2010. In contrast to top-selling small molecule therapies having an average of $370 million (8.8% of sales spent on promotion, top biologics were promoted less, with only $33 million (1.4% of sales spent per product. Little change occurred in the composition of promotion between primary care physicians and specialists from 2001-2010.These findings suggest that pharmaceutical companies have reduced promotion following changes in the pharmaceutical pipeline and patent expiry for several blockbuster drugs. Promotional strategies for biologic drugs differ substantially from small molecule therapies.

Promotion of prescription drugs to consumers and providers, 2001-2010.

Science.gov (United States)

Kornfield, Rachel; Donohue, Julie; Berndt, Ernst R; Alexander, G Caleb

2013-01-01

Pharmaceutical firms heavily promote their products and may have changed marketing strategies in response to reductions in new product approvals, restrictions on some forms of promotion, and the expanding role of biologic therapies. We used descriptive analyses of annual cross-sectional data from 2001 through 2010 to examine direct-to-consumer advertising (DTCA) (Kantar Media) and provider-targeted promotion (IMS Health and SDI), including: (1) inflation-adjusted total promotion spending ($ and percent of sales); (2) distribution by channel (consumer v. provider); and (3) provider specialty both for the industry as a whole and for top-selling biologic and small molecule therapies. Total promotion peaked in 2004 at US$36.1 billion (13.4% of sales). By 2010 it had declined to $27.7B (9.0% of sales). Between 2006 and 2010, similar declines were seen for promotion to providers and DTCA (both by 25%). DTCA's share of total promotion increased from 12% in 2002 to 18% in 2006, but then declined to 16% and remains highly concentrated. Number of products promoted to providers peaked in 2004 at over 3000, and then declined 20% by 2010. In contrast to top-selling small molecule therapies having an average of $370 million (8.8% of sales) spent on promotion, top biologics were promoted less, with only $33 million (1.4% of sales) spent per product. Little change occurred in the composition of promotion between primary care physicians and specialists from 2001-2010. These findings suggest that pharmaceutical companies have reduced promotion following changes in the pharmaceutical pipeline and patent expiry for several blockbuster drugs. Promotional strategies for biologic drugs differ substantially from small molecule therapies.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Energy Technology Data Exchange (ETDEWEB)

Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

2014-04-25

Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Trouble Spots in Online Direct-to-Consumer Prescription Drug Promotion: Teaching Drug Marketers How to Inform Better or Spin Better?

Science.gov (United States)

Doran, Evan

2016-01-01

Hyosun Kim’s report "Trouble Spots in Online Direct to Consumer Prescription Drug Promotion: A content Analysis of FDA Warning Letters" aims to teach marketers how to avoid breaching current Food and Drug Administration (FDA) guidelines in their online drug promotion. While Kim hopes to minimise the potential for online promotion to misinform consumers and the study is carefully conducted, teaching drug marketers how to avoid the common mistakes in online drug promotion is more likely to make marketers more adept at spinning information than appropriately balancing it PMID:27239884

Heat shock protein 27-derived atheroprotection involves reverse cholesterol transport that is dependent on GM-CSF to maintain ABCA1 and ABCG1 expression in ApoE-/- mice.

Science.gov (United States)

Pulakazhi Venu, Vivek Krishna; Adijiang, Ayinuer; Seibert, Tara; Chen, Yong-Xiang; Shi, Chunhua; Batulan, Zarah; O'Brien, Edward R

2017-06-01

Recently, we demonstrated that heat shock protein (HSP)-27 is protective against the development of experimental atherosclerosis, reducing plaque cholesterol content by more than 30%. Moreover, elevated HSP-27 levels are predictive of relative freedom from clinical cardiovascular events. HSP-27 signaling occurs via the activation of NF-κB, which induces a marked up-regulation in expression of granulocyte-monocyte colony-stimulating factor (GM-CSF), a cytokine that is known to alter ABC transporters involved in reverse cholesterol transport (RCT). Therefore, we hypothesized that HSP-27-derived GM-CSF has a potent role in impeding plaque formation by promoting macrophage RCT and sought to better characterize this pathway. Treatment of THP-1 cells, RAW-Blue cells, and primary macrophages with recombinant HSP-27 resulted in NF-κB activation via TLR-4 and was inhibited by various pharmacologic blockers of this pathway. Moreover, HSP-27-induced upregulation of GM-CSF expression was dependent on TLR-4 signaling. Recombinant (r)HSP-27 treatment of ApoE -/- female (but not male) mice for 4 wk yielded reductions in plaque area and cholesterol clefts of 33 and 47%, respectively, with no effect on GM-CSF -/- ApoE -/- mice. With 12 wk of rHSP-27 treatment, both female and male mice showed reductions in plaque burden (55 and 42%, respectively) and a 60% reduction in necrotic core area but no treatment effect in GM-CSF -/- ApoE -/- mice. In vitro functional studies revealed that HSP-27 enhanced the expression of ABCA1 and ABCG1, as well as facilitated cholesterol efflux in vitro by ∼10%. These novel findings establish a paradigm for HSP-27-mediated RCT and set the stage for the development of HSP-27 atheroprotective therapeutics.-Pulakazhi Venu, V. K., Adijiang, A., Seibert, T., Chen, Y.-X., Shi, C., Batulan, Z., O'Brien, E. R. Heat shock protein 27-derived atheroprotection involves reverse cholesterol transport that is dependent on GM-CSF to maintain ABCA1 and ABCG1

Dual effects of the PI3K inhibitor ZSTK474 on multidrug efflux pumps in resistant cancer cells.

Science.gov (United States)

Muthiah, Divya; Callaghan, Richard

2017-11-15

ZSTK474 is a potent phosphoinositide 3-kinase (PI3K) inhibitor that reduces cell proliferation via G 1 -arrest. However, there is little information on the susceptibility of this anticancer drug to resistance conferred by the multidrug pumps P-glycoprotein (ABCB1) and ABCG2. We have demonstrated that ZSTK474 generated cytotoxicity in cells over-expressing either pump with potency similar to that in drug sensitive cells. In addition, the co-administration of ZSTK474 with the cytotoxic anti-cancer drugs vinblastine and mitoxantrone caused a potentiated cytotoxic effect in both drug sensitive and efflux pump expressing cells. These observations suggest that ZSTK474 is unaffected by the presence of multidrug efflux pumps and may circumvent their activities. Indeed, ZSTK474 increased the cellular accumulation of calcein-AM and mitoxantrone in cells expressing ABCB1 and ABCG2, respectively. ZSTK474 treatment also resulted in reduced expression of both efflux pumps in multidrug resistant cancer cells. Measurement of ABCB1 or ABCG2 mRNA levels demonstrated that the reduction was not due to altered transcription. Similarly, inhibitor studies showed that the proteasomal degradation pathway for ABCB1 and the lysosomal route for ABCG2 degradation were unaffected by ZSTK474. Thus the mechanism underlying reduced ABCB1 and ABCG2 levels caused by ZSTK474 was due to a reduction in overall protein synthesis; a process influenced by the PI3K pathway. In summary, ZSTK474 is not susceptible to efflux by the resistance mediators ABCB1 and ABCG2. Moreover, it inhibits the drug transport function of the pumps and leads to a reduction in their cellular expression levels. Our observations demonstrate that ZSTK474 is a powerful anticancer drug. Copyright © 2017 Elsevier B.V. All rights reserved.

Trouble Spots in Online Direct-to-Consumer Prescription Drug Promotion: Teaching Drug Marketers How to Inform Better or Spin Better? Comment on "Trouble Spots in Online Direct-to-Consumer Prescription Drug Promotion: A Content Analysis of FDA Warning Letters".

Science.gov (United States)

Doran, Evan

2016-02-21

Hyosun Kim's report "Trouble Spots in Online Direct to Consumer Prescription Drug Promotion: A content Analysis of FDA Warning Letters" aims to teach marketers how to avoid breaching current Food and Drug Administration (FDA) guidelines in their online drug promotion. While Kim hopes to minimise the potential for online promotion to misinform consumers and the study is carefully conducted, teaching drug marketers how to avoid the common mistakes in online drug promotion is more likely to make marketers more adept at spinning information than appropriately balancing it. © 2016 by Kerman University of Medical Sciences.

Extra-Renal Elimination of Uric Acid via Intestinal Efflux Transporter BCRP/ABCG2

Science.gov (United States)

Hosomi, Atsushi; Nakanishi, Takeo; Fujita, Takuya; Tamai, Ikumi

2012-01-01

Urinary excretion accounts for two-thirds of total elimination of uric acid and the remainder is excreted in feces. However, the mechanism of extra-renal elimination is poorly understood. In the present study, we aimed to clarify the mechanism and the extent of elimination of uric acid through liver and intestine using oxonate-treated rats and Caco-2 cells as a model of human intestinal epithelium. In oxonate-treated rats, significant amounts of externally administered and endogenous uric acid were recovered in the intestinal lumen, while biliary excretion was minimal. Accordingly, direct intestinal secretion was thought to be a substantial contributor to extra-renal elimination of uric acid. Since human efflux transporter BCRP/ABCG2 accepts uric acid as a substrate and genetic polymorphism causing a decrease of BCRP activity is known to be associated with hyperuricemia and gout, the contribution of rBcrp to intestinal secretion was examined. rBcrp was confirmed to transport uric acid in a membrane vesicle study, and intestinal regional differences of expression of rBcrp mRNA were well correlated with uric acid secretory activity into the intestinal lumen. Bcrp1 knockout mice exhibited significantly decreased intestinal secretion and an increased plasma concentration of uric acid. Furthermore, a Bcrp inhibitor, elacridar, caused a decrease of intestinal secretion of uric acid. In Caco-2 cells, uric acid showed a polarized flux from the basolateral to apical side, and this flux was almost abolished in the presence of elacridar. These results demonstrate that BCRP contributes at least in part to the intestinal excretion of uric acid as extra-renal elimination pathway in humans and rats. PMID:22348008

Drug discovery for Duchenne muscular dystrophy via utrophin promoter activation screening.

Directory of Open Access Journals (Sweden)

Catherine Moorwood

Full Text Available Duchenne muscular dystrophy (DMD is a devastating muscle wasting disease caused by mutations in dystrophin, a muscle cytoskeletal protein. Utrophin is a homologue of dystrophin that can functionally compensate for its absence when expressed at increased levels in the myofibre, as shown by studies in dystrophin-deficient mice. Utrophin upregulation is therefore a promising therapeutic approach for DMD. The use of a small, drug-like molecule to achieve utrophin upregulation offers obvious advantages in terms of delivery and bioavailability. Furthermore, much of the time and expense involved in the development of a new drug can be eliminated by screening molecules that are already approved for clinical use.We developed and validated a cell-based, high-throughput screening assay for utrophin promoter activation, and used it to screen the Prestwick Chemical Library of marketed drugs and natural compounds. Initial screening produced 20 hit molecules, 14 of which exhibited dose-dependent activation of the utrophin promoter and were confirmed as hits. Independent validation demonstrated that one of these compounds, nabumetone, is able to upregulate endogenous utrophin mRNA and protein, in C2C12 muscle cells.We have developed a cell-based, high-throughput screening utrophin promoter assay. Using this assay, we identified and validated a utrophin promoter-activating drug, nabumetone, for which pharmacokinetics and safety in humans are already well described, and which represents a lead compound for utrophin upregulation as a therapy for DMD.

Prevention and Treatment of Vaginal Bleeding after Drug-induced Abortion by Yaoliuan Capsule and Its Effects on Menses Recovery

Institute of Scientific and Technical Information of China (English)

JIN Zhichun; HUANG Guangying

2005-01-01

Summary: In order to explore the effect of Yaoliuan capsule in the prevention and treatment of vaginal bleeding after drug-induced abortion and menses recovery after drug-induced abortion, 323 cases of gestation period ≤ 49 days and without contraindication, were divided randomly into study group (168 cases, taking Yaoliuan capsule) and control group (155 cases, taking placebo capsule). The results showed that in the study group, there were 161 cases (95.8 %) of complete abortion, 7 cases (4.2 %) of incomplete abortion; In the control group, there were 146 cases (94.2 %) of complete abortion, 6 cases (3.9 %) of incomplete abortion, 3 cases (1.9 %) of abortion failure. The vaginal bleeding time was 5-25 days (mean 10.8 days) in study group, while that was 6-62 days (mean 19.1 days) in control group. The menstrual cycle was 30.5±5.2 days and 33.8 d±8.6 days respectively in study and control groups. The menstrual period was 6.1±3.5 days and 9.9±5.1 days respectively in study and control groups. Yaoliuan capsule is an effective drug to prevent and treat vaginal bleeding following drug-induced abortion, promote menstruation recovery and prevent pelvic infection.

Drug-induced cutaneous lupus erythematosus

DEFF Research Database (Denmark)

Laurinaviciene, Rasa; Holm Sandholdt, Linda; Bygum, Anette

2017-01-01

BACKGROUND: An increasing number of drugs have been linked to drug-induced subacute cutaneous lupus erythematosus (DI-SCLE). The recognition and management of DI-SCLE can be challenging, as the condition may be triggered by different classes of drugs after variable lengths of time. OBJECTIVES......: To determine the proportion of patients with cutaneous lupus erythematosus (CLE) whose drugs are an inducing or aggravating factor. MATERIALS & METHODS: We conducted a retrospective chart review of patients diagnosed with CLE at a dermatological department over a 21-year period. We registered clinical......, serological, and histological data with a focus on drug intake. RESULTS: Of 775 consecutive patients with a diagnosis of lupus erythematosus (LE) or suspected LE, a diagnosis of CLE could be confirmed in 448 patients. A total of 130 patients had a drug intake that could suggest DI-SCLE. In 88 cases, a drug...

Adverse drug reactions induced by cardiovascular drugs in outpatients.

Science.gov (United States)

Gholami, Kheirollah; Ziaie, Shadi; Shalviri, Gloria

2008-01-01

Considering increased use of cardiovascular drugs and limitations in pre-marketing trials for drug safety evaluation, post marketing evaluation of adverse drug reactions (ADRs) induced by this class of medicinal products seems necessary. To determine the rate and seriousness of adverse reactions induced by cardiovascular drugs in outpatients. To compare sex and different age groups in developing ADRs with cardiovascular agents. To assess the relationship between frequencies of ADRs and the number of drugs used. This cross-sectional study was done in cardiovascular clinic at a teaching hospital. All patients during an eight months period were evaluated for cardiovascular drugs induced ADRs. Patient and reaction factors were analyzed in detected ADRs. Patients with or without ADRs were compared in sex and age by using chi-square test. Assessing the relationship between frequencies of ADRs and the number of drugs used was done by using Pearson analysis. The total number of 518 patients was visited at the clinic. ADRs were detected in 105 (20.3%) patients. The most frequent ADRs were occurred in the age group of 51-60. The highest rate of ADRs was recorded to be induced by Diltiazem (23.5%) and the lowest rate with Atenolol (3%). Headache was the most frequent detected ADR (23%). Assessing the severity and preventability of ADRs revealed that 1.1% of ADRs were detected as severe and 1.9% as preventable reactions. Women significantly developed more ADRs in this study (chi square = 3.978, PPearson=0.259, P<0.05). Monitoring ADRs in patients using cardiovascular drugs is a matter of importance since this class of medicines is usually used by elderly patients with critical conditions and underlying diseases.

Drug-drug interaction of microdose and regular-dose omeprazole with a CYP2C19 inhibitor and inducer.

Science.gov (United States)

Park, Gab-Jin; Bae, Soo Hyeon; Park, Wan-Su; Han, Seunghoon; Park, Min-Ho; Shin, Seok-Ho; Shin, Young G; Yim, Dong-Seok

2017-01-01

A microdose drug-drug interaction (DDI) study may be a valuable tool for anticipating drug interaction at therapeutic doses. This study aimed to compare the magnitude of DDIs at microdoses and regular doses to explore the applicability of a microdose DDI study. Six healthy male volunteer subjects were enrolled into each DDI study of omeprazole (victim) and known perpetrators: fluconazole (inhibitor) and rifampin (inducer). For both studies, the microdose (100 μg, cold compound) and the regular dose (20 mg) of omeprazole were given at days 0 and 1, respectively. On days 2-9, the inhibitor or inducer was given daily, and the microdose and regular dose of omeprazole were repeated at days 8 and 9, respectively. Full omeprazole pharmacokinetic samplings were performed at days 0, 1, 8, and 9 of both studies for noncompartmental analysis. The magnitude of the DDI, the geometric mean ratios (with perpetrator/omeprazole only) of maximum concentration (C max ) and area under the curve to the last measurement (AUC t ) of the microdose and the regular dose were compared. The geometric mean ratios in the inhibition study were: 2.17 (micro) and 2.68 (regular) for C max , and 4.07 (micro), 4.33 (regular) for AUC t . For the induction study, they were 0.26 (micro) and 0.21 (regular) for C max , and 0.16 (micro) and 0.15 (regular) for AUC t . There were no significant statistical differences in the magnitudes of DDIs between microdose and regular-dose conditions, regardless of induction or inhibition. Our results may be used as partial evidence that microdose DDI studies may replace regular-dose studies, or at least be used for DDI-screening purposes.

School health promotion and use of drugs among students in Southern Brazil.

Science.gov (United States)

Paz, Fernanda Marques; Teixeira, Vanessa Andina; Pinto, Raquel Oliveira; Andersen, Cristine Scattolin; Fontoura, Larissa Prado; Castro, Luís César de; Pattussi, Marcos Pascoal; Horta, Rogério Lessa

2018-01-01

To analyze the relationship between the health promotion conditions in schools and the consumption of alcohol and other drugs by students. This is a cross-sectional study with a probabilistic sample of 3,464 students aged 12 to 17 from all schools of the cities of Lajeado and Sapiranga, state of Rio Grande do Sul, Brazil, and 53 managers from the same schools; the data was collected in 2012. Reports of the use of tobacco, alcohol, and illicit drugs in 2012 were used as outcomes, and the health promotion score in the school environment was used as the exposure of interest. We submitted the data to multilevel analysis. The prevalence of the annual use of tobacco was 9.8% (95%CI 8.8-10.8), alcohol was 46.2% (95%CI 44.5-47.8), and other drugs was 10.9% (95%CI 9.9-12.0). In the crude analysis, only the use of tobacco was associated with less health promoting schools (OR = 1.89, 95%CI 1.16-3.09) when compared to those with better conditions. This association lost statistical significance in the adjusted analysis (OR = 1.27, 95%CI 0.74-2.19). The effects of the school environment on the use of drugs, especially tobacco and alcohol, are manifested mainly by the individual and family conditions of the adolescents.

CYP2C9 polymorphism in non-steroidal anti-inflammatory drugs-induced gastropathy.

Science.gov (United States)

Ma, Juan; Yang, Xiu Yan; Qiao, Liang; Liang, Liu Qin; Chen, Min Hu

2008-05-01

Non-steroidal anti-inflammatory drugs (NSAID) induce gastroduodenal mucosal injury and are metabolized by cytochrome P450 2C9 (CYP2C9). It is postulated that CYP2C9 genotype is associated with NSAID-induced gastropathy. This study aims to determine whether individuals with a CYP2C9 allele mutation are susceptible to NSAID-induced gastropathy. A total of 109 patients diagnosed as having rheumatic diseases and taking NSAID were appraised as having gastropathy by endoscopy, stool occult blood test and questionnaire two weeks after entering the study. Their peripheral blood was analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). A total of 47.7% gastropathy (33% erosions, 14.7% ulcers, 2.75% ulcer bleeding) and 56% dyspeptic symptoms were presented. Only one CYP2C9*2 heterozygote (*1/*2) was found in the group with gastropathy and two variant alleles (CYP2C9*2 and CYP2C9* 3) could not be found in the group without gastropathy. There was no significant difference in both CYP2C9 genotype (0.96%vs 0%) and CYP2C9 variant allele frequency (1.92%vs 0%) between patients with and without gastropathy. These results confirm the high prevalence of NSAID-induced gastropathy but do not support the postulation that CYP2C9*2 and CYP2C9*3 contribute to the development of NSAID-induced gastropathy. This may be due to the low frequency of the two alleles in the population studied.

Trouble Spots in Online Direct-to-Consumer Prescription Drug Promotion: Teaching Drug Marketers How to Inform Better or Spin Better?; Comment on “Trouble Spots in Online Direct-to-Consumer Prescription Drug Promotion: A Content Analysis of FDA Warning Letters”

Directory of Open Access Journals (Sweden)

Evan Doran

2016-05-01

Full Text Available Hyosun Kim’s report “Trouble Spots in Online Direct to Consumer Prescription Drug Promotion: A content Analysis of FDA Warning Letters”aims to teach marketers how to avoid breaching current Food and Drug Administration (FDA guidelines in their online drug promotion. While Kim hopes to minimise the potential for online promotion to misinform consumers and the study is carefully conducted, teaching drug marketers how to avoid the common mistakes in online drug promotion is more likely to make marketers more adept at spinning information than appropriately balancing it.

Andrographolide Inhibits Oxidized LDL-Induced Cholesterol Accumulation and Foam Cell Formation in Macrophages.

Science.gov (United States)

Lin, Hung-Chih; Lii, Chong-Kuei; Chen, Hui-Chun; Lin, Ai-Hsuan; Yang, Ya-Chen; Chen, Haw-Wen

2018-01-01

oxLDL is involved in the pathogenesis of atherosclerotic lesions through cholesterol accumulation in macrophage foam cells. Andrographolide, the bioactive component of Andrographis paniculata, possesses several biological activities such as anti-inflammatory, anti-oxidant, and anticancer functions. Scavenger receptors (SRs), including class A SR (SR-A) and CD36, are responsible for the internalization of oxLDL. In contrast, receptors for reverse cholesterol transport, including ABCA1 and ABCG1, mediate the efflux of cholesterol from macrophage foam cells. Transcription factor liver X receptor [Formula: see text] (LXR[Formula: see text] plays a key role in lipid metabolism and inflammation as well as in the regulation of ABCA1 and ABCG1 expression. Because of the contribution of inflammation to macrophage foam cell formation and the potent anti-inflammatory activity of andrographolide, we hypothesized that andrographolide might inhibit oxLDL-induced macrophage foam cell formation. The results showed that andrographolide reduced oxLDL-induced lipid accumulation in macrophage foam cells. Andrographolide decreased the mRNA and protein expression of CD36 by inducing the degradation of CD36 mRNA; however, andrographolide had no effect on SR-A expression. In contrast, andrographolide increased the mRNA and protein expression of ABCA1 and ABCG1, which were dependent on LXR[Formula: see text]. Andrographolide enhanced LXR[Formula: see text] nuclear translocation and DNA binding activity. Treatment with the LXR[Formula: see text] antagonist GGPP and transfection with LXR[Formula: see text] siRNA reversed the ability of andrographolide to stimulate ABCA1 and ABCG1 protein expression. In conclusion, inhibition of CD36-mediated oxLDL uptake and induction of ABCA1- and ABCG1-dependent cholesterol efflux are two working mechanisms by which andrographolide inhibits macrophage foam cell formation, which suggests that andrographolide could be a potential candidate to prevent

Mechanisms of the hepatoprotective effects of tamoxifen against drug-induced and chemical-induced acute liver injuries

Energy Technology Data Exchange (ETDEWEB)

Yoshikawa, Yukitaka; Miyashita, Taishi; Higuchi, Satonori [Drug Metabolism and Toxicology, Faculty of Pharmaceutical Sciences, Kanazawa University, Kakuma-machi, Kanazawa 920‐1192 (Japan); Tsuneyama, Koichi [Department of Diagnostic Pathology, Graduate School of Medicine and Pharmaceutical Science for Research, University of Toyama, Sugitani, Toyama 930‐0194 (Japan); Endo, Shinya [Drug Metabolism and Toxicology, Faculty of Pharmaceutical Sciences, Kanazawa University, Kakuma-machi, Kanazawa 920‐1192 (Japan); Tsukui, Tohru [Research Center for Genomic Medicine, Saitama Medical University, Yamane, Hidaka 350‐1241 (Japan); Toyoda, Yasuyuki; Fukami, Tatsuki; Nakajima, Miki [Drug Metabolism and Toxicology, Faculty of Pharmaceutical Sciences, Kanazawa University, Kakuma-machi, Kanazawa 920‐1192 (Japan); Yokoi, Tsuyoshi, E-mail: tyokoi@p.kanazawa-u.ac.jp [Drug Metabolism and Toxicology, Faculty of Pharmaceutical Sciences, Kanazawa University, Kakuma-machi, Kanazawa 920‐1192 (Japan)

2012-10-01

Although estrogen receptor (ER)α agonists, such as estradiol and ethinylestradiol (EE2), cause cholestasis in mice, they also reduce the degree of liver injury caused by hepatotoxicants as well as ischemia–reperfusion. The functional mechanisms of ERα have yet to be elucidated in drug-induced or chemical-induced liver injury. The present study investigated the effects of an ERα agonist, selective ER modulators (SERMs) and an ER antagonist on drug-induced and chemical-induced liver injuries caused by acetaminophen, bromobenzene, diclofenac, and thioacetamide (TA). We observed hepatoprotective effects of EE2, tamoxifen (TAM) and raloxifene pretreatment in female mice that were exposed to a variety of hepatotoxic compounds. In contrast, the ER antagonist did not show any hepatoprotective effects. DNA microarray analyses suggested that monocyte to macrophage differentiation-associated 2 (Mmd2) protein, which has an unknown function, is commonly increased by TAM and RAL pretreatment, but not by pretreatment with the ER antagonist. In ERα-knockout mice, the hepatoprotective effects of TAM and the increased expression of Mmd2 mRNA were not observed in TA-induced liver injury. To investigate the function of Mmd2, the expression level of Mmd2 mRNA was significantly knocked down to approximately 30% in mice by injection of siRNA for Mmd2 (siMmd2). Mmd2 knockdown resulted in a reduction of the protective effects of TAM on TA-induced liver injury in mice. This is the first report of the involvement of ERα in drug-induced or chemical-induced liver injury. Upregulation of Mmd2 protein in the liver was suggested as the mechanism of the hepatoprotective effects of EE2 and SERMs. -- Highlights: ► Liver injury induced by drugs or chemicals was investigated in mice. ► Liver injury was suppressed by pretreatment with tamoxifen in female mice. ► Mmd2, whose function was unknown, could be a candidate gene for liver protection. ► Tamoxifen up-regulated Mmd2 mRNA expression

Mechanisms of the hepatoprotective effects of tamoxifen against drug-induced and chemical-induced acute liver injuries

International Nuclear Information System (INIS)

Yoshikawa, Yukitaka; Miyashita, Taishi; Higuchi, Satonori; Tsuneyama, Koichi; Endo, Shinya; Tsukui, Tohru; Toyoda, Yasuyuki; Fukami, Tatsuki; Nakajima, Miki; Yokoi, Tsuyoshi

2012-01-01

Although estrogen receptor (ER)α agonists, such as estradiol and ethinylestradiol (EE2), cause cholestasis in mice, they also reduce the degree of liver injury caused by hepatotoxicants as well as ischemia–reperfusion. The functional mechanisms of ERα have yet to be elucidated in drug-induced or chemical-induced liver injury. The present study investigated the effects of an ERα agonist, selective ER modulators (SERMs) and an ER antagonist on drug-induced and chemical-induced liver injuries caused by acetaminophen, bromobenzene, diclofenac, and thioacetamide (TA). We observed hepatoprotective effects of EE2, tamoxifen (TAM) and raloxifene pretreatment in female mice that were exposed to a variety of hepatotoxic compounds. In contrast, the ER antagonist did not show any hepatoprotective effects. DNA microarray analyses suggested that monocyte to macrophage differentiation-associated 2 (Mmd2) protein, which has an unknown function, is commonly increased by TAM and RAL pretreatment, but not by pretreatment with the ER antagonist. In ERα-knockout mice, the hepatoprotective effects of TAM and the increased expression of Mmd2 mRNA were not observed in TA-induced liver injury. To investigate the function of Mmd2, the expression level of Mmd2 mRNA was significantly knocked down to approximately 30% in mice by injection of siRNA for Mmd2 (siMmd2). Mmd2 knockdown resulted in a reduction of the protective effects of TAM on TA-induced liver injury in mice. This is the first report of the involvement of ERα in drug-induced or chemical-induced liver injury. Upregulation of Mmd2 protein in the liver was suggested as the mechanism of the hepatoprotective effects of EE2 and SERMs. -- Highlights: ► Liver injury induced by drugs or chemicals was investigated in mice. ► Liver injury was suppressed by pretreatment with tamoxifen in female mice. ► Mmd2, whose function was unknown, could be a candidate gene for liver protection. ► Tamoxifen up-regulated Mmd2 mRNA expression

The RAB2B-GARIL5 Complex Promotes Cytosolic DNA-Induced Innate Immune Responses.

Science.gov (United States)

Takahama, Michihiro; Fukuda, Mitsunori; Ohbayashi, Norihiko; Kozaki, Tatsuya; Misawa, Takuma; Okamoto, Toru; Matsuura, Yoshiharu; Akira, Shizuo; Saitoh, Tatsuya

2017-09-19

Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor that induces the IFN antiviral response. However, the regulatory mechanisms that mediate cGAS-triggered signaling have not been fully explored. Here, we show the involvement of a small GTPase, RAB2B, and its effector protein, Golgi-associated RAB2B interactor-like 5 (GARIL5), in the cGAS-mediated IFN response. RAB2B-deficiency affects the IFN response induced by cytosolic DNA. Consistent with this, RAB2B deficiency enhances replication of vaccinia virus, a DNA virus. After DNA stimulation, RAB2B colocalizes with stimulator of interferon genes (STING), the downstream signal mediator of cGAS, on the Golgi apparatus. The GTP-binding activity of RAB2B is required for its localization on the Golgi apparatus and for recruitment of GARIL5. GARIL5 deficiency also affects the IFN response induced by cytosolic DNA and enhances replication of vaccinia virus. These findings indicate that the RAB2B-GARIL5 complex promotes IFN responses against DNA viruses by regulating the cGAS-STING signaling axis. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

The RAB2B-GARIL5 Complex Promotes Cytosolic DNA-Induced Innate Immune Responses

Directory of Open Access Journals (Sweden)

Michihiro Takahama

2017-09-01

Full Text Available Cyclic GMP-AMP synthase (cGAS is a cytosolic DNA sensor that induces the IFN antiviral response. However, the regulatory mechanisms that mediate cGAS-triggered signaling have not been fully explored. Here, we show the involvement of a small GTPase, RAB2B, and its effector protein, Golgi-associated RAB2B interactor-like 5 (GARIL5, in the cGAS-mediated IFN response. RAB2B-deficiency affects the IFN response induced by cytosolic DNA. Consistent with this, RAB2B deficiency enhances replication of vaccinia virus, a DNA virus. After DNA stimulation, RAB2B colocalizes with stimulator of interferon genes (STING, the downstream signal mediator of cGAS, on the Golgi apparatus. The GTP-binding activity of RAB2B is required for its localization on the Golgi apparatus and for recruitment of GARIL5. GARIL5 deficiency also affects the IFN response induced by cytosolic DNA and enhances replication of vaccinia virus. These findings indicate that the RAB2B-GARIL5 complex promotes IFN responses against DNA viruses by regulating the cGAS-STING signaling axis.

Zinc depletion promotes apoptosis-like death in drug-sensitive and antimony-resistance Leishmania donovani.

Science.gov (United States)

Saini, Shalini; Bharati, Kavita; Shaha, Chandrima; Mukhopadhyay, Chinmay K

2017-09-05

Micronutrients are essential for survival and growth for all the organisms including pathogens. In this manuscript, we report that zinc (Zn) chelator N,N,N',N'-tetrakis(2-pyridinylmethyl)-1,2-ethylenediamine (TPEN) affects growth and viability of intracellular pathogen Leishmania donovani (LD) by a concentration and time dependent manner. Simultaneous addition of zinc salt reverses the effect of TPEN. Further experiments provide evidence of apoptosis-like death of the parasite due to Zn-depletion. TPEN treatment enhances caspase-like activity suggesting increase in apoptosis-like events in LD. Specific inhibitors of cathepsin B and Endoclease G block TPEN-induced leishmanial death. Evidences show involvement of reactive oxygen species (ROS) potentially of extra-mitochondrial origin in TPEN-induced LD death. Pentavalent antimonials remained the prime source of treatment against leishmaniasis for several decades; however, antimony-resistant Leishmania is now common source of the disease. We also reveal that Zn-depletion can promote apoptosis-like death in antimony-resistant parasites. In summary, we present a new finding about the role of zinc in the survival of drug sensitive and antimony-resistant LD.

Adverse drug reactions induced by cardiovascular drugs in outpatients

Directory of Open Access Journals (Sweden)

Gholami K

2008-03-01

Full Text Available Considering increased use of cardiovascular drugs and limitations in pre-marketing trials for drug safety evaluation, post marketing evaluation of adverse drug reactions (ADRs induced by this class of medicinal products seems necessary.Objectives: To determine the rate and seriousness of adverse reactions induced by cardiovascular drugs in outpatients. To compare sex and different age groups in developing ADRs with cardiovascular agents. To assess the relationship between frequencies of ADRs and the number of drugs used. Methods: This cross-sectional study was done in cardiovascular clinic at a teaching hospital. All patients during an eight months period were evaluated for cardiovascular drugs induced ADRs. Patient and reaction factors were analyzed in detected ADRs. Patients with or without ADRs were compared in sex and age by using chi-square test. Assessing the relationship between frequencies of ADRs and the number of drugs used was done by using Pearson analysis. Results: The total number of 518 patients was visited at the clinic. ADRs were detected in 105 (20.3% patients. The most frequent ADRs were occurred in the age group of 51-60. The highest rate of ADRs was recorded to be induced by Diltiazem (23.5% and the lowest rate with Atenolol (3%. Headache was the most frequent detected ADR (23%. Assessing the severity and preventability of ADRs revealed that 1.1% of ADRs were detected as severe and 1.9% as preventable reactions. Women significantly developed more ADRs in this study (chi square = 3.978, P<0.05. ADRs more frequently occurred with increasing age in this study (chi square = 15.871, P<0.05. With increasing the number of drugs used, the frequency of ADRs increased (Pearson=0.259, P<0.05. Conclusion: Monitoring ADRs in patients using cardiovascular drugs is a matter of importance since this class of medicines is usually used by elderly patients with critical conditions and underlying diseases.

Drug induced aseptic meningitis

African Journals Online (AJOL)

PROF. EZECHUKWU

2013-09-29

Sep 29, 2013 ... Abstract. Drug-induced aseptic meningitis (DIAM) is a rare but important and often challenging diagnosis for the physician. Intake of antimicrobials, steroids, anal- gesics amongst others has been implicated. Signs and symptoms generally develop within 24-48 hours of drug ingestion. The pa- tient often ...

ABCG2/BCRP decreases the transfer of a food-born chemical carcinogen, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) in perfused term human placenta

International Nuclear Information System (INIS)

Myllynen, Paeivi; Kummu, Maria; Kangas, Tiina; Ilves, Mika; Immonen, Elina; Rysae, Jaana; Pirilae, Rauna; Lastumaeki, Anni; Vaehaekangas, Kirsi H.

2008-01-01

We have studied the role of ATP binding cassette (ABC) transporters in fetal exposure to carcinogens using 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) a known substrate for ABC transporters as a model compound. In perfusion of human term placenta, transfer of 14 C-PhIP (2 μM) through the placenta resulted in fetal-to-maternal concentration ratio (FM ratio) of 0.72 ± 0.09 at 6 h. The specific ABCG2 inhibitor KO143 increased the transfer of 14 C-PhIP from maternal to fetal circulation (FM ratio 0.90 ± 0.08 at 6 h, p 14 C-PhIP (R = - 0.81, p 14 C-PhIP in perfused human placenta. Also, PhIP may modify ABC transporter expression in choriocarinoma cells

Aging Enables Ca2+ Overload and Apoptosis Induced by Amyloid-β Oligomers in Rat Hippocampal Neurons: Neuroprotection by Non-Steroidal Anti-Inflammatory Drugs and R-Flurbiprofen in Aging Neurons.

Science.gov (United States)

Calvo-Rodríguez, María; García-Durillo, Mónica; Villalobos, Carlos; Núñez, Lucía

2016-07-22

The most important risk factor for Alzheimer's disease (AD) is aging. Neurotoxicity in AD has been linked to dyshomeostasis of intracellular Ca2+ induced by small aggregates of the amyloid-β peptide 1-42 (Aβ42 oligomers). However, how aging influences susceptibility to neurotoxicity induced by Aβ42 oligomers is unknown. In this study, we used long-term cultures of rat hippocampal neurons, a model of neuronal in vitro aging, to investigate the contribution of aging to Ca2+ dishomeostasis and neuron cell death induced by Aβ42 oligomers. In addition, we tested whether non-steroidal anti-inflammatory drugs (NSAIDs) and R-flurbiprofen prevent apoptosis acting on subcellular Ca2+ in aged neurons. We found that Aβ42 oligomers have no effect on young hippocampal neurons cultured for 2 days in vitro (2 DIV). However, they promoted apoptosis modestly in mature neurons (8 DIV) and these effects increased dramatically after 13 DIV, when neurons display many hallmarks of in vivo aging. Consistently, cytosolic and mitochondrial Ca2+ responses induced by Aβ42 oligomers increased dramatically with culture age. At low concentrations, NSAIDs and the enantiomer R-flurbiprofen lacking anti-inflammatory activity prevent Ca2+ overload and neuron cell death induced by Aβ42 oligomers in aged neurons. However, at high concentrations R-flurbiprofen induces apoptosis. Thus, Aβ42 oligomers promote Ca2+ overload and neuron cell death only in aged rat hippocampal neurons. These effects are prevented by low concentrations of NSAIDs and R-flurbiprofen acting on mitochondrial Ca2+ overload.

Hepatocyte SLAMF3 reduced specifically the multidrugs resistance protein MRP-1 and increases HCC cells sensitization to anti-cancer drugs.

Science.gov (United States)

Fouquet, Grégory; Debuysscher, Véronique; Ouled-Haddou, Hakim; Eugenio, Mélanie Simoes; Demey, Baptiste; Singh, Amrathlal Rabbind; Ossart, Christèle; Al Bagami, Mohammed; Regimbeau, Jean-Marc; Nguyen-Khac, Eric; Naassila, Mickael; Marcq, Ingrid; Bouhlal, Hicham

2016-05-31

Multidrug resistance MDR proteins (MRPs) are members of the C family of a group of proteins named ATP binding cassette (ABC) transporters. MRPs can transport drugs including anticancer drugs, nucleoside analogs, antimetabolites and tyrosine kinase inhibitors. Drugs used in HCC therapy, such as tyrosine kinase inhibitor sorafenib, are substrates of uptake and/or efflux transporters. Variable expression of MRPs at the plasma membrane of tumor cells may contribute to drug resistance and subsequent clinical response. Recently, we reported that the hepatocyte SLAMF3 expression (Signaling Lymphocytic Activation Molecule Family member 3) was reduced in tumor cells from hepatocellular carcinoma (HCC) compared to its high expression in adjacent tissues. In the present study, we make a strong correlation between induced SLAMF3 overexpression and the specific loss of MRP-1 expression and its functionalities as a drugs resistance transporter. No changes were observed on expression of ABCG2 and MDR. More importantly, we highlight a strong inverse correlation between MRP-1 and SLAMF3 expression in patients with HCC. We propose that the SLAMF3 overexpression in cancerous cells could represent a potential therapeutic strategy to improve the drugs sensibility of resistant cells and thus control the therapeutic failure in HCC patients.

The epidemiology of drug promotion.

Science.gov (United States)

Silverman, M

1977-01-01

A survey was conducted on the promotion of 28 prescription drugs in the form of 40 different products marketed in the United States and Latin America by 23 multinational pharmaceutical companies. Striking differences were found in the manner in which the identical drug, marketed by the identical company or its foreign affiliate, was described to physicians in the United States and to physicians in Latin America. In the United States, the listed indications were usually few in number, while the contraindications, warnings, and potential adverse reactions were given in extensive detail. In Latin America, the listed indications were far more numerous, while the hazards were usually minimized, glossed over, or totally ignored. The differences were not simply between the United States on the one hand and all the Latin American countries on the other. There were substantial differences within Latin America, with the same global company telling one story in Mexico, another in Central America, a third in Ecuador and Colombia, and yet another in Brazil. The companies have sought to defend these practices by contending that they are not breaking any Latin American laws. In some countries, however, such promotion is in clear violation of the law. The corporate ethics and social responsibilities concerned here call for examination and action.

Promotion of Prescription Drugs to Consumers and Providers, 2001–2010

Science.gov (United States)

Kornfield, Rachel; Donohue, Julie; Berndt, Ernst R.; Alexander, G. Caleb

2013-01-01

Background Pharmaceutical firms heavily promote their products and may have changed marketing strategies in response to reductions in new product approvals, restrictions on some forms of promotion, and the expanding role of biologic therapies. Methods We used descriptive analyses of annual cross-sectional data from 2001 through 2010 to examine direct-to-consumer advertising (DTCA) (Kantar Media) and provider-targeted promotion (IMS Health and SDI), including: (1) inflation-adjusted total promotion spending ($ and percent of sales); (2) distribution by channel (consumer v. provider); and (3) provider specialty both for the industry as a whole and for top-selling biologic and small molecule therapies. Results Total promotion peaked in 2004 at US$36.1 billion (13.4% of sales). By 2010 it had declined to $27.7B (9.0% of sales). Between 2006 and 2010, similar declines were seen for promotion to providers and DTCA (both by 25%). DTCA’s share of total promotion increased from 12% in 2002 to 18% in 2006, but then declined to 16% and remains highly concentrated. Number of products promoted to providers peaked in 2004 at over 3000, and then declined 20% by 2010. In contrast to top-selling small molecule therapies having an average of $370 million (8.8% of sales) spent on promotion, top biologics were promoted less, with only $33 million (1.4% of sales) spent per product. Little change occurred in the composition of promotion between primary care physicians and specialists from 2001–2010. Conclusions These findings suggest that pharmaceutical companies have reduced promotion following changes in the pharmaceutical pipeline and patent expiry for several blockbuster drugs. Promotional strategies for biologic drugs differ substantially from small molecule therapies. PMID:23469165

HLA Association with Drug-Induced Adverse Reactions

Directory of Open Access Journals (Sweden)

Wen-Lang Fan

2017-01-01

Full Text Available Adverse drug reactions (ADRs remain a common and major problem in healthcare. Severe cutaneous adverse drug reactions (SCARs, such as Stevens–Johnson syndrome (SJS/toxic epidermal necrolysis (TEN with mortality rate ranges from 10% to more than 30%, can be life threatening. A number of recent studies demonstrated that ADRs possess strong genetic predisposition. ADRs induced by several drugs have been shown to have significant associations with specific alleles of human leukocyte antigen (HLA genes. For example, hypersensitivity to abacavir, a drug used for treating of human immunodeficiency virus (HIV infection, has been proposed to be associated with allele 57:01 of HLA-B gene (terms HLA-B∗57:01. The incidences of abacavir hypersensitivity are much higher in Caucasians compared to other populations due to various allele frequencies in different ethnic populations. The antithyroid drug- (ATDs- induced agranulocytosis are strongly associated with two alleles: HLA-B∗38:02 and HLA-DRB1∗08:03. In addition, HLA-B∗15:02 allele was reported to be related to carbamazepine-induced SJS/TEN, and HLA-B∗57:01 in abacavir hypersensitivity and flucloxacillin induced drug-induced liver injury (DILI. In this review, we summarized the alleles of HLA genes which have been proposed to have association with ADRs caused by different drugs.

Melatonin successfully rescues hippocampal bioenergetics and improves cognitive function following drug intoxication by promoting Nrf2-ARE signaling activity.

Science.gov (United States)

Chen, Li-You; Renn, Ting-Yi; Liao, Wen-Chieh; Mai, Fu-Der; Ho, Ying-Jui; Hsiao, George; Lee, Ai-Wei; Chang, Hung-Ming

2017-09-01

Prolonged exposure to gamma-hydroxybutyric acid (GHB) would cause drug intoxication in which impaired cognitive function results from enhanced hippocampal oxidative stress may serve as a major symptom in this deficiency. Considering melatonin possesses significant anti-oxidative efficacy, this study aimed to determine whether melatonin would successfully promote the nuclear factor erythroid 2-related factor 2 and antioxidant responsive element (Nrf2-ARE) signaling, depress oxidative stress, and rescue hippocampal bioenergetics and cognitive function following drug intoxication injury. Adolescent rats subjected to 10 days of GHB were received melatonin at doses of either 10 or 100 mg/kg. Time-of-flight secondary ion mass spectrometry, biochemical assay, quantitative histochemistry, [ 14 C]-2-deoxyglucose analysis, together with Morris water maze were employed to detect the molecular signaling, oxidative status, bioenergetic level, as well as the cognitive performances, respectively. Results indicated that in GHB-intoxicated rats, enhanced oxidative stress, increased cholesterol level, and decreased anti-oxidative enzymes activities were detected in hippocampal regions. Intense oxidative stress paralleled well with reduced bioenergetics and poor performance in behavioral testing. However, in rats treated with melatonin following GHB intoxication, all above parameters and cognitive function were gradually returned to nearly normal levels. Melatonin also remarkably promoted the translocation of Nrf2 from cytoplasm to nucleus in a dose-dependent manner, thereby increased the Nrf2-ARE signaling-related downstream anti-oxidative enzymes activities. As melatonin effectively rescues hippocampal bioenergetics through depressing the oxidative stress by promoting Nrf2-ARE molecular machinery, this study thus highlights for the first time that clinical use of melatonin may serve as a therapeutic strategy to improve the cognitive function in unsuspecting victims suffered from

Sorafenib-induced defective autophagy promotes cell death by necroptosis.

Science.gov (United States)

Kharaziha, Pedram; Chioureas, Dimitris; Baltatzis, George; Fonseca, Pedro; Rodriguez, Patricia; Gogvadze, Vladimir; Lennartsson, Lena; Björklund, Ann-Charlotte; Zhivotovsky, Boris; Grandér, Dan; Egevad, Lars; Nilsson, Sten; Panaretakis, Theocharis

2015-11-10

Autophagy is one of the main cytoprotective mechanisms that cancer cells deploy to withstand the cytotoxic stress and survive the lethal damage induced by anti-cancer drugs. However, under specific conditions, autophagy may, directly or indirectly, induce cell death. In our study, treatment of the Atg5-deficient DU145 prostate cancer cells, with the multi-tyrosine kinase inhibitor, sorafenib, induces mitochondrial damage, autophagy and cell death. Molecular inhibition of autophagy by silencing ULK1 and Beclin1 rescues DU145 cells from cell death indicating that, in this setting, autophagy promotes cell death. Re-expression of Atg5 restores the lipidation of LC3 and rescues DU145 and MEF atg5-/- cells from sorafenib-induced cell death. Despite the lack of Atg5 expression and LC3 lipidation, DU145 cells form autophagosomes as demonstrated by transmission and immuno-electron microscopy, and the formation of LC3 positive foci. However, the lack of cellular content in the autophagosomes, the accumulation of long-lived proteins, the presence of GFP-RFP-LC3 positive foci and the accumulated p62 protein levels indicate that these autophagosomes may not be fully functional. DU145 cells treated with sorafenib undergo a caspase-independent cell death that is inhibited by the RIPK1 inhibitor, necrostatin-1. Furthermore, treatment with sorafenib induces the interaction of RIPK1 with p62, as demonstrated by immunoprecipitation and a proximity ligation assay. Silencing of p62 decreases the RIPK1 protein levels and renders necrostatin-1 ineffective in blocking sorafenib-induced cell death. In summary, the formation of Atg5-deficient autophagosomes in response to sorafenib promotes the interaction of p62 with RIPK leading to cell death by necroptosis.

Increased Risk of Drug-Induced Hyponatremia during High Temperatures

Directory of Open Access Journals (Sweden)

Anna K Jönsson

2017-07-01

Full Text Available Purpose: To investigate the relationship between outdoor temperature in Sweden and the reporting of drug-induced hyponatremia to the Medical Products Agency (MPA. Methods: All individual adverse drug reactions (ADR reported to MPA from 1 January 2010 to 31 October 2013 of suspected drug-induced hyponatremia and random controls were identified. Reports where the ADR had been assessed as having at least a possible relation to the suspected drug were included. Information on administered drugs, onset date, causality assessment, sodium levels, and the geographical origin of the reports was extracted. A case-crossover design was used to ascertain the association between heat exposure and drug-induced hyponatremia at the individual level, while linear regression was used to study its relationship to sodium concentration in blood. Temperature exposure data were obtained from the nearest observation station to the reported cases. Results: During the study period, 280 reports of hyponatremia were identified. More cases of drug-induced hyponatremia were reported in the warmer season, with a peak in June, while other ADRs showed an opposite annual pattern. The distributed lag non-linear model indicated an increasing odds ratio (OR with increasing temperature in the warm season with a highest odds ratio, with delays of 1–5 days after heat exposure. A cumulative OR for a lag time of 1 to 3 days was estimated at 2.21 at an average daily temperature of 20 °C. The change in sodium per 1 °C increase in temperature was estimated to be −0.37 mmol/L (95% CI: −0.02, −0.72. Conclusions: Warm weather appears to increase the risk of drug-induced hyponatremia

Melanocortin 1 Receptor Deficiency Promotes Atherosclerosis in Apolipoprotein E-/- Mice.

Science.gov (United States)

Rinne, Petteri; Kadiri, James J; Velasco-Delgado, Mauricio; Nuutinen, Salla; Viitala, Miro; Hollmén, Maija; Rami, Martina; Savontaus, Eriika; Steffens, Sabine

2018-02-01

The MC1-R (melanocortin 1 receptor) is expressed by monocytes and macrophages where it mediates anti-inflammatory actions. MC1-R also protects against macrophage foam cell formation primarily by promoting cholesterol efflux through the ABCA1 (ATP-binding cassette transporter subfamily A member 1) and ABCG1 (ATP-binding cassette transporter subfamily G member 1). In this study, we aimed to investigate whether global deficiency in MC1-R signaling affects the development of atherosclerosis. Apoe -/- (apolipoprotein E deficient) mice were crossed with recessive yellow (Mc1r e/e ) mice carrying dysfunctional MC1-R and fed a high-fat diet to induce atherosclerosis. Apoe -/- Mc1r e/e mice developed significantly larger atherosclerotic lesions in the aortic sinus and in the whole aorta compared with Apoe -/- controls. In terms of plaque composition, MC1-R deficiency was associated with less collagen and smooth muscle cells and increased necrotic core, indicative of more vulnerable lesions. These changes were accompanied by reduced Abca1 and Abcg1 expression in the aorta. Furthermore, Apoe -/- Mc1r e/e mice showed a defect in bile acid metabolism that aggravated high-fat diet-induced hypercholesterolemia and hepatic lipid accumulation. Flow cytometric analysis of leukocyte profile revealed that dysfunctional MC1-R enhanced arterial accumulation of classical Ly6C high monocytes and macrophages, effects that were evident in mice fed a normal chow diet but not under high-fat diet conditions. In support of enhanced arterial recruitment of Ly6C high monocytes, these cells had increased expression of L-selectin and P-selectin glycoprotein ligand 1. The present study highlights the importance of MC1-R in the development of atherosclerosis. Deficiency in MC1-R signaling exacerbates atherosclerosis by disturbing cholesterol handling and by increasing arterial monocyte accumulation. © 2017 The Authors.

Thymus function in drug-induced lupus.

Science.gov (United States)

Rubin, R L; Salomon, D R; Guerrero, R S

2001-01-01

Autoimmunity develops when a lupus-inducing drug is introduced into the thymus of normal mice, but the relevance of this model to the human disorder is unclear in part because it is widely assumed that the thymus is non-functional in the adult. We compared thymus function in 10 patients with symptomatic procainamide-induced lupus to that in 13 asymptomatic patients who only developed drug-induced autoantibodies. T cell output from the thymus was quantified using a competitive polymerase chain reaction that detects T cell receptor DNA excision circles in peripheral blood lymphocytes. Despite the advanced age of the patient population under study, newly generated T cells were detected in all subjects. Although there was no overall quantitative difference between the symptomatic and asymptomatic patients, we found a positive correlation between the level of T cell receptor excision circles in peripheral lymphocytes and serum IgG anti-chromatin antibody activity in patients with drug-induced lupus. The association between autoantibodies and nascent peripheral T cells supports the requirement for T cells in autoantibody production. Our observations are consistent with findings in mice in which autoreactive T cells derived from drug-induced abnormalities in T cell development in the thymus.

Deficiency of ABCA1 and ABCG1 in Macrophages Increases Inflammation and Accelerates Atherosclerosis in Mice

Science.gov (United States)

Westerterp, Marit; Murphy, Andrew J.; Wang, Mi; Pagler, Tamara A.; Vengrenyuk, Yuliya; Kappus, Mojdeh S.; Gorman, Darren J.; Nagareddy, Prabhakara R.; Zhu, Xuewei; Abramowicz, Sandra; Parks, John S.; Welch, Carrie; Fisher, Edward A.; Wang, Nan; Yvan-Charvet, Laurent; Tall, Alan R.

2013-01-01

Rationale Plasma HDL levels are inversely correlated with atherosclerosis. Although it is widely assumed that this is due to the ability of HDL to promote cholesterol efflux from macrophage foam cells, direct experimental support for this hypothesis is lacking. Objective To assess the role of macrophage cholesterol efflux pathways in atherogenesis. Methods and Results We developed MAC-ABCDKO mice with efficient deletion of the ATP Binding Cassette Transporters A1 and G1 (ABCA1 and ABCG1) in macrophages but not in hematopoietic stem or progenitor populations. MAC-ABCDKO bone marrow (BM) was transplanted into Ldlr-/- recipients. On the chow diet, these mice had similar plasma cholesterol and blood monocyte levels but increased atherosclerosis compared to controls. On the Western type diet (WTD), MAC-ABCDKO BM transplanted Ldlr-/- mice had disproportionate atherosclerosis, considering they also had lower VLDL/LDL cholesterol levels than controls. ABCA1/G1 deficient macrophages in lesions showed increased inflammatory gene expression. Unexpectedly, WTD-fed MAC-ABCDKO BM transplanted Ldlr-/- mice displayed monocytosis and neutrophilia in the absence of HSPC proliferation. Mechanistic studies revealed increased expression of M-CSF and G-CSF in splenic macrophage foam cells, driving BM monocyte and neutrophil production. Conclusion These studies 1) show that macrophage deficiency of ABCA1/G1 is pro-atherogenic likely by promoting plaque inflammation and 2) uncover a novel positive feedback loop in which cholesterol-laden splenic macrophages signal BM progenitors to produce monocytes, with suppression by macrophage cholesterol efflux pathways. PMID:23572498

[Drug advertising and promotion: regulations and extent of compliance in five Latin American countries].

Science.gov (United States)

Vacca, Claudia; Vargas, Claudia; Cañás, Martín; Reveiz, Ludovic

2011-02-01

To analyze differing regulations regarding drug promotion, and the extent of compliance as seen in samples of advertising directed to the public in Argentina, Colombia, Ecuador, Nicaragua, and Peru. A total of 683 pieces of promotional material on display in health facilities, pharmacies, and on the street were collected, 132 of which were randomly selected for analysis. The regulations governing pharmaceutical advertising, taken from official websites and interviews with regulatory officials and Ministry of Health staff in the five countries covered, were reviewed, along with their adherence to the ethical criteria of the World Health Organization (WHO). The contents of the materials in the sample were evaluated to determine their degree of compliance with national regulations and WHO recommendations on drug promotion. The countries have regulations incorporating WHO ethical criteria. Over 80% of the material analyzed included the indications for the drug, while over 70% omitted information on adverse effects. Fifty percent of the advertisements for over-the-counter (OTC) drugs on display in pharmacies listed indications not approved by the relevant health authority. In advertising in pharmacies, the risks from inadequate information were not found to differ significantly for OTC or prescription medications. Compared with materials provided in health facilities, the relative risk of the absence of information on dosage in the material distributed in pharmacies was 2.08 (confidence interval 95% 1.32-3.39). Although regulations on drug promotion and advertising in the five countries studied generally incorporate the WHO recommendations, promotional materials often fail to reflect the fact.

Leveraging consumer's behaviour to promote generic drugs in Italy.

Science.gov (United States)

Zerbini, Cristina; Luceri, Beatrice; Vergura, Donata Tania

2017-04-01

The aim of this study was to fill the lack of knowledge regarding a more grounded exploration of the consumer's decision-making process in the context of generic drugs. In this perspective, a model, within the theoretical framework of the Theory of Planned Behaviour (TPB), for studying the consumers' purchase intention of generic drugs was developed. An online survey on 2,222 Italian people who bought drugs in the past was conducted. The proposed model was tested through structural equation modelling (SEM). Almost all the constructs considered in the model, except the perceived behavioural control, contribute to explain the consumer's purchase intention of generic drugs, after controlling for demographic variables (age, income, education). Specifically, attitude, subjective norm, past behaviour, self-identity and trust in the pharmacist have a positive influence on the intention to buy generic drugs. On the contrary, perceived risk towards products and brand sensitivity act negatively. The results of the present study could be useful to public policy makers in developing effective policies and educational campaigns aimed at promoting generic drugs. Specifically, marketing efforts should be directed to inform consumers about the generic drugs' characteristics to mitigate the perceived risk towards these products and to raise awareness during their decision-making process. Copyright © 2017 Elsevier B.V. All rights reserved.

Residue analysis of veterinary drugs and growth-promoting agents

NARCIS (Netherlands)

Stolker, A.A.M.; Zuidema, T.; Nielen, M.W.F.

2007-01-01

Two major trends are observed in the analysis of veterinary drugs and growth-promoting agents. First is the selection of sample material for monitoring the use of registered veterinary drugs. Traditionally meat, kidney and liver were analyzed but, due to the food scandals in which meat was very

Recent Advances in Drug-Induced Angioedema

Directory of Open Access Journals (Sweden)

Naoko Inomata

2012-01-01

Full Text Available Angioedema is the end result of deep dermal, subcutaneous and/or mucosal swelling, and is potentially a life- threatening condition in cases where the pharynx or larynx is involved. Drug-induced angioedema has been reported to occur in response to a wide range of drugs and vaccines. Drug-induced angioedema, like other cutaneous drug reactions, has been reported to be most frequently elicited by beta-lactam antibiotics and nonsteroidal anti-inflammatory drugs, although reliable data from epidemiologic studies are scarce. Recent reports suggested an increasing role of angiotensin-converting enzyme inhibitors (ACEIs in the causation of life- threatening angioedema. ACEI-related angioedema is never accompanied by urticaria and occurs via a kinin- dependent mechanism. ACEI-related angioedema not only can start years after beginning the treatment, but it can then recur irregularly while under that treatment. Furthermore, allergy tests are unreliable for the diagnosis of ACEI-related angioedema, and so the relationship between angioedema and ACEIs is often missed and consequently quite underestimated. Accordingly, better understanding of the kinin-dependent mechanism, which is particular to angioedema, is necessary for the appropriate management of drug-induced angioedema.

Potential pharmacokinetic effect of rifampicin on enrofloxacin in broilers: Roles of P-glycoprotein and BCRP induction by rifampicin.

Science.gov (United States)

Guo, Mengjie; Dai, Xiaohua; Hu, Dongmin; Zhang, Yu; Sun, Yong; Ren, Weilong; Wang, Liping

2016-09-01

P-glycoprotein ( P-GP: , encoding gene Abcb1) and Breast Cancer Resistance Protein ( BCRP: , encoding gene Abcg2) are transport proteins that play a major role in modulating the bioavailability of oral drugs in humans and rodents. It has been shown that rifampicin is the typical inducer of P-gp in rodents by activating the nuclear receptor. However, its effect on Abcb1, Abcg2, CYP3A, and chicken xenobiotic-sensing orphan nuclear receptor ( CXR: ) mRNA expression in broilers is poorly understood. This study explored the effect of rifampicin on mRNA expression of Abcb1, Abcg2, CYP3A37, CXR as well as its effect on the pharmacokinetics of enrofloxacin in broilers. The mRNA levels of Abcb1, Abcg2, CYP3A37, and CXR were significantly increased in the liver (except Abcg2), kidney, jejunum, and ileum (P 0.05) after treated with rifampicin. Further analysis revealed that the variation tendencies of Abcb1, Abcg2, and CYP3A37 expression levels were significantly correlated with CXR mRNA expression levels in liver, kidney, jejunum, and ileum. Coadministration of rifampicin significantly changed the pharmacokinetic behavior of enrofloxacin orally administered by showing clearly lower AUC0-∞, AUC0-t, and Cmax as well as longer Tmax. The bioavailability of orally administered enrofloxacin was decreased from 72.5% to 24.8% by rifampicin. However, rifampicin did not significantly change the pharmacokinetics of enrofloxacin following intravenous administration. Our study shows that rifampicin up-regulated the small intestinal level of P-gp and BCRP and suggests that P-gp and BCRP are key factors that affected pharmacokinetic behavior of orally administered enrofloxacin by limiting its absorption from the intestine in broilers. © 2016 Poultry Science Association Inc.

Hypoxia-induced cytotoxic drug resistance in osteosarcoma is independent of HIF-1Alpha.

Directory of Open Access Journals (Sweden)

Jennifer Adamski

Full Text Available Survival rates from childhood cancer have improved dramatically in the last 40 years, such that over 80% of children are now cured. However in certain subgroups, including metastatic osteosarcoma, survival has remained stubbornly poor, despite dose intensive multi-agent chemotherapy regimens, and new therapeutic approaches are needed. Hypoxia is common in adult solid tumours and is associated with treatment resistance and poorer outcome. Hypoxia induces chemotherapy resistance in paediatric tumours including neuroblastoma, rhabdomyosarcoma and Ewing's sarcoma, in vitro, and this drug resistance is dependent on the oxygen-regulated transcription factor hypoxia inducible factor-1 (HIF-1. In this study the effects of hypoxia on the response of the osteosarcoma cell lines 791T, HOS and U2OS to the clinically relevant cytotoxics cisplatin, doxorubicin and etoposide were evaluated. Significant hypoxia-induced resistance to all three agents was seen in all three cell lines and hypoxia significantly reduced drug-induced apoptosis. Hypoxia also attenuated drug-induced activation of p53 in the p53 wild-type U2OS osteosarcoma cells. Drug resistance was not induced by HIF-1α stabilisation in normoxia by cobalt chloride nor reversed by the suppression of HIF-1α in hypoxia by shRNAi, siRNA, dominant negative HIF or inhibition with the small molecule NSC-134754, strongly suggesting that hypoxia-induced drug resistance in osteosarcoma cells is independent of HIF-1α. Inhibition of the phosphoinositide 3-kinase (PI3K pathway using the inhibitor PI-103 did not reverse hypoxia-induced drug resistance, suggesting the hypoxic activation of Akt in osteosarcoma cells does not play a significant role in hypoxia-induced drug resistance. Targeting hypoxia is an exciting prospect to improve current anti-cancer therapy and combat drug resistance. Significant hypoxia-induced drug resistance in osteosarcoma cells highlights the potential importance of hypoxia as a target

Molecular Mechanisms of Antipsychotic Drug-Induced Diabetes

Directory of Open Access Journals (Sweden)

Jiezhong Chen

2017-11-01

Full Text Available Antipsychotic drugs (APDs are widely prescribed to control various mental disorders. As mental disorders are chronic diseases, these drugs are often used over a life-time. However, APDs can cause serious glucometabolic side-effects including type 2 diabetes and hyperglycaemic emergency, leading to medication non-compliance. At present, there is no effective approach to overcome these side-effects. Understanding the mechanisms for APD-induced diabetes should be helpful in prevention and treatment of these side-effects of APDs and thus improve the clinical outcomes of APDs. In this review, the potential mechanisms for APD-induced diabetes are summarized so that novel approaches can be considered to relieve APD-induced diabetes. APD-induced diabetes could be mediated by multiple mechanisms: (1 APDs can inhibit the insulin signaling pathway in the target cells such as muscle cells, hepatocytes and adipocytes to cause insulin resistance; (2 APD-induced obesity can result in high levels of free fatty acids (FFA and inflammation, which can also cause insulin resistance. (3 APDs can cause direct damage to β-cells, leading to dysfunction and apoptosis of β-cells. A recent theory considers that both β-cell damage and insulin resistance are necessary factors for the development of diabetes. In high-fat diet-induced diabetes, the compensatory ability of β-cells is gradually damaged, while APDs cause direct β-cell damage, accounting for the severe form of APD-induced diabetes. Based on these mechanisms, effective prevention of APD-induced diabetes may need an integrated approach to combat various effects of APDs on multiple pathways.

Targeting Oct2 and P53: Formononetin prevents cisplatin-induced acute kidney injury

Energy Technology Data Exchange (ETDEWEB)

Huang, Di [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian (China); Wang, Chuangyuan [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Dalian, Liaoning (China); Duan, Yingjie [General hospital of Fuxin mining (Group) Co., Ltd (China); Meng, Qiang; Liu, Zhihao; Huo, Xiaokui; Sun, Huijun; Ma, Xiaodong [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Dalian, Liaoning (China); Liu, Kexin, E-mail: kexinliu@dlmedu.edu.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Dalian, Liaoning (China)

2017-07-01

Nephrotoxicity is one of major side effects of cisplatin in chemotherapy. Therefore, there is an urgent medical need to develop drugs that may protect kidney from toxicity. In previous study, we found that it showed the protective effects of formononetin against apoptosis by upregulating Nrf2. In this study, we investigated the renoprotective effect of formononetin against cisplatin-induced AKI and tried to elucidate the possible mechanisms. The amelioration of renal function, histopathological changes, and apoptosis in tubular cells was observed after formononetin treatment. Formononetin decreased expression of organic cation transporter 2 (Oct2) and increased the expressions of multidrug resistance-associated proteins (Mrps), which might result in a decrease accumulation of cisplatin in tubular cells after AKI. 5-Bromo-2-deoxyuridine (BrdU) and Ki-67 staining assay indicated that formononetin could promote the renal tubular cells proliferation after cisplatin nephrotoxicity. Moreover, formononetin regulated cyclins and pro-apoptotic proteins to involve the regulation of cell cycle. Furthermore, formononetin decreased p53 expression via promoting the overexpression of murine double minute 2 (MDM2) and MDMX. Taken together, formononetin provided protective effects by promoting proliferation of surviving renal tubular cells and inhibiting apoptosis after cisplatin-induced AKI. - Highlights: • Formononetin ameliorated the cisplatin-induced AKI. • Oct2 were reduced by formononetin. • Protective effect of formononetin was closely related to the reduction of cisplatin.

Targeting Oct2 and P53: Formononetin prevents cisplatin-induced acute kidney injury

International Nuclear Information System (INIS)

Huang, Di; Wang, Chuangyuan; Duan, Yingjie; Meng, Qiang; Liu, Zhihao; Huo, Xiaokui; Sun, Huijun; Ma, Xiaodong; Liu, Kexin

2017-01-01

Nephrotoxicity is one of major side effects of cisplatin in chemotherapy. Therefore, there is an urgent medical need to develop drugs that may protect kidney from toxicity. In previous study, we found that it showed the protective effects of formononetin against apoptosis by upregulating Nrf2. In this study, we investigated the renoprotective effect of formononetin against cisplatin-induced AKI and tried to elucidate the possible mechanisms. The amelioration of renal function, histopathological changes, and apoptosis in tubular cells was observed after formononetin treatment. Formononetin decreased expression of organic cation transporter 2 (Oct2) and increased the expressions of multidrug resistance-associated proteins (Mrps), which might result in a decrease accumulation of cisplatin in tubular cells after AKI. 5-Bromo-2-deoxyuridine (BrdU) and Ki-67 staining assay indicated that formononetin could promote the renal tubular cells proliferation after cisplatin nephrotoxicity. Moreover, formononetin regulated cyclins and pro-apoptotic proteins to involve the regulation of cell cycle. Furthermore, formononetin decreased p53 expression via promoting the overexpression of murine double minute 2 (MDM2) and MDMX. Taken together, formononetin provided protective effects by promoting proliferation of surviving renal tubular cells and inhibiting apoptosis after cisplatin-induced AKI. - Highlights: • Formononetin ameliorated the cisplatin-induced AKI. • Oct2 were reduced by formononetin. • Protective effect of formononetin was closely related to the reduction of cisplatin.

Dopamine receptor D4 promoter hypermethylation increases the risk of drug addiction.

Science.gov (United States)

Ji, Huihui; Xu, Xuting; Liu, Guili; Liu, Huifen; Wang, Qinwen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Hu, Haochang; Xu, Lei; Zhou, Wenhua; Duan, Shiwei

2018-02-01

Heroin and methylamphetamine (METH) are two addictive drugs that cause serious problems for society. Dopamine receptor D4 (DRD4), a key receptor in the dopaminergic system, may facilitate the development of drug addiction. The aim of the present study was to investigate the association between the promoter methylation level of DRD4 gene and drug addiction. Bisulfite pyrosequencing technology was used to measure the methylation levels of DRD4 promoter in 60 drug addicts and 52 matched controls. Significantly higher levels of DRD4 CpG1 and CpG4 methylation were detected in METH and heroin drug addicts compared with controls (Pdrug addiction.

Activity of the protector chlorophyllin or promoter of the genetic damage induced by the 1,2 dimethyl hydrazine

International Nuclear Information System (INIS)

Guerrero M, M.G.

2004-01-01

The chlorophyllin (CHLN) it is a porphyrin of soluble nutritious grade in water, derived of the chlorophyll that includes in their structure a copper atom. It has been reported that this pigment can act as anti mutagen, reducing the damage to the DNA caused by physical or chemical agents of direct or indirect action. Their anti carcinogen action has also been studied during the initiation phase induced for carcinogen as the aflatoxins and heterocyclic amines. In contrast the reports have increased on a probable promoter activity of the CHLN on the induced genetic damage. This effect was seen for the first time before the damage induced by alkylating agents in Salmonella. Recently it has been observed with the damage induced by gamma radiation, ENU and CrO 3 in somatic cells of the wing of Drosophila and in the induction of tumors for 1,2-dimethylhydrazine (DMH) in mice. Presently study is evaluated the protective effect or promoter of the CHLN before the genetic damage induced by 1,2-dimethylhydrazine, by means of the bioassay mutation and somatic recombination (SMART) in the wing of Drosophila melanogaster. Its were pretreated with CHLN or SAC to transheterocygotes larvas for two locus of the chromosome three mwh+/+flr 3 ; later on they are retarded the chronic treatment with DMH 0, 1, 2 and 3 days. It was measured the toxicity and the speed of development of the treated individuals. The wings of those adults that emerged were analyzed to register the number and the size of stains. The results indicated: differences in the viability of the individuals of the groups SAC + DMH vs CHLN + DMH only in the treated immediately after the pretreatment (DRT-0) that the CHLN doesn't modify the rate of the treated individuals development. The results of somatic mutation indicated that the CHLN has a protective effect only immediately after the pretreatment (DRT-0) however in DRT-1, 2 and 3 showed a promoter effect of genetic damage. (Author)

A significant association between BDNF promoter methylation and the risk of drug addiction.

Science.gov (United States)

Xu, Xuting; Ji, Huihui; Liu, Guili; Wang, Qinwen; Liu, Huifen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Zhou, Wenhua; Duan, Shiwei

2016-06-10

As a member of the neurotrophic factor family, brain derived neurotrophic factor (BDNF) plays an important role in the survival and differentiation of neurons. The aim of our work was to evaluate the role of BDNF promoter methylation in drug addiction. A total of 60 drug abusers (30 heroin and 30 methylamphetamine addicts) and 52 healthy age- and gender-matched controls were recruited for the current case control study. Bisulfite pyrosequencing technology was used to determine the methylation levels of five CpGs (CpG1-5) on the BDNF promoter. Among the five CpGs, CpG5 methylation was significantly lower in drug abusers than controls. Moreover, significant associations were found between CpG5 methylation and addictive phenotypes including tension-anxiety, anger-hostility, fatigue-inertia, and depression-dejection. In addition, luciferase assay showed that the DNA fragment of BDNF promoter played a key role in the regulation of gene expression. Our results suggest that BDNF promoter methylation is associated with drug addiction, although further studies are needed to understand the mechanisms by which BDNF promoter methylation contributes to the pathophysiology of drug addiction. Copyright © 2016. Published by Elsevier B.V.

microRNA-150 inhibits the formation of macrophage foam cells through targeting adiponectin receptor 2

Energy Technology Data Exchange (ETDEWEB)

Li, Jing [Department of Geratory, Linzi District People’s Hospital of Zibo City, Zibo, Shandong (China); Zhang, Suhua, E-mail: drsuhuangzhang@qq.com [Department of HealthCare, Qilu Hospital of Shandong University (Qingdao), Qingdao City, Qingdao (China)

2016-08-05

Transformation of macrophages into foam cells plays a critical role in the pathogenesis of atherosclerosis. The aim of this study was to determine the expression and biological roles of microRNA (miR)-150 in the formation of macrophage foam cells and to identify its functional target(s). Exposure to 50 μg/ml oxidized low-density lipoprotein (oxLDL) led to a significant upregulation of miR-150 in THP-1 macrophages. Overexpression of miR-150 inhibited oxLDL-induced lipid accumulation in THP-1 macrophages, while knockdown of miR-150 enhanced lipid accumulation. apoA-I- and HDL-mediated cholesterol efflux was increased by 66% and 43%, respectively, in miR-150-overexpressing macrophages relative to control cells. In contrast, downregulation of miR-150 significantly reduced cholesterol efflux from oxLDL-laden macrophages. Bioinformatic analysis and luciferase reporter assay revealed adiponectin receptor 2 (AdipoR2) as a direct target of miR-150. Small interfering RNA-mediated downregulation of AdipoR2 phenocopied the effects of miR-150 overexpression, reducing lipid accumulation and facilitating cholesterol efflux in oxLDL-treated THP-1 macrophages. Knockdown of AdipoR2 induced the expression of proliferator-activated receptor gamma (PPARγ), liver X receptor alpha (LXRα), ABCA1, and ABCG1. Moreover, pharmacological inhibition of PPARγ or LXRα impaired AdipoR2 silencing-induced upregulation of ABCA1 and ABCG1. Taken together, our results indicate that miR-150 can attenuate oxLDL-induced lipid accumulation in macrophages via promotion of cholesterol efflux. The suppressive effects of miR-150 on macrophage foam cell formation are mediated through targeting of AdipoR2. Delivery of miR-150 may represent a potential approach to prevent macrophage foam cell formation in atherosclerosis. -- Highlights: •miR-150 inhibits macrophage foam cell formation. •miR-150 accelerates cholesterol efflux from oxLDL-laden macrophages. •miR-150 suppresses macrophage foam cell

Drug-induced gynecomastia in children and adolescents

Science.gov (United States)

Goldman, Ran D.

2010-01-01

ABSTRACT QUESTION I frequently see adolescent boys in my practice with transient gynecomastia. My management includes reassuring the boys and their families; however, I also understand that specific medication, alcohol, and drugs can cause gynecomastia. How common is this phenomenon, and what medications can induce gynecomastia? ANSWER While gynecomastia is a physiologic phenomenon in most newborns and adolescents, it is important to consider pathologic conditions and medications that can cause breast enlargement. Antibiotics, antiulcer drugs, growth hormones, and chemotherapy have been reported to induce gynecomastia. Adolescents who use anabolic steroids, or who abuse alcohol, marijuana, heroin, or amphetamines, should be alerted to the fact that gynecomastia might develop. Treatment of drug-induced gynecomastia includes discontinuation of the offending drug. Very rarely is surgical intervention required. PMID:20393092

77 FR 12997 - Drug and Drug-Related Supply Promotion by Pharmaceutical Company Representatives at VA Facilities

Science.gov (United States)

2012-03-05

...,'' ``promotional materials,'' ``patient education materials,'' and ``individual departments.'' We disagree with the... supply, or therapeutic indication be submitted to a specific approval authority. With respect to... and associated materials regarding (1) a drug, drug-related supply, or new therapeutic indication for...

Drug-induced psoriasis: clinical perspectives

Directory of Open Access Journals (Sweden)

Balak DMW

2017-12-01

Full Text Available Deepak MW Balak, Enes Hajdarbegovic Department of Dermatology, Erasmus University Medical Center, Rotterdam, the Netherlands Abstract: Exposure to certain drugs can elicit an induction or exacerbation of psoriasis. Although well-conducted systematic studies on drug-related psoriasis are mostly lacking, traditionally strong associations have been documented for beta-blockers, lithium, antimalarial drugs such as (hydroxychloroquine, interferons, imiquimod, and terbinafine. More recently, new associations have been reported for monoclonal antibody- and small-molecule-based targeted therapies used for oncological and immunological indications, such as tumor necrosis factor-alpha antagonists and anti-programmed cell death protein 1 immune checkpoint inhibitors. Recognizing potential drug-related psoriasis is of clinical relevance to allow an optimal management of psoriasis. However, in clinical practice, identifying medication-related exacerbations and induction of psoriasis can be challenging. The clinical and histopathological features of drug-provoked psoriasis may differ little from that of “classical” nondrug-related forms of psoriasis. In addition, the latency period between start of the medication and onset of psoriasis can be significantly long for some drugs. Assessment of the Naranjo adverse drug reaction probability scale could be used as a practical tool to better differentiate drug-related psoriasis. The first step in the management of drug-related psoriasis is cessation and replacement of the offending drug when deemed clinically possible. However, the induced psoriasis skin lesions may persist after treatment withdrawal. Additional skin-directed treatment options for drug-related psoriasis follows the conventional psoriasis treatment guidelines and includes topical steroids and vitamin D analogs, ultraviolet phototherapy, systemic treatments, such as acitretin, methotrexate, and fumaric acid esters, and biological treatments

Platelets promote tumor growth and metastasis via direct interaction between Aggrus/podoplanin and CLEC-2.

Directory of Open Access Journals (Sweden)

Satoshi Takagi

Full Text Available The platelet aggregation-inducing factor Aggrus, also known as podoplanin, is frequently upregulated in several types of tumors and enhances hematogenous metastasis by interacting with and activating the platelet receptor CLEC-2. Thus, Aggrus-CLEC-2 binding could be a therapeutic molecular mechanism for cancer therapy. We generated a new anti-human Aggrus monoclonal antibody, MS-1, that suppressed Aggrus-CLEC-2 binding, Aggrus-induced platelet aggregation, and Aggrus-mediated tumor metastasis. Interestingly, the MS-1 monoclonal antibody attenuated the growth of Aggrus-positive tumors in vivo. Moreover, the humanized chimeric MS-1 antibody, ChMS-1, also exhibited strong antitumor activity against Aggrus-positive lung squamous cell carcinoma xenografted into NOD-SCID mice compromising antibody-dependent cellular cytotoxic and complement-dependent cytotoxic activities. Because Aggrus knockdown suppressed platelet-induced proliferation in vitro and tumor growth of the lung squamous cell carcinoma in vivo, Aggrus may be involved in not only tumor metastasis but also tumor growth by promoting platelet-tumor interaction, platelet activation, and secretion of platelet-derived factors in vivo. Our results indicate that molecular target drugs inhibiting specific platelet-tumor interactions can be developed as antitumor drugs that suppress both metastasis and proliferation of tumors such as lung squamous cell carcinoma.

Prevalence and Complications of Drug-induced Seizures in Baharloo Hospital, Tehran, Iran

Directory of Open Access Journals (Sweden)

Behnam Behnoush

2012-05-01

Full Text Available Background: Seizure is a frequent and important finding in the field of clinical toxicology. Almost all poisons and drugs can produce seizure. We have evaluated frequency and complications of drug-induced seizure in present study. Methods: The present descriptive cross-sectional study was done on patients who were referred to Baharloo Hospital, Tehran, Iran, that had developed seizure before or after hospitalization following intoxication between 20 March 2010 and 20 March 2011. The exclusion criteria were a positive history of epilepsy, head trauma, or abnormal findings in EEG or brain CT scan. Results: Tramadol and tricyclic antidepressants were the most common causes of drug-induced seizure (31.5% and 14.7% of the cases, respectively. Overall, 6 patients (4.2% had developed persistent vegetative state in consequence of brain hypoxia, 16 patients (11.2% had died due to complications of seizure or the poisoning itself. Tramadol was the leading cause of drug-induced seizure and its morbidity and mortality. Tonic-colonic seizure was the most common type of drug-induced seizure. Seizure had occurred once in 58% of the patients, twice in 37.1% of the patients, and had been revolutionized to status epilepticus in 4.9% of them. Among the 7 patients who had developed status epilepticus, 3 cases had died. Conclusion: Appropriate measures for treatment of seizure and prevention of its complications should be taken when patients with drug poisoning are admitted into hospital, especially when the offending drug(s has a higher likelihood to induce seizure.

Development of inducer-free expression plasmids based on IPTG-inducible promoters for Bacillus subtilis.

Science.gov (United States)

Tran, Dinh Thi Minh; Phan, Trang Thi Phuong; Huynh, Thanh Kieu; Dang, Ngan Thi Kim; Huynh, Phuong Thi Kim; Nguyen, Tri Minh; Truong, Tuom Thi Tinh; Tran, Thuoc Linh; Schumann, Wolfgang; Nguyen, Hoang Duc

2017-07-25

the inducible vector using the same promoter. Finally, we used gfp as a reporter gene in combination with the two promoters Pgrac01 and Pgrac100 to test the new vector types. The GFP expression levels could be repressed at least 1.5 times for the Pgrac01-gfp+ inducer-free construct in E. coli. The inducer-free constructs Pgrac01-gfp+ and Pgrac100-gfp+ allowed GFP expression at high levels from 23 × 10 4 to 32 × 10 4 RFU units and 9-13% of total intracellular proteins. We could reconfirm the two major advantages of the new inducer-free expression plasmids: (1) Strong repression of the target gene expression in the E. coli cloning strain, and (2) production of the target protein at high levels in B. subtilis in the absence of the inducer. We propose a general strategy to generate inducer-free expression vector by using IPTG-inducible vectors, and more specifically we developed inducer-free expression plasmids using IPTG-inducible promoters in the absence of the LacI repressor. These plasmids could be an excellent choice for high-level production of recombinant proteins in B. subtilis without the addition of inducer and at the same time maintaining a low basal level of the recombinant proteins in E. coli. The repression of the recombinant gene expression would facilitate cloning of genes that potentially inhibit the growth of E. coli cloning strains. The inducer-free expression plasmids will be extended versions of the current available IPTG-inducible expression vectors for B. subtilis, in which all these vectors use the same cognate promoters. These inducer-free and previously developed IPTG-inducible expression plasmids will be a useful cassette to study gene expression at a small scale up to a larger scale up for the production of recombinant proteins.

Contribution of a mesocorticolimbic subcircuit to drug context-induced reinstatement of cocaine-seeking behavior in rats.

Science.gov (United States)

Lasseter, Heather C; Xie, Xiaohu; Arguello, Amy A; Wells, Audrey M; Hodges, Matthew A; Fuchs, Rita A

2014-02-01

Cocaine-seeking behavior triggered by drug-paired environmental context exposure is dependent on orbitofrontal cortex (OFC)-basolateral amygdala (BLA) interactions. Here, we present evidence supporting the hypothesis that dopaminergic input from the ventral tegmental area (VTA) to the OFC critically regulates these interactions. In experiment 1, we employed site-specific pharmacological manipulations to show that dopamine D1-like receptor stimulation in the OFC is required for drug context-induced reinstatement of cocaine-seeking behavior following extinction training in an alternate context. Intra-OFC pretreatment with the dopamine D1-like receptor antagonist, SCH23390, dose-dependently attenuated cocaine-seeking behavior in an anatomically selective manner, without altering motor performance. Furthermore, the effects of SCH23390 could be surmounted by co-administration of a sub-threshold dose of the D1-like receptor agonist, SKF81297. In experiment 2, we examined effects of D1-like receptor antagonism in the OFC on OFC-BLA interactions using a functional disconnection manipulation. Unilateral SCH23390 administration into the OFC plus GABA agonist-induced neural inactivation of the contralateral or ipsilateral BLA disrupted drug context-induced cocaine-seeking behavior relative to vehicle, while independent unilateral manipulations of these brain regions were without effect. Finally, in experiment 3, we used fluorescent retrograde tracers to demonstrate that the VTA, but not the substantia nigra, sends dense intra- and interhemispheric projections to the OFC, which in turn has reciprocal bi-hemispheric connections with the BLA. These findings support that dopaminergic input from the VTA, via dopamine D1-like receptor stimulation in the OFC, is required for OFC-BLA functional interactions. Thus, a VTA-OFC-BLA neural circuit promotes drug context-induced motivated behavior.

Activation of human stearoyl-coenzyme A desaturase 1 contributes to the lipogenic effect of PXR in HepG2 cells.

Directory of Open Access Journals (Sweden)

Jun Zhang

Full Text Available The pregnane X receptor (PXR was previously known as a xenobiotic receptor. Several recent studies suggested that PXR also played an important role in lipid homeostasis but the underlying mechanism remains to be clearly defined. In this study, we found that rifampicin, an agonist of human PXR, induced lipid accumulation in HepG2 cells. Lipid analysis showed the total cholesterol level increased. However, the free cholesterol and triglyceride levels were not changed. Treatment of HepG2 cells with rifampicin induced the expression of the free fatty acid transporter CD36 and ABCG1, as well as several lipogenic enzymes, including stearoyl-CoA desaturase-1 (SCD1, long chain free fatty acid elongase (FAE, and lecithin-cholesterol acyltransferase (LCAT, while the expression of acyl:cholesterol acetyltransferase(ACAT1 was not affected. Moreover, in PXR over-expressing HepG2 cells (HepG2-PXR, the SCD1 expression was significantly higher than in HepG2-Vector cells, even in the absence of rifampicin. Down-regulation of PXR by shRNA abolished the rifampicin-induced SCD1 gene expression in HepG2 cells. Promoter analysis showed that the human SCD1 gene promoter is activated by PXR and a novel DR-7 type PXR response element (PXRE response element was located at -338 bp of the SCD1 gene promoter. Taken together, these results indicated that PXR activation promoted lipid synthesis in HepG2 cells and SCD1 is a novel PXR target gene.

Promoter Methylation and BDNF and DAT1 Gene Expression Profiles in Patients with Drug Addiction.

Science.gov (United States)

Kordi-Tamandani, Dor Mohammad; Tajoddini, Shahrad; Salimi, Farzaneh

2015-01-01

Drug addiction is a brain disorder that has negative consequences for individuals and society. Addictions are chronic relapsing diseases of the brain that are caused by direct drug-induced effects and persevering neuroadaptations at the epigenetic, neuropeptide and neurotransmitter levels. Because the dopaminergic system has a significant role in drug abuse, the purpose of this study was to analyze the methylation and expression profile of brain-derived neurotrophic factor (BDNF) and dopamine transporter (DAT1) genes in individuals with drug addiction. BDNF and DAT1 promoter methylation were investigated with a methylation-specific polymerase chain reaction (PCR) technique in blood samples from 75 individuals with drug addiction and 65 healthy controls. The expression levels of BDNF and DAT1 were assessed in 12 mRNA samples from the blood of patients and compared to the samples of healthy controls (n = 12) with real-time quantitative reverse transcription PCR. No significant differences were found in the methylation of BDNF and DAT1 between patients and controls, but the relative levels of expression of BDNF and DAT1 mRNA differed significantly in the patients compared to controls (p drug addiction.

The silence of MUC2 mRNA induced by promoter hypermethylation associated with HBV in Hepatocellular Carcinoma

Directory of Open Access Journals (Sweden)

Ling Yang

2013-01-01

Full Text Available Abstract Background To evaluate the promoter methylation status of MUC2 gene and mRNA expression in patients with hepatocellular carcinoma. Methods We analyzed MUC2 methylation by MSP, and MUC2 mRNA by real-time PCR in 74 HCC. Results MUC2 mRNA were lower in HCC tissues (Mean -ΔCt = −4.70 than that in Non-HCC tissues (Mean -ΔCt = −2.98. Expression of MUC2 was elevated in only 23 (31.08% of the 74 HCC patients. MUC2 promoter was hypermethylated in 62.2% (46/74 of HCCs, and in only 18.9% (14/74 of non-tumor samples. MUC2 mRNA were lower in HCC patients with hypermethylation (Mean -ΔΔCt = −2.25 than those with demethylation (Mean -ΔΔCt = −0.22, and there is a decreased tendency for MUC2 mRNA in HCC patients with promoter hypermethylation (p = 0.011. There was a significantly correlation found between MUC2 mRNA and HBV and AFP in HCC. The loss of MUC2 mRNA and hypermethylation could be poor prognostic factors. After treated by 5-Aza-CdR and TSA, we found that MUC2 mRNA induced significantly in 7721, Huh7 and HepG2 cells. Conclusion The results suggested that MUC2 mRNA silenced by promoter hypermethylation is associated with high levels HBV in HCC.

Antithyroid Drug-induced Agranulocytosis

Directory of Open Access Journals (Sweden)

Ming-Tsung Sun

2009-08-01

Full Text Available Antithyroid drugs are widely used to treat hyperthyroidism, especially Graves' disease, but they tend to cause agranulocytosis, which increases the mortality rate. Granulocyte colony-stimulating factor decreases the duration of recovery from agranulocytosis. We retrospectively studied cases of antithyroid drug-induced agranulocytosis over the past 10 years in a northern Taiwan medical center. A clinical evaluation was conducted, including a review of complete blood cell counts and differential counts. Four cases were included in this analysis. Agranulocytosis persisted in 2 cases despite a change in therapy from propylthiouracil to methimazole. Fever, sore throat, and diarrhea were common symptoms of agranulocytosis. Initial white blood cell counts ranged from 450 to 1,710/μL. Only 1 case had a positive result from a throat swab culture (Staphylococcus aureus. Three of 4 cases received granulocyte colony-stimulating factor therapy, and the recovery time ranged from 3 to 13 days. All of the patients recovered from agranulocytosis. We concluded that: (1 conducting a routine complete blood cell count is beneficial in alerting caregivers to the possibility of agranulocytosis; (2 educating patients about the common symptoms of agranulocytosis may contribute to an early diagnosis; (3 providing granulocyte colony-stimulating factor therapy to patients results in good prognosis; and (4 monitoring for cross-reactions between drugs should be performed to prevent further episodes of agranulocytosis.

The Platelet Aggregation-Inducing Factor Aggrus/Podoplanin Promotes Pulmonary Metastasis

Science.gov (United States)

Kunita, Akiko; Kashima, Takeshi G.; Morishita, Yasuyuki; Fukayama, Masashi; Kato, Yukinari; Tsuruo, Takashi; Fujita, Naoya

2007-01-01

Tumor cell-induced platelet aggregation has been reported to facilitate hematogenous metastasis. Aggrus/podoplanin is a platelet aggregation-inducing factor that is up-regulated in a number of human cancers and has been implicated in tumor progression. We studied herein the role of Aggrus in tumor growth, metastasis, and survival in vivo. Aggrus expression in Chinese hamster ovary cells promoted pulmonary metastasis in both an experimental and a spontaneous mouse model. No differences in the size of metastatic foci or in primary tumor growth were found in either set of mice. Aggrus-expressing cells, which were covered with platelets, arrested in the lung microvasculature 30 minutes after injection. In addition, lung metastasis resulting from Aggrus expression decreased the survival of the mice. By generating several Aggrus point mutants, we revealed that point mutation at the platelet aggregation-stimulating domain of Aggrus (Thr34 and Thr52) obliterated both platelet aggregation and metastasis. Furthermore, administration of aspirin to mice reduced the number of metastatic foci. These results indicate that Aggrus contributes to the establishment of metastasis by promoting platelet aggregation without affecting subsequent growth. Thus, Aggrus could serve as an ideal therapeutic target for drug development to block metastasis. PMID:17392172

Vitiligo, drug induced (image)

Science.gov (United States)

... this person's face have resulted from drug-induced vitiligo. Loss of melanin, the primary skin pigment, occasionally ... is the case with this individual. The typical vitiligo lesion is flat and depigmented, but maintains the ...

Tranexamic acid-induced fixed drug eruption

Directory of Open Access Journals (Sweden)

Natsuko Matsumura

2015-01-01

Full Text Available A 33-year-old male showed multiple pigmented patches on his trunk and extremities after he took tranexamic acid for common cold. He stated that similar eruptions appeared when he was treated with tranexamic acid for influenza 10 months before. Patch test showed positive results at 48 h and 72 h by 1% and 10% tranexamic acid at the lesional skin only. To our knowledge, nine cases of fixed drug eruption induced by tranexamic acid have been reported in Japan. Tranexamic acid is a safe drug and frequently used because of its anti-fibrinolytic and anti-inflammatory effects, but caution of inducing fixed drug eruption should be necessary.

B1-induced caspase-independent apoptosis in MCF-7 cells is mediated by down-regulation of Bcl-2 via p53 binding to P2 promoter TATA box

International Nuclear Information System (INIS)

Liang Xin; Xu Ke; Xu Yufang; Liu Jianwen; Qian Xuhong

2011-01-01

The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report here that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P 2 promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research highlights: → B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. → B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. → B1 induced significant increase of p53 binding to Bcl-2 P 2 promoter TATA box.

Mitofusin2 decreases intracellular cholesterol of oxidized LDL-induced foam cells from rat vascular smooth muscle cells.

Science.gov (United States)

He, Chao; Chen, Ying; Liu, Chun; Cao, Ming; Fan, Yu-jin; Guo, Xiao-mei

2013-04-01

Mitofusin2 (Mfn2) plays a pivotal role in the proliferation and apoptosis of vascular smooth muscle cells (VSMCs). The purpose of this study was to investigate the effects of Mfn2 on the trafficking of intracellular cholesterol in the foam cells derived from rat VSMCs (rVSMCs) and also to investigate the effects of Mfn2 on the expression of adenosine triphosphate-binding cassette subfamily A member 1 (ABCA1), adenosine triphosphate-binding cassette subfamily G member 1 (ABCG1) and peroxisome proliferator-activated receptor gamma (PPARγ). The rVSMCs were co-cultured with oxidized low density lipoprotein (LDL, 80 μg/mL) to produce foam cells and cholesterol accumulation in cells. Before oxidized LDL treatment, different titers (20, 40 and 60 pfu/cell) of recombinant adenovirus containing Mfn2 gene (Adv-Mfn2) were added into the culture medium for 24 h to transfect the Mfn2 gene into the rVSMCs. Then the cells were harvested for analyses. The protein expression of Mfn2 was significantly higher in Adv-Mfn2-transfected group than in untransfected group (PLDL treatment, rVSMCs became irregular and their nuclei became larger, and their plasma abounded with red lipid droplets. However, the number of red lipid droplets was significantly decreased in Adv-Mfn2-transfected group as compared with untransfected group. At 48 h after oxidized LDL treatment, the intracellular cholesterol in rVSMCs was significantly increased (P0.05), the phosporylation levels of PPARγ were significantly decreased in Adv-Mfn2-transfected group as compared with untransfected group (Pcholesterol in oxidized LDL-induced rVSMCs possibly by decreasing PPARγ phosporylation and then increasing protein expression levels of ABCA1 and ABCG1, which may be helpful to suppress the formation of foam cells.

Comparison of clinical features between primary and drug-induced sleep-related eating disorder

Directory of Open Access Journals (Sweden)

Komada Y

2016-05-01

Full Text Available Yoko Komada,1 Yoshikazu Takaesu,2 Kentaro Matsui,3 Masaki Nakamura,3 Shingo Nishida,3 Meri Kanno,3,† Akira Usui,3 Yuichi Inoue1,3 1Department of Somnology, 2Department of Psychiatry, Tokyo Medical University, 3Japan Somnology Center, Institute of Neuropsychiatry, Tokyo, Japan †Meri Kanno passed away on March 1, 2016 Purpose: The aim of this study was to ascertain the clinical characteristics of drug-induced sleep-related eating disorder (SRED. Patients and methods: We retrospectively reviewed the medical records of 30 patients with primary SRED (without any comorbid sleep disorders and who were not taking any possible causative medications, and ten patients with drug-induced SRED (occurrence of SRED episodes after starting nightly medication of sedative drugs, which completely resolved after dose reduction or discontinuation of the sedatives. Results: All patients with drug-induced SRED took multiple types of sedatives, such as benzodiazepines or benzodiazepine receptor agonists. Clinical features of drug-induced SRED compared with primary SRED were as follows: higher mean age of onset (40 years old in drug-induced SRED vs 26 years old in primary SRED, significantly higher rate of patients who had total amnesia during most of their SRED episodes (75.0% vs 31.8%, significantly lower rate of comorbidity of night eating syndrome (0% vs 63.3%, and significantly lower rate of history of sleepwalking (10.0% vs 46.7%. Increased doses of benzodiazepine receptor agonists may be responsible for drug-induced SRED. Conclusion: The clinical features of drug-induced SRED were different from those of primary SRED, possibly reflecting differences in the underlying mechanisms between these two categories of SREDs. Keywords: nocturnal eating syndrome, night eating, eating disorder, hypnotics, amnesia, sleepwalking, benzodiazepine

Nonacetaminophen Drug-Induced Acute Liver Failure.

Science.gov (United States)

Thomas, Arul M; Lewis, James H

2018-05-01

Acute liver failure of all causes is diagnosed in between 2000 and 2500 patients annually in the United States. Drug-induced acute liver failure is the leading cause of acute liver failure, accounting for more than 50% of cases. Nonacetaminophen drug injury represents 11% of all cases in the latest registry from the US Acute Liver Failure Study Group. Although rare, acute liver failure is clinically dramatic when it occurs, and requires a multidisciplinary approach to management. In contrast with acetaminophen-induced acute liver failure, non-acetaminophen-induced acute liver failure has a more ominous prognosis with a lower liver transplant-free survival. Copyright © 2018 Elsevier Inc. All rights reserved.

Overexpression of pig selenoprotein S blocks OTA-induced promotion of PCV2 replication by inhibiting oxidative stress and p38 phosphorylation in PK15 cells

Science.gov (United States)

Gan, Fang; Hu, Zhihua; Huang, Yu; Xue, Hongxia; Huang, Da; Qian, Gang; Hu, Junfa; Chen, Xingxiang; Wang, Tian; Huang, Kehe

2016-01-01

Porcine circovirus type 2 (PCV2) is the primary cause of porcine circovirus disease, and ochratoxin A (OTA)-induced oxidative stress promotes PCV2 replication. In humans, selenoprotein S (SelS) has antioxidant ability, but it is unclear whether SelS affects viral infection. Here, we stably transfected PK15 cells with pig pCDNA3.1-SelS to overexpress SelS. Selenium (Se) at 2 or 4 μM and SelS overexpression blocked the OTA-induced increases of PCV2 DNA copy number and infected cell numbers. SelS overexpression also increased glutathione (GSH), NF-E2-related factor 2 (Nrf2) mRNA, and γ-glutamyl-cysteine synthetase mRNA levels; decreased reactive oxygen species (ROS) levels; and inhibited p38 phosphorylation in PCV2-infected PK15 cells, regardless of OTA treatment. Buthionine sulfoximine reversed all of the above SelS-induced changes. siRNA-mediated SelS knockdown decreased Nrf2 mRNA and GSH levels, increased ROS levels, and promoted PCV2 replication in OTA-treated PK15 cells. These data indicate that pig SelS blocks OTA-induced promotion of PCV2 replication by inhibiting the oxidative stress and p38 phosphorylation in PK15 cells. PMID:26943035

Genetic association analysis of ATP binding cassette protein family reveals a novel association of ABCB1 genetic variants with epilepsy risk, but not with drug-resistance.

Directory of Open Access Journals (Sweden)

Shabeesh Balan

Full Text Available Epilepsy constitutes a heterogeneous group of disorders that is characterized by recurrent unprovoked seizures due to widely different etiologies. Multidrug resistance remains a major issue in clinical epileptology, where one third of patients with epilepsy continue to have seizures. Role of efflux transporters in multidrug resistant epilepsy has been attributed to drug-resistant epilepsy although, with discrepant observation in genetic studies. These discrepancies could be attributed to variety of factors such as variable definition of the anti-epileptic drug (AED-resistance, variable epilepsy phenotypes and ethnicities among the studies. In the present study we inquired the role of multidrug transporters ABCB1 and ABCG2 variants in determining AED-resistance and susceptibility to epilepsy in three well-characterized cohorts comprising of mesial temporal lobe epilepsy with hippocampal sclerosis (MTLE-HS (prototype for AED-resistant epilepsy; juvenile myoclonic epilepsy (JME (prototype for AED-responsive epilepsy; and healthy non-epileptic controls, in 738 subjects of Malayalam speaking south Indian ancestry. ABCB1 and ABCG2 variants were not found to be associated with drug resistance when AED-resistant and AED-responsive cohorts were compared. However, a significant association was observed between ABCB1 (C3435T rs1045642 and risk of having epilepsy (MTLE-HS and JME pooled cohort; genotypic p-value = 0.0002; allelic p-value = 0.004. This association was seen persistent with MTLE-HS (genotypic p-value = 0.0008; allelic p-value = 0.004 and also with JME (genotypic p-value = 0.01; allelic p-value = 0.05 cohort individually. In-silico functional prediction indicated that ABCB1 rs1045642 has a deleterious impact on protein coding function and in splicing regulation. We conclude that the ABCB1 and ABCG2 variants do not confer to AED-resistance in the study population. However, ABCB1 rs1045642 increases vulnerability to epilepsy with greater tendency

Association of drug transporter expression with mortality and progression-free survival in stage IV head and neck squamous cell carcinoma.

Directory of Open Access Journals (Sweden)

Rolf Warta

Full Text Available Drug transporters such as P-glycoprotein (ABCB1 have been associated with chemotherapy resistance and are considered unfavorable prognostic factors for survival of cancer patients. Analyzing mRNA expression levels of a subset of drug transporters by quantitative reverse transcription polymerase chain reaction (qRT-PCR or protein expression by tissue microarray (TMA in tumor samples of therapy naïve stage IV head and neck squamous cell carcinoma (HNSCC (qRT-PCR, n = 40; TMA, n = 61, this in situ study re-examined the significance of transporter expression for progression-free survival (PFS and overall survival (OS. Data from The Cancer Genome Atlas database was used to externally validate the respective findings (n = 317. In general, HNSCC tended to lower expression of drug transporters compared to normal epithelium. High ABCB1 mRNA tumor expression was associated with both favorable progression-free survival (PFS, p = 0.0357 and overall survival (OS, p = 0.0535. Similar results were obtained for the mRNA of ABCC1 (MRP1, multidrug resistance-associated protein 1; PFS, p = 0.0183; OS, p = 0.038. In contrast, protein expression of ATP7b (copper transporter ATP7b, mRNA expression of ABCG2 (BCRP, breast cancer resistance protein, ABCC2 (MRP2, and SLC31A1 (hCTR1, human copper transporter 1 did not correlate with survival. Cluster analysis however revealed that simultaneous high expression of SLC31A1, ABCC2, and ABCG2 indicates poor survival of HNSCC patients. In conclusion, this study militates against the intuitive dogma where high expression of drug efflux transporters indicates poor survival, but demonstrates that expression of single drug transporters might indicate even improved survival. Prospectively, combined analysis of the 'transportome' should rather be performed as it likely unravels meaningful data on the impact of drug transporters on survival of patients with HNSCC.

One man's poison is another man's meat: using azithromycin-induced phospholipidosis to promote ocular surface health.

Science.gov (United States)

Liu, Yang; Kam, Wendy R; Ding, Juan; Sullivan, David A

2014-06-05

Drug-induced phospholipidosis (PLD) is a common adverse effect which has led to the termination of clinical trials for many candidate pharmaceuticals. However, this lipid-inducing effect may be beneficial in the treatment of meibomian gland dysfunction (MGD). MGD is the major cause of dry eye disease (DED), which affects 40 million people in the USA and has no cure. Azithromycin (AZM) is a PLD-inducing antibiotic that is used off-label to treat MGD, and is presumably effective because it suppresses the MGD-associated conjunctival inflammation (i.e. posterior blepharitis) and growth of lid bacteria. We hypothesize that AZM can act directly to promote the function of human meibomian gland epithelial cells by inducing PLD in these cells, characterized by the accumulation of lipids and lysosomes. Immortalized human meibomian gland epithelial cells (HMGEC) were cultured with or without azithromycin for 5 days. Cells were evaluated for cholesterol (Filipin) and neutral lipid (LipidTox) staining, as well as the appearance of lysosomes (LysoTracker) and lamellar bodies (transmission electron microscopy, TEM). The lipid composition of cellular lysates was analyzed by high performance thin-layer chromatography. Our findings demonstrate that AZM stimulates the accumulation of free cholesterol, neutral lipids and lysosomes in HMGEC. This AZM-induced increase of neutral lipid content occurred predominantly within lysosomes. Many of these vesicles appeared to be lamellar bodies by TEM, which is the characteristic of PLD. Our findings also show that AZM promotes an accumulation of free and esterified cholesterol, as well as phospholipids in HMGECimmortalized. Our results support our hypothesis and confirm the beneficial effect of PLD induced by AZM on HMGEC. Our discovery reveals a new potential use of PLD-inducing drugs, and makes this adverse effect a beneficial effect. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

A study of promotional advertisements of drugs in a medical journal: an ethics perspective.

Science.gov (United States)

Nath, Sarmila; Bhowmick, Subhrojyoti; Dutta, Trayambak; Chowrasia, V R; Bhattacharya, Shipra; Chatterjee, R N; Sarkar, Manjula; Ram, A K; Mukherjee, P K

2014-01-01

The study assessed 54 advertisements of 145 different drugs, published over one year (from December 2011 to November 2012) in an Indian medical journal, circulated widely mainly among general practitioners (GPs). The ethical guidelines of the World Health Organization (WHO) and Organisation of Pharmaceutical Producers of India (OPPI) for medicinal drug promotion were applied. The brand name was mentioned in all advertisements (100% compliance both with the WHO and OPPI criteria) and the names of the active ingredients were also mentioned in 128 (90.14%) advertisements. However, major adverse drug reactions were mentioned in only two advertisements (1.37%); precautions, contraindications and warnings in only two (1.37%); and major interactions in only one (0.68%). Only three advertisements (2.06%) were well substantiated with references. To ensure the ethical promotionof drugs among GPs, journals must introduce compulsory review and appraisal of promotional advertisements by a dedicated review board, including at least one member trained in pharmacology and one representative from the medical division of a pharmaceutical company.

Hypoxic human cancer cells are sensitized to BH-3 mimetic–induced apoptosis via downregulation of the Bcl-2 protein Mcl-1

Science.gov (United States)

Harrison, Luke R.E.; Micha, Dimitra; Brandenburg, Martin; Simpson, Kathryn L.; Morrow, Christopher J.; Denneny, Olive; Hodgkinson, Cassandra; Yunus, Zaira; Dempsey, Clare; Roberts, Darren; Blackhall, Fiona; Makin, Guy; Dive, Caroline

2011-01-01

Solid tumors contain hypoxic regions in which cancer cells are often resistant to chemotherapy-induced apoptotic cell death. Therapeutic strategies that specifically target hypoxic cells and promote apoptosis are particularly appealing, as few normal tissues experience hypoxia. We have found that the compound ABT-737, a Bcl-2 homology domain 3 (BH-3) mimetic, promotes apoptotic cell death in human colorectal carcinoma and small cell lung cancer cell lines exposed to hypoxia. This hypoxic induction of apoptosis was mediated through downregulation of myeloid cell leukemia sequence 1 (Mcl-1), a Bcl-2 family protein that serves as a biomarker for ABT-737 resistance. Downregulation of Mcl-1 in hypoxia was independent of hypoxia-inducible factor 1 (HIF-1) activity and was consistent with decreased global protein translation. In addition, ABT-737 induced apoptosis deep within tumor spheroids, consistent with an optimal hypoxic oxygen tension being necessary to promote ABT-737–induced cell death. Tumor xenografts in ABT-737–treated mice also displayed significantly more apoptotic cells within hypoxic regions relative to normoxic regions. Synergies between ABT-737 and other cytotoxic drugs were maintained in hypoxia, suggesting that this drug may be useful in combination with chemotherapeutic agents. Taken together, these findings suggest that Mcl-1–sparing BH-3 mimetics may induce apoptosis in hypoxic tumor cells that are resistant to other chemotherapeutic agents and may have a role in combinatorial chemotherapeutic regimens for treatment of solid tumors. PMID:21393866

Retigabine, a Kv7.2/Kv7.3-Channel Opener, Attenuates Drug-Induced Seizures in Knock-In Mice Harboring Kcnq2 Mutations.

Science.gov (United States)

Ihara, Yukiko; Tomonoh, Yuko; Deshimaru, Masanobu; Zhang, Bo; Uchida, Taku; Ishii, Atsushi; Hirose, Shinichi

2016-01-01

The hetero-tetrameric voltage-gated potassium channel Kv7.2/Kv7.3, which is encoded by KCNQ2 and KCNQ3, plays an important role in limiting network excitability in the neonatal brain. Kv7.2/Kv7.3 dysfunction resulting from KCNQ2 mutations predominantly causes self-limited or benign epilepsy in neonates, but also causes early onset epileptic encephalopathy. Retigabine (RTG), a Kv7.2/ Kv7.3-channel opener, seems to be a rational antiepileptic drug for epilepsies caused by KCNQ2 mutations. We therefore evaluated the effects of RTG on seizures in two strains of knock-in mice harboring different Kcnq2 mutations, in comparison to the effects of phenobarbital (PB), which is the first-line antiepileptic drug for seizures in neonates. The subjects were heterozygous knock-in mice (Kcnq2Y284C/+ and Kcnq2A306T/+) bearing the Y284C or A306T Kcnq2 mutation, respectively, and their wild-type (WT) littermates, at 63-100 days of age. Seizures induced by intraperitoneal injection of kainic acid (KA, 12mg/kg) were recorded using a video-electroencephalography (EEG) monitoring system. Effects of RTG on KA-induced seizures of both strains of knock-in mice were assessed using seizure scores from a modified Racine's scale and compared with those of PB. The number and total duration of spike bursts on EEG and behaviors monitored by video recording were also used to evaluate the effects of RTG and PB. Both Kcnq2Y284C/+ and Kcnq2A306T/+ mice showed significantly more KA-induced seizures than WT mice. RTG significantly attenuated KA-induced seizure activities in both Kcnq2Y284C/+ and Kcnq2A306T/+ mice, and more markedly than PB. This is the first reported evidence of RTG ameliorating KA-induced seizures in knock-in mice bearing mutations of Kcnq2, with more marked effects than those observed with PB. RTG or other Kv7.2-channel openers may be considered as first-line antiepileptic treatments for epilepsies resulting from KCNQ2 mutations.

Metabolic activation of hepatotoxic drug (benzbromarone) induced mitochondrial membrane permeability transition

Energy Technology Data Exchange (ETDEWEB)

Shirakawa, Maho; Sekine, Shuichi; Tanaka, Ayaka [The Laboratory of Biopharmaceutics, Graduate School of Pharmaceutical Sciences, Chiba University, Chiba (Japan); Horie, Toshiharu [Faculty of Pharmaceutical Sciences, Teikyo Heisei University, Tokyo (Japan); Ito, Kousei, E-mail: itokousei@chiba-u.jp [The Laboratory of Biopharmaceutics, Graduate School of Pharmaceutical Sciences, Chiba University, Chiba (Japan)

2015-10-01

The risk of drug-induced liver injury (DILI) is of great concern to the pharmaceutical industry. It is well-known that metabolic activation of drugs to form toxic metabolites (TMs) is strongly associated with DILI onset. Drug-induced mitochondrial dysfunction is also strongly associated with increased risk of DILI. However, it is difficult to determine the target of TMs associated with exacerbation of DILI because of difficulties in identifying and purifying TMs. In this study, we propose a sequential in vitro assay system to assess TM formation and their ability to induce mitochondrial permeability transition (MPT) in a one-pot process. In this assay system, freshly-isolated rat liver mitochondria were incubated with reaction solutions of 44 test drugs preincubated with liver microsomes in the presence or absence of NADPH; then, NADPH-dependent MPT pore opening was assessed as mitochondrial swelling. In this assay system, several hepatotoxic drugs, including benzbromarone (BBR), significantly induced MPT in a NADPH-dependent manner. We investigated the rationality of using BBR as a model drug, since it showed the most prominent MPT in our assay system. Both the production of a candidate toxic metabolite of BBR (1′,6-(OH){sub 2} BBR) and NADPH-dependent MPT were inhibited by several cytochrome P450 (CYP) inhibitors (clotrimazole and SKF-525A, 100 μM). In summary, this assay system can be used to evaluate comprehensive metabolite-dependent MPT without identification or purification of metabolites. - Highlights: • We constructed a sequential assay system for toxic metabolite induced MPT in one pot. • 14 drugs (e.g. benzbromarone (BBR)) induced toxic metabolite dependent MPT. • Both the production of toxic metabolite and MPT could be inhibited by CYP inhibitors. • This system could evaluate the comprehensive MPT without purification of metabolites.

Developing and promoting an intranet site for a drug information service.

Science.gov (United States)

Costerison, Emily C; Graham, Angie S

2008-04-01

The development and promotion of a drug information service (DIS) intranet site are described. Stanford Hospital and Clinics (SHC) is an acute and tertiary care facility with 613 licensed inpatient beds and 48 outpatient clinics. A DIS intranet site was developed to allow better accessibility to pharmacy forms and products (e.g., drug shortage list, reference guides) and to reduce repetitive requests to the DIS. The goal was to continue to provide information to SHC health care providers but allow the drug information specialist to focus on answering clinical questions. The intranet site was completed over a four-month period. The intranet site was divided into seven webpages: DIS overview, pharmacy and therapeutics, frequently asked questions, quick drug reference guide, ask the pharmacist, drug information resources, and referral center. The preparation for and implementation of the promotional phase took approximately two months. Promotional strategies included the creation and dissemination of brochures and stickers. The intranet site went live on January 1, 2007, and the advertising campaign began one month later. The utility of the site was measured for five months by tracking the number of visits to the site, the number of visits to each webpage, and the number of downloaded files. Request volume, caller affiliation, and question types received by the DIS call center were also recorded. Establishing a DIS intranet site required a considerable time investment and a willingness to work with existing infrastructures, such as the marketing and communications department and Web marketing staff.

Cardiovascular drugs inducing QT prolongation: facts and evidence.

Science.gov (United States)

Taira, Carlos A; Opezzo, Javier A W; Mayer, Marcos A; Höcht, Christian

2010-01-01

Acquired QT syndrome is mainly caused by the administration of drugs that prolong ventricular repolarization. On the other hand, the risk of drug-induced torsades de pointes is increased by numerous predisposing factors, such as genetic predisposition, female sex, hypokalemia and cardiac dysfunction. This adverse reaction is induced by different chemical compounds used for the treatment of a variety of pathologies, including arrhythmias. As it is known, antiarrhythmic agents and other cardiovascular drugs can prolong the QT interval, causing this adverse reaction. Of the 20 most commonly reported drugs, 10 were cardiovascular agents and these appeared in 348 of the reports (46%). Class Ia antiarrhythmic agents have frequently been linked to inducing arrhythmia, including torsades de pointes. Sotalol and amiodarone, class III antiarrhythmics, are known to prolong the QT interval by blocking I(Kr). Due to the severity of events caused by the therapeutic use of these drugs, in this work of revision the cardiovascular drugs that present this property and the factors and evidence will be mentioned.

Primary psychosis with comorbid drug abuse and drug-induced psychosis: Diagnostic and clinical evolution at follow up.

Science.gov (United States)

Mauri, M C; Di Pace, C; Reggiori, A; Paletta, S; Colasanti, A

2017-10-01

The study reports a follow-up assessment of 48 patients with concomitant drug abuse at the first admission for psychosis. We focused on the diagnostic distinction between primary psychosis with concomitant drug abuse and drug induced psychosis, to observe whether the diagnoses are stable over time and whether the clinical course significantly differs. The study examined 25 primary psychotic disorder with comorbid drug abuse and 23 drug-induced psychotic disorder patients. Diagnostic and psychopathological assessments were made at baseline and at follow-up. Mean follow-up period was 4.96 years. Patients with comorbid Drug Abuse exhibited higher scores in the item Unusual Content of Thought at baseline than drug-induced psychotic disorder patients: 5.48 vs 4.39 while the two patients groups did not differ in any of the BPRS items evaluated at follow-up. The primary psychosis with comorbid drug abuse and the substance induced psychosis groups were similar regarding diagnostic stability, and a diagnosis of schizophrenia at follow-up occurred similarly. There was no evidence that Drug Induced psychotic patients' symptoms tend to improve more after cessation of drug abuse. An earlier age of onset was found in primary psychotic patients, particularly for patients diagnosed as affected by schizophrenia at follow up. These results might reflect the uncertainty of the distinction between Primary and Drug Induced Psychosis and the difficulties in applying the DSM IV-TR criteria for diagnosing comorbid drug use disorders and psychotic disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

PIF4 Promotes Expression of LNG1 and LNG2 to Induce Thermomorphogenic Growth in Arabidopsis

Directory of Open Access Journals (Sweden)

Geonhee Hwang

2017-07-01

Full Text Available Arabidopsis plants adapt to high ambient temperature by a suite of morphological changes including elongation of hypocotyls and petioles and leaf hyponastic growth. These morphological changes are collectively called thermomorphogenesis and are believed to increase leaf cooling capacity by enhancing transpiration efficiency, thereby increasing tolerance to heat stress. The bHLH transcription factor PHYTOCHROME INTERACTING FACTOR4 (PIF4 has been identified as a major regulator of thermomorphogenic growth. Here, we show that PIF4 promotes the expression of two homologous genes LONGIFOLIA1 (LNG1 and LONGIFOLIA2 (LNG2 that have been reported to regulate leaf morphology. ChIP-Seq analyses and ChIP assays showed that PIF4 directly binds to the promoters of both LNG1 and LNG2. The expression of LNG1 and LNG2 is induced by high temperature in wild type plants. However, the high temperature activation of LNG1 and LNG2 is compromised in the pif4 mutant, indicating that PIF4 directly regulates LNG1 and LNG2 expression in response to high ambient temperatures. We further show that the activities of LNGs support thermomorphogenic growth. The expression of auxin biosynthetic and responsive genes is decreased in the lng quadruple mutant, implying that LNGs promote thermomorphogenic growth by activating the auxin pathway. Together, our results demonstrate that LNG1 and LNG2 are directly regulated by PIF4 and are new components for the regulation of thermomorphogenesis.

The Conundrum of Online Prescription Drug Promotion Comment on "Trouble Spots in Online Direct-to-Consumer Prescription Drug Promotion: A Content Analysis of FDA Warning Letters".

Science.gov (United States)

Wanasika, Isaac

2016-03-26

This commentary discusses pertinent issues from Hyosun Kim's paper on online prescription drug promotion. The study is well-designed and the findings highlight some of the consequences of the Food and Drug Administration's (FDA's) decision to deregulate online advertising of prescription drugs. While Kim's findings confirm some of the early concerns, they also provide a perspective of implementation challenges in the ever-changing technological environment. © 2016 by Kerman University of Medical Sciences.

Chemical inducible promoter used to obtain transgenic plants with a silent marker

Science.gov (United States)

Aoyama, Takashi; Zuo, Jianru; Chua, Nam-Hai

2004-08-31

A chemically inducible promoter is described that may be used to transform plants, including tobacco and lettuce, with genes which are easily regulatable by adding the plants or plant cells to a medium containing an inducer of the promoter or by removing the plants or plant cells from such medium. The promoter described is one that is inducible by a glucocorticoid which is not endogenous to plants. Such promoters may be used with a variety of genes such as ipt or knotted1 to induce shoot formation in the presence of a glucocorticoid. The promoter may also be used with antibiotic or herbicide resistance genes which are then regulatable by the presence or absence of inducer rather than being constitutive. Other examples of genes which may be placed under the control of the inducible promoter are also presented.

Thrombocytopenia induced by noncytotoxic drugs in Denmark 1968-91

DEFF Research Database (Denmark)

Pedersen-Bjergaard, U; Andersen, M; Hansen, P B

1996-01-01

reporting system on adverse drug reactions. SUBJECTS: A total of 309 critically reviewed cases of drug-induced thrombocytopenia reported during the period from 1968 to the end of 1991. RESULTS: Sodiumaurothiomalate and the combination sulfamethoxazole with trimethoprim were the most commonly reported single...... numerously reported. The still-growing list of thrombocytopenia-inducing agents contained 110 different drugs. At present, 20% of reported cases concern drugs not previously registered as causing thrombocytopenia in Denmark. Twenty-five per cent of all cases were caused by drugs which appeared only...

Unexpected Binding Mode of a Potent Indeno[1,2-b]indole-Type Inhibitor of Protein Kinase CK2 Revealed by Complex Structures with the Catalytic Subunit CK2α and Its Paralog CK2α′

Directory of Open Access Journals (Sweden)

Jennifer Hochscherf

2017-12-01

Full Text Available Protein kinase CK2, a member of the eukaryotic protein kinase superfamily, is associated with cancer and other human pathologies and thus an attractive drug target. The indeno[1,2-b]indole scaffold is a novel lead structure to develop ATP-competitive CK2 inhibitors. Some indeno[1,2-b]indole-based CK2 inhibitors additionally obstruct ABCG2, an ABC half transporter overexpressed in breast cancer and co-responsible for drug efflux and resistance. Comprehensive derivatization studies revealed substitutions of the indeno[1,2-b]indole framework that boost either the CK2 or the ABCG2 selectivity or even support the dual inhibition potential. The best indeno[1,2-b]indole-based CK2 inhibitor described yet (IC50 = 25 nM is 5-isopropyl-4-(3-methylbut-2-enyl-oxy-5,6,7,8-tetrahydroindeno[1,2-b]indole-9,10-dione (4p. Herein, we demonstrate the membrane permeability of 4p and describe co-crystal structures of 4p with CK2α and CK2α′, the paralogs of human CK2 catalytic subunit. As expected, 4p occupies the narrow, hydrophobic ATP site of CK2α/CK2α′, but surprisingly with a unique orientation: its hydrophobic substituents point towards the solvent while its two oxo groups are hydrogen-bonded to a hidden water molecule. An equivalent water molecule was found in many CK2α structures, but never as a critical mediator of ligand binding. This unexpected binding mode is independent of the interdomain hinge/helix αD region conformation and of the salt content in the crystallization medium.

Hydrocortisone-induced embryotoxicity and embryonic drug disposition in H-2 congenic mice

International Nuclear Information System (INIS)

Roberts, L.S.G.

1986-01-01

Congenic mouse strains C57BL/10Sn (B10) and B10.A/SgSn(B10A), genetically different only at the H-2 complex, were compared for sensitivity to glucocorticoid-induced embryotoxicity and embryonic drug disposition. B10A mice dosed intramuscularly with 0, 100, 150 and 200 mg hydrocortisone/kg body weight on gestational day twelve, and B10 mice injected with 0, 200, 400, 600, and 800 mg/kg, were evaluated at dissection on gestational day eighteen for signs of toxicity. In both strains, probit analysis of cleft palate production demonstrated a linear dose response. The ED50 for cleft palate production demonstrates a linear dose response. The ED50 for cleft palate production in B10A mice was 143.6 mg/kg and 512.0 mg/kg for the B10 strain. Embryonic exposure was evaluated by administration of 3 H-hydrocortisone (5 uCi/mouse) to pregnant mice on day twelve of gestation, at the ED50 for cleft palate production in B10A strain. The purposes of the experiment were to quantify the difference in susceptibility to steroid-induced cleft palate, determine if a milder manifestation of embryotoxicity, fetal growth retardation, occurred at sub-clefting dosages, and determine if the difference in sensitivity to hydrocortisone-induced embryotoxicity was the result of an underlying difference in embryonic exposure to the teratogen

Preventing Unnecessary Costs of Drug-Induced Hypoglycemia in Older Adults with Type 2 Diabetes in the United States and Canada.

Science.gov (United States)

Boulin, Mathieu; Diaby, Vakaramoko; Tannenbaum, Cara

2016-01-01

The costs of drug-induced hypoglycemia are a critical but often neglected component of value-based arguments to reduce tight glycemic control in older adults with type 2 diabetes. An economic (decision-tree) analysis compared rates, costs, quality-adjusted life-years, and incremental costs per quality-adjusted life-year gained associated with mild, moderate and severe hypoglycemic events for 6 glucose-lowering medication classes in type 2 diabetic adults aged 65-79 versus those 80 years and older. The national U.S. (Center for Medicare Services) and Canadian public health payer perspectives were adopted. Incidence rates of drug-induced hypoglycemia were the highest for basal insulin and sulfonylureas: 8.64 and 4.32 events per person-year in 65-79 year olds, and 12.06 and 6.03 events per person-year for 80 years and older. In both the U.S. and Canada, metformin dominated sulfonylureas, basal insulin and glucagon-like peptide1 receptor agonists. Relative to sulfonylureas, thiazolidinediones had the lowest incremental cost-effectiveness ratios in the U.S. and dominated sulfonylureas in Canada for adults 80 years and older. Relative to sulfonylureas, dipeptidyl peptidase4 inhibitors were cost-effective for adults 80 years and older in both countries, and for 65-79 year olds in Canada. Annual costs of hypoglycemia for older adults attaining very tight glycemic control with the use of insulin or sulfonylureas were estimated at U.S.$509,214,473 in the U.S. and CAN$65,497,849 in Canada. Optimizing drug therapy for older type 2 diabetic adults through the avoidance of drug-induced hypoglycemia will dramatically improve patient health while also generating millions of dollars by saving unnecessary medical costs.

Drug perfusion enhancement in tissue model by steady streaming induced by oscillating microbubbles.

Science.gov (United States)

Oh, Jin Sun; Kwon, Yong Seok; Lee, Kyung Ho; Jeong, Woowon; Chung, Sang Kug; Rhee, Kyehan

2014-01-01

Drug delivery into neurological tissue is challenging because of the low tissue permeability. Ultrasound incorporating microbubbles has been applied to enhance drug delivery into these tissues, but the effects of a streaming flow by microbubble oscillation on drug perfusion have not been elucidated. In order to clarify the physical effects of steady streaming on drug delivery, an experimental study on dye perfusion into a tissue model was performed using microbubbles excited by acoustic waves. The surface concentration and penetration length of the drug were increased by 12% and 13%, respectively, with streaming flow. The mass of dye perfused into a tissue phantom for 30s was increased by about 20% in the phantom with oscillating bubbles. A computational model that considers fluid structure interaction for streaming flow fields induced by oscillating bubbles was developed, and mass transfer of the drug into the porous tissue model was analyzed. The computed flow fields agreed with the theoretical solutions, and the dye concentration distribution in the tissue agreed well with the experimental data. The computational results showed that steady streaming with a streaming velocity of a few millimeters per second promotes mass transfer into a tissue. © 2013 Published by Elsevier Ltd.

Sulindac, a nonsteroidal anti-inflammatory drug, selectively inhibits interferon-γ-induced expression of the chemokine CXCL9 gene in mouse macrophages

International Nuclear Information System (INIS)

Sakaeda, Yoshiichi; Hiroi, Miki; Shimojima, Takahiro; Iguchi, Mayumi; Kanegae, Haruhide; Ohmori, Yoshihiro

2006-01-01

Sulindac, a non-steroidal anti-inflammatory drug, has been shown to exert an anti-tumor effect on several types of cancer. To determine the effect of sulindac on intracellular signaling pathways in host immune cells such as macrophages, we investigated the effect of the drug on interferon gamma (IFNγ)-induced expression of signal transducer and activator of transcription 1 (STAT1) and other genes in mouse macrophage-like cell line RAW264.7 cells. Sulindac, but not aspirin or sodium salicylate, inhibited IFNγ-induced expression of the CXC ligand 9 (CXCL9) mRNA, a chemokine for activated T cells, whereas the interferon-induced expression of CXCL10 or IFN regulatory factor-1 was not affected by sulindac. Luciferase reporter assay demonstrated that sulindac inhibited IFNγ-induced promoter activity of the CXCL9 gene. Surprisingly, sulindac had no inhibitory effect on IFNγ-induced STAT1 activation; however, constitutive nuclear factor κB activity was suppressed by the drug. These results indicate that sulindac selectively inhibited IFNγ-inducible gene expression without inhibiting STAT1 activation

Advantageous use of HepaRG cells for the screening and mechanistic study of drug-induced steatosis

Energy Technology Data Exchange (ETDEWEB)

Tolosa, Laia [Unidad de Hepatología Experimental, Instituto de Investigación Sanitaria La Fe, Valencia 46026 (Spain); Gómez-Lechón, M. José [Unidad de Hepatología Experimental, Instituto de Investigación Sanitaria La Fe, Valencia 46026 (Spain); CIBERehd, FIS, Barcelona 08036 (Spain); Jiménez, Nuria [Unidad de Hepatología Experimental, Instituto de Investigación Sanitaria La Fe, Valencia 46026 (Spain); Hervás, David [Biostatistics Unit, Instituto de Investigación Sanitaria La Fe, Valencia 46026 (Spain); Jover, Ramiro [Unidad de Hepatología Experimental, Instituto de Investigación Sanitaria La Fe, Valencia 46026 (Spain); CIBERehd, FIS, Barcelona 08036 (Spain); Departamento de Bioquímica y Biología Molecular, Facultad de Medicina, Universidad de Valencia, Valencia 46010 (Spain); Donato, M. Teresa, E-mail: donato_mte@gva.es [Unidad de Hepatología Experimental, Instituto de Investigación Sanitaria La Fe, Valencia 46026 (Spain); CIBERehd, FIS, Barcelona 08036 (Spain); Departamento de Bioquímica y Biología Molecular, Facultad de Medicina, Universidad de Valencia, Valencia 46010 (Spain)

2016-07-01

Only a few in vitro assays have been proposed to evaluate the steatotic potential of new drugs. The present study examines the utility of HepaRG cells as a cell-based assay system for screening drug-induced liver steatosis. A high-content screening assay was run to evaluate multiple toxicity-related cell parameters in HepaRG cells exposed to 28 compounds, including drugs reported to cause steatosis through different mechanisms and non-steatotic compounds. Lipid content was the most sensitive parameter for all the steatotic drugs, whereas no effects on lipid levels were produced by non-steatotic compounds. Apart from fat accumulation, increased ROS production and altered mitochondrial membrane potential were also found in the cells exposed to steatotic drugs, which indicates that all these cellular events contributed to drug-induced hepatotoxicity. These findings are of clinical relevance as most effects were observed at drug concentrations under 100-fold of the therapeutic peak plasmatic concentration. HepaRG cells showed increased lipid overaccumulation vs. HepG2 cells, which suggests greater sensitivity to drug-induced steatosis. An altered expression profile of transcription factors and the genes that code key proteins in lipid metabolism was also found in the cells exposed to drugs capable of inducing liver steatosis. Our results generally indicate the value of HepaRG cells for assessing the risk of liver damage associated with steatogenic compounds and for investigating the molecular mechanisms involved in drug-induced steatosis. - Highlights: • HepaRG cells were explored as an in vitro model to detect steatogenic potential. • Multiple toxicity-related endpoints were analysed by HCS. • HepaRG showed a greater sensitivity to drug-induced steatosis than HepG2 cells. • Changes in the expression of genes related to lipid metabolism were revealed. • HepaRG allow mechanistic understanding of liver damage induced by steatogenic drugs.

Advantageous use of HepaRG cells for the screening and mechanistic study of drug-induced steatosis

International Nuclear Information System (INIS)

Tolosa, Laia; Gómez-Lechón, M. José; Jiménez, Nuria; Hervás, David; Jover, Ramiro; Donato, M. Teresa

2016-01-01

Only a few in vitro assays have been proposed to evaluate the steatotic potential of new drugs. The present study examines the utility of HepaRG cells as a cell-based assay system for screening drug-induced liver steatosis. A high-content screening assay was run to evaluate multiple toxicity-related cell parameters in HepaRG cells exposed to 28 compounds, including drugs reported to cause steatosis through different mechanisms and non-steatotic compounds. Lipid content was the most sensitive parameter for all the steatotic drugs, whereas no effects on lipid levels were produced by non-steatotic compounds. Apart from fat accumulation, increased ROS production and altered mitochondrial membrane potential were also found in the cells exposed to steatotic drugs, which indicates that all these cellular events contributed to drug-induced hepatotoxicity. These findings are of clinical relevance as most effects were observed at drug concentrations under 100-fold of the therapeutic peak plasmatic concentration. HepaRG cells showed increased lipid overaccumulation vs. HepG2 cells, which suggests greater sensitivity to drug-induced steatosis. An altered expression profile of transcription factors and the genes that code key proteins in lipid metabolism was also found in the cells exposed to drugs capable of inducing liver steatosis. Our results generally indicate the value of HepaRG cells for assessing the risk of liver damage associated with steatogenic compounds and for investigating the molecular mechanisms involved in drug-induced steatosis. - Highlights: • HepaRG cells were explored as an in vitro model to detect steatogenic potential. • Multiple toxicity-related endpoints were analysed by HCS. • HepaRG showed a greater sensitivity to drug-induced steatosis than HepG2 cells. • Changes in the expression of genes related to lipid metabolism were revealed. • HepaRG allow mechanistic understanding of liver damage induced by steatogenic drugs.

Drug Eruptions Induced by Allopurinol Associated with HLA-BFNx015801

Directory of Open Access Journals (Sweden)

Meihua Zeng

2015-01-01

Full Text Available Allopurinol, a drug commonly used for treating gout and hyperuricemia, is a frequent cause of drug eruptions. Recent investigations suggest that HLA-BFNx015801 allele is a very strong marker for allopurinol-induced cutaneous adverse drug reactions (cADRs. In this article we report two cases of allopurinol-induced drug eruptions in patients carrying the HLA-BFNx015801 allele and review the literature on the association between HLA-BFNx015801 and allopurinol-induced cADRs based on a MEDLINE and PubMed search

Consumer perceptions of prescription and over-the-counter drug advertisements with promotional offers.

Science.gov (United States)

Aikin, Kathryn J; Sullivan, Helen W; O'Donoghue, Amie C; Betts, Kevin R

2016-01-01

Information on the effects of promotional offers in direct-to-consumer prescription drug ads is limited. In two studies, we examined the effect of promotional offers (e.g., money-back guarantee) and ad type (creating prescription and over-the-counter drug ads by varying the presence of benefit and risk information). We found little effect of promotional offers. Adding benefit (risk) information to the ad increased consumers' knowledge of the benefit (risk) information and their efficacy (risk) perceptions. In most cases, adding risk information to an ad with benefit information increased risk knowledge and perceptions without decreasing benefit knowledge or perceptions.

The role of germline promoters and I exons in cytokine-induced gene-specific class switch recombination.

Science.gov (United States)

Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T

2011-01-01

Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.

Fibroblast growth factor-2-induced host stroma reaction during initial tumor growth promotes progression of mouse melanoma via vascular endothelial growth factor A-dependent neovascularization.

Science.gov (United States)

Tsunoda, Satoshi; Nakamura, Toshiyuki; Sakurai, Hiroaki; Saiki, Ikuo

2007-04-01

Fibroblast growth factor (FGF)-2 has been considered to play a critical role in neovascularization in several tumors; however, its precise role in tumor progression is not fully understood. In the present study, we have characterized the role of FGF-2 in B16-BL6 mouse melanoma cells, focusing on effects during the initial phase of tumor growth. FGF-2 was injected at the tumor inoculation site of dorsal skin during the initial phase. FGF-2 induced marked tumor growth and lymph node metastasis. This was well correlated with an increase in neovascularization in the host stroma. FGF-2 also recruited inflammatory and mesenchymal cells in host stroma. Marked tumor growth, pulmonary metastasis and intensive neovascularization in tumor parenchyma were also observed after a single injection of FGF-2 into the footpad inoculation site. In contrast, repeated injections of FGF-2 at a site remote from the footpad tumor were ineffective in promoting tumor growth and metastasis. These promoting activities of FGF-2 were blocked by local injections of a glucocorticoid hormone, suggesting that host inflammatory responses induced by FGF-2 are associated with FGF-2-induced tumor progression. In addition, although FGF-2 did not promote cellular proliferation and vascular endothelial growth factor A (VEGFA) mRNA expression in B16-BL6 cells in vitro, FGF-2 induced VEGFA expression in host stroma rather than tumor tissue, and local injections of a neutralizing antibody against VEGFA inhibited these activities of FGF-2 in vivo. These results indicate that abundant FGF-2 during the initial phase of tumor growth induces VEGFA-dependent intensive neovascularization in host stroma, and supports marked tumor growth and metastasis.

Characterization of the promoter of human CRTh2, a prostaglandin D{sub 2} receptor

Energy Technology Data Exchange (ETDEWEB)

Quapp, Russell; Madsen, Norman [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada); Cameron, Lisa [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada)

2007-11-30

Chemoattractant-receptor homologous molecule expressed on Th2 cells (CRTh2) is a receptor for prostaglandin (PG)D{sub 2}, a lipid mediator involved in allergic inflammation. CRTh2 is expressed by Th2 cells, eosinophils and basophils and PDG{sub 2}-CRTh2 signaling induces calcium mobilization, cell migration and expression of the Th2 cytokines IL-4, IL-5, and IL-13. Despite the role of CRTh2 in allergic inflammation, transcriptional regulation of this gene has not been studied. Here, we demonstrated that a reporter construct of the CRTh2 promoter was induced following T cell stimulation. This activity could be further enhanced by over-expression of GATA-3, but not NFAT2 or STAT6. Electromobility shift assay demonstrated GATA-3 binding to a probe from the CRTh2 promoter. This study provides the first detailed analysis of transcriptional regulation of the human CRTh2 promoter. These findings may help identify strategies to attenuate expression of this gene and influence the maintenance and proliferation of Th2 cells in allergic inflammation.

Melatonin modulates drug-induced acute porphyria

Directory of Open Access Journals (Sweden)

Sandra M. Lelli

Full Text Available This work investigated the modulation by melatonin (Mel of the effects of the porphyrinogenic drugs 2-allyl-2-isopropylacetamide (AIA and 3,5-diethoxycarbonyl-1,4-dihydro-2,4,6-collidine (DDC on oxidative environment, glucose biosynthesis and heme pathway parameters. Administration of Mel before rat intoxication with AIA/DDC showed a clear beneficial effect in all cases. Mel induced decreases of 42% and 35% in the excretion of the hemeprecursors 5-aminolevulinic acid (ALA and porphobilinogen (PBG, respectively, and a 33% decrease in the induction of the heme regulatory enzyme 5-aminolevulinic acid-synthase (ALA-S. The activity of the glucose metabolism enzyme phosphoenolpyruvate carboxykinase (PEPCK, which had been diminished by the porphyrinogenic treatment, was restored by 45% when animals were pre-treated with Mel. Mel abolished the modest decrease in glucose 6-phospatase (G6Pase activity caused by AIA/DDC treatment. The oxidative status of lipids was attenuated by Mel treatment in homogenates by 47%, whereas no statistically significant AIA/DDC-induced increase in thiobarbituric acid reactive substances (TBARS was observed in microsomes after Mel pre-treatment. We hypothesize that Mel may be scavenging reactive species of oxygen (ROS that could be damaging lipids, PEPCK, G6Pase and ferrochelatase (FQ. Additionally, Mel administration resulted in the repression of the key enzyme ALA-S, and this could be due to an increase in glucose levels, which is known to inhibit ALA-S induction. The consequent decrease in levels of the heme precursors ALA and PBG had a beneficial effect on the drug-induced porphyria. The results obtained open the possibility of further research on the use of melatonin as a co-treatment option in acute porphyria. Keywords: Melatonin, Glucose synthesis, Heme pathway, Acute porphyria, Oxidative stress

Drug-induced regulation of target expression

DEFF Research Database (Denmark)

Iskar, Murat; Campillos, Monica; Kuhn, Michael

2010-01-01

Drug perturbations of human cells lead to complex responses upon target binding. One of the known mechanisms is a (positive or negative) feedback loop that adjusts the expression level of the respective target protein. To quantify this mechanism systems-wide in an unbiased way, drug......-induced differential expression of drug target mRNA was examined in three cell lines using the Connectivity Map. To overcome various biases in this valuable resource, we have developed a computational normalization and scoring procedure that is applicable to gene expression recording upon heterogeneous drug treatments....... In 1290 drug-target relations, corresponding to 466 drugs acting on 167 drug targets studied, 8% of the targets are subject to regulation at the mRNA level. We confirmed systematically that in particular G-protein coupled receptors, when serving as known targets, are regulated upon drug treatment. We...

Porous Polymer Drug-Eluting Coating Prepared by Radiation Induced Polymerization

International Nuclear Information System (INIS)

Veres, M.; Beiler, B.; Himics, L.; Tóth, S.; Koós, M.

2010-01-01

Many areas of modern medicine are almost unimaginable without the use of different kinds of implants. They used as replacements, supports, auxiliary devices etc. for various parts or functions of the body. Their use has many advantages, however there could be some drawbacks too, like the possibility of rejection, inflammation and other side-effects. Many of these drawbacks are directly related to the materials used for the implant fabrication. Coatings are widely used to eliminate the unwanted effects appearing after the implantation. In addition to the protection and separation of tissues from the implant material they could also enhance the functionality and the acceptance of the artificial device and also promote the regeneration of the tissues after the intervention. Drug-eluting coatings are a good example for the latter. By delivery and controlled elution of drugs they could actively suppress inflammatory reactions, allergy and rejection of the implant, and their activity is localized to the place where these effects could mainly occur – to the region of the implant. This project is aimed to develop a drug-eluting porous polymer coating by radiation induced polymerization that can be used in different medical implants. The primary objects for this research are coronary stents however these porous layers could have perspective in other types of medical devices too. The main objectives are to develop a method for coating the surface of medical grade metallic alloy wires, plates and tubes with a porous polymer nanocomposite layer prepared by radiation induced polymerization and to characterize the obtained coatings

Porous Polymer Drug-Eluting Coating Prepared by Radiation Induced Polymerization

Energy Technology Data Exchange (ETDEWEB)

Veres, M.; Beiler, B.; Himics, L.; Tóth, S.; Koós, M., E-mail: vm@szfki.hu [Hungarian Academy of Sciences, Research Institute for Solid State Physics and Optics, Department of Laser Applications, Konkoly Thege Miklós ut 29-33, 1121 Budapest, P.O. Box 49, 1525 Budapest (Hungary)

2010-07-01

Many areas of modern medicine are almost unimaginable without the use of different kinds of implants. They used as replacements, supports, auxiliary devices etc. for various parts or functions of the body. Their use has many advantages, however there could be some drawbacks too, like the possibility of rejection, inflammation and other side-effects. Many of these drawbacks are directly related to the materials used for the implant fabrication. Coatings are widely used to eliminate the unwanted effects appearing after the implantation. In addition to the protection and separation of tissues from the implant material they could also enhance the functionality and the acceptance of the artificial device and also promote the regeneration of the tissues after the intervention. Drug-eluting coatings are a good example for the latter. By delivery and controlled elution of drugs they could actively suppress inflammatory reactions, allergy and rejection of the implant, and their activity is localized to the place where these effects could mainly occur – to the region of the implant. This project is aimed to develop a drug-eluting porous polymer coating by radiation induced polymerization that can be used in different medical implants. The primary objects for this research are coronary stents however these porous layers could have perspective in other types of medical devices too. The main objectives are to develop a method for coating the surface of medical grade metallic alloy wires, plates and tubes with a porous polymer nanocomposite layer prepared by radiation induced polymerization and to characterize the obtained coatings.

Drug-induced low blood sugar

Science.gov (United States)

Drug-induced low blood sugar is low blood glucose that results from taking medicine. ... Low blood sugar (hypoglycemia) is common in people with diabetes who are taking insulin or other medicines to control their diabetes. ...

Tissue specific promoters improve the localization of radiation-inducible gene expression

International Nuclear Information System (INIS)

Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph

1996-01-01

Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene

hypoxia-inducible factors activate CD133 promoter through ETS family transcription factors.

Directory of Open Access Journals (Sweden)

Shunsuke Ohnishi

Full Text Available CD133 is a cellular surface protein that has been reported to be a cancer stem cell marker, and thus it is considered to be a potential target for cancer treatment. However, the mechanism regulating CD133 expression is not yet understood. In this study, we analyzed the activity of five putative promoters (P1-P5 of CD133 in human embryonic kidney (HEK 293 cells and colon cancer cell line WiDr, and found that the activity of promoters, particularly of P5, is elevated by overexpression of hypoxia-inducible factors (HIF-1α and HIF-2α. Deletion and mutation analysis identified one of the two E-twenty six (ETS binding sites (EBSs in the P5 region as being essential for its promoter activity induced by HIF-1α and HIF-2α. In addition, a chromatin imunoprecipitation assay demonstrated that HIF-1α and HIF-2α bind to the proximal P5 promoter at the EBSs. The immunoprecipitation assay showed that HIF-1α physically interacts with Elk1; however, HIF-2α did not bind to Elk1 or ETS1. Furthermore, knockdown of both HIF-1α and HIF-2α resulted in a reduction of CD133 expression in WiDr. Taken together, our results revealed that HIF-1α and HIF-2α activate CD133 promoter through ETS proteins.

Effects of photobiomodulation therapy and topical non-steroidal anti-inflammatory drug on skeletal muscle injury induced by contusion in rats-part 2: biochemical aspects.

Science.gov (United States)

Tomazoni, Shaiane Silva; Frigo, Lúcio; Dos Reis Ferreira, Tereza Cristina; Casalechi, Heliodora Leão; Teixeira, Simone; de Almeida, Patrícia; Muscara, Marcelo Nicolas; Marcos, Rodrigo Labat; Serra, Andrey Jorge; de Carvalho, Paulo de Tarso Camillo; Leal-Junior, Ernesto Cesar Pinto

2017-11-01

Muscle injuries trigger an inflammatory process, releasing important biochemical markers for tissue regeneration. The use of non-steroidal anti-inflammatory drugs (NSAIDs) is the treatment of choice to promote pain relief due to muscle injury. NSAIDs exhibit several adverse effects and their efficacy is questionable. Photobiomodulation therapy (PBMT) has been demonstrated to effectively modulate inflammation induced from musculoskeletal disorders and may be used as an alternative to NSAIDs. Here, we assessed and compared the effects of different doses of PBMT and topical NSAIDs on biochemical parameters during an acute inflammatory process triggered by a controlled model of contusion-induced musculoskeletal injury in rats. Muscle injury was induced by trauma to the anterior tibial muscle of rats. After 1 h, rats were treated with PBMT (830 nm, continuous mode, 100 mW of power, 35.71 W/cm 2 ; 1, 3, and 9 J; 10, 30, and 90 s) or diclofenac sodium (1 g). Our results demonstrated that PBMT, 1 J (35.7 J/cm 2 ), 3 J (107.1 J/cm 2 ), and 9 J (321.4 J/cm 2 ) reduced the expression of tumor necrosis factor alpha (TNF-α) and cyclooxygenase-2 (COX-2) genes at all assessed times as compared to the injury and diclofenac groups (p levels of COX-2 only in relation to the injury group (p levels of cytokines TNF-α, interleukin (IL)-1β, and IL-6 at all assessed times as compared to the injury and diclofenac groups (p topical NSAIDs in the modulation of the inflammatory process caused by muscle contusion injuries.

Sesquiterpene lactones isolated from indigenous Middle Eastern plants inhibit tumor promoter-induced transformation of JB6 cells

Directory of Open Access Journals (Sweden)

Saikali Melody

2012-07-01

Full Text Available Abstract Background Sesquiterpene lactones (SL are plant secondary metabolites that are known for their anti-fungal, anti-bacterial, anti-inflammatory, and anti-tumor properties. Considering that several SL-derived drugs are currently in cancer clinical trials, we have tested two SL molecules, 3-β-methoxy-iso-seco-tanapartholide (β-tan isolated from Achillea falcata and salograviolide A (Sal A isolated from Centaurea ainetensis, for their anti-tumor properties. We used the mouse epidermal JB6P + cells as a model for tumor promotion and cellular transformation. Key players that are involved in cellular transformation and tumorigenesis are the AP-1 and NF-κB transcription factors; therefore, we assessed how β-tan and Sal A modulate their signaling pathways in JB6P + cells. Methods The effects of β-tan and Sal A on the growth of normal and neoplastic keratinocytes and on the tumor promotion-responsive JB6P + cells were determined using the MTT assay. Anchorage-independent cell growth transformation assays were used to evaluate the anti-tumor promoting properties of these SL molecules in JB6P + cells and dual luciferase reporter assays and western blot analysis were used to investigate their effects on tumor promoter-induced AP-1 and NF-κB activities and protein levels of key AP-1 and NF-кB target genes. Results β-tan and Sal A selectively inhibited tumor promoter-induced cell growth and transformation of JB6P + cells at concentrations that do not affect JB6P + and primary keratinocytes basal cell growth. In addition, both molecules reduced basal and tumor promoter-induced NF-κB transcriptional activities, differentially regulated basal and tumor promoter-induced AP-1 transcriptional activities, and modulated key players of the AP-1 and NF-κB signaling pathways. Conclusions These results highlight the anti-tumor promoting properties of β-tan and Sal A. These SL molecules isolated from two plant species native to

Sesquiterpene lactones isolated from indigenous Middle Eastern plants inhibit tumor promoter-induced transformation of JB6 cells.

Science.gov (United States)

Saikali, Melody; Ghantous, Akram; Halawi, Racha; Talhouk, Salma N; Saliba, Najat A; Darwiche, Nadine

2012-07-09

Sesquiterpene lactones (SL) are plant secondary metabolites that are known for their anti-fungal, anti-bacterial, anti-inflammatory, and anti-tumor properties. Considering that several SL-derived drugs are currently in cancer clinical trials, we have tested two SL molecules, 3-β-methoxy-iso-seco-tanapartholide (β-tan) isolated from Achillea falcata and salograviolide A (Sal A) isolated from Centaurea ainetensis, for their anti-tumor properties. We used the mouse epidermal JB6P + cells as a model for tumor promotion and cellular transformation. Key players that are involved in cellular transformation and tumorigenesis are the AP-1 and NF-κB transcription factors; therefore, we assessed how β-tan and Sal A modulate their signaling pathways in JB6P + cells. The effects of β-tan and Sal A on the growth of normal and neoplastic keratinocytes and on the tumor promotion-responsive JB6P + cells were determined using the MTT assay. Anchorage-independent cell growth transformation assays were used to evaluate the anti-tumor promoting properties of these SL molecules in JB6P + cells and dual luciferase reporter assays and western blot analysis were used to investigate their effects on tumor promoter-induced AP-1 and NF-κB activities and protein levels of key AP-1 and NF-кB target genes. β-tan and Sal A selectively inhibited tumor promoter-induced cell growth and transformation of JB6P + cells at concentrations that do not affect JB6P + and primary keratinocytes basal cell growth. In addition, both molecules reduced basal and tumor promoter-induced NF-κB transcriptional activities, differentially regulated basal and tumor promoter-induced AP-1 transcriptional activities, and modulated key players of the AP-1 and NF-κB signaling pathways. These results highlight the anti-tumor promoting properties of β-tan and Sal A. These SL molecules isolated from two plant species native to the Middle East may provide opportunities for complementary

Sulforaphane inhibits CYP1A1 activity and promotes genotoxicity induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin in vitro

Energy Technology Data Exchange (ETDEWEB)

Yang, Fangxing, E-mail: fxyang@zju.edu.cn [MOE Key Laboratory of Environmental Remediation and Ecosystem Health, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou, 310058 (China); Zhuang, Shulin [MOE Key Laboratory of Environmental Remediation and Ecosystem Health, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou, 310058 (China); Zhang, Chao; Dai, Heping [State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, 430072 (China); Liu, Weiping, E-mail: wliu@zju.edu.cn [MOE Key Laboratory of Environmental Remediation and Ecosystem Health, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou, 310058 (China)

2013-06-15

Increasing environmental pollution by carcinogens such as some of persistent organic pollutants (POPs) has prompted growing interest in searching for chemopreventive compounds which are readily obtainable. Sulforaphane (SFN) is isolated from cruciferous vegetables and has the potentials to reduce carcinogenesis through various pathways. In this study, we studied the effects of SFN on CYP1A1 activity and genotoxicity induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The results showed that SFN inhibited TCDD-induced CYP1A1 activity in H4IIE cells by directly inhibiting CYP1A1 activity, probably through binding to aryl hydrocarbon receptor and/or CYP1A1 revealed by molecular docking. However, SFN promoted TCDD-induced DNA damage in yeast cells and reduced the viability of initiated yeast cells. Besides, it is surprising that SFN also failed to reduce genotoxicity induced by other genotoxic reagents which possess different mechanisms to lead to DNA damage. Currently, it is difficult to predict whether SFN has the potentials to reduce the risk of TCDD based on the conflicting observations in the study. Therefore, further studies should be urgent to reveal the function and mechanism of SFN in the stress of such POPs on human health. - Highlights: • Sulforaphane inhibited TCDD-induced CYP1A1 activity in H4IIE cells. • Sulforaphane may bind to aryl hydrocarbon receptor and/or CYP1A1. • Sulforaphane promoted TCDD-induced DNA damage in yeast cells. • Sulforaphane may promote DNA damage by DNA strand breaks or DNA alkylation.

In silico modeling to predict drug-induced phospholipidosis

International Nuclear Information System (INIS)

Choi, Sydney S.; Kim, Jae S.; Valerio, Luis G.; Sadrieh, Nakissa

2013-01-01

Drug-induced phospholipidosis (DIPL) is a preclinical finding during pharmaceutical drug development that has implications on the course of drug development and regulatory safety review. A principal characteristic of drugs inducing DIPL is known to be a cationic amphiphilic structure. This provides evidence for a structure-based explanation and opportunity to analyze properties and structures of drugs with the histopathologic findings for DIPL. In previous work from the FDA, in silico quantitative structure–activity relationship (QSAR) modeling using machine learning approaches has shown promise with a large dataset of drugs but included unconfirmed data as well. In this study, we report the construction and validation of a battery of complementary in silico QSAR models using the FDA's updated database on phospholipidosis, new algorithms and predictive technologies, and in particular, we address high performance with a high-confidence dataset. The results of our modeling for DIPL include rigorous external validation tests showing 80–81% concordance. Furthermore, the predictive performance characteristics include models with high sensitivity and specificity, in most cases above ≥ 80% leading to desired high negative and positive predictivity. These models are intended to be utilized for regulatory toxicology applied science needs in screening new drugs for DIPL. - Highlights: • New in silico models for predicting drug-induced phospholipidosis (DIPL) are described. • The training set data in the models is derived from the FDA's phospholipidosis database. • We find excellent predictivity values of the models based on external validation. • The models can support drug screening and regulatory decision-making on DIPL

Preventing Unnecessary Costs of Drug-Induced Hypoglycemia in Older Adults with Type 2 Diabetes in the United States and Canada.

Directory of Open Access Journals (Sweden)

Mathieu Boulin

Full Text Available The costs of drug-induced hypoglycemia are a critical but often neglected component of value-based arguments to reduce tight glycemic control in older adults with type 2 diabetes.An economic (decision-tree analysis compared rates, costs, quality-adjusted life-years, and incremental costs per quality-adjusted life-year gained associated with mild, moderate and severe hypoglycemic events for 6 glucose-lowering medication classes in type 2 diabetic adults aged 65-79 versus those 80 years and older. The national U.S. (Center for Medicare Services and Canadian public health payer perspectives were adopted.Incidence rates of drug-induced hypoglycemia were the highest for basal insulin and sulfonylureas: 8.64 and 4.32 events per person-year in 65-79 year olds, and 12.06 and 6.03 events per person-year for 80 years and older. In both the U.S. and Canada, metformin dominated sulfonylureas, basal insulin and glucagon-like peptide1 receptor agonists. Relative to sulfonylureas, thiazolidinediones had the lowest incremental cost-effectiveness ratios in the U.S. and dominated sulfonylureas in Canada for adults 80 years and older. Relative to sulfonylureas, dipeptidyl peptidase4 inhibitors were cost-effective for adults 80 years and older in both countries, and for 65-79 year olds in Canada. Annual costs of hypoglycemia for older adults attaining very tight glycemic control with the use of insulin or sulfonylureas were estimated at U.S.$509,214,473 in the U.S. and CAN$65,497,849 in Canada.Optimizing drug therapy for older type 2 diabetic adults through the avoidance of drug-induced hypoglycemia will dramatically improve patient health while also generating millions of dollars by saving unnecessary medical costs.

Conditioned Place Preference Induced by Licit Drugs: Establishment, Extinction, and Reinstatement

Directory of Open Access Journals (Sweden)

Yu Liu

2008-01-01

Full Text Available The conditioned place preference (CPP model has been widely used to evaluate the rewarding effects of abused drugs, and recently, the extinction and reinstatement phases of this paradigm have been used to assess relapse to drug seeking. The vast majority of studies have focused on CPP induced by illicit drugs, such as psychostimulants and opioids. Although legal psychoactive drugs, such as ethanol, nicotine, and caffeine, are more widely used than illegal drugs, the establishment, extinction, and reinstatement of CPP produced by these licit drugs are less well understood. The present review discusses the extant research on CPP induced by legal drugs. We first describe the CPP model and discuss the behavioral procedures used to induce CPP for ethanol, nicotine, and caffeine. We then summarize the neuronal substrates that underlie CPP induced by these drugs from a genetic perspective. Finally, we draw on findings from pharmacological studies and discuss the neurotransmitters and neurohormones underlying CPP produced by ethanol, nicotine, and caffeine.

Erratum: PDGF-BB induces intratumoral lymphangiogenesis and promotes lymphatic metastasis

DEFF Research Database (Denmark)

Cao, R.H.; Bjorndahl, M.A.; Religa, P.

2006-01-01

This corrects the article "PDGF-BB induces intratumoral lymphangiogenesis and promotes lymphatic metastasis", Cancer Cell, 2004, vol. 6(4), pg 333-45.......This corrects the article "PDGF-BB induces intratumoral lymphangiogenesis and promotes lymphatic metastasis", Cancer Cell, 2004, vol. 6(4), pg 333-45....

Pectin penta-oligogalacturonide reduces cholesterol accumulation by promoting bile acid biosynthesis and excretion in high-cholesterol-fed mice.

Science.gov (United States)

Zhu, Ru-Gang; Sun, Yan-Di; Hou, Yu-Ting; Fan, Jun-Gang; Chen, Gang; Li, Tuo-Ping

2017-06-25

Haw pectin penta-oligogalacturonide (HPPS) has important role in improving cholesterol metabolism and promoting the conversion of cholesterol to bile acids (BA) in mice fed high-cholesterol diet (HCD). However, the mechanism is not clear. This study aims to investigate the effects of HPPS on cholesterol accumulation and the regulation of hepatic BA synthesis and transport in HCD-fed mice. Results showed that HPPS significantly decreased plasma and hepatic TC levels but increased plasma high-density lipoprotein cholesterol (HDL-C) and apolipoprotein A-I (apoA-I) levels, compared to HCD. BA analysis showed that HPPS markedly decreased hepatic and small intestine BA levels but increased the gallbladder BA levels, and finally decreased the total BA pool size, compared to HCD. Studies of molecular mechanism revealed that HPPS promoted hepatic ATP-binding cassette transporter A1 (ABCA1), ATP-binding cassette transporter G1 (ABCG1), and scavenger receptor BI (SR-BI) expression but did not affect ATB binding cassette transporter G5/G8 (ABCG5/8) expression. HPPS inactivated hepatic farnesoid X receptor (FXR) and target genes expression, which resulted in significant increase of cholesterol 7α-hydroxylase 1 (CYP7A1) and sterol 12α-hydroxylase (CYP8B1) expression, with up-regulations of 204.2% and 33.5% for mRNA levels, respectively, compared with HCD. In addition, HPPS markedly enhanced bile salt export pump (BSEP) expression but didn't affect the sodium/taurocholate co-transporting polypeptide (NTCP) expression. In conclusion, the study revealed that HPPS reduced cholesterol accumulation by promoting BA synthesis in the liver and excretion in the feces, and might promote macrophage-to-liver reverse cholesterol transport (RCT) but did not liver-to-fecal RCT. Copyright © 2017 Elsevier B.V. All rights reserved.

Overcoming STC2 mediated drug resistance through drug and gene co-delivery by PHB-PDMAEMA cationic polyester in liver cancer cells.

Science.gov (United States)

Cheng, Hongwei; Wu, Zhixian; Wu, Caisheng; Wang, Xiaoyuan; Liow, Sing Shy; Li, Zibiao; Wu, Yun-Long

2018-02-01

Stanniocalcin 2 (STC2) overexpression in hepatocellular carcinoma (HCC) could lead to poor prognosis, which might be due to its induced P-glycoprotein and Bcl-2 protein expression level increase. P-glycoprotein or membrane pump induced drug efflux and altered prosurvival Bcl-2 expression are key mechanisms for drug resistance leading to failure of chemotherapy in HCC. However, current strategy to overcome both P-glycoprotein and Bcl-2 protein induced drug resistance was rarely reported. In this work, we utilized an amphiphilic poly[(R)-3-hydroxybutyrate] (PHB)-b-poly(2-(dimethylamino)ethyl methacrylate) (PDMAEMA) cationic polyester to encapsulate chemotherapeutic paclitaxel (PTX) in hydrophobic PHB domain and Bcl-2 convertor Nur77/ΔDBD gene (Nur77 without DNA binding domain for mitochondria localization) by formation of polyplex due to cationic PDMAEMA segment, to effectively inhibit the drug resistant HepG2/STC2 and SMCC7721/STC2 liver cancer cell growth. Thanks to the cationic nanoparticle complex formation ability and high transfection efficiency to express Bcl-2 conversion proteins, PHB-PDMAEMA/PTX@polyplex could partially impair P-glycoprotein induced PTX efflux and activate the apoptotic function of previous prosurvival Bcl-2 protein. This is the pioneer report of cationic amphiphilic polyester PHB-PDMAEMA to codeliver anticancer drug and therapeutic plasmid to overcome both pump and non-pump mediated chemotherapeutic resistance in liver cancer cells, which might be inspiring for the application of polyester in personalized cancer therapy. Copyright © 2017 Elsevier B.V. All rights reserved.

Prolonged drug-induced hypothermia in experimental stroke

DEFF Research Database (Denmark)

Johansen, Flemming Fryd; Jørgensen, Henrik Stig; Reith, Jakob

2007-01-01

In experimental and human stroke, hypothermia is strongly related to a favorable outcome. Previous attempts to manipulate the core temperature in focal cerebral ischemia have been based on mechanical cooling. The purpose of the study is to establish a model for long-term drug-induced hypothermia...... in focal ischemia by pharmacological alteration of the central thermoregulatory set-point. We tested the hypothesis that the dopaminergic agonist Talipexole, which induces hypothermia, reduces infarct size. Body temperature was monitored by a radio-pill-implant. Rats had reversible occlusion of the middle...... that the core body temperature was reduced by 1.7 degrees C for 24 hours after MCAO in rats treated with Talipexole. This treatment induced a significant reduction of infarct volume at 7 days after focal ischemia by 47%. We suggest that the reduction in infarct volume is related to drug-induced hypothermia...

ATP binding cassette G1-dependent cholesterol efflux during inflammation.

Science.gov (United States)

de Beer, Maria C; Ji, Ailing; Jahangiri, Anisa; Vaughan, Ashley M; de Beer, Frederick C; van der Westhuyzen, Deneys R; Webb, Nancy R

2011-02-01

ATP binding cassette transporter G1 (ABCG1) mediates the transport of cellular cholesterol to HDL, and it plays a key role in maintaining macrophage cholesterol homeostasis. During inflammation, HDL undergoes substantial remodeling, acquiring lipid changes and serum amyloid A (SAA) as a major apolipoprotein. In the current study, we investigated whether remodeling of HDL that occurs during acute inflammation impacts ABCG1-dependent efflux. Our data indicate that lipid free SAA acts similarly to apolipoprotein A-I (apoA-I) in mediating sequential efflux from ABCA1 and ABCG1. Compared with normal mouse HDL, acute phase (AP) mouse HDL containing SAA exhibited a modest but significant 17% increase in ABCG1-dependent efflux. Interestingly, AP HDL isolated from mice lacking SAA (SAAKO mice) was even more effective in promoting ABCG1 efflux. Hydrolysis with Group IIA secretory phospholipase A(2) (sPLA(2)-IIA) significantly reduced the ability of AP HDL from SAAKO mice to serve as a substrate for ABCG1-mediated cholesterol transfer, indicating that phospholipid (PL) enrichment, and not the presence of SAA, is responsible for alterations in efflux. AP human HDL, which is not PL-enriched, was somewhat less effective in mediating ABCG1-dependent efflux compared with normal human HDL. Our data indicate that inflammatory remodeling of HDL impacts ABCG1-dependent efflux independent of SAA.

The discovery of drug-induced illness.

Science.gov (United States)

Jick, H

1977-03-03

The increased use of drugs (and the concurrent increased risks of drug-induced illness) require definition of relevant research areas and strategy. For established marketed drugs, research needs depend on the magnitudes of risk of an illness from a drug and the base-line risk. With the drug risk high and the base-line risk low, the problem surfaces in premarketing studies or through the epidemic that develops after marketing. If the drug adds slightly to a high base-line risk, the effect is undetectable. When both risks are low, adverse effects can be discovered by chance, but systematic case-referent studies can speed discovery. If both risks are high, clinical trials and nonexperimental studies may be used. With both risks intermediate, systematic evaluations, especially case-referent studies are needed. Newly marketed drugs should be routinely evaluated through compulsory registration and follow-up study of the earliest users.

hERG trafficking inhibition in drug-induced lethal cardiac arrhythmia.

Science.gov (United States)

Nogawa, Hisashi; Kawai, Tomoyuki

2014-10-15

Acquired long QT syndrome induced by non-cardiovascular drugs can cause lethal cardiac arrhythmia called torsades de points and is a significant problem in drug development. The prolongation of QT interval and cardiac action potential duration are mainly due to reduced physiological function of the rapidly activating voltage-dependent potassium channels encoded by human ether-a-go-go-related gene (hERG). Structurally diverse groups of drugs are known to directly inhibit hERG channel conductance. Therefore, the ability of acute hERG inhibition is routinely assessed at the preclinical stages in pharmaceutical testing. Recent findings indicated that chronic treatment with various drugs not only inhibits hERG channels but also decreases hERG channel expression in the plasma membrane of cardiomyocytes, which has become another concern in safety pharmacology. The mechanisms involve the disruption of hERG trafficking to the surface membrane or the acceleration of hERG protein degradation. From this perspective, we present a brief overview of mechanisms of drug-induced trafficking inhibition and pathological regulation. Understanding of drug-induced hERG trafficking inhibition may provide new strategies for predicting drug-induced QT prolongation and lethal cardiac arrhythmia in pharmaceutical drug development. Copyright © 2014 Elsevier B.V. All rights reserved.

Immunoexpression of interleukin-6 in drug-induced gingival overgrowth patients

Directory of Open Access Journals (Sweden)

P R Ganesh

2016-01-01

Full Text Available Background: To analyze the role of proinflammatory cytokines in drug-induced gingival enlargement in Indian population. Aim: To evaluate for the presence of interleukin-6 (IL-6 in drug-induced gingival enlargement and to compare it with healthy control in the absence of enlargement. Materials and Methods: Thirty-five patients selected for the study and divided into control group (10 and study group (25 consisting of phenytoin (10; cyclosporin (10 and nifedipine (5 induced gingival enlargement. Gingival overgrowth index of Seymour was used to assess overgrowth and allot groups. Under LA, incisional biopsy done, tissue sample fixed in 10% formalin and immunohistochemically evaluated for the presence of IL-6 using LAB-SA method, Labeled- Streptavidin-Biotin Method (LAB-SA kit from Zymed- 2nd generation LAB-SA detection system, Zymed Laboratories, CA. The results of immunohistochemistry were statistically analyzed using Kruskaal–Wallis and Mann–Whitney test. Results: The data obtained from immunohistochemistry assessment shows that drug-induced gingival overgrowth (DIGO samples express more IL-6 than control group and cyclosporin expresses more IL-6 followed by phenytoin and nifedipine. Conclusion: Increased IL-6 expression was noticed in all three DIGO groups in comparison with control group. Among the study group, cyclosporin expressed maximum IL-6 expression followed by phenytoin and nifedipine.

Gamma-sterilization-induced radicals in biodegradable drug delivery systems

International Nuclear Information System (INIS)

Maeder, K.; Swartz, H.M.; Domb, A.

1996-01-01

Electron paramagnetic resonance (EPR) spectroscopy (1.2 and 9.25 GHz, 25 o C) was used to characterize free radicals in gamma-ray sterilized biodegradable polymers of the type which are in clinical use. Free radicals were detected in all irradiated polymer samples. The temperature of irradiation (25 o vs dry ice temperature) had only a minor influence on the yield of radicals and the shape of the EPR spectra. In contrast, the composition of the polymers and the drugs incorporated in them did strongly influence the amount of radiation-induced free radicals and their reactivity. In general, polymers with high melting points and crystallinity had the highest yields of radicals observable at room temperature. We were able to use the free radicals induced by the usual sterilization procedures to follow the penetration of water and the degradation of the polymers in vitro and in vivo. The ability of in vivo EPR to follow drug delivery noninvasively and continuously in vivo, using the free radicals induced in the usual sterilization process indicates that this approach could be applied immediately for the characterization of these drug delivery systems in experimental animals and in the near future should be able to be used in human subjects. (author)

CRH promotes human colon cancer cell proliferation via IL-6/JAK2/STAT3 signaling pathway and VEGF-induced tumor angiogenesis.

Science.gov (United States)

Fang, Xianjun; Hong, Yali; Dai, Li; Qian, Yuanyuan; Zhu, Chao; Wu, Biao; Li, Shengnan

2017-11-01

Corticotrophin-releasing hormone (CRH) has been demonstrated to participate in various diseases. Our previous study showed that its receptor CRHR1 mediated the development of colitis-associated cancer in mouse model. However, the detailed mechanisms remain unclear. In this study, we explored the oncogenetic role of CRH/CRHR1 signaling in colon cancer cells. Cell proliferation and colony formation assays revealed that CRH contributed to cell proliferation. Moreover, tube formation assay showed that CRH-treated colon cancer cell supernatant significantly promoted tube formation of human umbilical vein endothelial cells (HUVECs). And these effects could be reversed by the CRHR1 specific antagonist Antalarmin. Further investigation showed that CRH significantly upregulated the expressions of interlukin-6 (IL-6) and vascular endothelial growth factor (VEGF) through activating nuclear factor-kappa B (NF-κB). The CRH-induced IL-6 promoted phosphorylation of janus kinase 2 (JAK2) and signal transducers and activators of transcription 3 (STAT3). STAT3 inhibition by Stattic significantly inhibited the CRH-induced cell proliferation. In addition, silence of VEGF resulted in declined tube formation induced by CRH. Taken together, CRH/CRHR1 signaling promoted human colon cancer cell proliferation via NF-κB/IL-6/JAK2/STAT3 signaling pathway and tumor angiogenesis via NF-κB/VEGF signaling pathway. Our results provide evidence to support a critical role for the CRH/CRHR1 signaling in colon cancer progression and suggest its potential utility as a new therapeutic target for colon cancer. © 2017 Wiley Periodicals, Inc.

Age-Related Inducibility of Carboxylesterases by the Antiepileptic Agent Phenobarbital and Implications in Drug Metabolism and Lipid Accumulation 1, 2

Science.gov (United States)

Xiao, Da; Chen, Yi-Tzai; Yang, Dongfang; Yan, Bingfang

2014-01-01

Carboxylesterases (CES) constitute a class of hydrolytic enzymes that play critical roles in drug metabolism and lipid mobilization. Previous studies with a large number of human liver samples have suggested that the inducibility of carboxylesterases is inversely related with age. To directly test this possibility, neonatal (10 days of age) and adult mice were treated with the antiepileptic agent phenobarbital. The expression and hydrolytic activity were determined on six major carboxylesterases including ces1d, the ortholog of human CES1. Without exception, all carboxylesterases tested were induced to a greater extent in neonatal than adult mice. The induction was detected at mRNA, protein and catalytic levels. Ces1d was greatly induced and found to rapidly hydrolyze the antiplatelet agent clopidogrel and support the accumulation of neutral lipids. Phenobarbital represents a large number of therapeutic agents that induce drug metabolizing enzymes and transporters in a species-conserved manner. The higher inducibility of carboxylesterases in the developmental age likely represents a general phenomenon cross species including human. Consequently, individuals in the developmental age may experience greater drug-drug interactions. The greater induction of ces1d also provides a molecular explanation to the clinical observation that children on antiepileptic drugs increase plasma lipids. PMID:22513142

Drug-induced status epilepticus.

Science.gov (United States)

Cock, Hannah R

2015-08-01

Drug-induced status epilepticus (SE) is a relatively uncommon phenomenon, probably accounting for less than 5% of all SE cases, although limitations in case ascertainment and establishing causation substantially weaken epidemiological estimates. Some antiepileptic drugs, particularly those with sodium channel or GABA(γ-aminobutyric acid)-ergic properties, frequently exacerbate seizures and may lead to SE if used inadvertently in generalized epilepsies or less frequently in other epilepsies. Tiagabine seems to have a particular propensity for triggering nonconvulsive SE sometimes in patients with no prior history of seizures. In therapeutic practice, SE is most commonly seen in association with antibiotics (cephalosporins, quinolones, and some others) and immunotherapies/chemotherapies, the latter often in the context of a reversible encephalopathy syndrome. Status epilepticus following accidental or intentional overdoses, particularly of antidepressants or other psychotropic medications, has also featured prominently in the literature: whilst there are sometimes fatal consequences, this is more commonly because of cardiorespiratory or metabolic complications than as a result of seizure activity. A high index of suspicion is required in identifying those at risk and in recognizing potential clues from the presentation, but even with a careful analysis of patient and drug factors, establishing causation can be difficult. In addition to eliminating the potential trigger, management should be as for SE in any other circumstances, with the exception that phenobarbitone is recommended as a second-line treatment for suspected toxicity-related SE where the risk of cardiovascular complications is higher anyways and may be exacerbated by phenytoin. There are also specific recommendations/antidotes in some situations. The outcome of drug-induced status epilepticus is mostly good when promptly identified and treated, though less so in the context of overdoses. This article is

Rational polypharmacology: systematically identifying and engaging multiple drug targets to promote axon growth

Science.gov (United States)

Al-Ali, Hassan; Lee, Do-Hun; Danzi, Matt C.; Nassif, Houssam; Gautam, Prson; Wennerberg, Krister; Zuercher, Bill; Drewry, David H.; Lee, Jae K.; Lemmon, Vance P.; Bixby, John L.

2016-01-01

Mammalian Central Nervous System (CNS) neurons regrow their axons poorly following injury, resulting in irreversible functional losses. Identifying therapeutics that encourage CNS axon repair has been difficult, in part because multiple etiologies underlie this regenerative failure. This suggests a particular need for drugs that engage multiple molecular targets. Although multi-target drugs are generally more effective than highly selective alternatives, we lack systematic methods for discovering such drugs. Target-based screening is an efficient technique for identifying potent modulators of individual targets. In contrast, phenotypic screening can identify drugs with multiple targets; however, these targets remain unknown. To address this gap, we combined the two drug discovery approaches using machine learning and information theory. We screened compounds in a phenotypic assay with primary CNS neurons and also in a panel of kinase enzyme assays. We used learning algorithms to relate the compounds’ kinase inhibition profiles to their influence on neurite outgrowth. This allowed us to identify kinases that may serve as targets for promoting neurite outgrowth, as well as others whose targeting should be avoided. We found that compounds that inhibit multiple targets (polypharmacology) promote robust neurite outgrowth in vitro. One compound with exemplary polypharmacology, was found to promote axon growth in a rodent spinal cord injury model. A more general applicability of our approach is suggested by its ability to deconvolve known targets for a breast cancer cell line, as well as targets recently shown to mediate drug resistance. PMID:26056718

Drug Transporters in the Intestine

DEFF Research Database (Denmark)

Steffansen, Bente

2016-01-01

to the intestinal exsorptive DTs. An example is the API sulfasalazine, which is a substrate for breast cancer resistance protein (BCRP)/ABCG2. Sulfasalazine absorption is found to increase when human volunteers are administered high concentrations together with the inhibitor and spice curcumin. In conclusion...

Expression and Activity of Breast Cancer Resistance Protein (BCRP/ABCG2) in Human Distal Lung Epithelial Cells In Vitro.

Science.gov (United States)

Nickel, Sabrina; Selo, Mohammed Ali; Fallack, Juliane; Clerkin, Caoimhe G; Huwer, Hanno; Schneider-Daum, Nicole; Lehr, Claus-Michael; Ehrhardt, Carsten

2017-12-01

Breast cancer resistance protein (BCRP/ABCG2) has previously been identified with high expression levels in human lung. The subcellular localisation and functional activity of the transporter in lung epithelia, however, remains poorly investigated. The aim of this project was to study BCRP expression and activity in freshly isolated human alveolar epithelial type 2 (AT2) and type 1-like (AT1-like) cells in primary culture, and to compare these findings with data obtained from the NCI-H441 cell line. BCRP expression levels in AT2 and AT1-like cells and in different passages of NCI-H441 cells were determined using q-PCR and immunoblot. Transporter localisation was confirmed by confocal laser scanning microscopy. Efflux and transport studies using the BCRP substrate BODIPY FL prazosin and the inhibitor Ko143 were carried out to assess BCRP activity in the different cell models. BCRP expression decreased during transdifferentiation from AT2 to AT1-like phenotype. Culturing NCI-H441 cells at an air-liquid interface or submersed did not change BCRP abundance, however, BCRP levels increased with passage number. BCRP was localised to the apical membrane and cytosol in NCI-H441 cells. In primary cells, the protein was found predominantly in the nucleus. Functional studies were consistent with expression data. BCRP is differently expressed in AT2 and AT1-like cells with lower abundance and activity in the latter ones. Nuclear BCRP might play a transcriptional role in distal lung epithelium. In NCI-H441 cells, BCRP is expressed in apical cell membranes and its activity is consistent with the localisation pattern.

Effectiveness of hepatoprotective drugs for anti-tuberculosis drug-induced hepatotoxicity: a retrospective analysis

Directory of Open Access Journals (Sweden)

Zenya Saito

2016-11-01

Full Text Available Abstract Background The effectiveness of hepatoprotective drugs for DIH (drug induced hepatotoxicity during tuberculosis treatment is not clear. We evaluated the effectiveness of hepatoprotective drugs by comparing the period until the normalization of hepatic enzymes between patients who were prescribed with the hepatoprotective drugs after DIH was occurred and patients who were not prescribed with the hepatoprotective drugs. Methods During 2006–2010, 389 patients with active tuberculosis were included in this study. DIH was defined as elevation of peak serum aspartate aminotransferase (AST and/or alanine aminotransferase (ALT of more than twice the upper limit of normal (ULN. We divided the patients into the severe (peak serum AST and/or ALT elevation of >5 times the ULN, moderate (peak serum AST and/or ALT elevation of >3 to ≤5 times the ULN, and mild DIH groups (peak serum AST and/or ALT elevation of >2 to ≤3 times the ULN. We compared the average period until the normalization of hepatic enzymes between patient subgroups with and without hepatoprotective drugs (ursodeoxycholic acid: UDCA, stronger neo-minophagen C: SNMC, and glycyrrhizin. Results In the severe group, there was no significant difference in the average period until the normalization between subgroups with and without hepatoprotective drugs (21.4 ± 10.8 vs 21.5 ± 11.1 days, P = 0.97. In the mild group, the period was longer in the subgroup with hepatoprotective drugs than that without hepatoprotective drugs (15.7 ± 6.2 vs 12.4 ± 7.9 days, P = 0.046. Conclusion Regardless of the severity, hepatoprotective drugs did not shorten the period until the normalization of hepatic enzymes.

Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

International Nuclear Information System (INIS)

Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.

2003-01-01

Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

Glucosylceramide and Lysophosphatidylcholines as Potential Blood Biomarkers for Drug-Induced Hepatic Phospholipidosis

Science.gov (United States)

Saito, Kosuke; Maekawa, Keiko; Ishikawa, Masaki; Senoo, Yuya; Urata, Masayo; Murayama, Mayumi; Nakatsu, Noriyuki; Yamada, Hiroshi; Saito, Yoshiro

2014-01-01

Drug-induced phospholipidosis is one of the major concerns in drug development and clinical treatment. The present study involved the use of a nontargeting lipidomic analysis with liquid chromatography-mass spectrometry to explore noninvasive blood biomarkers for hepatic phospholipidosis from rat plasma. We used three tricyclic antidepressants (clomipramine [CPM], imipramine [IMI], and amitriptyline [AMT]) for the model of phospholipidosis in hepatocytes and ketoconazole (KC) for the model of phospholipidosis in cholangiocytes and administered treatment for 3 and 28 days each. Total plasma lipids were extracted and measured. Lipid molecules contributing to the separation of control and drug-treated rat plasma in a multivariate orthogonal partial least squares discriminant analysis were identified. Four lysophosphatidylcholines (LPCs) (16:1, 18:1, 18:2, and 20:4) and 42:1 hexosylceramide (HexCer) were identified as molecules separating control and drug-treated rats in all models of phospholipidosis in hepatocytes. In addition, 16:1, 18:2, and 20:4 LPCs and 42:1 HexCer were identified in a model of hepatic phospholipidosis in cholangiocytes, although LPCs were identified only in the case of 3-day treatment with KC. The levels of LPCs were decreased by drug-induced phospholipidosis, whereas those of 42:1 HexCer were increased. The increase in 42:1 HexCer was much higher in the case of IMI and AMT than in the case of CPM; moreover, the increase induced by IMI was dose-dependent. Structural characterization determining long-chain base and hexose delineated that 42:1 HexCer was d18:1/24:0 glucosylceramide (GluCer). In summary, our study demonstrated that d18:1/24:0 GluCer and LPCs are potential novel biomarkers for drug-induced hepatic phospholipidosis. PMID:24980264

Role of nonalcoholic fatty liver disease as risk factor for drug-induced hepatotoxicity

Science.gov (United States)

Massart, Julie; Begriche, Karima; Moreau, Caroline; Fromenty, Bernard

2017-01-01

Background Obesity is often associated with nonalcoholic fatty liver disease (NAFLD), which refers to a large spectrum of hepatic lesions including fatty liver, nonalcoholic steatohepatitis (NASH) and cirrhosis. Different investigations showed or suggested that obesity and NAFLD are able to increase the risk of hepatotoxicity of different drugs. Some of these drugs could induce more frequently an acute hepatitis in obese individuals whereas others could worsen pre-existing NAFLD. Aim The main objective of the present review was to collect the available information regarding the role of NAFLD as risk factor for drug-induced hepatotoxicity. For this purpose, we performed a data-mining analysis using different queries including drug-induced liver injury (or DILI), drug-induced hepatotoxicity, fatty liver, nonalcoholic fatty liver disease (or NAFLD), steatosis and obesity. The main data from the collected articles are reported in this review and when available, some pathophysiological hypotheses are put forward. Relevance for patients Drugs that could pose a potential risk in obese patients include compounds belonging to different pharmacological classes such as acetaminophen, halothane, methotrexate, rosiglitazone, stavudine and tamoxifen. For some of these drugs, experimental investigations in obese rodents confirmed the clinical observations and unveiled different pathophysiological mechanisms which could explain why these pharmaceuticals are particularly hepatotoxic in obesity and NAFLD. Other drugs such as pentoxifylline, phenobarbital and omeprazole might also pose a risk but more investigations are required to determine whether this risk is significant or not. Because obese people often take several drugs for the treatment of different obesity-related diseases such as type 2 diabetes, hyperlipidemia and coronary heart disease, it is urgent to identify the main pharmaceuticals that can cause acute hepatitis on a fatty liver background or induce NAFLD worsening

Pharmacological activation of aldehyde dehydrogenase 2 promotes osteoblast differentiation via bone morphogenetic protein-2 and induces bone anabolic effect

Energy Technology Data Exchange (ETDEWEB)

Mittal, Monika; Pal, Subhashis; China, Shyamsundar Pal; Porwal, Konica [Division of Endocrinology and Centre for Research in Anabolic Skeletal Targets in Health and Illness (ASTHI), CSIR-Central Drug Research Institute, Lucknow 226031 (India); Dev, Kapil [Division of Medicinal and Process Chemistry, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Shrivastava, Richa [Division of Toxicology, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Raju, Kanumuri Siva Rama; Rashid, Mamunur [Pharmaceutics Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Trivedi, Arun Kumar; Sanyal, Sabyasachi [Biochemistry Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Wahajuddin, Muhammad [Pharmaceutics Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Bhaduria, Smrati [Division of Toxicology, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Maurya, Rakesh [Division of Medicinal and Process Chemistry, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Chattopadhyay, Naibedya, E-mail: n_chattopadhyay@cdri.res.in [Division of Endocrinology and Centre for Research in Anabolic Skeletal Targets in Health and Illness (ASTHI), CSIR-Central Drug Research Institute, Lucknow 226031 (India)

2017-02-01

Aldehyde dehydrogenases (ALDHs) are a family of enzymes involved in detoxifying aldehydes. Previously, we reported that an ALDH inhibitor, disulfiram caused bone loss in rats and among ALDHs, osteoblast expressed only ALDH2. Loss-of-function mutation in ALDH2 gene is reported to cause bone loss in humans which suggested its importance in skeletal homeostasis. We thus studied whether activating ALDH2 by N-(1, 3-benzodioxol-5-ylmethyl)-2, 6-dichlorobenzamide (alda-1) had osteogenic effect. We found that alda-1 increased and acetaldehyde decreased the differentiation of rat primary osteoblasts and expressions of ALDH2 and bone morphogenetic protein-2 (BMP-2). Silencing ALDH2 in osteoblasts abolished the alda-1 effects. Further, alda-1 attenuated the acetaldehyde-induced lipid-peroxidation and oxidative stress. BMP-2 is essential for bone regeneration and alda-1 increased its expression in osteoblasts. We then showed that alda-1 (40 mg/kg dose) augmented bone regeneration at the fracture site with concomitant increase in BMP-2 protein compared with control. The osteogenic dose (40 mg/kg) of alda-1 attained a bone marrow concentration that was stimulatory for osteoblast differentiation, suggesting that the tissue concentration of alda-1 matched its pharmacologic effect. In addition, alda-1 promoted modeling-directed bone growth and peak bone mass achievement, and increased bone mass in adult rats which reiterated its osteogenic effect. In osteopenic ovariectomized (OVX) rats, alda-1 reversed trabecular osteopenia with attendant increase in serum osteogenic marker (procollagen type I N-terminal peptide) and decrease in oxidative stress. Alda-1 has no effect on liver and kidney function. We conclude that activating ALDH2 by alda-1 had an osteoanabolic effect involving increased osteoblastic BMP-2 production and decreased OVX-induced oxidative stress. - Highlights: • Alda-1 induced osteoblast differentiation that involved upregulation of ALDH2 and BMP-2 • Alda-1

Inhibition of mitogen-activated protein kinase kinase, DNA methyltransferase, and transforming growth factor-β promotes differentiation of human induced pluripotent stem cells into enterocytes.

Science.gov (United States)

Kodama, Nao; Iwao, Takahiro; Kabeya, Tomoki; Horikawa, Takashi; Niwa, Takuro; Kondo, Yuki; Nakamura, Katsunori; Matsunaga, Tamihide

2016-06-01

We previously reported that small-molecule compounds were effective in generating pharmacokinetically functional enterocytes from human induced pluripotent stem (iPS) cells. In this study, to determine whether the compounds promote the differentiation of human iPS cells into enterocytes, we investigated the effects of a combination of mitogen-activated protein kinase kinase (MEK), DNA methyltransferase (DNMT), and transforming growth factor (TGF)-β inhibitors on intestinal differentiation. Human iPS cells cultured on feeder cells were differentiated into endodermal cells by activin A. These endodermal-like cells were then differentiated into intestinal stem cells by fibroblast growth factor 2. Finally, the cells were differentiated into enterocyte cells by epidermal growth factor and small-molecule compounds. After differentiation, mRNA expression levels and drug-metabolizing enzyme activities were measured. The mRNA expression levels of the enterocyte marker sucrase-isomaltase and the major drug-metabolizing enzyme cytochrome P450 (CYP) 3A4 were increased by a combination of MEK, DNMT, and TGF-β inhibitors. The mRNA expression of CYP3A4 was markedly induced by 1α,25-dihydroxyvitamin D3. Metabolic activities of CYP1A1/2, CYP2B6, CYP2C9, CYP2C19, CYP3A4/5, UDP-glucuronosyltransferase, and sulfotransferase were also observed in the differentiated cells. In conclusion, MEK, DNMT, and TGF-β inhibitors can be used to promote the differentiation of human iPS cells into pharmacokinetically functional enterocytes. Copyright © 2016 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. All rights reserved.

1-[2-(2-Methoxyphenylaminoethylamino]-3-(naphthalene-1- yloxypropan-2-ol May Be a Promising Anticancer Drug

Directory of Open Access Journals (Sweden)

Tomoyuki Nishizaki

2014-12-01

Full Text Available We have originally synthesized the naftopidil analogue 1-[2-(2-methoxyphenylaminoethylamino]-3-(naphthalene-1-yloxypropan-2-ol (HUHS 1015 as a new anticancer drug. HUHS1015 induces cell death in a wide variety of human cancer cell lines originated from malignant pleural mesothelioma, lung cancer, hepatoma, gastric cancer, colorectal cancer, bladder cancer, prostate cancer, and renal cancer. HUHS1015-induced cell death includes necrosis (necroptosis and apoptosis, and the underlying mechanism differs depending upon cancer cell types. HUHS1015 effectively suppresses tumor growth in mice inoculated with NCI-H2052, MKN45, or CW2 cells, with a potential similar to or higher than that of currently used anticancer drugs. Here we show how HUHS1015 might offer brilliant hope for cancer therapy.

Spontaneous reports on drug-induced pancreatitis in Denmark from 1968 to 1999

DEFF Research Database (Denmark)

Andersen, V; Sonne, J; Andersen, M

2001-01-01

valproate (two cases), clomipramine (one case) and azathioprine (one case). Definite relationship was stated for mesalazine (three cases), azathioprine (two cases) and simvastatin (one case) on the basis of re-challenge. A possible or probable causality was considered for a further 30 drugs including 5...... (measles" mumps/rubella) vaccination. CONCLUSION: Drug-induced pancreatitis is rarely reported. The incidence may be increasing and the course is often serious. This is the first report on definite simvastatin-induced pancreatitis. Further studies on the pancreotoxic potential of drugs are warranted.......OBJECTIVES: To present an update on drug-induced pancreatitis reported to the Danish Committee on Adverse Drug Reactions. DESIGN: Retrospective study of spontaneous case reports to the Danish reporting system on adverse drug reactions. METHODS: All cases of suspected drug-induced pancreatitis...

Macrophage deficiency of miR-21 promotes apoptosis, plaque necrosis, and vascular inflammation during atherogenesis.

Science.gov (United States)

Canfrán-Duque, Alberto; Rotllan, Noemi; Zhang, Xinbo; Fernández-Fuertes, Marta; Ramírez-Hidalgo, Cristina; Araldi, Elisa; Daimiel, Lidia; Busto, Rebeca; Fernández-Hernando, Carlos; Suárez, Yajaira

2017-09-01

Atherosclerosis, the major cause of cardiovascular disease, is a chronic inflammatory disease characterized by the accumulation of lipids and inflammatory cells in the artery wall. Aberrant expression of microRNAs has been implicated in the pathophysiological processes underlying the progression of atherosclerosis. Here, we define the contribution of miR-21 in hematopoietic cells during atherogenesis. Interestingly, we found that miR-21 is the most abundant miRNA in macrophages and its absence results in accelerated atherosclerosis, plaque necrosis, and vascular inflammation. miR-21 expression influences foam cell formation, sensitivity to ER-stress-induced apoptosis, and phagocytic clearance capacity. Mechanistically, we discovered that the absence of miR-21 in macrophages increases the expression of the miR-21 target gene, MKK3, promoting the induction of p38-CHOP and JNK signaling. Both pathways enhance macrophage apoptosis and promote the post-translational degradation of ABCG1, a transporter that regulates cholesterol efflux in macrophages. Altogether, these findings reveal a major role for hematopoietic miR-21 in atherogenesis. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

Cell proliferation in dimethylhydrazine-induced colonic adenocarcinomata following cytotoxic drug treatment.

Science.gov (United States)

Tutton, P J; Barkla, D H

1978-08-25

A stathmokinetic technique was used to study cell proliferation in dimethylhydrazine-induced adenocarcinomata of rat colon following treatment with cytotoxic drugs. The rate of cell division was significantly increased three days after treatment with 5,7-dihydroxytryptamine and seven days after treatment with 5-fluorouracil. Acceleration of tumour cell proliferation following 5,7-dihydroxytryptamine treatment was inhibited by treating animals with the antiseritoninergic drug Xylamidine Tosylate. Acceleration of tumour cell proliferation following 5-fluorouracil treatment was inhibited by treating animals either with the antiseritoninergic drug BW501 or with the histamine H2-receptor blocking drug Cimetidine.

Influence of dietary iodine on drug-induced hypothyrodism in the rat.

Science.gov (United States)

Beyssen, M L; Lagorce, J F; Cledat, D; Buxeraud, J

1999-06-01

Several compounds of pharmaceutical importance from a variety of chemical families, for example chlorpromazine and clomipramine, have been found to form charge-transfer complexes with iodine. We have investigated the influence of dietary iodine on thyroid-gland dysfunction induced by clomipramine, chlorpromazine or 2-thiazoline-2-thiol. We suggest that iodine is partly diverted from its metabolic pathway by complexation with drugs, and so the urinary concentration of iodide is increased. Both chlorpromazine and clomipramine, at doses which do not inhibit thyroperoxidase, enhanced urinary iodine excretion when dietary iodine was restricted (3.944+/-0.96 microg/day for chlorpromazine-tested rats, 3.43+/-1.33 microg/day for clomipramine-tested rats, compared with 2.34+/-0.11 microg/day in control rats). Concurrently, these pharmaceutical compounds increased the level of free thyroid-stimulating hormone (TSH) in comparison with controls and induced histological modifications in, and enlargement of, the thyroid gland. We have demonstrated that drug-induced loss of iodine in the urine was associated with antithyroid action when iodine intake was limited.

Neuropsychotoxicity of abused drugs: involvement of matrix metalloproteinase-2 and -9 and tissue inhibitor of matrix metalloproteinase-2 in methamphetamine-induced behavioral sensitization and reward in rodents.

Science.gov (United States)

Mizoguchi, Hiroyuki; Yamada, Kiyofumi; Nabeshima, Toshitaka

2008-01-01

Matrix metalloproteinases (MMPs) and their inhibitors (TIMPs) function to remodel the pericellular environment. We have investigated the role of the MMP/TIMP system in methamphetamine (METH) dependence in rodents, in which the remodeling of neural circuits may be crucial. Repeated METH treatment induced behavioral sensitization, which was accompanied by an increase in MMP-2/-9/TIMP-2 activity in the brain. An antisense TIMP-2 oligonucleotide enhanced the sensitization, which was associated with a potentiation of the METH-induced release of dopamine in the nucleus accumbens (NAc). MMP-2/-9 inhibitors blocked the METH-induced behavioral sensitization and conditioned place preference (CPP), a measure of the rewarding effect of a drug, and reduced the METH-increased dopamine release in the NAc. In MMP-2- and MMP-9-deficient mice, METH-induced behavioral sensitization and CPP as well as dopamine release were attenuated. The MMP/TIMP system may be involved in METH-induced sensitization and reward by regulating extracellular dopamine levels.

Test systems in drug discovery for hazard identification and risk assessment of human drug-induced liver injury.

Science.gov (United States)

Weaver, Richard J; Betts, Catherine; Blomme, Eric A G; Gerets, Helga H J; Gjervig Jensen, Klaus; Hewitt, Philip G; Juhila, Satu; Labbe, Gilles; Liguori, Michael J; Mesens, Natalie; Ogese, Monday O; Persson, Mikael; Snoeys, Jan; Stevens, James L; Walker, Tracy; Park, B Kevin

2017-07-01

The liver is an important target for drug-induced toxicities. Early detection of hepatotoxic drugs requires use of well-characterized test systems, yet current knowledge, gaps and limitations of tests employed remains an important issue for drug development. Areas Covered: The current state of the science, understanding and application of test systems in use for the detection of drug-induced cytotoxicity, mitochondrial toxicity, cholestasis and inflammation is summarized. The test systems highlighted herein cover mostly in vitro and some in vivo models and endpoint measurements used in the assessment of small molecule toxic liabilities. Opportunities for research efforts in areas necessitating the development of specific tests and improved mechanistic understanding are highlighted. Expert Opinion: Use of in vitro test systems for safety optimization will remain a core activity in drug discovery. Substantial inroads have been made with a number of assays established for human Drug-induced Liver Injury. There nevertheless remain significant gaps with a need for improved in vitro tools and novel tests to address specific mechanisms of human Drug-Induced Liver Injury. Progress in these areas will necessitate not only models fit for application, but also mechanistic understanding of how chemical insult on the liver occurs in order to identify translational and quantifiable readouts for decision-making.

[Non-steroidal anti-inflammatory drug induced gastropathy and preventive effects of teprenone on the gastropathy in rats].

Science.gov (United States)

Ma, Juan; Yuan, Gang; Chen, Min-hu

2006-10-31

To construct the model of non-steroidal anti-inflammatory drug (NSAID) induced gastropathy and observe the preventive effects of Teprenone on it in rats. Ninety-one male Sprague-Dawley (SD) rats were divided into normal saline group, model group (I) and prophylaxis group (II). Group I includes four subgroups (Ia, Ib, Ic, Id) treated by indomethacin (5 mgxkg(-1)xd(-1)), combination of indomethacin (5 mgxkg(-1)xd(-1)) and prednisone (10 mgxkg(-1)xd(-1)), celecoxib (100 mgxkg(-1)xd(-1)) and combination of celecoxib (100 mgxkg(-1)xd(-1)) and prednisone (10 mgxkg(-1)xd(-1)) respectively. Group II also includes four subgroups (IIa, IIb, IIc, IId) pretreated by teprenone (12 mgxkg(-1)xd(-1)) compared with group I. Lesion index (LI), pathohistology index, cyclooxygenase-1 (COX-1) and cyclooxygenase-2 (COX-2) mRNA detected by RT-PCR were observed after 4 days. Compared with normal saline group, LI (11.00 (1.00 - 22.5), 8.50 (0.75 - 14.50), 11.00 (3.50 - 14.75), P NSAID. Prednisone could promote the risk in NSAID induced gastropathy. In addition to COX-1 inhibition, other factors might also involved in NSAID induced gastropathy. Teprenone could prevented from NSAID induced gastropathy but the actions might be not associated with COXs.

Mouse ATP-Binding Cassette (ABC) Transporters Conferring Multi-Drug Resistance

Science.gov (United States)

Shuaizhang, L I; Zhang, Wen; Yin, Xuejiao; Xing, Shilai; Xie, Qunhui; Cao, Zhengyu; Zhao, Bin

2015-04-28

The ABC (ATP-binding cassette) transporter is one of the largest and most ancient protein families with members functioning from protozoa to human. The resistance of cancer and tumor cells to anticancer drugs is due to the over-expression of some ABC transporters, which may finally lead to chemotherapy failure. The mouse ABC transporters are classified into seven subfamilies by phylogenetic analysis. The mouse ABC transporter gene, alias, chromosomal location and function have been determined. Within the ABC super-family, the MDR transporters (Abcb1, Abcc1, Abcg2) in mouse models have been proved to be valuable to investigate the biochemistry and physiological functions. This review concentrates on the multidrug resistance of mouse ABC transporters in cancer and tumor cells.

Drug Induced Steatohepatitis: An Uncommon Culprit of a Common Disease

Directory of Open Access Journals (Sweden)

Liane Rabinowich

2015-01-01

Full Text Available Nonalcoholic fatty liver disease (NAFLD is a leading cause of liver disease in developed countries. Its frequency is increasing in the general population mostly due to the widespread occurrence of obesity and the metabolic syndrome. Although drugs and dietary supplements are viewed as a major cause of acute liver injury, drug induced steatosis and steatohepatitis are considered a rare form of drug induced liver injury (DILI. The complex mechanism leading to hepatic steatosis caused by commonly used drugs such as amiodarone, methotrexate, tamoxifen, valproic acid, glucocorticoids, and others is not fully understood. It relates not only to induction of the metabolic syndrome by some drugs but also to their impact on important molecular pathways including increased hepatocytes lipogenesis, decreased secretion of fatty acids, and interruption of mitochondrial β-oxidation as well as altered expression of genes responsible for drug metabolism. Better familiarity with this type of liver injury is important for early recognition of drug hepatotoxicity and crucial for preventing severe forms of liver injury and cirrhosis. Moreover, understanding the mechanisms leading to drug induced hepatic steatosis may provide much needed clues to the mechanism and potential prevention of the more common form of metabolic steatohepatitis.

Glucose hypermetabolism in the thalamus of patients with drug-induced blepharospasm.

Science.gov (United States)

Suzuki, Y; Kiyosawa, M; Wakakura, M; Mochizuki, M; Ishiwata, K; Oda, K; Ishii, K

2014-03-28

We examined the difference in cerebral function alterations between drug-induced blepharospasm patients and essential blepharospasm (EB) patients by using positron emission tomography with (18)F-fluorodeoxyglucose. Cerebral glucose metabolism was examined in 21 patients with drug-induced blepharospasm (5 men and 16 women; mean age, 53.1 [range, 29-78] years), 21 essential EB patients (5 men and 16 women; mean age, 53.0 [range, 33-72] years) and 24 healthy subjects (6 men and 18 women; mean age, 57.9 [range, 22-78] years) with long-term history of benzodiazepines use (drug healthy subjects). Drug-induced blepharospasm patients developed symptoms while taking benzodiazepines or thienodiazepines. Sixty-three normal volunteers (15 men and 48 women; mean age, 53.6 [range, 20-70] years) were examined as controls. Differences between the patient groups and control group were examined by statistical parametric mapping. Additionally, we defined regions of interests on both sides of the thalamus, caudate nucleus, anterior putamen, posterior putamen and primary somatosensory area. The differences between groups were tested using two-sample t-tests with Bonferroni correction for multiple comparisons. Cerebral glucose hypermetabolism on both side of the thalamus was detected in drug-induced blepharospasm, EB patients and drug healthy subjects by statistical parametric mapping. In the analysis of regions of interest, glucose metabolism in both sides of the thalamus in the drug-induced blepharospasm group was significantly lower than that in the EB group. Moreover, we observed glucose hypermetabolism in the anterior and posterior putamen bilaterally in EB group but not in drug-induced blepharospasm group and drug healthy subjects. Long-term regimens of benzodiazepines or thienodiazepines may cause down-regulation of benzodiazepine receptors in the brain. We suggest that the functional brain alteration in drug-induced blepharospasm patients is similar to that in EB patients, and

An Overview on the Proposed Mechanisms of Antithyroid Drugs-Induced Liver Injury