Energy Technology Data Exchange (ETDEWEB)
Wang, Juan; Xin, Beibei; Wang, Hui; He, Xiaodan [School of Medicine, Nankai University, 94 Weijin Road, Tianjin 300071 (China); Wei, Wei; Zhang, Ti [Tianjin Medical University Cancer Institute and Hospital, Huanhu West Road, Tianjin 300060 (China); Shen, Xiaohong, E-mail: zebal2014@163.com [School of Medicine, Nankai University, 94 Weijin Road, Tianjin 300071 (China)
2016-08-01
Gastrin is absent in most normal adult pancreatic tissues but is highly expressed in pancreatic cancer tissues. Although Gastrin expression was reported to be associated with tumor proliferation in human pancreatic cancer, studies on the relationship between Gastrin and tumor metastasis in pancreatic cancer are rare. In this study, we performed an analysis to determine the effects of Gastrin on modulating the side populations, cell proportion and tumor cell metastatic potential and invasion activity and explored its mechanisms in pancreatic cancer. We indicated that Gastrin and ABCG2 were widely expressed in pancreatic cancer cell lines and overexpressed in cancer tissues. Gastrin induced ABCG2 expression, and this effect was mediated by NF-κB activation. Gastrin regulated the SP proportion of BxPC-3 cells via modulating ABCG2 expression. Through the regulation of the functions of NF-κB/ABCG2, Gastrin functionally promoted the migration and invasion in pancreatic cancer cell. The present study indicated that Gastrin induced ABCG2 expression by activating NF-κB and thereby modulated the SP proportion, tumor cell metastatic potential and invasion activity in pancreatic cancer. Gastrin could serve as an effective therapeutic target for the metastasis of pancreatic cancer. - Highlights: • Gastrin induces ABCG2 expression mediated by NF-κB activation. • Gastrin regulates NF-κB's function that binds to the ABCG2 promoter in BxPC-3 cells. • Gastrin promotes the SP proportion in BxPC-3 cells by modulating ABCG2 expression via activation of NF-κB molecule. • Gastrin induces an increase in migration and invasion potential in pancreatic cancer cell by regulating NF-κB/ABCG2 signaling.
Haider, Ameena J; Cox, Megan H; Jones, Natalie; Goode, Alice J; Bridge, Katherine S; Wong, Kelvin; Briggs, Deborah; Kerr, Ian D
2015-07-17
ABCG2 is an ABC (ATP-binding cassette) transporter with a physiological role in urate transport in the kidney and is also implicated in multi-drug efflux from a number of organs in the body. The trafficking of the protein and the mechanism by which it recognizes and transports diverse drugs are important areas of research. In the current study, we have made a series of single amino acid mutations in ABCG2 on the basis of sequence analysis. Mutant isoforms were characterized for cell surface expression and function. One mutant (I573A) showed disrupted glycosylation and reduced trafficking kinetics. In contrast with many ABC transporter folding mutations which appear to be 'rescued' by chemical chaperones or low temperature incubation, the I573A mutation was not enriched at the cell surface by either treatment, with the majority of the protein being retained in the endoplasmic reticulum (ER). Two other mutations (P485A and M549A) showed distinct effects on transport of ABCG2 substrates reinforcing the role of TM helix 3 in drug recognition and transport and indicating the presence of intracellular coupling regions in ABCG2. © 2015 Authors.
Directory of Open Access Journals (Sweden)
Pranav Gupta
2018-02-01
Full Text Available Background/Aims: The overexpression of ATP-Binding Cassette (ABC transporters has known to be one of the major obstacles impeding the success of chemotherapy in drug resistant cancers. In this study, we evaluated voruciclib, a CDK 4/6 inhibitor, for its chemo-sensitizing activity in ABCB1- and ABCG2- overexpressing cells. Methods: Cytotoxicity and reversal effect of voruciclib was determined by MTT assay. The intracellular accumulation and efflux of ABCB1 and ABCG2 substrates were measured by scintillation counter. The effects on expression and intracellular localization of ABCB1 and ABCG2 proteins were determined by Western blotting and immunofluorescence, respectively. Vanadate-sensitive ATPase assay was done to determine the effect of voruciclib on the ATPase activity of ABCB1 and ABCG2. Flow cytometric analysis was done to determine the effect of voruciclib on apoptosis of ABCB1 and ABCG2-overexpressing cells and docking analysis was done to determine the interaction of voruciclib with ABCB1 and ACBG2 protein. Results: Voruciclib significantly potentiated the effect of paclitaxel and doxorubicin in ABCB1-overexpressing cells, as well as mitoxantrone and SN-38 in ABCG2-overexpressing cells. Voruciclib moderately sensitized ABCC10- overexpressing cells to paclitaxel, whereas it did not alter the cytotoxicity of substrates of ABCC1. Furthermore, voruciclib increased the intracellular accumulation and decreased the efflux of substrate anti-cancer drugs from ABCB1- or ABCG2-overexpressing cells. However, voruciclib did not alter the expression or the sub-cellular localization of ABCB1 or ABCG2. Voruciclib stimulated the ATPase activity of both ABCB1 and ABCG2 in a concentration-dependent manner. Lastly, voruciclib exhibited a drug-induced apoptotic effect in ABCB1- or ABCG2- overexpressing cells. Conclusion: Voruciclib is currently a phase I clinical trial drug. Our findings strongly support its potential use in combination with conventional anti
Hegedüs, Csilla; Truta-Feles, Krisztina; Antalffy, Géza; Várady, György; Német, Katalin; Ozvegy-Laczka, Csilla; Kéri, György; Orfi, László; Szakács, Gergely; Settleman, Jeffrey; Váradi, András; Sarkadi, Balázs
2012-08-01
Human ABCG2 is a plasma membrane glycoprotein that provides physiological protection against xenobiotics. ABCG2 also significantly influences biodistribution of drugs through pharmacological tissue barriers and confers multidrug resistance to cancer cells. Moreover, ABCG2 is the molecular determinant of the side population that is characteristically enriched in normal and cancer stem cells. Numerous tumors depend on unregulated EGFR signaling, thus inhibition of this receptor by small molecular weight inhibitors such as gefitinib, and the novel second generation agents vandetanib, pelitinib and neratinib, is a promising therapeutic option. In the present study, we provide detailed biochemical characterization regarding the interaction of these EGFR inhibitors with ABCG2. We show that ABCG2 confers resistance to gefitinib and pelitinib, whereas the intracellular action of vandetanib and neratinib is unaltered by the presence of the transporter. At higher concentrations, however, all these EGFR inhibitors inhibit ABCG2 function, thereby promoting accumulation of ABCG2 substrate drugs. We also report enhanced expression of ABCG2 in gefitinib-resistant non-small cell lung cancer cells, suggesting potential clinical relevance of ABCG2 in acquired drug resistance. Since ABCG2 has important impact on both the pharmacological properties and anti-cancer efficiencies of drugs, our results regarding the novel EGFR inhibitors should provide useful information about their therapeutic applicability against ABCG2-expressing cancer cells depending on EGFR signaling. In addition, the finding that these EGFR inhibitors efficiently block ABCG2 function may help to design novel drug-combination therapeutic strategies. Copyright © 2012 Elsevier Inc. All rights reserved.
Wang, De-Shen; Patel, Atish; Shukla, Suneet; Zhang, Yun-Kai; Wang, Yi-Jun; Kathawala, Rishil J; Robey, Robert W; Zhang, Li; Yang, Dong-Hua; Talele, Tanaji T; Bates, Susan E; Ambudkar, Suresh V; Xu, Rui-Hua; Chen, Zhe-Sheng
2014-06-30
ABCG2 is a potential biomarker causing multidrug resistance (MDR) in Non-Small Cell Lung Cancer (NSCLC). We conducted this study to investigate whether Icotinib, a small-molecule inhibitor of EGFR tyrosine kinase, could interact with ABCG2 transporter in NSCLC. Our results showed that Icotinib reversed ABCG2-mediated MDR by antagonizing the drug efflux function of ABCG2. Icotinib stimulated the ATPase activity in a concentration-dependent manner and inhibited the photolabeling of ABCG2 with [125I]-Iodoarylazidoprazosin, demonstrating that it interacts at the drug-binding pocket. Homology modeling predicted the binding conformation of Icotinib at Asn629 centroid-based grid of ABCG2. However, Icotinib at reversal concentration did not affect the expression levels of AKT and ABCG2. Furthermore, a combination of Icotinib and topotecan exhibited significant synergistic anticancer activity against NCI-H460/MX20 tumor xenografts. However, the inhibition of transport activity of ABCG2 was insufficient to overcome pemetrexed resistance in NCI-H460/MX20 cells, which was due to the co-upregulated thymidylate synthase (TS) and ABCG2 expression. This is the first report to show that the up-regulation of TS in ABCG2-overexpressing cell line NCI-H460/MX20 may play a role of resistance to pemetrexate. Our findings suggested different possible strategies of overcoming the resistance of topotecan and pemetrexed in the NSCLC patients.
The structure of the human ABC transporter ABCG2 reveals a novel mechanism for drug extrusion.
Khunweeraphong, Narakorn; Stockner, Thomas; Kuchler, Karl
2017-10-23
The human ABC transporter ABCG2 (Breast Cancer Resistance Protein, BCRP) is implicated in anticancer resistance, in detoxification across barriers and linked to gout. Here, we generate a novel atomic model of ABCG2 using the crystal structure of ABCG5/G8. Extensive mutagenesis verifies the structure, disclosing hitherto unrecognized essential residues and domains in the homodimeric ABCG2 transporter. The elbow helix, the first intracellular loop (ICL1) and the nucleotide-binding domain (NBD) constitute pivotal elements of the architecture building the transmission interface that borders a central cavity which acts as a drug trap. The transmission interface is stabilized by salt-bridge interactions between the elbow helix and ICL1, as well as within ICL1, which is essential to control the conformational switch of ABCG2 to the outward-open drug-releasing conformation. Importantly, we propose that ICL1 operates like a molecular spring that holds the NBD dimer close to the membrane, thereby enabling efficient coupling of ATP hydrolysis during the catalytic cycle. These novel mechanistic data open new opportunities to therapeutically target ABCG2 in the context of related diseases.
Directory of Open Access Journals (Sweden)
Jun-O Jin
Full Text Available Breast cancer resistance protein (ABCG2, a member of the ATP-binding cassette transporters has been identified as a major determinant of multidrug resistance (MDR in cancer cells, but ABC transporter inhibition has limited therapeutic value in vivo. In this research, we demonstrated that inhibition of efflux transporters ABCG2 induced the generation of tolerogenic DCs from human peripheral blood myeloid DCs (mDCs. ABCG2 expression was present in mDCs and was further increased by LPS stimulation. Treatment of CD1c+ mDCs with an ABCG2 inhibitor, Ko143, during LPS stimulation caused increased production of IL-10 and decreased production of pro-inflammatory cytokines and decreased expression of CD83 and CD86. Moreover, inhibition of ABCG2 in monocyte-derived DCs (MDDCs abrogated the up-regulation of co-stimulatory molecules and production of pro-inflammatory cytokines in these cells in response to LPS. Furthermore, CD1c+ mDCs stimulated with LPS plus Ko143 inhibited the proliferation of allogeneic and superantigen-specific syngenic CD4+ T cells and promoted expansion of CD25+FOXP3+ regulatory T (Treg cells in an IL-10-dependent fashion. These tolerogenic effects of ABCG2 inhibition could be abolished by ERK inhibition. Thus, we demonstrated that inhibition of ABCG2 in LPS-stimulated mDCs can potently induce tolerogenic potentials in these cells, providing crucial new information that could lead to development of better strategies to combat MDR cancer.
Generation of an ABCG2GFPn-puro transgenic line - A tool to study ABCG2 expression in mice
International Nuclear Information System (INIS)
Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen; Malas, Stavros
2009-01-01
The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.
Generation of an ABCG2{sup GFPn-puro} transgenic line - A tool to study ABCG2 expression in mice
Energy Technology Data Exchange (ETDEWEB)
Orford, Michael; Mean, Richard; Lapathitis, George; Genethliou, Nicholas; Panayiotou, Elena; Panayi, Helen [The Cyprus Institute of Neurology and Genetics, Airport Avenue, No. 6, Agios Dometios 2370, Nicosia (Cyprus); Malas, Stavros, E-mail: smalas@cing.ac.cy [The Cyprus Institute of Neurology and Genetics, Airport Avenue, No. 6, Agios Dometios 2370, Nicosia (Cyprus); Department of Biological Sciences, University of Cyprus, P.O. Box 20537, 1678 Nicosia (Cyprus)
2009-06-26
The ATP-binding cassette (ABC) transporter 2 (ABCG2) is expressed by stem cells in many organs and in stem cells of solid tumors. These cells are isolated based on the side population (SP) phenotype, a Hoechst 3342 dye efflux property believed to be conferred by ABCG2. Because of the limitations of this approach we generated transgenic mice that express Nuclear GFP (GFPn) coupled to the Puromycin-resistance gene, under the control of ABCG2 promoter/enhancer sequences. We show that ABCG2 is expressed in neural progenitors of the developing forebrain and spinal cord and in embryonic and adult endothelial cells of the brain. Using the neurosphere assay, we isolated tripotent ABCG2-expressing neural stem cells from embryonic mouse brain. This transgenic line is a powerful tool for studying the expression of ABCG2 in many tissues and for performing functional studies in different experimental settings.
Cigarette smoke promotes drug resistance and expansion of cancer stem cell-like side population.
Directory of Open Access Journals (Sweden)
Yi An
Full Text Available It is well known that many patients continue to smoke cigarettes after being diagnosed with cancer. Although smoking cessation has typically been presumed to possess little therapeutic value for cancer, a growing body of evidence suggests that continued smoking is associated with reduced efficacy of treatment and a higher incidence of recurrence. We therefore investigated the effect of cigarette smoke condensate (CSC on drug resistance in the lung cancer and head and neck cancer cell lines A549 and UMSCC-10B, respectively. Our results showed that CSC significantly increased the cellular efflux of doxorubicin and mitoxantrone. This was accompanied by membrane localization and increased expression of the multi-drug transporter ABCG2. The induced efflux of doxorubicin was reversed upon addition of the specific ABCG2 inhibitor Fumitremorgin C, confirming the role of ABCG2. Treatment with CSC increased the concentration of phosphorylated Akt, while addition of the PI3K inhibitor LY294002 blocked doxorubicin extrusion, suggesting that Akt activation is required for CSC-induced drug efflux. In addition, CSC was found to promote resistance to doxorubicin as determined by MTS assays. This CSC-induced doxurbicin-resistance was mitigated by mecamylamine, a nicotinic acetylcholine receptor inhibitor, suggesting that nicotine is at least partially responsible for the effect of CSC. Lastly, CSC increased the size of the side population (SP, which has been linked to a cancer stem cell-like phenotype. In summary, CSC promotes chemoresistance via Akt-mediated regulation of ABCG2 activity, and may also increase the proportion of cancer stem-like cells, contributing to tumor resilience. These findings underscore the importance of smoking cessation following a diagnosis of cancer, and elucidate the mechanisms of continued smoking that may be detrimental to treatment.
Directory of Open Access Journals (Sweden)
Anne Ripperger
2018-05-01
Full Text Available The ATP-binding cassette transporter ABCG2 (BCRP and MXR is involved in the absorption, distribution, and elimination of numerous drugs. Thus, drugs that are able to reduce the activity of ABCG2, e.g., antihypertensive AT1 receptor antagonists (ARBs, may cause drug-drug interactions and compromise drug safety and efficacy. In addition, genetic variability within the ABCG2 gene may influence the ability of the transporter to interact with ARBs. Thus, the aim of this study was to characterize the ARB-ABCG2 interaction in the light of naturally occurring variations (F489L, R482G or amino acid substitutions with in silico-predicted relevance for the ARB-ABCG2 interaction (Y469A; M483F; Y570A. For this purpose, ABCG2 variants were expressed in HEK293 cells and the impact of ARBs on ABCG2 activity was studied in vitro using the pheophorbide A (PhA efflux assay. First, we demonstrated that both the F489L and the Y469A substitution, respectively, reduced ABCG2 protein levels in these cells. Moreover, both substitutions enhanced the inhibitory effect of candesartan cilexetil, irbesartan, losartan, and telmisartan on ABCG2-mediated PhA efflux, whereas the R482G substitution blunted the inhibitory effect of candesartan cilexetil and telmisartan in this regard. In contrast, the ARB-ABCG2 interaction was not altered in cells expressing either the M483F or the Y570A variant, respectively. In conclusion, our data indicate that the third transmembrane helix and adjacent regions of ABCG2 may be of major importance for the interaction of ARBs with the ABC transporter. Moreover, we conclude from our data that individuals carrying the F489L polymorphism may be at increased risk of developing ABCG2-related drug-drug interactions in multi-drug regimens involving ARBs.
Wang, Yu; Lin, Zhijian; Zhang, Bing; Nie, Anzheng; Bian, Meng
2017-01-01
Excessive production and/or reduced excretion of uric acid could lead to hyperuricemia, which could be a major cause of disability. Hyperuricemia has received increasing attention in the last few decades due to its global prevalence. Cichorium intybus L., commonly known as chicory, is a perennial herb of the asteraceae family. It was previously shown to exert potent hypouricemic effects linked with decreasing uric acid formation in the liver by down-regulating the activity of xanthine oxidase, and increasing uric acid excretion by up-regulating the renal OAT3 mRNA expression. The present study aimed to evaluate its extra-renal excretion and possible molecular mechanism underlying the transporter responsible for intestinal uric acid excretion in vivo. Chicory was administered intragastrically to hyperuricemic rats induced by drinking 10% fructose water. The uricosuric effect was evaluated by determining the serum uric acid level as well as the intestinal uric acid excretion by HPLC. The location and expression levels of ATP-binding cassette transporter, sub-family G, member 2 (ABCG2) in jejunum and ileum were analyzed. The administration of chicory decreased the serum uric acid level significantly and increased the intestinal uric acid excretion obviously in hyperuricemic rats induced by 10% fructose drinking. Staining showed that ABCG2 was expressed in the apical membrane of the epithelium and glands of the jejunum and ileum in rats. Further examination showed that chicory enhanced the mRNA and protein expressions of ABCG2 markedly in a dose-dependent manner in jejunum and ileum. These findings indicate that chicory increases uric acid excretion by intestines, which may be related to the stimulation of intestinal uric acid excretion via down-regulating the mRNA and protein expressions of ABCG2.
Maeda, Akimitsu; Ando, Hitoshi; Ura, Takashi; Komori, Azusa; Hasegawa, Ayako; Taniguchi, Hiroya; Kadowaki, Shigenori; Muro, Kei; Tajika, Masahiro; Kobara, Makiko; Matsuzaki, Masahide; Hashimoto, Naoya; Maeda, Mieko; Kojima, Yasushi; Aoki, Masahiro; Kondo, Eisaku; Mizutani, Akiyoshi; Fujimura, Akio
2017-05-01
Due to the occurrence of severe adverse drug reactions to regorafenib, a drug used in cancer therapy, the identification of a predictive marker(s) is needed to increase the therapeutic applicability of this compound. We therefore investigated whether polymorphisms in the ABCG2 and SLCO1B genes are associated with adverse drug reactions to regorafenib. For these analyses, 37 Japanese cancer patients were treated with regorafenib, genotyped for polymorphisms in ABCG2 and SLCO1B, and evaluated for drug-related adverse drug reactions. There was no association between the ABCG2 421C>A variant and adverse drug reactions to regorafenib. After treatment, the incidences of increased aspartate aminotransferase (AST) and alanine aminotransferase (ALT) as well as increased total bilirubin (grade ≥ 2) were 8%, 4%, and 12%, and 42%, 25%, and 25% among SLCO1B1*1b carriers and non-carriers, respectively. There were no significant associations between elevated ALT and bilirubin and the SLCO1B1*1b allele. However, there were significantly lower incidences of increased AST (8% vs. 42%) and anemia (16% vs. 50%) in SLCO1B1*1b carriers than in non-carriers. The absence of SLCO1B1*1b allele appears to be associated with the development of adverse drug reactions to regorafenib; however, further studies involving larger test groups and other populations are needed to confirm these findings. .
Contrasting roles of the ABCG2 Q141K variant in prostate cancer
Energy Technology Data Exchange (ETDEWEB)
Sobek, Kathryn M. [Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, PA (United States); Cummings, Jessica L. [Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, PA (United States); Department of Critical Care Medicine, University of Pittsburgh, Pittsburgh, PA (United States); Bacich, Dean J. [Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, PA (United States); Department of Urology, University of Texas Health Science Center, San Antonio, TX (United States); O’Keefe, Denise S., E-mail: OKeefeD@uthscsa.edu [Department of Urology, University of Pittsburgh School of Medicine, Pittsburgh, PA (United States); Department of Urology, University of Texas Health Science Center, San Antonio, TX (United States)
2017-05-01
ABCG2 is a membrane transport protein that effluxes growth-promoting molecules, such as folates and dihydrotestosterone, as well as chemotherapeutic agents. Therefore it is important to determine how variants of ABCG2 affect the transporter function in order to determine whether modified treatment regimens may be necessary for patients harboring ABCG2 variants. Previous studies have demonstrated an association between the ABCG2 Q141K variant and overall survival after a prostate cancer diagnosis. We report here that in patients with recurrent prostate cancer, those who carry the ABCG2 Q141K variant had a significantly shorter time to PSA recurrence post-prostatectomy than patients homozygous for wild-type ABCG2 (P=0.01). Transport studies showed that wild-type ABCG2 was able to efflux more folic acid than the Q141K variant (P<0.002), suggesting that retained tumoral folate contributes to the decreased time to PSA recurrence in the Q141K variant patients. In a seemingly conflicting study, it was previously reported that docetaxel-treated Q141K variant prostate cancer patients have a longer survival time. We found this may be due to less efficient docetaxel efflux in cells with the Q141K variant versus wild-type ABCG2. In human prostate cancer tissues, confocal microscopy revealed that all genotypes had a mixture of cytoplasmic and plasma membrane staining, with noticeably less staining in the two homozygous KK patients. In conclusion, the Q141K variant plays contrasting roles in prostate cancer: 1) by decreasing folate efflux, increased intracellular folate levels result in enhanced tumor cell proliferation and therefore time to recurrence decreases; and 2) in patients treated with docetaxel, by decreasing its efflux, intratumoral docetaxel levels and tumor cell drug sensitivity increase and therefore patient survival time increases. Taken together, these data suggest that a patient's ABCG2 genotype may be important when determining a personalized treatment
Directory of Open Access Journals (Sweden)
Guang Zhang
2013-01-01
Full Text Available Background. Despite improvement in treatment, the prognosis of hepatocellular carcinoma (HCC remains disastrous. Cancer stem cells (CSCs may be responsible for cancer malignant behaviors. ATP-binding cassette, subfamily G, member 2 (ABCG2 is widely expressed in both normal and cancer stem cells and may play an important role in cancer malignant behaviors. Methods. The expression of ABCG2 in HCC tissues and SMMC-7721 cells was examined, and the relevance of ABCG2 expression with clinical characteristics was analyzed. ABCG2+ and ABCG2− cells were sorted, and the potential of tumorigenicity was determined. Expression level of ABCG2 was manipulated by RNA interference and overexpression. Malignant behaviors including proliferation, drug resistance, migration, and invasion were studied in vitro. Results. Expression of ABCG2 was found in a minor group of cells in HCC tissues and cell lines. ABCG2 expression showed tendencies of association with unfavorable prognosis factors. ABCG2 positive cells showed a superior tumorigenicity. Upregulation of ABCG2 enhanced the capacity of proliferation, doxorubicin resistance, migration, and invasion potential, while downregulation of ABCG2 significantly decreased these malignant behaviors. Conclusion. Our results indicate that ABCG2 is a potential CSC marker for HCC. Its expression level has a close relationship with tumorigenicity, proliferation, drug resistance, and metastasis ability.
Manzini, L; Halwachs, S; Girolami, F; Badino, P; Honscha, W; Nebbia, C
2017-12-01
The ATP-binding cassette efflux transporter ABCG2 plays a key role in the mammary excretion of drugs and toxins in humans and animals. Aflatoxins (AF) are worldwide contaminants of food and feed commodities, while PCB 126 is a dioxin-like PCB which may contaminate milk and dairy products. Both compounds are known human carcinogens. The interactions between AF and bovine ABCG2 (bABCG2) as well as the effects of PCB 126 on its efflux activity have been investigated by means of the Hoechst H33342 transport assay in MDCKII cells stably expressing mammary bABCG2. Both AFB1 and its main milk metabolite AFM1 showed interaction with bABCG2 even at concentrations approaching the legal limits in feed and food commodities. Moreover, PCB 126 significantly enhanced bABCG2 functional activity. Specific inhibitors of either AhR (CH233191) or ABCG2 (Ko143) were able to reverse the PCB 126-induced increase in bABCG2 transport activity, showing the specific upregulation of the efflux protein by the AhR pathway. The incubation of PCB 126-pretreated cells with AFM1 was able to substantially reverse such effect, with still unknown mechanism(s). Overall, results from this study point to AFB1 and AFM1 as likely bABCG2 substrates. The PCB 126-dependent increased activity of the transporter could enhance the ABCG2-mediated excretion into dairy milk of chemicals (i.e., drugs and toxins) potentially harmful to neonates and consumers. © 2017 John Wiley & Sons Ltd.
Shukla, Suneet; Wu, Chung-Pu; Nandigama, Krishnamachary; Ambudkar, Suresh V.
2008-01-01
Vitamin K3 (Menadione; 2-methyl-1,4-naphthoquinone) is a structural precursor of vitamins K1 and K2 which are essential for blood clotting. The naturally occurring structural analog of this vitamin, plumbagin (5-hydroxy-menadione), is known to modulate cellular proliferation, apoptosis, carcinogenesis, and radioresistance. We, here, report that both vitamin K3 and plumbagin are substrates of the multidrug resistance-linked ATP binding cassette (ABC) drug transporter, ABCG2. Vitamin K3 and plumbagin specifically inhibited the ABCG2-mediated efflux of mitoxantrone, but did not have any effect on the ABCB1-mediated efflux of rhodamine 123. This inhibition of ABCG2 function was due to their interaction at the substrate-binding site(s). They inhibited the binding of [125I]-Iodoarylazidoprazosin (IAAP), a substrate of ABCG2, to this transporter in a concentration-dependent manner with IC50 values of 7.3 and 22.6 μM, respectively, but had no effect on the binding of this photoaffinity analog to ABCB1. Both compounds stimulated ABCG2-mediated ATP hydrolysis and also inhibited the mitoxantrone-stimulated ATPase activity of this transporter, but did not have any significant effect on the ATPase activity of ABCB1. In a cytotoxicity assay, ABCG2-expressing HEK cells were 2.8- and 2.3-fold resistant to plumbagin and vitamin K3, respectively, compared to the control cells, suggesting that they are substrates of this transporter. Collectively, these data demonstrate for the first time that vitamin K3 is a substrate of the ABCG2 transporter. Thus, ABCG2 may have a role in the regulation of vitamin K3 levels in the body. In addition, vitamin K3 and its structural derivative, plumbagin, could potentially be used to modulate ABCG2 function. PMID:18065489
International Nuclear Information System (INIS)
Vlaming, Maria L.H.; Läppchen, Tilman; Jansen, Harm T.; Kivits, Suzanne; Driel, Andy van; Steeg, Evita van de; Hoorn, José W. van der; Sio, Charles F.; Steinbach, Oliver C.; DeGroot, Jeroen
2015-01-01
Introduction: The efflux transporters P-glycoprotein (P-gp, ABCB1) and breast cancer resistance protein (BCRP, ABCG2) are expressed at the blood–brain barrier (BBB), and can limit the access of a wide range of drugs to the brain. In this study we developed a PET-CT imaging method for non-invasive, quantitative analysis of the effect of ABCB1 and ABCG2 on brain penetration of the anti-cancer drug gefitinib, and demonstrated the applicability of this method for identification and quantification of potential modulators of ABCB1 and ABCB2 using the dual inhibitor elacridar. Methods: In vitro cellular accumulation studies with [ 14 C]-gefitinib were conducted in LLC-PK1, MDCKII, and the corresponding ABCB1/Abcb1a and ABCG2/Abcg2 overexpressing cell lines. Subsequently, in vivo brain penetration of [ 18 F]-gefitinib was quantified by PET-CT imaging studies in wild-type, Abcg2 −/− , Abcb1a/1b −/− , and Abcb1a/1b;Abcg2 −/− mice. Results: In vitro studies showed that [ 14 C]-gefitinib is a substrate of the human ABCB1 and ABCG2 transporters. After i.v. administration of [ 18 F]-gefitinib (1 mg/kg), PET-CT imaging showed 2.3-fold increased brain levels of [ 18 F]-gefitinib in Abcb1a/1b;Abcg2 −/− mice, compared to wild-type. Levels in single knockout animals were not different from wild-type, showing that Abcb1a/1b and Abcg2 together limit access of [ 18 F]-gefitinib to the brain. Furthermore, enhanced brain accumulation of [ 18 F]-gefitinib after administration of the ABCB1 and ABCG2 inhibitor elacridar (10 mg/kg) could be quantified with PET-CT imaging. Conclusions: PET-CT imaging with [ 18 F]-gefitinib is a powerful tool to non-invasively assess potential ABCB1- and ABCG2-mediated drug–drug interactions (DDIs) in vivo. Advances in knowledge and implications for patient care: This minimally-invasive, [ 18 F]-based PET-CT imaging method shows the interplay of ABCB1 and ABCG2 at the BBB in vivo. The method may be applied in the future to assess ABCB1 and
Effect of ABCG2/BCRP Expression on Efflux and Uptake of Gefitinib in NSCLC Cell Lines.
Directory of Open Access Journals (Sweden)
Maricla Galetti
Full Text Available BCRP/ABCG2 emerged as an important multidrug resistance protein, because it confers resistance to several classes of cancer chemotherapeutic agents and to a number of novel molecularly-targeted therapeutics such as tyrosine kinase inhibitors. Gefitinib is an orally active, selective EGFR tyrosine kinase inhibitor used in the treatment of patients with advanced non small cell lung cancer (NSCLC carrying activating EGFR mutations. Membrane transporters may affect the distribution and accumulation of gefitinib in tumour cells; in particular a reduced intracellular level of the drug may result from poor uptake, enhanced efflux or increased metabolism.The present study, performed in a panel of NSCLC cell lines expressing different ABCG2 plasma membrane levels, was designed to investigate the effect of the efflux transporter ABCG2 on intracellular gefitinib accumulation, by dissecting the contribution of uptake and efflux processes.Our findings indicate that gefitinib, in lung cancer cells, inhibits ABCG2 activity, as previously reported. In addition, we suggest that ABCG2 silencing or overexpression affects intracellular gefitinib content by modulating the uptake rather than the efflux. Similarly, overexpression of ABCG2 affected the expression of a number of drug transporters, altering the functional activities of nutrient and drug transport systems, in particular inhibiting MPP, glucose and glutamine uptake.Therefore, we conclude that gefitinib is an inhibitor but not a substrate for ABCG2 and that ABCG2 overexpression may modulate the expression and activity of other transporters involved in the uptake of different substrates into the cells.
Chua, Vivian Y L; Larma, Irma; Harvey, Jennet; Thomas, Marc A; Bentel, Jacqueline M
2016-10-01
Elevated expression of the efflux transporter, ATP-binding cassette subfamily G isoform 2 (ABCG2) on the plasma membrane of cancer cells contributes to the development of drug resistance and is a key characteristic of cancer stem cells. In this study, gene expression analysis identified that treatment of the MCF-7 and T-47D breast cancer cell lines with the androgen, 5α-dihydrotestosterone (DHT), and the Hedgehog signaling inhibitor, cyclopamine downregulated ABCG2 mRNA levels. In MCF-7 cells, and in Hoechst 33342(lo) /CD44(hi) /CD24(lo) breast cancer stem-like cells isolated from MCF-7 cultures, ABCG2 was accumulated in cell-to-cell junction complexes and in large cytoplasmic aggresome-like vesicles. DHT treatments, which decreased cellular ABCG2 protein levels, led to diminished ABCG2 localization in both cell-to-cell junction complexes and in cytoplasmic vesicles. In contrast, cyclopamine, which did not alter ABCG2 protein levels, induced accumulation of ABCG2 in cytoplasmic vesicles, reducing its localization in cell-to-cell junction complexes. The reduced localization of ABCG2 at the plasma membrane of MCF-7 cells was associated with decreased efflux of the ABCG2 substrate, mitoxantrone, and increased sensitivity of cyclopamine-treated cultures to the cytotoxic effects of mitoxantrone. Together, these findings indicate that DHT and cyclopamine reduce ABCG2 activity in breast cancer cells by distinct mechanisms, providing evidence to advocate the adjunct use of analogous pharmaceutics to increase or prolong the efficacy of breast cancer treatments. J. Cell. Biochem. 117: 2249-2259, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Zhang, Yun-Kai; Zhang, Guan-Nan; Wang, Yi-Jun; Patel, Bhargav A.; Talele, Tanaji T.; Yang, Dong-Hua; Chen, Zhe-Sheng
2016-05-01
ATP-Binding Cassette transporters are involved in the efflux of xenobiotic compounds and are responsible for decreasing drug accumulation in multidrug resistant (MDR) cells. Discovered by structure-based virtual screening algorithms, bafetinib, a Bcr-Abl/Lyn tyrosine kinase inhibitor, was found to have inhibitory effects on both ABCB1- and ABCG2-mediated MDR in this in-vitro investigation. Bafetinib significantly sensitized ABCB1 and ABCG2 overexpressing MDR cells to their anticancer substrates and increased the intracellular accumulation of anticancer drugs, particularly doxorubicin and [3H]-paclitaxel in ABCB1 overexpressing cells; mitoxantrone and [3H]-mitoxantrone in ABCG2 overexpressing cells, respectively. Bafetinib stimulated ABCB1 ATPase activities while inhibited ABCG2 ATPase activities. There were no significant changes in the expression level or the subcellular distribution of ABCB1 and ABCG2 in the cells exposed to 3 μM of bafetinib. Overall, our study indicated that bafetinib reversed ABCB1- and ABCG2-mediated MDR by blocking the drug efflux function of these transporters. These findings might be useful in developing combination therapy for MDR cancer treatment.
Shukla, Suneet; Wu, Chung-Pu; Nandigama, Krishnamachary; Ambudkar, Suresh V
2007-12-01
Vitamin K3 (menadione; 2-methyl-1,4-naphthoquinone) is a structural precursor of vitamins K1 and K2, which are essential for blood clotting. The naturally occurring structural analogue of this vitamin, plumbagin (5-hydroxy-menadione), is known to modulate cellular proliferation, apoptosis, carcinogenesis, and radioresistance. We here report that both vitamin K3 and plumbagin are substrates of the multidrug resistance-linked ATP binding cassette drug transporter, ABCG2. Vitamin K3 and plumbagin specifically inhibited the ABCG2-mediated efflux of mitoxantrone but did not have any effect on the ABCB1-mediated efflux of rhodamine 123. This inhibition of ABCG2 function was due to their interaction at the substrate-binding site(s). Vitamin K3 and plumbagin inhibited the binding of [(125)I]iodoarylazidoprazosin, a substrate of ABCG2, to this transporter in a concentration-dependent manner with IC(50) values of 7.3 and 22.6 micromol/L, respectively, but had no effect on the binding of the photoaffinity analogue to ABCB1. Both compounds stimulated ABCG2-mediated ATP hydrolysis and also inhibited the mitoxantrone-stimulated ATPase activity of the ABCG2 transporter, but did not have any significant effect on the ATPase activity of ABCB1. In a cytotoxicity assay, ABCG2-expressing HEK cells were 2.8- and 2.3-fold resistant to plumbagin and vitamin K3, respectively, compared with the control cells, suggesting that they are substrates of this transporter. Collectively, these data show for the first time that vitamin K3 is a substrate of the ABCG2 transporter. Thus, ABCG2 may have a role in the regulation of vitamin K3 levels in the body. In addition, vitamin K3 and its structural derivative, plumbagin, could potentially be used to modulate ABCG2 function.
Implications of ABCG2 Expression on Irinotecan Treatment of Colorectal Cancer Patients
DEFF Research Database (Denmark)
Nielsen, Dorte Lisbet; Palshof, Jesper Andreas; Bruenner, Nils
2017-01-01
Background: One of the main chemotherapeutic drugs used on a routine basis in patients with metastatic colorectal cancer ((m)CRC) is the topoisomerase-1 inhibitor, irinotecan. However, its usefulness is limited by the pre-existing or inevitable development of resistance. The ATP-binding cassette...... to irinotecan treatment in CRC patients. Results: Few studies have evaluated the association between ABCG2 gene or protein expression and prognosis in CRC patients. Discordant results were reported. The discrepancies might be explained by the use of different criteria for interpretation of results...... (ABC) transporter ABCG2/breast cancer resistance protein (BRCP) through its function in xenobiotic clearance might play an important role in irinotecan resistance. With a goal to evaluate the clinical significance of ABCG2 measurements, we here review the current literature on ABCG2 in relation...
Directory of Open Access Journals (Sweden)
Ping Peng
Full Text Available To investigate the association of ABCG1, GALNT2 and HMGCR genes promoter DNA methylation with coronary heart disease (CHD and explore the interaction between their methylation status and the CHD patients' clinical characteristics in Han Chinese population.Methylation-specific polymerase chain reaction (MSP technology was used to examine the role of the aberrant gene promoter methylation in CHD in Han Chinese population. A total of 85 CHD patients and 54 participants without CHD confirmed by angiography were recruited. 82.8% of the participants with ABCG1 gene promoter hypermethylation have CHD, while only 17.4% of the participants without hypermethylation have it. The average age of the participants with GALNT2 gene promoter hypermethylation is 62.10 ± 8.21, while that of the participants without hypermethylation is 57.28 ± 9.87; in the former group, 75.4% of the participants have CHD, compared to only 50% in the latter group. As for the HMGCR gene, the average age of the participants with promoter hypermethylation is 63.24 ± 8.10 and that of the participants without hypermethylation is 57.79 ± 9.55; its promoter hypermethylation is likely to be related to smoking. Our results indicated a significant statistical association of promoter methylation of the ABCG1 gene with increased risk of CHD (OR = 19.966; 95% CI, 7.319-54.468; P*<0.001; P*: adjusted for age, gender, smoking, lipid level, hypertension, and diabetes. Similar results were obtained for that of the GALNT2 gene (OR = 2.978; 95% CI, 1.335-6.646; P* = 0.008, but not of HMGCR gene (OR = 1.388; 95% CI, 0.572-3.371; P* = 0.469.The present work provides evidence to support the association of promoter DNA methylation status with the risk profile of CHD. Our data indicates that promoter DNA hypermethylation of the ABCG1 and GALNT2 genes, but not the HMGCR gene, is associated with an increased risk of CHD. CHD, smoking and aging are likely to be the important factors influencing DNA
The multidrug transporter ABCG2 (BCRP) is inhibited by plant-derived cannabinoids.
Holland, M L; Lau, D T T; Allen, J D; Arnold, J C
2007-11-01
Cannabinoids are used therapeutically for the palliation of the adverse side effects associated with cancer chemotherapy. However, cannabinoids also inhibit both the activity and expression of the multidrug transporter, P-glycoprotein in vitro. Here we address the interaction of cannabinol (CBN), cannabidiol (CBD) and delta 9-tetrahydrocannabinol (THC) with the related multidrug transporter, ABCG2. Cannabinoid inhibition of Abcg2/ABCG2 was assessed using flow cytometric analysis of substrate accumulation and ATPase activity assays. The cytotoxicity and chemosensitization by cannabinoids was determined with cell viability assays. Expression of cannabinoid and vanilloid receptors was assessed using reverse transcriptase polymerase chain reaction, and cannabinoid modulation of ABCG2 expression was examined using immunoblotting. CBN, CBD and THC increased the intracellular accumulation of the Abcg2/ABCG2 substrate, mitoxantrone, in an over-expressing cell line. The THC metabolite, (-)-11-nor-9-carboxy-delta 9-THC was much less potent. The plant cannabinoids inhibited both basal and substrate stimulated ATPase activity of human ABCG2. Cannabinoid cytotoxicity occurred in the absence of known cannabinoid cell surface receptors, and only at concentrations higher than those required for Abcg2/ABCG2 inhibition. Sub-toxic concentrations of the cannabinoids resensitized the overexpressing cell line to the cytotoxic effect of Abcg2/ABCG2 substrates, mitoxantrone and topotecan. This occurred in the absence of any effect on ABCG2 expression. Cannabinoids are novel Abcg2/ABCG2 inhibitors, reversing the Abcg2-mediated multidrug-resistant phenotype in vitro. This finding may have implications for the co-administration of cannabinoids with pharmaceuticals that are ABCG2 substrates.
Otero, J A; Barrera, B; de la Fuente, A; Prieto, J G; Marqués, M; Álvarez, A I; Merino, G
2015-01-01
The ATP-binding cassette transporter ABCG2 restricts the exposure of certain drugs and natural compounds in different tissues and organs. Its expression in the mammary gland is induced during lactation and is responsible for the active secretion of many compounds into milk, including antimicrobial agents. This particular function of ABCG2 may affect drug efficacy against mastitis and the potential presence of drug residues in the milk. Previous in vitro and in vivo studies showed increased transport of several compounds, including fluoroquinolones, by the bovine ABCG2 Y581S polymorphism. Our main purpose was to study the potential effect of this bovine ABCG2 polymorphism on the secretion into milk of the antimicrobial danofloxacin administered at the therapeutic dose of 6mg/kg used for mastitis treatment. In addition, the effect of this polymorphism on the relative mRNA and protein levels of ABCG2 by quantitative real-time PCR and Western blot were studied. Danofloxacin 18% (6mg/kg) was administered to 6 Y/Y homozygous and 5 Y/S heterozygous cows. Danofloxacin levels in milk and milk-to-plasma concentration ratios were almost 1.5- and 2-fold higher, respectively, in Y/S cows compared with the Y/Y cows, showing a higher capacity of this variant to transport danofloxacin into milk. Furthermore, the higher activity of this polymorphism is not linked to higher ABCG2 mRNA or protein levels. These results demonstrate the relevant effect of the Y581S polymorphism of the bovine ABCG2 transporter in the secretion into milk of danofloxacin after administration of 6mg/kg, with potentially important consequences for mastitis treatment and for milk residue handling. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Role of Abcg2 During Mouse Embroyonic Stem Cell Diffferentiation
Role of Abcg2 During Mouse Embryonic Stem Cell Differentiation. Abcg2 is a multidrug resistance ATP-binding cassette (ABC) transporter whose activity may be considered a hallmark of stem cell plasticity. The role of Abcg2 during early embryogenesis, however, is unclear. Studies...
The cholesterol transporter ABCG1 links cholesterol homeostasis and tumour immunity.
Sag, Duygu; Cekic, Caglar; Wu, Runpei; Linden, Joel; Hedrick, Catherine C
2015-02-27
ATP-binding cassette transporter G1 (ABCG1) promotes cholesterol efflux from cells and regulates intracellular cholesterol homeostasis. Here we demonstrate a role of ABCG1 as a mediator of tumour immunity. Abcg1(-/-) mice have dramatically suppressed subcutaneous MB49-bladder carcinoma and B16-melanoma growth and prolonged survival. We show that reduced tumour growth in Abcg1(-/-) mice is myeloid cell intrinsic and is associated with a phenotypic shift of the macrophages from a tumour-promoting M2 to a tumour-fighting M1 within the tumour. Abcg1(-/-) macrophages exhibit an intrinsic bias towards M1 polarization with increased NF-κB activation and direct cytotoxicity for tumour cells in vitro. Overall, our study demonstrates that the absence of ABCG1 inhibits tumour growth through modulation of macrophage function within the tumour, and illustrates a link between cholesterol homeostasis and cancer.
Bloks, VW; Bakker-van Waarde, WW; Verkade, HJ; Kema, IP; Havinga, R; Wolters, H; Schaap, FG; Sauer, PJJ; Vink, E; Groen, AK; Kuipers, F
ABSTRACT: P234 Downregulation of Hepatic and Intestinal ATP-Binding-Cassette Transporters Abcg5 and Abcg8 Expression Associated with Altered Sterol Fluxes in Rats with Streptozotocin-Induced Diabetes Vincent W. Bloks, Willie W. Bakker-van Waarde, Henkjan J. Verkade, Ido P. Kema, Rick Havinga, Henk
Ishikawa, Toshihisa; Tamura, Ai; Saito, Hikaru; Wakabayashi, Kanako; Nakagawa, Hiroshi
2005-10-01
In the post-genome-sequencing era, emerging genomic technologies are shifting the paradigm for drug discovery and development. Nevertheless, drug discovery and development still remain high-risk and high-stakes ventures with long and costly timelines. Indeed, the attrition of drug candidates in preclinical and development stages is a major problem in drug design. For at least 30% of the candidates, this attrition is due to poor pharmacokinetics and toxicity. Thus, pharmaceutical companies have begun to seriously re-evaluate their current strategies of drug discovery and development. In that light, we propose that a transport mechanism-based design might help to create new, pharmacokinetically advantageous drugs, and as such should be considered an important component of drug design strategy. Performing enzyme- and/or cell-based drug transporter, interaction tests may greatly facilitate drug development and allow the prediction of drug-drug interactions. We recently developed methods for high-speed functional screening and quantitative structure-activity relationship analysis to study the substrate specificity of ABC transporters and to evaluate the effect of genetic polymorphisms on their function. These methods would provide a practical tool to screen synthetic and natural compounds, and these data can be applied to the molecular design of new drugs. In this review article, we present an overview on the genetic polymorphisms of human ABC transporter ABCG2 and new camptothecin analogues that can circumvent AGCG2-associated multidrug resistance of cancer.
Zhang, Lanfang; Guo, Xiaohe; Zhang, Dezhong; Fan, Yingying; Qin, Lei; Dong, Shuping; Zhang, Lanfang
2017-09-01
Cisplatin resistance has long been a major problem that restricts its use. A novel paradigm in tumor biology suggests that gastric tumor chemo-resistance is driven by gastric cancer stem cell-like (GCSCs). Growing evidence has indicated that microRNAs (miRNAs) contributes to chemo-resistance in gastric cancer (GC). Here, Lgr5 + cells derived from gastric cancer cell lines displayed stem cell-like features. Flow cytometry demonstrated the presence of a variable fraction of Lgr5 in 19 out of 20 GC specimens. By comparing the miRNA expression profiles of Lgr5 + GCSCs and Lrg5 - cells, we established the upregulation of miR-132 in Lgr5 + GCSCs. The enhanced miR-132 expression correlated chemo-resistance in GC patients. Kaplan-Meier survival curve showed that patients with low miR-132 expression survived obviously longer. Functional assays results indicated that miR-132 promoted cisplatin resistance in Lgr5 + GCSCs in vitro and in vivo. Further dual-luciferase reporter gene assays revealed that SIRT1 was the direct target of miR-132. The expression of miR-132 was inversely correlated with SIRT1 in gastric cancer specimens. Furthermore, through PCR array we discovered ABCG2 was one of the downstream targets of SIRT1. Overexpression of SIRT1 down-regulated ABCG2 expression by promoting the de-acetylation of the transcription factor CREB. CREB was further activated ABCG2 via binding to the promoter of ABCG2 to induce transcription. Thus, we concluded that miR-132 regulated SIRT1/CREB/ABCG2 signaling pathway contributing to the cisplatin resistance and might serve as a novel therapeutic target against gastric cancer. © 2017 Wiley Periodicals, Inc.
Structure and function of ABCG2-rich extracellular vesicles mediating multidrug resistance.
Directory of Open Access Journals (Sweden)
Vicky Goler-Baron
2011-01-01
Full Text Available Multidrug resistance (MDR is a major impediment to curative cancer chemotherapy. The ATP-Binding Cassette transporters ABCG2, ABCB1 and ABCC2 form a unique defense network against multiple structurally and functionally distinct chemotherapeutics, thereby resulting in MDR. Thus, deciphering novel mechanisms of MDR and their overcoming is a major goal of cancer research. Recently we have shown that overexpression of ABCG2 in the membrane of novel extracellular vesicles (EVs in breast cancer cells results in mitoxantrone resistance due to its dramatic sequestration in EVs. However, nothing is known about EVs structure, biogenesis and their ability to concentrate multiple antitumor agents. To this end, we here found that EVs are structural and functional homologues of bile canaliculi, are apically localized, sealed structures reinforced by an actin-based cytoskeleton and secluded from the extracellular milieu by the tight junction proteins occludin and ZO-1. Apart from ABCG2, ABCB1 and ABCC2 were also selectively targeted to the membrane of EVs. Moreover, Ezrin-Radixin-Moesin protein complex selectively localized to the border of the EVs membrane, suggesting a key role for the tethering of MDR pumps to the actin cytoskeleton. The ability of EVs to concentrate and sequester different antitumor drugs was also explored. Taking advantage of the endogenous fluorescence of anticancer drugs, we found that EVs-forming breast cancer cells display high level resistance to topotecan, imidazoacridinones and methotrexate via efficient intravesicular drug concentration hence sequestering them away from their cellular targets. Thus, we identified a new modality of anticancer drug compartmentalization and resistance in which multiple chemotherapeutics are actively pumped from the cytoplasm and highly concentrated within the lumen of EVs via a network of MDR transporters differentially targeted to the EVs membrane. We propose a composite model for the structure and
Goler-Baron, Vicky; Assaraf, Yehuda G.
2012-01-01
Multidrug resistance (MDR) remains a dominant impediment to curative cancer chemotherapy. Efflux transporters of the ATP-binding cassette (ABC) superfamily including ABCG2, ABCB1 and ABCC1 mediate MDR to multiple structurally and functionally distinct antitumor agents. Recently we identified a novel mechanism of MDR in which ABCG2-rich extracellular vesicles (EVs) form in between attached neighbor breast cancer cells and highly concentrate various chemotherapeutics in an ABCG2-dependent manner, thereby sequestering them away from their intracellular targets. Hence, development of novel strategies to overcome MDR modalities is a major goal of cancer research. Towards this end, we here developed a novel approach to selectively target and kill MDR cancer cells. We show that illumination of EVs that accumulated photosensitive cytotoxic drugs including imidazoacridinones (IAs) and topotecan resulted in intravesicular formation of reactive oxygen species (ROS) and severe damage to the EVs membrane that is shared by EVs-forming cells, thereby leading to tumor cell lysis and the overcoming of MDR. Furthermore, consistent with the weak base nature of IAs, MDR cells that are devoid of EVs but contained an increased number of lysosomes, highly accumulated IAs in lysosomes and upon photosensitization were efficiently killed via ROS-dependent lysosomal rupture. Combining targeted lysis of IAs-loaded EVs and lysosomes elicited a synergistic cytotoxic effect resulting in MDR reversal. In contrast, topotecan, a bona fide transport substrate of ABCG2, accumulated exclusively in EVs of MDR cells but was neither detected in lysosomes of normal breast epithelial cells nor in non-MDR breast cancer cells. This exclusive accumulation in EVs enhanced the selectivity of the cytotoxic effect exerted by photodynamic therapy to MDR cells without harming normal cells. Moreover, lysosomal alkalinization with bafilomycin A1 abrogated lysosomal accumulation of IAs, consequently preventing
ABCG2 inhibition as a therapeutic approach for overcoming ...
Indian Academy of Sciences (India)
2016-02-16
Feb 16, 2016 ... Breast cancer resistance protein (BCRP, ABCP or MXR)/ATP-binding cassette subfamily G member 2 (ABCG2) was characterized as a multidrug resistance efflux transporter in 1998. ABCG2 physiologically acts as a part of a self- defence mechanism for the organism; it enhances eliminating of toxic ...
ABCG2 Inhibition as a Therapeutic Approach for Overcoming ...
Indian Academy of Sciences (India)
Breast cancer resistance protein (BCRP, ABCP or MXR) / ATP-binding cassette subfamily G member 2 (ABCG2) was characterized as a multidrug resistance efflux transporter in 1998. ABCG2 physiologically acts as a part of a self-defense mechanism for the organism; it enhances eliminating of toxic xenobiotic substances ...
Correlation of HIF-2α, ABCG2 and OCT-4 with chemotherapy resistance in human gastric cancer
Directory of Open Access Journals (Sweden)
Hong-mei ZHANG
2015-11-01
Full Text Available Objective To investigate the correlation of HIF-2α, ABCG2 and OCT-4 with chemotherapy resistant gastric cancer in humans. Methods Fifty-two patients who were confirmed to have advanced gastric cancer with the aid of electronic endoscopy and pathology in the Department of Gastroenterology, Affiliated Hospital of Weifang Medical College, were enrolled in the study. According to the effect of FOL-FOX4 chemotherapy that these patients had experienced, they were divided into three groups: CR+PR (complete remission+partial remission group, SD (stable disease group and PD (progressive disease group. The expression levels of HIF-2α, ABCG2, and OCT-4 mRNA and protein were assessed in different groups by using RT-PCR and immunocytochemistry. Results Two patients achieved CR , 19 achieved PR , 25 showed SD, and 6 showed PD. In other words, CR+PR were seen in 21 patients (40.4%, SD in 25(48.1%, PD in 6(11.5%. In CR+PR group, the expression levels of HIF-2α, ABCG2 and OCT4 mRNA and protein were low, but the above mentioned expressions were significantly increased in SD group and PD group. The expression levels of HIF-2α, ABCG2 and Oct-4 mRNA and protein were highest in the PD group, lower in the SD group, and lowest in the CR + PR groups (all P<0.05. Conclusions The expression of the markers HIF-2α, ABCG2 and OCT4 in human tumor tissues is related to the effect of chemotherapy for gastric cancer. A high expression of tumor markers is perhaps the main reason for low efficacy of chemotherapy due to drug resistance. DOI: 10.11855/j.issn.0577-7402.2015.10.09
Shukla, Suneet; Wu, Chung-Pu; Nandigama, Krishnamachary; Ambudkar, Suresh V.
2007-01-01
Vitamin K3 (Menadione; 2-methyl-1,4-naphthoquinone) is a structural precursor of vitamins K1 and K2 which are essential for blood clotting. The naturally occurring structural analog of this vitamin, plumbagin (5-hydroxy-menadione), is known to modulate cellular proliferation, apoptosis, carcinogenesis, and radioresistance. We, here, report that both vitamin K3 and plumbagin are substrates of the multidrug resistance-linked ATP binding cassette (ABC) drug transporter, ABCG2. Vitamin K3 and plu...
Abdel Gaber, Sara A; Müller, Patricia; Zimmermann, Wolfgang; Hüttenberger, Dirk; Wittig, Rainer; Abdel Kader, Mahmoud H; Stepp, Herbert
2018-01-01
Photodynamic therapy (PDT) of malignant brain tumors is a promising adjunct to standard treatment, especially if tumor stem cells thought to be responsible for tumor progression and therapy resistance were also susceptible to this kind of treatment. However, some photosensitizers have been reported to be substrates of ABCG2, one of the membrane transporters mediating resistance to chemotherapy. Here we investigate, whether inhibition of ABCG2 can restore sensitivity to photosensitizer chlorin e6-mediated PDT. Accumulation of chlorin e6 in wild type U87 and doxycycline-inducible U251 glioblastoma cells with or without induction of ABCG2 expression or ABCG2 inhibition by KO143 was analyzed using flow cytometry. In U251 cells, ABCG2 was inducible by doxycycline after stable transfection with a tet-on expression plasmid. Tumor sphere cultivation under low attachment conditions was used to enrich for cells with stem cell-like properties. PDT was done on monolayer cell cultures by irradiation with laser light at 665nm. Elevated levels of ABCG2 in U87 cells grown as tumor spheres or in U251 cells after ABCG2 induction led to a 6-fold lower accumulation of chlorin e6 and the light dose needed to reduce cell viability by 50% (LD50) was 2.5 to 4-fold higher. Both accumulation and PDT response can be restored by KO143, an efficient non-toxic inhibitor of ABCG2. Glioblastoma stem cells might escape phototoxic destruction by ABCG2-mediated reduction of photosensitizer accumulation. Inhibition of ABCG2 during photosensitizer accumulation and irradiation promises to restore full susceptibility of this crucial tumor cell population to photodynamic treatment. Copyright © 2017 Elsevier B.V. All rights reserved.
ABCG2 in peptic ulcer: gene expression and mutation analysis.
Salagacka-Kubiak, Aleksandra; Żebrowska, Marta; Wosiak, Agnieszka; Balcerczak, Mariusz; Mirowski, Marek; Balcerczak, Ewa
2016-08-01
The aim of this study was to evaluate the participation of polymorphism at position C421A and mRNA expression of the ABCG2 gene in the development of peptic ulcers, which is a very common and severe disease. ABCG2, encoded by the ABCG2 gene, has been found inter alia in the gastrointestinal tract, where it plays a protective role eliminating xenobiotics from cells into the extracellular environment. The materials for the study were biopsies of gastric mucosa taken during a routine endoscopy. For genotyping by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) at position C421A, DNA was isolated from 201 samples, while for the mRNA expression level by real-time PCR, RNA was isolated from 60 patients. The control group of healthy individuals consisted of 97 blood donors. The dominant genotype in the group of peptic ulcer patients and healthy individuals was homozygous CC. No statistically significant differences between healthy individuals and the whole group of peptic ulcer patients and, likewise, between the subgroups of peptic ulcer patients (infected and uninfected with Helicobacter pylori) were found. ABCG2 expression relative to GAPDH expression was found in 38 of the 60 gastric mucosa samples. The expression level of the gene varies greatly among cases. The statistically significant differences between the intensity (p = 0.0375) of H. pylori infection and ABCG2 gene expression have been shown. It was observed that the more intense the infection, the higher the level of ABCG2 expression.
A novel ABCG-like transporter of Trypanosoma cruzi is involved in natural resistance to benznidazole
Directory of Open Access Journals (Sweden)
Bianca Zingales
2015-05-01
Full Text Available Benznidazole (BZ is one of the two drugs used for Chagas disease treatment. Nevertheless therapeutic failures of BZ have been reported, which were mostly attributed to variable drug susceptibility among Trypanosoma cruzi strains. ATP-binding cassette (ABC transporters are involved in a variety of translocation processes and some members have been implicated in drug resistance. Here we report the characterisation of the first T. cruzi ABCG transporter gene, named TcABCG1, which is over-expressed in parasite strains naturally resistant to BZ. Comparison of TcABCG1 gene sequence of two TcI BZ-resistant strains with CL Brener BZ-susceptible strain showed several single nucleotide polymorphisms, which determined 11 amino acid changes. CL Brener transfected with TcI transporter genes showed 40-47% increased resistance to BZ, whereas no statistical significant increment in drug resistance was observed when CL Brener was transfected with the homologous gene. Only in the parasites transfected with TcI genes there was 2-2.6-fold increased abundance of TcABCG1 transporter protein. The analysis in wild type strains also suggests that the level of TcABCG1 transporter is related to BZ natural resistance. The characteristics of untranslated regions of TcABCG1 genes of BZ-susceptible and resistant strains were investigated by computational tools.
Toussaint, Frédéric; Pierman, Baptiste; Bertin, Aurélie; Lévy, Daniel; Boutry, Marc
2017-05-04
Pleiotropic drug resistance (PDR) transporters belong to the ABCG subfamily of ATP-binding cassette (ABC) transporters and are involved in the transport of various molecules across plasma membranes. During evolution, PDR genes appeared independently in fungi and in plants from a duplication of a half-size ABC gene. The enzymatic properties of purified PDR transporters from yeast have been characterized. This is not the case for any plant PDR transporter, or, incidentally, for any purified plant ABC transporter. Yet, plant PDR transporters play important roles in plant physiology such as hormone signaling or resistance to pathogens or herbivores. Here, we describe the expression, purification, enzymatic characterization and 2D analysis by electron microscopy of NpABCG5/NpPDR5 from Nicotiana plumbaginifolia , which has been shown to be involved in the plant defense against herbivores. We constitutively expressed NpABCG5/NpPDR5, provided with a His-tag in a homologous system: suspension cells from Nicotiana tabacum (Bright Yellow 2 line). NpABCG5/NpPDR5 was targeted to the plasma membrane and was solubilized by dodecyl maltoside and purified by Ni-affinity chromatography. The ATP-hydrolyzing specific activity (27 nmol min -1 mg -1 ) was stimulated seven-fold in the presence of 0.1% asolectin. Electron microscopy analysis indicated that NpABCG5/NpPDR5 is monomeric and with dimensions shorter than those of known ABC transporters. Enzymatic data (optimal pH and sensitivity to inhibitors) confirmed that plant and fungal PDR transporters have different properties. These data also show that N. tabacum suspension cells are a convenient host for the purification and biochemical characterization of ABC transporters. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.
Directory of Open Access Journals (Sweden)
Gozzi GJ
2015-07-01
Full Text Available Gustavo Jabor Gozzi,1,2 Zouhair Bouaziz,3 Evelyn Winter,1,4 Nathalia Daflon-Yunes,1 Mylène Honorat,1 Nathalie Guragossian,3 Christelle Marminon,3 Glaucio Valdameri,1,2 Andre Bollacke,5 Jean Guillon,6 Noël Pinaud,7 Mathieu Marchivie,8 Silvia M Cadena,2 Joachim Jose,5 Marc Le Borgne,3 Attilio Di Pietro11Equipe Labellisée Ligue 2014, BMSSI UMR5086 CNRS/Lyon I University, IBCP, Lyon, France; 2Department of Biochemistry and Molecular Biology, Federal University of Paraná, Curitiba, Paraná, Brazil; 3Faculty of Pharmacy – ISPB, EA 4446 Biomolecules, Cancer and Chemoresistance, Health SFR of East Lyon CNRS UMS3453 - INSERM US7, University of Lyon, Lyon I University, Lyon Cedex 8, France; 4Department of Pharmaceutical Sciences, PGFAR, Federal University of Santa Catarina, Florianopolis, Santa Catarina, Brazil; 5Institute of Pharmaceutical and Medicinal Chemistry, University of Münster, Münster, Germany; 6ARNA Laboratory, Pharmaceutical Sciences UFR, INSERM U869, University of Bordeaux, Bordeaux Cedex, France; 7ISM – CNRS UMR 5255, University of Bordeaux Cedex, France; 8ICMCB CNRS-UPR 9048, University of Bordeaux, Pessac Cedex, FranceAbstract: Ketonic indeno[1,2-b]indole-9,10-dione derivatives, initially designed as human casein kinase II (CK2 inhibitors, were recently shown to be converted into efficient inhibitors of drug efflux by the breast cancer resistance protein ABCG2 upon suited substitutions including a N5-phenethyl on C-ring and hydrophobic groups on D-ring. A series of ten phenolic and seven p-quinonic derivatives were synthesized and screened for inhibition of both CK2 and ABCG2 activities. The best phenolic inhibitors were about threefold more potent against ABCG2 than the corresponding ketonic derivatives, and showed low cytotoxicity. They were selective for ABCG2 over both P-glycoprotein and MRP1 (multidrug resistance protein 1, whereas the ketonic derivatives also interacted with MRP1, and they additionally displayed a lower
[Construction and identification of eukaryotic plasmid pGC-silencer-U6/Neo/GFP/ABCG2].
Yu, Yanping; Zhang, Song; Kong, Weijia
2010-09-01
To construct three short hairpin RNA (shRNA) interference expression plasmid vectors of human ABCG2 gene, to assay the expression of ABCG2 in a human nasopharyngeal carcinoma (NPC) cell line, CEN-2 cell line, and to detect the RNAi effect of shRNA. Targeting ABCG2 gene sequence, three plasmid expression vectors coding for shRNA and a control vector containing random DNA fragment were constructed. The recombinant plasmids were amplified in Ecoli. DH5 and then identified by restriction digestion, PCR and sequencing. The recombinant plasmids were transfected into CEN-2 cells. ABCG2 expression was assayed by real-time quantitative PCR and Western blot. The construction of pGC-silencer-U6/Neo/GFP/ABCG2 was succeed. The shRNA plasmids significantly down-regulated the ABCG2 expression in CEN-2 cells, at both mRNA level and protein level. Recombinant plasmid 1 had the strongest effect compared with plasmids 2 and 3 (P < 0.05), with an inhibition ratio of 75% at the mRNA level and 68% at the protein level. pGC-silencer-U6/Neo/GFP/ABCG2 has been successfully constructed and it can down-regulate ABCG2 expression after transfected into CEN-2 cells, which could help further studies of ABCG2 functions CEN-2 cell line and contribute to the NPC gene therapy.
Khan, Adil Mehraj; Rampal, Satyavan; Sood, Naresh Kumar
2018-03-01
Adenosine triphosphate-binding cassette (ABC) sub-family G member-2 (ABCG-2) is a transporter protein, implicated for multi-drug efflux from tissues. This study evaluated the effect of fluoroquinolones; levofloxacin, pazufloxacin and enrofloxacin, and non-steroidal anti-inflammatory drug, meloxicam; on the immunolocalization of ABCG-2 transporter protein of rabbit retinas. Thirty-two male rabbits were randomly divided in to eight groups. Control group was gavaged, 2% benzyl alcohol in 5% dextrose since these chemicals are excipients of the drug preparations used in the treatment groups of this study. Four groups were exclusively gavaged, levofloxacin hemihydrate (10 mg/kg body weight b.i.d 12 h), pazufloxacin mesylate (10 mg/kg body weight b.i.d 12 h), enrofloxacin (20 mg/kg body weight o.d.), and meloxicam (0.2 mg/kg body weight o.d.), respectively. Three other groups were co-gavaged meloxicam with above fluoroquinolones, respectively. These drugs were administered for 21 days. ABCG-2 immunolocalization was mild in the retinas of control and levofloxacin-alone-treated groups. The immunolocalization intensity was significantly higher in meloxicam-alone-treated group when compared to control and levofloxacin-alone-treated groups. Immunolocalization of this transporter increased in the levofloxacin-meloxicam co-treated group when compared to the levofloxacin-alone-treated group. Highest immunolocalization was observed in the enrofloxacin-meloxicam co-treated group although the immunolocalization of all treatment groups, except the levofloxacin-alone-treated group, was significantly higher than the control and levofloxacin-alone-treated groups.
Expressions of ABCG2, CD133, and Podoplanin in Salivary Adenoid Cystic Carcinoma
Directory of Open Access Journals (Sweden)
Wuwei Li
2014-01-01
Full Text Available Adenoid cystic carcinoma (ACC is one of the most common salivary gland malignant tumors with a high risk of recurrence and metastasis. Current studies on cancer stem cells (CSCs have verified that CSCs are the driving force behind tumor initiation and progression, suggesting that new cancer therapies may be established by effectively targeting and killing the CSCs. The primary goal of this study is to investigate the expression patterns of ABCG2, CD133, and podoplanin in ACC of minor salivary glands by immunohistochemistry analysis. We found that ABCG2 was weakly expressed in normal looking salivary gland tissues. A significant upregulation of ABCG2 expression in ACC was observed with a similar expression pattern of Ki-67. CD133 was detected in apical membrane of epithelial cells and podoplanin was expressed positively in myoepithelial cells of both normal looking tissue and ACC. However, no significant difference was found of the expression pattern of CD133 and podoplanin between normal looking tissues and ACC. Our observations suggest that CSCs may exist in quiescent cells with ABCG2 positive staining, which are surrounded by cells with positive expression of ABCG2 and Ki-67 in ACC, and costaining with ABCG2 and Ki-67 may help predict the location of CSCs.
Hedgehog Pathway Inhibitor HhAntag691 Is a Potent Inhibitor of ABCG2/BCRP and ABCB1/Pgp
Directory of Open Access Journals (Sweden)
Yimao Zhang
2009-01-01
Full Text Available HhAntag691 (GDC-0449, a low-molecular weight inhibitor of the tumor-promoting hedgehog (Hh signaling pathway, has been used to treat medulloblastoma in animal models and has recently entered clinical trials for a variety of solid tumors. Here, we show that HhAntag691 inhibits multiple ATP-binding cassette (ABC transporters. ATP-binding cassette transporters are within a family of membrane proteins, the overexpression of which is associated with multidrug resistance, a major impediment to successful cancer treatment. HhAntag691 is a potent inhibitor of two ABC transporters, ABCG2/BCRP and ABCB1/Pgp, and is a mild inhibitor of ABCC1/MRP1. In ABCG2-overexpressing HEK293 cells, HhAntag691 increased retention of the fluorescent ABCG2 substrate BODIPY-prazosin and resensitized these cells to mitoxantrone, an antineoplastic ABCG2 substrate. In Madin-Darby canine kidney II cells engineered to overexpress Pgp or MRP1, HhAntag691 increased the retention of calcein-AM and resensitized them to colchicine. HhAntag691 also resensitized human non-small cell lung carcinoma cells NCI-H460/par and NCI-H460/MX20, which overexpress ABCG2 in response to mitoxantrone, to mitoxantrone, and to topotecan or SN-38. The IC50 values of HhAntag691 for inhibition of ABCG2 and Pgp were ∼1.4 and ∼3.0 µM, respectively. Because ABC transporters are highly expressed at the blood-brain barrier and on many tumor cells, they contribute significantly to treatment failure of many types of cancer, particularly of those within the neuraxis. In addition to its effect on Hh signaling, the ability of HhAntag691 and related compounds to inhibit two key ABC transporters could contribute to their effectiveness in treating malignancies.
Functional non-synonymous variants of ABCG2 and gout risk.
Stiburkova, Blanka; Pavelcova, Katerina; Zavada, Jakub; Petru, Lenka; Simek, Pavel; Cepek, Pavel; Pavlikova, Marketa; Matsuo, Hirotaka; Merriman, Tony R; Pavelka, Karel
2017-11-01
Common dysfunctional variants of ATP binding cassette subfamily G member 2 (Junior blood group) (ABCG2), a high-capacity urate transporter gene, that result in decreased urate excretion are major causes of hyperuricemia and gout. In the present study, our objective was to determine the frequency and effect on gout of common and rare non-synonymous and other functional allelic variants in the ABCG2 gene. The main cohort recruited from the Czech Republic consisted of 145 gout patients; 115 normouricaemic controls were used for comparison. We amplified, directly sequenced and analysed 15 ABCG2 exons. The associations between genetic variants and clinical phenotype were analysed using the t-test, Fisher's exact test and a logistic and linear regression approach. Data from a New Zealand Polynesian sample set and the UK Biobank were included for the p.V12M analysis. In the ABCG2 gene, 18 intronic (one dysfunctional splicing) and 11 exonic variants were detected: 9 were non-synonymous (2 common, 7 rare including 1 novel), namely p.V12M, p.Q141K, p.R147W, p.T153M, p.F373C, p.T434M, p.S476P, p.D620N and p.K360del. The p.Q141K (rs2231142) variant had a significantly higher minor allele frequency (0.23) in the gout patients compared with the European-origin population (0.09) and was significantly more common among gout patients than among normouricaemic controls (odds ratio = 3.26, P gout (42 vs 48 years, P = 0.0143) and a greater likelihood of a familial history of gout (41% vs 27%, odds ratio = 1.96, P = 0.053). In a meta-analysis p.V12M exerted a protective effect from gout (P gout. Non-synonymous allelic variants of ABCG2 had a significant effect on earlier onset of gout and the presence of a familial gout history. ABCG2 should thus be considered a common and significant risk factor for gout. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Rheumatology. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Structural basis of small-molecule inhibition of human multidrug transporter ABCG2
DEFF Research Database (Denmark)
Jackson, Scott M; Manolaridis, Ioannis; Kowal, Julia
2018-01-01
requires high-resolution structural insight. Here, we present cryo-EM structures of human ABCG2 bound to synthetic derivatives of the fumitremorgin C-related inhibitor Ko143 or the multidrug resistance modulator tariquidar. Both compounds are bound to the central, inward-facing cavity of ABCG2, blocking...
Studzian, Maciej; Bartosz, Grzegorz; Pulaski, Lukasz
2015-08-01
ABCG2, a metabolite and xenobiotic transporter located at the plasma membrane (predominantly in barrier tissues and progenitor cells), undergoes a direct progressive endocytosis process from plasma membrane to intracellular compartments upon binding of 5D3 monoclonal antibody. This antibody is specific to an external epitope on the protein molecule and locks it in a discrete conformation within its activity cycle, presumably providing a structural trigger for the observed internalization phenomenon. Using routine and novel assays, we show that ABCG2 is endocytosed by a mixed mechanism: partially via a rapid, clathrin-dependent pathway and partially in a cholesterol-dependent, caveolin-independent manner. While the internalization process is entirely dynamin-dependent and converges initially at the early endosome, subsequent intracellular fate of ABCG2 is again twofold: endocytosis leads to only partial lysosomal degradation, while a significant fraction of the protein is retained in a post-endosomal compartment with the possibility of at least partial recycling back to the cell surface. This externally triggered, conformation-related trafficking pathway may serve as a general regulatory paradigm for membrane transporters, and its discovery was made possible thanks to consistent application of quantitative methods. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Halwachs, Sandra; Schäfer, Ingo; Kneuer, Carsten; Seibel, Peter; Honscha, Walther
2016-01-01
In humans, the ATP-binding cassette efflux transporter ABCG2 contributes to the fetoprotective barrier function of the placenta, potentially limiting the toxicity of transporter substrates to the fetus. During testing of chemicals including pesticides, developmental toxicity studies are performed in rabbit. Despite its toxicological relevance, ABCG2-mediated transport of pesticides in rabbit placenta has not been yet elucidated. We therefore generated polarized MDCK II cells expressing the ABCG2 transporter from rabbit placenta (rbABCG2) and evaluated interaction of the efflux transporter with selected insecticides, fungicides, and herbicides. The Hoechst H33342 accumulation assay indicated that 13 widely used pesticidal active substances including azoxystrobin, carbendazim, chlorpyrifos, chlormequat, diflufenican, dimethoate, dimethomorph, dithianon, ioxynil, methiocarb, propamocarb, rimsulfuron and toclofos-methyl may be rbABCG2 inhibitors and/or substrates. No such evidence was obtained for chlorpyrifos-methyl, epoxiconazole, glyphosate, imazalil and thiacloprid. Moreover, chlorpyrifos (CPF), dimethomorph, tolclofos-methyl and rimsulfuron showed concentration-dependent inhibition of H33342 excretion in rbABCG2-transduced MDCKII cells. To further evaluate the role of rbABCG2 in pesticide transport across the placenta barrier, we generated polarized MDCKII-rbABCG2 monolayers. Confocal microscopy confirmed correct localization of rbABCG2 protein in the apical plasma membrane. In transepithelial flux studies, we showed the time-dependent preferential basolateral to apical (B > A) directed transport of [ 14 C] CPF across polarized MDCKII-rbABCG2 monolayers which was significantly inhibited by the ABCG2 inhibitor fumitremorgin C (FTC). Using this novel in vitro cell culture model, we altogether showed functional secretory activity of the ABCG2 transporter from rabbit placenta and identified several pesticides like the insecticide CPF as potential rbABCG2 substrates
Energy Technology Data Exchange (ETDEWEB)
Halwachs, Sandra [Institute of Pharmacology, Pharmacy and Toxicology, Faculty of Veterinary Medicine, Universität Leipzig, Leipzig (Germany); Schäfer, Ingo [Molecular Cell Therapy, Center for Biotechnology and Biomedicine, Faculty of Medicine, Universität Leipzig, Leipzig (Germany); Kneuer, Carsten [Federal Institute for Risk Assessment (BfR), Pesticide Safety, Max-Dohrn-Straße 8-10, D-10589 Berlin (Germany); Seibel, Peter [Molecular Cell Therapy, Center for Biotechnology and Biomedicine, Faculty of Medicine, Universität Leipzig, Leipzig (Germany); Honscha, Walther, E-mail: honscha@vetmed.uni-leipzig.de [Institute of Pharmacology, Pharmacy and Toxicology, Faculty of Veterinary Medicine, Universität Leipzig, Leipzig (Germany)
2016-08-15
In humans, the ATP-binding cassette efflux transporter ABCG2 contributes to the fetoprotective barrier function of the placenta, potentially limiting the toxicity of transporter substrates to the fetus. During testing of chemicals including pesticides, developmental toxicity studies are performed in rabbit. Despite its toxicological relevance, ABCG2-mediated transport of pesticides in rabbit placenta has not been yet elucidated. We therefore generated polarized MDCK II cells expressing the ABCG2 transporter from rabbit placenta (rbABCG2) and evaluated interaction of the efflux transporter with selected insecticides, fungicides, and herbicides. The Hoechst H33342 accumulation assay indicated that 13 widely used pesticidal active substances including azoxystrobin, carbendazim, chlorpyrifos, chlormequat, diflufenican, dimethoate, dimethomorph, dithianon, ioxynil, methiocarb, propamocarb, rimsulfuron and toclofos-methyl may be rbABCG2 inhibitors and/or substrates. No such evidence was obtained for chlorpyrifos-methyl, epoxiconazole, glyphosate, imazalil and thiacloprid. Moreover, chlorpyrifos (CPF), dimethomorph, tolclofos-methyl and rimsulfuron showed concentration-dependent inhibition of H33342 excretion in rbABCG2-transduced MDCKII cells. To further evaluate the role of rbABCG2 in pesticide transport across the placenta barrier, we generated polarized MDCKII-rbABCG2 monolayers. Confocal microscopy confirmed correct localization of rbABCG2 protein in the apical plasma membrane. In transepithelial flux studies, we showed the time-dependent preferential basolateral to apical (B > A) directed transport of [{sup 14}C] CPF across polarized MDCKII-rbABCG2 monolayers which was significantly inhibited by the ABCG2 inhibitor fumitremorgin C (FTC). Using this novel in vitro cell culture model, we altogether showed functional secretory activity of the ABCG2 transporter from rabbit placenta and identified several pesticides like the insecticide CPF as potential rbABCG2
Abcg5/Abcg8-independent pathways contribute to hepatobiliary cholesterol secretion in mice
Plosch, Torsten; van der Veen, Jelske N.; Havinga, Rick; Huijkman, Nicolette C. A.; Bloks, Vincent W.; Kuipers, Folkert
The ATP-binding cassette (ABC) half-transporters ABCG5 and ABCG8 heterodimerize into a functional complex that mediates the secretion of plant sterols and cholesterol by hepatocytes into bile and their apical efflux from enterocytes. We addressed the putative rate-controlling role of Abcg5/Abcg8 in
Huls, M.; Brown, C.D.; Windass, A.S.; Sayer, R.; Heuvel, J.J.M.W. van den; Heemskerk, S.; Russel, F.G.M.; Masereeuw, R.
2008-01-01
The Breast Cancer Resistance Protein (BCRP/ABCG2) is a transporter restricting absorption and enhancing excretion of many compounds including anticancer drugs. This transporter is highly expressed in many tissues; however, in human kidney, only the mRNA was found in contrast to the mouse kidney,
Functional characterization of the human multidrug transporter, ABCG2, expressed in insect cells
DEFF Research Database (Denmark)
Ozvegy, C.; Litman, Thomas; Szakacs, G.
2001-01-01
ABCG2 (also called MXR (3), BCRP (4), or ABCP (5) is a recently-identified ABC half-transporter, which causes multidrug resistance in cancer. Here we report that the expression of the ABCG2 protein in Sf9 insect cells resulted in a high-capacity, vanadate-sensitive ATPase activity in isolated...
ROLE OF ATP BINDING CASSETTE SUB-FAMILY MEMBER 2 (ABCG2) IN MOUSE EMBRYONIC STEM CELL DEVELOPMENT.
ATP binding cassette sub-family member 2 (ABCG2), is a member of the ABC transporter superfamily and a principal xenobiotic transporter. ABCG2 is also highly expressed in certain stem cell populations where it is thought to be related to stem cell plasticity, although the role o...
Crowe, Andrew; Keelan, Jeffrey A
2012-10-01
Human choriocarcinoma-derived BeWo cells express high levels of breast cancer resistance protein (BCRP/ABCG2) with no functional P-glycoprotein (P-gp) (ABCB1) activity, making them a potential model to study bidirectional ABCG2-mediated drug transport. However, the original BeWo clone (B24) available to researchers does not form confluent monolayers with tight junctions required by the model. Our aim was to adapt culture conditions to attempt to generate confluent BeWo monolayers for drug transport studies using the standard B24 clone. BeWo cells (B24; American Type Culture collection [ATCC]) were cultured in six-well plates or polycarbonate millicell inserts in a number of media formulations, growth supplements, and basement membrane substitutes. Cells were examined for confluence by microscopy, and transepithelial electrical resistance (TEER) was measured daily; monolayer permeability was assessed when TEER had stabilized. Optimal growth rates were achieved in culture conditions consisting of Medium 199 (M199) supplemented with epidermal growth factor (EGF; 20 ng/mL), vitamin supplements, and 10% fetal calf serum (FCS) with collagen coating. A TEER of 170 Ω in 0.6 cm(2) inserts was achieved 2 weeks after seeding under optimal conditions. The cell-impermeable diffusion marker 5(6) carboxy-2,7dichlorodihydrofluorescein (C-DCDHF) had a permeability coefficient of 3.5×10(-6) cm/s, indicative of minimal paracellular permeability. ABCG2 expression, as determined by immunoblotting, remained unaffected by confluency. In conclusion, we describe culture conditions for the B24 BeWo clone that facilitate the formation of monolayers with tighter junctions and reduced paracellular transport compared to previously published models. These growth conditions provide a good model of ABCG2-mediated drug transport in a human placental cell line.
Elferink, Ronald P. J. Oude; Ottenhoff, Roelof; Fricker, Gert; Seward, David J.; Ballatori, Nazzareno; Boyer, James
2004-01-01
The ABC transporters bile salt export pump ( BSEP; encoded by the ABCB11 gene), MDR3 P-glycoprotein (ABCB4), and sterolin 1 and 2 (ABCG5 and ABCG8) are crucial for the excretion of bile salt, phospholipid, and cholesterol, respectively, into the bile of mammals. The current paradigm is that
DEFF Research Database (Denmark)
Henriksen, Ulla Birk; Gether, Ulrik; Litman, Thomas
2005-01-01
The ATP binding cassette (ABC) half-transporter ABCG2 (MXR/BCRP/ABCP) is associated with mitoxantrone resistance accompanied by cross-resistance to a broad spectrum of cytotoxic drugs. Here we investigate the functional consequences of mutating a highly conserved lysine in the Walker A motif...
Gromicho, Marta; Dinis, Joana; Magalhães, Marta; Fernandes, Alexandra R; Tavares, Purificação; Laires, António; Rueff, José; Rodrigues, António Sebastião
2011-10-01
About 20% of patients with chronic myeloid leukemia (CML) do not respond to treatment with imatinib either initially or because of acquired resistance. To study the development of CML drug resistance, an in vitro experimental system comprising cell lines with different resistance levels was established by exposing K562 cells to increasing concentrations of imatinib and dasatinib anticancer agents. The mRNA levels of BCR- ABL1 and of genes involved in drug transport or redistribution (ABCB1, ABCC1, ABCC3, ABCG2, MVP, and SLC22A1) were measured and the ABL1 kinase domain sequenced. Results excluded BCR- ABL1 overexpression and mutations as relevant resistance mechanisms. Most studied transporters were overexpressed in the majority of resistant cell lines. Their expression pattern was dynamic: varying with resistance level and chronic drug exposure. Studied efflux transporters may have an important role at the initial stages of resistance, but after prolonged exposure and for higher doses of drugs other mechanisms might take place.
Localization of the ABCG2 mitoxantrone resistance-associated protein in normal tissues
DEFF Research Database (Denmark)
Fetsch, Patricia A; Abati, Andrea; Litman, Thomas
2006-01-01
was consistently found in alveolar pneumocytes, sebaceous glands, transitional epithelium of bladder, interstitial cells of testes, prostate epithelium, endocervical cells of uterus, squamous epithelium of cervix, small and large intestinal mucosa/epithelial cells, islet and acinar cells of pancreas, zona...... ABCG2 have a significant secretory function. These data suggest a dual function for ABCG2 in some tissues: the excretion of toxins and xenobiotics including anti-cancer agents and a potential, as-yet undefined role in the secretion of endogenous substrates....
ABCG2 inhibition as a therapeutic approach for overcoming
Indian Academy of Sciences (India)
2016-02-16
Feb 16, 2016 ... the permeability of multi-protein channel complexes. (receptors) .... ABCG2 overexpression is likely to be the cause of high- ... with low or absent function. ..... derivatives, is a water-soluble topoisomerase I inhibitor that.
DEFF Research Database (Denmark)
Henriksen, Ulla Birk; Fog, Jacob U; Litman, Thomas
2005-01-01
cysteines predicted to be on the extracellular face of ABCG2. Upon mutation of Cys-592 or Cys-608 to alanine (C592A and C608A), ABCG2 migrated as a dimer in SDS-PAGE under non-reducing conditions; however, mutation of Cys-603 to Ala (C603A) caused the transporter to migrate as a single monomeric band....... Despite this change, C603A displayed efficient membrane targeting and preserved transport function. Because the transporter migrated as a dimer in SDS-PAGE, when only Cys-603 was present (C592A-C608A), the data suggest that Cys-603 forms a symmetrical intermolecular disulfide bridge in the ABCG2 homodimer...
Population-specific association between ABCG2 variants and tophaceous disease in people with gout.
He, Wendy; Phipps-Green, Amanda; Stamp, Lisa K; Merriman, Tony R; Dalbeth, Nicola
2017-03-07
Tophi contribute to musculoskeletal disability, joint damage and poor health-related quality of life in people with gout. The aim of this study was to examine the role of SLC2A9 and ABCG2 variants in tophaceous disease in people with gout. Participants (n = 1778) with gout fulfilling the 1977 American Rheumatism Association (ARA) classification criteria, who were recruited from primary and secondary care, attended a detailed study visit. The presence of palpable tophi was recorded. SLC2A9 rs11942223, ABCG2 rs2231142 and ABCG2 rs10011796 were genotyped. Data were analysed according to tophus status. Compared to participants without tophi, those with tophi were older, had longer disease duration and higher serum creatinine, and were more likely to be of Māori or Pacific (Polynesian) ancestry. SLC2A9 rs11942223 was not associated with tophi. However, the risk alleles for both ABCG2 single nucleotide polymorphisms (SNPs) were present more frequently in those with tophi (OR (95% CI) 1.24 (1.02-1.51) for rs2231142 and 1.33 (1.01-1.74) for rs10011796, p gout.
MDM2 Antagonists Counteract Drug-Induced DNA Damage
Directory of Open Access Journals (Sweden)
Anna E. Vilgelm
2017-10-01
Full Text Available Antagonists of MDM2-p53 interaction are emerging anti-cancer drugs utilized in clinical trials for malignancies that rarely mutate p53, including melanoma. We discovered that MDM2-p53 antagonists protect DNA from drug-induced damage in melanoma cells and patient-derived xenografts. Among the tested DNA damaging drugs were various inhibitors of Aurora and Polo-like mitotic kinases, as well as traditional chemotherapy. Mitotic kinase inhibition causes mitotic slippage, DNA re-replication, and polyploidy. Here we show that re-replication of the polyploid genome generates replicative stress which leads to DNA damage. MDM2-p53 antagonists relieve replicative stress via the p53-dependent activation of p21 which inhibits DNA replication. Loss of p21 promoted drug-induced DNA damage in melanoma cells and enhanced anti-tumor activity of therapy combining MDM2 antagonist with mitotic kinase inhibitor in mice. In summary, MDM2 antagonists may reduce DNA damaging effects of anti-cancer drugs if they are administered together, while targeting p21 can improve the efficacy of such combinations.
Bloks, VW; Bakker-van Waarde, WM; Verkade, HJ; Kema, IP; Wolters, H; Vink, E; Groen, AK; Kuipers, F
Aim/hypothesis., Type I diabetes is associated with altered hepatic bile formation and increased intestinal cholesterol absorption. The aim of this study was to evaluate whether altered expression of the ATP-Binding Cassette half-transporters Abcg5 and Abcg8, recently implicated in control of both
Zander, Serge A. L.; Kersbergen, Ariena; Sol, Wendy; Gonggrijp, Maaike; van de Wetering, Koen; Jonkers, Jos; Borst, Piet; Rottenberg, Sven
2012-01-01
In addition to their role in drug resistance, the ATP-binding cassette (ABC) transporters ABCG2 and ABCB1 have been suggested to protect cells from a broad range of substances that may foster tumorigenesis. Phytoestrogens or their metabolites are substrates of these transporters and the influence of
Gál, Zita; Hegedüs, Csilla; Szakács, Gergely; Váradi, András; Sarkadi, Balázs; Özvegy-Laczka, Csilla
2015-02-01
Human ABCG2 is a plasma membrane glycoprotein causing multidrug resistance in cancer. Membrane cholesterol and bile acids are efficient regulators of ABCG2 function, while the molecular nature of the sterol-sensing sites has not been elucidated. The cholesterol recognition amino acid consensus (CRAC, L/V-(X)(1-5)-Y-(X)(1-5)-R/K) sequence is one of the conserved motifs involved in cholesterol binding in several proteins. We have identified five potential CRAC motifs in the transmembrane domain of the human ABCG2 protein. In order to define their roles in sterol-sensing, the central tyrosines of these CRACs (Y413, 459, 469, 570 and 645) were mutated to S or F and the mutants were expressed both in insect and mammalian cells. We found that mutation in Y459 prevented protein expression; the Y469S and Y645S mutants lost their activity; while the Y570S, Y469F, and Y645F mutants retained function as well as cholesterol and bile acid sensitivity. We found that in the case of the Y413S mutant, drug transport was efficient, while modulation of the ATPase activity by cholesterol and bile acids was significantly altered. We suggest that the Y413 residue within a putative CRAC motif has a role in sterol-sensing and the ATPase/drug transport coupling in the ABCG2 multidrug transporter. Copyright © 2014. Published by Elsevier B.V.
Genome-wide Identification and Expression Analysis of Half-size ABCG Genes in Malus × domestica
Directory of Open Access Journals (Sweden)
Juanjuan MA
2018-03-01
Full Text Available Half-size adenosine triphosphate-binding cassette transporter subgroup G (ABCG genes play crucial roles in regulating the movements of a variety of substrates and have been well studied in several plants. However, half-size ABCGs have not been characterized in detail in apple (Malus × domestica Borkh.. Here, we performed a genome-wide identification and expression analysis of the half-size ABCG gene family in apple. A total of 46 apple half-size ABCGs were identified and divided into six clusters according to the phylogenetic analysis. A gene structural analysis showed that most half-size ABCGs in the same cluster shared a similar exon–intron organization. A gene duplication analysis showed that segmental, tandem and whole-genome duplications could account for the expansion of half-size ABCG transporters in M. domestica. Moreover, a promoter scan, digital expression analysis and RNA-seq revealed that MdABCG21 may be involved in root's cytokinin transport and that ABCG17 may be involved in the lateral bud development of M. spectabilis ‘Bly114’ by mediating cytokinin transport. The data presented here lay the foundation for further investigations into the biological and physiological processes and functions of half-size ABCG genes in apple. Keywords: apple, ABCG gene, duplication, gene expression
DEFF Research Database (Denmark)
Cederbye, Camilla Natasha; Palshof, Jesper Andreas; Hansen, Tine Plato
2016-01-01
cancer (CRC), probably because of the use of different antibodies and scoring approaches. In this study, we systematically studied six commercially available anti-ABCG2 antibodies, using cell lines with up-regulation of ABCG2, and selected one antibody for validation in CRC tissue. Furthermore, we...... sections, especially when more than one core was used. In conclusion, here, we provide validated results to guide future studies on the associations between ABCG2 immunoreactivity in tumor cells and the benefits of chemotherapeutic treatment in patients with CRC...
Wang, Fang; Liang, Yong-Ju; Wu, Xing-Ping; Su, Xiao-Dong; Fu, Li-Wu
2012-03-01
S1-M1-80 cells, derived from human colon carcinoma S1 cells, are mitoxantrone-selected ABCG2-overexpressing cells and are widely used in in vitro studies of multidrug resistance(MDR). In this study, S1-M1-80 cell xenografts were established to investigate whether the MDR phenotype and cell biological properties were maintained in vivo. Our results showed that the proliferation, cell cycle, and ABCG2 expression level in S1-M1-80 cells were similar to those in cells isolated from S1-M1-80 cell xenografts (named xS1-M1-80 cells). Consistently, xS1-M1-80 cells exhibited high levels of resistance to ABCG2 substrates such as mitoxantrone and topotecan, but remained sensitive to the non-ABCG2 substrate cisplatin. Furthermore, the specific ABCG2 inhibitor Ko143 potently sensitized xS1-M1-80 cells to mitoxantrone and topotecan. These results suggest that S1-M1-80 cell xenografts in nude mice retain their original cytological characteristics at 9 weeks. Thus, this model could serve as a good system for further investigation of ABCG2-mediated MDR.
Kort, Anita; Durmus, Selvi; Sparidans, Rolf W; Wagenaar, Els; Beijnen, Jos H; Schinkel, Alfred H
2015-07-01
Regorafenib is a novel multikinase inhibitor, currently approved for the treatment of metastasized colorectal cancer and advanced gastrointestinal stromal tumors. We investigated whether regorafenib is a substrate for the multidrug efflux transporters ABCG2 and ABCB1 and whether oral availability, brain and testis accumulation of regorafenib and its active metabolites are influenced by these transporters. We used in vitro transport assays to assess human (h)ABCB1- or hABCG2- or murine (m)Abcg2-mediated active transport at high and low concentrations of regorafenib. To study the single and combined roles of Abcg2 and Abcb1a/1b in oral regorafenib disposition and the impact of Cyp3a-mediated metabolism, we used appropriate knockout mouse strains. Regorafenib was transported well by mAbcg2 and hABCG2 and modestly by hABCB1 in vitro. Abcg2 and to a lesser extent Abcb1a/1b limited brain and testis accumulation of regorafenib and metabolite M2 (brain only) in mice. Regorafenib oral availability was not increased in Abcg2(-/-);Abcb1a/1b(-/-) mice. Up till 2 h, metabolite M5 was undetectable in plasma and organs. Brain and testis accumulation of regorafenib and brain accumulation of metabolite M2 are restricted by Abcg2 and Abcb1a/1b. Inhibition of these transporters may be of clinical relevance for patients with brain (micro)metastases positioned behind an intact blood-brain barrier.
Expression of ABCG2 and Bmi-1 in oral potentially malignant lesions and oral squamous cell carcinoma
International Nuclear Information System (INIS)
Dalley, Andrew J; Pitty, Luke P; Major, Aidan G; AbdulMajeed, Ahmad A; Farah, Camile S
2014-01-01
Early diagnosis is vital for effective treatment of oral squamous cell carcinoma (OSCC). The optimal time for clinical intervention is prior to malignancy when patients present with oral potentially malignant lesions such as leukoplakia or erythroplakia. Transformation rates for oral dysplasia vary greatly and more rigorous methods are needed to predict the malignant potential of oral lesions. We hypothesized that the expression of two putative stem cell markers, ABCG2 and Bmi-1, would correlate with disease severity for non diseased, potentially malignant and OSCC specimens and cell lines derived from an equivalent range of tissues. We compared immunoreactive protein and relative gene expression of ABCG2 and Bmi-1 in eight cell lines derived from source tissues ranging in disease severity from normal (OKF6-TERT2) through mild and moderate/severe dysplasia (DOK, POE-9n) to OSCC (PE/CA-PJ15, SCC04, SCC25, SCC09, SCC15). We also analyzed immunoreactive protein expression of ABCG2 and Bmi-1 in 189 tissue samples with the same range of disease severity. A trend between oral lesion severity to ABCG2 and Bmi-1 immunostain intensity was observed. Flow cytometry of oral cell lines confirmed this trend and gave good correlation with RT-PCR results for ABCG2 (r = 0.919, P = 0.001; Pearson) but not Bmi-1 (r = −0.311). The results provide evidence of increased density of ABCG2 and Bmi-1-positive populations in malignant and oral potentially malignant lesions and derived cell lines, but that intragroup variability within IHC, flow cytometry, and RT-PCR results compromise the diagnostic potential of these techniques for discriminating oral dysplasia from normal tissue or OSCC
Ren, Y C; Jin, T B; Sun, X D; Geng, T T; Zhang, M X; Wang, L; Feng, T; Kang, L L; Chen, C
2016-02-11
Previous studies have shown that the PDK2 and ABCG2 genes play important roles in many aspects of gout development in European populations. However, a detailed genotype-phenotype analysis was not performed. The aim of the present study was to investigate the potential association between variants in these two genes and metabolism-related quantitative phenotypes relevant to gout in a Chinese Tibetan population. In total, 316 Chinese Tibetan gout patients were recruited from rheumatology outpatient clinics and 6 single nucleotide polymorphisms in PDK2 and ABCG2 were genotyped, which were possible etiologic variants as identified in the HapMap Chinese Han Beijing population. A significant difference in blood glucose levels was detected between different genotypes of rs2728109 (P = 0.005) in the PDK2 gene. We also detected a significant difference in the mean serum uric levels between different genotypes of rs3114018 (P = 0.004) in the ABCG2 gene. All P values remained significant after Bonferroni's correction for multiple testing. Our data demonstrate potential roles for PDK2 and ABCG2 polymorphisms in the metabolic phenotypes of Tibetan gout patients, which may provide new insights into the etiology of gout. Further studies are required to confirm these findings.
Sugimoto, Ryusei; Watanabe, Hiroshi; Ikegami, Komei; Enoki, Yuki; Imafuku, Tadashi; Sakaguchi, Yoshiaki; Murata, Michiya; Nishida, Kento; Miyamura, Shigeyuki; Ishima, Yu; Tanaka, Motoko; Matsushita, Kazutaka; Komaba, Hirotaka; Fukagawa, Masafumi; Otagiri, Masaki; Maruyama, Toru
2017-03-01
Hyperuricemia occurs with increasing frequency among patients with hyperparathyroidism. However, the molecular mechanism by which the serum parathyroid hormone (PTH) affects serum urate levels remains unknown. This was studied in uremic rats with secondary hyperparathyroidism where serum urate levels were found to be increased and urate excretion in the intestine and kidney decreased, presumably due to down-regulation of the expression of the urate exporter ABCG2 in intestinal and renal epithelial membranes. These effects were prevented by administration of the calcimimetic cinacalcet, a PTH suppressor, suggesting that PTH may down-regulate ABCG2 expression. This was directly tested in intestinal Caco-2 cells where the expression of ABCG2 on the plasma membrane was down-regulated by PTH (1-34) while its mRNA level remained unchanged. Interestingly, an inactive PTH derivative (13-34) had no effect, suggesting that a posttranscriptional regulatory system acts through the PTH receptor to regulate ABCG2 plasma membrane expression. As found in an animal study, additional clinical investigations showed that treatment with cinacalcet resulted in significant reductions in serum urate levels together with decreases in PTH levels in patients with secondary hyperparathyroidism undergoing dialysis. Thus, PTH down-regulates ABCG2 expression on the plasma membrane to suppress intestinal and renal urate excretion, and the effects of PTH can be prevented by cinacalcet treatment. Copyright © 2016 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Andersen, Vibeke; Svenningsen, Katrine; Knudsen, Lina Almind
2015-01-01
transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1....../Mdr1a, abcc2/Mrp2, abcg2/Bcrp, knock-out mice, tight junction, membrane lipid function. RESULTS: Recently, human studies reported that changes in the levels of ABC transporters were early events in the adenoma-carcinoma sequence leading to CRC. A link between ABCB1, high fat diet and gut microbes...
International Nuclear Information System (INIS)
Malur, Anagha; Huizar, Isham; Wells, Greg; Barna, Barbara P.; Malur, Achut G.; Thomassen, Mary Jane
2011-01-01
but improved significantly after lenti-ABCG1 treatment. Data demonstrate that in vivo instillation of lenti-ABCG1 in GM-CSF KO mice is sufficient to restore pulmonary homeostasis by: (1) upregulating ABCG1; (2) reducing intra and extracellular lipids; and (3) improving lung function. Results suggest that the ABCG1 lipid transporter is the key downstream target of GM-CSF-induced PPARγ necessary for surfactant catabolism.
Directory of Open Access Journals (Sweden)
Edward B. Neufeld
2014-12-01
Full Text Available We have previously shown that GFP-tagged human ABCG1 on the plasma membrane (PM and in late endosomes (LE mobilizes sterol on both sides of the membrane lipid bilayer, thereby increasing cellular cholesterol efflux to lipid surfaces. In the present study, we examined ABCG1-induced changes in membrane cholesterol distribution, organization, and mobility. ABCG1-GFP expression increased the amount of mobile, non-sphingomyelin(SM-associated cholesterol at the PM and LE, but not the amount of SM-associated-cholesterol or SM. ABCG1-mobilized non-SM-associated-cholesterol rapidly cycled between the PM and LE and effluxed from the PM to extracellular acceptors, or, relocated to intracellular sites of esterification. ABCG1 increased detergent-soluble pools of PM and LE cholesterol, generated detergent-resistant, non-SM-associated PM cholesterol, and increased resistance to both amphotericin B-induced (cholesterol-mediated and lysenin-induced (SM-mediated cytolysis, consistent with altered organization of both PM cholesterol and SM. ABCG1 itself resided in detergent-soluble membrane domains. We propose that PM and LE ABCG1 residing at the phase boundary between ordered (Lo and disordered (Ld membrane lipid domains alters SM and cholesterol organization thereby increasing cholesterol flux between Lo and Ld, and hence, the amount of cholesterol available for removal by acceptors on either side of the membrane bilayer for either efflux or esterification.
Breedveld, Pauline; Zelcer, Noam; Pluim, Dick; Sönmezer, Ozgür; Tibben, Matthijs M.; Beijnen, Jos H.; Schinkel, Alfred H.; van Tellingen, Olaf; Borst, Piet; Schellens, Jan H. M.
2004-01-01
The antifolate drug methotrexate (MTX) is transported by breast cancer resistance protein (BCRP; ABCG2) and multidrug resistance-associated protein1-4 (MRP1-4; ABCC1-4). In cancer patients, coadministration of benzimidazoles and MTX can result in profound MTX-induced toxicity coinciding with an
DEFF Research Database (Denmark)
Robey, R W; Medina-Pérez, W Y; Nishiyama, K
2001-01-01
We sought to characterize the interactions of flavopiridol with members of the ATP-binding cassette (ABC) transporter family. Cells overexpressing multidrug resistance-1 (MDR-1) and multidrug resistance-associated protein (MRP) did not exhibit appreciable flavopiridol resistance, whereas cell lines...... overexpressing the ABC half-transporter, ABCG2 (MXR/BCRP/ABCP1), were found to be resistant to flavopiridol. Flavopiridol at a concentration of 10 microM was able to prevent MRP-mediated calcein efflux, whereas Pgp-mediated transport of rhodamine 123 was unaffected at flavopiridol concentrations of up to 100...... analysis revealed overexpression of the ABCG2 gene. Western blot confirmed overexpression of ABCG2; neither P-glycoprotein nor MRP overexpression was detected. These results suggest that ABCG2 plays a role in resistance to flavopiridol....
Zhou, Danqiu; Liu, Yunqing; Zhang, Xinju; Gu, Xiaoye; Wang, Hua; Luo, Xinhua; Zhang, Jin; Zou, Hejian; Guan, Ming
2014-05-22
Gout is a common type of arthritis that is characterized by hyperuricemia, tophi and joint inflammation. Genetic variations in the ABCG2 gene have been reported to influence serum uric acid levels and to participate in the pathogenesis of gout, but no further data have been reported in the Han Chinese population. Peripheral blood DNA was isolated from 352 male patients with gout and 350 gout-free normal male controls. High-resolution melting analysis and Sanger sequencing were performed to identify the genetic polymorphisms V12M, Q141K and Q126X in the ABCG2 gene. Genotype and haplotype analyses were utilized to determine the disease odds ratios (ORs). A prediction model for gout risk using ABCG2 protein function was established based on the genotype combination of Q126X and Q141K. For Q141K, the A allele frequency was 49.6% in the gout patients and 30.9% in the controls (OR 2.20, 95% confidence interval (CI): 1.77-2.74, p=8.99×10⁻¹³). Regarding Q126X, the T allele frequency was 4.7% in the gout patients and 1.7% in the controls (OR 2.91, 95% CI: 1.49-5.68, p=1.57×10⁻³). The A allele frequency for V12M was lower (18.3%) in the gout patients than in the controls (29%) (OR 0.55, 95% CI 0.43-0.71, p=2.55×10⁻⁶). In the order of V12M, Q126X and Q141K, the GCA and GTC haplotypes indicated increased disease risk (OR=2.30 and 2.71, respectively). Patients with mild to severe ABCG2 dysfunction accounted for 78.4% of gout cases. The ABCG2 126X and 141K alleles are associated with an increased risk of gout, whereas 12M has a protective effect on gout susceptibility in the Han Chinese population. ABCG2 dysfunction can be used to evaluate gout risk.
Cellular Localization and Trafficking of the Human ABCG1 Transporter
Neufeld, Edward B.; O’Brien, Katherine; Walts, Avram D.; Stonik, John A.; Demosky, Steven J.; Malide, Daniela; Combs, Christian A.; Remaley, Alan T.
2014-01-01
We have developed a suitable heterologous cell expression system to study the localization, trafficking, and site(s) of function of the human ABCG1 transporter. Increased plasma membrane (PM) and late endosomal (LE) cholesterol generated by ABCG1 was removed by lipoproteins and liposomes, but not apoA-I. Delivery of ABCG1 to the PM and LE was required for ABCG1-mediated cellular cholesterol efflux. ABCG1 LEs frequently contacted the PM, providing a collisional mechanism for transfer of ABCG1-mobilized cholesterol, similar to ABCG1-mediated PM cholesterol efflux to lipoproteins. ABCG1-mobilized LE cholesterol also trafficked to the PM by a non-vesicular pathway. Transfer of ABCG1-mobilized cholesterol from the cytoplasmic face of LEs to the PM and concomitant removal of cholesterol from the outer leaflet of the PM bilayer by extracellular acceptors suggests that ABCG1 mobilizes cholesterol on both sides of the lipid bilayer for removal by acceptors. ABCG1 increased uptake of HDL into LEs, consistent with a potential ABCG1-mediated cholesterol efflux pathway involving HDL resecretion. Thus, ABCG1 at the PM mobilizes PM cholesterol and ABCG1 in LE/LYS generates mobile pools of cholesterol that can traffic by both vesicular and non-vesicular pathways to the PM where it can also be transferred to extracellular acceptors with a lipid surface. PMID:25405320
Energy Technology Data Exchange (ETDEWEB)
Malur, Anagha; Huizar, Isham [Program in Lung Cell Biology and Translational Research, Division of Pulmonary, Critical Care and Sleep Medicine, East Carolina University, Greenville, NC (United States); Wells, Greg [Department of Microbiology and Immunology, East Carolina University, Greenville, NC (United States); Barna, Barbara P. [Program in Lung Cell Biology and Translational Research, Division of Pulmonary, Critical Care and Sleep Medicine, East Carolina University, Greenville, NC (United States); Malur, Achut G. [Department of Microbiology and Immunology, East Carolina University, Greenville, NC (United States); Thomassen, Mary Jane, E-mail: thomassenm@ecu.edu [Program in Lung Cell Biology and Translational Research, Division of Pulmonary, Critical Care and Sleep Medicine, East Carolina University, Greenville, NC (United States); Department of Microbiology and Immunology, East Carolina University, Greenville, NC (United States)
2011-11-18
analysis of bronchoalveolar lavage fluid. Lung compliance was diminished in untreated GMCSF KO mice but improved significantly after lenti-ABCG1 treatment. Data demonstrate that in vivo instillation of lenti-ABCG1 in GM-CSF KO mice is sufficient to restore pulmonary homeostasis by: (1) upregulating ABCG1; (2) reducing intra and extracellular lipids; and (3) improving lung function. Results suggest that the ABCG1 lipid transporter is the key downstream target of GM-CSF-induced PPAR{gamma} necessary for surfactant catabolism.
DEFF Research Database (Denmark)
Andersen, Vibeke; Svenningsen, Katrine; Almind Knudsen, Lina
2015-01-01
AIM: To evaluate ATP-binding cassette (ABC) transporters in colonic pathophysiology as they had recently been related to colorectal cancer (CRC) development. METHODS: Literature search was conducted on PubMed using combinations of the following terms: ABC transporters, ATP binding cassette...... with glucocorticoids. The evidence for the involvement of ABCC2 and ABCG2 in colonic pathophysiology was weak. CONCLUSION: ABCB1, diet, and gut microbes mutually interact in colonic inflammation, a well-known risk factor for CRC. Further insight may be translated into preventive and treatment strategies....... transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1...
Directory of Open Access Journals (Sweden)
К. Yu. Khristenko
2016-01-01
Full Text Available Overexpression of ABC drug transporters can cause multidrug resistance (MDR in cancer cells, which is a major obstacle in the success of cancer chemotherapy. Our study revealed a correlation between the expression of invasive breast cancer resistance-associated proteins, such as P-glycoprotein (ABCB1, MRP2 (ABCC2, BCRP (ABCG2 in tumor cells and pathologic response to neoadjuvant chemotherapy. The response to neoadjuvant chemotherapy was shown to be associated with a lack of BCRP expression in tumor cells. The pathologic tumor response was correlated with the presence of positive MRP2 expression and the expression level of P-glycoprotein in cells of invasive breast cancer.
DGAT1 and ABCG2 polymorphism in Indian cattle (Bos indicus and buffalo (Bubalus bubalis breeds
Directory of Open Access Journals (Sweden)
Mishra Bina
2006-11-01
Full Text Available Abstract Background Indian cattle (Bos indicus and riverine buffalo (Bubalus bubalis give a poor yield of milk but it has a high fat and protein percentage compared to taurine cattle. The identification of QTLs (Quantitative Trait Loci on BTA14 and BTA6 and its subsequent fine mapping has led to identification of two non conservative mutations affecting milk production and composition. Our objective was to estimate the frequency of K232A (DGAT1 – diacylglycerol – acyltransferase 1 and Y581S (ABCG2 – ATP binding cassette sub family G member 2 polymorphisms in diverse cattle and buffalo breeds of India having large variation in terms of milk production. Results We screened the reported missense mutations in six cattle and five buffalo breeds. The DGAT1K and ABCG2Y alleles were found to be fixed in Indian cattle and buffalo breeds studied. Conclusion This study provides an indirect evidence that all the Indian cattle and buffalo breeds have fixed alleles with respect to DGAT1 and ABCG2 genes reported to be responsible for higher milk fat yield, higher fat and protein percent.
DEFF Research Database (Denmark)
Özvegy-Laczka, Csilla; Laczkó, Rozália; Hegedűs, Csilla
2008-01-01
D3 monoclonal antibody shows a function-dependent reactivity to an extracellular epitope of the ABCG2 transporter. In the current experiments we have further characterized the 5D3-ABCG2 interaction. The effect of chemical cross-linking and the modulation of extracellular S-S bridges...... on the transporter function and 5D3 reactivity of ABCG2 were investigated in depth. We found that several protein cross-linkers greatly increased 5D3 labeling in ABCG2 expressing HEK cells; however, there was no correlation between covalent dimer formation, the inhibition of transport activity, and the increase in 5...
Effect of polymorphisms in the ABCG2, LEPR and SCD1 genes on ...
African Journals Online (AJOL)
Sahand Rayaneh
2016-06-24
Jun 24, 2016 ... Abstract. This study was performed to investigate the association between polymorphisms in the ABCG2 (ATP- binding cassette sub-family G member 2), LEPR (leptin receptor) and SCD1 (stearoyl-coenzyme A desaturase 1) genes and milk production traits in Holstein dairy cows in Iran. The analysis was ...
Myllynen, Päivi; Kummu, Maria; Kangas, Tiina; Ilves, Mika; Immonen, Elina; Rysä, Jaana; Pirilä, Rauna; Lastumäki, Anni; Vähäkangas, Kirsi H
2008-10-15
We have studied the role of ATP binding cassette (ABC) transporters in fetal exposure to carcinogens using 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) a known substrate for ABC transporters as a model compound. In perfusion of human term placenta, transfer of (14)C-PhIP (2 microM) through the placenta resulted in fetal-to-maternal concentration ratio (FM ratio) of 0.72+/-0.09 at 6 h. The specific ABCG2 inhibitor KO143 increased the transfer of (14)C-PhIP from maternal to fetal circulation (FM ratio 0.90+/-0.08 at 6 h, p<0.05) while the ABCC1/ABCC2 inhibitor probenecid had no effect (FM ratio at 6 h 0.75+/-0.10, p=0.84). There was a negative correlation between the expression of ABCG2 protein in perfused tissue and the FM ratio of (14)C-PhIP (R=-0.81, p<0.01) at the end of the perfusion. The expression of ABCC2 protein did not correlate with FM ratio of PhIP (R: -0.11, p=0.76). In addition, PhIP induced the expression of ABC transporters in BeWo cells at mRNA level. In conclusion, our data indicates that ABCG2 decreases placental transfer of (14)C-PhIP in perfused human placenta. Also, PhIP may modify ABC transporter expression in choriocarcinoma cells.
DEFF Research Database (Denmark)
Rocchi, E; Khodjakov, A; Volk, E L
2000-01-01
by Western blot and immunohistochemistry. This protein is highly overexpressed in several drug-resistant cell lines and localizes predominantly to the plasma membrane, instead of to intracellular membranes as seen with all other known half-transporters. Therefore, BCRP/MXR is unique among the ABC half......The products of the ABC gene family can be generally classified as either full-transporters of half-transporters. Full-transporters are expressed in the plasma membrane, whereas half-transporters are usually found in intracellular membranes. Recently, an ABC half-transporter, the ABCG2 gene product......-transporters by being localized to the plasma membrane....
DEFF Research Database (Denmark)
Andersen, Vibeke; Vogel, Lotte K.; Kopp, Tine Iskov
2015-01-01
Development of colorectal cancer (CRC) may result from a dysfunctional interplay between diet, gut microbes and the immune system. The ABC transport proteins ABCB1 (P-glycoprotein, Multidrug resistance protein 1, MDR1), ABCC2 (MRP2) and ABCG2 (BCRP) are involved in transport of various compounds...
Ishikawa, Toshihisa; Aw, Wanping; Kaneko, Kiyoko
2013-11-04
In mammals, excess purine nucleosides are removed from the body by breakdown in the liver and excretion from the kidneys. Uric acid is the end product of purine metabolism in humans. Two-thirds of uric acid in the human body is normally excreted through the kidney, whereas one-third undergoes uricolysis (decomposition of uric acid) in the gut. Elevated serum uric acid levels result in gout and could be a risk factor for cardiovascular disease and diabetes. Recent studies have shown that human ATP-binding cassette transporter ABCG2 plays a role of renal excretion of uric acid. Two non-synonymous single nucleotide polymorphisms (SNPs), i.e., 421C>A (major) and 376C>T (minor), in the ABCG2 gene result in impaired transport activity, owing to ubiquitination-mediated proteosomal degradation and truncation of ABCG2, respectively. These genetic polymorphisms are associated with hyperuricemia and gout. Allele frequencies of those SNPs are significantly higher in Asian populations than they are in African and Caucasian populations. A rapid and isothermal genotyping method has been developed to detect the SNP 421C>A, where one drop of peripheral blood is sufficient for the detection. Development of simple genotyping methods would serve to improve prevention and early therapeutic intervention for high-risk individuals in personalized healthcare.
The ABCG5/8 Cholesterol Transporter and Myocardial Infarction Versus Gallstone Disease
DEFF Research Database (Denmark)
Stender, Stefan; Frikke-Schmidt, Ruth; Nordestgaard, Børge G
2014-01-01
OBJECTIVES: The study sought to test the hypothesis that genetic variation in ABCG5/8, the transporter responsible for intestinal and hepatobiliary cholesterol efflux, may simultaneously influence plasma and biliary cholesterol levels, and hence risk of myocardial infarction (MI) and gallstone...... disease in opposite directions. BACKGROUND: High plasma levels of low-density lipoprotein (LDL) cholesterol are a causal risk factor for MI, whereas high levels of biliary cholesterol promote gallstone formation. METHODS: A total of 60,239 subjects from Copenhagen were included, including 5,647 with MI...... and 3,174 with symptomatic gallstone disease. Subjects were genotyped for 6 common, nonsynonymous and functional variants in ABCG5/8, and a combined weighted genotype score was calculated. RESULTS: Combined, weighted genotype scores were associated with stepwise decreases in LDL cholesterol of up to 5...
Qiu, Ya; Liu, Hua; Qing, Yufeng; Yang, Min; Tan, Xiaoyao; Zhao, Mingcai; Lin, Monica; Zhou, Jingguo
2014-09-01
Individual genetic association studies examining the relationship between the ABCG2 gene polymorphisms and gout have yielded inconsistent results. This study aims to evaluate the association between the ABCG2 gene variants and gout using meta-analysis. Relevant studies were identified by searching databases extensively. The odds ratio (OR) was calculated using a random-effect or fixed-effect model. A Q statistic was used to evaluate homogeneity, and Egger's test and funnel plot were used to assess publication bias. Subgroup analyses on ethnicities and sex were also performed. A total of 7 studies, including 2185 gout patients and 8028 controls from 5 countries or regions, were included and identified for the current meta-analysis. It was found that the A allele or AA genotype of the ABCG2 Q141K polymorphism (rs2231142) had an increased risk of gout in the general population (A allele, p gout (p gout.
Michaelis, Martin; Rothweiler, Florian; Löschmann, Nadine; Sharifi, Mohsen; Ghafourian, Taravat; Cinatl, Jindrich
2015-07-10
The PKCβ inhibitor enzastaurin was tested in parental neuroblastoma and rhabdomyosarcoma cell lines, their vincristine-resistant sub-lines, primary neuroblastoma cells, ABCB1-transduced, ABCG2-transduced, and p53-depleted cells. Enzastaurin IC50s ranged from 3.3 to 9.5 μM in cell lines and primary cells independently of the ABCB1, ABCG2, or p53 status. Enzastaurin 0.3125 μM interfered with ABCB1-mediated drug transport. PKCα and PKCβ may phosphorylate and activate ABCB1 under the control of p53. However, enzastaurin exerted similar effects on ABCB1 in the presence or absence of functional p53. Also, enzastaurin inhibited PKC signalling only in concentrations ≥ 1.25 μM. The investigated cell lines did not express PKCβ. PKCα depletion reduced PKC signalling but did not affect ABCB1 activity. Intracellular levels of the fluorescent ABCB1 substrate rhodamine 123 rapidly decreased after wash-out of extracellular enzastaurin, and enzastaurin induced ABCB1 ATPase activity resembling the ABCB1 substrate verapamil. Computational docking experiments detected a direct interaction of enzastaurin and ABCB1. These data suggest that enzastaurin directly interferes with ABCB1 function. Enzastaurin further inhibited ABCG2-mediated drug transport but by a different mechanism since it reduced ABCG2 ATPase activity. These findings are important for the further development of therapies combining enzastaurin with ABC transporter substrates.
Luo, Yong-Li; Ma, Guang-Xu; Luo, Yong-Fang; Kuang, Ce-Yan; Jiang, Ai-Yun; Li, Guo-Qing; Zhou, Rong-Qiong
2018-03-01
Toxocara canis is a zoonotic parasite with worldwide distribution. ATP-binding cassette (ABC) transporters are integral membrane proteins which involve in a range of biological processes in various organisms. In present study, the full-length coding sequence of abcg-5 gene of T. canis (Tc-abcg-5) was cloned and characterized. A 633 aa polypeptide containing two conserved Walker A and Walker B motifs was predicted from a continuous 1902 nt open reading frame. Quantitative real-time PCR was employed to determine the transcriptional levels of Tc-abcg-5 gene in adult male and female worms, which indicated high mRNA level of Tc-abcg-5 in the reproductive tract of adult female T. canis. Tc-abcg-5 was expressed to produce rabbit polyclonal antiserum against recombinant TcABCG5. Indirect-fluorescence immunohistochemical assays were carried out to detect the tissue distribution of TcABCG5, which showed predominant distribution of TcABCG5 in the uterus (especially in the germ cells) of adult female T. canis. Tissue transcription and expression pattern of Tc-abcg-5 indicated that Tc-abcg-5 might play essential roles in the reproduction of this parasitic nematode.
Directory of Open Access Journals (Sweden)
Kiyoko Kaneko
2013-11-01
Full Text Available In mammals, excess purine nucleosides are removed from the body by breakdown in the liver and excretion from the kidneys. Uric acid is the end product of purine metabolism in humans. Two-thirds of uric acid in the human body is normally excreted through the kidney, whereas one-third undergoes uricolysis (decomposition of uric acid in the gut. Elevated serum uric acid levels result in gout and could be a risk factor for cardiovascular disease and diabetes. Recent studies have shown that human ATP-binding cassette transporter ABCG2 plays a role of renal excretion of uric acid. Two non-synonymous single nucleotide polymorphisms (SNPs, i.e., 421C>A (major and 376C>T (minor, in the ABCG2 gene result in impaired transport activity, owing to ubiquitination-mediated proteosomal degradation and truncation of ABCG2, respectively. These genetic polymorphisms are associated with hyperuricemia and gout. Allele frequencies of those SNPs are significantly higher in Asian populations than they are in African and Caucasian populations. A rapid and isothermal genotyping method has been developed to detect the SNP 421C>A, where one drop of peripheral blood is sufficient for the detection. Development of simple genotyping methods would serve to improve prevention and early therapeutic intervention for high-risk individuals in personalized healthcare.
Directory of Open Access Journals (Sweden)
Ha-Won Jeong
2011-04-01
Full Text Available Our previous work shows that the stem cell factor SALL4 plays a central role in embryonic and leukemic stem cells. In this study, we report that SALL4 expression was higher in drug resistant primary acute myeloid leukemic patients than those from drug-responsive cases. In addition, while overexpression of SALL4 led to drug resistance in cell lines, cells with decreased SALL4 expression were more sensitive to drug treatments than the parental cells. This led to our investigation of the implication of SALL4 in drug resistance and its role in side population (SP cancer stem cells. SALL4 expression was higher in SP cells compared to non-SP cells by 2-4 fold in various malignant hematopoietic cell lines. Knocking down of SALL4 in isolated SP cells resulted in a reduction of SP cells, indicating that SALL4 is required for their self-renewal. The SP phenotype is known to be mediated by members of the ATP-binding cassette (ABC drug transport protein family, such as ABCG2 and ABCA3. Using chromatin-immunoprecipitation (ChIP, quantitative reverse transcription polymerase chain reaction (qRT-PCR and electrophoretic mobility shift assay(EMSA, we demonstrated that SALL4 was able to bind to the promoter region of ABCA3 and activate its expression while regulating the expression of ABCG2 indirectly. Furthermore, SALL4 expression was positively correlated to those of ABCG2 and ABCA3 in primary leukemic patient samples. Taken together, our results suggest a novel role for SALL4 in drug sensitivity, at least in part through the maintenance of SP cells, and therefore may be responsible for drug-resistance in leukemia. We are the first to demonstrate a direct link between stem cell factor SALL4, SP and drug resistance in leukemia.
Directory of Open Access Journals (Sweden)
Xuyong LIN, , , , ,
2009-04-01
Full Text Available Background and objective Increasing reports showed that some tumor stem cells were selfrenewal and multi-lineage differentiated in tumors, similar to the normal stem cells in human body. The aim of this study is to observe the expression of stem cell markers in lung squamous carcinoma tissues. Methods Fifty-four lung cancer specimens from surgery were analyzed for CK19, Notch3, CD133, P75NTR, STRO-1 and ABCG2 expression by using S-P immunohistochemistry. In addition, ten normal lung tissue samples were included as control. Results CK19, Notch3, CD133 and ABCG2 were expressed in 54 Lung cancer tissues, without expression of P75NTR and STRO-1. The expressionrate of CK19, Notch3, CD133 and ABCG2 was 66.67% (36/54, 87.04% (47/54, 50% (27/54, and 61.11% (33/54 respectively. The levels of expression of Notch3, CD133 and ABCG2 were significantly lower in high differentiation group than those in moderate and low differentiation group (P <0.05. The levels of expression of CK19, CD133 and ABCG2 were significantly higher in lymph node metastasis group than those in non-metastasis group (P <0.05. The percentage of total positive cells of four stem cell markers in serial tissue sections was lower than 2%. Conclusion There was expression ofsome stem cell markers in pulmonary squamous carcinomas, and there was relationship between expression degree withdifferentiation degree and lymph node metastasis.
Ben Cheikh, Yosra; Xuereb, Benoit; Boulangé-Lecomte, Céline; Le Foll, Frank
2018-02-01
Among the cellular protection arsenal, ABC transporters play an important role in xenobiotic efflux in marine organisms. Two pumps belonging to B and C subfamily has been identified in Mytilus edulis. In this study, we investigated the presence of the third major subtype ABCG2/BCRP protein in mussel tissues. Transcript was expressed in hemocytes and with higher level in gills. Molecular characterization revealed that mussel ABCG2 transporter shares the sequence and organizational structure with mammalian and molluscan orthologs. Overall identity of the predicted amino acid sequence with corresponding homologs from other organisms was between 49% and 98%. Moreover, protein efflux activity was demonstrated using a combination of fluorescent allocrites and specific inhibitors. The accumulation of bodipy prazosin and pheophorbide A was heterogeneous in gills and hemocytes. Most of the used blockers enhanced probe accumulation at different levels, most significantly for bodipy prazosin. Moreover, Mrp classical blocker MK571 showed a polyspecificity. In conclusion, our data demonstrate that several ABC transporters contribute to MXR phenotype in the blue mussel including ABCG2 that forms an active pump in hemocytes and gills. Efforts are needed to distinguish between the different members and to explore their single function and specificity towards allocrites and chemosensitizers. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Litman, Thomas; Jensen, Ulla; Hansen, Alastair
2002-01-01
Recent studies have characterized the ABC half-transporter associated with mitoxantrone resistance in human cancer cell lines. Encoded by the ABCG2 gene, overexpression confers resistance to camptothecins, as well as to mitoxantrone. We developed four polyclonal antibodies against peptides corres...
Czech Academy of Sciences Publication Activity Database
Campa, D.; Pardini, Barbara; Naccarati, Alessio; Vodičková, Ludmila; Novotný, J.; Försti, A.; Hemminki, K.; Barale, R.; Vodička, Pavel; Canzian, F.
2008-01-01
Roč. 645, 1-2 (2008), s. 56-60 ISSN 0027-5107 R&D Projects: GA ČR GA310/07/1430 Institutional research plan: CEZ:AV0Z50390512; CEZ:AV0Z50390703 Keywords : ABCG2 * Transporter * Colorectal cancer Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.198, year: 2008
Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.
2017-01-01
PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the
Arabidopsis ABCG14 protein controls the acropetal translocation of root-synthesized cytokinins
Zhang, Kewei; Novak, Ondrej; Wei, Zhaoyang; Gou, Mingyue; Zhang, Xuebin; Yu, Yong; Yang, Huijun; Cai, Yuanheng; Strnad, Miroslav; Liu, Chang-Jun
2014-02-01
Cytokinins are a major group of phytohormones regulating plant growth, development and stress responses. However, in contrast to the well-defined polar transport of auxins, the molecular basis of cytokinin transport is poorly understood. Here we show that an ATP-binding cassette transporter in Arabidopsis, AtABCG14, is essential for the acropetal (root to shoot) translocation of the root-synthesized cytokinins. AtABCG14 is expressed primarily in the pericycle and stelar cells of roots. Knocking out AtABCG14 strongly impairs the translocation of trans-zeatin (tZ)-type cytokinins from roots to shoots, thereby affecting the plant’s growth and development. AtABCG14 localizes to the plasma membrane of transformed cells. In planta feeding of C14 or C13-labelled tZ suggests that it acts as an efflux pump and its presence in the cells directly correlates with the transport of the fed cytokinin. Therefore, AtABCG14 is a transporter likely involved in the long-distance translocation of cytokinins in planta.
Directory of Open Access Journals (Sweden)
Damien Marechal
Full Text Available Down syndrome (DS results from one extra copy of human chromosome 21 and leads to several alterations including intellectual disabilities and locomotor defects. The transchromosomic Tc1 mouse model carrying an extra freely-segregating copy of human chromosome 21 was developed to better characterize the relation between genotype and phenotype in DS. The Tc1 mouse exhibits several locomotor and cognitive deficits related to DS. In this report we analyzed the contribution of the genetic dosage of 13 conserved mouse genes located between Abcg1 and U2af1, in the telomeric part of Hsa21. We used the Ms2Yah model carrying a deletion of the corresponding interval in the mouse genome to rescue gene dosage in the Tc1/Ms2Yah compound mice to determine how the different behavioral phenotypes are affected. We detected subtle changes with the Tc1/Ms2Yah mice performing better than the Tc1 individuals in the reversal paradigm of the Morris water maze. We also found that Tc1/Ms2Yah compound mutants performed better in the rotarod than the Tc1 mice. This data support the impact of genes from the Abcg1-U2af1 region as modifiers of Tc1-dependent memory and locomotor phenotypes. Our results emphasize the complex interactions between triplicated genes inducing DS features.
[ROLE OF SLC2A9 AND ABCG2 GENE POLYMORPHISMS IN ORIGIN OF HYPERURICEMIA AND GOUT].
Fadieieva, A; Prystupa, L; Pogorelova, O; Kirichenko, N; Dudchenko, I
2016-03-01
The polymorphisms V253I, Q126X, Q141K of SLC2A9 and ABCG2 genes were characterized. GCA и GTC haplotypes of Q126X and Q141K variants can be predictors of gout. The relationship of these polymorphisms with hyperuricaemia according to gender, metabolic syndrome components, with the response to allopurinol was analyzed. It has been established that Q141K polymorphism can directly modulate BCRP-mediated allopurinol and oxypurinol efflux, the K allele is associated with a lower reduction in serum uric acid in response to allopurinol treatment.
The ABCG5 ABCG8 sterol transporter and phytosterols: implications for cardiometabolic disease
Sabeva, Nadezhda S.; Liu, Jingjing; Graf, Gregory A.
2014-01-01
Purpose of review This review summarizes recent developments in the activity, regulation, and physiology of the ABCG5 ABCG8 (G5G8) transporter and the use of its xenobiotic substrates, phytosterols, as cholesterol lowering agents in the treatment of cardiovascular disease. Recent progress has significant implications for the role of G5G8 and its substrates in complications associated with features of the metabolic syndrome. Recent findings Recent reports expand the clinical presentation of sitosterolemia to include platelet and adrenal dysfunction. The G5G8 sterol transporter is critical to hepatobiliary excretion of cholesterol under nonpathological conditions and has been linked to the cholesterol gallstone susceptibility. Finally, the cardiovascular benefits of cholesterol lowering through the use of phytosterol supplements were offset by vascular dysfunction, suggesting that alternative strategies to reduced cholesterol absorption offer greater benefit. Summary Insulin resistance elevates G5G8 and increases susceptibility to cholesterol gallstones. However, this transporter is critical for the exclusion of phytosterols from the absorptive pathways in the intestine. Challenging the limits of this protective mechanism through phytosterol supplementation diminishes the cardioprotective benefits of cholesterol lowering in mouse models of cardiovascular disease. PMID:19306529
Phytosterol Feeding Causes Toxicity in ABCG5/G8 Knockout Mice
McDaniel, Allison L.; Alger, Heather M.; Sawyer, Janet K.; Kelley, Kathryn L.; Kock, Nancy D.; Brown, J. Mark; Temel, Ryan E.; Rudel, Lawrence L.
2014-01-01
Plant sterols, or phytosterols, are very similar in structure to cholesterol and are abundant in typical diets. The reason for poor absorption of plant sterols by the body is still unknown. Mutations in the ABC transporters G5 and G8 are known to cause an accumulation of plant sterols in blood and tissues (sitosterolemia). To determine the significance of phytosterol exclusion from the body, we fed wild-type and ABCG5/G8 knockout mice a diet enriched with plant sterols. The high-phytosterol diet was extremely toxic to the ABCG5/G8 knockout mice but had no adverse effects on wild-type mice. ABCG5/G8 knockout mice died prematurely and developed a phenotype that included high levels of plant sterols in many tissues, liver abnormalities, and severe cardiac lesions. This study is the first to report such toxic effects of phytosterol accumulation in ABCG5/G8 knockout mice. We believe these new data support the conclusion that plant sterols are excluded from the body because they are toxic when present at high levels. PMID:23380580
Matsuda, Shuichi; Takano, Sho; Sato, Moeko; Furukawa, Kaoru; Nagasawa, Hidetaka; Yoshikawa, Shoko; Kasuga, Jun; Tokuji, Yoshihiko; Yazaki, Kazufumi; Nakazono, Mikio; Takamure, Itsuro; Kato, Kiyoaki
2016-03-07
Water stress is one of the major environmental stresses that affect agricultural production worldwide. Water loss from plants occurs primarily through stomatal pores. Here, we report that an Oryza sativa half-size ATP-binding cassette (ABC) subfamily G protein, RCN1/OsABCG5, is involved in stomatal closure mediated by phytohormone abscisic acid (ABA) accumulation in guard cells. We found that the GFP-RCN1/OsABCG5-fusion protein was localized at the plasma membrane in guard cells. The percentage of guard cell pairs containing both ABA and GFP-RCN1/OsABCG5 increased after exogenous ABA treatment, whereas they were co-localized in guard cell pairs regardless of whether exogenous ABA was applied. ABA application resulted in a smaller increase in the percentage of guard cell pairs containing ABA in rcn1 mutant (A684P) and RCN1-RNAi than in wild-type plants. Furthermore, polyethylene glycol (drought stress)-inducible ABA accumulation in guard cells did not occur in rcn1 mutants. Stomata closure mediated by exogenous ABA application was strongly reduced in rcn1 mutants. Finally, rcn1 mutant plants had more rapid water loss from detached leaves than the wild-type plants. These results indicate that in response to drought stress, RCN1/OsABCG5 is involved in accumulation of ABA in guard cells, which is indispensable for stomatal closure. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Hsu, Ya-Yun [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Tseng, Yu-Ting [Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Lo, Yi-Ching, E-mail: yichlo@kmu.edu.tw [Department of Pharmacology, School of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China); Graduate Institute of Natural Products, Kaohsiung Medical University, Kaohsiung 80708, Taiwan (China)
2013-11-01
Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H{sub 2}O{sub 2} neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS
International Nuclear Information System (INIS)
Hsu, Ya-Yun; Tseng, Yu-Ting; Lo, Yi-Ching
2013-01-01
Reactive oxygen intermediates production and apoptotic damage induced by high glucose are major causes of neuronal damage in diabetic neuropathy. Berberine (BBR), a natural antidiabetes drug with PI3K-activating activity, holds promise for diabetes because of its dual antioxidant and anti-apoptotic activities. We have previously reported that BBR attenuated H 2 O 2 neurotoxicity via activating the PI3K/Akt/Nrf2-dependent pathway. In this study, we further explored the novel protective mechanism of BBR on high glucose-induced apoptotic death and neurite damage of SH-SY5Y cells. Results indicated BBR (0.1–10 nM) significantly attenuated reactive oxygen species (ROS) production, nucleus condensation, and apoptotic death in high glucose-treated cells. However, AG1024, an inhibitor of insulin growth factor-1 (IGF-1) receptor, significantly abolished BBR protection against high glucose-induced neuronal death. BBR also increased Bcl-2 expression and decreased cytochrome c release. High glucose down-regulated IGF-1 receptor and phosphorylation of Akt and GSK-3β, the effects of which were attenuated by BBR treatment. BBR also activated nuclear erythroid 2-related factor 2 (Nrf2), the key antioxidative transcription factor, which is accompanied with up-regulation of hemeoxygenase-1 (HO-1). Furthermore, BBR markedly enhanced nerve growth factor (NGF) expression and promoted neurite outgrowth in high glucose-treated cells. To further determine the role of the Nrf2 in BBR neuroprotection, RNA interference directed against Nrf2 was used. Results indicated Nrf2 siRNA abolished BBR-induced HO-1, NGF, neurite outgrowth and ROS decrease. In conclusion, BBR attenuated high glucose-induced neurotoxicity, and we are the first to reveal this novel mechanism of BBR as an Nrf2 activator against glucose neurotoxicity, providing another potential therapeutic use of BBR on the treatment of diabetic complications. - Highlights: • BBR attenuates high glucose-induced ROS production and
Directory of Open Access Journals (Sweden)
Adena S Spiro
Full Text Available The ABC transporters P-glycoprotein (P-gp, Abcb1 and breast cancer resistance protein (Bcrp, Abcg2 regulate the CNS disposition of many drugs. The main psychoactive constituent of cannabis Δ(9-tetrahydrocannabinol (THC has affinity for P-gp and Bcrp, however it is unknown whether these transporters modulate the brain accumulation of THC and its functional effects on the CNS. Here we aim to show that mice devoid of Abcb1 and Abcg2 retain higher brain THC levels and are more sensitive to cannabinoid-induced hypothermia than wild-type (WT mice. Abcb1a/b (-/-, Abcg2 (-/- and wild-type (WT mice were injected with THC before brain and blood were collected and THC concentrations determined. Another cohort of mice was examined for THC-induced hypothermia by measuring rectal body temperature. Brain THC concentrations were higher in both Abcb1a/b (-/- and Abcg2 (-/- mice than WT mice. ABC transporter knockout mice exhibited delayed elimination of THC from the brain with the effect being more prominent in Abcg2 (-/- mice. ABC transporter knockout mice were more sensitive to THC-induced hypothermia compared to WT mice. These results show P-gp and Bcrp prolong the brain disposition and hypothermic effects of THC and offer a novel mechanism for both genetic vulnerability to the psychoactive effects of cannabis and drug interactions between CNS therapies and cannabis.
Arctigenin promotes cholesterol efflux from THP-1 macrophages through PPAR-γ/LXR-α signaling pathway
Energy Technology Data Exchange (ETDEWEB)
Xu, Xiaolin [Department of Cardiothoracic Surgery, Huashan Hospital, Fudan University, Shanghai 200032 (China); Li, Qian [Department of Integrative Medicine and Neurobiology, School of Basic Medical Sciences, Shanghai Medical College, Fudan University, Shanghai (China); Pang, Liewen; Huang, Guoqian; Huang, Jiechun; Shi, Meng; Sun, Xiaotian [Department of Cardiothoracic Surgery, Huashan Hospital, Fudan University, Shanghai 200032 (China); Wang, Yiqing [Department of Cardiothoracic Surgery, Huashan Hospital, Fudan University, Shanghai 200032 (China)
2013-11-15
Highlights: •Arctigenin enhanced cholesterol efflux in oxLDL-loaded THP-1 macrophages. •The expression of ABCA1, ABCG1 and apoE was upregulated in arctigenin-treated cells. •Arctigenin promoted the expression of PPAR-γ and LXR-α. •Inhibition of PPAR-γ or LXR-α reversed arctigenin-mediated biological effects. •Arctigenin promotes cholesterol efflux via activation of PPAR-γ/LXR-α/ABCA1 pathway. -- Abstract: Cholesterol efflux from macrophages is a critical mechanism to prevent the development of atherosclerosis. Here, we sought to investigate the effects of arctigenin, a bioactive component of Arctium lappa, on the cholesterol efflux in oxidized low-density lipoprotein (oxLDL)-loaded THP-1 macrophages. Our data showed that arctigenin significantly accelerated apolipoprotein A-I- and high-density lipoprotein-induced cholesterol efflux in both dose- and time-dependent manners. Moreover, arctigenin treatment enhanced the expression of ATP binding cassette transporter A1 (ABCA1), ABCG1, and apoE, all of which are key molecules in the initial step of cholesterol efflux, at both mRNA and protein levels. Arctigenin also caused a concentration-dependent elevation in the expression of peroxisome proliferator-activated receptor-gamma (PPAR-γ) and liver X receptor-alpha (LXR-α). The arctigenin-mediated induction of ABCA1, ABCG1, and apoE was abolished by specific inhibition of PPAR-γ or LXR-α using small interfering RNA technology. Our results collectively indicate that arctigenin promotes cholesterol efflux in oxLDL-loaded THP-1 macrophages through upregulation of ABCA1, ABCG1 and apoE, which is dependent on the enhanced expression of PPAR-γ and LXR-α.
Arctigenin promotes cholesterol efflux from THP-1 macrophages through PPAR-γ/LXR-α signaling pathway
International Nuclear Information System (INIS)
Xu, Xiaolin; Li, Qian; Pang, Liewen; Huang, Guoqian; Huang, Jiechun; Shi, Meng; Sun, Xiaotian; Wang, Yiqing
2013-01-01
Highlights: •Arctigenin enhanced cholesterol efflux in oxLDL-loaded THP-1 macrophages. •The expression of ABCA1, ABCG1 and apoE was upregulated in arctigenin-treated cells. •Arctigenin promoted the expression of PPAR-γ and LXR-α. •Inhibition of PPAR-γ or LXR-α reversed arctigenin-mediated biological effects. •Arctigenin promotes cholesterol efflux via activation of PPAR-γ/LXR-α/ABCA1 pathway. -- Abstract: Cholesterol efflux from macrophages is a critical mechanism to prevent the development of atherosclerosis. Here, we sought to investigate the effects of arctigenin, a bioactive component of Arctium lappa, on the cholesterol efflux in oxidized low-density lipoprotein (oxLDL)-loaded THP-1 macrophages. Our data showed that arctigenin significantly accelerated apolipoprotein A-I- and high-density lipoprotein-induced cholesterol efflux in both dose- and time-dependent manners. Moreover, arctigenin treatment enhanced the expression of ATP binding cassette transporter A1 (ABCA1), ABCG1, and apoE, all of which are key molecules in the initial step of cholesterol efflux, at both mRNA and protein levels. Arctigenin also caused a concentration-dependent elevation in the expression of peroxisome proliferator-activated receptor-gamma (PPAR-γ) and liver X receptor-alpha (LXR-α). The arctigenin-mediated induction of ABCA1, ABCG1, and apoE was abolished by specific inhibition of PPAR-γ or LXR-α using small interfering RNA technology. Our results collectively indicate that arctigenin promotes cholesterol efflux in oxLDL-loaded THP-1 macrophages through upregulation of ABCA1, ABCG1 and apoE, which is dependent on the enhanced expression of PPAR-γ and LXR-α
Drug promotion practices: A review.
Jacob, Nilan T
2018-01-18
Over the years, the pharmaceutical industry has been at the forefront of research and innovation in drug discovery and development. The process of drug discovery extending from preclinical studies to multicentric clinical trials and postmarketing phase is a costly affair running into billions of dollars. On the flip side, not all investigational molecules clear the trial phases and get approved, which puts pressure on the manufacturers to maximize the profit from approved drugs. It is in this key area that the practice of drug promotion plays its role. The World Health Organization defines drug promotion as "all informational and persuasive activities by manufacturers and distributors, the effect of which is to influence the prescription, supply, purchase or use of medicinal drugs". With its humble intent of creating awareness among healthcare professionals and updating their knowledge on recent advances in treatment options, drug promotion has been an important tool, but gradually it has evolved to embrace aggressive marketing strategies and sometimes unethical business and scientific practices where the need for profit-making eclipses commitment to patient care and scientific exploration. In this review, we discuss the evolution of drug promotion practices, the various types, its merits and demerits, the influence of drug promotion on physician prescribing behaviour, the role of regulatory bodies, unethical promotional practices and finally summarize with future directions. © 2018 The British Pharmacological Society.
Directory of Open Access Journals (Sweden)
Abbass Ghanbari-Niaki
2014-03-01
Full Text Available Objective(s: ABC transporters comprise a large family of transmembrane proteins that use the energy provided by ATP hydrolysis to translocate a variety of substrates across biological membranes. All members of the human ABCG subfamily, except for ABCG2, are cholesterol-transporter. The aim of this study was to determine the liver, the small intestine and kidney ABCG5 relative gene expression in response to treadmill-running training in female rats. Materials and Methods: Twenty Wistar rats (6-8 weeks old and 125-135 g weight were used. Animals were randomly assigned to saline-control (SC, saline-training (ST, and Baneh-control (BC, and Baneh-training (BT groups. Training groups did the exercise on a motor-driven treadmill at 25 m/min (0% grade for 60 min/day for eight weeks (5 days/week. Rats were fed orally, with Baneh extraction and saline for six weeks. The two-way ANOVA was employed for statistical analysis. ABCG5 relative gene expression was detected by Real-time PCR method. Results:The current findings indicate that the Baneh-treated tissues had significantly lower levels of ABCG5 gene expression in the liver, small intestine, and kidneys (P< 0.001, P< 0.003, P< 0.001, respectively, when compared with saline-treated tissues. However, a higher level of gene expression was observed in exercise groups. A lower level of HDL-c but not triglyceride (TG and total cholesterol (TC levels were found in Baneh-treated animals at rest. Conclusion: Exercise training increases ABCG5 relative gene expression in the liver, small intestine and kidney tissues; therefore exercise training may adjust the reduction of ABCG5 relative gene expression in Baneh-training group.
Directory of Open Access Journals (Sweden)
Eviatar Nevo
2013-10-01
Full Text Available Wild barley eibi1 mutant with HvABCG31 gene mutation has low capacity to retain leaf water, a phenotype associated with reduced cutin deposition and a thin cuticle. To better understand how such a mutant plant survives, we performed a genome-wide gene expression analysis. The leaf transcriptomes between the near-isogenic lines eibi1 and the wild type were compared using the 22-k Barley1 Affymetrix microarray. We found that the pleiotropic effect of the single gene HvABCG31 mutation was linked to the co-regulation of metabolic processes and stress-related system. The cuticle development involved cytochrome P450 family members and fatty acid metabolism pathways were significantly up-regulated by the HvABCG31 mutation, which might be anticipated to reduce the levels of cutin monomers or wax and display conspicuous cuticle defects. The candidate genes for responses to stress were induced by eibi1 mutant through activating the jasmonate pathway. The down-regulation of co-expressed enzyme genes responsible for DNA methylation and histone deacetylation also suggested that HvABCG31 mutation may affect the epigenetic regulation for barley development. Comparison of transcriptomic profiling of barley under biotic and abiotic stresses revealed that the functions of HvABCG31 gene to high-water loss rate might be different from other osmotic stresses of gene mutations in barley. The transcriptional profiling of the HvABCG31 mutation provided candidate genes for further investigation of the physiological and developmental changes caused by the mutant.
Tu, Hung-Pin; Chung, Chia-Min; Min-Shan Ko, Albert; Lee, Su-Shin; Lai, Han-Ming; Lee, Chien-Hung; Huang, Chung-Ming; Liu, Chiu-Shong; Ko, Ying-Chin
2016-09-01
The aim of the present study was to evaluate the contribution of urate transporter genes and alcohol use to the risk of gout/tophi. Eight variants of ABCG2, SLC2A9, SLC22A12, SLC22A11 and SLC17A3 were genotyped in male individuals in a case-control study with 157 gout (33% tophi), 106 asymptomatic hyperuricaemia and 295 control subjects from Taiwan. The multilocus profiles of the genetic risk scores for urate gene variants were used to evaluate the risk of asymptomatic hyperuricaemia, gout and tophi. ABCG2 Q141K (T), SLC2A9 rs1014290 (A) and SLC22A12 rs475688 (C) under an additive model and alcohol use independently predicted the risk of gout (respective odds ratio for each factor=2.48, 2.03, 1.95 and 2.48). The additive composite Q141K, rs1014290 and rs475688 scores of high-risk alleles were associated with gout risk (Pgout and tophi risk (P for interaction=0.0452, 0.0033). The synergistic effect of genetic urate score 5-6 and alcohol use indicates that these combined factors correlate with gout and tophi occurrence.
Zago, V H S; Scherrer, D Z; Parra, E S; Panzoldo, N B; Alexandre, F; Nakandakare, E R; Quintão, E C R; de Faria, E C
2015-03-01
ATP binding cassette transporter G1 (ABCG1) promotes lipidation of nascent high-density lipoprotein (HDL) particles, acting as an intracellular transporter. SNP rs1893590 (c.-204A > C) of ABCG1 gene has been previously studied and reported as functional over plasma HDL-C and lipoprotein lipase activity. This study aimed to investigate the relationships of SNP rs1893590 with plasma lipids and lipoproteins in a large Brazilian population. Were selected 654 asymptomatic and normolipidemic volunteers from both genders. Clinical and anthropometrical data were taken and blood samples were drawn after 12 h fasting. Plasma lipids and lipoproteins, as well as HDL particle size and volume were determined. Genomic DNA was isolated for SNP rs1893590 detection by TaqMan(®) OpenArray(®) Real-Time PCR Plataform (Applied Biosystems). Mann-Whitney U, Chi square and two-way ANOVA were the used statistical tests. No significant differences were found in the comparison analyses between the allele groups for all studied parameters. Conversely, significant interactions were observed between SNP and age over plasma HDL-C, were volunteers under 60 years with AA genotype had increased HDL-C (p = 0.048). Similar results were observed in the group with body mass index (BMI) m(2), where volunteers with AA genotype had higher HDL-C levels (p = 0.0034), plus an increased HDL particle size (p = 0.01). These findings indicate that SNP rs1893590 of ABCG1 has a significant impact over HDL-C under asymptomatic clinical conditions in an age and BMI dependent way.
Alleviating Promotion of Inflammation and Cancer Induced by Nonsteroidal Anti-Inflammatory Drugs
Directory of Open Access Journals (Sweden)
Anthony M. Kyriakopoulos
2017-01-01
Full Text Available Clinical Relevance. Nonsteroidal Anti-Inflammatory Drugs (NSAIDs including aspirin are of intensive use nowadays. These drugs exert their activity via the metabolism of arachidonic acid (AA by cyclooxygenase inhibition. Though beneficial for health in some instances, both unspecific and specific cyclooxygenase inhibitor activity interfere with AA metabolism producing also proinflammatory lipids that may promote cancer. Materials and Methods. This review is based on available literature on clinical uses, biochemical investigations, molecular medicine, pharmacology, toxicity, and epidemiology-clinical studies on NSAIDs and other drugs that may be used accordingly, which was collected from electronic (SciFinder, Medline, Science Direct, and ACS among others and library searches of books and journals. Results. Relevant literature supports the notion that NDSAID use may also promote proinflammatory biochemical events that are also related to precancerous predisposition. Several agents are proposed that may be employed in immediate future to supplement and optimize treatment with NSAIDs. In this way serious side effects arising from promotion of inflammation and cancer, especially in chronic NSAID users and high risk groups of patients, could be avoided.
DEFF Research Database (Denmark)
Dayeh, Tasnim; Tuomi, Tiinamaija; Almgren, Peter
2016-01-01
Identification of subjects with a high risk of developing type 2 diabetes (T2D) is fundamental for prevention of the disease. Consequently, it is essential to search for new biomarkers that can improve the prediction of T2D. The aim of this study was to examine whether 5 DNA methylation loci...... muscle from diabetic vs. non-diabetic subjects. DNA methylation at the ABCG1 locus cg06500161 in blood DNA was associated with an increased risk for future T2D (OR = 1.09, 95% CI = 1.02-1.16, P-value = 0.007, Q-value = 0.018), while DNA methylation at the PHOSPHO1 locus cg02650017 in blood DNA...... was associated with a decreased risk for future T2D (OR = 0.85, 95% CI = 0.75-0.95, P-value = 0.006, Q-value = 0.018) after adjustment for age, gender, fasting glucose, and family relation. Furthermore, the level of DNA methylation at the ABCG1 locus cg06500161 in blood DNA correlated positively with BMI, HbA1c...
Kappus, Mojdeh S.; Murphy, Andrew J.; Abramowicz, Sandra; Ntonga, Vusisizwe; Welch, Carrie L.; Tall, Alan R.; Westerterp, Marit
2014-01-01
Objective Liver X Receptor (LXR) activators decrease atherosclerosis in mice. LXR activators (1) directly up-regulate genes involved in reverse cholesterol transport (RCT) and (2) exert anti-inflammatory effects mediated by transrepression of NFκB target genes. We investigated whether myeloid cell deficiency of ATP-binding cassette transporters A1 and G1 (ABCA1/G1), principal targets of LXR that promote macrophage cholesterol efflux and initiate RCT, would abolish the beneficial effects of LXR activation on atherosclerosis. Approach and Results LXR activator T0901317 (T0) substantially reduced inflammatory gene expression in macrophages lacking ABCA1/G1. Ldlr−/− mice were transplanted with Abca1−/−Abcg1−/− or wild-type bone marrow (BM) and fed a Western-type diet (WTD) for 6 weeks with or without T0 supplementation. Abca1/g1 BM deficiency increased atherosclerotic lesion complexity and inflammatory cell infiltration into the adventitia and myocardium. T0 markedly decreased lesion area, complexity and inflammatory cell infiltration in the Abca1−/−Abcg1−/− BM transplanted mice. To investigate whether this was due to macrophage Abca1/g1 deficiency, Ldlr−/− mice were transplanted with LysmCreAbca1fl/flAbcg1fl/fl or Abca1fl/flAbcg1fl/fl BM and fed WTD with or without the more specific LXR agonist GW3965 for 12 weeks. GW3965 decreased lesion size in both groups and the decrease was more prominent in the LysmCreAbca1fl/flAbcg1fl/fl group. Conclusions The results suggest that anti-inflammatory effects of LXR activators are of key importance to their anti-atherosclerotic effects in vivo independent of cholesterol efflux pathways mediated by macrophage ABCA1/G1. This has implications for the development of LXR activators that lack adverse effects on lipogenic genes while maintaining the ability to trans-repress inflammatory genes. PMID:24311381
Dharmapuri, Gangappa; Doneti, Ravinder; Philip, Gundala Harold; Kalle, Arunasree M
2015-07-01
Imatinib mesylate, a tyrosine kinase inhibitor, is very effective in the treatment of chronic myeloid leukemia (CML). However, development of resistance to imatinib therapy is also a very common mechanism observed with long-term administration of the drug. Our previous studies have highlighted the role of cyclooxygenase-2 (COX-2) in regulating the expression of multidrug resistant protein-1 (MDR1), P-gp, in imatinib-resistant K562 cells (IR-K562) via PGE2-cAMP-PKC-NF-κB pathway and inhibition of COX-2 by celecoxib, a COX-2 specific inhibitor, inhibits this pathway and reverses the drug resistance. Studies have identified that not only MDR1 but other ATP-binding cassette transport proteins (ABC transporters) are involved in the development of imatinib resistance. Here, we tried to study the role of COX-2 in the regulation of other ABC transporters such as MRP1, MRP2, MRP3, ABCA2 and ABCG2 that have been already implicated in imatinib resistance development. The results of the study clearly indicated that overexpression of COX-2 lead to upregulation of MRP family proteins in IR-K562 cells and celecoxib down-regulated the ABC transporters through Wnt and MEK signaling pathways. The study signifies that celecoxib in combination with the imatinib can be a good alternate treatment strategy for the reversal of imatinib resistance. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Sun Woo Sophie Kang
Full Text Available Mitochondrial damage is the major factor underlying drug-induced liver disease but whether conditions that thwart mitochondrial injury can prevent or reverse drug-induced liver damage is unclear. A key molecule regulating mitochondria quality control is AMP activated kinase (AMPK. When activated, AMPK causes mitochondria to elongate/fuse and proliferate, with mitochondria now producing more ATP and less reactive oxygen species. Autophagy is also triggered, a process capable of removing damaged/defective mitochondria. To explore whether AMPK activation could potentially prevent or reverse the effects of drug-induced mitochondrial and hepatocellular damage, we added an AMPK activator to collagen sandwich cultures of rat and human hepatocytes exposed to the hepatotoxic drugs, acetaminophen or diclofenac. In the absence of AMPK activation, the drugs caused hepatocytes to lose polarized morphology and have significantly decreased ATP levels and viability. At the subcellular level, mitochondria underwent fragmentation and had decreased membrane potential due to decreased expression of the mitochondrial fusion proteins Mfn1, 2 and/or Opa1. Adding AICAR, a specific AMPK activator, at the time of drug exposure prevented and reversed these effects. The mitochondria became highly fused and ATP production increased, and hepatocytes maintained polarized morphology. In exploring the mechanism responsible for this preventive and reversal effect, we found that AMPK activation prevented drug-mediated decreases in Mfn1, 2 and Opa1. AMPK activation also stimulated autophagy/mitophagy, most significantly in acetaminophen-treated cells. These results suggest that activation of AMPK prevents/reverses drug-induced mitochondrial and hepatocellular damage through regulation of mitochondrial fusion and autophagy, making it a potentially valuable approach for treatment of drug-induced liver injury.
Taniane, Caitlin; Farrell, Geoffrey; Arias, Irwin M.; Lippincott-Schwartz, Jennifer; Fu, Dong
2016-01-01
Mitochondrial damage is the major factor underlying drug-induced liver disease but whether conditions that thwart mitochondrial injury can prevent or reverse drug-induced liver damage is unclear. A key molecule regulating mitochondria quality control is AMP activated kinase (AMPK). When activated, AMPK causes mitochondria to elongate/fuse and proliferate, with mitochondria now producing more ATP and less reactive oxygen species. Autophagy is also triggered, a process capable of removing damaged/defective mitochondria. To explore whether AMPK activation could potentially prevent or reverse the effects of drug-induced mitochondrial and hepatocellular damage, we added an AMPK activator to collagen sandwich cultures of rat and human hepatocytes exposed to the hepatotoxic drugs, acetaminophen or diclofenac. In the absence of AMPK activation, the drugs caused hepatocytes to lose polarized morphology and have significantly decreased ATP levels and viability. At the subcellular level, mitochondria underwent fragmentation and had decreased membrane potential due to decreased expression of the mitochondrial fusion proteins Mfn1, 2 and/or Opa1. Adding AICAR, a specific AMPK activator, at the time of drug exposure prevented and reversed these effects. The mitochondria became highly fused and ATP production increased, and hepatocytes maintained polarized morphology. In exploring the mechanism responsible for this preventive and reversal effect, we found that AMPK activation prevented drug-mediated decreases in Mfn1, 2 and Opa1. AMPK activation also stimulated autophagy/mitophagy, most significantly in acetaminophen-treated cells. These results suggest that activation of AMPK prevents/reverses drug-induced mitochondrial and hepatocellular damage through regulation of mitochondrial fusion and autophagy, making it a potentially valuable approach for treatment of drug-induced liver injury. PMID:27792760
Hsieh, Victar; Kim, Mi-Jurng; Gelissen, Ingrid C.; Brown, Andrew J.; Sandoval, Cecilia; Hallab, Jeannette C.; Kockx, Maaike; Traini, Mathew; Jessup, Wendy; Kritharides, Leonard
2014-01-01
The objective of this study was to examine the influence of cholesterol in post-translational control of ABCA1 and ABCG1 protein expression. Using CHO cell lines stably expressing human ABCA1 or ABCG1, we observed that the abundance of these proteins is increased by cell cholesterol loading. The response to increased cholesterol is rapid, is independent of transcription, and appears to be specific for these membrane proteins. The effect is mediated through cholesterol-dependent inhibition of transporter protein degradation. Cell cholesterol loading similarly regulates degradation of endogenously expressed ABCA1 and ABCG1 in human THP-1 macrophages. Turnover of ABCA1 and ABCG1 is strongly inhibited by proteasomal inhibitors and is unresponsive to inhibitors of lysosomal proteolysis. Furthermore, cell cholesterol loading inhibits ubiquitination of ABCA1 and ABCG1. Our findings provide evidence for a rapid, cholesterol-dependent, post-translational control of ABCA1 and ABCG1 protein levels, mediated through a specific and sterol-sensitive mechanism for suppression of transporter protein ubiquitination, which in turn decreases proteasomal degradation. This provides a mechanism for acute fine-tuning of cholesterol transporter activity in response to fluctuations in cell cholesterol levels, in addition to the longer term cholesterol-dependent transcriptional regulation of these genes. PMID:24500716
Drug-Induced Morphology Switch in Drug Delivery Systems Based on Poly(2-oxazoline)s
2015-01-01
Defined aggregates of polymers such as polymeric micelles are of great importance in the development of pharmaceutical formulations. The amount of drug that can be formulated by a drug delivery system is an important issue, and most drug delivery systems suffer from their relatively low drug-loading capacity. However, as the loading capacities increase, i.e., promoted by good drug–polymer interactions, the drug may affect the morphology and stability of the micellar system. We investigated this effect in a prominent system with very high capacity for hydrophobic drugs and found extraordinary stability as well as a profound morphology change upon incorporation of paclitaxel into micelles of amphiphilic ABA poly(2-oxazoline) triblock copolymers. The hydrophilic blocks A comprised poly(2-methyl-2-oxazoline), while the middle blocks B were either just barely hydrophobic poly(2-n-butyl-2-oxazoline) or highly hydrophobic poly(2-n-nonyl-2-oxazoline). The aggregation behavior of both polymers and their formulations with varying paclitaxel contents were investigated by means of dynamic light scattering, atomic force microscopy, (cryogenic) transmission electron microscopy, and small-angle neutron scattering. While without drug, wormlike micelles were present, after incorporation of small amounts of drugs only spherical morphologies remained. Furthermore, the much more hydrophobic poly(2-n-nonyl-2-oxazoline)-containing triblock copolymer exhibited only half the capacity for paclitaxel than the poly(2-n-butyl-2-oxazoline)-containing copolymer along with a lower stability. In the latter, contents of paclitaxel of 8 wt % or higher resulted in a raspberry-like micellar core. PMID:24548260
The Promotion of Drug Abuse- PO*
African Journals Online (AJOL)
1974-03-02
Mar 2, 1974 ... experience in modern marketing techniques could develop a promotional campaign to increase drug abuse. ... Drug abuse-identity ... conforms to the same social, intellectual and cultural ... The brand names should also be chosen carefu11y. ... In this market the mass media offer the greatest coverage.
Skrobik, Yoanna; Leger, Caroline; Cossette, Mariève; Michaud, Veronique; Turgeon, Jacques
2013-04-01
Delirium and sedative-induced coma are described as incremental manifestations of cerebral dysfunction. Both may be associated with sedative or opiate doses and pharmacokinetic or pharmacogenetic variables, such as drug plasma levels (exposure), drug metabolism, and/or their transport across the blood-brain barrier. To compare biological and drug treatment characteristics in patients with coma and/or delirium while in the ICU. In 99 patients receiving IV fentanyl, midazolam, or both, we evaluated drug doses, covariates likely to influence drug effects (age, body mass index, and renal and hepatic dysfunction); delirium risk factors; concomitant administration of CYP3A and P-glycoprotein substrates/inhibitors; ABCB1, ABCG2, and CYP3A5 genetic polymorphisms; and fentanyl and midazolam plasma levels. Delirium and coma were evaluated daily. In patients with only coma (n=15), only delirium (n=7), and neither ever (n=14), we measured plasma levels of tumor necrosis factor-α, interleukin (IL)-1β, IL-1RA, IL-6, IL-8, IL-10, IL-17,macrophage inflammatory protein-1β, and monocyte chemotactic protein-1. Time to first coma was associated with fentanyl and midazolam doses (p=0.03 and p=0.01, respectively). The number of days in coma was associated with the number of days of coadministration of CYP3A inhibitors (r=0.30; p=0.006). Plasma levels of fentanyl were higher in patients with clinical coma (3.7±4.7 vs. 2.0±1.8 ng/mL, p=0.0001) as were midazolam plasma levels (1050±2232 vs. 168±249 ng/mL, p=0.0001). Delirium occurrence was unrelated to midazolam administration, cumulative doses, or serum levels. Days with delirium were associated with days of coadministration of P-glycoprotein inhibitor (r=0.35; p=0.0004). Delirious patients had higher levels of the inflammatory mediator IL-6 than comatose patients (129.3 vs. 35.0 pg/mL, p=0.05). Coma is associated with fentanyl and midazolam exposure; delirium is unrelated to midazolam and may be linked to inflammatory status
Chen, Piaojuan; Li, Yi; Zhao, Lihua; Hou, Zhimin; Yan, Maokai; Hu, Bingyan; Liu, Yanhui; Azam, Syed Muhammad; Zhang, Ziyan; Rahman, Zia Ur; Liu, Liping; Qin, Yuan
2017-01-01
Pineapple ( Ananas comosus L .) cultivation commonly relies on asexual reproduction which is easily impeded by many factors in agriculture production. Sexual reproduction might be a novel approach to improve the pineapple planting. However, genes controlling pineapple sexual reproduction are still remain elusive. In different organisms a conserved superfamily proteins known as ATP binding cassette (ABC) participate in various biological processes. Whereas, till today the ABC gene family has not been identified in pineapple. Here 100 ABC genes were identified in the pineapple genome and grouped into eight subfamilies (5 ABCAs , 20 ABCB s, 16 ABCCs , 2 ABCDs , one ABCEs , 5 ABCFs , 42 ABCGs and 9 ABCIs ). Gene expression profiling revealed the dynamic expression pattern of ABC gene family in various tissues and different developmental stages. AcABCA5, AcABCB6, AcABCC4 , AcABCC7 , AcABCC9 , AcABCG26 , AcABCG38 and AcABCG42 exhibited preferential expression in ovule and stamen. Over-expression of AcABCG38 in the Arabidopsis double mutant abcg1-2abcg16-2 partially restored its pollen abortion defects, indicating that AcABCG38 plays important roles in pollen development. Our study on ABC gene family in pineapple provides useful information for developing sexual pineapple plantation which could be utilized to improve pineapple agricultural production.
Carnosol promotes endothelial differentiation under H2O2-induced oxidative stress
Directory of Open Access Journals (Sweden)
Ou Shulin
2017-01-01
Full Text Available Oxidative stress causes deregulation of endothelial cell differentiation. Carnosol is a potent antioxidant and antiinflammatory compound. In the present study, we examined whether the antioxidant effect of carnosol might protect bone marrow stem cells against H2O2-induced oxidative stress and promote endothelial differentiation. We examined cell viability by the MTT assay; oxidative stress and apoptosis were analyzed through changes in ROS levels, apoptotic ratio and caspase-3 activity; changes in protein expression of OCT-4, Flk-1, CD31 and Nrf-2 were assessed by Western blot analysis. H2O2 treatment increased oxidative stress and reduced cell viability, while the stem cell marker OCT-4 and endothelial markers Flk-1, CD31 were significantly downregulated as a result of the treatment with H2O2. Treatment with carnosol improved the antioxidant status, increased OCT-4 expression and promoted endothelial differentiation. This study provides evidence that carnosol could increase the antioxidant defense mechanism and promote endothelial differentiation.
Directory of Open Access Journals (Sweden)
Pascaline Boudou-Rouquette
Full Text Available BACKGROUND: Identifying predictive biomarkers of drug response is of key importance to improve therapy management and drug selection in cancer therapy. To date, the influence of drug exposure and pharmacogenetic variants on sorafenib-induced toxicity remains poorly documented. The aim of this pharmacokinetic/pharmacodynamic (PK/PD study was to investigate the relationship between early toxicity and drug exposure or pharmacogenetic variants in unselected adult outpatients treated with single-agent sorafenib for advanced solid tumors. METHODS: Toxicity was recorded in 54 patients on days 15 and 30 after treatment initiation and sorafenib exposure was assessed in 51 patients. The influence of polymorphisms in CYP3A5, UGT1A9, ABCB1 and ABCG2 was examined in relation to sorafenib exposure and toxicity. Clinical characteristics, drug exposure and pharmacogenetic variants were tested univariately for association with toxicities. Candidate variables with p<0.1 were analyzed in a multivariate analysis. RESULTS: Gender was the sole parameter independently associated with sorafenib exposure (p = 0.0008. Multivariate analysis showed that increased cumulated sorafenib (AUC(cum was independently associated with any grade ≥ 3 toxicity (p = 0.037; UGT1A9 polymorphism (rs17868320 with grade ≥ 2 diarrhea (p = 0.015 and female gender with grade ≥ 2 hand-foot skin reaction (p = 0.018. Using ROC curve, the threshold AUC(cum value of 3,161 mg/L.h was associated with the highest risk to develop any grade ≥ 3 toxicity (p = 0.018. CONCLUSION: In this preliminary study, increased cumulated drug exposure and UGT1A9 polymorphism (rs17868320 identified patients at high risk for early sorafenib-induced severe toxicity. Further PK/PD studies on larger population are warranted to confirm these preliminary results.
Sesink, A.L.A.; Arts, I.C.W.; Boer, de V.C.J.; Breedveld, P.; Schellens, J.H.M.; Hollman, P.C.H.; Russel, F.G.M.
2005-01-01
The intestinal absorption of the flavonoid quercetin in rats is limited by the secretion of glucuronidated metabolites back into the gut lumen. The objective of this study was to determine the role of the intestinal efflux transporters breast cancer resistance protein (Bcrp1)/Abcg2 and multidrug
Sesink, A.L.; Arts, I.C.; Boer, V.C. de; Breedveld, P.; Schellens, J.H.; Hollman, P.C.H.; Russel, F.G.M.
2005-01-01
The intestinal absorption of the flavonoid quercetin in rats is limited by the secretion of glucuronidated metabolites back into the gut lumen. The objective of this study was to determine the role of the intestinal efflux transporters breast cancer resistance protein (Bcrp1)/Abcg2 and multidrug
Energy Technology Data Exchange (ETDEWEB)
Choy, B.B.K.
1991-01-01
Mammalian ribonucleotide reductase is a highly regulated, rate-limiting activity responsible for converting ribonucleoside diphosphates to the deoxyribonucleotide precursors of DNA. The enzyme consists of two nonidentical proteins called M1 and M2, both of which are required for activity. Hydroxyurea is an antitumor agent which inhibits ribonucleotide reductase by interacting with the M2 component specifically at a unique tyrosyl free radical. Studies were conducted on a series of drug resistant mouse cell lines, selected by a step-wise procedure for increasing levels of resistance to the cytotoxic effects of hydroxyurea. Each successive drug selection step leading to the isolation of highly resistant cells was accompanied by stable elevations in cellular resistance and ribonucleotide reductase activity. The drug resistant cell lines exhibited gene amplification of the M2 gene, elevated M2 mRNA, and M2 protein. In addition to M2 gene amplification, posttranscriptional modulation also occurred during the drug selection. Studies of the biosynthesis rates with exogenously added iron suggest a role for iron in regulating the level of M2 protein when cells are cultured in the presence of hydroxyurea. The hydroxyurea-inactivated ribonucleotide reductase protein M2 has a destabilized iron centre, which readily releases iron. Altered expression of ferritin appears to be required for the development of hydroxyurea resistance in nammalian cells. The results show an interesting relationship between the expressions of ribonucleotide reductase and ferritin. The phorbol ester tumor promoter, TPA, is also able to alter the expression of M2. TPA was able to induce M2 mRNA levels transiently up to 18-fold within 1/2 hour. This rapid and large elevation of ribonucleotide reductase suggests that the enzyme may play a role in tumor promotion. Studies of the M2 promoter region were undertaken to better understand the mechanism of TPA induction of M2.
Directory of Open Access Journals (Sweden)
Eadie Brennan D
2009-02-01
Full Text Available Abstract Background Cognitive deficits are a hallmark feature of both Down Syndrome (DS and Alzheimer's Disease (AD. Extra copies of the genes on chromosome 21 may also play an important role in the accelerated onset of AD in DS individuals. Growing evidence suggests an important function for cholesterol in the pathogenesis of AD, particularly in APP metabolism and production of Aβ peptides. The ATP-Binding Cassette-G1 (ABCG1 transporter is located on chromosome 21, and participates in the maintenance of tissue cholesterol homeostasis. Results To assess the role of ABCG1 in DS-related cognition, we evaluated the cognitive performance of mice selectively over-expressing the ABCG1 gene from its endogenous regulatory signals. Both wild-type and ABCG1 transgenic mice performed equivalently on several behavioral tests, including measures of anxiety, as well as on reference and working memory tasks. No deficits in hippocampal CA1 synaptic plasticity as determined with electrophysiological studies were apparent in mice over-expressing ABCG1. Conclusion These findings indicate that although ABCG1 may play a role in maintaining cellular or tissue cholesterol homeostasis, it is unlikely that excess ABCG1 expression contributes to the cognitive deficits in DS individuals.
Terbinafine-induced lichenoid drug eruption.
Zheng, Yue; Zhang, Jie; Chen, Haiyan; Lai, Wei; Maibach, Howard I
2017-03-01
Drug-induced lichen planus has been induced by antibiotics, anticonvulsants, antidiabetics, antimalarials, antitubercular drugs, antihypertensives, psychiatric drugs, chemotherapeutic agents, diuretic, heavy metals, NSAIDs, etc. Terbinafine, an antifungal agent, is widely used for dermatophyte infections and onychomycosis. Cutaneous adverse effects of terbinafine are rarely reported. Here, we report a case of terbinafine-induced lichenoid drug eruption in a 22-year-old who presented with generalized lichenoid eruption 2 weeks after terbinafine initiation of. The body and lip cleared completely after 8 weeks of drug withdrawal; nail change cleared after 12 weeks.
Jebbink, Jiska; Veenboer, Geertruda; Boussata, Souad; Keijser, Remco; Kremer, Andreas E.; Elferink, Ronald Oude; van der Post, Joris; Afink, Gijs; Ris-Stalpers, Carrie
2015-01-01
To investigate total bile acid (TBA) levels in maternal (MB) and umbilical cord blood (UCB) in normotensive, preeclamptic (PE), and PE pregnancies complicated by hemolysis elevated liver enzymes and low platelets (HELLP) syndrome in the context of ABCG2 placental gene expression levels, a recently
Genistein and Glyceollin Effects on ABCC2 (MRP2 and ABCG2 (BCRP in Caco-2 Cells
Directory of Open Access Journals (Sweden)
Chandler Schexnayder
2015-12-01
Full Text Available The goal of the present study was to determine the effects of glyceollins on intestinal ABCC2 (ATP Binding Cassette C2, multidrug resistance protein 2, MRP2 and ABCG2 (ATP Binding Cassette G2, breast cancer resistance protein, BCRP function using the Caco-2 cell intestinal epithelial cell model. Glyceollins are soy-derived phytoestrogens that demonstrate anti-proliferative activity in several sources of cancer cells. 5 (and 6-carboxy-2′,7′-dichloroflourescein (CDF was used as a prototypical MRP2 substrate; whereas BODIPY-prazosin provided an indication of BCRP function. Comparison studies were conducted with genistein. Glyceollins were shown to inhibit MRP2-mediated CDF transport, with activity similar to the MRP2 inhibitor, MK-571. They also demonstrated concentration-dependent inhibition BCRP-mediated efflux of BODIPY-prazosin, with a potency similar to that of the recognized BCRP inhibitor, Ko143. In contrast, genistein did not appear to alter MRP2 activity and even provided a modest increase in BCRP efflux of BODIPY-prazosin. In particular, glyceollin inhibition of these two important intestinal efflux transporters suggests the potential for glyceollin to alter the absorption of other phytochemicals with which it might be co-administered as a dietary supplement, as well as alteration of the absorption of pharmaceuticals that may be administered concomitantly.
Energy Technology Data Exchange (ETDEWEB)
Xue, Shanshan [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China); Department of Pediatrics, Baodi District People’s Hospital of Tianjin City, Tianjin, 301800 (China); Wang, Jiaxing [Department of Physiology and Pathophysiology, Peking University Health Science Center, Beijing, 100191 (China); Zhang, Xu; Shi, Ying; Li, Bochuan; Bao, Qiankun [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China); Pang, Wei [Department of Physiology and Pathophysiology, Peking University Health Science Center, Beijing, 100191 (China); Ai, Ding [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China); Zhu, Yi [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China); Department of Physiology and Pathophysiology, Peking University Health Science Center, Beijing, 100191 (China); He, Jinlong, E-mail: hejinlong@tmu.edu.cn [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China)
2016-08-19
Activated vascular endothelium inflammation under persistent hyperlipidemia is the initial step of atherogenesis. ATP-binding cassette G1 (ABCG1) is a crucial factor maintaining sterol and lipid homeostasis by transporting cholesterol efflux to high-density lipoprotein. In this study, we investigated the protective effects of ABCG1 in endothelial inflammation activation during early-stage atherogenesis in mice and the underlying mechanisms. Endothelial cell (EC)-specific ABCG1 transgenic (EC-ABCG1-Tg) mice were generated and cross-bred with low-density lipoprotein receptor–deficient (Ldlr{sup −/−}) mice. After a 4-week Western-type diet, the mice were sacrificed for assessing atherosclerosis. Human umbilical vein ECs were treated with different flows, and ABCG1 was adenovirally overexpressed to investigate the mechanism in vitro. Compared with Ldlr{sup −/−} mouse aortas, EC-ABCG1-Tg/Ldlr{sup −/−} aortas showed decreased early-stage lesions. Furthermore, the lesion area in the EC-ABCG1-Tg/Ldlr{sup −/−} mouse aortic arch but not thoracic aorta was significantly reduced, which suggests a protective role of ABCG1 under atheroprone flow. In vitro, overexpression of ABCG1 attenuated EC activation caused by oscillatory shear stress. Overexpression of ABCG1 blunted cholesterol-activated ECs in vitro. In exploring the mechanisms of ABCG1 attenuating endothelial inflammation, we found that ABCG1 inhibited oscillatory flow-activated nuclear factor kappa B and NLRP3 inflammasome in ECs. ABCG1 may play a protective role in early-stage atherosclerosis by reducing endothelial activation induced by oscillatory shear stress via suppressing the inflammatory response. - Highlights: • EC-ABCG1-Tg mice in a Ldlr{sup −/−} background showed decreased atherosclerosis. • Overexpression of ABCG1 in ECs decreased OSS-induced EC activation. • NLRP3 and NF-κB might be an underlying mechanism of ABCG1 protective role.
DEFF Research Database (Denmark)
Friis, Henrik; Andreasen, P B
1992-01-01
The Danish Committee on Adverse Drug Reactions received 1100 reports of suspected drug-induced hepatic injury during the decade 1978-1987. The causal relationship between drug and hepatic injury was classified as definite in 57 (5.2%) reports, probable in 989 (89.9%) reports, possible in 50 (4.......5%) reports and unclassifiable in four (0.4%) reports. Hepatic injuries accounted for 5.9% of all adverse drug reactions reported, and 14.7% of the lethal adverse drug reactions. A total of 47.2% were classified as acute cytotoxic, 16.2% as acute cholestatic and 26.9% as abnormal hepatic function. In 52 (4.......7%) cases the hepatic injury was lethal; only 14 (1.3%) cases were chronic. Halothane accounted for 25% of the cases. The incidence of halothane-induced hepatic injury is decreasing, and only one lethal case has been reported since 1981. Next to halothane, sulfasalazine was the drug most often suspected...
Kuromori, Takashi; Fujita, Miki; Urano, Kaoru; Tanabata, Takanari; Sugimoto, Eriko; Shinozaki, Kazuo
2016-10-01
In addition to improving drought tolerance, improvement of water use efficiency is a major challenge in plant physiology. Due to their trade-off relationships, it is generally considered that achieving stress tolerance is incompatible with maintaining stable growth. Abscisic acid (ABA) is a key phytohormone that regulates the balance between intrinsic growth and environmental responses. Previously, we identified AtABCG25 as a cell-membrane ABA transporter that export ABA from the inside to the outside of cells. AtABCG25-overexpressing plants showed a lower transpiration phenotype without any growth retardation. Here, we dissected this useful trait using precise phenotyping approaches. AtABCG25 overexpression stimulated a local ABA response in guard cells. Furthermore, AtABCG25 overexpression enhanced drought tolerance, probably resulting from maintenance of water contents over the common threshold for survival after drought stress treatment. Finally, we observed enhanced water use efficiency by overexpression of AtABCG25, in addition to drought tolerance. These results were consistent with the function of AtABCG25 as an ABA efflux transporter. This unique trait may be generally useful for improving the water use efficiency and drought tolerance of plants. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Karthikeyan, Chandrabose; Lee, Crystal; Moore, Joshua; Mittal, Roopali; Suswam, Esther A; Abbott, Kodye L; Pondugula, Satyanarayana R; Manne, Upender; Narayanan, Narayanan K; Trivedi, Piyush; Tiwari, Amit K
2015-02-01
Naturally occurring condensed quinolines have anticancer properties. In efforts to find active analogues, we designed and synthesized eight polycyclic heterocycles with a pyrimido[1″,2″:1,5]pyrazolo[3,4-b]quinoline framework (IND series). The compounds were evaluated for activity against colon (HCT-116 and S1-MI-80), prostate (PC3 and DU-145), breast (MCF-7 and MDAMB-231), ovarian (ov2008 and A2780), and hepatocellular (HepG2) cancer cells and against non-cancerous Madin Darby canine kidney (MDCK), mouse embryonic fibroblast (NIH/3T3), and human embryonic kidney cells (HEK293). IND-2, a 4-chloro-2-methyl pyrimido[1″,2″:1,5]pyrazolo[3,4-b]quinoline, exhibited more than ten-fold selectivity and potent cytotoxic activity against colon cancer cells relative to the other cancer and non-cancer cells. With five additional colon cancer cell lines (HT-29, HCT-15, LS-180, LS-174, and LoVo), IND-2 had similar cytotoxicity and selectivity, and sub-micromolar concentrations caused changes in the morphology of HCT-116 and HCT-15 cells. IND-2 did not activate the transactivating function of the pregnane X receptor (PXR), indicating that it does not induce PXR-regulated ABCB1 or ABCG2 transporters. Indeed, IND-2 was not a substrate of ABCB1 or ABCG2, and it induced cytotoxicity in HEK293 cells overexpressing ABCB1 or ABCG2 to the same extent as in normal HEK293 cells. IND-2 was cytotoxic to resistant colon carcinoma S1-MI-80 cells, approximately three- and five-fold more than SN-38 and topotecan, respectively. In HCT-116 colon cancer cells, IND-2 produced concentration-dependent changes in mitochondrial membrane potential, leading to apoptosis, and sub-micromolar concentrations caused chromosomal DNA fragmentation. These findings suggest that, by increasing apoptosis, IND-2 has potential therapeutic efficacy for colorectal cancer. Copyright © 2014 Elsevier Ltd. All rights reserved.
21 CFR 312.7 - Promotion of investigational drugs.
2010-04-01
... 21 Food and Drugs 5 2010-04-01 2010-04-01 false Promotion of investigational drugs. 312.7 Section 312.7 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS FOR HUMAN USE INVESTIGATIONAL NEW DRUG APPLICATION General Provisions § 312.7 Promotion of...
Lemmen, Julia; Tozakidis, Iasson E P; Bele, Prachee; Galla, Hans-Joachim
2013-03-21
ATP-driven efflux transporters are considered to be the major hurdle in the treatment of central nervous system (CNS) diseases. Abcb1 (P-glycoprotein) and Abcg2 (breast cancer resistance protein/brain multidrug resistance protein) belong to the best known ABC-transporters. These ABC-transporters limit the permeability of the blood-brain barrier and protect the brain against toxic compounds in the blood but on the other hand they also reduce the efficacy of CNS pharmacotherapy. Even after 40 years of extensive research, the regulatory mechanisms of these efflux transporters are still not completely understood. To unravel the efflux transporter regulation, we analyzed the effect of the nuclear receptor CAR (constitutive androstane receptor) on the expression of Abcb1 and Abcg2 in primary cultures of porcine brain capillary endothelial cells (PBCEC). CAR is a xenobiotic-activated transcription factor, which is, like the other important nuclear receptor pregnane X receptor (PXR), highly expressed in barrier tissue and known to be a positive regulator of ABC-transporters. We demonstrate that activation of porcine CAR by the human CAR (hCAR) ligand CITCO (6-(4-chlorophenyl)-imidazo[2,1-b]thiazole-5-carbaldehyde) leads to an up-regulation of both transporters, whereas the mouse-specific CAR ligand TCPOBOP (1,4-bis-[2-(3,5-dichloropyridyloxy)]benzene) had no effect on transporter expression. The stimulation of PBCEC with CITCO caused a significant up-regulation of both efflux-transporters on RNA-level, protein level and transport level. Furthermore the additional application of a CAR inhibitor significantly decreased the transporter expression to control niveau. In conclusion our data prove CAR activation only by the human ligand CITCO leading to an increased ABC-transporter expression and transport activity. Copyright © 2013 Elsevier B.V. All rights reserved.
[Drug-induced oral ulcerations].
Madinier, I; Berry, N; Chichmanian, R M
2000-06-01
Different side effects of drugs have been described in the oral cavity, including oral ulcerations. Direct contact between drugs and oral mucosa may induce chemical burn or local hypersensitivity. Less frequently, these drug-induced oral ulcerations are part of a complex reaction with cutaneous or systemic manifestations. Sometimes, one or more oral ulcerations appear as the main side-effect of a drug, or exceptionally as solitary lesions. Solitary oral ulcerations usually appear after few weeks of treatment. In most of cases, these lesions resist to conventional treatments, with a rapid healing following the suppression of the responsible drug. This diagnosis is usually difficult, particularly with patients receiving multiple drug therapy. Besides, special attention must be paid to new drugs. Oral ulcerations following symptoms of burning mouth, metallic taste, dysgueusia or agueusia are strongly suggestive of a pharmacological origin. Most of the molecules able to induce solitary oral ulcerations are commonly prescribed in a) rheumatology: NSAI (diclofenac, flurbiprofen, indomethacin, naproxen), long-term rheumatoid arthritis therapy (azathioprine, methotrexate, penicillamine, gold compounds, tiopronin); b) cardiology: angiotensin-converting-enzyme inhibitors (captopril, enalapril), angiotensin 2-receptor antagonist (losartan), anti-angorous (nicorandil), c) psychiatry: antidepressants (fluoxetine, lithium), d) AIDS therapy (foscarnet, zalcitabine).
Directory of Open Access Journals (Sweden)
Zahra Tavoosi
2015-01-01
Full Text Available ABCA1 and ABCG1 genes encode the cholesterol transporter proteins that play a key role in cholesterol and phospholipids homeostasis. This study was aimed at evaluating and comparing ABCA1 and ABCG1 genes expression in metabolic syndrome patients and healthy individuals. This case-control study was performed on 36 patients with metabolic syndrome and the same number of healthy individuals in Hamadan (west of Iran during 2013-2014. Total RNA was extracted from mononuclear cells and purified using RNeasy Mini Kit column. The expression of ABCA1 and ABCG1 genes was performed by qRT-PCR. Lipid profile and fasting blood glucose were measured using colorimetric procedures. ABCG1 expression in metabolic syndrome patients was significantly lower (about 75% compared to that of control group, while for ABCA1 expression, there was no significant difference between the two studied groups. Comparison of other parameters such as HDL-C, FBS, BMI, waist circumference, and systolic and diastolic blood pressure between metabolic syndrome patients and healthy individuals showed significant differences (P<0.05. Decrease in ABCG1 expression in metabolic syndrome patients compared to healthy individuals suggests that hyperglycemia, related metabolites, and hyperlipidemia over the transporter capacity resulted in decreased expression of ABCG1. Absence of a significant change in ABCA1 gene expression between two groups can indicate a different regulation mechanism for ABCA1 expression.
Mechanical Stress Promotes Cisplatin-Induced Hepatocellular Carcinoma Cell Death
Riad, Sandra; Bougherara, Habiba
2015-01-01
Cisplatin (CisPt) is a commonly used platinum-based chemotherapeutic agent. Its efficacy is limited due to drug resistance and multiple side effects, thereby warranting a new approach to improving the pharmacological effect of CisPt. A newly developed mathematical hypothesis suggested that mechanical loading, when coupled with a chemotherapeutic drug such as CisPt and immune cells, would boost tumor cell death. The current study investigated the aforementioned mathematical hypothesis by exposing human hepatocellular liver carcinoma (HepG2) cells to CisPt, peripheral blood mononuclear cells, and mechanical stress individually and in combination. HepG2 cells were also treated with a mixture of CisPt and carnosine with and without mechanical stress to examine one possible mechanism employed by mechanical stress to enhance CisPt effects. Carnosine is a dipeptide that reportedly sequesters platinum-based drugs away from their pharmacological target-site. Mechanical stress was achieved using an orbital shaker that produced 300 rpm with a horizontal circular motion. Our results demonstrated that mechanical stress promoted CisPt-induced death of HepG2 cells (~35% more cell death). Moreover, results showed that CisPt-induced death was compromised when CisPt was left to mix with carnosine 24 hours preceding treatment. Mechanical stress, however, ameliorated cell death (20% more cell death). PMID:25685789
Mechanical Stress Promotes Cisplatin-Induced Hepatocellular Carcinoma Cell Death
Directory of Open Access Journals (Sweden)
Laila Ziko
2015-01-01
Full Text Available Cisplatin (CisPt is a commonly used platinum-based chemotherapeutic agent. Its efficacy is limited due to drug resistance and multiple side effects, thereby warranting a new approach to improving the pharmacological effect of CisPt. A newly developed mathematical hypothesis suggested that mechanical loading, when coupled with a chemotherapeutic drug such as CisPt and immune cells, would boost tumor cell death. The current study investigated the aforementioned mathematical hypothesis by exposing human hepatocellular liver carcinoma (HepG2 cells to CisPt, peripheral blood mononuclear cells, and mechanical stress individually and in combination. HepG2 cells were also treated with a mixture of CisPt and carnosine with and without mechanical stress to examine one possible mechanism employed by mechanical stress to enhance CisPt effects. Carnosine is a dipeptide that reportedly sequesters platinum-based drugs away from their pharmacological target-site. Mechanical stress was achieved using an orbital shaker that produced 300 rpm with a horizontal circular motion. Our results demonstrated that mechanical stress promoted CisPt-induced death of HepG2 cells (~35% more cell death. Moreover, results showed that CisPt-induced death was compromised when CisPt was left to mix with carnosine 24 hours preceding treatment. Mechanical stress, however, ameliorated cell death (20% more cell death.
Molecular Genetics of Drug-resistance in Epilepsies
Directory of Open Access Journals (Sweden)
Kurupath Radhakrishnan
2015-06-01
Full Text Available Nearly one-third of newly diagnosed patients with epilepsy remain unresponsive to antiepileptic drugs (AEDs, etiopathogenesis of which is poorly understood. The genes encoding the proteins that regulate the pharmacokinetics such as P-glycoprotein [ABCBI], major vault protein [MVP gene] and drug metabolizing enzymes [ABCB1, ABCG2, MVP, CYP2C9, CYP2C19, CYP3A4, CYP3A5, EPHX1, UGT1A1, UGT2B7], and pharmacodynamics such as sodium channels [SCN1A, SCN2A] and GABA receptors [GABRA1, GABRA6, GABRB2, GABRG2] of AEDs are under intense investigation to unravel the mysteries of AED-resistance. However, till today, a consistent and reliable result that could help the clinician either to predict drug resistance or to overcome it has not been forthcoming. The discrepant results may be related to variations in the definition of drug-resistance, heterogeneous patient populations, ethnic variations in the frequency distribution of single nucleotide polymorphisms (SNPs and the selection of SNPs. Understanding of these limitations of existing studies, hopefully, will help in designing better studies. Nearly one-third of newly diagnosed patients with epilepsy remain unresponsive toantiepileptic drugs (AEDs, etiopathogenesis of which is poorly understood. The genesencoding the proteins that regulate the pharmacokinetics such as P-glycoprotein[ABCBI], major vault protein [MVP gene] and drug metabolizing enzymes [ABCB1,ABCG2, MVP, CYP2C9, CYP2C19, CYP3A4, CYP3A5, EPHX1, UGT1A1, UGT2B7],and pharmacodynamics such as sodium channels [SCN1A, SCN2A] and GABAreceptors [GABRA1, GABRA6, GABRB2, GABRG2] of AEDs are under intenseinvestigation to unravel the mysteries of AED-resistance. However, till today, aconsistent and reliable result that could help the clinician either to predict drugresistanceor to overcome it has not been forthcoming. The discrepant results may berelated to variations in the definition of drug-resistance, heterogeneous patientpopulations, ethnic
Xu, Xiaolin; Li, Qian; Pang, Liewen; Huang, Guoqian; Huang, Jiechun; Shi, Meng; Sun, Xiaotian; Wang, Yiqing
2013-11-15
Cholesterol efflux from macrophages is a critical mechanism to prevent the development of atherosclerosis. Here, we sought to investigate the effects of arctigenin, a bioactive component of Arctium lappa, on the cholesterol efflux in oxidized low-density lipoprotein (oxLDL)-loaded THP-1 macrophages. Our data showed that arctigenin significantly accelerated apolipoprotein A-I- and high-density lipoprotein-induced cholesterol efflux in both dose- and time-dependent manners. Moreover, arctigenin treatment enhanced the expression of ATP binding cassette transporter A1 (ABCA1), ABCG1, and apoE, all of which are key molecules in the initial step of cholesterol efflux, at both mRNA and protein levels. Arctigenin also caused a concentration-dependent elevation in the expression of peroxisome proliferator-activated receptor-gamma (PPAR-γ) and liver X receptor-alpha (LXR-α). The arctigenin-mediated induction of ABCA1, ABCG1, and apoE was abolished by specific inhibition of PPAR-γ or LXR-α using small interfering RNA technology. Our results collectively indicate that arctigenin promotes cholesterol efflux in oxLDL-loaded THP-1 macrophages through upregulation of ABCA1, ABCG1 and apoE, which is dependent on the enhanced expression of PPAR-γ and LXR-α. Copyright © 2013 Elsevier Inc. All rights reserved.
Idiosyncratic Drug-Induced Liver Injury: Is Drug-Cytokine Interaction the Linchpin?
Roth, Robert A; Maiuri, Ashley R; Ganey, Patricia E
2017-02-01
Idiosyncratic drug-induced liver injury continues to be a human health problem in part because drugs that cause these reactions are not identified in current preclinical testing and because progress in prevention is hampered by incomplete knowledge of mechanisms that underlie these adverse responses. Several hypotheses involving adaptive immune responses, inflammatory stress, inability to adapt to stress, and multiple, concurrent factors have been proposed. Yet much remains unknown about how drugs interact with the liver to effect death of hepatocytes. Evidence supporting hypotheses implicating adaptive or innate immune responses in afflicted patients has begun to emerge and is bolstered by results obtained in experimental animal models and in vitro systems. A commonality in adaptive and innate immunity is the production of cytokines, including interferon-γ (IFNγ). IFNγ initiates cell signaling pathways that culminate in cell death or inhibition of proliferative repair. Tumor necrosis factor-α, another cytokine prominent in immune responses, can also promote cell death. Furthermore, tumor necrosis factor-α interacts with IFNγ, leading to enhanced cellular responses to each cytokine. In this short review, we propose that the interaction of drugs with these cytokines contributes to idiosyncratic drug-induced liver injury, and mechanisms by which this could occur are discussed. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.
Porous Polymer Drug-Eluting Coating Prepared by Radiation Induced Polymerization
Energy Technology Data Exchange (ETDEWEB)
Veres, M.; Tóth, S.; Koós, M. [Research Institute for Solid State Physics and Optics, Budapest (Hungary); Beiler, B. [Institute of Isotopes, HAS, Budapest (Hungary)
2009-07-01
Drug-eluting stents have several advantages over bare metal implants. They eliminate restenosis, the main drawback of bare metal stents. In addition the locally delivered drug is more effective and causes less side-effects. However in some cases dangerous stent thrombosis, inflammatory and allergy reactions were observed after their implantation, which first of all related to the drug-eluting coating. This project is aimed to develop a novel biocompatible nanoporous polymer layer by radiation induced polymerization that is capable of holding and eluting drugs and promotes endothelization after the release of the drug. (author)
Porous Polymer Drug-Eluting Coating Prepared by Radiation Induced Polymerization
International Nuclear Information System (INIS)
Veres, M.; Tóth, S.; Koós, M.; Beiler, B.
2009-01-01
Drug-eluting stents have several advantages over bare metal implants. They eliminate restenosis, the main drawback of bare metal stents. In addition the locally delivered drug is more effective and causes less side-effects. However in some cases dangerous stent thrombosis, inflammatory and allergy reactions were observed after their implantation, which first of all related to the drug-eluting coating. This project is aimed to develop a novel biocompatible nanoporous polymer layer by radiation induced polymerization that is capable of holding and eluting drugs and promotes endothelization after the release of the drug. (author)
Morard, Isabelle; Hadengue, Antoine
2008-09-03
Diarrhea is a frequent adverse event involving the most frequently antibiotics, laxatives and NSAI. Drug induced diarrhea may be acute or chronic. It may be due to expected, dose dependant properties of the drug, to immuno-allergic or bio-genomic mechanisms. Several pathophysiological mechanisms have been described resulting in osmotic, secretory or inflammatory diarrhea, shortened transit time, or malabsorption. Histopathological lesions sometimes associated with drug induced diarrhea are usually non specific and include ulcerations, inflammatory or ischemic lesions, fibrous diaphragms, microscopic colitis and apoptosis. The diagnosis of drug induced diarrhea, sometimes difficult to assess, relies on the absence of other obvious causes and on the rapid disappearance of the symptoms after withdrawal of the suspected drug.
PTTG1 attenuates drug-induced cellular senescence.
Directory of Open Access Journals (Sweden)
Yunguang Tong
Full Text Available As PTTG1 (pituitary tumor transforming gene abundance correlates with adverse outcomes in cancer treatment, we determined mechanisms underlying this observation by assessing the role of PTTG1 in regulating cell response to anti-neoplastic drugs. HCT116 cells devoid of PTTG1 (PTTG1(-/- exhibited enhanced drug sensitivity as assessed by measuring BrdU incorporation in vitro. Apoptosis, mitosis catastrophe or DNA damage were not detected, but features of senescence were observed using low doses of doxorubicin and TSA. The number of drug-induced PTTG1(-/- senescent cells increased ∼4 fold as compared to WT PTTG1-replete cells (p<0.001. p21, an important regulator of cell senescence, was induced ∼3 fold in HCT116 PTTG1(-/- cells upon doxorubicin or Trichostatin A treatment. Binding of Sp1, p53 and p300 to the p21 promoter was enhanced in PTTG1(-/- cells after treatment, suggesting transcriptional regulation of p21. p21 knock down abrogated the observed senescent effects of these drugs, indicating that PTTG1 likely suppresses p21 to regulate drug-induced senescence. PTTG1 also regulated SW620 colon cancer cells response to doxorubicin and TSA mediated by p21. Subcutaneously xenografted PTTG1(-/- HCT116 cells developed smaller tumors and exhibited enhanced responses to doxorubicin. PTTG1(-/- tumor tissue derived from excised tumors exhibited increased doxorubicin-induced senescence. As senescence is a determinant of cell responses to anti-neoplastic treatments, these findings suggest PTTG1 as a tumor cell marker to predict anti-neoplastic treatment outcomes.
Directory of Open Access Journals (Sweden)
Kristi M Porter
Full Text Available Pulmonary Hypertension (PH is a progressive disorder characterized by endothelial dysfunction and proliferation. Hypoxia induces PH by increasing vascular remodeling. A potential mediator in hypoxia-induced PH development is arachidonate 5-Lipoxygenase (ALOX5. While ALOX5 metabolites have been shown to promote pulmonary vasoconstriction and endothelial cell proliferation, the contribution of ALOX5 to hypoxia-induced proliferation remains unknown. We hypothesize that hypoxia exposure stimulates HPAEC proliferation by increasing ALOX5 expression and activity. To test this, human pulmonary artery endothelial cells (HPAEC were cultured under normoxic (21% O2 or hypoxic (1% O2 conditions for 24-, 48-, or 72 hours. In a subset of cells, the ALOX5 inhibitor, zileuton, or the 5-lipoxygenase activating protein inhibitor, MK-886, was administered during hypoxia exposure. ALOX5 expression was measured by qRT-PCR and western blot and HPAEC proliferation was assessed. Our results demonstrate that 24 and 48 hours of hypoxia exposure have no effect on HPAEC proliferation or ALOX5 expression. Seventy two hours of hypoxia significantly increases HPAEC ALOX5 expression, hydrogen peroxide (H2O2 release, and HPAEC proliferation. We also demonstrate that targeted ALOX5 gene silencing or inhibition of the ALOX5 pathway by pharmacological blockade attenuates hypoxia-induced HPAEC proliferation. Furthermore, our findings indicate that hypoxia-induced increases in cell proliferation and ALOX5 expression are dependent on H2O2 production, as administration of the antioxidant PEG-catalase blocks these effects and addition of H2O2 to HPAEC promotes proliferation. Overall, these studies indicate that hypoxia exposure induces HPAEC proliferation by activating the ALOX5 pathway via the generation of H2O2.
DEFF Research Database (Denmark)
Pedersen-Bjergaard, U; Andersen, M; Hansen, P B
1997-01-01
induced by non-cytotoxic drugs is characterised by heterogeneous clinical picture and recovery is generally rapid. Although corticosteroids seem inefficient, we still recommend that severe symptomatic cases of drug-induced thrombocytopenia are treated as idiopathic thrombocytopenic purpura due...
Directory of Open Access Journals (Sweden)
Su-Feng Chen
Full Text Available BACKGROUND: Treatment failure in oral squamous cell carcinoma (OSCC leading to local recurrence(s and metastases is mainly due to drug resistance. Cancer stem cells (CSCs are thought be responsible for the development of drug resistance. However, the correlations between CSCs, drug resistance, and new strategy against drug resistance in OSCC remain elusive. METHODS: A drug-resistant sphere (DRSP model was generated by using a nonadhesive culture system to induce drug-resistant cells from SCC25 oral cancer cells. A comparative analysis was performed between the parent control cells and DRSPs with a related treatment strategy focusing on the expression of epithelial-mesenchymal transition (EMT-associated markers, drug-resistance-related genes, and CSC properties in vitro, as well as tumorigenicity and the regimen for tumor regression in vivo. RESULTS: Our data show the presence of a phenomenon of EMT with gradual cellular transition from an epithelioid to mesenchymal-like spheroid morphology during induction of drug resistance. The characterization of DRSPs revealed the upregulation of the drug-resistance-related genes ABCG2 and MDR-1 and of CSC-representative markers, suggesting that DRSPs have greater resistance to cisplatin (Cis and stronger CSC properties compared with the control. Moreover, overexpression of phosphorylated heat-shock protein 27 (p-Hsp27 via the activation of p38 MAPK signaling was observed in DRSPs. Knockdown of Hsp27 decreased Cis resistance and induced apoptosis in DRSPs. Furthermore, an inhibitor of Hsp27, quercetin (Qu, suppressed p-Hsp27 expression, with alterations of the EMT signature, leading to the promotion of apoptosis in DRSPs. A xenographic study also confirmed the increase of tumorigenicity in DRSPs. The combination of Qu and Cis can reduce tumor growth and decrease drug resistance in OSCC. CONCLUSIONS: The p38 MAPK-Hsp27 axis plays an important role in CSCs-mediated drug resistance in OSCC. Targeting this axis
Future Challenges and Opportunities in Online Prescription Drug Promotion Research
Southwell, Brian G.; Rupert, Douglas J.
2016-01-01
Despite increased availability of online promotional tools for prescription drug marketers, evidence on online prescription drug promotion is far from settled or conclusive. We highlight ways in which online prescription drug promotion is similar to conventional broadcast and print advertising and ways in which it differs. We also highlight five key areas for future research: branded drug website influence on consumer knowledge and behavior, interactive features on branded drug websites, mobile viewing of branded websites and mobile advertisements, online promotion and non-US audiences, and social media and medication decisions. PMID:26927597
ΔNp63α induces the expression of FAT2 and Slug to promote tumor invasion
Dang, Tuyen T.; Westcott, Jill M.; Maine, Erin A.; Kanchwala, Mohammed; Xing, Chao; Pearson, Gray W.
2016-01-01
Tumor invasion can be induced by changes in gene expression that alter cell phenotype. The transcription factor ΔNp63α promotes basal-like breast cancer (BLBC) migration by inducing the expression of the mesenchymal genes Slug and Axl, which confers cells with a hybrid epithelial/mesenchymal state. However, the extent of the ΔNp63α regulated genes that support invasive behavior is not known. Here, using gene expression analysis, ChIP-seq, and functional testing, we find that ΔNp63α promotes BLBC motility by inducing the expression of the atypical cadherin FAT2, the vesicular binding protein SNCA, the carbonic anhydrase CA12, the lipid binding protein CPNE8 and the kinase NEK1, along with Slug and Axl. Notably, lung squamous cell carcinoma migration also required ΔNp63α dependent FAT2 and Slug expression, demonstrating that ΔNp63α promotes migration in multiple tumor types by inducing mesenchymal and non-mesenchymal genes. ΔNp63α activation of FAT2 and Slug influenced E-cadherin localization to cell-cell contacts, which can restrict spontaneous cell movement. Moreover, live-imaging of spheroids in organotypic culture demonstrated that ΔNp63α, FAT2 and Slug were essential for the extension of cellular protrusions that initiate collective invasion. Importantly, ΔNp63α is co-expressed with FAT2 and Slug in patient tumors and the elevated expression of ΔNp63α, FAT2 and Slug correlated with poor patient outcome. Together, these results reveal how ΔNp63α promotes cell migration by directly inducing the expression of a cohort of genes with distinct cellular functions and suggest that FAT2 is a new regulator of collective invasion that may influence patient outcome. PMID:27081041
Data-driven prediction of adverse drug reactions induced by drug-drug interactions.
Liu, Ruifeng; AbdulHameed, Mohamed Diwan M; Kumar, Kamal; Yu, Xueping; Wallqvist, Anders; Reifman, Jaques
2017-06-08
The expanded use of multiple drugs has increased the occurrence of adverse drug reactions (ADRs) induced by drug-drug interactions (DDIs). However, such reactions are typically not observed in clinical drug-development studies because most of them focus on single-drug therapies. ADR reporting systems collect information on adverse health effects caused by both single drugs and DDIs. A major challenge is to unambiguously identify the effects caused by DDIs and to attribute them to specific drug interactions. A computational method that provides prospective predictions of potential DDI-induced ADRs will help to identify and mitigate these adverse health effects. We hypothesize that drug-protein interactions can be used as independent variables in predicting ADRs. We constructed drug pair-protein interaction profiles for ~800 drugs using drug-protein interaction information in the public domain. We then constructed statistical models to score drug pairs for their potential to induce ADRs based on drug pair-protein interaction profiles. We used extensive clinical database information to construct categorical prediction models for drug pairs that are likely to induce ADRs via synergistic DDIs and showed that model performance deteriorated only slightly, with a moderate amount of false positives and false negatives in the training samples, as evaluated by our cross-validation analysis. The cross validation calculations showed an average prediction accuracy of 89% across 1,096 ADR models that captured the deleterious effects of synergistic DDIs. Because the models rely on drug-protein interactions, we made predictions for pairwise combinations of 764 drugs that are currently on the market and for which drug-protein interaction information is available. These predictions are publicly accessible at http://avoid-db.bhsai.org . We used the predictive models to analyze broader aspects of DDI-induced ADRs, showing that ~10% of all combinations have the potential to induce ADRs
Prescription Drug Promotion from 2001-2014: Data from the U.S. Food and Drug Administration.
Directory of Open Access Journals (Sweden)
Helen W Sullivan
Full Text Available The volume of prescription drug promotion over time is often measured by assessing changes in ad spending. However, this method obscures the fact that some types of advertising are more expensive than others. Another way to measure the changes in prescription drug promotion over time is to assess the number of promotional pieces submitted to the U.S. Food and Drug Administration (FDA. Form FDA 2253 collects information such as the date submitted and the type of material submitted. We analyzed data from Forms FDA 2253 received from 2001-2014. We examined the frequency of submissions by audience (consumer and healthcare professional and type of promotional material. There was a noted increase in prescription drug promotion submissions across all media in the early 2000s. Although non-Internet promotion submissions have since plateaued, Internet promotion continued to increase. These results can help public health advocates and regulators focus attention and resources.
The role of the seven crude drug components in the sleep-promoting effect of Yokukansan.
Ogawa, Yuko; Fujii, Yuuko; Sugiyama, Reina; Konishi, Tenji
2016-01-11
Yokukansan is a traditional Japanese "Kampo" medicine derived from Yi-Gan San in traditional Chinese medicine. Many studies have been published on its effects and mechanisms. In this study, we focused on the sleep-promoting effects of Yokukansan. Yokukansan composes of seven crude drugs: Uncaria Hook, Bupleurm Root, Cnidium Rhizome, Japanese Angelica Root, Poria Sclerotium, Atractylodes Lancea Rhizome, and Glycyrrhiza. Although each has distinctive effects in isolation, they combine to work as a sleep aid in the Yokukansan formula. We examined the roles of the seven crude drug components in the sleep-promoting effect of Yokukansan. In this study, we used an easy in vivo assay method which we developed previously to screen sleeping substances using thermography. This assay method focuses on the decrease in skin temperature of mice during sleep inducement. By administering the crude drug components of Yokukansan one at a time, it was possible to separate them into two groups: those that caused a decrease in body temperature (Uncaria Hook, Bupleurm Root, Cnidium rhizome, and Japanese Angelica root) and those that did not (Poria Sclerotium, Atractylodes Lancea Rhizome, and Glycyrrhiza). Accordingly, it was thought that the crude drugs causing a drop in body temperature were responsible for promoting sleep, while those in the other group would have no such effect in isolation. To investigate whether the crude drugs that did not cause a decrease in body temperature might be unnecessary for the sleep-promoting effect of Yokukansan, a number of decoctions were prepared using only six of the seven crude drug components, excluding a different crude drug in each case. Results showed that when any of the three components (Poria Sclerotium, Atractylodes Lancea Rhizome, or Glycyrrhiza) of Yokukansan that had no effect on body temperature in isolation were removed from Yokukansan, the resulting extract no longer had any of Yokukansan's sleep-promoting effects. This result
Ryu, JiHyeon; Lee, HeeYoung; Suh, JinUk; Yang, MyungSuk; Kang, WonKu; Kim, EunYoung
2015-01-01
We analyzed differences between spontaneously reported drug-induced (not including contrast media) and contrast media-induced adverse reactions. Adverse drug reactions reported by an in-hospital pharmacovigilance center (St. Mary's teaching hospital, Daejeon, Korea) from 2010-2012 were classified as drug-induced or contrast media-induced. Clinical patterns, frequency, causality, severity, Schumock and Thornton's preventability, and type A/B reactions were recorded. The trends among causality tools measuring drug and contrast-induced adverse reactions were analyzed. Of 1,335 reports, 636 drug-induced and contrast media-induced adverse reactions were identified. The prevalence of spontaneously reported adverse drug reaction-related admissions revealed a suspected adverse drug reaction-reporting rate of 20.9/100,000 (inpatient, 0.021%) and 3.9/100,000 (outpatients, 0.004%). The most common adverse drug reaction-associated drug classes included nervous system agents and anti-infectives. Dermatological and gastrointestinal adverse drug reactions were most frequently and similarly reported between drug and contrast media-induced adverse reactions. Compared to contrast media-induced adverse reactions, drug-induced adverse reactions were milder, more likely to be preventable (9.8% vs. 1.1%, p contrast media-induced adverse reactions (56.6%, p = 0.066). Causality patterns differed between the two adverse reaction classes. The World Health Organization-Uppsala Monitoring Centre causality evaluation and Naranjo algorithm results significantly differed from those of the Korean algorithm version II (p contrast media-induced adverse reactions. The World Health Organization-Uppsala Monitoring Centre and Naranjo algorithm causality evaluation afforded similar results.
Glycolysis inhibition inactivates ABC transporters to restore drug sensitivity in malignant cells.
Directory of Open Access Journals (Sweden)
Ayako Nakano
Full Text Available Cancer cells eventually acquire drug resistance largely via the aberrant expression of ATP-binding cassette (ABC transporters, ATP-dependent efflux pumps. Because cancer cells produce ATP mostly through glycolysis, in the present study we explored the effects of inhibiting glycolysis on the ABC transporter function and drug sensitivity of malignant cells. Inhibition of glycolysis by 3-bromopyruvate (3BrPA suppressed ATP production in malignant cells, and restored the retention of daunorubicin or mitoxantrone in ABC transporter-expressing, RPMI8226 (ABCG2, KG-1 (ABCB1 and HepG2 cells (ABCB1 and ABCG2. Interestingly, although side population (SP cells isolated from RPMI8226 cells exhibited higher levels of glycolysis with an increased expression of genes involved in the glycolytic pathway, 3BrPA abolished Hoechst 33342 exclusion in SP cells. 3BrPA also disrupted clonogenic capacity in malignant cell lines including RPMI8226, KG-1, and HepG2. Furthermore, 3BrPA restored cytotoxic effects of daunorubicin and doxorubicin on KG-1 and RPMI8226 cells, and markedly suppressed subcutaneous tumor growth in combination with doxorubicin in RPMI8226-implanted mice. These results collectively suggest that the inhibition of glycolysis is able to overcome drug resistance in ABC transporter-expressing malignant cells through the inactivation of ABC transporters and impairment of SP cells with enhanced glycolysis as well as clonogenic cells.
Pharmacogenetics of drug-induced arrhythmias
DEFF Research Database (Denmark)
De Bruin, Marie L; van Puijenbroek, Eugene P; Bracke, Madelon
2006-01-01
PURPOSE: The bottleneck in pharmacogenetic research on rare adverse drug reactions (ADR) is retrieval of patients. Spontaneous reports of ADRs may form a useful source of patients. We investigated the feasibility of a pharmacogenetic study, in which cases were selected from the database...... of a spontaneous reporting system for ADRs, using drug-induced arrhythmias as an example. METHODS: Reports of drug-induced arrhythmias to proarrhythmic drugs were selected from the database of the Netherlands Pharmacovigilance Centre (1996-2003). Information on the patient's general practitioner (GP) was obtained...... be included in the study, giving an overall participation rate of 9% (4/45). The main reason for GPs not being willing to participate was lack of time. Variants were identified in KCNH2, SCN5A and KCNE1. CONCLUSIONS: Spontaneous reporting systems for ADRs may be used for pharmacogenetic research. The methods...
2016-05-01
Hair loss can have major psychological consequences. It can be due to a wide variety of causes, including hormonal disorders, dietary factors, infections, inflammation, trauma, emotional factors, and cancer. Drugs can also induce hair loss, by interacting with the hair growth cycle. Drug-induced hair loss may be immediate or delayed, sudden or gradual, and diffuse or localised. It is usually reversible after drug discontinuation. The drugs most often implicated in hair loss are anticancer agents, interferon, azole antifungals, lithium, immunosuppressants, and many other drugs belonging to a variety of pharmacological classes.
Boutroy, M J
1994-01-01
Drugs have been in the past and will in the future still be liable to induce apnea in neonates, infants and older children. At these different stages of development, the child may be abnormally vulnerable to respiratory disorders and apnea, and doses of drugs, without any abnormal side effects in adult patients, can be harmful in younger subjects. Drugs responsible for apnea during development are numerous, but more than half of the problems are induced by sedatives and hypnotics, among which phenothiazines, barbiturates, benzodiazepines (included transplacentally acquired) and general anesthetics are a few. Other pharmacological families are apnea inducers in the neonatal period and childhood: analgesics and opioid narcotics, agents acting at the levels of neuromuscular function and autonomic ganglia, and cardiovascular agents. The pathogenesis of these apneas depends on the disturbance of any mechanism responsible for the respiratory activity: medullary centers and brain stem structures, afferent influx to CNS, sleep stages, upper airways, lungs and respiratory muscles. At key stages such as birth and infancy, drugs may emphasize the particular sensitivity of the mechanisms responsible for inducing apnea. This might explain unexpected respiratory disorders during development.
Habibi, Roojin; Lexchin, Joel; Mintzes, Barbara; Holbrook, Anne
2017-11-01
This study compares physicians' recall of the claims of benefits on cardiovascular disease and diabetes made by pharmaceutical sales representatives for drugs approved on the basis of a surrogate outcome, i.e., an off-label claim, compared with those approved on the basis of a serious morbidity or mortality (clinical) outcome. Physicians in primary care practices in Montreal, Vancouver, Sacramento and Toulouse, who saw sales representatives as part of their usual practice and served a non-referral population, were contacted in blocks of 25 from a randomized list of all physicians practising in the relevant metropolitan area. We compared how frequently physicians reported that sales reps made claims of serious morbidity or mortality (clinically meaningful) benefits for drugs approved on the basis of surrogate outcomes vs. drugs approved on the basis of clinical outcomes. There were 448 promotions for 58 unique brand name cardiovascular and diabetes drugs. Claims of clinically meaningful benefit were reported in 156 (45%) of the 347 promotions for surrogate outcome drugs, constituting unwarranted efficacy claims, i.e., off-label promotion. Claims of clinical benefit were reported in 72 of the 101 promotions (71%) for drugs approved on the basis of clinical outcomes, adjusted OR = 0.3 (95% CI 0.2, 0.6), P sales visit promotions for drugs approved only on the basis of surrogate outcomes extended beyond the regulator-approved efficacy information for the product in almost half of promotions. Unapproved claims of drug efficacy constitute a form of off-label promotion and merit greater attention from regulators. © 2017 The British Pharmacological Society.
Directory of Open Access Journals (Sweden)
Surendra K Sharma
2016-01-01
Full Text Available Background & objectives: The N-acetyltransferase 2 (NAT2 gene encodes an enzyme which both activates and deactivates arylamine and other drugs and carcinogens. This study was aimed to investigate the role of NAT2 gene polymorphism in anti-tuberculosis drug-induced hepatotoxicity (DIH. Methods: In this prospective study, polymerase chain reaction-restriction fragment length polymorphism results for NAT2 gene were compared between 185 tuberculosis patients who did not develop DIH and 105 tuberculosis patients who developed DIH while on anti-tuberculosis drugs. Results: Frequency of slow-acetylator genotype was commonly encountered and was not significantly different between DIH (82.8% and non-DIH (77.2% patients. However, the genotypic distribution of variant NAT2FNx015/FNx017 amongst slow-acetylator genotypes was significantly higher in DIH (56% group as compared to non-DIH (39% group (odds ratio 2.02; P=0.006. Interpretation & conclusions: The present study demonstrated no association between NAT2 genotype and DIH in the north Indian patients with tuberculosis.
Scheen, André J
2014-04-01
Inhibitors of sodium-glucose cotransporters type 2 (SGLT2) reduce hyperglycaemia by decreasing renal glucose threshold and thereby increasing urinary glucose excretion. They are proposed as a novel approach for the management of type 2 diabetes mellitus. They have proven their efficacy in reducing glycated haemoglobin, without inducing hypoglycaemia, as monotherapy or in combination with various other glucose-lowering agents, with the add-on value of promoting some weight loss and lowering arterial blood pressure. As they may be used concomitantly with many other drugs, we review the potential drug-drug interactions (DDIs) regarding the three leaders in the class (dapagliglozin, canagliflozin and empagliflozin). Most of the available studies were performed in healthy volunteers and have assessed the pharmacokinetic interferences with a single administration of the SGLT2 inhibitor. The exposure [assessed by peak plasma concentrations (Cmax) and area under the concentration-time curve (AUC)] to each SGLT2 inhibitor tested was not significantly influenced by the concomitant administration of other glucose-lowering agents or cardiovascular agents commonly used in patients with type 2 diabetes. Reciprocally, these medications did not influence the pharmacokinetic parameters of dapagliflozin, canagliflozin or empagliflozin. Some modest changes were not considered as clinically relevant. However, drugs that could specifically interfere with the metabolic pathways of SGLT2 inhibitors [rifampicin, inhibitors or inducers of uridine diphosphate-glucuronosyltransferase (UGT)] may result in significant changes in the exposure of SGLT2 inhibitors, as shown for dapagliflozin and canagliflozin. Potential DDIs in patients with type 2 diabetes receiving chronic treatment with an SGLT2 inhibitor deserve further attention, especially in individuals treated with several medications or in more fragile patients with hepatic and/or renal impairment.
Szilagyi, John T; Vetrano, Anna M; Laskin, Jeffrey D; Aleksunes, Lauren M
2017-07-01
The breast cancer resistance protein (BCRP/ABCG2) is an efflux transporter in the placental barrier. By transporting chemicals from the fetal to the maternal circulation, BCRP limits fetal exposure to a range of drugs, toxicants, and endobiotics such as bile acids and hormones. The purpose of the present studies was to 1) determine whether BCRP localizes to highly-ordered, cholesterol-rich lipid raft microdomains in placenta microvillous membranes, and 2) determine the impact of cholesterol on BCRP-mediated placental transport in vitro. BCRP expression was analyzed in lipid rafts isolated from placentas from healthy, term pregnancies and BeWo trophoblasts by density gradient ultracentrifugation. BeWo cells were also tested for their ability to efflux BCRP substrates after treatment with the cholesterol sequestrant methyl-β-cyclodextrin (MβCD, 5 mM, 1 h) or the cholesterol synthesis inhibitor pravastatin (200 μM, 48 h). BCRP was found to co-localize with lipid raft proteins in detergent-resistant, lipid raft-containing fractions from placental microvillous membranes and BeWo cells. Treatment of BeWo cells with MβCD redistributed BCRP protein into higher density non-lipid raft fractions. Repletion of the cells with cholesterol restored BCRP localization to lipid raft-containing fractions. Treatment of BeWo cells with MβCD or pravastatin increased cellular retention of two BCRP substrates, the fluorescent dye Hoechst 33342 and the mycotoxin zearalenone. Repletion with cholesterol restored BCRP transporter activity. Taken together, these data demonstrate that cholesterol may play a critical role in the post-translational regulation of BCRP in placental lipid rafts. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ryan J Mailloux
2010-10-01
Full Text Available Uncoupling protein-2 (UCP2 is known to suppress mitochondrial reactive oxygen species (ROS production and is employed by drug-resistant cancer cells to mitigate oxidative stress. Using the drug-sensitive HL-60 cells and the drug-resistant MX2 subline as model systems, we show that genipin, a UCP2 inhibitor, sensitizes drug-resistant cells to cytotoxic agents. Increased MX2 cell death was observed upon co-treatment with genipin and different doses of menadione, doxorubicin, and epirubicin. DCFH-DA fluorimetry revealed that the increase in MX2 cell death was accompanied by enhanced cellular ROS levels. The drug-induced increase in ROS was linked to genipin-mediated inhibition of mitochondrial proton leak. State 4 and resting cellular respiratory rates were higher in the MX2 cells in comparison to the HL-60 cells, and the increased respiration was readily suppressed by genipin in the MX2 cells. UCP2 accounted for a remarkable 37% of the resting cellular oxygen consumption indicating that the MX2 cells are functionally reliant on this protein. Higher amounts of UCP2 protein were detected in the MX2 versus the HL-60 mitochondria. The observed effects of genipin were absent in the HL-60 cells pointing to the selectivity of this natural product for drug-resistant cells. The specificity of genipin for UCP2 was confirmed using CHO cells stably expressing UCP2 in which genipin induced an ∼22% decrease in state 4 respiration. These effects were absent in empty vector CHO cells expressing no UCP2. Thus, the chemical inhibition of UCP2 with genipin sensitizes multidrug-resistant cancer cells to cytotoxic agents.
Directory of Open Access Journals (Sweden)
Spurling Geoffrey K
2008-05-01
advertisements (2.7% promoted the assessment of cardiovascular risk. Conclusion Print advertisements for antihypertensive medications in Australia provide some, but not all, of the key messages required for guideline-concordant care. These results have implications for the regulation of drug advertising and the continuing education of doctors.
Montgomery, Brett D; Mansfield, Peter R; Spurling, Geoffrey K; Ward, Alison M
2008-05-20
Antihypertensive medications are widely prescribed by doctors and heavily promoted by the pharmaceutical industry. Despite strong evidence of the effectiveness and cost-effectiveness of thiazide diuretics, trends in both promotion and prescription of antihypertensive drugs favour newer, less cost-effective agents. Observational evidence shows correlations between exposure to pharmaceutical promotion and less ideal prescribing. Our study therefore aimed to determine whether print advertisements for antihypertensive medications promote quality prescribing in hypertension. We performed a cross-sectional study of 113 advertisements for antihypertensive drugs from 4 general practice-oriented Australian medical publications in 2004. Advertisements were evaluated using a quality checklist based on a review of hypertension management guidelines. Main outcome measures included: frequency with which antihypertensive classes were advertised, promotion of thiazide class drugs as first line agents, use of statistical claims in advertisements, mention of harms and prices in the advertisements, promotion of assessment and treatment of cardiovascular risk, promotion of lifestyle modification, and targeting of particular patient subgroups. Thiazides were the most frequently advertised drug class (48.7% of advertisements), but were largely promoted in combination preparations. The only thiazide advertised as a single agent was the most expensive, indapamide. No advertisement specifically promoted any thiazide as a better first-line drug. Statistics in the advertisements tended to be expressed in relative rather than absolute terms. Drug costs were often reported, but without cost comparisons between drugs. Adverse effects were usually reported but largely confined to the advertisements' small print. Other than mentioning drug interactions with alcohol and salt, no advertisements promoted lifestyle modification. Few advertisements (2.7%) promoted the assessment of cardiovascular risk
Findlay, S D
2001-01-01
Spending on outpatient prescription drugs in the US is accelerating rapidly. Although numerous factors are driving this trend, attention has recently focused on the role played by the marketing, promotion and advertising of pharmaceuticals, in particular direct-to-consumer (DTC) advertising. In 1997, the US Food and Drug Administration (FDA) issued a 'guidance' on such mass media promotion. The guidance altered existing FDA rules and effectively permitted pharmaceutical companies to promote prescription drugs on television and radio without giving detailed or even summary information on indications, efficacy or potential adverse effects. Since then, television commercials, in particular, and print advertisements in consumer magazines and newspapers have proliferated rapidly. Pharmaceutical companies spent $US1.8 billion on DTC advertising in 1999, a 40% increase over 1998. This spending in 1999 was heavily concentrated on about 50 drugs. Evidence is growing that DTC promotion of prescription drugs is: (i) alerting consumers to the existence of new drugs and the conditions they treat; (ii) increasing consumer demand for many drugs; (iii) contributing increasingly to the recent sharp increase in the number of prescriptions being dispensed; (iv) raising sales revenues; and, thus, (v) contributing to the higher pharmaceutical costs of health insurers, government and consumers. The public policy issues surrounding DTC advertisements centre on the following questions: (i) are the advertisements leading to the inappropriate clinical use of some drugs? (ii) are the advertisements inducing both consumers and physicians to choose more costly new brand-name drugs over less expensive, but equally effective, older brand or generic drugs? (iii) do television advertisements for prescription drugs contain a balanced amount of information on benefits versus potential adverse effects? and (iv) will the revenue benefits generated by DTC advertising cause pharmaceutical companies to
Cubeddu, Luigi X.
2016-01-01
Risk of severe and fatal ventricular arrhythmias, presenting as Torsade de Pointes (TdP), is increased in congenital and acquired forms of long QT syndromes (LQTS). Drug-induced inhibition of K+ currents, IKs, IKr, IK1, and/or Ito, delay repolarization, prolong QT, and increase the risk of TdP. Drug-induced interference with IKr is the most common cause of acquired LQTS/TdP. Multiple drugs bind to KNCH2-hERG-K+ channels affecting IKr, including antiarrythmics, antibiotics, antivirals, azole-antifungals, antimalarials, anticancer, antiemetics, prokinetics, antipsychotics, and antidepressants. Azithromycin has been recently added to this list. In addition to direct channel inhibition, some drugs interfere with the traffic of channels from the endoplasmic reticulum to the cell membrane, decreasing mature channel membrane density; e.g., pentamidine, geldalamicin, arsenic trioxide, digoxin, and probucol. Other drugs, such as ketoconazole, fluoxetine, norfluoxetine, citalopram, escitalopram, donepezil, tamoxifen, endoxifen, atazanavir, and roxitromycin, induce both direct channel inhibition and impaired channel trafficking. Although many drugs prolong the QT interval, TdP is a rare event. The following conditions increase the risk of drug-induced TdP: a) Disease states/electrolyte levels (heart failure, structural cardiac disease, bradycardia, hypokalemia); b) Pharmacogenomic variables (presence of congenital LQTS, subclinical ion-channel mutations, history of or having a relative with history of drug-induced long QT/TdP); c) Pharmacodynamic and kinetic factors (high doses, women, elderly, metabolism inhibitors, combining two or more QT prolonging drugs, drugs that prolong the QT and increase QT dispersion, and drugs with multiple actions on ion channels). Because most of these conditions are preventable, careful evaluation of risk factors and increased knowledge of drug use associated with repolarization abnormalities are strongly recommended. PMID:26926294
Li, Fa-gui; Chu, Yi; Meng, Dong-mei; Tong, Ya-wen
2011-12-01
To assess the association between a C421A single nucleotide polymorphism (SNP) in exon 5 of ATP-binding cassette, sub-family G (WHITE), member 2 (ABCG2) gene and susceptibility of primary gout in Han Chinese males. For 200 male patients with primary gout and 235 controls, the genotype of C421A locus was analyzed by PCR and direct sequencing. Blood glucose, uric acid, total cholesterol, triglycerides, creatinine and urea nitrogen was measured by an automatic biochemical analyzer. Compared with the controls, there was a higher frequency for AA genotype and A allele of the rs2231142 SNP in gout patients (22.5% vs. 8.5% by genotype; 44.9% vs. 32.3% by allele). The association with gout reached significance (chi-square =15.91, Pgout patients were significantly higher than those of controls (Pgout in Han Chinese males.
Mechanistic review of drug-induced steatohepatitis
International Nuclear Information System (INIS)
Schumacher, Justin D.; Guo, Grace L.
2015-01-01
Drug-induced steatohepatitis is a rare form of liver injury known to be caused by only a handful of compounds. These compounds stimulate the development of steatohepatitis through their toxicity to hepatocyte mitochondria; inhibition of beta-oxidation, mitochondrial respiration, and/or oxidative phosphorylation. Other mechanisms discussed include the disruption of phospholipid metabolism in lysosomes, prevention of lipid egress from hepatocytes, targeting mitochondrial DNA and topoisomerase, decreasing intestinal barrier function, activation of the adenosine pathway, increasing fatty acid synthesis, and sequestration of coenzyme A. It has been found that the majority of compounds that induce steatohepatitis have cationic amphiphilic structures; a lipophilic ring structure with a side chain containing a cationic secondary or tertiary amine. Within the last decade, the ability of many chemotherapeutics to cause steatohepatitis has become more evident coining the term chemotherapy-associated steatohepatitis (CASH). The mechanisms behind drug-induced steatohepatitis are discussed with a focus on cationic amphiphilic drugs and chemotherapeutic agents. - Highlights: • Reviewed the mechanisms underlying drug-induced steatohepatitis for many compounds • Mitochondrial dysfunction is critical in the development of drug-induced steatohepatitis. • Majority of drugs that induce steatohepatitis are cationic amphiphilic drugs. • Chemotherapeutics that induce CASH are cationic amphiphilic drugs. • Majority of drugs that induce steatohepatitis are carnitine palmitoyltransferase-I inhibitors.
Mechanistic review of drug-induced steatohepatitis
Energy Technology Data Exchange (ETDEWEB)
Schumacher, Justin D., E-mail: Justin.d.schumacher@rutgers.edu; Guo, Grace L.
2015-11-15
Drug-induced steatohepatitis is a rare form of liver injury known to be caused by only a handful of compounds. These compounds stimulate the development of steatohepatitis through their toxicity to hepatocyte mitochondria; inhibition of beta-oxidation, mitochondrial respiration, and/or oxidative phosphorylation. Other mechanisms discussed include the disruption of phospholipid metabolism in lysosomes, prevention of lipid egress from hepatocytes, targeting mitochondrial DNA and topoisomerase, decreasing intestinal barrier function, activation of the adenosine pathway, increasing fatty acid synthesis, and sequestration of coenzyme A. It has been found that the majority of compounds that induce steatohepatitis have cationic amphiphilic structures; a lipophilic ring structure with a side chain containing a cationic secondary or tertiary amine. Within the last decade, the ability of many chemotherapeutics to cause steatohepatitis has become more evident coining the term chemotherapy-associated steatohepatitis (CASH). The mechanisms behind drug-induced steatohepatitis are discussed with a focus on cationic amphiphilic drugs and chemotherapeutic agents. - Highlights: • Reviewed the mechanisms underlying drug-induced steatohepatitis for many compounds • Mitochondrial dysfunction is critical in the development of drug-induced steatohepatitis. • Majority of drugs that induce steatohepatitis are cationic amphiphilic drugs. • Chemotherapeutics that induce CASH are cationic amphiphilic drugs. • Majority of drugs that induce steatohepatitis are carnitine palmitoyltransferase-I inhibitors.
DEFF Research Database (Denmark)
von Kampen, Oliver; Buch, Stephan; Nothnagel, Michael
2013-01-01
The sterolin locus (ABCG5/ABCG8) confers susceptibility for cholesterol gallstone disease in humans. Both the responsible variant and the molecular mechanism causing an increased incidence of gallstones in these patients have as yet not been identified. Genetic mapping utilized patient samples from...... Germany (2,808 cases, 2,089 controls), Chile (680 cases, 442 controls), Denmark (366 cases, 766 controls), India (247 cases, 224 controls), and China (280 cases, 244 controls). Analysis of allelic imbalance in complementary DNA (cDNA) samples from human liver (n = 22) was performed using pyrosequencing....... Transiently transfected HEK293 cells were used for [(3) H]-cholesterol export assays, analysis of protein expression, and localization of allelic constructs. Through fine mapping in German and Chilean samples, an ∼250 kB disease-associated interval could be defined for this locus. Lack of allelic imbalance...
Directory of Open Access Journals (Sweden)
Xiao-Na Pan
Full Text Available Nowadays, drug resistance still represents a major obstacle to successful acute myeloid leukemia (AML treatment and the underlying mechanism is not fully elucidated. Here, we found that high expression of c-Myc was one of the cytogenetic characteristics in the drug-resistant leukemic cells. c-Myc over-expression in leukemic cells induced resistance to chemotherapeutic drugs, enhanced colony formation capacity and inhibited cell differentiation induced by all-trans retinoic acid (ATRA. Meanwhile, inhibition of c-Myc by shRNA or specific c-Myc inhibitor 10058-F4 rescued the sensitivity to cytotoxic drugs, restrained the colony formation ability and promoted differentiation. RT-PCR and western blotting analysis showed that down-regulation of C/EBPβ contributed to the poor differentiation state of leukemic cells induced by c-Myc over-expression. Importantly, over-expression of C/EBPβ could reverse c-Myc induced drug resistance. In primary AML cells, the c-Myc expression was negatively correlated with C/EBPβ. 10058-F4, displayed anti-proliferative activity and increased cellular differentiation with up-regulation of C/EBPβ in primary AML cells. Thus, our study indicated that c-Myc could be a novel target to overcome drug resistance, providing a new approach in AML therapy.
Buttari, Brigitta; Profumo, Elisabetta; Domenici, Giacomo; Tagliani, Angela; Ippoliti, Flora; Bonini, Sergio; Businaro, Rita; Elenkov, Ilia; Riganò, Rachele
2014-07-01
Neuropeptide Y (NPY), a major autonomic nervous system and stress mediator, is emerging as an important regulator of inflammation, implicated in autoimmunity, asthma, atherosclerosis, and cancer. Yet the role of NPY in regulating phenotype and functions of dendritic cells (DCs), the professional antigen-presenting cells, remains undefined. Here we investigated whether NPY could induce DCs to migrate, mature, and polarize naive T lymphocytes. We found that NPY induced a dose-dependent migration of human monocyte-derived immature DCs through the engagement of NPY Y1 receptor and the activation of ERK and p38 mitogen-activated protein kinases. NPY promoted DC adhesion to endothelial cells and transendothelial migration. It failed to induce phenotypic DC maturation, whereas it conferred a T helper 2 (Th2) polarizing profile to DCs through the up-regulation of interleukin (IL)-6 and IL-10 production. Thus, during an immune/inflammatory response NPY may exert proinflammatory effects through the recruitment of immature DCs, but it may exert antiinflammatory effects by promoting a Th2 polarization. Locally, at inflammatory sites, cell recruitment could be amplified in conditions of intense acute, chronic, or cold stress. Thus, altered or amplified signaling through the NPY-NPY-Y1 receptor-DC axis may have implications for the development of inflammatory conditions.-Buttari, B., Profumo, E., Domenici, G., Tagliani, A., Ippoliti, F., Bonini, S., Businaro, R., Elenkov, I., Riganò, R. Neuropeptide Y induces potent migration of human immature dendritic cells and promotes a Th2 polarization. © FASEB.
Directory of Open Access Journals (Sweden)
Guangmang Liu
2013-07-01
Full Text Available Leucine, a branched chain amino acid, is well known to stimulate protein synthesis in skeletal muscle. However, the role of leucine in myoblast proliferation remains unclear. In this study, we found that leucine could promote proliferation of C2C12 cells. Moreover, expressions of miR-27a and myostatin (a bona fide target of miR-27a were upregulated and downregulated, respectively, following leucine treatment. We also found that miR-27a loss-of-function by transfection of a miR-27a inhibitor suppressed the promotion of myoblast proliferation caused by leucine. Our results suggest that miR-27a is induced by leucine and contributes to leucine-induced proliferation promotion of myoblast.
Suzuki, Kazushi; Onishi, Takahito; Nakada, Chieko; Takei, Shunsuke; Daniels, Matthew J; Nakano, Masahiro; Matsuda, Tomoki; Nagai, Takeharu
2018-05-18
Cardiomyocytes derived from human-induced pluripotent stem cells are a powerful platform for high-throughput drug screening in vitro. However, current modalities for drug testing, such as electrophysiology and fluorescence imaging have inherent drawbacks. To circumvent these problems, we report the development of a bioluminescent Ca 2+ indicator GmNL(Ca 2+ ), and its application in a customized microscope for high-throughput drug screening. GmNL(Ca 2+ ) gives a 140% signal change with Ca 2+ , and can image drug-induced changes of Ca 2+ dynamics in cultured cells. Since bioluminescence requires application of a chemical substrate, which is consumed over ~ 30 min we made a dedicated microscope with automated drug dispensing inside a light-tight box, to control drug addition. To overcome thermal instability of the luminescent substrate, or small molecule, dual climate control enables distinct temperature settings in the drug reservoir and the biological sample. By combining GmNL(Ca 2+ ) with this adaptation, we could image spontaneous Ca 2+ transients in cultured cardiomyocytes and phenotype their response to well-known drugs without accessing the sample directly. In addition, the bioluminescent strategy demonstrates minimal perturbation of contractile parameters and long-term observation attributable to lack of phototoxicity and photobleaching. Overall, bioluminescence may enable more accurate drug screening in a high-throughput manner.
Wiersma, Harmen; Nijstad, Niels; de Boer, Jan Freark; Out, Ruud; Hogewerf, Wytse; Van Berkel, Theo J.; Kuipers, Folkert; Tietge, Uwe J. F.
Objective: The ATP Binding Cassette transporter G1 (ABCG1) has been implicated in cholesterol efflux towards HDL and reverse cholesterol transport (RCT). Biliary cholesterol secretion is considered as an important step in RCT. The aim of the present study was to determine the consequences of Abcg1
The necrosome promotes pancreatic oncogenesis via CXCL1 and Mincle-induced immune suppression.
Seifert, Lena; Werba, Gregor; Tiwari, Shaun; Giao Ly, Nancy Ngoc; Alothman, Sara; Alqunaibit, Dalia; Avanzi, Antonina; Barilla, Rocky; Daley, Donnele; Greco, Stephanie H; Torres-Hernandez, Alejandro; Pergamo, Matthew; Ochi, Atsuo; Zambirinis, Constantinos P; Pansari, Mridul; Rendon, Mauricio; Tippens, Daniel; Hundeyin, Mautin; Mani, Vishnu R; Hajdu, Cristina; Engle, Dannielle; Miller, George
2016-04-14
Neoplastic pancreatic epithelial cells are believed to die through caspase 8-dependent apoptotic cell death, and chemotherapy is thought to promote tumour apoptosis. Conversely, cancer cells often disrupt apoptosis to survive. Another type of programmed cell death is necroptosis (programmed necrosis), but its role in pancreatic ductal adenocarcinoma (PDA) is unclear. There are many potential inducers of necroptosis in PDA, including ligation of tumour necrosis factor receptor 1 (TNFR1), CD95, TNF-related apoptosis-inducing ligand (TRAIL) receptors, Toll-like receptors, reactive oxygen species, and chemotherapeutic drugs. Here we report that the principal components of the necrosome, receptor-interacting protein (RIP)1 and RIP3, are highly expressed in PDA and are further upregulated by the chemotherapy drug gemcitabine. Blockade of the necrosome in vitro promoted cancer cell proliferation and induced an aggressive oncogenic phenotype. By contrast, in vivo deletion of RIP3 or inhibition of RIP1 protected against oncogenic progression in mice and was associated with the development of a highly immunogenic myeloid and T cell infiltrate. The immune-suppressive tumour microenvironment associated with intact RIP1/RIP3 signalling depended in part on necroptosis-induced expression of the chemokine attractant CXCL1, and CXCL1 blockade protected against PDA. Moreover, cytoplasmic SAP130 (a subunit of the histone deacetylase complex) was expressed in PDA in a RIP1/RIP3-dependent manner, and Mincle--its cognate receptor--was upregulated in tumour-infiltrating myeloid cells. Ligation of Mincle by SAP130 promoted oncogenesis, whereas deletion of Mincle protected against oncogenesis and phenocopied the immunogenic reprogramming of the tumour microenvironment that was induced by RIP3 deletion. Cellular depletion suggested that whereas inhibitory macrophages promote tumorigenesis in PDA, they lose their immune-suppressive effects when RIP3 or Mincle is deleted. Accordingly, T cells
Coffee induces breast cancer resistance protein expression in Caco-2 cells.
Isshiki, Marina; Umezawa, Kazuo; Tamura, Hiroomi
2011-01-01
Coffee is a beverage that is consumed world-wide on a daily basis and is known to induce a series of metabolic and pharmacological effects, especially in the digestive tract. However, little is known concerning the effects of coffee on transporters in the gastrointestinal tract. To elucidate the effect of coffee on intestinal transporters, we investigated its effect on expression of the breast cancer resistance protein (BCRP/ABCG2) in a human colorectal cancer cell line, Caco-2. Coffee induced BCRP gene expression in Caco-2 cells in a coffee-dose dependent manner. Coffee treatment of Caco-2 cells also increased the level of BCRP protein, which corresponded to induction of gene expression, and also increased cellular efflux activity, as judged by Hoechst33342 accumulation. None of the major constituents of coffee tested could induce BCRP gene expression. The constituent of coffee that mediated this induction was extractable with ethyl acetate and was produced during the roasting process. Dehydromethylepoxyquinomicin (DHMEQ), an inhibitor of nuclear factor (NF)-κB, inhibited coffee-mediated induction of BCRP gene expression, suggesting involvement of NF-κB in this induction. Our data suggest that daily consumption of coffee might induce BCRP expression in the gastrointestinal tract and may affect the bioavailability of BCRP substrates.
Inflammation induced mTORC2-Akt-mTORC1 signaling promotes macrophage foam cell formation.
Banerjee, Dipanjan; Sinha, Archana; Saikia, Sudeshna; Gogoi, Bhaskarjyoti; Rathore, Arvind K; Das, Anindhya Sundar; Pal, Durba; Buragohain, Alak K; Dasgupta, Suman
2018-06-05
The transformation of macrophages into lipid loaded foam cells is a critical and early event in the pathogenesis of atherosclerosis. Several recent reports highlighted that induction of TLR4 signaling promotes macrophage foam cell formation; however, the underlying molecular mechanisms have not been clearly elucidated. Here, we found that the TLR4 mediated inflammatory signaling communicated with mTORC2-Akt-mTORC1 metabolic cascade in macrophage and thereby promoting lipid uptake and foam cell formation. Mechanistically, LPS treatment markedly upregulates TLR4 mediated inflammatory pathway which by activating mTORC2 induces Akt phosphorylation at serine 473 and that aggravate mTORC1 dependent scavenger receptors expression and consequent lipid accumulation in THP-1 macrophages. Inhibition of mTORC2 either by silencing Rictor expression or inhibiting its association with mTOR notably prevents LPS induced Akt activation, scavenger receptors expression and macrophage lipid accumulation. Although suppression of mTORC1 expression by genetic knockdown of Raptor did not produce any significant change in Akt S473 phosphorylation, however, incubation with Akt activator in Rictor silenced cells failed to promote scavenger receptors expression and macrophage foam cell formation. Thus, present research explored the signaling pathway involved in inflammation induced macrophage foam cells formation and therefore, targeting this pathway might be useful for preventing macrophage foam cell formation. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Factors affecting drug-induced liver injury: antithyroid drugs as instances
Directory of Open Access Journals (Sweden)
Reza Heidari
2014-09-01
Full Text Available Methimazole and propylthiouracil have been used in the management of hyperthyroidism for more than half a century. However, hepatotoxicity is one of the most deleterious side effects associated with these medications. The mechanism(s of hepatic injury induced by antithyroid agents is not fully recognized yet. Furthermore, there are no specific tools for predicting the occurrence of hepatotoxicity induced by these drugs. The purpose of this article is to give an overview on possible susceptibility factors in liver injury induced by antithyroid agents. Age, gender, metabolism characteristics, alcohol consumption, underlying diseases, immunologic mechanisms, and drug interactions are involved in enhancing antithyroid drugs-induced hepatic damage. An outline on the clinically used treatments for antithyroid drugs-induced hepatotoxicity and the potential therapeutic strategies found to be effective against this complication are also discussed.
van Eeden, Annelies E; Roach, Rachel E J; Halbesma, Nynke; Dekker, Friedo W
2012-01-01
To determine and compare the foundation of claims in drug-promoting advertisements in a Dutch journal for physicians and a Dutch journal for pharmacists. A cross-sectional study. We included all the drug-promoting advertisements referring to a randomized controlled trial (RCT) we could find on Medline from 2 volumes of the Dutch Journal of Medicine (Nederlands Tijdschrift voor Geneeskunde; NTvG) and the (also Dutch) Pharmaceutical Weekly (Pharmaceutisch Weekblad; PW). The validity of the advertisements (n = 54) and the methodological quality of the referenced RCTs (n = 150) were independently scored by 250 medical students using 2 standardised questionnaires. The advertisements' sources were concealed from the students. Per journal, the percentage of drug-promoting advertisements having a valid claim and the percentage of high-quality RCT references were determined. Average scores on quality and validity were compared between the 2 journals. On a scale of 0-18 points, the mean quality scores of the RCTs differed 0.3 (95% CI: -0.1-0.7) between the NTvG (score: 14.8; SD: 2.2) and the PW (score: 14.5; SD: 2.6). The difference between the validity scores of drug-promoting advertisements in the NTvG (score: 5.8; SD: 3.3) and the PW (score: 5.6; SD: 3.6) was 0.3 (95% CI: -0.3-0.9) on a scale of 0-10 points. For both journals, an average of 15% of drug-promoting advertisements was valid (defined as a validity score of > 8 points); 35% of the RCTs referred to was of good methodological quality (defined as a quality score of > 16 points). The substantiation of many claims in drug-promoting advertisements in the NTvG and the PW was mediocre. There was no difference between the 2 journals.
Southwell, Brian G; Rupert, Douglas J
2016-01-16
Despite increased availability of online promotional tools for prescription drug marketers, evidence on online prescription drug promotion is far from settled or conclusive. We highlight ways in which online prescription drug promotion is similar to conventional broadcast and print advertising and ways in which it differs. We also highlight five key areas for future research: branded drug website influence on consumer knowledge and behavior, interactive features on branded drug websites, mobile viewing of branded websites and mobile advertisements, online promotion and non-US audiences, and social media and medication decisions. © 2016 by Kerman University of Medical Sciences.
Zhang, Lili; Spencer, Kylee L.; Voruganti, V. Saroja; Jorgensen, Neal W.; Fornage, Myriam; Best, Lyle G.; Brown-Gentry, Kristin D.; Cole, Shelley A.; Crawford, Dana C.; Deelman, Ewa; Franceschini, Nora; Gaffo, Angelo L.; Glenn, Kimberly R.; Heiss, Gerardo; Jenny, Nancy S.; Kottgen, Anna; Li, Qiong; Liu, Kiang; Matise, Tara C.; North, Kari E.; Umans, Jason G.; Kao, W. H. Linda
2013-01-01
A loss-of-function mutation (Q141K, rs2231142) in the ATP-binding cassette, subfamily G, member 2 gene (ABCG2) has been shown to be associated with serum uric acid levels and gout in Asians, Europeans, and European and African Americans; however, less is known about these associations in other populations. Rs2231142 was genotyped in 22,734 European Americans, 9,720 African Americans, 3,849 Mexican Americans, and 3,550 American Indians in the Population Architecture using Genomics and Epidemiology (PAGE) Study (2008–2012). Rs2231142 was significantly associated with serum uric acid levels (P = 2.37 × 10−67, P = 3.98 × 10−5, P = 6.97 × 10−9, and P = 5.33 × 10−4 in European Americans, African Americans, Mexican Americans, and American Indians, respectively) and gout (P = 2.83 × 10−10, P = 0.01, and P = 0.01 in European Americans, African Americans, and Mexican Americans, respectively). Overall, the T allele was associated with a 0.24-mg/dL increase in serum uric acid level (P = 1.37 × 10−80) and a 1.75-fold increase in the odds of gout (P = 1.09 × 10−12). The association between rs2231142 and serum uric acid was significantly stronger in men, postmenopausal women, and hormone therapy users compared with their counterparts. The association with gout was also significantly stronger in men than in women. These results highlight a possible role of sex hormones in the regulation of ABCG2 urate transporter and its potential implications for the prevention, diagnosis, and treatment of hyperuricemia and gout. PMID:23552988
Directory of Open Access Journals (Sweden)
Shaowen Tang
Full Text Available The pathogenic mechanism of anti-tuberculosis (anti-TB drug-induced hepatitis is associated with drug metabolizing enzymes. No tagging single-nucleotide polymorphisms (tSNPs of cytochrome P450 2E1(CYP2E1 in the risk of anti-TB drug-induced hepatitis have been reported. The present study was aimed at exploring the role of tSNPs in CYP2E1 gene in a population-based anti-TB treatment cohort.A nested case-control study was designed. Each hepatitis case was 14 matched with controls by age, gender, treatment history, disease severity and drug dosage. The tSNPs were selected by using Haploview 4.2 based on the HapMap database of Han Chinese in Beijing, and detected by using TaqMan allelic discrimination technology.Eighty-nine anti-TB drug-induced hepatitis cases and 356 controls were included in this study. 6 tSNPs (rs2031920, rs2070672, rs915908, rs8192775, rs2515641, rs2515644 were genotyped and minor allele frequencies of these tSNPs were 21.9%, 23.0%, 19.1%, 23.6%, 20.8% and 44.4% in the cases and 20.9%, 22.7%, 18.9%, 23.2%, 18.2% and 43.2% in the controls, respectively. No significant difference was observed in genotypes or allele frequencies of the 6 tSNPs between case group and control group, and neither of haplotypes in block 1 nor in block 2 was significantly associated with the development of hepatitis.Based on the Chinese anti-TB treatment cohort, we did not find a statistically significant association between genetic polymorphisms of CYP2E1 and the risk of anti-TB drug-induced hepatitis. None of the haplotypes showed a significant association with the development of hepatitis in Chinese TB population.
Drug-induced cholestasis: mechanisms, models, and markers.
Chatterjee, Sagnik; Annaert, Pieter
2018-04-27
Drug-induced cholestasis is a risk factor in progression of drug candidates, and poses serious health hazard if not detected before going into human. Intrahepatic accumulation of bile acids (BAs) represents a characteristic phenomenon associated with drug-induced cholestasis. The major challenges in obtaining a complete understanding of drug-induced cholestasis lies in the complexity of BA-mediated toxicity mechanisms and the impact of bile acids at different 'targets' such as transporters, enzymes and nuclear receptors. At the same time, it is not trivial to have a relevant in vitro system that recapitulates these features. In addition, lack of sensitive and early preclinical biomarkers, relevant to the clinical situation, complicates proper detection of drug-induced cholestasis. Significant overlap in biomarker signatures between different mechanisms of drug-induced liver injury (DILI) precludes identification of specific mechanisms. Over the last decade the knowledge gaps in drug-induced cholestasis are closing due to growing mechanistic understanding of BA-mediated toxicity at (patho)physiologically relevant BA concentrations. Significant progress has been made in the mechanistic understanding of drug-induced cholestasis and associated toxicity, biomarkers and susceptibility factors. In addition, novel in vitro models are evolving which provide a holistic understanding of processes underlying drug-induced cholestasis. This review summarizes the challenges and recent understandings about drug-induced cholestasis with a potential path forward. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
DEFF Research Database (Denmark)
Zager, Adriano; Brandão, Wesley Nogueira; Margatho, Rafael Oliveira
2018-01-01
The wake-promoting drug Modafinil has been used for many years for treatment of Narcolepsy and Excessive Daytime Sleepiness, due to a dopamine-related psychostimulant action. Recent studies have indicated that Modafinil prevents neuroinflammation in animal models. Thus, the aim of the present stu...
Directory of Open Access Journals (Sweden)
Brian G. Southwell
2016-03-01
Full Text Available Despite increased availability of online promotional tools for prescription drug marketers, evidence on online prescription drug promotion is far from settled or conclusive. We highlight ways in which online prescription drug promotion is similar to conventional broadcast and print advertising and ways in which it differs. We also highlight five key areas for future research: branded drug website influence on consumer knowledge and behavior, interactive features on branded drug websites, mobile viewing of branded websites and mobile advertisements, online promotion and non-US audiences, and social media and medication decisions.
Study of cancer-specific chimeric promoters induced by irradiation
International Nuclear Information System (INIS)
Xiong Jie; Zhou Yunfeng; Sun Wenjie; Wang Weifeng; Liao Zhengkai; Zhou Fuxiang; Xie Conghua
2010-01-01
Objective: To combine the radio-inducible CArG element with cancer-specific human telomerase reverse transcriptase (hTERT) gene promoter, and to construct the novel chimeric promoters. Methods: The synthetic hTERT promoters containing different number of radio-inducible CArG elements were constructed, and the activities of the promoters in the cancer cells (HeLa, A549, and MHCC97 cells) and nomal cells (hEL cells) were detected by using luciferase-reporter assays after the treatment of irradiation (a single or fractionated irradiation dose). Results: Synthetic promoter containing 6 repeated CArG units was better in radio-inducibility than any other promoters containing different number of CArG units, and nearly maximum levels obtained at 4-6 Gy. The very low activities of the chimeric promoters could be detected in normal hEL cells. A similar level of reporter gene expression was observed after 3 fractionated doses of 2 Gy compared with a single dose of 6 Gy in cancer cells. Conclusions: The cancer-specific chimeric promoter containing 6 CArG elements showes the best radio-response, and the chimeric promoter system has the potential in cancer gene therapy. (authors)
DNA of HeLa cells during caffeine-promoted recovery from X-ray induced G2 arrest
International Nuclear Information System (INIS)
Bases, R.; Mendez, F.; Liebeskind, D.; Elequin, F.; Neubort, S.
1980-01-01
Progression of X-irradiated HeLa cells from G2 arrest through mitosis was promoted by 1mM caffeine. Caffeine promoted the return from abnormally high levels of radiation-induced immunoreactivity to antinucleoside antibodies, which indicates persistent DNA strand separation, to the low levels normally found in G2. With caffeine, the irradiated cells progressed through mitosis, producing daughter cells with the normal G1 content of DNA. Without caffeine, the DNA content of individual radiation-arrested cells retained G2 values and the abnormally high levels of immunoreactivity to antinucleoside antibodies. (author)
Promotion of prescription drugs to consumers and providers, 2001-2010.
Directory of Open Access Journals (Sweden)
Rachel Kornfield
Full Text Available Pharmaceutical firms heavily promote their products and may have changed marketing strategies in response to reductions in new product approvals, restrictions on some forms of promotion, and the expanding role of biologic therapies.We used descriptive analyses of annual cross-sectional data from 2001 through 2010 to examine direct-to-consumer advertising (DTCA (Kantar Media and provider-targeted promotion (IMS Health and SDI, including: (1 inflation-adjusted total promotion spending ($ and percent of sales; (2 distribution by channel (consumer v. provider; and (3 provider specialty both for the industry as a whole and for top-selling biologic and small molecule therapies.Total promotion peaked in 2004 at US$36.1 billion (13.4% of sales. By 2010 it had declined to $27.7B (9.0% of sales. Between 2006 and 2010, similar declines were seen for promotion to providers and DTCA (both by 25%. DTCA's share of total promotion increased from 12% in 2002 to 18% in 2006, but then declined to 16% and remains highly concentrated. Number of products promoted to providers peaked in 2004 at over 3000, and then declined 20% by 2010. In contrast to top-selling small molecule therapies having an average of $370 million (8.8% of sales spent on promotion, top biologics were promoted less, with only $33 million (1.4% of sales spent per product. Little change occurred in the composition of promotion between primary care physicians and specialists from 2001-2010.These findings suggest that pharmaceutical companies have reduced promotion following changes in the pharmaceutical pipeline and patent expiry for several blockbuster drugs. Promotional strategies for biologic drugs differ substantially from small molecule therapies.
Promotion of prescription drugs to consumers and providers, 2001-2010.
Kornfield, Rachel; Donohue, Julie; Berndt, Ernst R; Alexander, G Caleb
2013-01-01
Pharmaceutical firms heavily promote their products and may have changed marketing strategies in response to reductions in new product approvals, restrictions on some forms of promotion, and the expanding role of biologic therapies. We used descriptive analyses of annual cross-sectional data from 2001 through 2010 to examine direct-to-consumer advertising (DTCA) (Kantar Media) and provider-targeted promotion (IMS Health and SDI), including: (1) inflation-adjusted total promotion spending ($ and percent of sales); (2) distribution by channel (consumer v. provider); and (3) provider specialty both for the industry as a whole and for top-selling biologic and small molecule therapies. Total promotion peaked in 2004 at US$36.1 billion (13.4% of sales). By 2010 it had declined to $27.7B (9.0% of sales). Between 2006 and 2010, similar declines were seen for promotion to providers and DTCA (both by 25%). DTCA's share of total promotion increased from 12% in 2002 to 18% in 2006, but then declined to 16% and remains highly concentrated. Number of products promoted to providers peaked in 2004 at over 3000, and then declined 20% by 2010. In contrast to top-selling small molecule therapies having an average of $370 million (8.8% of sales) spent on promotion, top biologics were promoted less, with only $33 million (1.4% of sales) spent per product. Little change occurred in the composition of promotion between primary care physicians and specialists from 2001-2010. These findings suggest that pharmaceutical companies have reduced promotion following changes in the pharmaceutical pipeline and patent expiry for several blockbuster drugs. Promotional strategies for biologic drugs differ substantially from small molecule therapies.
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Doran, Evan
2016-01-01
Hyosun Kim’s report "Trouble Spots in Online Direct to Consumer Prescription Drug Promotion: A content Analysis of FDA Warning Letters" aims to teach marketers how to avoid breaching current Food and Drug Administration (FDA) guidelines in their online drug promotion. While Kim hopes to minimise the potential for online promotion to misinform consumers and the study is carefully conducted, teaching drug marketers how to avoid the common mistakes in online drug promotion is more likely to make marketers more adept at spinning information than appropriately balancing it PMID:27239884
Pulakazhi Venu, Vivek Krishna; Adijiang, Ayinuer; Seibert, Tara; Chen, Yong-Xiang; Shi, Chunhua; Batulan, Zarah; O'Brien, Edward R
2017-06-01
Recently, we demonstrated that heat shock protein (HSP)-27 is protective against the development of experimental atherosclerosis, reducing plaque cholesterol content by more than 30%. Moreover, elevated HSP-27 levels are predictive of relative freedom from clinical cardiovascular events. HSP-27 signaling occurs via the activation of NF-κB, which induces a marked up-regulation in expression of granulocyte-monocyte colony-stimulating factor (GM-CSF), a cytokine that is known to alter ABC transporters involved in reverse cholesterol transport (RCT). Therefore, we hypothesized that HSP-27-derived GM-CSF has a potent role in impeding plaque formation by promoting macrophage RCT and sought to better characterize this pathway. Treatment of THP-1 cells, RAW-Blue cells, and primary macrophages with recombinant HSP-27 resulted in NF-κB activation via TLR-4 and was inhibited by various pharmacologic blockers of this pathway. Moreover, HSP-27-induced upregulation of GM-CSF expression was dependent on TLR-4 signaling. Recombinant (r)HSP-27 treatment of ApoE -/- female (but not male) mice for 4 wk yielded reductions in plaque area and cholesterol clefts of 33 and 47%, respectively, with no effect on GM-CSF -/- ApoE -/- mice. With 12 wk of rHSP-27 treatment, both female and male mice showed reductions in plaque burden (55 and 42%, respectively) and a 60% reduction in necrotic core area but no treatment effect in GM-CSF -/- ApoE -/- mice. In vitro functional studies revealed that HSP-27 enhanced the expression of ABCA1 and ABCG1, as well as facilitated cholesterol efflux in vitro by ∼10%. These novel findings establish a paradigm for HSP-27-mediated RCT and set the stage for the development of HSP-27 atheroprotective therapeutics.-Pulakazhi Venu, V. K., Adijiang, A., Seibert, T., Chen, Y.-X., Shi, C., Batulan, Z., O'Brien, E. R. Heat shock protein 27-derived atheroprotection involves reverse cholesterol transport that is dependent on GM-CSF to maintain ABCA1 and ABCG1
Dual effects of the PI3K inhibitor ZSTK474 on multidrug efflux pumps in resistant cancer cells.
Muthiah, Divya; Callaghan, Richard
2017-11-15
ZSTK474 is a potent phosphoinositide 3-kinase (PI3K) inhibitor that reduces cell proliferation via G 1 -arrest. However, there is little information on the susceptibility of this anticancer drug to resistance conferred by the multidrug pumps P-glycoprotein (ABCB1) and ABCG2. We have demonstrated that ZSTK474 generated cytotoxicity in cells over-expressing either pump with potency similar to that in drug sensitive cells. In addition, the co-administration of ZSTK474 with the cytotoxic anti-cancer drugs vinblastine and mitoxantrone caused a potentiated cytotoxic effect in both drug sensitive and efflux pump expressing cells. These observations suggest that ZSTK474 is unaffected by the presence of multidrug efflux pumps and may circumvent their activities. Indeed, ZSTK474 increased the cellular accumulation of calcein-AM and mitoxantrone in cells expressing ABCB1 and ABCG2, respectively. ZSTK474 treatment also resulted in reduced expression of both efflux pumps in multidrug resistant cancer cells. Measurement of ABCB1 or ABCG2 mRNA levels demonstrated that the reduction was not due to altered transcription. Similarly, inhibitor studies showed that the proteasomal degradation pathway for ABCB1 and the lysosomal route for ABCG2 degradation were unaffected by ZSTK474. Thus the mechanism underlying reduced ABCB1 and ABCG2 levels caused by ZSTK474 was due to a reduction in overall protein synthesis; a process influenced by the PI3K pathway. In summary, ZSTK474 is not susceptible to efflux by the resistance mediators ABCB1 and ABCG2. Moreover, it inhibits the drug transport function of the pumps and leads to a reduction in their cellular expression levels. Our observations demonstrate that ZSTK474 is a powerful anticancer drug. Copyright © 2017 Elsevier B.V. All rights reserved.
Doran, Evan
2016-02-21
Hyosun Kim's report "Trouble Spots in Online Direct to Consumer Prescription Drug Promotion: A content Analysis of FDA Warning Letters" aims to teach marketers how to avoid breaching current Food and Drug Administration (FDA) guidelines in their online drug promotion. While Kim hopes to minimise the potential for online promotion to misinform consumers and the study is carefully conducted, teaching drug marketers how to avoid the common mistakes in online drug promotion is more likely to make marketers more adept at spinning information than appropriately balancing it. © 2016 by Kerman University of Medical Sciences.
Extra-Renal Elimination of Uric Acid via Intestinal Efflux Transporter BCRP/ABCG2
Hosomi, Atsushi; Nakanishi, Takeo; Fujita, Takuya; Tamai, Ikumi
2012-01-01
Urinary excretion accounts for two-thirds of total elimination of uric acid and the remainder is excreted in feces. However, the mechanism of extra-renal elimination is poorly understood. In the present study, we aimed to clarify the mechanism and the extent of elimination of uric acid through liver and intestine using oxonate-treated rats and Caco-2 cells as a model of human intestinal epithelium. In oxonate-treated rats, significant amounts of externally administered and endogenous uric acid were recovered in the intestinal lumen, while biliary excretion was minimal. Accordingly, direct intestinal secretion was thought to be a substantial contributor to extra-renal elimination of uric acid. Since human efflux transporter BCRP/ABCG2 accepts uric acid as a substrate and genetic polymorphism causing a decrease of BCRP activity is known to be associated with hyperuricemia and gout, the contribution of rBcrp to intestinal secretion was examined. rBcrp was confirmed to transport uric acid in a membrane vesicle study, and intestinal regional differences of expression of rBcrp mRNA were well correlated with uric acid secretory activity into the intestinal lumen. Bcrp1 knockout mice exhibited significantly decreased intestinal secretion and an increased plasma concentration of uric acid. Furthermore, a Bcrp inhibitor, elacridar, caused a decrease of intestinal secretion of uric acid. In Caco-2 cells, uric acid showed a polarized flux from the basolateral to apical side, and this flux was almost abolished in the presence of elacridar. These results demonstrate that BCRP contributes at least in part to the intestinal excretion of uric acid as extra-renal elimination pathway in humans and rats. PMID:22348008
Drug discovery for Duchenne muscular dystrophy via utrophin promoter activation screening.
Directory of Open Access Journals (Sweden)
Catherine Moorwood
Full Text Available Duchenne muscular dystrophy (DMD is a devastating muscle wasting disease caused by mutations in dystrophin, a muscle cytoskeletal protein. Utrophin is a homologue of dystrophin that can functionally compensate for its absence when expressed at increased levels in the myofibre, as shown by studies in dystrophin-deficient mice. Utrophin upregulation is therefore a promising therapeutic approach for DMD. The use of a small, drug-like molecule to achieve utrophin upregulation offers obvious advantages in terms of delivery and bioavailability. Furthermore, much of the time and expense involved in the development of a new drug can be eliminated by screening molecules that are already approved for clinical use.We developed and validated a cell-based, high-throughput screening assay for utrophin promoter activation, and used it to screen the Prestwick Chemical Library of marketed drugs and natural compounds. Initial screening produced 20 hit molecules, 14 of which exhibited dose-dependent activation of the utrophin promoter and were confirmed as hits. Independent validation demonstrated that one of these compounds, nabumetone, is able to upregulate endogenous utrophin mRNA and protein, in C2C12 muscle cells.We have developed a cell-based, high-throughput screening utrophin promoter assay. Using this assay, we identified and validated a utrophin promoter-activating drug, nabumetone, for which pharmacokinetics and safety in humans are already well described, and which represents a lead compound for utrophin upregulation as a therapy for DMD.
Institute of Scientific and Technical Information of China (English)
JIN Zhichun; HUANG Guangying
2005-01-01
Summary: In order to explore the effect of Yaoliuan capsule in the prevention and treatment of vaginal bleeding after drug-induced abortion and menses recovery after drug-induced abortion, 323 cases of gestation period ≤ 49 days and without contraindication, were divided randomly into study group (168 cases, taking Yaoliuan capsule) and control group (155 cases, taking placebo capsule). The results showed that in the study group, there were 161 cases (95.8 %) of complete abortion, 7 cases (4.2 %) of incomplete abortion; In the control group, there were 146 cases (94.2 %) of complete abortion, 6 cases (3.9 %) of incomplete abortion, 3 cases (1.9 %) of abortion failure. The vaginal bleeding time was 5-25 days (mean 10.8 days) in study group, while that was 6-62 days (mean 19.1 days) in control group. The menstrual cycle was 30.5±5.2 days and 33.8 d±8.6 days respectively in study and control groups. The menstrual period was 6.1±3.5 days and 9.9±5.1 days respectively in study and control groups. Yaoliuan capsule is an effective drug to prevent and treat vaginal bleeding following drug-induced abortion, promote menstruation recovery and prevent pelvic infection.
Drug-induced cutaneous lupus erythematosus
DEFF Research Database (Denmark)
Laurinaviciene, Rasa; Holm Sandholdt, Linda; Bygum, Anette
2017-01-01
BACKGROUND: An increasing number of drugs have been linked to drug-induced subacute cutaneous lupus erythematosus (DI-SCLE). The recognition and management of DI-SCLE can be challenging, as the condition may be triggered by different classes of drugs after variable lengths of time. OBJECTIVES......: To determine the proportion of patients with cutaneous lupus erythematosus (CLE) whose drugs are an inducing or aggravating factor. MATERIALS & METHODS: We conducted a retrospective chart review of patients diagnosed with CLE at a dermatological department over a 21-year period. We registered clinical......, serological, and histological data with a focus on drug intake. RESULTS: Of 775 consecutive patients with a diagnosis of lupus erythematosus (LE) or suspected LE, a diagnosis of CLE could be confirmed in 448 patients. A total of 130 patients had a drug intake that could suggest DI-SCLE. In 88 cases, a drug...
Adverse drug reactions induced by cardiovascular drugs in outpatients.
Gholami, Kheirollah; Ziaie, Shadi; Shalviri, Gloria
2008-01-01
Considering increased use of cardiovascular drugs and limitations in pre-marketing trials for drug safety evaluation, post marketing evaluation of adverse drug reactions (ADRs) induced by this class of medicinal products seems necessary. To determine the rate and seriousness of adverse reactions induced by cardiovascular drugs in outpatients. To compare sex and different age groups in developing ADRs with cardiovascular agents. To assess the relationship between frequencies of ADRs and the number of drugs used. This cross-sectional study was done in cardiovascular clinic at a teaching hospital. All patients during an eight months period were evaluated for cardiovascular drugs induced ADRs. Patient and reaction factors were analyzed in detected ADRs. Patients with or without ADRs were compared in sex and age by using chi-square test. Assessing the relationship between frequencies of ADRs and the number of drugs used was done by using Pearson analysis. The total number of 518 patients was visited at the clinic. ADRs were detected in 105 (20.3%) patients. The most frequent ADRs were occurred in the age group of 51-60. The highest rate of ADRs was recorded to be induced by Diltiazem (23.5%) and the lowest rate with Atenolol (3%). Headache was the most frequent detected ADR (23%). Assessing the severity and preventability of ADRs revealed that 1.1% of ADRs were detected as severe and 1.9% as preventable reactions. Women significantly developed more ADRs in this study (chi square = 3.978, PPearson=0.259, P<0.05). Monitoring ADRs in patients using cardiovascular drugs is a matter of importance since this class of medicines is usually used by elderly patients with critical conditions and underlying diseases.
Drug-drug interaction of microdose and regular-dose omeprazole with a CYP2C19 inhibitor and inducer.
Park, Gab-Jin; Bae, Soo Hyeon; Park, Wan-Su; Han, Seunghoon; Park, Min-Ho; Shin, Seok-Ho; Shin, Young G; Yim, Dong-Seok
2017-01-01
A microdose drug-drug interaction (DDI) study may be a valuable tool for anticipating drug interaction at therapeutic doses. This study aimed to compare the magnitude of DDIs at microdoses and regular doses to explore the applicability of a microdose DDI study. Six healthy male volunteer subjects were enrolled into each DDI study of omeprazole (victim) and known perpetrators: fluconazole (inhibitor) and rifampin (inducer). For both studies, the microdose (100 μg, cold compound) and the regular dose (20 mg) of omeprazole were given at days 0 and 1, respectively. On days 2-9, the inhibitor or inducer was given daily, and the microdose and regular dose of omeprazole were repeated at days 8 and 9, respectively. Full omeprazole pharmacokinetic samplings were performed at days 0, 1, 8, and 9 of both studies for noncompartmental analysis. The magnitude of the DDI, the geometric mean ratios (with perpetrator/omeprazole only) of maximum concentration (C max ) and area under the curve to the last measurement (AUC t ) of the microdose and the regular dose were compared. The geometric mean ratios in the inhibition study were: 2.17 (micro) and 2.68 (regular) for C max , and 4.07 (micro), 4.33 (regular) for AUC t . For the induction study, they were 0.26 (micro) and 0.21 (regular) for C max , and 0.16 (micro) and 0.15 (regular) for AUC t . There were no significant statistical differences in the magnitudes of DDIs between microdose and regular-dose conditions, regardless of induction or inhibition. Our results may be used as partial evidence that microdose DDI studies may replace regular-dose studies, or at least be used for DDI-screening purposes.
School health promotion and use of drugs among students in Southern Brazil.
Paz, Fernanda Marques; Teixeira, Vanessa Andina; Pinto, Raquel Oliveira; Andersen, Cristine Scattolin; Fontoura, Larissa Prado; Castro, Luís César de; Pattussi, Marcos Pascoal; Horta, Rogério Lessa
2018-01-01
To analyze the relationship between the health promotion conditions in schools and the consumption of alcohol and other drugs by students. This is a cross-sectional study with a probabilistic sample of 3,464 students aged 12 to 17 from all schools of the cities of Lajeado and Sapiranga, state of Rio Grande do Sul, Brazil, and 53 managers from the same schools; the data was collected in 2012. Reports of the use of tobacco, alcohol, and illicit drugs in 2012 were used as outcomes, and the health promotion score in the school environment was used as the exposure of interest. We submitted the data to multilevel analysis. The prevalence of the annual use of tobacco was 9.8% (95%CI 8.8-10.8), alcohol was 46.2% (95%CI 44.5-47.8), and other drugs was 10.9% (95%CI 9.9-12.0). In the crude analysis, only the use of tobacco was associated with less health promoting schools (OR = 1.89, 95%CI 1.16-3.09) when compared to those with better conditions. This association lost statistical significance in the adjusted analysis (OR = 1.27, 95%CI 0.74-2.19). The effects of the school environment on the use of drugs, especially tobacco and alcohol, are manifested mainly by the individual and family conditions of the adolescents.
CYP2C9 polymorphism in non-steroidal anti-inflammatory drugs-induced gastropathy.
Ma, Juan; Yang, Xiu Yan; Qiao, Liang; Liang, Liu Qin; Chen, Min Hu
2008-05-01
Non-steroidal anti-inflammatory drugs (NSAID) induce gastroduodenal mucosal injury and are metabolized by cytochrome P450 2C9 (CYP2C9). It is postulated that CYP2C9 genotype is associated with NSAID-induced gastropathy. This study aims to determine whether individuals with a CYP2C9 allele mutation are susceptible to NSAID-induced gastropathy. A total of 109 patients diagnosed as having rheumatic diseases and taking NSAID were appraised as having gastropathy by endoscopy, stool occult blood test and questionnaire two weeks after entering the study. Their peripheral blood was analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). A total of 47.7% gastropathy (33% erosions, 14.7% ulcers, 2.75% ulcer bleeding) and 56% dyspeptic symptoms were presented. Only one CYP2C9*2 heterozygote (*1/*2) was found in the group with gastropathy and two variant alleles (CYP2C9*2 and CYP2C9* 3) could not be found in the group without gastropathy. There was no significant difference in both CYP2C9 genotype (0.96%vs 0%) and CYP2C9 variant allele frequency (1.92%vs 0%) between patients with and without gastropathy. These results confirm the high prevalence of NSAID-induced gastropathy but do not support the postulation that CYP2C9*2 and CYP2C9*3 contribute to the development of NSAID-induced gastropathy. This may be due to the low frequency of the two alleles in the population studied.
Directory of Open Access Journals (Sweden)
Evan Doran
2016-05-01
Full Text Available Hyosun Kim’s report “Trouble Spots in Online Direct to Consumer Prescription Drug Promotion: A content Analysis of FDA Warning Letters”aims to teach marketers how to avoid breaching current Food and Drug Administration (FDA guidelines in their online drug promotion. While Kim hopes to minimise the potential for online promotion to misinform consumers and the study is carefully conducted, teaching drug marketers how to avoid the common mistakes in online drug promotion is more likely to make marketers more adept at spinning information than appropriately balancing it.
Lin, Hung-Chih; Lii, Chong-Kuei; Chen, Hui-Chun; Lin, Ai-Hsuan; Yang, Ya-Chen; Chen, Haw-Wen
2018-01-01
oxLDL is involved in the pathogenesis of atherosclerotic lesions through cholesterol accumulation in macrophage foam cells. Andrographolide, the bioactive component of Andrographis paniculata, possesses several biological activities such as anti-inflammatory, anti-oxidant, and anticancer functions. Scavenger receptors (SRs), including class A SR (SR-A) and CD36, are responsible for the internalization of oxLDL. In contrast, receptors for reverse cholesterol transport, including ABCA1 and ABCG1, mediate the efflux of cholesterol from macrophage foam cells. Transcription factor liver X receptor [Formula: see text] (LXR[Formula: see text] plays a key role in lipid metabolism and inflammation as well as in the regulation of ABCA1 and ABCG1 expression. Because of the contribution of inflammation to macrophage foam cell formation and the potent anti-inflammatory activity of andrographolide, we hypothesized that andrographolide might inhibit oxLDL-induced macrophage foam cell formation. The results showed that andrographolide reduced oxLDL-induced lipid accumulation in macrophage foam cells. Andrographolide decreased the mRNA and protein expression of CD36 by inducing the degradation of CD36 mRNA; however, andrographolide had no effect on SR-A expression. In contrast, andrographolide increased the mRNA and protein expression of ABCA1 and ABCG1, which were dependent on LXR[Formula: see text]. Andrographolide enhanced LXR[Formula: see text] nuclear translocation and DNA binding activity. Treatment with the LXR[Formula: see text] antagonist GGPP and transfection with LXR[Formula: see text] siRNA reversed the ability of andrographolide to stimulate ABCA1 and ABCG1 protein expression. In conclusion, inhibition of CD36-mediated oxLDL uptake and induction of ABCA1- and ABCG1-dependent cholesterol efflux are two working mechanisms by which andrographolide inhibits macrophage foam cell formation, which suggests that andrographolide could be a potential candidate to prevent
Energy Technology Data Exchange (ETDEWEB)
Yoshikawa, Yukitaka; Miyashita, Taishi; Higuchi, Satonori [Drug Metabolism and Toxicology, Faculty of Pharmaceutical Sciences, Kanazawa University, Kakuma-machi, Kanazawa 920‐1192 (Japan); Tsuneyama, Koichi [Department of Diagnostic Pathology, Graduate School of Medicine and Pharmaceutical Science for Research, University of Toyama, Sugitani, Toyama 930‐0194 (Japan); Endo, Shinya [Drug Metabolism and Toxicology, Faculty of Pharmaceutical Sciences, Kanazawa University, Kakuma-machi, Kanazawa 920‐1192 (Japan); Tsukui, Tohru [Research Center for Genomic Medicine, Saitama Medical University, Yamane, Hidaka 350‐1241 (Japan); Toyoda, Yasuyuki; Fukami, Tatsuki; Nakajima, Miki [Drug Metabolism and Toxicology, Faculty of Pharmaceutical Sciences, Kanazawa University, Kakuma-machi, Kanazawa 920‐1192 (Japan); Yokoi, Tsuyoshi, E-mail: tyokoi@p.kanazawa-u.ac.jp [Drug Metabolism and Toxicology, Faculty of Pharmaceutical Sciences, Kanazawa University, Kakuma-machi, Kanazawa 920‐1192 (Japan)
2012-10-01
Although estrogen receptor (ER)α agonists, such as estradiol and ethinylestradiol (EE2), cause cholestasis in mice, they also reduce the degree of liver injury caused by hepatotoxicants as well as ischemia–reperfusion. The functional mechanisms of ERα have yet to be elucidated in drug-induced or chemical-induced liver injury. The present study investigated the effects of an ERα agonist, selective ER modulators (SERMs) and an ER antagonist on drug-induced and chemical-induced liver injuries caused by acetaminophen, bromobenzene, diclofenac, and thioacetamide (TA). We observed hepatoprotective effects of EE2, tamoxifen (TAM) and raloxifene pretreatment in female mice that were exposed to a variety of hepatotoxic compounds. In contrast, the ER antagonist did not show any hepatoprotective effects. DNA microarray analyses suggested that monocyte to macrophage differentiation-associated 2 (Mmd2) protein, which has an unknown function, is commonly increased by TAM and RAL pretreatment, but not by pretreatment with the ER antagonist. In ERα-knockout mice, the hepatoprotective effects of TAM and the increased expression of Mmd2 mRNA were not observed in TA-induced liver injury. To investigate the function of Mmd2, the expression level of Mmd2 mRNA was significantly knocked down to approximately 30% in mice by injection of siRNA for Mmd2 (siMmd2). Mmd2 knockdown resulted in a reduction of the protective effects of TAM on TA-induced liver injury in mice. This is the first report of the involvement of ERα in drug-induced or chemical-induced liver injury. Upregulation of Mmd2 protein in the liver was suggested as the mechanism of the hepatoprotective effects of EE2 and SERMs. -- Highlights: ► Liver injury induced by drugs or chemicals was investigated in mice. ► Liver injury was suppressed by pretreatment with tamoxifen in female mice. ► Mmd2, whose function was unknown, could be a candidate gene for liver protection. ► Tamoxifen up-regulated Mmd2 mRNA expression
International Nuclear Information System (INIS)
Yoshikawa, Yukitaka; Miyashita, Taishi; Higuchi, Satonori; Tsuneyama, Koichi; Endo, Shinya; Tsukui, Tohru; Toyoda, Yasuyuki; Fukami, Tatsuki; Nakajima, Miki; Yokoi, Tsuyoshi
2012-01-01
Although estrogen receptor (ER)α agonists, such as estradiol and ethinylestradiol (EE2), cause cholestasis in mice, they also reduce the degree of liver injury caused by hepatotoxicants as well as ischemia–reperfusion. The functional mechanisms of ERα have yet to be elucidated in drug-induced or chemical-induced liver injury. The present study investigated the effects of an ERα agonist, selective ER modulators (SERMs) and an ER antagonist on drug-induced and chemical-induced liver injuries caused by acetaminophen, bromobenzene, diclofenac, and thioacetamide (TA). We observed hepatoprotective effects of EE2, tamoxifen (TAM) and raloxifene pretreatment in female mice that were exposed to a variety of hepatotoxic compounds. In contrast, the ER antagonist did not show any hepatoprotective effects. DNA microarray analyses suggested that monocyte to macrophage differentiation-associated 2 (Mmd2) protein, which has an unknown function, is commonly increased by TAM and RAL pretreatment, but not by pretreatment with the ER antagonist. In ERα-knockout mice, the hepatoprotective effects of TAM and the increased expression of Mmd2 mRNA were not observed in TA-induced liver injury. To investigate the function of Mmd2, the expression level of Mmd2 mRNA was significantly knocked down to approximately 30% in mice by injection of siRNA for Mmd2 (siMmd2). Mmd2 knockdown resulted in a reduction of the protective effects of TAM on TA-induced liver injury in mice. This is the first report of the involvement of ERα in drug-induced or chemical-induced liver injury. Upregulation of Mmd2 protein in the liver was suggested as the mechanism of the hepatoprotective effects of EE2 and SERMs. -- Highlights: ► Liver injury induced by drugs or chemicals was investigated in mice. ► Liver injury was suppressed by pretreatment with tamoxifen in female mice. ► Mmd2, whose function was unknown, could be a candidate gene for liver protection. ► Tamoxifen up-regulated Mmd2 mRNA expression
The RAB2B-GARIL5 Complex Promotes Cytosolic DNA-Induced Innate Immune Responses.
Takahama, Michihiro; Fukuda, Mitsunori; Ohbayashi, Norihiko; Kozaki, Tatsuya; Misawa, Takuma; Okamoto, Toru; Matsuura, Yoshiharu; Akira, Shizuo; Saitoh, Tatsuya
2017-09-19
Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor that induces the IFN antiviral response. However, the regulatory mechanisms that mediate cGAS-triggered signaling have not been fully explored. Here, we show the involvement of a small GTPase, RAB2B, and its effector protein, Golgi-associated RAB2B interactor-like 5 (GARIL5), in the cGAS-mediated IFN response. RAB2B-deficiency affects the IFN response induced by cytosolic DNA. Consistent with this, RAB2B deficiency enhances replication of vaccinia virus, a DNA virus. After DNA stimulation, RAB2B colocalizes with stimulator of interferon genes (STING), the downstream signal mediator of cGAS, on the Golgi apparatus. The GTP-binding activity of RAB2B is required for its localization on the Golgi apparatus and for recruitment of GARIL5. GARIL5 deficiency also affects the IFN response induced by cytosolic DNA and enhances replication of vaccinia virus. These findings indicate that the RAB2B-GARIL5 complex promotes IFN responses against DNA viruses by regulating the cGAS-STING signaling axis. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
The RAB2B-GARIL5 Complex Promotes Cytosolic DNA-Induced Innate Immune Responses
Directory of Open Access Journals (Sweden)
Michihiro Takahama
2017-09-01
Full Text Available Cyclic GMP-AMP synthase (cGAS is a cytosolic DNA sensor that induces the IFN antiviral response. However, the regulatory mechanisms that mediate cGAS-triggered signaling have not been fully explored. Here, we show the involvement of a small GTPase, RAB2B, and its effector protein, Golgi-associated RAB2B interactor-like 5 (GARIL5, in the cGAS-mediated IFN response. RAB2B-deficiency affects the IFN response induced by cytosolic DNA. Consistent with this, RAB2B deficiency enhances replication of vaccinia virus, a DNA virus. After DNA stimulation, RAB2B colocalizes with stimulator of interferon genes (STING, the downstream signal mediator of cGAS, on the Golgi apparatus. The GTP-binding activity of RAB2B is required for its localization on the Golgi apparatus and for recruitment of GARIL5. GARIL5 deficiency also affects the IFN response induced by cytosolic DNA and enhances replication of vaccinia virus. These findings indicate that the RAB2B-GARIL5 complex promotes IFN responses against DNA viruses by regulating the cGAS-STING signaling axis.
Saini, Shalini; Bharati, Kavita; Shaha, Chandrima; Mukhopadhyay, Chinmay K
2017-09-05
Micronutrients are essential for survival and growth for all the organisms including pathogens. In this manuscript, we report that zinc (Zn) chelator N,N,N',N'-tetrakis(2-pyridinylmethyl)-1,2-ethylenediamine (TPEN) affects growth and viability of intracellular pathogen Leishmania donovani (LD) by a concentration and time dependent manner. Simultaneous addition of zinc salt reverses the effect of TPEN. Further experiments provide evidence of apoptosis-like death of the parasite due to Zn-depletion. TPEN treatment enhances caspase-like activity suggesting increase in apoptosis-like events in LD. Specific inhibitors of cathepsin B and Endoclease G block TPEN-induced leishmanial death. Evidences show involvement of reactive oxygen species (ROS) potentially of extra-mitochondrial origin in TPEN-induced LD death. Pentavalent antimonials remained the prime source of treatment against leishmaniasis for several decades; however, antimony-resistant Leishmania is now common source of the disease. We also reveal that Zn-depletion can promote apoptosis-like death in antimony-resistant parasites. In summary, we present a new finding about the role of zinc in the survival of drug sensitive and antimony-resistant LD.
Adverse drug reactions induced by cardiovascular drugs in outpatients
Directory of Open Access Journals (Sweden)
Gholami K
2008-03-01
Full Text Available Considering increased use of cardiovascular drugs and limitations in pre-marketing trials for drug safety evaluation, post marketing evaluation of adverse drug reactions (ADRs induced by this class of medicinal products seems necessary.Objectives: To determine the rate and seriousness of adverse reactions induced by cardiovascular drugs in outpatients. To compare sex and different age groups in developing ADRs with cardiovascular agents. To assess the relationship between frequencies of ADRs and the number of drugs used. Methods: This cross-sectional study was done in cardiovascular clinic at a teaching hospital. All patients during an eight months period were evaluated for cardiovascular drugs induced ADRs. Patient and reaction factors were analyzed in detected ADRs. Patients with or without ADRs were compared in sex and age by using chi-square test. Assessing the relationship between frequencies of ADRs and the number of drugs used was done by using Pearson analysis. Results: The total number of 518 patients was visited at the clinic. ADRs were detected in 105 (20.3% patients. The most frequent ADRs were occurred in the age group of 51-60. The highest rate of ADRs was recorded to be induced by Diltiazem (23.5% and the lowest rate with Atenolol (3%. Headache was the most frequent detected ADR (23%. Assessing the severity and preventability of ADRs revealed that 1.1% of ADRs were detected as severe and 1.9% as preventable reactions. Women significantly developed more ADRs in this study (chi square = 3.978, P<0.05. ADRs more frequently occurred with increasing age in this study (chi square = 15.871, P<0.05. With increasing the number of drugs used, the frequency of ADRs increased (Pearson=0.259, P<0.05. Conclusion: Monitoring ADRs in patients using cardiovascular drugs is a matter of importance since this class of medicines is usually used by elderly patients with critical conditions and underlying diseases.
Drug induced aseptic meningitis
African Journals Online (AJOL)
PROF. EZECHUKWU
2013-09-29
Sep 29, 2013 ... Abstract. Drug-induced aseptic meningitis (DIAM) is a rare but important and often challenging diagnosis for the physician. Intake of antimicrobials, steroids, anal- gesics amongst others has been implicated. Signs and symptoms generally develop within 24-48 hours of drug ingestion. The pa- tient often ...
International Nuclear Information System (INIS)
Myllynen, Paeivi; Kummu, Maria; Kangas, Tiina; Ilves, Mika; Immonen, Elina; Rysae, Jaana; Pirilae, Rauna; Lastumaeki, Anni; Vaehaekangas, Kirsi H.
2008-01-01
We have studied the role of ATP binding cassette (ABC) transporters in fetal exposure to carcinogens using 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) a known substrate for ABC transporters as a model compound. In perfusion of human term placenta, transfer of 14 C-PhIP (2 μM) through the placenta resulted in fetal-to-maternal concentration ratio (FM ratio) of 0.72 ± 0.09 at 6 h. The specific ABCG2 inhibitor KO143 increased the transfer of 14 C-PhIP from maternal to fetal circulation (FM ratio 0.90 ± 0.08 at 6 h, p 14 C-PhIP (R = - 0.81, p 14 C-PhIP in perfused human placenta. Also, PhIP may modify ABC transporter expression in choriocarinoma cells
Calvo-Rodríguez, María; García-Durillo, Mónica; Villalobos, Carlos; Núñez, Lucía
2016-07-22
The most important risk factor for Alzheimer's disease (AD) is aging. Neurotoxicity in AD has been linked to dyshomeostasis of intracellular Ca2+ induced by small aggregates of the amyloid-β peptide 1-42 (Aβ42 oligomers). However, how aging influences susceptibility to neurotoxicity induced by Aβ42 oligomers is unknown. In this study, we used long-term cultures of rat hippocampal neurons, a model of neuronal in vitro aging, to investigate the contribution of aging to Ca2+ dishomeostasis and neuron cell death induced by Aβ42 oligomers. In addition, we tested whether non-steroidal anti-inflammatory drugs (NSAIDs) and R-flurbiprofen prevent apoptosis acting on subcellular Ca2+ in aged neurons. We found that Aβ42 oligomers have no effect on young hippocampal neurons cultured for 2 days in vitro (2 DIV). However, they promoted apoptosis modestly in mature neurons (8 DIV) and these effects increased dramatically after 13 DIV, when neurons display many hallmarks of in vivo aging. Consistently, cytosolic and mitochondrial Ca2+ responses induced by Aβ42 oligomers increased dramatically with culture age. At low concentrations, NSAIDs and the enantiomer R-flurbiprofen lacking anti-inflammatory activity prevent Ca2+ overload and neuron cell death induced by Aβ42 oligomers in aged neurons. However, at high concentrations R-flurbiprofen induces apoptosis. Thus, Aβ42 oligomers promote Ca2+ overload and neuron cell death only in aged rat hippocampal neurons. These effects are prevented by low concentrations of NSAIDs and R-flurbiprofen acting on mitochondrial Ca2+ overload.
Fouquet, Grégory; Debuysscher, Véronique; Ouled-Haddou, Hakim; Eugenio, Mélanie Simoes; Demey, Baptiste; Singh, Amrathlal Rabbind; Ossart, Christèle; Al Bagami, Mohammed; Regimbeau, Jean-Marc; Nguyen-Khac, Eric; Naassila, Mickael; Marcq, Ingrid; Bouhlal, Hicham
2016-05-31
Multidrug resistance MDR proteins (MRPs) are members of the C family of a group of proteins named ATP binding cassette (ABC) transporters. MRPs can transport drugs including anticancer drugs, nucleoside analogs, antimetabolites and tyrosine kinase inhibitors. Drugs used in HCC therapy, such as tyrosine kinase inhibitor sorafenib, are substrates of uptake and/or efflux transporters. Variable expression of MRPs at the plasma membrane of tumor cells may contribute to drug resistance and subsequent clinical response. Recently, we reported that the hepatocyte SLAMF3 expression (Signaling Lymphocytic Activation Molecule Family member 3) was reduced in tumor cells from hepatocellular carcinoma (HCC) compared to its high expression in adjacent tissues. In the present study, we make a strong correlation between induced SLAMF3 overexpression and the specific loss of MRP-1 expression and its functionalities as a drugs resistance transporter. No changes were observed on expression of ABCG2 and MDR. More importantly, we highlight a strong inverse correlation between MRP-1 and SLAMF3 expression in patients with HCC. We propose that the SLAMF3 overexpression in cancerous cells could represent a potential therapeutic strategy to improve the drugs sensibility of resistant cells and thus control the therapeutic failure in HCC patients.
The epidemiology of drug promotion.
Silverman, M
1977-01-01
A survey was conducted on the promotion of 28 prescription drugs in the form of 40 different products marketed in the United States and Latin America by 23 multinational pharmaceutical companies. Striking differences were found in the manner in which the identical drug, marketed by the identical company or its foreign affiliate, was described to physicians in the United States and to physicians in Latin America. In the United States, the listed indications were usually few in number, while the contraindications, warnings, and potential adverse reactions were given in extensive detail. In Latin America, the listed indications were far more numerous, while the hazards were usually minimized, glossed over, or totally ignored. The differences were not simply between the United States on the one hand and all the Latin American countries on the other. There were substantial differences within Latin America, with the same global company telling one story in Mexico, another in Central America, a third in Ecuador and Colombia, and yet another in Brazil. The companies have sought to defend these practices by contending that they are not breaking any Latin American laws. In some countries, however, such promotion is in clear violation of the law. The corporate ethics and social responsibilities concerned here call for examination and action.
Promotion of Prescription Drugs to Consumers and Providers, 2001–2010
Kornfield, Rachel; Donohue, Julie; Berndt, Ernst R.; Alexander, G. Caleb
2013-01-01
Background Pharmaceutical firms heavily promote their products and may have changed marketing strategies in response to reductions in new product approvals, restrictions on some forms of promotion, and the expanding role of biologic therapies. Methods We used descriptive analyses of annual cross-sectional data from 2001 through 2010 to examine direct-to-consumer advertising (DTCA) (Kantar Media) and provider-targeted promotion (IMS Health and SDI), including: (1) inflation-adjusted total promotion spending ($ and percent of sales); (2) distribution by channel (consumer v. provider); and (3) provider specialty both for the industry as a whole and for top-selling biologic and small molecule therapies. Results Total promotion peaked in 2004 at US$36.1 billion (13.4% of sales). By 2010 it had declined to $27.7B (9.0% of sales). Between 2006 and 2010, similar declines were seen for promotion to providers and DTCA (both by 25%). DTCA’s share of total promotion increased from 12% in 2002 to 18% in 2006, but then declined to 16% and remains highly concentrated. Number of products promoted to providers peaked in 2004 at over 3000, and then declined 20% by 2010. In contrast to top-selling small molecule therapies having an average of $370 million (8.8% of sales) spent on promotion, top biologics were promoted less, with only $33 million (1.4% of sales) spent per product. Little change occurred in the composition of promotion between primary care physicians and specialists from 2001–2010. Conclusions These findings suggest that pharmaceutical companies have reduced promotion following changes in the pharmaceutical pipeline and patent expiry for several blockbuster drugs. Promotional strategies for biologic drugs differ substantially from small molecule therapies. PMID:23469165
HLA Association with Drug-Induced Adverse Reactions
Directory of Open Access Journals (Sweden)
Wen-Lang Fan
2017-01-01
Full Text Available Adverse drug reactions (ADRs remain a common and major problem in healthcare. Severe cutaneous adverse drug reactions (SCARs, such as Stevens–Johnson syndrome (SJS/toxic epidermal necrolysis (TEN with mortality rate ranges from 10% to more than 30%, can be life threatening. A number of recent studies demonstrated that ADRs possess strong genetic predisposition. ADRs induced by several drugs have been shown to have significant associations with specific alleles of human leukocyte antigen (HLA genes. For example, hypersensitivity to abacavir, a drug used for treating of human immunodeficiency virus (HIV infection, has been proposed to be associated with allele 57:01 of HLA-B gene (terms HLA-B∗57:01. The incidences of abacavir hypersensitivity are much higher in Caucasians compared to other populations due to various allele frequencies in different ethnic populations. The antithyroid drug- (ATDs- induced agranulocytosis are strongly associated with two alleles: HLA-B∗38:02 and HLA-DRB1∗08:03. In addition, HLA-B∗15:02 allele was reported to be related to carbamazepine-induced SJS/TEN, and HLA-B∗57:01 in abacavir hypersensitivity and flucloxacillin induced drug-induced liver injury (DILI. In this review, we summarized the alleles of HLA genes which have been proposed to have association with ADRs caused by different drugs.
Chen, Li-You; Renn, Ting-Yi; Liao, Wen-Chieh; Mai, Fu-Der; Ho, Ying-Jui; Hsiao, George; Lee, Ai-Wei; Chang, Hung-Ming
2017-09-01
Prolonged exposure to gamma-hydroxybutyric acid (GHB) would cause drug intoxication in which impaired cognitive function results from enhanced hippocampal oxidative stress may serve as a major symptom in this deficiency. Considering melatonin possesses significant anti-oxidative efficacy, this study aimed to determine whether melatonin would successfully promote the nuclear factor erythroid 2-related factor 2 and antioxidant responsive element (Nrf2-ARE) signaling, depress oxidative stress, and rescue hippocampal bioenergetics and cognitive function following drug intoxication injury. Adolescent rats subjected to 10 days of GHB were received melatonin at doses of either 10 or 100 mg/kg. Time-of-flight secondary ion mass spectrometry, biochemical assay, quantitative histochemistry, [ 14 C]-2-deoxyglucose analysis, together with Morris water maze were employed to detect the molecular signaling, oxidative status, bioenergetic level, as well as the cognitive performances, respectively. Results indicated that in GHB-intoxicated rats, enhanced oxidative stress, increased cholesterol level, and decreased anti-oxidative enzymes activities were detected in hippocampal regions. Intense oxidative stress paralleled well with reduced bioenergetics and poor performance in behavioral testing. However, in rats treated with melatonin following GHB intoxication, all above parameters and cognitive function were gradually returned to nearly normal levels. Melatonin also remarkably promoted the translocation of Nrf2 from cytoplasm to nucleus in a dose-dependent manner, thereby increased the Nrf2-ARE signaling-related downstream anti-oxidative enzymes activities. As melatonin effectively rescues hippocampal bioenergetics through depressing the oxidative stress by promoting Nrf2-ARE molecular machinery, this study thus highlights for the first time that clinical use of melatonin may serve as a therapeutic strategy to improve the cognitive function in unsuspecting victims suffered from
Sorafenib-induced defective autophagy promotes cell death by necroptosis.
Kharaziha, Pedram; Chioureas, Dimitris; Baltatzis, George; Fonseca, Pedro; Rodriguez, Patricia; Gogvadze, Vladimir; Lennartsson, Lena; Björklund, Ann-Charlotte; Zhivotovsky, Boris; Grandér, Dan; Egevad, Lars; Nilsson, Sten; Panaretakis, Theocharis
2015-11-10
Autophagy is one of the main cytoprotective mechanisms that cancer cells deploy to withstand the cytotoxic stress and survive the lethal damage induced by anti-cancer drugs. However, under specific conditions, autophagy may, directly or indirectly, induce cell death. In our study, treatment of the Atg5-deficient DU145 prostate cancer cells, with the multi-tyrosine kinase inhibitor, sorafenib, induces mitochondrial damage, autophagy and cell death. Molecular inhibition of autophagy by silencing ULK1 and Beclin1 rescues DU145 cells from cell death indicating that, in this setting, autophagy promotes cell death. Re-expression of Atg5 restores the lipidation of LC3 and rescues DU145 and MEF atg5-/- cells from sorafenib-induced cell death. Despite the lack of Atg5 expression and LC3 lipidation, DU145 cells form autophagosomes as demonstrated by transmission and immuno-electron microscopy, and the formation of LC3 positive foci. However, the lack of cellular content in the autophagosomes, the accumulation of long-lived proteins, the presence of GFP-RFP-LC3 positive foci and the accumulated p62 protein levels indicate that these autophagosomes may not be fully functional. DU145 cells treated with sorafenib undergo a caspase-independent cell death that is inhibited by the RIPK1 inhibitor, necrostatin-1. Furthermore, treatment with sorafenib induces the interaction of RIPK1 with p62, as demonstrated by immunoprecipitation and a proximity ligation assay. Silencing of p62 decreases the RIPK1 protein levels and renders necrostatin-1 ineffective in blocking sorafenib-induced cell death. In summary, the formation of Atg5-deficient autophagosomes in response to sorafenib promotes the interaction of p62 with RIPK leading to cell death by necroptosis.
Increased Risk of Drug-Induced Hyponatremia during High Temperatures
Directory of Open Access Journals (Sweden)
Anna K Jönsson
2017-07-01
Full Text Available Purpose: To investigate the relationship between outdoor temperature in Sweden and the reporting of drug-induced hyponatremia to the Medical Products Agency (MPA. Methods: All individual adverse drug reactions (ADR reported to MPA from 1 January 2010 to 31 October 2013 of suspected drug-induced hyponatremia and random controls were identified. Reports where the ADR had been assessed as having at least a possible relation to the suspected drug were included. Information on administered drugs, onset date, causality assessment, sodium levels, and the geographical origin of the reports was extracted. A case-crossover design was used to ascertain the association between heat exposure and drug-induced hyponatremia at the individual level, while linear regression was used to study its relationship to sodium concentration in blood. Temperature exposure data were obtained from the nearest observation station to the reported cases. Results: During the study period, 280 reports of hyponatremia were identified. More cases of drug-induced hyponatremia were reported in the warmer season, with a peak in June, while other ADRs showed an opposite annual pattern. The distributed lag non-linear model indicated an increasing odds ratio (OR with increasing temperature in the warm season with a highest odds ratio, with delays of 1–5 days after heat exposure. A cumulative OR for a lag time of 1 to 3 days was estimated at 2.21 at an average daily temperature of 20 °C. The change in sodium per 1 °C increase in temperature was estimated to be −0.37 mmol/L (95% CI: −0.02, −0.72. Conclusions: Warm weather appears to increase the risk of drug-induced hyponatremia
Melanocortin 1 Receptor Deficiency Promotes Atherosclerosis in Apolipoprotein E-/- Mice.
Rinne, Petteri; Kadiri, James J; Velasco-Delgado, Mauricio; Nuutinen, Salla; Viitala, Miro; Hollmén, Maija; Rami, Martina; Savontaus, Eriika; Steffens, Sabine
2018-02-01
The MC1-R (melanocortin 1 receptor) is expressed by monocytes and macrophages where it mediates anti-inflammatory actions. MC1-R also protects against macrophage foam cell formation primarily by promoting cholesterol efflux through the ABCA1 (ATP-binding cassette transporter subfamily A member 1) and ABCG1 (ATP-binding cassette transporter subfamily G member 1). In this study, we aimed to investigate whether global deficiency in MC1-R signaling affects the development of atherosclerosis. Apoe -/- (apolipoprotein E deficient) mice were crossed with recessive yellow (Mc1r e/e ) mice carrying dysfunctional MC1-R and fed a high-fat diet to induce atherosclerosis. Apoe -/- Mc1r e/e mice developed significantly larger atherosclerotic lesions in the aortic sinus and in the whole aorta compared with Apoe -/- controls. In terms of plaque composition, MC1-R deficiency was associated with less collagen and smooth muscle cells and increased necrotic core, indicative of more vulnerable lesions. These changes were accompanied by reduced Abca1 and Abcg1 expression in the aorta. Furthermore, Apoe -/- Mc1r e/e mice showed a defect in bile acid metabolism that aggravated high-fat diet-induced hypercholesterolemia and hepatic lipid accumulation. Flow cytometric analysis of leukocyte profile revealed that dysfunctional MC1-R enhanced arterial accumulation of classical Ly6C high monocytes and macrophages, effects that were evident in mice fed a normal chow diet but not under high-fat diet conditions. In support of enhanced arterial recruitment of Ly6C high monocytes, these cells had increased expression of L-selectin and P-selectin glycoprotein ligand 1. The present study highlights the importance of MC1-R in the development of atherosclerosis. Deficiency in MC1-R signaling exacerbates atherosclerosis by disturbing cholesterol handling and by increasing arterial monocyte accumulation. © 2017 The Authors.
Thymus function in drug-induced lupus.
Rubin, R L; Salomon, D R; Guerrero, R S
2001-01-01
Autoimmunity develops when a lupus-inducing drug is introduced into the thymus of normal mice, but the relevance of this model to the human disorder is unclear in part because it is widely assumed that the thymus is non-functional in the adult. We compared thymus function in 10 patients with symptomatic procainamide-induced lupus to that in 13 asymptomatic patients who only developed drug-induced autoantibodies. T cell output from the thymus was quantified using a competitive polymerase chain reaction that detects T cell receptor DNA excision circles in peripheral blood lymphocytes. Despite the advanced age of the patient population under study, newly generated T cells were detected in all subjects. Although there was no overall quantitative difference between the symptomatic and asymptomatic patients, we found a positive correlation between the level of T cell receptor excision circles in peripheral lymphocytes and serum IgG anti-chromatin antibody activity in patients with drug-induced lupus. The association between autoantibodies and nascent peripheral T cells supports the requirement for T cells in autoantibody production. Our observations are consistent with findings in mice in which autoreactive T cells derived from drug-induced abnormalities in T cell development in the thymus.
Westerterp, Marit; Murphy, Andrew J.; Wang, Mi; Pagler, Tamara A.; Vengrenyuk, Yuliya; Kappus, Mojdeh S.; Gorman, Darren J.; Nagareddy, Prabhakara R.; Zhu, Xuewei; Abramowicz, Sandra; Parks, John S.; Welch, Carrie; Fisher, Edward A.; Wang, Nan; Yvan-Charvet, Laurent; Tall, Alan R.
2013-01-01
Rationale Plasma HDL levels are inversely correlated with atherosclerosis. Although it is widely assumed that this is due to the ability of HDL to promote cholesterol efflux from macrophage foam cells, direct experimental support for this hypothesis is lacking. Objective To assess the role of macrophage cholesterol efflux pathways in atherogenesis. Methods and Results We developed MAC-ABCDKO mice with efficient deletion of the ATP Binding Cassette Transporters A1 and G1 (ABCA1 and ABCG1) in macrophages but not in hematopoietic stem or progenitor populations. MAC-ABCDKO bone marrow (BM) was transplanted into Ldlr-/- recipients. On the chow diet, these mice had similar plasma cholesterol and blood monocyte levels but increased atherosclerosis compared to controls. On the Western type diet (WTD), MAC-ABCDKO BM transplanted Ldlr-/- mice had disproportionate atherosclerosis, considering they also had lower VLDL/LDL cholesterol levels than controls. ABCA1/G1 deficient macrophages in lesions showed increased inflammatory gene expression. Unexpectedly, WTD-fed MAC-ABCDKO BM transplanted Ldlr-/- mice displayed monocytosis and neutrophilia in the absence of HSPC proliferation. Mechanistic studies revealed increased expression of M-CSF and G-CSF in splenic macrophage foam cells, driving BM monocyte and neutrophil production. Conclusion These studies 1) show that macrophage deficiency of ABCA1/G1 is pro-atherogenic likely by promoting plaque inflammation and 2) uncover a novel positive feedback loop in which cholesterol-laden splenic macrophages signal BM progenitors to produce monocytes, with suppression by macrophage cholesterol efflux pathways. PMID:23572498
Vacca, Claudia; Vargas, Claudia; Cañás, Martín; Reveiz, Ludovic
2011-02-01
To analyze differing regulations regarding drug promotion, and the extent of compliance as seen in samples of advertising directed to the public in Argentina, Colombia, Ecuador, Nicaragua, and Peru. A total of 683 pieces of promotional material on display in health facilities, pharmacies, and on the street were collected, 132 of which were randomly selected for analysis. The regulations governing pharmaceutical advertising, taken from official websites and interviews with regulatory officials and Ministry of Health staff in the five countries covered, were reviewed, along with their adherence to the ethical criteria of the World Health Organization (WHO). The contents of the materials in the sample were evaluated to determine their degree of compliance with national regulations and WHO recommendations on drug promotion. The countries have regulations incorporating WHO ethical criteria. Over 80% of the material analyzed included the indications for the drug, while over 70% omitted information on adverse effects. Fifty percent of the advertisements for over-the-counter (OTC) drugs on display in pharmacies listed indications not approved by the relevant health authority. In advertising in pharmacies, the risks from inadequate information were not found to differ significantly for OTC or prescription medications. Compared with materials provided in health facilities, the relative risk of the absence of information on dosage in the material distributed in pharmacies was 2.08 (confidence interval 95% 1.32-3.39). Although regulations on drug promotion and advertising in the five countries studied generally incorporate the WHO recommendations, promotional materials often fail to reflect the fact.
Leveraging consumer's behaviour to promote generic drugs in Italy.
Zerbini, Cristina; Luceri, Beatrice; Vergura, Donata Tania
2017-04-01
The aim of this study was to fill the lack of knowledge regarding a more grounded exploration of the consumer's decision-making process in the context of generic drugs. In this perspective, a model, within the theoretical framework of the Theory of Planned Behaviour (TPB), for studying the consumers' purchase intention of generic drugs was developed. An online survey on 2,222 Italian people who bought drugs in the past was conducted. The proposed model was tested through structural equation modelling (SEM). Almost all the constructs considered in the model, except the perceived behavioural control, contribute to explain the consumer's purchase intention of generic drugs, after controlling for demographic variables (age, income, education). Specifically, attitude, subjective norm, past behaviour, self-identity and trust in the pharmacist have a positive influence on the intention to buy generic drugs. On the contrary, perceived risk towards products and brand sensitivity act negatively. The results of the present study could be useful to public policy makers in developing effective policies and educational campaigns aimed at promoting generic drugs. Specifically, marketing efforts should be directed to inform consumers about the generic drugs' characteristics to mitigate the perceived risk towards these products and to raise awareness during their decision-making process. Copyright © 2017 Elsevier B.V. All rights reserved.
Residue analysis of veterinary drugs and growth-promoting agents
Stolker, A.A.M.; Zuidema, T.; Nielen, M.W.F.
2007-01-01
Two major trends are observed in the analysis of veterinary drugs and growth-promoting agents. First is the selection of sample material for monitoring the use of registered veterinary drugs. Traditionally meat, kidney and liver were analyzed but, due to the food scandals in which meat was very
Recent Advances in Drug-Induced Angioedema
Directory of Open Access Journals (Sweden)
Naoko Inomata
2012-01-01
Full Text Available Angioedema is the end result of deep dermal, subcutaneous and/or mucosal swelling, and is potentially a life- threatening condition in cases where the pharynx or larynx is involved. Drug-induced angioedema has been reported to occur in response to a wide range of drugs and vaccines. Drug-induced angioedema, like other cutaneous drug reactions, has been reported to be most frequently elicited by beta-lactam antibiotics and nonsteroidal anti-inflammatory drugs, although reliable data from epidemiologic studies are scarce. Recent reports suggested an increasing role of angiotensin-converting enzyme inhibitors (ACEIs in the causation of life- threatening angioedema. ACEI-related angioedema is never accompanied by urticaria and occurs via a kinin- dependent mechanism. ACEI-related angioedema not only can start years after beginning the treatment, but it can then recur irregularly while under that treatment. Furthermore, allergy tests are unreliable for the diagnosis of ACEI-related angioedema, and so the relationship between angioedema and ACEIs is often missed and consequently quite underestimated. Accordingly, better understanding of the kinin-dependent mechanism, which is particular to angioedema, is necessary for the appropriate management of drug-induced angioedema.
Guo, Mengjie; Dai, Xiaohua; Hu, Dongmin; Zhang, Yu; Sun, Yong; Ren, Weilong; Wang, Liping
2016-09-01
P-glycoprotein ( P-GP: , encoding gene Abcb1) and Breast Cancer Resistance Protein ( BCRP: , encoding gene Abcg2) are transport proteins that play a major role in modulating the bioavailability of oral drugs in humans and rodents. It has been shown that rifampicin is the typical inducer of P-gp in rodents by activating the nuclear receptor. However, its effect on Abcb1, Abcg2, CYP3A, and chicken xenobiotic-sensing orphan nuclear receptor ( CXR: ) mRNA expression in broilers is poorly understood. This study explored the effect of rifampicin on mRNA expression of Abcb1, Abcg2, CYP3A37, CXR as well as its effect on the pharmacokinetics of enrofloxacin in broilers. The mRNA levels of Abcb1, Abcg2, CYP3A37, and CXR were significantly increased in the liver (except Abcg2), kidney, jejunum, and ileum (P 0.05) after treated with rifampicin. Further analysis revealed that the variation tendencies of Abcb1, Abcg2, and CYP3A37 expression levels were significantly correlated with CXR mRNA expression levels in liver, kidney, jejunum, and ileum. Coadministration of rifampicin significantly changed the pharmacokinetic behavior of enrofloxacin orally administered by showing clearly lower AUC0-∞, AUC0-t, and Cmax as well as longer Tmax. The bioavailability of orally administered enrofloxacin was decreased from 72.5% to 24.8% by rifampicin. However, rifampicin did not significantly change the pharmacokinetics of enrofloxacin following intravenous administration. Our study shows that rifampicin up-regulated the small intestinal level of P-gp and BCRP and suggests that P-gp and BCRP are key factors that affected pharmacokinetic behavior of orally administered enrofloxacin by limiting its absorption from the intestine in broilers. © 2016 Poultry Science Association Inc.
Hypoxia-induced cytotoxic drug resistance in osteosarcoma is independent of HIF-1Alpha.
Directory of Open Access Journals (Sweden)
Jennifer Adamski
Full Text Available Survival rates from childhood cancer have improved dramatically in the last 40 years, such that over 80% of children are now cured. However in certain subgroups, including metastatic osteosarcoma, survival has remained stubbornly poor, despite dose intensive multi-agent chemotherapy regimens, and new therapeutic approaches are needed. Hypoxia is common in adult solid tumours and is associated with treatment resistance and poorer outcome. Hypoxia induces chemotherapy resistance in paediatric tumours including neuroblastoma, rhabdomyosarcoma and Ewing's sarcoma, in vitro, and this drug resistance is dependent on the oxygen-regulated transcription factor hypoxia inducible factor-1 (HIF-1. In this study the effects of hypoxia on the response of the osteosarcoma cell lines 791T, HOS and U2OS to the clinically relevant cytotoxics cisplatin, doxorubicin and etoposide were evaluated. Significant hypoxia-induced resistance to all three agents was seen in all three cell lines and hypoxia significantly reduced drug-induced apoptosis. Hypoxia also attenuated drug-induced activation of p53 in the p53 wild-type U2OS osteosarcoma cells. Drug resistance was not induced by HIF-1α stabilisation in normoxia by cobalt chloride nor reversed by the suppression of HIF-1α in hypoxia by shRNAi, siRNA, dominant negative HIF or inhibition with the small molecule NSC-134754, strongly suggesting that hypoxia-induced drug resistance in osteosarcoma cells is independent of HIF-1α. Inhibition of the phosphoinositide 3-kinase (PI3K pathway using the inhibitor PI-103 did not reverse hypoxia-induced drug resistance, suggesting the hypoxic activation of Akt in osteosarcoma cells does not play a significant role in hypoxia-induced drug resistance. Targeting hypoxia is an exciting prospect to improve current anti-cancer therapy and combat drug resistance. Significant hypoxia-induced drug resistance in osteosarcoma cells highlights the potential importance of hypoxia as a target
Molecular Mechanisms of Antipsychotic Drug-Induced Diabetes
Directory of Open Access Journals (Sweden)
Jiezhong Chen
2017-11-01
Full Text Available Antipsychotic drugs (APDs are widely prescribed to control various mental disorders. As mental disorders are chronic diseases, these drugs are often used over a life-time. However, APDs can cause serious glucometabolic side-effects including type 2 diabetes and hyperglycaemic emergency, leading to medication non-compliance. At present, there is no effective approach to overcome these side-effects. Understanding the mechanisms for APD-induced diabetes should be helpful in prevention and treatment of these side-effects of APDs and thus improve the clinical outcomes of APDs. In this review, the potential mechanisms for APD-induced diabetes are summarized so that novel approaches can be considered to relieve APD-induced diabetes. APD-induced diabetes could be mediated by multiple mechanisms: (1 APDs can inhibit the insulin signaling pathway in the target cells such as muscle cells, hepatocytes and adipocytes to cause insulin resistance; (2 APD-induced obesity can result in high levels of free fatty acids (FFA and inflammation, which can also cause insulin resistance. (3 APDs can cause direct damage to β-cells, leading to dysfunction and apoptosis of β-cells. A recent theory considers that both β-cell damage and insulin resistance are necessary factors for the development of diabetes. In high-fat diet-induced diabetes, the compensatory ability of β-cells is gradually damaged, while APDs cause direct β-cell damage, accounting for the severe form of APD-induced diabetes. Based on these mechanisms, effective prevention of APD-induced diabetes may need an integrated approach to combat various effects of APDs on multiple pathways.
Targeting Oct2 and P53: Formononetin prevents cisplatin-induced acute kidney injury
Energy Technology Data Exchange (ETDEWEB)
Huang, Di [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian (China); Wang, Chuangyuan [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Dalian, Liaoning (China); Duan, Yingjie [General hospital of Fuxin mining (Group) Co., Ltd (China); Meng, Qiang; Liu, Zhihao; Huo, Xiaokui; Sun, Huijun; Ma, Xiaodong [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Dalian, Liaoning (China); Liu, Kexin, E-mail: kexinliu@dlmedu.edu.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Dalian, Liaoning (China)
2017-07-01
Nephrotoxicity is one of major side effects of cisplatin in chemotherapy. Therefore, there is an urgent medical need to develop drugs that may protect kidney from toxicity. In previous study, we found that it showed the protective effects of formononetin against apoptosis by upregulating Nrf2. In this study, we investigated the renoprotective effect of formononetin against cisplatin-induced AKI and tried to elucidate the possible mechanisms. The amelioration of renal function, histopathological changes, and apoptosis in tubular cells was observed after formononetin treatment. Formononetin decreased expression of organic cation transporter 2 (Oct2) and increased the expressions of multidrug resistance-associated proteins (Mrps), which might result in a decrease accumulation of cisplatin in tubular cells after AKI. 5-Bromo-2-deoxyuridine (BrdU) and Ki-67 staining assay indicated that formononetin could promote the renal tubular cells proliferation after cisplatin nephrotoxicity. Moreover, formononetin regulated cyclins and pro-apoptotic proteins to involve the regulation of cell cycle. Furthermore, formononetin decreased p53 expression via promoting the overexpression of murine double minute 2 (MDM2) and MDMX. Taken together, formononetin provided protective effects by promoting proliferation of surviving renal tubular cells and inhibiting apoptosis after cisplatin-induced AKI. - Highlights: • Formononetin ameliorated the cisplatin-induced AKI. • Oct2 were reduced by formononetin. • Protective effect of formononetin was closely related to the reduction of cisplatin.
Targeting Oct2 and P53: Formononetin prevents cisplatin-induced acute kidney injury
International Nuclear Information System (INIS)
Huang, Di; Wang, Chuangyuan; Duan, Yingjie; Meng, Qiang; Liu, Zhihao; Huo, Xiaokui; Sun, Huijun; Ma, Xiaodong; Liu, Kexin
2017-01-01
Nephrotoxicity is one of major side effects of cisplatin in chemotherapy. Therefore, there is an urgent medical need to develop drugs that may protect kidney from toxicity. In previous study, we found that it showed the protective effects of formononetin against apoptosis by upregulating Nrf2. In this study, we investigated the renoprotective effect of formononetin against cisplatin-induced AKI and tried to elucidate the possible mechanisms. The amelioration of renal function, histopathological changes, and apoptosis in tubular cells was observed after formononetin treatment. Formononetin decreased expression of organic cation transporter 2 (Oct2) and increased the expressions of multidrug resistance-associated proteins (Mrps), which might result in a decrease accumulation of cisplatin in tubular cells after AKI. 5-Bromo-2-deoxyuridine (BrdU) and Ki-67 staining assay indicated that formononetin could promote the renal tubular cells proliferation after cisplatin nephrotoxicity. Moreover, formononetin regulated cyclins and pro-apoptotic proteins to involve the regulation of cell cycle. Furthermore, formononetin decreased p53 expression via promoting the overexpression of murine double minute 2 (MDM2) and MDMX. Taken together, formononetin provided protective effects by promoting proliferation of surviving renal tubular cells and inhibiting apoptosis after cisplatin-induced AKI. - Highlights: • Formononetin ameliorated the cisplatin-induced AKI. • Oct2 were reduced by formononetin. • Protective effect of formononetin was closely related to the reduction of cisplatin.
Dopamine receptor D4 promoter hypermethylation increases the risk of drug addiction.
Ji, Huihui; Xu, Xuting; Liu, Guili; Liu, Huifen; Wang, Qinwen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Hu, Haochang; Xu, Lei; Zhou, Wenhua; Duan, Shiwei
2018-02-01
Heroin and methylamphetamine (METH) are two addictive drugs that cause serious problems for society. Dopamine receptor D4 (DRD4), a key receptor in the dopaminergic system, may facilitate the development of drug addiction. The aim of the present study was to investigate the association between the promoter methylation level of DRD4 gene and drug addiction. Bisulfite pyrosequencing technology was used to measure the methylation levels of DRD4 promoter in 60 drug addicts and 52 matched controls. Significantly higher levels of DRD4 CpG1 and CpG4 methylation were detected in METH and heroin drug addicts compared with controls (Pdrug addiction.
International Nuclear Information System (INIS)
Guerrero M, M.G.
2004-01-01
The chlorophyllin (CHLN) it is a porphyrin of soluble nutritious grade in water, derived of the chlorophyll that includes in their structure a copper atom. It has been reported that this pigment can act as anti mutagen, reducing the damage to the DNA caused by physical or chemical agents of direct or indirect action. Their anti carcinogen action has also been studied during the initiation phase induced for carcinogen as the aflatoxins and heterocyclic amines. In contrast the reports have increased on a probable promoter activity of the CHLN on the induced genetic damage. This effect was seen for the first time before the damage induced by alkylating agents in Salmonella. Recently it has been observed with the damage induced by gamma radiation, ENU and CrO 3 in somatic cells of the wing of Drosophila and in the induction of tumors for 1,2-dimethylhydrazine (DMH) in mice. Presently study is evaluated the protective effect or promoter of the CHLN before the genetic damage induced by 1,2-dimethylhydrazine, by means of the bioassay mutation and somatic recombination (SMART) in the wing of Drosophila melanogaster. Its were pretreated with CHLN or SAC to transheterocygotes larvas for two locus of the chromosome three mwh+/+flr 3 ; later on they are retarded the chronic treatment with DMH 0, 1, 2 and 3 days. It was measured the toxicity and the speed of development of the treated individuals. The wings of those adults that emerged were analyzed to register the number and the size of stains. The results indicated: differences in the viability of the individuals of the groups SAC + DMH vs CHLN + DMH only in the treated immediately after the pretreatment (DRT-0) that the CHLN doesn't modify the rate of the treated individuals development. The results of somatic mutation indicated that the CHLN has a protective effect only immediately after the pretreatment (DRT-0) however in DRT-1, 2 and 3 showed a promoter effect of genetic damage. (Author)
A significant association between BDNF promoter methylation and the risk of drug addiction.
Xu, Xuting; Ji, Huihui; Liu, Guili; Wang, Qinwen; Liu, Huifen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Zhou, Wenhua; Duan, Shiwei
2016-06-10
As a member of the neurotrophic factor family, brain derived neurotrophic factor (BDNF) plays an important role in the survival and differentiation of neurons. The aim of our work was to evaluate the role of BDNF promoter methylation in drug addiction. A total of 60 drug abusers (30 heroin and 30 methylamphetamine addicts) and 52 healthy age- and gender-matched controls were recruited for the current case control study. Bisulfite pyrosequencing technology was used to determine the methylation levels of five CpGs (CpG1-5) on the BDNF promoter. Among the five CpGs, CpG5 methylation was significantly lower in drug abusers than controls. Moreover, significant associations were found between CpG5 methylation and addictive phenotypes including tension-anxiety, anger-hostility, fatigue-inertia, and depression-dejection. In addition, luciferase assay showed that the DNA fragment of BDNF promoter played a key role in the regulation of gene expression. Our results suggest that BDNF promoter methylation is associated with drug addiction, although further studies are needed to understand the mechanisms by which BDNF promoter methylation contributes to the pathophysiology of drug addiction. Copyright © 2016. Published by Elsevier B.V.
Energy Technology Data Exchange (ETDEWEB)
Li, Jing [Department of Geratory, Linzi District People’s Hospital of Zibo City, Zibo, Shandong (China); Zhang, Suhua, E-mail: drsuhuangzhang@qq.com [Department of HealthCare, Qilu Hospital of Shandong University (Qingdao), Qingdao City, Qingdao (China)
2016-08-05
Transformation of macrophages into foam cells plays a critical role in the pathogenesis of atherosclerosis. The aim of this study was to determine the expression and biological roles of microRNA (miR)-150 in the formation of macrophage foam cells and to identify its functional target(s). Exposure to 50 μg/ml oxidized low-density lipoprotein (oxLDL) led to a significant upregulation of miR-150 in THP-1 macrophages. Overexpression of miR-150 inhibited oxLDL-induced lipid accumulation in THP-1 macrophages, while knockdown of miR-150 enhanced lipid accumulation. apoA-I- and HDL-mediated cholesterol efflux was increased by 66% and 43%, respectively, in miR-150-overexpressing macrophages relative to control cells. In contrast, downregulation of miR-150 significantly reduced cholesterol efflux from oxLDL-laden macrophages. Bioinformatic analysis and luciferase reporter assay revealed adiponectin receptor 2 (AdipoR2) as a direct target of miR-150. Small interfering RNA-mediated downregulation of AdipoR2 phenocopied the effects of miR-150 overexpression, reducing lipid accumulation and facilitating cholesterol efflux in oxLDL-treated THP-1 macrophages. Knockdown of AdipoR2 induced the expression of proliferator-activated receptor gamma (PPARγ), liver X receptor alpha (LXRα), ABCA1, and ABCG1. Moreover, pharmacological inhibition of PPARγ or LXRα impaired AdipoR2 silencing-induced upregulation of ABCA1 and ABCG1. Taken together, our results indicate that miR-150 can attenuate oxLDL-induced lipid accumulation in macrophages via promotion of cholesterol efflux. The suppressive effects of miR-150 on macrophage foam cell formation are mediated through targeting of AdipoR2. Delivery of miR-150 may represent a potential approach to prevent macrophage foam cell formation in atherosclerosis. -- Highlights: •miR-150 inhibits macrophage foam cell formation. •miR-150 accelerates cholesterol efflux from oxLDL-laden macrophages. •miR-150 suppresses macrophage foam cell
Drug-induced gynecomastia in children and adolescents
Goldman, Ran D.
2010-01-01
ABSTRACT QUESTION I frequently see adolescent boys in my practice with transient gynecomastia. My management includes reassuring the boys and their families; however, I also understand that specific medication, alcohol, and drugs can cause gynecomastia. How common is this phenomenon, and what medications can induce gynecomastia? ANSWER While gynecomastia is a physiologic phenomenon in most newborns and adolescents, it is important to consider pathologic conditions and medications that can cause breast enlargement. Antibiotics, antiulcer drugs, growth hormones, and chemotherapy have been reported to induce gynecomastia. Adolescents who use anabolic steroids, or who abuse alcohol, marijuana, heroin, or amphetamines, should be alerted to the fact that gynecomastia might develop. Treatment of drug-induced gynecomastia includes discontinuation of the offending drug. Very rarely is surgical intervention required. PMID:20393092
2012-03-05
...,'' ``promotional materials,'' ``patient education materials,'' and ``individual departments.'' We disagree with the... supply, or therapeutic indication be submitted to a specific approval authority. With respect to... and associated materials regarding (1) a drug, drug-related supply, or new therapeutic indication for...
Drug-induced psoriasis: clinical perspectives
Directory of Open Access Journals (Sweden)
Balak DMW
2017-12-01
Full Text Available Deepak MW Balak, Enes Hajdarbegovic Department of Dermatology, Erasmus University Medical Center, Rotterdam, the Netherlands Abstract: Exposure to certain drugs can elicit an induction or exacerbation of psoriasis. Although well-conducted systematic studies on drug-related psoriasis are mostly lacking, traditionally strong associations have been documented for beta-blockers, lithium, antimalarial drugs such as (hydroxychloroquine, interferons, imiquimod, and terbinafine. More recently, new associations have been reported for monoclonal antibody- and small-molecule-based targeted therapies used for oncological and immunological indications, such as tumor necrosis factor-alpha antagonists and anti-programmed cell death protein 1 immune checkpoint inhibitors. Recognizing potential drug-related psoriasis is of clinical relevance to allow an optimal management of psoriasis. However, in clinical practice, identifying medication-related exacerbations and induction of psoriasis can be challenging. The clinical and histopathological features of drug-provoked psoriasis may differ little from that of “classical” nondrug-related forms of psoriasis. In addition, the latency period between start of the medication and onset of psoriasis can be significantly long for some drugs. Assessment of the Naranjo adverse drug reaction probability scale could be used as a practical tool to better differentiate drug-related psoriasis. The first step in the management of drug-related psoriasis is cessation and replacement of the offending drug when deemed clinically possible. However, the induced psoriasis skin lesions may persist after treatment withdrawal. Additional skin-directed treatment options for drug-related psoriasis follows the conventional psoriasis treatment guidelines and includes topical steroids and vitamin D analogs, ultraviolet phototherapy, systemic treatments, such as acitretin, methotrexate, and fumaric acid esters, and biological treatments
Directory of Open Access Journals (Sweden)
Satoshi Takagi
Full Text Available The platelet aggregation-inducing factor Aggrus, also known as podoplanin, is frequently upregulated in several types of tumors and enhances hematogenous metastasis by interacting with and activating the platelet receptor CLEC-2. Thus, Aggrus-CLEC-2 binding could be a therapeutic molecular mechanism for cancer therapy. We generated a new anti-human Aggrus monoclonal antibody, MS-1, that suppressed Aggrus-CLEC-2 binding, Aggrus-induced platelet aggregation, and Aggrus-mediated tumor metastasis. Interestingly, the MS-1 monoclonal antibody attenuated the growth of Aggrus-positive tumors in vivo. Moreover, the humanized chimeric MS-1 antibody, ChMS-1, also exhibited strong antitumor activity against Aggrus-positive lung squamous cell carcinoma xenografted into NOD-SCID mice compromising antibody-dependent cellular cytotoxic and complement-dependent cytotoxic activities. Because Aggrus knockdown suppressed platelet-induced proliferation in vitro and tumor growth of the lung squamous cell carcinoma in vivo, Aggrus may be involved in not only tumor metastasis but also tumor growth by promoting platelet-tumor interaction, platelet activation, and secretion of platelet-derived factors in vivo. Our results indicate that molecular target drugs inhibiting specific platelet-tumor interactions can be developed as antitumor drugs that suppress both metastasis and proliferation of tumors such as lung squamous cell carcinoma.
Prevalence and Complications of Drug-induced Seizures in Baharloo Hospital, Tehran, Iran
Directory of Open Access Journals (Sweden)
Behnam Behnoush
2012-05-01
Full Text Available Background: Seizure is a frequent and important finding in the field of clinical toxicology. Almost all poisons and drugs can produce seizure. We have evaluated frequency and complications of drug-induced seizure in present study. Methods: The present descriptive cross-sectional study was done on patients who were referred to Baharloo Hospital, Tehran, Iran, that had developed seizure before or after hospitalization following intoxication between 20 March 2010 and 20 March 2011. The exclusion criteria were a positive history of epilepsy, head trauma, or abnormal findings in EEG or brain CT scan. Results: Tramadol and tricyclic antidepressants were the most common causes of drug-induced seizure (31.5% and 14.7% of the cases, respectively. Overall, 6 patients (4.2% had developed persistent vegetative state in consequence of brain hypoxia, 16 patients (11.2% had died due to complications of seizure or the poisoning itself. Tramadol was the leading cause of drug-induced seizure and its morbidity and mortality. Tonic-colonic seizure was the most common type of drug-induced seizure. Seizure had occurred once in 58% of the patients, twice in 37.1% of the patients, and had been revolutionized to status epilepticus in 4.9% of them. Among the 7 patients who had developed status epilepticus, 3 cases had died. Conclusion: Appropriate measures for treatment of seizure and prevention of its complications should be taken when patients with drug poisoning are admitted into hospital, especially when the offending drug(s has a higher likelihood to induce seizure.
Tran, Dinh Thi Minh; Phan, Trang Thi Phuong; Huynh, Thanh Kieu; Dang, Ngan Thi Kim; Huynh, Phuong Thi Kim; Nguyen, Tri Minh; Truong, Tuom Thi Tinh; Tran, Thuoc Linh; Schumann, Wolfgang; Nguyen, Hoang Duc
2017-07-25
the inducible vector using the same promoter. Finally, we used gfp as a reporter gene in combination with the two promoters Pgrac01 and Pgrac100 to test the new vector types. The GFP expression levels could be repressed at least 1.5 times for the Pgrac01-gfp+ inducer-free construct in E. coli. The inducer-free constructs Pgrac01-gfp+ and Pgrac100-gfp+ allowed GFP expression at high levels from 23 × 10 4 to 32 × 10 4 RFU units and 9-13% of total intracellular proteins. We could reconfirm the two major advantages of the new inducer-free expression plasmids: (1) Strong repression of the target gene expression in the E. coli cloning strain, and (2) production of the target protein at high levels in B. subtilis in the absence of the inducer. We propose a general strategy to generate inducer-free expression vector by using IPTG-inducible vectors, and more specifically we developed inducer-free expression plasmids using IPTG-inducible promoters in the absence of the LacI repressor. These plasmids could be an excellent choice for high-level production of recombinant proteins in B. subtilis without the addition of inducer and at the same time maintaining a low basal level of the recombinant proteins in E. coli. The repression of the recombinant gene expression would facilitate cloning of genes that potentially inhibit the growth of E. coli cloning strains. The inducer-free expression plasmids will be extended versions of the current available IPTG-inducible expression vectors for B. subtilis, in which all these vectors use the same cognate promoters. These inducer-free and previously developed IPTG-inducible expression plasmids will be a useful cassette to study gene expression at a small scale up to a larger scale up for the production of recombinant proteins.
Lasseter, Heather C; Xie, Xiaohu; Arguello, Amy A; Wells, Audrey M; Hodges, Matthew A; Fuchs, Rita A
2014-02-01
Cocaine-seeking behavior triggered by drug-paired environmental context exposure is dependent on orbitofrontal cortex (OFC)-basolateral amygdala (BLA) interactions. Here, we present evidence supporting the hypothesis that dopaminergic input from the ventral tegmental area (VTA) to the OFC critically regulates these interactions. In experiment 1, we employed site-specific pharmacological manipulations to show that dopamine D1-like receptor stimulation in the OFC is required for drug context-induced reinstatement of cocaine-seeking behavior following extinction training in an alternate context. Intra-OFC pretreatment with the dopamine D1-like receptor antagonist, SCH23390, dose-dependently attenuated cocaine-seeking behavior in an anatomically selective manner, without altering motor performance. Furthermore, the effects of SCH23390 could be surmounted by co-administration of a sub-threshold dose of the D1-like receptor agonist, SKF81297. In experiment 2, we examined effects of D1-like receptor antagonism in the OFC on OFC-BLA interactions using a functional disconnection manipulation. Unilateral SCH23390 administration into the OFC plus GABA agonist-induced neural inactivation of the contralateral or ipsilateral BLA disrupted drug context-induced cocaine-seeking behavior relative to vehicle, while independent unilateral manipulations of these brain regions were without effect. Finally, in experiment 3, we used fluorescent retrograde tracers to demonstrate that the VTA, but not the substantia nigra, sends dense intra- and interhemispheric projections to the OFC, which in turn has reciprocal bi-hemispheric connections with the BLA. These findings support that dopaminergic input from the VTA, via dopamine D1-like receptor stimulation in the OFC, is required for OFC-BLA functional interactions. Thus, a VTA-OFC-BLA neural circuit promotes drug context-induced motivated behavior.
Directory of Open Access Journals (Sweden)
Jun Zhang
Full Text Available The pregnane X receptor (PXR was previously known as a xenobiotic receptor. Several recent studies suggested that PXR also played an important role in lipid homeostasis but the underlying mechanism remains to be clearly defined. In this study, we found that rifampicin, an agonist of human PXR, induced lipid accumulation in HepG2 cells. Lipid analysis showed the total cholesterol level increased. However, the free cholesterol and triglyceride levels were not changed. Treatment of HepG2 cells with rifampicin induced the expression of the free fatty acid transporter CD36 and ABCG1, as well as several lipogenic enzymes, including stearoyl-CoA desaturase-1 (SCD1, long chain free fatty acid elongase (FAE, and lecithin-cholesterol acyltransferase (LCAT, while the expression of acyl:cholesterol acetyltransferase(ACAT1 was not affected. Moreover, in PXR over-expressing HepG2 cells (HepG2-PXR, the SCD1 expression was significantly higher than in HepG2-Vector cells, even in the absence of rifampicin. Down-regulation of PXR by shRNA abolished the rifampicin-induced SCD1 gene expression in HepG2 cells. Promoter analysis showed that the human SCD1 gene promoter is activated by PXR and a novel DR-7 type PXR response element (PXRE response element was located at -338 bp of the SCD1 gene promoter. Taken together, these results indicated that PXR activation promoted lipid synthesis in HepG2 cells and SCD1 is a novel PXR target gene.
Promoter Methylation and BDNF and DAT1 Gene Expression Profiles in Patients with Drug Addiction.
Kordi-Tamandani, Dor Mohammad; Tajoddini, Shahrad; Salimi, Farzaneh
2015-01-01
Drug addiction is a brain disorder that has negative consequences for individuals and society. Addictions are chronic relapsing diseases of the brain that are caused by direct drug-induced effects and persevering neuroadaptations at the epigenetic, neuropeptide and neurotransmitter levels. Because the dopaminergic system has a significant role in drug abuse, the purpose of this study was to analyze the methylation and expression profile of brain-derived neurotrophic factor (BDNF) and dopamine transporter (DAT1) genes in individuals with drug addiction. BDNF and DAT1 promoter methylation were investigated with a methylation-specific polymerase chain reaction (PCR) technique in blood samples from 75 individuals with drug addiction and 65 healthy controls. The expression levels of BDNF and DAT1 were assessed in 12 mRNA samples from the blood of patients and compared to the samples of healthy controls (n = 12) with real-time quantitative reverse transcription PCR. No significant differences were found in the methylation of BDNF and DAT1 between patients and controls, but the relative levels of expression of BDNF and DAT1 mRNA differed significantly in the patients compared to controls (p drug addiction.
Directory of Open Access Journals (Sweden)
Ling Yang
2013-01-01
Full Text Available Abstract Background To evaluate the promoter methylation status of MUC2 gene and mRNA expression in patients with hepatocellular carcinoma. Methods We analyzed MUC2 methylation by MSP, and MUC2 mRNA by real-time PCR in 74 HCC. Results MUC2 mRNA were lower in HCC tissues (Mean -ΔCt = −4.70 than that in Non-HCC tissues (Mean -ΔCt = −2.98. Expression of MUC2 was elevated in only 23 (31.08% of the 74 HCC patients. MUC2 promoter was hypermethylated in 62.2% (46/74 of HCCs, and in only 18.9% (14/74 of non-tumor samples. MUC2 mRNA were lower in HCC patients with hypermethylation (Mean -ΔΔCt = −2.25 than those with demethylation (Mean -ΔΔCt = −0.22, and there is a decreased tendency for MUC2 mRNA in HCC patients with promoter hypermethylation (p = 0.011. There was a significantly correlation found between MUC2 mRNA and HBV and AFP in HCC. The loss of MUC2 mRNA and hypermethylation could be poor prognostic factors. After treated by 5-Aza-CdR and TSA, we found that MUC2 mRNA induced significantly in 7721, Huh7 and HepG2 cells. Conclusion The results suggested that MUC2 mRNA silenced by promoter hypermethylation is associated with high levels HBV in HCC.
Antithyroid Drug-induced Agranulocytosis
Directory of Open Access Journals (Sweden)
Ming-Tsung Sun
2009-08-01
Full Text Available Antithyroid drugs are widely used to treat hyperthyroidism, especially Graves' disease, but they tend to cause agranulocytosis, which increases the mortality rate. Granulocyte colony-stimulating factor decreases the duration of recovery from agranulocytosis. We retrospectively studied cases of antithyroid drug-induced agranulocytosis over the past 10 years in a northern Taiwan medical center. A clinical evaluation was conducted, including a review of complete blood cell counts and differential counts. Four cases were included in this analysis. Agranulocytosis persisted in 2 cases despite a change in therapy from propylthiouracil to methimazole. Fever, sore throat, and diarrhea were common symptoms of agranulocytosis. Initial white blood cell counts ranged from 450 to 1,710/μL. Only 1 case had a positive result from a throat swab culture (Staphylococcus aureus. Three of 4 cases received granulocyte colony-stimulating factor therapy, and the recovery time ranged from 3 to 13 days. All of the patients recovered from agranulocytosis. We concluded that: (1 conducting a routine complete blood cell count is beneficial in alerting caregivers to the possibility of agranulocytosis; (2 educating patients about the common symptoms of agranulocytosis may contribute to an early diagnosis; (3 providing granulocyte colony-stimulating factor therapy to patients results in good prognosis; and (4 monitoring for cross-reactions between drugs should be performed to prevent further episodes of agranulocytosis.
The Platelet Aggregation-Inducing Factor Aggrus/Podoplanin Promotes Pulmonary Metastasis
Kunita, Akiko; Kashima, Takeshi G.; Morishita, Yasuyuki; Fukayama, Masashi; Kato, Yukinari; Tsuruo, Takashi; Fujita, Naoya
2007-01-01
Tumor cell-induced platelet aggregation has been reported to facilitate hematogenous metastasis. Aggrus/podoplanin is a platelet aggregation-inducing factor that is up-regulated in a number of human cancers and has been implicated in tumor progression. We studied herein the role of Aggrus in tumor growth, metastasis, and survival in vivo. Aggrus expression in Chinese hamster ovary cells promoted pulmonary metastasis in both an experimental and a spontaneous mouse model. No differences in the size of metastatic foci or in primary tumor growth were found in either set of mice. Aggrus-expressing cells, which were covered with platelets, arrested in the lung microvasculature 30 minutes after injection. In addition, lung metastasis resulting from Aggrus expression decreased the survival of the mice. By generating several Aggrus point mutants, we revealed that point mutation at the platelet aggregation-stimulating domain of Aggrus (Thr34 and Thr52) obliterated both platelet aggregation and metastasis. Furthermore, administration of aspirin to mice reduced the number of metastatic foci. These results indicate that Aggrus contributes to the establishment of metastasis by promoting platelet aggregation without affecting subsequent growth. Thus, Aggrus could serve as an ideal therapeutic target for drug development to block metastasis. PMID:17392172
Vitiligo, drug induced (image)
... this person's face have resulted from drug-induced vitiligo. Loss of melanin, the primary skin pigment, occasionally ... is the case with this individual. The typical vitiligo lesion is flat and depigmented, but maintains the ...
Tranexamic acid-induced fixed drug eruption
Directory of Open Access Journals (Sweden)
Natsuko Matsumura
2015-01-01
Full Text Available A 33-year-old male showed multiple pigmented patches on his trunk and extremities after he took tranexamic acid for common cold. He stated that similar eruptions appeared when he was treated with tranexamic acid for influenza 10 months before. Patch test showed positive results at 48 h and 72 h by 1% and 10% tranexamic acid at the lesional skin only. To our knowledge, nine cases of fixed drug eruption induced by tranexamic acid have been reported in Japan. Tranexamic acid is a safe drug and frequently used because of its anti-fibrinolytic and anti-inflammatory effects, but caution of inducing fixed drug eruption should be necessary.
International Nuclear Information System (INIS)
Liang Xin; Xu Ke; Xu Yufang; Liu Jianwen; Qian Xuhong
2011-01-01
The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report here that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P 2 promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research highlights: → B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. → B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. → B1 induced significant increase of p53 binding to Bcl-2 P 2 promoter TATA box.
He, Chao; Chen, Ying; Liu, Chun; Cao, Ming; Fan, Yu-jin; Guo, Xiao-mei
2013-04-01
Mitofusin2 (Mfn2) plays a pivotal role in the proliferation and apoptosis of vascular smooth muscle cells (VSMCs). The purpose of this study was to investigate the effects of Mfn2 on the trafficking of intracellular cholesterol in the foam cells derived from rat VSMCs (rVSMCs) and also to investigate the effects of Mfn2 on the expression of adenosine triphosphate-binding cassette subfamily A member 1 (ABCA1), adenosine triphosphate-binding cassette subfamily G member 1 (ABCG1) and peroxisome proliferator-activated receptor gamma (PPARγ). The rVSMCs were co-cultured with oxidized low density lipoprotein (LDL, 80 μg/mL) to produce foam cells and cholesterol accumulation in cells. Before oxidized LDL treatment, different titers (20, 40 and 60 pfu/cell) of recombinant adenovirus containing Mfn2 gene (Adv-Mfn2) were added into the culture medium for 24 h to transfect the Mfn2 gene into the rVSMCs. Then the cells were harvested for analyses. The protein expression of Mfn2 was significantly higher in Adv-Mfn2-transfected group than in untransfected group (PLDL treatment, rVSMCs became irregular and their nuclei became larger, and their plasma abounded with red lipid droplets. However, the number of red lipid droplets was significantly decreased in Adv-Mfn2-transfected group as compared with untransfected group. At 48 h after oxidized LDL treatment, the intracellular cholesterol in rVSMCs was significantly increased (P0.05), the phosporylation levels of PPARγ were significantly decreased in Adv-Mfn2-transfected group as compared with untransfected group (Pcholesterol in oxidized LDL-induced rVSMCs possibly by decreasing PPARγ phosporylation and then increasing protein expression levels of ABCA1 and ABCG1, which may be helpful to suppress the formation of foam cells.
Comparison of clinical features between primary and drug-induced sleep-related eating disorder
Directory of Open Access Journals (Sweden)
Komada Y
2016-05-01
Full Text Available Yoko Komada,1 Yoshikazu Takaesu,2 Kentaro Matsui,3 Masaki Nakamura,3 Shingo Nishida,3 Meri Kanno,3,† Akira Usui,3 Yuichi Inoue1,3 1Department of Somnology, 2Department of Psychiatry, Tokyo Medical University, 3Japan Somnology Center, Institute of Neuropsychiatry, Tokyo, Japan †Meri Kanno passed away on March 1, 2016 Purpose: The aim of this study was to ascertain the clinical characteristics of drug-induced sleep-related eating disorder (SRED. Patients and methods: We retrospectively reviewed the medical records of 30 patients with primary SRED (without any comorbid sleep disorders and who were not taking any possible causative medications, and ten patients with drug-induced SRED (occurrence of SRED episodes after starting nightly medication of sedative drugs, which completely resolved after dose reduction or discontinuation of the sedatives. Results: All patients with drug-induced SRED took multiple types of sedatives, such as benzodiazepines or benzodiazepine receptor agonists. Clinical features of drug-induced SRED compared with primary SRED were as follows: higher mean age of onset (40 years old in drug-induced SRED vs 26 years old in primary SRED, significantly higher rate of patients who had total amnesia during most of their SRED episodes (75.0% vs 31.8%, significantly lower rate of comorbidity of night eating syndrome (0% vs 63.3%, and significantly lower rate of history of sleepwalking (10.0% vs 46.7%. Increased doses of benzodiazepine receptor agonists may be responsible for drug-induced SRED. Conclusion: The clinical features of drug-induced SRED were different from those of primary SRED, possibly reflecting differences in the underlying mechanisms between these two categories of SREDs. Keywords: nocturnal eating syndrome, night eating, eating disorder, hypnotics, amnesia, sleepwalking, benzodiazepine
Nonacetaminophen Drug-Induced Acute Liver Failure.
Thomas, Arul M; Lewis, James H
2018-05-01
Acute liver failure of all causes is diagnosed in between 2000 and 2500 patients annually in the United States. Drug-induced acute liver failure is the leading cause of acute liver failure, accounting for more than 50% of cases. Nonacetaminophen drug injury represents 11% of all cases in the latest registry from the US Acute Liver Failure Study Group. Although rare, acute liver failure is clinically dramatic when it occurs, and requires a multidisciplinary approach to management. In contrast with acetaminophen-induced acute liver failure, non-acetaminophen-induced acute liver failure has a more ominous prognosis with a lower liver transplant-free survival. Copyright © 2018 Elsevier Inc. All rights reserved.
Gan, Fang; Hu, Zhihua; Huang, Yu; Xue, Hongxia; Huang, Da; Qian, Gang; Hu, Junfa; Chen, Xingxiang; Wang, Tian; Huang, Kehe
2016-01-01
Porcine circovirus type 2 (PCV2) is the primary cause of porcine circovirus disease, and ochratoxin A (OTA)-induced oxidative stress promotes PCV2 replication. In humans, selenoprotein S (SelS) has antioxidant ability, but it is unclear whether SelS affects viral infection. Here, we stably transfected PK15 cells with pig pCDNA3.1-SelS to overexpress SelS. Selenium (Se) at 2 or 4 μM and SelS overexpression blocked the OTA-induced increases of PCV2 DNA copy number and infected cell numbers. SelS overexpression also increased glutathione (GSH), NF-E2-related factor 2 (Nrf2) mRNA, and γ-glutamyl-cysteine synthetase mRNA levels; decreased reactive oxygen species (ROS) levels; and inhibited p38 phosphorylation in PCV2-infected PK15 cells, regardless of OTA treatment. Buthionine sulfoximine reversed all of the above SelS-induced changes. siRNA-mediated SelS knockdown decreased Nrf2 mRNA and GSH levels, increased ROS levels, and promoted PCV2 replication in OTA-treated PK15 cells. These data indicate that pig SelS blocks OTA-induced promotion of PCV2 replication by inhibiting the oxidative stress and p38 phosphorylation in PK15 cells. PMID:26943035
Directory of Open Access Journals (Sweden)
Shabeesh Balan
Full Text Available Epilepsy constitutes a heterogeneous group of disorders that is characterized by recurrent unprovoked seizures due to widely different etiologies. Multidrug resistance remains a major issue in clinical epileptology, where one third of patients with epilepsy continue to have seizures. Role of efflux transporters in multidrug resistant epilepsy has been attributed to drug-resistant epilepsy although, with discrepant observation in genetic studies. These discrepancies could be attributed to variety of factors such as variable definition of the anti-epileptic drug (AED-resistance, variable epilepsy phenotypes and ethnicities among the studies. In the present study we inquired the role of multidrug transporters ABCB1 and ABCG2 variants in determining AED-resistance and susceptibility to epilepsy in three well-characterized cohorts comprising of mesial temporal lobe epilepsy with hippocampal sclerosis (MTLE-HS (prototype for AED-resistant epilepsy; juvenile myoclonic epilepsy (JME (prototype for AED-responsive epilepsy; and healthy non-epileptic controls, in 738 subjects of Malayalam speaking south Indian ancestry. ABCB1 and ABCG2 variants were not found to be associated with drug resistance when AED-resistant and AED-responsive cohorts were compared. However, a significant association was observed between ABCB1 (C3435T rs1045642 and risk of having epilepsy (MTLE-HS and JME pooled cohort; genotypic p-value = 0.0002; allelic p-value = 0.004. This association was seen persistent with MTLE-HS (genotypic p-value = 0.0008; allelic p-value = 0.004 and also with JME (genotypic p-value = 0.01; allelic p-value = 0.05 cohort individually. In-silico functional prediction indicated that ABCB1 rs1045642 has a deleterious impact on protein coding function and in splicing regulation. We conclude that the ABCB1 and ABCG2 variants do not confer to AED-resistance in the study population. However, ABCB1 rs1045642 increases vulnerability to epilepsy with greater tendency
Directory of Open Access Journals (Sweden)
Rolf Warta
Full Text Available Drug transporters such as P-glycoprotein (ABCB1 have been associated with chemotherapy resistance and are considered unfavorable prognostic factors for survival of cancer patients. Analyzing mRNA expression levels of a subset of drug transporters by quantitative reverse transcription polymerase chain reaction (qRT-PCR or protein expression by tissue microarray (TMA in tumor samples of therapy naïve stage IV head and neck squamous cell carcinoma (HNSCC (qRT-PCR, n = 40; TMA, n = 61, this in situ study re-examined the significance of transporter expression for progression-free survival (PFS and overall survival (OS. Data from The Cancer Genome Atlas database was used to externally validate the respective findings (n = 317. In general, HNSCC tended to lower expression of drug transporters compared to normal epithelium. High ABCB1 mRNA tumor expression was associated with both favorable progression-free survival (PFS, p = 0.0357 and overall survival (OS, p = 0.0535. Similar results were obtained for the mRNA of ABCC1 (MRP1, multidrug resistance-associated protein 1; PFS, p = 0.0183; OS, p = 0.038. In contrast, protein expression of ATP7b (copper transporter ATP7b, mRNA expression of ABCG2 (BCRP, breast cancer resistance protein, ABCC2 (MRP2, and SLC31A1 (hCTR1, human copper transporter 1 did not correlate with survival. Cluster analysis however revealed that simultaneous high expression of SLC31A1, ABCC2, and ABCG2 indicates poor survival of HNSCC patients. In conclusion, this study militates against the intuitive dogma where high expression of drug efflux transporters indicates poor survival, but demonstrates that expression of single drug transporters might indicate even improved survival. Prospectively, combined analysis of the 'transportome' should rather be performed as it likely unravels meaningful data on the impact of drug transporters on survival of patients with HNSCC.
Liu, Yang; Kam, Wendy R; Ding, Juan; Sullivan, David A
2014-06-05
Drug-induced phospholipidosis (PLD) is a common adverse effect which has led to the termination of clinical trials for many candidate pharmaceuticals. However, this lipid-inducing effect may be beneficial in the treatment of meibomian gland dysfunction (MGD). MGD is the major cause of dry eye disease (DED), which affects 40 million people in the USA and has no cure. Azithromycin (AZM) is a PLD-inducing antibiotic that is used off-label to treat MGD, and is presumably effective because it suppresses the MGD-associated conjunctival inflammation (i.e. posterior blepharitis) and growth of lid bacteria. We hypothesize that AZM can act directly to promote the function of human meibomian gland epithelial cells by inducing PLD in these cells, characterized by the accumulation of lipids and lysosomes. Immortalized human meibomian gland epithelial cells (HMGEC) were cultured with or without azithromycin for 5 days. Cells were evaluated for cholesterol (Filipin) and neutral lipid (LipidTox) staining, as well as the appearance of lysosomes (LysoTracker) and lamellar bodies (transmission electron microscopy, TEM). The lipid composition of cellular lysates was analyzed by high performance thin-layer chromatography. Our findings demonstrate that AZM stimulates the accumulation of free cholesterol, neutral lipids and lysosomes in HMGEC. This AZM-induced increase of neutral lipid content occurred predominantly within lysosomes. Many of these vesicles appeared to be lamellar bodies by TEM, which is the characteristic of PLD. Our findings also show that AZM promotes an accumulation of free and esterified cholesterol, as well as phospholipids in HMGECimmortalized. Our results support our hypothesis and confirm the beneficial effect of PLD induced by AZM on HMGEC. Our discovery reveals a new potential use of PLD-inducing drugs, and makes this adverse effect a beneficial effect. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
A study of promotional advertisements of drugs in a medical journal: an ethics perspective.
Nath, Sarmila; Bhowmick, Subhrojyoti; Dutta, Trayambak; Chowrasia, V R; Bhattacharya, Shipra; Chatterjee, R N; Sarkar, Manjula; Ram, A K; Mukherjee, P K
2014-01-01
The study assessed 54 advertisements of 145 different drugs, published over one year (from December 2011 to November 2012) in an Indian medical journal, circulated widely mainly among general practitioners (GPs). The ethical guidelines of the World Health Organization (WHO) and Organisation of Pharmaceutical Producers of India (OPPI) for medicinal drug promotion were applied. The brand name was mentioned in all advertisements (100% compliance both with the WHO and OPPI criteria) and the names of the active ingredients were also mentioned in 128 (90.14%) advertisements. However, major adverse drug reactions were mentioned in only two advertisements (1.37%); precautions, contraindications and warnings in only two (1.37%); and major interactions in only one (0.68%). Only three advertisements (2.06%) were well substantiated with references. To ensure the ethical promotionof drugs among GPs, journals must introduce compulsory review and appraisal of promotional advertisements by a dedicated review board, including at least one member trained in pharmacology and one representative from the medical division of a pharmaceutical company.
Harrison, Luke R.E.; Micha, Dimitra; Brandenburg, Martin; Simpson, Kathryn L.; Morrow, Christopher J.; Denneny, Olive; Hodgkinson, Cassandra; Yunus, Zaira; Dempsey, Clare; Roberts, Darren; Blackhall, Fiona; Makin, Guy; Dive, Caroline
2011-01-01
Solid tumors contain hypoxic regions in which cancer cells are often resistant to chemotherapy-induced apoptotic cell death. Therapeutic strategies that specifically target hypoxic cells and promote apoptosis are particularly appealing, as few normal tissues experience hypoxia. We have found that the compound ABT-737, a Bcl-2 homology domain 3 (BH-3) mimetic, promotes apoptotic cell death in human colorectal carcinoma and small cell lung cancer cell lines exposed to hypoxia. This hypoxic induction of apoptosis was mediated through downregulation of myeloid cell leukemia sequence 1 (Mcl-1), a Bcl-2 family protein that serves as a biomarker for ABT-737 resistance. Downregulation of Mcl-1 in hypoxia was independent of hypoxia-inducible factor 1 (HIF-1) activity and was consistent with decreased global protein translation. In addition, ABT-737 induced apoptosis deep within tumor spheroids, consistent with an optimal hypoxic oxygen tension being necessary to promote ABT-737–induced cell death. Tumor xenografts in ABT-737–treated mice also displayed significantly more apoptotic cells within hypoxic regions relative to normoxic regions. Synergies between ABT-737 and other cytotoxic drugs were maintained in hypoxia, suggesting that this drug may be useful in combination with chemotherapeutic agents. Taken together, these findings suggest that Mcl-1–sparing BH-3 mimetics may induce apoptosis in hypoxic tumor cells that are resistant to other chemotherapeutic agents and may have a role in combinatorial chemotherapeutic regimens for treatment of solid tumors. PMID:21393866
Ihara, Yukiko; Tomonoh, Yuko; Deshimaru, Masanobu; Zhang, Bo; Uchida, Taku; Ishii, Atsushi; Hirose, Shinichi
2016-01-01
The hetero-tetrameric voltage-gated potassium channel Kv7.2/Kv7.3, which is encoded by KCNQ2 and KCNQ3, plays an important role in limiting network excitability in the neonatal brain. Kv7.2/Kv7.3 dysfunction resulting from KCNQ2 mutations predominantly causes self-limited or benign epilepsy in neonates, but also causes early onset epileptic encephalopathy. Retigabine (RTG), a Kv7.2/ Kv7.3-channel opener, seems to be a rational antiepileptic drug for epilepsies caused by KCNQ2 mutations. We therefore evaluated the effects of RTG on seizures in two strains of knock-in mice harboring different Kcnq2 mutations, in comparison to the effects of phenobarbital (PB), which is the first-line antiepileptic drug for seizures in neonates. The subjects were heterozygous knock-in mice (Kcnq2Y284C/+ and Kcnq2A306T/+) bearing the Y284C or A306T Kcnq2 mutation, respectively, and their wild-type (WT) littermates, at 63-100 days of age. Seizures induced by intraperitoneal injection of kainic acid (KA, 12mg/kg) were recorded using a video-electroencephalography (EEG) monitoring system. Effects of RTG on KA-induced seizures of both strains of knock-in mice were assessed using seizure scores from a modified Racine's scale and compared with those of PB. The number and total duration of spike bursts on EEG and behaviors monitored by video recording were also used to evaluate the effects of RTG and PB. Both Kcnq2Y284C/+ and Kcnq2A306T/+ mice showed significantly more KA-induced seizures than WT mice. RTG significantly attenuated KA-induced seizure activities in both Kcnq2Y284C/+ and Kcnq2A306T/+ mice, and more markedly than PB. This is the first reported evidence of RTG ameliorating KA-induced seizures in knock-in mice bearing mutations of Kcnq2, with more marked effects than those observed with PB. RTG or other Kv7.2-channel openers may be considered as first-line antiepileptic treatments for epilepsies resulting from KCNQ2 mutations.
Energy Technology Data Exchange (ETDEWEB)
Shirakawa, Maho; Sekine, Shuichi; Tanaka, Ayaka [The Laboratory of Biopharmaceutics, Graduate School of Pharmaceutical Sciences, Chiba University, Chiba (Japan); Horie, Toshiharu [Faculty of Pharmaceutical Sciences, Teikyo Heisei University, Tokyo (Japan); Ito, Kousei, E-mail: itokousei@chiba-u.jp [The Laboratory of Biopharmaceutics, Graduate School of Pharmaceutical Sciences, Chiba University, Chiba (Japan)
2015-10-01
The risk of drug-induced liver injury (DILI) is of great concern to the pharmaceutical industry. It is well-known that metabolic activation of drugs to form toxic metabolites (TMs) is strongly associated with DILI onset. Drug-induced mitochondrial dysfunction is also strongly associated with increased risk of DILI. However, it is difficult to determine the target of TMs associated with exacerbation of DILI because of difficulties in identifying and purifying TMs. In this study, we propose a sequential in vitro assay system to assess TM formation and their ability to induce mitochondrial permeability transition (MPT) in a one-pot process. In this assay system, freshly-isolated rat liver mitochondria were incubated with reaction solutions of 44 test drugs preincubated with liver microsomes in the presence or absence of NADPH; then, NADPH-dependent MPT pore opening was assessed as mitochondrial swelling. In this assay system, several hepatotoxic drugs, including benzbromarone (BBR), significantly induced MPT in a NADPH-dependent manner. We investigated the rationality of using BBR as a model drug, since it showed the most prominent MPT in our assay system. Both the production of a candidate toxic metabolite of BBR (1′,6-(OH){sub 2} BBR) and NADPH-dependent MPT were inhibited by several cytochrome P450 (CYP) inhibitors (clotrimazole and SKF-525A, 100 μM). In summary, this assay system can be used to evaluate comprehensive metabolite-dependent MPT without identification or purification of metabolites. - Highlights: • We constructed a sequential assay system for toxic metabolite induced MPT in one pot. • 14 drugs (e.g. benzbromarone (BBR)) induced toxic metabolite dependent MPT. • Both the production of toxic metabolite and MPT could be inhibited by CYP inhibitors. • This system could evaluate the comprehensive MPT without purification of metabolites.
Developing and promoting an intranet site for a drug information service.
Costerison, Emily C; Graham, Angie S
2008-04-01
The development and promotion of a drug information service (DIS) intranet site are described. Stanford Hospital and Clinics (SHC) is an acute and tertiary care facility with 613 licensed inpatient beds and 48 outpatient clinics. A DIS intranet site was developed to allow better accessibility to pharmacy forms and products (e.g., drug shortage list, reference guides) and to reduce repetitive requests to the DIS. The goal was to continue to provide information to SHC health care providers but allow the drug information specialist to focus on answering clinical questions. The intranet site was completed over a four-month period. The intranet site was divided into seven webpages: DIS overview, pharmacy and therapeutics, frequently asked questions, quick drug reference guide, ask the pharmacist, drug information resources, and referral center. The preparation for and implementation of the promotional phase took approximately two months. Promotional strategies included the creation and dissemination of brochures and stickers. The intranet site went live on January 1, 2007, and the advertising campaign began one month later. The utility of the site was measured for five months by tracking the number of visits to the site, the number of visits to each webpage, and the number of downloaded files. Request volume, caller affiliation, and question types received by the DIS call center were also recorded. Establishing a DIS intranet site required a considerable time investment and a willingness to work with existing infrastructures, such as the marketing and communications department and Web marketing staff.
Cardiovascular drugs inducing QT prolongation: facts and evidence.
Taira, Carlos A; Opezzo, Javier A W; Mayer, Marcos A; Höcht, Christian
2010-01-01
Acquired QT syndrome is mainly caused by the administration of drugs that prolong ventricular repolarization. On the other hand, the risk of drug-induced torsades de pointes is increased by numerous predisposing factors, such as genetic predisposition, female sex, hypokalemia and cardiac dysfunction. This adverse reaction is induced by different chemical compounds used for the treatment of a variety of pathologies, including arrhythmias. As it is known, antiarrhythmic agents and other cardiovascular drugs can prolong the QT interval, causing this adverse reaction. Of the 20 most commonly reported drugs, 10 were cardiovascular agents and these appeared in 348 of the reports (46%). Class Ia antiarrhythmic agents have frequently been linked to inducing arrhythmia, including torsades de pointes. Sotalol and amiodarone, class III antiarrhythmics, are known to prolong the QT interval by blocking I(Kr). Due to the severity of events caused by the therapeutic use of these drugs, in this work of revision the cardiovascular drugs that present this property and the factors and evidence will be mentioned.
Mauri, M C; Di Pace, C; Reggiori, A; Paletta, S; Colasanti, A
2017-10-01
The study reports a follow-up assessment of 48 patients with concomitant drug abuse at the first admission for psychosis. We focused on the diagnostic distinction between primary psychosis with concomitant drug abuse and drug induced psychosis, to observe whether the diagnoses are stable over time and whether the clinical course significantly differs. The study examined 25 primary psychotic disorder with comorbid drug abuse and 23 drug-induced psychotic disorder patients. Diagnostic and psychopathological assessments were made at baseline and at follow-up. Mean follow-up period was 4.96 years. Patients with comorbid Drug Abuse exhibited higher scores in the item Unusual Content of Thought at baseline than drug-induced psychotic disorder patients: 5.48 vs 4.39 while the two patients groups did not differ in any of the BPRS items evaluated at follow-up. The primary psychosis with comorbid drug abuse and the substance induced psychosis groups were similar regarding diagnostic stability, and a diagnosis of schizophrenia at follow-up occurred similarly. There was no evidence that Drug Induced psychotic patients' symptoms tend to improve more after cessation of drug abuse. An earlier age of onset was found in primary psychotic patients, particularly for patients diagnosed as affected by schizophrenia at follow up. These results might reflect the uncertainty of the distinction between Primary and Drug Induced Psychosis and the difficulties in applying the DSM IV-TR criteria for diagnosing comorbid drug use disorders and psychotic disorders. Copyright © 2017 Elsevier B.V. All rights reserved.
PIF4 Promotes Expression of LNG1 and LNG2 to Induce Thermomorphogenic Growth in Arabidopsis
Directory of Open Access Journals (Sweden)
Geonhee Hwang
2017-07-01
Full Text Available Arabidopsis plants adapt to high ambient temperature by a suite of morphological changes including elongation of hypocotyls and petioles and leaf hyponastic growth. These morphological changes are collectively called thermomorphogenesis and are believed to increase leaf cooling capacity by enhancing transpiration efficiency, thereby increasing tolerance to heat stress. The bHLH transcription factor PHYTOCHROME INTERACTING FACTOR4 (PIF4 has been identified as a major regulator of thermomorphogenic growth. Here, we show that PIF4 promotes the expression of two homologous genes LONGIFOLIA1 (LNG1 and LONGIFOLIA2 (LNG2 that have been reported to regulate leaf morphology. ChIP-Seq analyses and ChIP assays showed that PIF4 directly binds to the promoters of both LNG1 and LNG2. The expression of LNG1 and LNG2 is induced by high temperature in wild type plants. However, the high temperature activation of LNG1 and LNG2 is compromised in the pif4 mutant, indicating that PIF4 directly regulates LNG1 and LNG2 expression in response to high ambient temperatures. We further show that the activities of LNGs support thermomorphogenic growth. The expression of auxin biosynthetic and responsive genes is decreased in the lng quadruple mutant, implying that LNGs promote thermomorphogenic growth by activating the auxin pathway. Together, our results demonstrate that LNG1 and LNG2 are directly regulated by PIF4 and are new components for the regulation of thermomorphogenesis.
Wanasika, Isaac
2016-03-26
This commentary discusses pertinent issues from Hyosun Kim's paper on online prescription drug promotion. The study is well-designed and the findings highlight some of the consequences of the Food and Drug Administration's (FDA's) decision to deregulate online advertising of prescription drugs. While Kim's findings confirm some of the early concerns, they also provide a perspective of implementation challenges in the ever-changing technological environment. © 2016 by Kerman University of Medical Sciences.
Chemical inducible promoter used to obtain transgenic plants with a silent marker
Aoyama, Takashi; Zuo, Jianru; Chua, Nam-Hai
2004-08-31
A chemically inducible promoter is described that may be used to transform plants, including tobacco and lettuce, with genes which are easily regulatable by adding the plants or plant cells to a medium containing an inducer of the promoter or by removing the plants or plant cells from such medium. The promoter described is one that is inducible by a glucocorticoid which is not endogenous to plants. Such promoters may be used with a variety of genes such as ipt or knotted1 to induce shoot formation in the presence of a glucocorticoid. The promoter may also be used with antibiotic or herbicide resistance genes which are then regulatable by the presence or absence of inducer rather than being constitutive. Other examples of genes which may be placed under the control of the inducible promoter are also presented.
Thrombocytopenia induced by noncytotoxic drugs in Denmark 1968-91
DEFF Research Database (Denmark)
Pedersen-Bjergaard, U; Andersen, M; Hansen, P B
1996-01-01
reporting system on adverse drug reactions. SUBJECTS: A total of 309 critically reviewed cases of drug-induced thrombocytopenia reported during the period from 1968 to the end of 1991. RESULTS: Sodiumaurothiomalate and the combination sulfamethoxazole with trimethoprim were the most commonly reported single...... numerously reported. The still-growing list of thrombocytopenia-inducing agents contained 110 different drugs. At present, 20% of reported cases concern drugs not previously registered as causing thrombocytopenia in Denmark. Twenty-five per cent of all cases were caused by drugs which appeared only...
Directory of Open Access Journals (Sweden)
Jennifer Hochscherf
2017-12-01
Full Text Available Protein kinase CK2, a member of the eukaryotic protein kinase superfamily, is associated with cancer and other human pathologies and thus an attractive drug target. The indeno[1,2-b]indole scaffold is a novel lead structure to develop ATP-competitive CK2 inhibitors. Some indeno[1,2-b]indole-based CK2 inhibitors additionally obstruct ABCG2, an ABC half transporter overexpressed in breast cancer and co-responsible for drug efflux and resistance. Comprehensive derivatization studies revealed substitutions of the indeno[1,2-b]indole framework that boost either the CK2 or the ABCG2 selectivity or even support the dual inhibition potential. The best indeno[1,2-b]indole-based CK2 inhibitor described yet (IC50 = 25 nM is 5-isopropyl-4-(3-methylbut-2-enyl-oxy-5,6,7,8-tetrahydroindeno[1,2-b]indole-9,10-dione (4p. Herein, we demonstrate the membrane permeability of 4p and describe co-crystal structures of 4p with CK2α and CK2α′, the paralogs of human CK2 catalytic subunit. As expected, 4p occupies the narrow, hydrophobic ATP site of CK2α/CK2α′, but surprisingly with a unique orientation: its hydrophobic substituents point towards the solvent while its two oxo groups are hydrogen-bonded to a hidden water molecule. An equivalent water molecule was found in many CK2α structures, but never as a critical mediator of ligand binding. This unexpected binding mode is independent of the interdomain hinge/helix αD region conformation and of the salt content in the crystallization medium.
Hydrocortisone-induced embryotoxicity and embryonic drug disposition in H-2 congenic mice
International Nuclear Information System (INIS)
Roberts, L.S.G.
1986-01-01
Congenic mouse strains C57BL/10Sn (B10) and B10.A/SgSn(B10A), genetically different only at the H-2 complex, were compared for sensitivity to glucocorticoid-induced embryotoxicity and embryonic drug disposition. B10A mice dosed intramuscularly with 0, 100, 150 and 200 mg hydrocortisone/kg body weight on gestational day twelve, and B10 mice injected with 0, 200, 400, 600, and 800 mg/kg, were evaluated at dissection on gestational day eighteen for signs of toxicity. In both strains, probit analysis of cleft palate production demonstrated a linear dose response. The ED50 for cleft palate production demonstrates a linear dose response. The ED50 for cleft palate production in B10A mice was 143.6 mg/kg and 512.0 mg/kg for the B10 strain. Embryonic exposure was evaluated by administration of 3 H-hydrocortisone (5 uCi/mouse) to pregnant mice on day twelve of gestation, at the ED50 for cleft palate production in B10A strain. The purposes of the experiment were to quantify the difference in susceptibility to steroid-induced cleft palate, determine if a milder manifestation of embryotoxicity, fetal growth retardation, occurred at sub-clefting dosages, and determine if the difference in sensitivity to hydrocortisone-induced embryotoxicity was the result of an underlying difference in embryonic exposure to the teratogen
Boulin, Mathieu; Diaby, Vakaramoko; Tannenbaum, Cara
2016-01-01
The costs of drug-induced hypoglycemia are a critical but often neglected component of value-based arguments to reduce tight glycemic control in older adults with type 2 diabetes. An economic (decision-tree) analysis compared rates, costs, quality-adjusted life-years, and incremental costs per quality-adjusted life-year gained associated with mild, moderate and severe hypoglycemic events for 6 glucose-lowering medication classes in type 2 diabetic adults aged 65-79 versus those 80 years and older. The national U.S. (Center for Medicare Services) and Canadian public health payer perspectives were adopted. Incidence rates of drug-induced hypoglycemia were the highest for basal insulin and sulfonylureas: 8.64 and 4.32 events per person-year in 65-79 year olds, and 12.06 and 6.03 events per person-year for 80 years and older. In both the U.S. and Canada, metformin dominated sulfonylureas, basal insulin and glucagon-like peptide1 receptor agonists. Relative to sulfonylureas, thiazolidinediones had the lowest incremental cost-effectiveness ratios in the U.S. and dominated sulfonylureas in Canada for adults 80 years and older. Relative to sulfonylureas, dipeptidyl peptidase4 inhibitors were cost-effective for adults 80 years and older in both countries, and for 65-79 year olds in Canada. Annual costs of hypoglycemia for older adults attaining very tight glycemic control with the use of insulin or sulfonylureas were estimated at U.S.$509,214,473 in the U.S. and CAN$65,497,849 in Canada. Optimizing drug therapy for older type 2 diabetic adults through the avoidance of drug-induced hypoglycemia will dramatically improve patient health while also generating millions of dollars by saving unnecessary medical costs.
Drug perfusion enhancement in tissue model by steady streaming induced by oscillating microbubbles.
Oh, Jin Sun; Kwon, Yong Seok; Lee, Kyung Ho; Jeong, Woowon; Chung, Sang Kug; Rhee, Kyehan
2014-01-01
Drug delivery into neurological tissue is challenging because of the low tissue permeability. Ultrasound incorporating microbubbles has been applied to enhance drug delivery into these tissues, but the effects of a streaming flow by microbubble oscillation on drug perfusion have not been elucidated. In order to clarify the physical effects of steady streaming on drug delivery, an experimental study on dye perfusion into a tissue model was performed using microbubbles excited by acoustic waves. The surface concentration and penetration length of the drug were increased by 12% and 13%, respectively, with streaming flow. The mass of dye perfused into a tissue phantom for 30s was increased by about 20% in the phantom with oscillating bubbles. A computational model that considers fluid structure interaction for streaming flow fields induced by oscillating bubbles was developed, and mass transfer of the drug into the porous tissue model was analyzed. The computed flow fields agreed with the theoretical solutions, and the dye concentration distribution in the tissue agreed well with the experimental data. The computational results showed that steady streaming with a streaming velocity of a few millimeters per second promotes mass transfer into a tissue. © 2013 Published by Elsevier Ltd.
International Nuclear Information System (INIS)
Sakaeda, Yoshiichi; Hiroi, Miki; Shimojima, Takahiro; Iguchi, Mayumi; Kanegae, Haruhide; Ohmori, Yoshihiro
2006-01-01
Sulindac, a non-steroidal anti-inflammatory drug, has been shown to exert an anti-tumor effect on several types of cancer. To determine the effect of sulindac on intracellular signaling pathways in host immune cells such as macrophages, we investigated the effect of the drug on interferon gamma (IFNγ)-induced expression of signal transducer and activator of transcription 1 (STAT1) and other genes in mouse macrophage-like cell line RAW264.7 cells. Sulindac, but not aspirin or sodium salicylate, inhibited IFNγ-induced expression of the CXC ligand 9 (CXCL9) mRNA, a chemokine for activated T cells, whereas the interferon-induced expression of CXCL10 or IFN regulatory factor-1 was not affected by sulindac. Luciferase reporter assay demonstrated that sulindac inhibited IFNγ-induced promoter activity of the CXCL9 gene. Surprisingly, sulindac had no inhibitory effect on IFNγ-induced STAT1 activation; however, constitutive nuclear factor κB activity was suppressed by the drug. These results indicate that sulindac selectively inhibited IFNγ-inducible gene expression without inhibiting STAT1 activation
Advantageous use of HepaRG cells for the screening and mechanistic study of drug-induced steatosis
Energy Technology Data Exchange (ETDEWEB)
Tolosa, Laia [Unidad de Hepatología Experimental, Instituto de Investigación Sanitaria La Fe, Valencia 46026 (Spain); Gómez-Lechón, M. José [Unidad de Hepatología Experimental, Instituto de Investigación Sanitaria La Fe, Valencia 46026 (Spain); CIBERehd, FIS, Barcelona 08036 (Spain); Jiménez, Nuria [Unidad de Hepatología Experimental, Instituto de Investigación Sanitaria La Fe, Valencia 46026 (Spain); Hervás, David [Biostatistics Unit, Instituto de Investigación Sanitaria La Fe, Valencia 46026 (Spain); Jover, Ramiro [Unidad de Hepatología Experimental, Instituto de Investigación Sanitaria La Fe, Valencia 46026 (Spain); CIBERehd, FIS, Barcelona 08036 (Spain); Departamento de Bioquímica y Biología Molecular, Facultad de Medicina, Universidad de Valencia, Valencia 46010 (Spain); Donato, M. Teresa, E-mail: donato_mte@gva.es [Unidad de Hepatología Experimental, Instituto de Investigación Sanitaria La Fe, Valencia 46026 (Spain); CIBERehd, FIS, Barcelona 08036 (Spain); Departamento de Bioquímica y Biología Molecular, Facultad de Medicina, Universidad de Valencia, Valencia 46010 (Spain)
2016-07-01
Only a few in vitro assays have been proposed to evaluate the steatotic potential of new drugs. The present study examines the utility of HepaRG cells as a cell-based assay system for screening drug-induced liver steatosis. A high-content screening assay was run to evaluate multiple toxicity-related cell parameters in HepaRG cells exposed to 28 compounds, including drugs reported to cause steatosis through different mechanisms and non-steatotic compounds. Lipid content was the most sensitive parameter for all the steatotic drugs, whereas no effects on lipid levels were produced by non-steatotic compounds. Apart from fat accumulation, increased ROS production and altered mitochondrial membrane potential were also found in the cells exposed to steatotic drugs, which indicates that all these cellular events contributed to drug-induced hepatotoxicity. These findings are of clinical relevance as most effects were observed at drug concentrations under 100-fold of the therapeutic peak plasmatic concentration. HepaRG cells showed increased lipid overaccumulation vs. HepG2 cells, which suggests greater sensitivity to drug-induced steatosis. An altered expression profile of transcription factors and the genes that code key proteins in lipid metabolism was also found in the cells exposed to drugs capable of inducing liver steatosis. Our results generally indicate the value of HepaRG cells for assessing the risk of liver damage associated with steatogenic compounds and for investigating the molecular mechanisms involved in drug-induced steatosis. - Highlights: • HepaRG cells were explored as an in vitro model to detect steatogenic potential. • Multiple toxicity-related endpoints were analysed by HCS. • HepaRG showed a greater sensitivity to drug-induced steatosis than HepG2 cells. • Changes in the expression of genes related to lipid metabolism were revealed. • HepaRG allow mechanistic understanding of liver damage induced by steatogenic drugs.
Advantageous use of HepaRG cells for the screening and mechanistic study of drug-induced steatosis
International Nuclear Information System (INIS)
Tolosa, Laia; Gómez-Lechón, M. José; Jiménez, Nuria; Hervás, David; Jover, Ramiro; Donato, M. Teresa
2016-01-01
Only a few in vitro assays have been proposed to evaluate the steatotic potential of new drugs. The present study examines the utility of HepaRG cells as a cell-based assay system for screening drug-induced liver steatosis. A high-content screening assay was run to evaluate multiple toxicity-related cell parameters in HepaRG cells exposed to 28 compounds, including drugs reported to cause steatosis through different mechanisms and non-steatotic compounds. Lipid content was the most sensitive parameter for all the steatotic drugs, whereas no effects on lipid levels were produced by non-steatotic compounds. Apart from fat accumulation, increased ROS production and altered mitochondrial membrane potential were also found in the cells exposed to steatotic drugs, which indicates that all these cellular events contributed to drug-induced hepatotoxicity. These findings are of clinical relevance as most effects were observed at drug concentrations under 100-fold of the therapeutic peak plasmatic concentration. HepaRG cells showed increased lipid overaccumulation vs. HepG2 cells, which suggests greater sensitivity to drug-induced steatosis. An altered expression profile of transcription factors and the genes that code key proteins in lipid metabolism was also found in the cells exposed to drugs capable of inducing liver steatosis. Our results generally indicate the value of HepaRG cells for assessing the risk of liver damage associated with steatogenic compounds and for investigating the molecular mechanisms involved in drug-induced steatosis. - Highlights: • HepaRG cells were explored as an in vitro model to detect steatogenic potential. • Multiple toxicity-related endpoints were analysed by HCS. • HepaRG showed a greater sensitivity to drug-induced steatosis than HepG2 cells. • Changes in the expression of genes related to lipid metabolism were revealed. • HepaRG allow mechanistic understanding of liver damage induced by steatogenic drugs.
Drug Eruptions Induced by Allopurinol Associated with HLA-BFNx015801
Directory of Open Access Journals (Sweden)
Meihua Zeng
2015-01-01
Full Text Available Allopurinol, a drug commonly used for treating gout and hyperuricemia, is a frequent cause of drug eruptions. Recent investigations suggest that HLA-BFNx015801 allele is a very strong marker for allopurinol-induced cutaneous adverse drug reactions (cADRs. In this article we report two cases of allopurinol-induced drug eruptions in patients carrying the HLA-BFNx015801 allele and review the literature on the association between HLA-BFNx015801 and allopurinol-induced cADRs based on a MEDLINE and PubMed search
Aikin, Kathryn J; Sullivan, Helen W; O'Donoghue, Amie C; Betts, Kevin R
2016-01-01
Information on the effects of promotional offers in direct-to-consumer prescription drug ads is limited. In two studies, we examined the effect of promotional offers (e.g., money-back guarantee) and ad type (creating prescription and over-the-counter drug ads by varying the presence of benefit and risk information). We found little effect of promotional offers. Adding benefit (risk) information to the ad increased consumers' knowledge of the benefit (risk) information and their efficacy (risk) perceptions. In most cases, adding risk information to an ad with benefit information increased risk knowledge and perceptions without decreasing benefit knowledge or perceptions.
Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T
2011-01-01
Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.
Tsunoda, Satoshi; Nakamura, Toshiyuki; Sakurai, Hiroaki; Saiki, Ikuo
2007-04-01
Fibroblast growth factor (FGF)-2 has been considered to play a critical role in neovascularization in several tumors; however, its precise role in tumor progression is not fully understood. In the present study, we have characterized the role of FGF-2 in B16-BL6 mouse melanoma cells, focusing on effects during the initial phase of tumor growth. FGF-2 was injected at the tumor inoculation site of dorsal skin during the initial phase. FGF-2 induced marked tumor growth and lymph node metastasis. This was well correlated with an increase in neovascularization in the host stroma. FGF-2 also recruited inflammatory and mesenchymal cells in host stroma. Marked tumor growth, pulmonary metastasis and intensive neovascularization in tumor parenchyma were also observed after a single injection of FGF-2 into the footpad inoculation site. In contrast, repeated injections of FGF-2 at a site remote from the footpad tumor were ineffective in promoting tumor growth and metastasis. These promoting activities of FGF-2 were blocked by local injections of a glucocorticoid hormone, suggesting that host inflammatory responses induced by FGF-2 are associated with FGF-2-induced tumor progression. In addition, although FGF-2 did not promote cellular proliferation and vascular endothelial growth factor A (VEGFA) mRNA expression in B16-BL6 cells in vitro, FGF-2 induced VEGFA expression in host stroma rather than tumor tissue, and local injections of a neutralizing antibody against VEGFA inhibited these activities of FGF-2 in vivo. These results indicate that abundant FGF-2 during the initial phase of tumor growth induces VEGFA-dependent intensive neovascularization in host stroma, and supports marked tumor growth and metastasis.
Characterization of the promoter of human CRTh2, a prostaglandin D{sub 2} receptor
Energy Technology Data Exchange (ETDEWEB)
Quapp, Russell; Madsen, Norman [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada); Cameron, Lisa [Department of Medicine, Division of Pulmonary Medicine, Pulmonary Research Group, 574B Heritage Medical Research Centre, University of Alberta, Edmonton, AB, T6G 2S2 (Canada)
2007-11-30
Chemoattractant-receptor homologous molecule expressed on Th2 cells (CRTh2) is a receptor for prostaglandin (PG)D{sub 2}, a lipid mediator involved in allergic inflammation. CRTh2 is expressed by Th2 cells, eosinophils and basophils and PDG{sub 2}-CRTh2 signaling induces calcium mobilization, cell migration and expression of the Th2 cytokines IL-4, IL-5, and IL-13. Despite the role of CRTh2 in allergic inflammation, transcriptional regulation of this gene has not been studied. Here, we demonstrated that a reporter construct of the CRTh2 promoter was induced following T cell stimulation. This activity could be further enhanced by over-expression of GATA-3, but not NFAT2 or STAT6. Electromobility shift assay demonstrated GATA-3 binding to a probe from the CRTh2 promoter. This study provides the first detailed analysis of transcriptional regulation of the human CRTh2 promoter. These findings may help identify strategies to attenuate expression of this gene and influence the maintenance and proliferation of Th2 cells in allergic inflammation.
Melatonin modulates drug-induced acute porphyria
Directory of Open Access Journals (Sweden)
Sandra M. Lelli
Full Text Available This work investigated the modulation by melatonin (Mel of the effects of the porphyrinogenic drugs 2-allyl-2-isopropylacetamide (AIA and 3,5-diethoxycarbonyl-1,4-dihydro-2,4,6-collidine (DDC on oxidative environment, glucose biosynthesis and heme pathway parameters. Administration of Mel before rat intoxication with AIA/DDC showed a clear beneficial effect in all cases. Mel induced decreases of 42% and 35% in the excretion of the hemeprecursors 5-aminolevulinic acid (ALA and porphobilinogen (PBG, respectively, and a 33% decrease in the induction of the heme regulatory enzyme 5-aminolevulinic acid-synthase (ALA-S. The activity of the glucose metabolism enzyme phosphoenolpyruvate carboxykinase (PEPCK, which had been diminished by the porphyrinogenic treatment, was restored by 45% when animals were pre-treated with Mel. Mel abolished the modest decrease in glucose 6-phospatase (G6Pase activity caused by AIA/DDC treatment. The oxidative status of lipids was attenuated by Mel treatment in homogenates by 47%, whereas no statistically significant AIA/DDC-induced increase in thiobarbituric acid reactive substances (TBARS was observed in microsomes after Mel pre-treatment. We hypothesize that Mel may be scavenging reactive species of oxygen (ROS that could be damaging lipids, PEPCK, G6Pase and ferrochelatase (FQ. Additionally, Mel administration resulted in the repression of the key enzyme ALA-S, and this could be due to an increase in glucose levels, which is known to inhibit ALA-S induction. The consequent decrease in levels of the heme precursors ALA and PBG had a beneficial effect on the drug-induced porphyria. The results obtained open the possibility of further research on the use of melatonin as a co-treatment option in acute porphyria. Keywords: Melatonin, Glucose synthesis, Heme pathway, Acute porphyria, Oxidative stress
Drug-induced regulation of target expression
DEFF Research Database (Denmark)
Iskar, Murat; Campillos, Monica; Kuhn, Michael
2010-01-01
Drug perturbations of human cells lead to complex responses upon target binding. One of the known mechanisms is a (positive or negative) feedback loop that adjusts the expression level of the respective target protein. To quantify this mechanism systems-wide in an unbiased way, drug......-induced differential expression of drug target mRNA was examined in three cell lines using the Connectivity Map. To overcome various biases in this valuable resource, we have developed a computational normalization and scoring procedure that is applicable to gene expression recording upon heterogeneous drug treatments....... In 1290 drug-target relations, corresponding to 466 drugs acting on 167 drug targets studied, 8% of the targets are subject to regulation at the mRNA level. We confirmed systematically that in particular G-protein coupled receptors, when serving as known targets, are regulated upon drug treatment. We...
Porous Polymer Drug-Eluting Coating Prepared by Radiation Induced Polymerization
International Nuclear Information System (INIS)
Veres, M.; Beiler, B.; Himics, L.; Tóth, S.; Koós, M.
2010-01-01
Many areas of modern medicine are almost unimaginable without the use of different kinds of implants. They used as replacements, supports, auxiliary devices etc. for various parts or functions of the body. Their use has many advantages, however there could be some drawbacks too, like the possibility of rejection, inflammation and other side-effects. Many of these drawbacks are directly related to the materials used for the implant fabrication. Coatings are widely used to eliminate the unwanted effects appearing after the implantation. In addition to the protection and separation of tissues from the implant material they could also enhance the functionality and the acceptance of the artificial device and also promote the regeneration of the tissues after the intervention. Drug-eluting coatings are a good example for the latter. By delivery and controlled elution of drugs they could actively suppress inflammatory reactions, allergy and rejection of the implant, and their activity is localized to the place where these effects could mainly occur – to the region of the implant. This project is aimed to develop a drug-eluting porous polymer coating by radiation induced polymerization that can be used in different medical implants. The primary objects for this research are coronary stents however these porous layers could have perspective in other types of medical devices too. The main objectives are to develop a method for coating the surface of medical grade metallic alloy wires, plates and tubes with a porous polymer nanocomposite layer prepared by radiation induced polymerization and to characterize the obtained coatings
Porous Polymer Drug-Eluting Coating Prepared by Radiation Induced Polymerization
Energy Technology Data Exchange (ETDEWEB)
Veres, M.; Beiler, B.; Himics, L.; Tóth, S.; Koós, M., E-mail: vm@szfki.hu [Hungarian Academy of Sciences, Research Institute for Solid State Physics and Optics, Department of Laser Applications, Konkoly Thege Miklós ut 29-33, 1121 Budapest, P.O. Box 49, 1525 Budapest (Hungary)
2010-07-01
Many areas of modern medicine are almost unimaginable without the use of different kinds of implants. They used as replacements, supports, auxiliary devices etc. for various parts or functions of the body. Their use has many advantages, however there could be some drawbacks too, like the possibility of rejection, inflammation and other side-effects. Many of these drawbacks are directly related to the materials used for the implant fabrication. Coatings are widely used to eliminate the unwanted effects appearing after the implantation. In addition to the protection and separation of tissues from the implant material they could also enhance the functionality and the acceptance of the artificial device and also promote the regeneration of the tissues after the intervention. Drug-eluting coatings are a good example for the latter. By delivery and controlled elution of drugs they could actively suppress inflammatory reactions, allergy and rejection of the implant, and their activity is localized to the place where these effects could mainly occur – to the region of the implant. This project is aimed to develop a drug-eluting porous polymer coating by radiation induced polymerization that can be used in different medical implants. The primary objects for this research are coronary stents however these porous layers could have perspective in other types of medical devices too. The main objectives are to develop a method for coating the surface of medical grade metallic alloy wires, plates and tubes with a porous polymer nanocomposite layer prepared by radiation induced polymerization and to characterize the obtained coatings.
Drug-induced low blood sugar is low blood glucose that results from taking medicine. ... Low blood sugar (hypoglycemia) is common in people with diabetes who are taking insulin or other medicines to control their diabetes. ...
Tissue specific promoters improve the localization of radiation-inducible gene expression
International Nuclear Information System (INIS)
Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph
1996-01-01
Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene
hypoxia-inducible factors activate CD133 promoter through ETS family transcription factors.
Directory of Open Access Journals (Sweden)
Shunsuke Ohnishi
Full Text Available CD133 is a cellular surface protein that has been reported to be a cancer stem cell marker, and thus it is considered to be a potential target for cancer treatment. However, the mechanism regulating CD133 expression is not yet understood. In this study, we analyzed the activity of five putative promoters (P1-P5 of CD133 in human embryonic kidney (HEK 293 cells and colon cancer cell line WiDr, and found that the activity of promoters, particularly of P5, is elevated by overexpression of hypoxia-inducible factors (HIF-1α and HIF-2α. Deletion and mutation analysis identified one of the two E-twenty six (ETS binding sites (EBSs in the P5 region as being essential for its promoter activity induced by HIF-1α and HIF-2α. In addition, a chromatin imunoprecipitation assay demonstrated that HIF-1α and HIF-2α bind to the proximal P5 promoter at the EBSs. The immunoprecipitation assay showed that HIF-1α physically interacts with Elk1; however, HIF-2α did not bind to Elk1 or ETS1. Furthermore, knockdown of both HIF-1α and HIF-2α resulted in a reduction of CD133 expression in WiDr. Taken together, our results revealed that HIF-1α and HIF-2α activate CD133 promoter through ETS proteins.
Tomazoni, Shaiane Silva; Frigo, Lúcio; Dos Reis Ferreira, Tereza Cristina; Casalechi, Heliodora Leão; Teixeira, Simone; de Almeida, Patrícia; Muscara, Marcelo Nicolas; Marcos, Rodrigo Labat; Serra, Andrey Jorge; de Carvalho, Paulo de Tarso Camillo; Leal-Junior, Ernesto Cesar Pinto
2017-11-01
Muscle injuries trigger an inflammatory process, releasing important biochemical markers for tissue regeneration. The use of non-steroidal anti-inflammatory drugs (NSAIDs) is the treatment of choice to promote pain relief due to muscle injury. NSAIDs exhibit several adverse effects and their efficacy is questionable. Photobiomodulation therapy (PBMT) has been demonstrated to effectively modulate inflammation induced from musculoskeletal disorders and may be used as an alternative to NSAIDs. Here, we assessed and compared the effects of different doses of PBMT and topical NSAIDs on biochemical parameters during an acute inflammatory process triggered by a controlled model of contusion-induced musculoskeletal injury in rats. Muscle injury was induced by trauma to the anterior tibial muscle of rats. After 1 h, rats were treated with PBMT (830 nm, continuous mode, 100 mW of power, 35.71 W/cm 2 ; 1, 3, and 9 J; 10, 30, and 90 s) or diclofenac sodium (1 g). Our results demonstrated that PBMT, 1 J (35.7 J/cm 2 ), 3 J (107.1 J/cm 2 ), and 9 J (321.4 J/cm 2 ) reduced the expression of tumor necrosis factor alpha (TNF-α) and cyclooxygenase-2 (COX-2) genes at all assessed times as compared to the injury and diclofenac groups (p levels of COX-2 only in relation to the injury group (p levels of cytokines TNF-α, interleukin (IL)-1β, and IL-6 at all assessed times as compared to the injury and diclofenac groups (p topical NSAIDs in the modulation of the inflammatory process caused by muscle contusion injuries.
Directory of Open Access Journals (Sweden)
Saikali Melody
2012-07-01
Full Text Available Abstract Background Sesquiterpene lactones (SL are plant secondary metabolites that are known for their anti-fungal, anti-bacterial, anti-inflammatory, and anti-tumor properties. Considering that several SL-derived drugs are currently in cancer clinical trials, we have tested two SL molecules, 3-β-methoxy-iso-seco-tanapartholide (β-tan isolated from Achillea falcata and salograviolide A (Sal A isolated from Centaurea ainetensis, for their anti-tumor properties. We used the mouse epidermal JB6P + cells as a model for tumor promotion and cellular transformation. Key players that are involved in cellular transformation and tumorigenesis are the AP-1 and NF-κB transcription factors; therefore, we assessed how β-tan and Sal A modulate their signaling pathways in JB6P + cells. Methods The effects of β-tan and Sal A on the growth of normal and neoplastic keratinocytes and on the tumor promotion-responsive JB6P + cells were determined using the MTT assay. Anchorage-independent cell growth transformation assays were used to evaluate the anti-tumor promoting properties of these SL molecules in JB6P + cells and dual luciferase reporter assays and western blot analysis were used to investigate their effects on tumor promoter-induced AP-1 and NF-κB activities and protein levels of key AP-1 and NF-кB target genes. Results β-tan and Sal A selectively inhibited tumor promoter-induced cell growth and transformation of JB6P + cells at concentrations that do not affect JB6P + and primary keratinocytes basal cell growth. In addition, both molecules reduced basal and tumor promoter-induced NF-κB transcriptional activities, differentially regulated basal and tumor promoter-induced AP-1 transcriptional activities, and modulated key players of the AP-1 and NF-κB signaling pathways. Conclusions These results highlight the anti-tumor promoting properties of β-tan and Sal A. These SL molecules isolated from two plant species native to
Saikali, Melody; Ghantous, Akram; Halawi, Racha; Talhouk, Salma N; Saliba, Najat A; Darwiche, Nadine
2012-07-09
Sesquiterpene lactones (SL) are plant secondary metabolites that are known for their anti-fungal, anti-bacterial, anti-inflammatory, and anti-tumor properties. Considering that several SL-derived drugs are currently in cancer clinical trials, we have tested two SL molecules, 3-β-methoxy-iso-seco-tanapartholide (β-tan) isolated from Achillea falcata and salograviolide A (Sal A) isolated from Centaurea ainetensis, for their anti-tumor properties. We used the mouse epidermal JB6P + cells as a model for tumor promotion and cellular transformation. Key players that are involved in cellular transformation and tumorigenesis are the AP-1 and NF-κB transcription factors; therefore, we assessed how β-tan and Sal A modulate their signaling pathways in JB6P + cells. The effects of β-tan and Sal A on the growth of normal and neoplastic keratinocytes and on the tumor promotion-responsive JB6P + cells were determined using the MTT assay. Anchorage-independent cell growth transformation assays were used to evaluate the anti-tumor promoting properties of these SL molecules in JB6P + cells and dual luciferase reporter assays and western blot analysis were used to investigate their effects on tumor promoter-induced AP-1 and NF-κB activities and protein levels of key AP-1 and NF-кB target genes. β-tan and Sal A selectively inhibited tumor promoter-induced cell growth and transformation of JB6P + cells at concentrations that do not affect JB6P + and primary keratinocytes basal cell growth. In addition, both molecules reduced basal and tumor promoter-induced NF-κB transcriptional activities, differentially regulated basal and tumor promoter-induced AP-1 transcriptional activities, and modulated key players of the AP-1 and NF-κB signaling pathways. These results highlight the anti-tumor promoting properties of β-tan and Sal A. These SL molecules isolated from two plant species native to the Middle East may provide opportunities for complementary
Energy Technology Data Exchange (ETDEWEB)
Yang, Fangxing, E-mail: fxyang@zju.edu.cn [MOE Key Laboratory of Environmental Remediation and Ecosystem Health, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou, 310058 (China); Zhuang, Shulin [MOE Key Laboratory of Environmental Remediation and Ecosystem Health, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou, 310058 (China); Zhang, Chao; Dai, Heping [State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, 430072 (China); Liu, Weiping, E-mail: wliu@zju.edu.cn [MOE Key Laboratory of Environmental Remediation and Ecosystem Health, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou, 310058 (China)
2013-06-15
Increasing environmental pollution by carcinogens such as some of persistent organic pollutants (POPs) has prompted growing interest in searching for chemopreventive compounds which are readily obtainable. Sulforaphane (SFN) is isolated from cruciferous vegetables and has the potentials to reduce carcinogenesis through various pathways. In this study, we studied the effects of SFN on CYP1A1 activity and genotoxicity induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The results showed that SFN inhibited TCDD-induced CYP1A1 activity in H4IIE cells by directly inhibiting CYP1A1 activity, probably through binding to aryl hydrocarbon receptor and/or CYP1A1 revealed by molecular docking. However, SFN promoted TCDD-induced DNA damage in yeast cells and reduced the viability of initiated yeast cells. Besides, it is surprising that SFN also failed to reduce genotoxicity induced by other genotoxic reagents which possess different mechanisms to lead to DNA damage. Currently, it is difficult to predict whether SFN has the potentials to reduce the risk of TCDD based on the conflicting observations in the study. Therefore, further studies should be urgent to reveal the function and mechanism of SFN in the stress of such POPs on human health. - Highlights: • Sulforaphane inhibited TCDD-induced CYP1A1 activity in H4IIE cells. • Sulforaphane may bind to aryl hydrocarbon receptor and/or CYP1A1. • Sulforaphane promoted TCDD-induced DNA damage in yeast cells. • Sulforaphane may promote DNA damage by DNA strand breaks or DNA alkylation.
In silico modeling to predict drug-induced phospholipidosis
International Nuclear Information System (INIS)
Choi, Sydney S.; Kim, Jae S.; Valerio, Luis G.; Sadrieh, Nakissa
2013-01-01
Drug-induced phospholipidosis (DIPL) is a preclinical finding during pharmaceutical drug development that has implications on the course of drug development and regulatory safety review. A principal characteristic of drugs inducing DIPL is known to be a cationic amphiphilic structure. This provides evidence for a structure-based explanation and opportunity to analyze properties and structures of drugs with the histopathologic findings for DIPL. In previous work from the FDA, in silico quantitative structure–activity relationship (QSAR) modeling using machine learning approaches has shown promise with a large dataset of drugs but included unconfirmed data as well. In this study, we report the construction and validation of a battery of complementary in silico QSAR models using the FDA's updated database on phospholipidosis, new algorithms and predictive technologies, and in particular, we address high performance with a high-confidence dataset. The results of our modeling for DIPL include rigorous external validation tests showing 80–81% concordance. Furthermore, the predictive performance characteristics include models with high sensitivity and specificity, in most cases above ≥ 80% leading to desired high negative and positive predictivity. These models are intended to be utilized for regulatory toxicology applied science needs in screening new drugs for DIPL. - Highlights: • New in silico models for predicting drug-induced phospholipidosis (DIPL) are described. • The training set data in the models is derived from the FDA's phospholipidosis database. • We find excellent predictivity values of the models based on external validation. • The models can support drug screening and regulatory decision-making on DIPL
Directory of Open Access Journals (Sweden)
Mathieu Boulin
Full Text Available The costs of drug-induced hypoglycemia are a critical but often neglected component of value-based arguments to reduce tight glycemic control in older adults with type 2 diabetes.An economic (decision-tree analysis compared rates, costs, quality-adjusted life-years, and incremental costs per quality-adjusted life-year gained associated with mild, moderate and severe hypoglycemic events for 6 glucose-lowering medication classes in type 2 diabetic adults aged 65-79 versus those 80 years and older. The national U.S. (Center for Medicare Services and Canadian public health payer perspectives were adopted.Incidence rates of drug-induced hypoglycemia were the highest for basal insulin and sulfonylureas: 8.64 and 4.32 events per person-year in 65-79 year olds, and 12.06 and 6.03 events per person-year for 80 years and older. In both the U.S. and Canada, metformin dominated sulfonylureas, basal insulin and glucagon-like peptide1 receptor agonists. Relative to sulfonylureas, thiazolidinediones had the lowest incremental cost-effectiveness ratios in the U.S. and dominated sulfonylureas in Canada for adults 80 years and older. Relative to sulfonylureas, dipeptidyl peptidase4 inhibitors were cost-effective for adults 80 years and older in both countries, and for 65-79 year olds in Canada. Annual costs of hypoglycemia for older adults attaining very tight glycemic control with the use of insulin or sulfonylureas were estimated at U.S.$509,214,473 in the U.S. and CAN$65,497,849 in Canada.Optimizing drug therapy for older type 2 diabetic adults through the avoidance of drug-induced hypoglycemia will dramatically improve patient health while also generating millions of dollars by saving unnecessary medical costs.
Conditioned Place Preference Induced by Licit Drugs: Establishment, Extinction, and Reinstatement
Directory of Open Access Journals (Sweden)
Yu Liu
2008-01-01
Full Text Available The conditioned place preference (CPP model has been widely used to evaluate the rewarding effects of abused drugs, and recently, the extinction and reinstatement phases of this paradigm have been used to assess relapse to drug seeking. The vast majority of studies have focused on CPP induced by illicit drugs, such as psychostimulants and opioids. Although legal psychoactive drugs, such as ethanol, nicotine, and caffeine, are more widely used than illegal drugs, the establishment, extinction, and reinstatement of CPP produced by these licit drugs are less well understood. The present review discusses the extant research on CPP induced by legal drugs. We first describe the CPP model and discuss the behavioral procedures used to induce CPP for ethanol, nicotine, and caffeine. We then summarize the neuronal substrates that underlie CPP induced by these drugs from a genetic perspective. Finally, we draw on findings from pharmacological studies and discuss the neurotransmitters and neurohormones underlying CPP produced by ethanol, nicotine, and caffeine.
Erratum: PDGF-BB induces intratumoral lymphangiogenesis and promotes lymphatic metastasis
DEFF Research Database (Denmark)
Cao, R.H.; Bjorndahl, M.A.; Religa, P.
2006-01-01
This corrects the article "PDGF-BB induces intratumoral lymphangiogenesis and promotes lymphatic metastasis", Cancer Cell, 2004, vol. 6(4), pg 333-45.......This corrects the article "PDGF-BB induces intratumoral lymphangiogenesis and promotes lymphatic metastasis", Cancer Cell, 2004, vol. 6(4), pg 333-45....
Zhu, Ru-Gang; Sun, Yan-Di; Hou, Yu-Ting; Fan, Jun-Gang; Chen, Gang; Li, Tuo-Ping
2017-06-25
Haw pectin penta-oligogalacturonide (HPPS) has important role in improving cholesterol metabolism and promoting the conversion of cholesterol to bile acids (BA) in mice fed high-cholesterol diet (HCD). However, the mechanism is not clear. This study aims to investigate the effects of HPPS on cholesterol accumulation and the regulation of hepatic BA synthesis and transport in HCD-fed mice. Results showed that HPPS significantly decreased plasma and hepatic TC levels but increased plasma high-density lipoprotein cholesterol (HDL-C) and apolipoprotein A-I (apoA-I) levels, compared to HCD. BA analysis showed that HPPS markedly decreased hepatic and small intestine BA levels but increased the gallbladder BA levels, and finally decreased the total BA pool size, compared to HCD. Studies of molecular mechanism revealed that HPPS promoted hepatic ATP-binding cassette transporter A1 (ABCA1), ATP-binding cassette transporter G1 (ABCG1), and scavenger receptor BI (SR-BI) expression but did not affect ATB binding cassette transporter G5/G8 (ABCG5/8) expression. HPPS inactivated hepatic farnesoid X receptor (FXR) and target genes expression, which resulted in significant increase of cholesterol 7α-hydroxylase 1 (CYP7A1) and sterol 12α-hydroxylase (CYP8B1) expression, with up-regulations of 204.2% and 33.5% for mRNA levels, respectively, compared with HCD. In addition, HPPS markedly enhanced bile salt export pump (BSEP) expression but didn't affect the sodium/taurocholate co-transporting polypeptide (NTCP) expression. In conclusion, the study revealed that HPPS reduced cholesterol accumulation by promoting BA synthesis in the liver and excretion in the feces, and might promote macrophage-to-liver reverse cholesterol transport (RCT) but did not liver-to-fecal RCT. Copyright © 2017 Elsevier B.V. All rights reserved.
Cheng, Hongwei; Wu, Zhixian; Wu, Caisheng; Wang, Xiaoyuan; Liow, Sing Shy; Li, Zibiao; Wu, Yun-Long
2018-02-01
Stanniocalcin 2 (STC2) overexpression in hepatocellular carcinoma (HCC) could lead to poor prognosis, which might be due to its induced P-glycoprotein and Bcl-2 protein expression level increase. P-glycoprotein or membrane pump induced drug efflux and altered prosurvival Bcl-2 expression are key mechanisms for drug resistance leading to failure of chemotherapy in HCC. However, current strategy to overcome both P-glycoprotein and Bcl-2 protein induced drug resistance was rarely reported. In this work, we utilized an amphiphilic poly[(R)-3-hydroxybutyrate] (PHB)-b-poly(2-(dimethylamino)ethyl methacrylate) (PDMAEMA) cationic polyester to encapsulate chemotherapeutic paclitaxel (PTX) in hydrophobic PHB domain and Bcl-2 convertor Nur77/ΔDBD gene (Nur77 without DNA binding domain for mitochondria localization) by formation of polyplex due to cationic PDMAEMA segment, to effectively inhibit the drug resistant HepG2/STC2 and SMCC7721/STC2 liver cancer cell growth. Thanks to the cationic nanoparticle complex formation ability and high transfection efficiency to express Bcl-2 conversion proteins, PHB-PDMAEMA/PTX@polyplex could partially impair P-glycoprotein induced PTX efflux and activate the apoptotic function of previous prosurvival Bcl-2 protein. This is the pioneer report of cationic amphiphilic polyester PHB-PDMAEMA to codeliver anticancer drug and therapeutic plasmid to overcome both pump and non-pump mediated chemotherapeutic resistance in liver cancer cells, which might be inspiring for the application of polyester in personalized cancer therapy. Copyright © 2017 Elsevier B.V. All rights reserved.
Prolonged drug-induced hypothermia in experimental stroke
DEFF Research Database (Denmark)
Johansen, Flemming Fryd; Jørgensen, Henrik Stig; Reith, Jakob
2007-01-01
In experimental and human stroke, hypothermia is strongly related to a favorable outcome. Previous attempts to manipulate the core temperature in focal cerebral ischemia have been based on mechanical cooling. The purpose of the study is to establish a model for long-term drug-induced hypothermia...... in focal ischemia by pharmacological alteration of the central thermoregulatory set-point. We tested the hypothesis that the dopaminergic agonist Talipexole, which induces hypothermia, reduces infarct size. Body temperature was monitored by a radio-pill-implant. Rats had reversible occlusion of the middle...... that the core body temperature was reduced by 1.7 degrees C for 24 hours after MCAO in rats treated with Talipexole. This treatment induced a significant reduction of infarct volume at 7 days after focal ischemia by 47%. We suggest that the reduction in infarct volume is related to drug-induced hypothermia...
ATP binding cassette G1-dependent cholesterol efflux during inflammation.
de Beer, Maria C; Ji, Ailing; Jahangiri, Anisa; Vaughan, Ashley M; de Beer, Frederick C; van der Westhuyzen, Deneys R; Webb, Nancy R
2011-02-01
ATP binding cassette transporter G1 (ABCG1) mediates the transport of cellular cholesterol to HDL, and it plays a key role in maintaining macrophage cholesterol homeostasis. During inflammation, HDL undergoes substantial remodeling, acquiring lipid changes and serum amyloid A (SAA) as a major apolipoprotein. In the current study, we investigated whether remodeling of HDL that occurs during acute inflammation impacts ABCG1-dependent efflux. Our data indicate that lipid free SAA acts similarly to apolipoprotein A-I (apoA-I) in mediating sequential efflux from ABCA1 and ABCG1. Compared with normal mouse HDL, acute phase (AP) mouse HDL containing SAA exhibited a modest but significant 17% increase in ABCG1-dependent efflux. Interestingly, AP HDL isolated from mice lacking SAA (SAAKO mice) was even more effective in promoting ABCG1 efflux. Hydrolysis with Group IIA secretory phospholipase A(2) (sPLA(2)-IIA) significantly reduced the ability of AP HDL from SAAKO mice to serve as a substrate for ABCG1-mediated cholesterol transfer, indicating that phospholipid (PL) enrichment, and not the presence of SAA, is responsible for alterations in efflux. AP human HDL, which is not PL-enriched, was somewhat less effective in mediating ABCG1-dependent efflux compared with normal human HDL. Our data indicate that inflammatory remodeling of HDL impacts ABCG1-dependent efflux independent of SAA.
The discovery of drug-induced illness.
Jick, H
1977-03-03
The increased use of drugs (and the concurrent increased risks of drug-induced illness) require definition of relevant research areas and strategy. For established marketed drugs, research needs depend on the magnitudes of risk of an illness from a drug and the base-line risk. With the drug risk high and the base-line risk low, the problem surfaces in premarketing studies or through the epidemic that develops after marketing. If the drug adds slightly to a high base-line risk, the effect is undetectable. When both risks are low, adverse effects can be discovered by chance, but systematic case-referent studies can speed discovery. If both risks are high, clinical trials and nonexperimental studies may be used. With both risks intermediate, systematic evaluations, especially case-referent studies are needed. Newly marketed drugs should be routinely evaluated through compulsory registration and follow-up study of the earliest users.
hERG trafficking inhibition in drug-induced lethal cardiac arrhythmia.
Nogawa, Hisashi; Kawai, Tomoyuki
2014-10-15
Acquired long QT syndrome induced by non-cardiovascular drugs can cause lethal cardiac arrhythmia called torsades de points and is a significant problem in drug development. The prolongation of QT interval and cardiac action potential duration are mainly due to reduced physiological function of the rapidly activating voltage-dependent potassium channels encoded by human ether-a-go-go-related gene (hERG). Structurally diverse groups of drugs are known to directly inhibit hERG channel conductance. Therefore, the ability of acute hERG inhibition is routinely assessed at the preclinical stages in pharmaceutical testing. Recent findings indicated that chronic treatment with various drugs not only inhibits hERG channels but also decreases hERG channel expression in the plasma membrane of cardiomyocytes, which has become another concern in safety pharmacology. The mechanisms involve the disruption of hERG trafficking to the surface membrane or the acceleration of hERG protein degradation. From this perspective, we present a brief overview of mechanisms of drug-induced trafficking inhibition and pathological regulation. Understanding of drug-induced hERG trafficking inhibition may provide new strategies for predicting drug-induced QT prolongation and lethal cardiac arrhythmia in pharmaceutical drug development. Copyright © 2014 Elsevier B.V. All rights reserved.
Immunoexpression of interleukin-6 in drug-induced gingival overgrowth patients
Directory of Open Access Journals (Sweden)
P R Ganesh
2016-01-01
Full Text Available Background: To analyze the role of proinflammatory cytokines in drug-induced gingival enlargement in Indian population. Aim: To evaluate for the presence of interleukin-6 (IL-6 in drug-induced gingival enlargement and to compare it with healthy control in the absence of enlargement. Materials and Methods: Thirty-five patients selected for the study and divided into control group (10 and study group (25 consisting of phenytoin (10; cyclosporin (10 and nifedipine (5 induced gingival enlargement. Gingival overgrowth index of Seymour was used to assess overgrowth and allot groups. Under LA, incisional biopsy done, tissue sample fixed in 10% formalin and immunohistochemically evaluated for the presence of IL-6 using LAB-SA method, Labeled- Streptavidin-Biotin Method (LAB-SA kit from Zymed- 2nd generation LAB-SA detection system, Zymed Laboratories, CA. The results of immunohistochemistry were statistically analyzed using Kruskaal–Wallis and Mann–Whitney test. Results: The data obtained from immunohistochemistry assessment shows that drug-induced gingival overgrowth (DIGO samples express more IL-6 than control group and cyclosporin expresses more IL-6 followed by phenytoin and nifedipine. Conclusion: Increased IL-6 expression was noticed in all three DIGO groups in comparison with control group. Among the study group, cyclosporin expressed maximum IL-6 expression followed by phenytoin and nifedipine.
Gamma-sterilization-induced radicals in biodegradable drug delivery systems
International Nuclear Information System (INIS)
Maeder, K.; Swartz, H.M.; Domb, A.
1996-01-01
Electron paramagnetic resonance (EPR) spectroscopy (1.2 and 9.25 GHz, 25 o C) was used to characterize free radicals in gamma-ray sterilized biodegradable polymers of the type which are in clinical use. Free radicals were detected in all irradiated polymer samples. The temperature of irradiation (25 o vs dry ice temperature) had only a minor influence on the yield of radicals and the shape of the EPR spectra. In contrast, the composition of the polymers and the drugs incorporated in them did strongly influence the amount of radiation-induced free radicals and their reactivity. In general, polymers with high melting points and crystallinity had the highest yields of radicals observable at room temperature. We were able to use the free radicals induced by the usual sterilization procedures to follow the penetration of water and the degradation of the polymers in vitro and in vivo. The ability of in vivo EPR to follow drug delivery noninvasively and continuously in vivo, using the free radicals induced in the usual sterilization process indicates that this approach could be applied immediately for the characterization of these drug delivery systems in experimental animals and in the near future should be able to be used in human subjects. (author)
Fang, Xianjun; Hong, Yali; Dai, Li; Qian, Yuanyuan; Zhu, Chao; Wu, Biao; Li, Shengnan
2017-11-01
Corticotrophin-releasing hormone (CRH) has been demonstrated to participate in various diseases. Our previous study showed that its receptor CRHR1 mediated the development of colitis-associated cancer in mouse model. However, the detailed mechanisms remain unclear. In this study, we explored the oncogenetic role of CRH/CRHR1 signaling in colon cancer cells. Cell proliferation and colony formation assays revealed that CRH contributed to cell proliferation. Moreover, tube formation assay showed that CRH-treated colon cancer cell supernatant significantly promoted tube formation of human umbilical vein endothelial cells (HUVECs). And these effects could be reversed by the CRHR1 specific antagonist Antalarmin. Further investigation showed that CRH significantly upregulated the expressions of interlukin-6 (IL-6) and vascular endothelial growth factor (VEGF) through activating nuclear factor-kappa B (NF-κB). The CRH-induced IL-6 promoted phosphorylation of janus kinase 2 (JAK2) and signal transducers and activators of transcription 3 (STAT3). STAT3 inhibition by Stattic significantly inhibited the CRH-induced cell proliferation. In addition, silence of VEGF resulted in declined tube formation induced by CRH. Taken together, CRH/CRHR1 signaling promoted human colon cancer cell proliferation via NF-κB/IL-6/JAK2/STAT3 signaling pathway and tumor angiogenesis via NF-κB/VEGF signaling pathway. Our results provide evidence to support a critical role for the CRH/CRHR1 signaling in colon cancer progression and suggest its potential utility as a new therapeutic target for colon cancer. © 2017 Wiley Periodicals, Inc.
Xiao, Da; Chen, Yi-Tzai; Yang, Dongfang; Yan, Bingfang
2014-01-01
Carboxylesterases (CES) constitute a class of hydrolytic enzymes that play critical roles in drug metabolism and lipid mobilization. Previous studies with a large number of human liver samples have suggested that the inducibility of carboxylesterases is inversely related with age. To directly test this possibility, neonatal (10 days of age) and adult mice were treated with the antiepileptic agent phenobarbital. The expression and hydrolytic activity were determined on six major carboxylesterases including ces1d, the ortholog of human CES1. Without exception, all carboxylesterases tested were induced to a greater extent in neonatal than adult mice. The induction was detected at mRNA, protein and catalytic levels. Ces1d was greatly induced and found to rapidly hydrolyze the antiplatelet agent clopidogrel and support the accumulation of neutral lipids. Phenobarbital represents a large number of therapeutic agents that induce drug metabolizing enzymes and transporters in a species-conserved manner. The higher inducibility of carboxylesterases in the developmental age likely represents a general phenomenon cross species including human. Consequently, individuals in the developmental age may experience greater drug-drug interactions. The greater induction of ces1d also provides a molecular explanation to the clinical observation that children on antiepileptic drugs increase plasma lipids. PMID:22513142
Drug-induced status epilepticus.
Cock, Hannah R
2015-08-01
Drug-induced status epilepticus (SE) is a relatively uncommon phenomenon, probably accounting for less than 5% of all SE cases, although limitations in case ascertainment and establishing causation substantially weaken epidemiological estimates. Some antiepileptic drugs, particularly those with sodium channel or GABA(γ-aminobutyric acid)-ergic properties, frequently exacerbate seizures and may lead to SE if used inadvertently in generalized epilepsies or less frequently in other epilepsies. Tiagabine seems to have a particular propensity for triggering nonconvulsive SE sometimes in patients with no prior history of seizures. In therapeutic practice, SE is most commonly seen in association with antibiotics (cephalosporins, quinolones, and some others) and immunotherapies/chemotherapies, the latter often in the context of a reversible encephalopathy syndrome. Status epilepticus following accidental or intentional overdoses, particularly of antidepressants or other psychotropic medications, has also featured prominently in the literature: whilst there are sometimes fatal consequences, this is more commonly because of cardiorespiratory or metabolic complications than as a result of seizure activity. A high index of suspicion is required in identifying those at risk and in recognizing potential clues from the presentation, but even with a careful analysis of patient and drug factors, establishing causation can be difficult. In addition to eliminating the potential trigger, management should be as for SE in any other circumstances, with the exception that phenobarbitone is recommended as a second-line treatment for suspected toxicity-related SE where the risk of cardiovascular complications is higher anyways and may be exacerbated by phenytoin. There are also specific recommendations/antidotes in some situations. The outcome of drug-induced status epilepticus is mostly good when promptly identified and treated, though less so in the context of overdoses. This article is
Al-Ali, Hassan; Lee, Do-Hun; Danzi, Matt C.; Nassif, Houssam; Gautam, Prson; Wennerberg, Krister; Zuercher, Bill; Drewry, David H.; Lee, Jae K.; Lemmon, Vance P.; Bixby, John L.
2016-01-01
Mammalian Central Nervous System (CNS) neurons regrow their axons poorly following injury, resulting in irreversible functional losses. Identifying therapeutics that encourage CNS axon repair has been difficult, in part because multiple etiologies underlie this regenerative failure. This suggests a particular need for drugs that engage multiple molecular targets. Although multi-target drugs are generally more effective than highly selective alternatives, we lack systematic methods for discovering such drugs. Target-based screening is an efficient technique for identifying potent modulators of individual targets. In contrast, phenotypic screening can identify drugs with multiple targets; however, these targets remain unknown. To address this gap, we combined the two drug discovery approaches using machine learning and information theory. We screened compounds in a phenotypic assay with primary CNS neurons and also in a panel of kinase enzyme assays. We used learning algorithms to relate the compounds’ kinase inhibition profiles to their influence on neurite outgrowth. This allowed us to identify kinases that may serve as targets for promoting neurite outgrowth, as well as others whose targeting should be avoided. We found that compounds that inhibit multiple targets (polypharmacology) promote robust neurite outgrowth in vitro. One compound with exemplary polypharmacology, was found to promote axon growth in a rodent spinal cord injury model. A more general applicability of our approach is suggested by its ability to deconvolve known targets for a breast cancer cell line, as well as targets recently shown to mediate drug resistance. PMID:26056718
Drug Transporters in the Intestine
DEFF Research Database (Denmark)
Steffansen, Bente
2016-01-01
to the intestinal exsorptive DTs. An example is the API sulfasalazine, which is a substrate for breast cancer resistance protein (BCRP)/ABCG2. Sulfasalazine absorption is found to increase when human volunteers are administered high concentrations together with the inhibitor and spice curcumin. In conclusion...
Nickel, Sabrina; Selo, Mohammed Ali; Fallack, Juliane; Clerkin, Caoimhe G; Huwer, Hanno; Schneider-Daum, Nicole; Lehr, Claus-Michael; Ehrhardt, Carsten
2017-12-01
Breast cancer resistance protein (BCRP/ABCG2) has previously been identified with high expression levels in human lung. The subcellular localisation and functional activity of the transporter in lung epithelia, however, remains poorly investigated. The aim of this project was to study BCRP expression and activity in freshly isolated human alveolar epithelial type 2 (AT2) and type 1-like (AT1-like) cells in primary culture, and to compare these findings with data obtained from the NCI-H441 cell line. BCRP expression levels in AT2 and AT1-like cells and in different passages of NCI-H441 cells were determined using q-PCR and immunoblot. Transporter localisation was confirmed by confocal laser scanning microscopy. Efflux and transport studies using the BCRP substrate BODIPY FL prazosin and the inhibitor Ko143 were carried out to assess BCRP activity in the different cell models. BCRP expression decreased during transdifferentiation from AT2 to AT1-like phenotype. Culturing NCI-H441 cells at an air-liquid interface or submersed did not change BCRP abundance, however, BCRP levels increased with passage number. BCRP was localised to the apical membrane and cytosol in NCI-H441 cells. In primary cells, the protein was found predominantly in the nucleus. Functional studies were consistent with expression data. BCRP is differently expressed in AT2 and AT1-like cells with lower abundance and activity in the latter ones. Nuclear BCRP might play a transcriptional role in distal lung epithelium. In NCI-H441 cells, BCRP is expressed in apical cell membranes and its activity is consistent with the localisation pattern.
Directory of Open Access Journals (Sweden)
Zenya Saito
2016-11-01
Full Text Available Abstract Background The effectiveness of hepatoprotective drugs for DIH (drug induced hepatotoxicity during tuberculosis treatment is not clear. We evaluated the effectiveness of hepatoprotective drugs by comparing the period until the normalization of hepatic enzymes between patients who were prescribed with the hepatoprotective drugs after DIH was occurred and patients who were not prescribed with the hepatoprotective drugs. Methods During 2006–2010, 389 patients with active tuberculosis were included in this study. DIH was defined as elevation of peak serum aspartate aminotransferase (AST and/or alanine aminotransferase (ALT of more than twice the upper limit of normal (ULN. We divided the patients into the severe (peak serum AST and/or ALT elevation of >5 times the ULN, moderate (peak serum AST and/or ALT elevation of >3 to ≤5 times the ULN, and mild DIH groups (peak serum AST and/or ALT elevation of >2 to ≤3 times the ULN. We compared the average period until the normalization of hepatic enzymes between patient subgroups with and without hepatoprotective drugs (ursodeoxycholic acid: UDCA, stronger neo-minophagen C: SNMC, and glycyrrhizin. Results In the severe group, there was no significant difference in the average period until the normalization between subgroups with and without hepatoprotective drugs (21.4 ± 10.8 vs 21.5 ± 11.1 days, P = 0.97. In the mild group, the period was longer in the subgroup with hepatoprotective drugs than that without hepatoprotective drugs (15.7 ± 6.2 vs 12.4 ± 7.9 days, P = 0.046. Conclusion Regardless of the severity, hepatoprotective drugs did not shorten the period until the normalization of hepatic enzymes.
Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer
International Nuclear Information System (INIS)
Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.
2003-01-01
Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement
Saito, Kosuke; Maekawa, Keiko; Ishikawa, Masaki; Senoo, Yuya; Urata, Masayo; Murayama, Mayumi; Nakatsu, Noriyuki; Yamada, Hiroshi; Saito, Yoshiro
2014-01-01
Drug-induced phospholipidosis is one of the major concerns in drug development and clinical treatment. The present study involved the use of a nontargeting lipidomic analysis with liquid chromatography-mass spectrometry to explore noninvasive blood biomarkers for hepatic phospholipidosis from rat plasma. We used three tricyclic antidepressants (clomipramine [CPM], imipramine [IMI], and amitriptyline [AMT]) for the model of phospholipidosis in hepatocytes and ketoconazole (KC) for the model of phospholipidosis in cholangiocytes and administered treatment for 3 and 28 days each. Total plasma lipids were extracted and measured. Lipid molecules contributing to the separation of control and drug-treated rat plasma in a multivariate orthogonal partial least squares discriminant analysis were identified. Four lysophosphatidylcholines (LPCs) (16:1, 18:1, 18:2, and 20:4) and 42:1 hexosylceramide (HexCer) were identified as molecules separating control and drug-treated rats in all models of phospholipidosis in hepatocytes. In addition, 16:1, 18:2, and 20:4 LPCs and 42:1 HexCer were identified in a model of hepatic phospholipidosis in cholangiocytes, although LPCs were identified only in the case of 3-day treatment with KC. The levels of LPCs were decreased by drug-induced phospholipidosis, whereas those of 42:1 HexCer were increased. The increase in 42:1 HexCer was much higher in the case of IMI and AMT than in the case of CPM; moreover, the increase induced by IMI was dose-dependent. Structural characterization determining long-chain base and hexose delineated that 42:1 HexCer was d18:1/24:0 glucosylceramide (GluCer). In summary, our study demonstrated that d18:1/24:0 GluCer and LPCs are potential novel biomarkers for drug-induced hepatic phospholipidosis. PMID:24980264
Role of nonalcoholic fatty liver disease as risk factor for drug-induced hepatotoxicity
Massart, Julie; Begriche, Karima; Moreau, Caroline; Fromenty, Bernard
2017-01-01
Background Obesity is often associated with nonalcoholic fatty liver disease (NAFLD), which refers to a large spectrum of hepatic lesions including fatty liver, nonalcoholic steatohepatitis (NASH) and cirrhosis. Different investigations showed or suggested that obesity and NAFLD are able to increase the risk of hepatotoxicity of different drugs. Some of these drugs could induce more frequently an acute hepatitis in obese individuals whereas others could worsen pre-existing NAFLD. Aim The main objective of the present review was to collect the available information regarding the role of NAFLD as risk factor for drug-induced hepatotoxicity. For this purpose, we performed a data-mining analysis using different queries including drug-induced liver injury (or DILI), drug-induced hepatotoxicity, fatty liver, nonalcoholic fatty liver disease (or NAFLD), steatosis and obesity. The main data from the collected articles are reported in this review and when available, some pathophysiological hypotheses are put forward. Relevance for patients Drugs that could pose a potential risk in obese patients include compounds belonging to different pharmacological classes such as acetaminophen, halothane, methotrexate, rosiglitazone, stavudine and tamoxifen. For some of these drugs, experimental investigations in obese rodents confirmed the clinical observations and unveiled different pathophysiological mechanisms which could explain why these pharmaceuticals are particularly hepatotoxic in obesity and NAFLD. Other drugs such as pentoxifylline, phenobarbital and omeprazole might also pose a risk but more investigations are required to determine whether this risk is significant or not. Because obese people often take several drugs for the treatment of different obesity-related diseases such as type 2 diabetes, hyperlipidemia and coronary heart disease, it is urgent to identify the main pharmaceuticals that can cause acute hepatitis on a fatty liver background or induce NAFLD worsening
Energy Technology Data Exchange (ETDEWEB)
Mittal, Monika; Pal, Subhashis; China, Shyamsundar Pal; Porwal, Konica [Division of Endocrinology and Centre for Research in Anabolic Skeletal Targets in Health and Illness (ASTHI), CSIR-Central Drug Research Institute, Lucknow 226031 (India); Dev, Kapil [Division of Medicinal and Process Chemistry, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Shrivastava, Richa [Division of Toxicology, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Raju, Kanumuri Siva Rama; Rashid, Mamunur [Pharmaceutics Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Trivedi, Arun Kumar; Sanyal, Sabyasachi [Biochemistry Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Wahajuddin, Muhammad [Pharmaceutics Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Bhaduria, Smrati [Division of Toxicology, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Maurya, Rakesh [Division of Medicinal and Process Chemistry, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Chattopadhyay, Naibedya, E-mail: n_chattopadhyay@cdri.res.in [Division of Endocrinology and Centre for Research in Anabolic Skeletal Targets in Health and Illness (ASTHI), CSIR-Central Drug Research Institute, Lucknow 226031 (India)
2017-02-01
Aldehyde dehydrogenases (ALDHs) are a family of enzymes involved in detoxifying aldehydes. Previously, we reported that an ALDH inhibitor, disulfiram caused bone loss in rats and among ALDHs, osteoblast expressed only ALDH2. Loss-of-function mutation in ALDH2 gene is reported to cause bone loss in humans which suggested its importance in skeletal homeostasis. We thus studied whether activating ALDH2 by N-(1, 3-benzodioxol-5-ylmethyl)-2, 6-dichlorobenzamide (alda-1) had osteogenic effect. We found that alda-1 increased and acetaldehyde decreased the differentiation of rat primary osteoblasts and expressions of ALDH2 and bone morphogenetic protein-2 (BMP-2). Silencing ALDH2 in osteoblasts abolished the alda-1 effects. Further, alda-1 attenuated the acetaldehyde-induced lipid-peroxidation and oxidative stress. BMP-2 is essential for bone regeneration and alda-1 increased its expression in osteoblasts. We then showed that alda-1 (40 mg/kg dose) augmented bone regeneration at the fracture site with concomitant increase in BMP-2 protein compared with control. The osteogenic dose (40 mg/kg) of alda-1 attained a bone marrow concentration that was stimulatory for osteoblast differentiation, suggesting that the tissue concentration of alda-1 matched its pharmacologic effect. In addition, alda-1 promoted modeling-directed bone growth and peak bone mass achievement, and increased bone mass in adult rats which reiterated its osteogenic effect. In osteopenic ovariectomized (OVX) rats, alda-1 reversed trabecular osteopenia with attendant increase in serum osteogenic marker (procollagen type I N-terminal peptide) and decrease in oxidative stress. Alda-1 has no effect on liver and kidney function. We conclude that activating ALDH2 by alda-1 had an osteoanabolic effect involving increased osteoblastic BMP-2 production and decreased OVX-induced oxidative stress. - Highlights: • Alda-1 induced osteoblast differentiation that involved upregulation of ALDH2 and BMP-2 • Alda-1
Kodama, Nao; Iwao, Takahiro; Kabeya, Tomoki; Horikawa, Takashi; Niwa, Takuro; Kondo, Yuki; Nakamura, Katsunori; Matsunaga, Tamihide
2016-06-01
We previously reported that small-molecule compounds were effective in generating pharmacokinetically functional enterocytes from human induced pluripotent stem (iPS) cells. In this study, to determine whether the compounds promote the differentiation of human iPS cells into enterocytes, we investigated the effects of a combination of mitogen-activated protein kinase kinase (MEK), DNA methyltransferase (DNMT), and transforming growth factor (TGF)-β inhibitors on intestinal differentiation. Human iPS cells cultured on feeder cells were differentiated into endodermal cells by activin A. These endodermal-like cells were then differentiated into intestinal stem cells by fibroblast growth factor 2. Finally, the cells were differentiated into enterocyte cells by epidermal growth factor and small-molecule compounds. After differentiation, mRNA expression levels and drug-metabolizing enzyme activities were measured. The mRNA expression levels of the enterocyte marker sucrase-isomaltase and the major drug-metabolizing enzyme cytochrome P450 (CYP) 3A4 were increased by a combination of MEK, DNMT, and TGF-β inhibitors. The mRNA expression of CYP3A4 was markedly induced by 1α,25-dihydroxyvitamin D3. Metabolic activities of CYP1A1/2, CYP2B6, CYP2C9, CYP2C19, CYP3A4/5, UDP-glucuronosyltransferase, and sulfotransferase were also observed in the differentiated cells. In conclusion, MEK, DNMT, and TGF-β inhibitors can be used to promote the differentiation of human iPS cells into pharmacokinetically functional enterocytes. Copyright © 2016 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Tomoyuki Nishizaki
2014-12-01
Full Text Available We have originally synthesized the naftopidil analogue 1-[2-(2-methoxyphenylaminoethylamino]-3-(naphthalene-1-yloxypropan-2-ol (HUHS 1015 as a new anticancer drug. HUHS1015 induces cell death in a wide variety of human cancer cell lines originated from malignant pleural mesothelioma, lung cancer, hepatoma, gastric cancer, colorectal cancer, bladder cancer, prostate cancer, and renal cancer. HUHS1015-induced cell death includes necrosis (necroptosis and apoptosis, and the underlying mechanism differs depending upon cancer cell types. HUHS1015 effectively suppresses tumor growth in mice inoculated with NCI-H2052, MKN45, or CW2 cells, with a potential similar to or higher than that of currently used anticancer drugs. Here we show how HUHS1015 might offer brilliant hope for cancer therapy.
Spontaneous reports on drug-induced pancreatitis in Denmark from 1968 to 1999
DEFF Research Database (Denmark)
Andersen, V; Sonne, J; Andersen, M
2001-01-01
valproate (two cases), clomipramine (one case) and azathioprine (one case). Definite relationship was stated for mesalazine (three cases), azathioprine (two cases) and simvastatin (one case) on the basis of re-challenge. A possible or probable causality was considered for a further 30 drugs including 5...... (measles" mumps/rubella) vaccination. CONCLUSION: Drug-induced pancreatitis is rarely reported. The incidence may be increasing and the course is often serious. This is the first report on definite simvastatin-induced pancreatitis. Further studies on the pancreotoxic potential of drugs are warranted.......OBJECTIVES: To present an update on drug-induced pancreatitis reported to the Danish Committee on Adverse Drug Reactions. DESIGN: Retrospective study of spontaneous case reports to the Danish reporting system on adverse drug reactions. METHODS: All cases of suspected drug-induced pancreatitis...
Canfrán-Duque, Alberto; Rotllan, Noemi; Zhang, Xinbo; Fernández-Fuertes, Marta; Ramírez-Hidalgo, Cristina; Araldi, Elisa; Daimiel, Lidia; Busto, Rebeca; Fernández-Hernando, Carlos; Suárez, Yajaira
2017-09-01
Atherosclerosis, the major cause of cardiovascular disease, is a chronic inflammatory disease characterized by the accumulation of lipids and inflammatory cells in the artery wall. Aberrant expression of microRNAs has been implicated in the pathophysiological processes underlying the progression of atherosclerosis. Here, we define the contribution of miR-21 in hematopoietic cells during atherogenesis. Interestingly, we found that miR-21 is the most abundant miRNA in macrophages and its absence results in accelerated atherosclerosis, plaque necrosis, and vascular inflammation. miR-21 expression influences foam cell formation, sensitivity to ER-stress-induced apoptosis, and phagocytic clearance capacity. Mechanistically, we discovered that the absence of miR-21 in macrophages increases the expression of the miR-21 target gene, MKK3, promoting the induction of p38-CHOP and JNK signaling. Both pathways enhance macrophage apoptosis and promote the post-translational degradation of ABCG1, a transporter that regulates cholesterol efflux in macrophages. Altogether, these findings reveal a major role for hematopoietic miR-21 in atherogenesis. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.
Tutton, P J; Barkla, D H
1978-08-25
A stathmokinetic technique was used to study cell proliferation in dimethylhydrazine-induced adenocarcinomata of rat colon following treatment with cytotoxic drugs. The rate of cell division was significantly increased three days after treatment with 5,7-dihydroxytryptamine and seven days after treatment with 5-fluorouracil. Acceleration of tumour cell proliferation following 5,7-dihydroxytryptamine treatment was inhibited by treating animals with the antiseritoninergic drug Xylamidine Tosylate. Acceleration of tumour cell proliferation following 5-fluorouracil treatment was inhibited by treating animals either with the antiseritoninergic drug BW501 or with the histamine H2-receptor blocking drug Cimetidine.
Influence of dietary iodine on drug-induced hypothyrodism in the rat.
Beyssen, M L; Lagorce, J F; Cledat, D; Buxeraud, J
1999-06-01
Several compounds of pharmaceutical importance from a variety of chemical families, for example chlorpromazine and clomipramine, have been found to form charge-transfer complexes with iodine. We have investigated the influence of dietary iodine on thyroid-gland dysfunction induced by clomipramine, chlorpromazine or 2-thiazoline-2-thiol. We suggest that iodine is partly diverted from its metabolic pathway by complexation with drugs, and so the urinary concentration of iodide is increased. Both chlorpromazine and clomipramine, at doses which do not inhibit thyroperoxidase, enhanced urinary iodine excretion when dietary iodine was restricted (3.944+/-0.96 microg/day for chlorpromazine-tested rats, 3.43+/-1.33 microg/day for clomipramine-tested rats, compared with 2.34+/-0.11 microg/day in control rats). Concurrently, these pharmaceutical compounds increased the level of free thyroid-stimulating hormone (TSH) in comparison with controls and induced histological modifications in, and enlargement of, the thyroid gland. We have demonstrated that drug-induced loss of iodine in the urine was associated with antithyroid action when iodine intake was limited.
Mizoguchi, Hiroyuki; Yamada, Kiyofumi; Nabeshima, Toshitaka
2008-01-01
Matrix metalloproteinases (MMPs) and their inhibitors (TIMPs) function to remodel the pericellular environment. We have investigated the role of the MMP/TIMP system in methamphetamine (METH) dependence in rodents, in which the remodeling of neural circuits may be crucial. Repeated METH treatment induced behavioral sensitization, which was accompanied by an increase in MMP-2/-9/TIMP-2 activity in the brain. An antisense TIMP-2 oligonucleotide enhanced the sensitization, which was associated with a potentiation of the METH-induced release of dopamine in the nucleus accumbens (NAc). MMP-2/-9 inhibitors blocked the METH-induced behavioral sensitization and conditioned place preference (CPP), a measure of the rewarding effect of a drug, and reduced the METH-increased dopamine release in the NAc. In MMP-2- and MMP-9-deficient mice, METH-induced behavioral sensitization and CPP as well as dopamine release were attenuated. The MMP/TIMP system may be involved in METH-induced sensitization and reward by regulating extracellular dopamine levels.
Weaver, Richard J; Betts, Catherine; Blomme, Eric A G; Gerets, Helga H J; Gjervig Jensen, Klaus; Hewitt, Philip G; Juhila, Satu; Labbe, Gilles; Liguori, Michael J; Mesens, Natalie; Ogese, Monday O; Persson, Mikael; Snoeys, Jan; Stevens, James L; Walker, Tracy; Park, B Kevin
2017-07-01
The liver is an important target for drug-induced toxicities. Early detection of hepatotoxic drugs requires use of well-characterized test systems, yet current knowledge, gaps and limitations of tests employed remains an important issue for drug development. Areas Covered: The current state of the science, understanding and application of test systems in use for the detection of drug-induced cytotoxicity, mitochondrial toxicity, cholestasis and inflammation is summarized. The test systems highlighted herein cover mostly in vitro and some in vivo models and endpoint measurements used in the assessment of small molecule toxic liabilities. Opportunities for research efforts in areas necessitating the development of specific tests and improved mechanistic understanding are highlighted. Expert Opinion: Use of in vitro test systems for safety optimization will remain a core activity in drug discovery. Substantial inroads have been made with a number of assays established for human Drug-induced Liver Injury. There nevertheless remain significant gaps with a need for improved in vitro tools and novel tests to address specific mechanisms of human Drug-Induced Liver Injury. Progress in these areas will necessitate not only models fit for application, but also mechanistic understanding of how chemical insult on the liver occurs in order to identify translational and quantifiable readouts for decision-making.
Ma, Juan; Yuan, Gang; Chen, Min-hu
2006-10-31
To construct the model of non-steroidal anti-inflammatory drug (NSAID) induced gastropathy and observe the preventive effects of Teprenone on it in rats. Ninety-one male Sprague-Dawley (SD) rats were divided into normal saline group, model group (I) and prophylaxis group (II). Group I includes four subgroups (Ia, Ib, Ic, Id) treated by indomethacin (5 mgxkg(-1)xd(-1)), combination of indomethacin (5 mgxkg(-1)xd(-1)) and prednisone (10 mgxkg(-1)xd(-1)), celecoxib (100 mgxkg(-1)xd(-1)) and combination of celecoxib (100 mgxkg(-1)xd(-1)) and prednisone (10 mgxkg(-1)xd(-1)) respectively. Group II also includes four subgroups (IIa, IIb, IIc, IId) pretreated by teprenone (12 mgxkg(-1)xd(-1)) compared with group I. Lesion index (LI), pathohistology index, cyclooxygenase-1 (COX-1) and cyclooxygenase-2 (COX-2) mRNA detected by RT-PCR were observed after 4 days. Compared with normal saline group, LI (11.00 (1.00 - 22.5), 8.50 (0.75 - 14.50), 11.00 (3.50 - 14.75), P NSAID. Prednisone could promote the risk in NSAID induced gastropathy. In addition to COX-1 inhibition, other factors might also involved in NSAID induced gastropathy. Teprenone could prevented from NSAID induced gastropathy but the actions might be not associated with COXs.
Mouse ATP-Binding Cassette (ABC) Transporters Conferring Multi-Drug Resistance
Shuaizhang, L I; Zhang, Wen; Yin, Xuejiao; Xing, Shilai; Xie, Qunhui; Cao, Zhengyu; Zhao, Bin
2015-04-28
The ABC (ATP-binding cassette) transporter is one of the largest and most ancient protein families with members functioning from protozoa to human. The resistance of cancer and tumor cells to anticancer drugs is due to the over-expression of some ABC transporters, which may finally lead to chemotherapy failure. The mouse ABC transporters are classified into seven subfamilies by phylogenetic analysis. The mouse ABC transporter gene, alias, chromosomal location and function have been determined. Within the ABC super-family, the MDR transporters (Abcb1, Abcc1, Abcg2) in mouse models have been proved to be valuable to investigate the biochemistry and physiological functions. This review concentrates on the multidrug resistance of mouse ABC transporters in cancer and tumor cells.
Drug Induced Steatohepatitis: An Uncommon Culprit of a Common Disease
Directory of Open Access Journals (Sweden)
Liane Rabinowich
2015-01-01
Full Text Available Nonalcoholic fatty liver disease (NAFLD is a leading cause of liver disease in developed countries. Its frequency is increasing in the general population mostly due to the widespread occurrence of obesity and the metabolic syndrome. Although drugs and dietary supplements are viewed as a major cause of acute liver injury, drug induced steatosis and steatohepatitis are considered a rare form of drug induced liver injury (DILI. The complex mechanism leading to hepatic steatosis caused by commonly used drugs such as amiodarone, methotrexate, tamoxifen, valproic acid, glucocorticoids, and others is not fully understood. It relates not only to induction of the metabolic syndrome by some drugs but also to their impact on important molecular pathways including increased hepatocytes lipogenesis, decreased secretion of fatty acids, and interruption of mitochondrial β-oxidation as well as altered expression of genes responsible for drug metabolism. Better familiarity with this type of liver injury is important for early recognition of drug hepatotoxicity and crucial for preventing severe forms of liver injury and cirrhosis. Moreover, understanding the mechanisms leading to drug induced hepatic steatosis may provide much needed clues to the mechanism and potential prevention of the more common form of metabolic steatohepatitis.
Glucose hypermetabolism in the thalamus of patients with drug-induced blepharospasm.
Suzuki, Y; Kiyosawa, M; Wakakura, M; Mochizuki, M; Ishiwata, K; Oda, K; Ishii, K
2014-03-28
We examined the difference in cerebral function alterations between drug-induced blepharospasm patients and essential blepharospasm (EB) patients by using positron emission tomography with (18)F-fluorodeoxyglucose. Cerebral glucose metabolism was examined in 21 patients with drug-induced blepharospasm (5 men and 16 women; mean age, 53.1 [range, 29-78] years), 21 essential EB patients (5 men and 16 women; mean age, 53.0 [range, 33-72] years) and 24 healthy subjects (6 men and 18 women; mean age, 57.9 [range, 22-78] years) with long-term history of benzodiazepines use (drug healthy subjects). Drug-induced blepharospasm patients developed symptoms while taking benzodiazepines or thienodiazepines. Sixty-three normal volunteers (15 men and 48 women; mean age, 53.6 [range, 20-70] years) were examined as controls. Differences between the patient groups and control group were examined by statistical parametric mapping. Additionally, we defined regions of interests on both sides of the thalamus, caudate nucleus, anterior putamen, posterior putamen and primary somatosensory area. The differences between groups were tested using two-sample t-tests with Bonferroni correction for multiple comparisons. Cerebral glucose hypermetabolism on both side of the thalamus was detected in drug-induced blepharospasm, EB patients and drug healthy subjects by statistical parametric mapping. In the analysis of regions of interest, glucose metabolism in both sides of the thalamus in the drug-induced blepharospasm group was significantly lower than that in the EB group. Moreover, we observed glucose hypermetabolism in the anterior and posterior putamen bilaterally in EB group but not in drug-induced blepharospasm group and drug healthy subjects. Long-term regimens of benzodiazepines or thienodiazepines may cause down-regulation of benzodiazepine receptors in the brain. We suggest that the functional brain alteration in drug-induced blepharospasm patients is similar to that in EB patients, and
An Overview on the Proposed Mechanisms of Antithyroid Drugs-Induced Liver Injury
Directory of Open Access Journals (Sweden)
Reza Heidari
2015-03-01
Full Text Available Drug-induced liver injury (DILI is a major problem for pharmaceutical industry and drug development. Mechanisms of DILI are many and varied. Elucidating the mechanisms of DILI will allow clinicians to prevent liver failure, need for liver transplantation, and death induced by drugs. Methimazole and propylthiouracil (PTU are two convenient antithyroid agents which their administration is accompanied by hepatotoxicity as a deleterious side effect. Although several cases of antithyroid drugs-induced liver injury are reported, there is no clear idea about the mechanism(s of hepatotoxicity induced by these medications. Different mechanisms such as reactive metabolites formation, oxidative stress induction, intracellular targets dysfunction, and immune-mediated toxicity are postulated to be involved in antithyroid agents-induced hepatic damage. Due to the idiosyncratic nature of antithyroid drugs-induced hepatotoxicity, it is impossible to draw a specific conclusion about the mechanisms of liver injury. However, it seems that reactive metabolite formation and immune-mediated toxicity have a great role in antithyroids liver toxicity, especially those caused by methimazole. This review attempted to discuss different mechanisms proposed to be involved in the hepatic injury induced by antithyroid drugs.
DEFF Research Database (Denmark)
Nielsen, Mille Bækdal; Ytting, Henriette; Skalshøi Kjær, Mette
2017-01-01
OBJECTIVE: The idiosyncratic subtype of drug-induced liver injury (DILI) is a rare reaction to medical treatment that in severe cases can lead to acute liver failure and death. The aim of this study was to describe the presentation and outcome of DILI and to identify potential predictive factors...... that DILI may be severe and run a fatal course, and that bilirubin and INR levels may predict poor outcome....
Rhabdomyolysis induced by antiepileptic drugs: characteristics, treatment and prognosis.
Jiang, Wei; Wang, Xuefeng; Zhou, Shengnian
2016-01-01
Rhabdomyolysis syndrome refers to a variety of factors that affect the striated muscle cell membrane, the membrane channels and its energy supply. Most cases of rhabdomyolysis are due to direct trauma. However, infection, toxins, drugs, muscle ischemia, electrolyte imbalance, metabolic diseases, genetic diseases and abnormal body temperature can also lead to rhabdomyolysis. Epilepsy is one of the most common chronic neurological diseases. The primary long-term treatment is antiepileptic drugs (AEDs), which may cause rhabdomyolysis. This article summarizes the characteristics, treatment methods and prognosis of patients with rhabdomyolysis that is induced by antiepileptic drugs. This review is based on PubMed, EMBASE and MEDLINE searches of the literature using the keywords "epilepsy", "antiepileptic drugs","status epilepticus","rhabdomyolysis", and "antiepileptic drugs and rhabdomyolysis syndrome" as well as extensive personal clinical experience with various antiepileptic drugs. Potential relationships between antiepileptic drugs and rhabdomyolysis are discussed. Worldwide, there are approximately 50 million epilepsy patients, most of whom are treated with drugs. Reports have indicated that the majority of antiepileptic drugs on the market can cause rhabdomyolysis. Although rhabdomyolysis induced by antiepileptic drugs is a rare condition with a low incidence, this condition has serious consequences and merits attention from clinicians.
An Update on Drug-induced Liver Injury.
Devarbhavi, Harshad
2012-09-01
Idiosyncratic drug-induced liver injury (DILI) is an important cause of morbidity and mortality following drugs taken in therapeutic doses. Hepatotoxicity is a leading cause of attrition in drug development, or withdrawal or restricted use after marketing. No age is exempt although adults and the elderly are at increased risk. DILI spans the entire spectrum ranging from asymptomatic elevation in transaminases to severe disease such as acute hepatitis leading to acute liver failure. The liver specific Roussel Uclaf Causality Assessment Method is the most validated and extensively used for determining the likelihood that an implicated drug caused DILI. Asymptomatic elevation in liver tests must be differentiated from adaptation. Drugs producing DILI have a signature pattern although no single pattern is characteristic. Antimicrobial and central nervous system agents including antiepileptic drugs are the leading causes of DILI worldwide. In the absence of a diagnostic test or a biomarker, the diagnosis rests on the evidence of absence of competing causes such as acute viral hepatitis, autoimmune hepatitis and others. Recent studies show that antituberculosis drugs given for active or latent disease are still a major cause of drug-induced liver injury in India and the West respectively. Presence of jaundice signifies a severe disease and entails a worse outcome. The pathogenesis is unclear and is due to a mix of host, drug metabolite and environmental factors. Research has evolved from incriminating candidate genes to genome wide analysis studies. Immediate cessation of the drug is key to prevent or minimize progressive damage. Treatment is largely supportive. N-acetylcysteine is the antidote for paracetamol toxicity. Carnitine has been tried in valproate injury whereas steroids and ursodeoxycholic acid may be used in DILI associated with hypersensitivity or cholestatic features respectively. This article provides an overview of the epidemiology, the patterns of
Directory of Open Access Journals (Sweden)
Yuewen Tang
2017-02-01
Full Text Available Abstract Tissue damage induces cells into reprogramming-like cellular state, which contributes to tissue regeneration. However, whether factors promoting the cell reprogramming favor tissue regeneration remains elusive. Here we identified combination of small chemical compounds including drug cocktails robustly promoting in vitro cell reprogramming. We then administrated the drug cocktails to mice with acute liver injuries induced by partial hepatectomy or toxic treatment. Our results demonstrated that the drug cocktails which promoted cell reprogramming in vitro improved liver regeneration and hepatic function in vivo after acute injuries. The underlying mechanism could be that expression of pluripotent genes activated after injury is further upregulated by drug cocktails. Thus our study offers proof-of-concept evidence that cocktail of clinical compounds improving cell reprogramming favors tissue recovery after acute damages, which is an attractive strategy for regenerative purpose.
Drug-induced Hypothermia by 5HT1A Agonists Provide Neuroprotection in Experimental Stroke
DEFF Research Database (Denmark)
Johansen, Flemming Fryd; Hasseldam, Henrik; Nybro Smith, Matthias
2014-01-01
BACKGROUND: Drug-induced hypothermia reduces brain damage in animal stroke models and is an undiscovered potential in human stroke treatment. We studied hypothermia induced by the serotonergic agonists S14671 (1-[2-(2-thenoylamino)ethyl]-4[1-(7- methoxynaphtyl)]piperazine) and ipsapirone in a rat...... therapeutic hypothermia....
Kassem, Ahmed Alaa; Abd El-Alim, Sameh Hosam; Basha, Mona; Salama, Abeer
2017-03-01
To enhance the oral antidiabetic effect of repaglinide (RG), a newly emerging approach, based on the combination of phospholipid complexation and micelle techniques, was employed. Repaglinide-phospholipid complex (RG-PLC) was prepared by the solvent-evaporation method then characterized using Differential scanning calorimetry (DSC), Fourier transform infrared spectroscopy (FT-IR) and X-ray powder diffraction (XPRD). The results revealed obvious disappearance of the characteristic peaks of the prepared RG-PLCs confirming the formation of drug-phospholipid complex. RG-PLC enriched micelles (RG-PLC-Ms) were prepared by the solvent-evaporation technique employing poloxamer 188 as surfactant. The prepared RG-PLC-Ms showed high drug encapsulation efficiencies (93.81-99.38%), with nanometric particle diameters (500.61-665.32nm) of monodisperse distribution and high stability (Zeta potential < -29.8mV). The in vitro release of RG from RG-PLC-Ms was pH-dependant according to the release media. A higher release pattern was reported in pH=1.2 compared to a more retarded release in pH=6.8 owing to two different kinetics of drug release. Oral antidiabetic effect of two optimized RG-PLC-M formulations was evaluated in an alloxan-induced diabetic rat model for 7-day treatment protocol. The two investigated formulations depicted normal blood glucose, serum malondialdehyde and insulin levels as well as an improved lipid profile, at the end of daily oral treatment, in contrast to RG marketed tablets implying enhanced antidiabetic effect of the drug. Hence, phospholipid-complex enriched micelles approach holds a promising potential for promoting the antidiabetic effect of RG. Copyright © 2016 Elsevier B.V. All rights reserved.
mTOR complex 1: a key player in neuroadaptations induced by drugs of abuse.
Neasta, Jeremie; Barak, Segev; Hamida, Sami Ben; Ron, Dorit
2014-07-01
The mammalian (or mechanistic) target of rapamycin (mTOR) complex 1 (mTORC1) is a serine and threonine kinase that regulates cell growth, survival, and proliferation. mTORC1 is a master controller of the translation of a subset of mRNAs. In the central nervous system mTORC1 plays a crucial role in mechanisms underlying learning and memory by controlling synaptic protein synthesis. Here, we review recent evidence suggesting that the mTORC1 signaling pathway promotes neuroadaptations following exposure to a diverse group of drugs of abuse including stimulants, cannabinoids, opiates, and alcohol. We further describe potential molecular mechanisms by which drug-induced mTORC1 activation may alter brain functions. Finally, we propose that mTORC1 is a focal point shared by drugs of abuse to mediate drug-related behaviors such as reward seeking and excessive drug intake, and offer future directions to decipher the contribution of the kinase to mechanisms underlying addiction. Recent studies suggesting that exposure to diverse classes of drugs of abuse as well as exposure to drug-associated memories lead to mTORC1 kinase activation in the limbic system. In turn, mTORC1 controls the onset and the maintenance of pathological neuroadaptions that underlie several features of drug addiction such as drug seeking and relapse. Therefore, we propose that targeting mTORC1 and its effectors is a promising strategy to treat drug disorders. © 2014 International Society for Neurochemistry.
Calotropis procera Latex-Induced Inflammatory Hyperalgesia—Effect of Antiinflammatory Drugs
Directory of Open Access Journals (Sweden)
Raman Sehgal
2005-01-01
Full Text Available The milky white latex of plant Calotropis procera produces inflammation of the skin and mucous membranes on accidental exposure. It produces edema on local administration due to the release of histamine and prostaglandins and is associated with hyperalgesia. In the present study we have evaluated the antiedematous and analgesic activity of antiinflammatory drugs against inflammatory response induced by dried latex (DL of C procera in rat paw edema model. An aqueous extract of DL of C procera was injected into the subplantar surface of the rat paw and the paw volume was measured by a plethysmometer at 0, 1, 2, 6, 12, and 24 hours. Concomitantly the hyperalgesic response was also evaluated by motility test, stair climbing ability test, dorsal flexion pain test, compression test, and observing the grooming behavior. The inhibitory effect of diclofenac and rofecoxib on edema formation and hyperalgesic response was compared with cyproheptadine (CPH. DL-induced edema formation was maximum at 2 hours that was associated with decreased pain threshold, functional impairment, and grooming. Treatment with antiinflammatory drugs and CPH significantly attenuated the edematous response and grooming, increased the pain threshold, and improved functional parameters. Both antiinflammatory and antiserotonergic drugs significantly inhibited the hyperalgesia associated with DL-induced paw edema. Rofecoxib was found to be superior than diclofenac and was as effective as CPH in ameliorating the hyperalgesia. However, it was found to be less effective than CPH in attenuating edema formation.
Clinical Relevance and Predictive Value of Damage Biomarkers of Drug-Induced Kidney Injury.
Kane-Gill, Sandra L; Smithburger, Pamela L; Kashani, Kianoush; Kellum, John A; Frazee, Erin
2017-11-01
Nephrotoxin exposure accounts for up to one-fourth of acute kidney injury episodes in hospitalized patients, and the associated consequences are as severe as acute kidney injury due to other etiologies. As the use of nephrotoxic agents represents one of the few modifiable risk factors for acute kidney injury, clinicians must be able to identify patients at high risk for drug-induced kidney injury rapidly. Recently, significant advancements have been made in the field of biomarker utilization for the prediction and detection of acute kidney injury. Such biomarkers may have a role both for detection of drug-induced kidney disease and implementation of preventative and therapeutic strategies designed to mitigate injury. In this article, basic principles of renal biomarker use in practice are summarized, and the existing evidence for six markers specifically used to detect drug-induced kidney injury are outlined, including liver-type fatty acid binding protein, neutrophil gelatinase-associated lipocalin, tissue inhibitor of metalloproteinase-2 times insulin-like growth factor-binding protein 7 ([TIMP-2]·[IGFBP7]), kidney injury molecule-1 and N-acetyl-β-D-glucosaminidase. The results of the literature search for these six kidney damage biomarkers identified 29 unique articles with none detected for liver-type fatty acid binding protein and [TIMP-2]·[IGFBP7]. For three biomarkers, kidney injury molecule-1, neutrophil gelatinase-associated lipocalin and N-acetyl-β-D-glucosaminidase, the majority of the studies suggest utility in clinical practice. While many questions need to be answered to clearly articulate the use of biomarkers to predict drug-induced kidney disease, current data are promising.
Saldarriaga, Omar A.; Travi, Bruno L.; Choudhury, Goutam Ghosh; Melby, Peter C.
2012-01-01
IFN-γ/LPS-activated hamster (Mesocricetus auratus) macrophages express significantly less iNOS (NOS2) than activated mouse macrophages, which contributes to the hamster's susceptibility to intracellular pathogens. We determined a mechanism responsible for differences in iNOS promoter activity in hamsters and mice. The HtPP (1.2 kb) showed low basal and inducible promoter activity when compared with the mouse, and sequences within a 100-bp region (−233 to −133) of the mouse and hamster promoters influenced this activity. Moreover, within this 100 bp, we identified a smaller region (44 bp) in the mouse promoter, which recovered basal promoter activity when swapped into the hamster promoter. The mouse homolog (100-bp region) contained a cis-element for NF-IL-6 (−153/−142), which was absent in the hamster counterpart. EMSA and supershift assays revealed that the hamster sequence did not support the binding of NF-IL-6. Introduction of a functional NF-IL-6 binding sequence into the hamster promoter or its alteration in the mouse promoter revealed the critical importance of this transcription factor for full iNOS promoter activity. Furthermore, the binding of NF-IL-6 to the iNOS promoter (−153/−142) in vivo was increased in mouse cells but was reduced in hamster cells after IFN-γ/LPS stimulation. Differences in the activity of the iNOS promoters were evident in mouse and hamster cells, so they were not merely a result of species-specific differences in transcription factors. Thus, we have identified unique DNA sequences and a critical transcription factor, NF-IL-6, which contribute to the overall basal and inducible expression of hamster iNOS. PMID:22517919
International Nuclear Information System (INIS)
Liu, Yang; Kam, Wendy R.; Ding, Juan; Sullivan, David A.
2014-01-01
Drug-induced phospholipidosis (PLD) is a common adverse effect which has led to the termination of clinical trials for many candidate pharmaceuticals. However, this lipid-inducing effect may be beneficial in the treatment of meibomian gland dysfunction (MGD). MGD is the major cause of dry eye disease (DED), which affects 40 million people in the USA and has no cure. Azithromycin (AZM) is a PLD-inducing antibiotic that is used off-label to treat MGD, and is presumably effective because it suppresses the MGD-associated conjunctival inflammation (i.e. posterior blepharitis) and growth of lid bacteria. We hypothesize that AZM can act directly to promote the function of human meibomian gland epithelial cells by inducing PLD in these cells, characterized by the accumulation of lipids and lysosomes. Immortalized human meibomian gland epithelial cells (HMGEC) were cultured with or without azithromycin for 5 days. Cells were evaluated for cholesterol (Filipin) and neutral lipid (LipidTox) staining, as well as the appearance of lysosomes (LysoTracker) and lamellar bodies (transmission electron microscopy, TEM). The lipid composition of cellular lysates was analyzed by high performance thin-layer chromatography. Our findings demonstrate that AZM stimulates the accumulation of free cholesterol, neutral lipids and lysosomes in HMGEC. This AZM-induced increase of neutral lipid content occurred predominantly within lysosomes. Many of these vesicles appeared to be lamellar bodies by TEM, which is the characteristic of PLD. Our findings also show that AZM promotes an accumulation of free and esterified cholesterol, as well as phospholipids in HMGECimmortalized. Our results support our hypothesis and confirm the beneficial effect of PLD induced by AZM on HMGEC. Our discovery reveals a new potential use of PLD-inducing drugs, and makes this adverse effect a beneficial effect
Drug-induced parkinsonism: diagnosis and management
Directory of Open Access Journals (Sweden)
Blanchet PJ
2016-09-01
Full Text Available Pierre J Blanchet,1–3 Veronika Kivenko1–3 1Department of Stomatology, Faculty of Dental Medicine, University of Montreal, 2Andre-Barbeau Movement Disorders Unit, University of Montreal Hospital Center (CHU Montreal, 3Montreal Mental Health University Institute, Montreal, QC, Canada Abstract: Drug-induced parkinsonism (DIP has been known for >60 years. It is the second leading cause of parkinsonism, but still underdiagnosis is likely to influence reported incidence figures. Since DIP is clinically undistinguishable from Lewy-body Parkinson’s disease, any new case of parkinsonism should prompt the search for an offending antipsychotic, hidden neuroleptic, or nonneuroleptic agent that may produce DIP. DIP is reversible upon drug withdrawal in most cases. There is no consensus regarding the duration of the recovery period to allow motor signs to fully remit in order to confirm the diagnosis of DIP following removal of the causative agent, but a drug-free interval of at least 6 months is generally recommended. Interestingly, up to 30% of DIP cases may show persisting or worsening motor signs beyond 6 months following drug withdrawal or adjustment, due to complex postsynaptic and presynaptic factors that may variably interact to negatively influence nigrostriatal dopamine transmission in a so-called “double-hit” hypothesis. The condition significantly impacts on quality of life and increases the risks of morbidity and mortality. Management is challenging in psychiatric patients and requires a team approach to achieve the best outcome. Keywords: neuroleptic drugs, extrapyramidal side effects, second generation antipsychotics, calcium channel blockers, valproic acid, tetrabenazine
Seebacher, Nicole A; Lane, Darius J R; Jansson, Patric J; Richardson, Des R
2016-02-19
Pgp is functional on the plasma membrane and lysosomal membrane. Lysosomal-Pgp can pump substrates into the organelle, thereby trapping certain chemotherapeutics (e.g. doxorubicin; DOX). This mechanism serves as a "safe house" to protect cells against cytotoxic drugs. Interestingly, in contrast to DOX, lysosomal sequestration of the novel anti-tumor agent and P-glycoprotein (Pgp) substrate, di-2-pyridylketone-4,4-dimethyl-3-thiosemicarbazone (Dp44mT), induces lysosomal membrane permeabilization. This mechanism of lysosomal-Pgp utilization enhances cytotoxicity to multidrug-resistant cells. Consequently, Dp44mT has greater anti-tumor activity in drug-resistant relative to non-Pgp-expressing tumors. Interestingly, stressors in the tumor microenvironment trigger endocytosis for cell signaling to assist cell survival. Hence, this investigation examined how glucose variation-induced stress regulated early endosome and lysosome formation via endocytosis of the plasma membrane. Furthermore, the impact of glucose variation-induced stress on resistance to DOX was compared with Dp44mT and its structurally related analogue, di-2-pyridylketone 4-cyclohexyl-4-methyl-3-thiosemicarbazone (DpC). These studies showed that glucose variation-induced stress-stimulated formation of early endosomes and lysosomes. In fact, through the process of fluid-phase endocytosis, Pgp was redistributed from the plasma membrane to the lysosomal membrane via early endosome formation. This lysosomal-Pgp actively transported the Pgp substrate, DOX, into the lysosome where it became trapped as a result of protonation at pH 5. Due to increased lysosomal DOX trapping, Pgp-expressing cells became more resistant to DOX. In contrast, cytotoxicity of Dp44mT and DpC was potentiated due to more lysosomes containing functional Pgp under glucose-induced stress. These thiosemicarbazones increased lysosomal membrane permeabilization and cell death. This mechanism has critical implications for drug-targeting in
Direct-to-Consumer Promotion of Prescription Drugs on Mobile Devices: Content Analysis.
Aikin, Kathryn J; Sullivan, Helen W; Dolina, Suzanne; Lynch, Molly; Squiers, Linda B
2017-07-04
US Food and Drug Administration (FDA) regulations state that any prescription drug promotion that presents drug benefits to consumers must also disclose certain information about the drug's risks in a similar manner. Nearly three-quarters of all US mobile phone subscribers use a smartphone, and over half report receiving mobile advertisements on their device. The objective of this project was to investigate how prescription drugs are being promoted to consumers using mobile technologies. We were particularly interested in the presentation of drug benefits and risks, with regard to presence, placement, and prominence. We analyzed a sample of 51 mobile promotional communications and their associated linked landing pages. We assessed the content and format of the mobile communications and landing pages with regard to presentation of drug benefits and risks. Of the 51 mobile communications we coded, 41% (21/51) were product claim communications (includes the drug name, benefits, and risks), 22% (11/51) were reminder communications (includes drug name only), and 37% (19/51) were help-seeking communications (includes information about the medical condition but not the drug name). Some of the product claim communications (5/21, 24%) required scrolling to see all the benefit information; in contrast, 95% (20/21) required scrolling to see all the risk information. Of the 19 product claim communications that presented both benefits and risks, 95% (18/19) presented benefits before risks and 47% (9/19) used a bigger font for benefits than for risks. Most mobile communications (35/51, 69%) linked to branded drug websites with both benefits and risks, 25% (13/51) linked to a landing page with benefits but no visible risks, and 6% (3/51) linked to a landing page with risks but no visible benefits. Few landing pages (4/51, 8%) required scrolling to see all the benefit information; in contrast, 51% (26/51) required scrolling to see all the risk information. Of the 35 landing pages
Directory of Open Access Journals (Sweden)
R Ramachandran
2015-01-01
Full Text Available Steroids are used in the management of drug-induced acute interstitial nephritis (AIN. The present study was undertaken to compare the efficacy of pulse methyl prednisolone with oral prednisolone in the treatment of drug-induced AIN. Patients with biopsy-proven AIN with a history of drug intake were randomized to oral prednisolone (Group 1 1 mg/kg for 3 weeks or a pulse methyl prednisolone (Group II 30 mg/kg for 3 days followed by oral prednisolone 1 mg/kg for 2 weeks, tapered over 3 weeks. Kidney biopsy scoring was done for interstitial edema, infiltration and tubular damage. The response was reported as complete remission (CR (improvement in estimated glomerular filtration rate [eGFR] to ≥60 ml/min/1.73 m 2 , partial remission (PR (improvement but eGFR <60 ml/min/1.73 m 2 or resistance (no CR/PR. A total of 29 patients, Group I: 16 and Group II: 13 were studied. Offending drugs included nonsteroidal anti-inflammatory drugs, herbal drugs, antibiotics, diuretic, rifampicin and omeprazole. There was no difference in the baseline parameters between the two groups. The biopsy score in Groups I and II was 5.9 1.1 and 5.1 1.2, respectively. At 3 months in Group I, eight patients each (50% achieved CR and PR. In Group II, 8 (61% achieved CR and 5 (39% PR. This was not significantly different. Percentage fall in serum creatinine at 1 week (56% was higher in CR as compared to (42% those with PR. ( P = 0.14. Patients with neutrophil infiltration had higher CR compared to patients with no neutrophil infiltration ( P = 0.01. Early steroid therapy, both oral and pulse steroid, is equally effective in achieving remission in drug-induced AIN.
Qin, Yu-Xiang; Qin, Fangyuan
2016-02-01
Dehydrins confer abiotic stress tolerance in seedlings, but few dehydrins have been studied by transgenic analysis under their own promoters in relation to abiotic stress tolerance. Also the inducible promoters for transgenic engineering are limited. In this study, we isolated from wheat three salt-induced YSK2 dehydrin genes and their promoters. The cDNA sequences were 711, 785, and 932 bp in length, encoding proteins containing 133, 166 and 231 amino acids, respectively, and were named TaDHN1, TaDHN2, and TaDHN3. TaDHN2 doesn't contain introns, while the other two genes each contain one. Semi-quantitative reverse transcription PCR analysis revealed all three dehydrin genes are substantially induced by ABA and NaCl, but only TaDHN2 is induced in seedlings by PEG and by cold (4 °C). Regulatory sequences upstream of the first translation codon (775, 1615 and 889 bp) of the three dehydrin genes were also cloned. Cis-element prediction indicated the presence of ABRE and other abiotic-stress-related elements. Histochemical analysis using GUS expression demonstrated that all three promoters were induced by ABA, cold or NaCl. Ectopic over-expression of TaDHN1 or TaDHN3 in Arabidopsis under their own inducible promoters enhanced NaCl- and drought-stress tolerance without growth retardation. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
A Critical Analysis of Claims and Their Authenticity in Indian Drug Promotional Advertisements
Directory of Open Access Journals (Sweden)
Gurpreet Kaur Randhawa
2015-01-01
Full Text Available Introduction. Drug promotional advertisements (DPAs form a major marketing technique of pharmaceutical companies for promoting their products and disseminating ambiguous drug information which can affect prescribing pattern of physicians. Drug information includes product characteristics, various marketing claims with references in support to increase its credibility and authenticity. Material and Methods. An observational study was carried out on fifty printed drug advertisement brochures which were collected from different OPDs of Guru Nanak Dev Hospital attached to Government Medical College, Amritsar, India. These advertisements were analyzed and claims were categorized into true, false, exaggerated, vague, and controversial on criteria as reported by Rohraa et al. (2006. References of DPAs in support of the claims were critically analyzed for their retrievability from web and validity pertaining to claims. Results. Out of 209 claims from 50 advertisements, only 46% were found to be true, 21% false, 16% vague, 7% exaggerated, and 10% controversial in nature. Out of 160 references given in support of claims, 49 (30% of references were irretrievable. Out of 111 (70% retrievable references, 92 (83% references were found valid. Conclusion. Drug information provided in the DPAs was biased, incomplete, unauthentic, and unreliable with references exhibiting questionable credibility.
Sexual side effects induced by psychotropic drugs
DEFF Research Database (Denmark)
Kristensen, Ellids
2002-01-01
The majority of psychotropic drugs entail sexual side effects. The sexual side effects may reduce quality of life and may give rise to non-compliance. For example, 30-60 per cent of patients treated with antidepressants are known to develop a sexual dysfunction. However, some psychotropic drugs...... with no or very few sexual side effects have begun to emerge. The treatment of sexual side effects induced by psychotropic drugs may consist of: modified sexual habits, reduction in dosage, switching to another medication, possibly in combination with different psychotropic agents, other varieties...
Directory of Open Access Journals (Sweden)
Hyosun Kim
2015-12-01
Full Text Available Background For the purpose of understanding the Food and Drug Administration’s (FDA’s concerns regarding online promotion of prescription drugs advertised directly to consumers, this study examines notices of violations (NOVs and warning letters issued by the FDA to pharmaceutical manufacturers. Methods The FDA’s warning letters and NOVs, which were issued to pharmaceutical companies over a 10-year period (2005 to 2014 regarding online promotional activities, were content-analyzed. Results Six violation categories were identified: risk information, efficacy information, indication information, product labeling, material information issues, and approval issues. The results reveal that approximately 95% of the alleged violations were found on branded drug websites, in online paid advertisements, and in online videos. Of the total 179 violations, the majority of the alleged violations were concerned with the lack of risk information and/or misrepresentation of efficacy information, suggesting that achieving a fair balance of benefit versus risk information is a major problem with regard to the direct-to-consumer advertising (DTCA of prescription drugs. In addition, the character space limitations of online platforms, eg, sponsored links on search engines, pose challenges for pharmaceutical marketers with regard to adequately communicating important drug information, such as indication information, risk information, and product labeling. Conclusion Presenting drug information in a fair and balanced manner remains a major problem. Industry guidance should consider addressing visibility and accessibility of information in the web environment to help pharmaceutical marketers meet the requirements for direct-to-consumer promotion and to protect consumers from misleading drug information. Promotion via social media warrants further attention, as pharmaceutical manufacturers have already begun actively establishing a social media presence, and the
Kim, Hyosun
2015-08-25
For the purpose of understanding the Food and Drug Administration's (FDA's) concerns regarding online promotion of prescription drugs advertised directly to consumers, this study examines notices of violations (NOVs) and warning letters issued by the FDA to pharmaceutical manufacturers. The FDA's warning letters and NOVs, which were issued to pharmaceutical companies over a 10-year period (2005 to 2014) regarding online promotional activities, were content-analyzed. Six violation categories were identified: risk information, efficacy information, indication information, product labeling, material information issues, and approval issues. The results reveal that approximately 95% of the alleged violations were found on branded drug websites, in online paid advertisements, and in online videos. Of the total 179 violations, the majority of the alleged violations were concerned with the lack of risk information and/or misrepresentation of efficacy information, suggesting that achieving a fair balance of benefit versus risk information is a major problem with regard to the direct-to-consumer advertising (DTCA) of prescription drugs. In addition, the character space limitations of online platforms, eg, sponsored links on search engines, pose challenges for pharmaceutical marketers with regard to adequately communicating important drug information, such as indication information, risk information, and product labeling. Presenting drug information in a fair and balanced manner remains a major problem. Industry guidance should consider addressing visibility and accessibility of information in the web environment to help pharmaceutical marketers meet the requirements for direct-to-consumer promotion and to protect consumers from misleading drug information. Promotion via social media warrants further attention, as pharmaceutical manufacturers have already begun actively establishing a social media presence, and the FDA has thus begun to keep tabs on social media promotions of
Directory of Open Access Journals (Sweden)
Alexander Michael Bedford Johns
2016-10-01
Full Text Available Rhodotorula (Rhodosporidium toruloides is an oleaginous yeast with great biotechnological potential, capable of accumulating lipid up to 70 % of its dry biomass, and of carotenoid biosynthesis. However, few molecular genetic tools are available for manipulation of this basidiomycete yeast and its high genomic GC content can make routine cloning difficult. We have developed plasmid vectors for transformation of R. toruloides which include elements for Saccharomyces cerevisiae in-yeast assembly; this method is robust to the assembly of GC-rich DNA and of large plasmids. Using such vectors we screened for controllable promoters, and identified inducible promoters from the genes NAR1, ICL1, CTR3 and MET16. These four promoters have independent induction/repression conditions and exhibit different levels and rates of induction in R. toruloides, making them appropriate for controllable transgene expression in different experimental situations. Nested deletions were used to identify regulatory regions in the four promoters, and to delimit the minimal inducible promoters, which are as small as 200 bp for the NAR1 promoter. The NAR1 promoter shows very tight regulation under repressed conditions as determined both by an EGFP reporter gene and by conditional rescue of a leu2 mutant. These new tools facilitate molecular genetic manipulation and controllable gene expression in R. toruloides.
Tang, Siwei; Bai, Chen; Yang, Pengyuan; Chen, Xian
2013-06-07
Major vault protein (MVP) is the predominant constituent of the vault particle, the largest known ribonuclear protein complex. Although emerging evidence have been establishing the links between MVP (vault) and multidrug resistance (MDR), little is known regarding exactly how the MDR activity of MVP is modulated during cellular response to drug-induced DNA damage (DDR). Bleomycin (BLM), an anticancer drug, induces DNA double-stranded breaks (DSBs) and consequently triggers the cellular DDR. Due to its physiological implications in hepatocellular carcinoma (HCC) and cell fate decision, 14-3-3ε was chosen as the pathway-specific bait protein to identify the critical target(s) responsible for HCC MDR. By using an LC-MS/MS-based proteomic approach, MVP was first identified in the BLM-induced 14-3-3ε interactome formed in HCC cells. Biological characterization revealed that MVP possesses specific activity to promote the resistance to the BLM-induced DDR. On the other hand, 14-3-3ε enhances BLM-induced DDR by interacting with MVP. Mechanistic investigation further revealed that 14-3-3ε, in a phosphorylation-dependent manner, binds to the phosphorylated sites at both Thr52 and Ser864 of the monomer of MVP. Consequently, the phosphorylation-dependent binding between 14-3-3ε and MVP inhibits the drug-resistant activity of MVP for an enhanced DDR to BLM treatment. Our findings provide an insight into the mechanism underlying how the BLM-induced interaction between 14-3-3ε and MVP modulates MDR, implicating novel strategy to overcome the chemotherapeutic resistance through interfering specific protein-protein interactions.
Energy Technology Data Exchange (ETDEWEB)
Yao, Jingyun; Wei, Xing [State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, 130 Meilong Road, Shanghai (China); Shanghai Collaborative Innovation Center for Biomanufacturing Technology, 130 Meilong Road, Shanghai (China); Lu, Yanhua, E-mail: luyanhua@ecust.edu.cn [State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, 130 Meilong Road, Shanghai (China); Shanghai Collaborative Innovation Center for Biomanufacturing Technology, 130 Meilong Road, Shanghai (China)
2016-05-13
Drug resistance limits leukemia treatment and chaetominine, a cytotoxic alkaloid that promotes apoptosis in a K562 human leukemia cell line via the mitochondrial pathway was studied with respect to chemoresistance in a K562/Adr human resistant leukemia cell line. Cytotoxicity assays indicated that K562/Adr resistance to adriamycin (ADR) did not occur in the presence of chaetominine and that chaetominine increased chemosensitivity of K562/Adr to ADR. Data show that chaetominine enhanced ADR-induced apoptosis and intracellular ADR accumulation in K562/Adr cells. Accordingly, chaetominine induced apoptosis by upregulating ROS, pro-apoptotic Bax and downregulating anti-apoptotic Bcl-2. RT-PCR and western-blot confirmed that chaetominine suppressed highly expressed MRP1 at mRNA and protein levels. But little obvious alternation of another drug transporter MDR1 mRNA was observed. Furthermore, inhibition of MRP1 by chaetominine relied on inhibiting Akt phosphorylation and nuclear Nrf2. In summary, chaetominine strongly reverses drug resistance by interfering with the PI3K/Akt/Nrf2 signaling, resulting in reduction of MRP1-mediated drug efflux and induction of Bax/Bcl-2-dependent apoptosis in an ADR-resistant K562/Adr leukemia cell line. - Highlights: • Chaetominine enhanced chemosensitivity of ADR against K562/Adr cells. • Chaetominine increased intracellular ADR levels via inhibiting MRP1. • Chaetominine induced apoptosis of K562/Adr cells through upregulation of ROS and modulation of Bax/Bcl-2. • Inhibition of MRP1 and Nrf2 by chaetominine treatment was correlative with blockade of PI3K/Akt signaling.
Stable and biocompatible genipin-inducing interlayer-crosslinked micelles for sustained drug release
Energy Technology Data Exchange (ETDEWEB)
Dai, Yu; Zhang, Xiaojin, E-mail: zhangxj@cug.edu.cn [China University of Geosciences, Faculty of Materials Science and Chemistry (China)
2017-05-15
To develop the sustained drug release system, here we describe genipin-inducing interlayer-crosslinked micelles crosslinked via Schiff bases between the amines of amphiphilic linear-hyperbranched polymer poly(ethylene glycol)-branched polyethylenimine-poly(ε-caprolactone) (PEG-PEI-PCL) and genipin. The generation of Schiff bases was confirmed by the color changes and UV-Vis absorption spectra of polymeric micelles after adding genipin. The particle size, morphology, stability, in vitro cytotoxicity, drug loading capacity, and in vitro drug release behavior of crosslinked micelles as well as non-crosslinked micelles were characterized. The results indicated that genipin-inducing interlayer-crosslinked micelles had better stability and biocompatibility than non-crosslinked micelles and glutaraldehyde-inducing interlayer-crosslinked micelles. In addition, genipin-inducing interlayer-crosslinked micelles were able to improve drug loading capacity, reduce the initial burst release, and achieve sustained drug release.
RLIM interacts with Smurf2 and promotes TGF-β induced U2OS cell migration
International Nuclear Information System (INIS)
Huang, Yongsheng; Yang, Yang; Gao, Rui; Yang, Xianmei; Yan, Xiaohua; Wang, Chenji; Jiang, Sirui; Yu, Long
2011-01-01
Highlights: → RLIM directly binds to Smurf2. → RLIM enhances TGF-β responsiveness in U2OS cells. → RLIM promotes TGF-β driven migration of osteosarcoma U2OS cells. -- Abstract: TGF-β (transforming growth factor-β), a pleiotropic cytokine that regulates diverse cellular processes, has been suggested to play critical roles in cell proliferation, migration, and carcinogenesis. Here we found a novel E3 ubiquitin ligase RLIM which can directly bind to Smurf2, enhancing TGF-β responsiveness in osteosarcoma U2OS cells. We constructed a U2OS cell line stably over-expressing RLIM and demonstrated that RLIM promoted TGF-β-driven migration of U2OS cells as tested by wound healing assay. Our results indicated that RLIM is an important positive regulator in TGF-β signaling pathway and cell migration.
[Drug-induced fever: a diagnosis to remember].
Vodovar, D; Le Beller, C; Lillo-Le-Louet, A; Hanslik, T; Megarbane, B
2014-03-01
Drug fever (DF) is a febrile reaction induced by a drug without additional clinical features like skin eruption. This adverse drug reaction is probably common but under diagnosed. While its outcome is generally favourable, DF generates unnecessary diagnostic procedures as well as hospitalisations or hospitalisation prolongations. Clinical presentation and biological findings are not specific. Fever is generally well tolerated but may be accompanied by general symptoms mimicking sepsis. Moderate biological disorders could be expected, including elevation or decrease in white blood cell count, eosinophilia, liver cytolysis, and increased C-reactive protein. An infection should be systematically ruled out. Clinical or biological signs of severity should question DF diagnosis. When DF is suspected, the involved drug(s) should be stopped after a reliable assessment of imputability. Antibiotics represent the most often implicated drugs. Fever disappearance after discontinuing the suspected drug is the cornerstone of DF diagnosis. Before stopping the administration of the suspected drug(s), a risk/benefit ratio assessment is necessary. Consistently, it may be complicated to stop an antimicrobial drug when treating an infection or an immunosuppressive drug if required. Copyright © 2013. Published by Elsevier SAS.
Hepatocyte-based in vitro model for assessment of drug-induced cholestasis
Energy Technology Data Exchange (ETDEWEB)
Chatterjee, Sagnik, E-mail: Sagnik.Chatterjee@pharm.kuleuven.be [Drug Delivery and Disposition, KU Leuven Department of Pharmaceutical and Pharmacological Sciences, O and N2, Herestraat 49 — bus 921, 3000 Leuven (Belgium); Richert, Lysiane, E-mail: l.richert@kaly-cell.com [KaLy-Cell, 20A rue du Général Leclerc, 67115 Plobsheim (France); Augustijns, Patrick, E-mail: Patrick.Augustijns@pharm.kuleuven.be [Drug Delivery and Disposition, KU Leuven Department of Pharmaceutical and Pharmacological Sciences, O and N2, Herestraat 49 — bus 921, 3000 Leuven (Belgium); Annaert, Pieter, E-mail: Pieter.Annaert@pharm.kuleuven.be [Drug Delivery and Disposition, KU Leuven Department of Pharmaceutical and Pharmacological Sciences, O and N2, Herestraat 49 — bus 921, 3000 Leuven (Belgium)
2014-01-01
Early detection of drug-induced cholestasis remains a challenge during drug development. We have developed and validated a biorelevant sandwich-cultured hepatocytes- (SCH) based model that can identify compounds causing cholestasis by altering bile acid disposition. Human and rat SCH were exposed (24–48 h) to known cholestatic and/or hepatotoxic compounds, in the presence or in the absence of a concentrated mixture of bile acids (BAs). Urea assay was used to assess (compromised) hepatocyte functionality at the end of the incubations. The cholestatic potential of the compounds was expressed by calculating a drug-induced cholestasis index (DICI), reflecting the relative residual urea formation by hepatocytes co-incubated with BAs and test compound as compared to hepatocytes treated with test compound alone. Compounds with clinical reports of cholestasis, including cyclosporin A, troglitazone, chlorpromazine, bosentan, ticlopidine, ritonavir, and midecamycin showed enhanced toxicity in the presence of BAs (DICI ≤ 0.8) for at least one of the tested concentrations. In contrast, the in vitro toxicity of compounds causing hepatotoxicity by other mechanisms (including diclofenac, valproic acid, amiodarone and acetaminophen), remained unchanged in the presence of BAs. A safety margin (SM) for drug-induced cholestasis was calculated as the ratio of lowest in vitro concentration for which was DICI ≤ 0.8, to the reported mean peak therapeutic plasma concentration. SM values obtained in human SCH correlated well with reported % incidence of clinical drug-induced cholestasis, while no correlation was observed in rat SCH. This in vitro model enables early identification of drug candidates causing cholestasis by disturbed BA handling. - Highlights: • Novel in vitro assay to detect drug-induced cholestasis • Rat and human sandwich-cultured hepatocytes (SCH) as in vitro models • Cholestatic compounds sensitize SCH to toxic effects of accumulating bile acids • Drug-induced
Hepatocyte-based in vitro model for assessment of drug-induced cholestasis
International Nuclear Information System (INIS)
Chatterjee, Sagnik; Richert, Lysiane; Augustijns, Patrick; Annaert, Pieter
2014-01-01
Early detection of drug-induced cholestasis remains a challenge during drug development. We have developed and validated a biorelevant sandwich-cultured hepatocytes- (SCH) based model that can identify compounds causing cholestasis by altering bile acid disposition. Human and rat SCH were exposed (24–48 h) to known cholestatic and/or hepatotoxic compounds, in the presence or in the absence of a concentrated mixture of bile acids (BAs). Urea assay was used to assess (compromised) hepatocyte functionality at the end of the incubations. The cholestatic potential of the compounds was expressed by calculating a drug-induced cholestasis index (DICI), reflecting the relative residual urea formation by hepatocytes co-incubated with BAs and test compound as compared to hepatocytes treated with test compound alone. Compounds with clinical reports of cholestasis, including cyclosporin A, troglitazone, chlorpromazine, bosentan, ticlopidine, ritonavir, and midecamycin showed enhanced toxicity in the presence of BAs (DICI ≤ 0.8) for at least one of the tested concentrations. In contrast, the in vitro toxicity of compounds causing hepatotoxicity by other mechanisms (including diclofenac, valproic acid, amiodarone and acetaminophen), remained unchanged in the presence of BAs. A safety margin (SM) for drug-induced cholestasis was calculated as the ratio of lowest in vitro concentration for which was DICI ≤ 0.8, to the reported mean peak therapeutic plasma concentration. SM values obtained in human SCH correlated well with reported % incidence of clinical drug-induced cholestasis, while no correlation was observed in rat SCH. This in vitro model enables early identification of drug candidates causing cholestasis by disturbed BA handling. - Highlights: • Novel in vitro assay to detect drug-induced cholestasis • Rat and human sandwich-cultured hepatocytes (SCH) as in vitro models • Cholestatic compounds sensitize SCH to toxic effects of accumulating bile acids • Drug-induced
Drug-induced pulmonary arterial hypertension: a recent outbreak
Directory of Open Access Journals (Sweden)
Gérald Simonneau
2013-09-01
Full Text Available Pulmonary arterial hypertension (PAH is a rare disorder characterised by progressive obliteration of the pulmonary microvasculature resulting in elevated pulmonary vascular resistance and premature death. According to the current classification PAH can be associated with exposure to certain drugs or toxins, particularly to appetite suppressant intake drugs, such as aminorex, fenfluramine derivatives and benfluorex. These drugs have been confirmed to be risk factors for PAH and were withdrawn from the market. The supposed mechanism is an increase in serotonin levels, which was demonstrated to act as a growth factor for the pulmonary artery smooth muscle cells. Amphetamines, phentermine and mazindol were less frequently used, but are considered possible risk factors, for PAH. Dasatinib, dual Src/Abl kinase inhibitor, used in the treatment of chronic myelogenous leukaemia was associated with cases of severe PAH, potentially in part reversible after dasatinib withdrawal. Recently, several studies have raised the issue of potential endothelial dysfunction that could be induced by interferon, and a few cases of PAH have been reported with interferon therapy. PAH remains a rare complication of these drugs, suggesting possible individual susceptibility, and further studies are needed to identify patients at risk of drug-induced PAH.
Drug–drug interaction of microdose and regular-dose omeprazole with a CYP2C19 inhibitor and inducer
Directory of Open Access Journals (Sweden)
Park G
2017-03-01
Full Text Available Gab-jin Park,1 Soo Hyeon Bae,1 Wan-Su Park,1 Seunghoon Han,1 Min-Ho Park,2 Seok-Ho Shin,2 Young G Shin,2 Dong-Seok Yim1,2 1Department of Clinical Pharmacology and Therapeutics, Seoul St Mary’s Hospital, PIPET (Pharmacometrics Institute for Practical Education and Training, College of Medicine, Catholic University of Korea, Seoul, South Korea; 2College of Pharmacy, Chungnam National University, Daejeon, South Korea Purpose: A microdose drug–drug interaction (DDI study may be a valuable tool for anticipating drug interaction at therapeutic doses. This study aimed to compare the magnitude of DDIs at microdoses and regular doses to explore the applicability of a microdose DDI study. Patients and methods: Six healthy male volunteer subjects were enrolled into each DDI study of omeprazole (victim and known perpetrators: fluconazole (inhibitor and rifampin (inducer. For both studies, the microdose (100 µg, cold compound and the regular dose (20 mg of omeprazole were given at days 0 and 1, respectively. On days 2–9, the inhibitor or inducer was given daily, and the microdose and regular dose of omeprazole were repeated at days 8 and 9, respectively. Full omeprazole pharmacokinetic samplings were performed at days 0, 1, 8, and 9 of both studies for noncompartmental analysis. Results: The magnitude of the DDI, the geometric mean ratios (with perpetrator/omeprazole only of maximum concentration (Cmax and area under the curve to the last measurement (AUCt of the microdose and the regular dose were compared. The geometric mean ratios in the inhibition study were: 2.17 (micro and 2.68 (regular for Cmax, and 4.07 (micro, 4.33 (regular for AUCt. For the induction study, they were 0.26 (micro and 0.21 (regular for Cmax, and 0.16 (micro and 0.15 (regular for AUCt. There were no significant statistical differences in the magnitudes of DDIs between microdose and regular-dose conditions, regardless of induction or inhibition. Conclusion: Our results may be
Frank, Matthew G; Watkins, Linda R; Maier, Steven F
2011-06-01
Stress and stress-induced glucocorticoids (GCs) sensitize drug abuse behavior as well as the neuroinflammatory response to a subsequent pro-inflammatory challenge. Stress also predisposes or sensitizes individuals to develop substance abuse. There is an emerging evidence that glia and glia-derived neuroinflammatory mediators play key roles in the development of drug abuse. Drugs of abuse such as opioids, psychostimulants, and alcohol induce neuroinflammatory mediators such as pro-inflammatory cytokines (e.g. interleukin (IL)-1β), which modulate drug reward, dependence, and tolerance as well as analgesic properties. Drugs of abuse may directly activate microglial and astroglial cells via ligation of Toll-like receptors (TLRs), which mediate the innate immune response to pathogens as well as xenobiotic agents (e.g. drugs of abuse). The present review focuses on understanding the immunologic mechanism(s) whereby stress primes or sensitizes the neuroinflammatory response to drugs of abuse and explores whether stress- and GC-induced sensitization of neuroimmune processes predisposes individuals to drug abuse liability and the role of neuroinflammatory mediators in the development of drug addiction. Copyright © 2011 Elsevier Inc. All rights reserved.
Yeo, Hyun-Seok; Shehzad, Adeeb; Lee, Young Sup
2012-04-01
Altered oxidative stress has long been observed in cancer cells, and this biochemical property of cancer cells represents a specific vulnerability that can be exploited for therapeutic benefit. The major role of an elevated oxidative stress for the efficacy of molecular targeted drugs is under investigation. Menadione is considered an attractive model for the study of oxidative stress, which can induce apoptosis in human leukemia HL-60 cell lines. Prostaglandin E(2) (PGE(2)) via its receptors not only promotes cell survival but also reverses apoptosis and promotes cancer progression. Here, we present evidence for the biological role of PGE(2) as a protective agent of oxidative stress-induced apoptosis in monocytic cells. Pretreatment of HL-60 cells with PGE(2) markedly ameliorated the menadione-induced apoptosis and inhibited the degradation of PARP and lamin B. The EP(2) receptor antagonist AH6809 abrogated the inhibitory effect of PGE(2), suggesting the role of the EP(2)/cAMP system. The PKA inhibitor H89 also reversed apoptosis and decreased the PKA activity that was elevated 10-fold by PGE(2). The treatment of HL-60 cells with NAC or zinc chloride showed a similar protective effect as with PGE(2) on menadione-treated cells. Furthermore, PGE(2) activated the Ras/Raf/MEK pathway, which in turn initiated ERK activation, and ultimately protected menadione-induced apoptosis. These results imply that PGE(2) via cell survival pathways may protect oxidative stress-induced apoptosis in monocytic cells. This study warrants further pre-clinical investigation as well as application towards leukemia clinics.
International Nuclear Information System (INIS)
Yan, Jidong; Xu, Jing; Fei, Yao; Jiang, Congshan; Zhu, Wenhua; Han, Yan; Lu, Shemin
2016-01-01
Thioredoxin reductase 2 (TrxR2) is a selenium (Se) containing protein. Se deficiency is associated with an endemic osteoarthropathy characterized by impaired cartilage formation. It is unclear whether TrxR2 have roles in cartilage function. We examined the effects of TrxR2 on chondrogenic ATDC5 cells through shRNA-mediated gene silencing of TrxR2. We demonstrated TrxR2 deficiencies could enhance chondrogenic differentiation and apoptosis of ATDC5 cells. TrxR2 deficiencies increased accumulation of cartilage glycosaminoglycans (GAGs) and mineralization. TrxR2 deficiencies also stimulated expression of extracellular (ECM) gene including Collagen II and Aggrecan. The enhanced chondrogenic properties were further confirmed by activation of Akt signaling which are required for chondrogenesis. In addition, TrxR2 deficiencies promoted chondrocyte proliferation through acceleration of cell cycle progression by increase in both S and G2/M phase cell distribution accompanied with induction of parathyroid hormone-related protein (PTHrP). Moreover, TrxR2 deficiencies induced chondrocyte death via apoptosis and increased cell sensitivity to exogenous oxidative stress. Furthermore, TrxR2 deficiencies induced emission of mitochondrial reactive oxygen species (ROS) without alteration of mitochondrial membrane potential and intracellular ATP content. Finally, treatment of TrxR2 deficiency cells with N-acetylcysteine (NAC) inhibited mitochondrial ROS production and chondrocyte apoptosis. NAC also prevented chondrogenic differentiation of TrxR2 deficiency cells by suppression of ECM gene expression, GAGs accumulation and mineralization, as well as attenuation of Akt signaling. Thus, TrxR2-mediated mitochondrial integrity is indispensable for chondrogenic differentiation of ATDC5 cells. TrxR2 deficiency-induced impaired proliferation and death of chondrocytes may be the pathological mechanism of the osteoarthropathy due to Se deficiency. Notably, this study also uncover the roles of
Energy Technology Data Exchange (ETDEWEB)
Yan, Jidong [Department of Human Anatomy, Histology and Embryology, School of Basic Medical Sciences, Xi’an Jiaotong University Health Science Center, Xi’an, Shaanxi 710061 (China); Xu, Jing [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Xi’an Jiaotong University Health Science Center, Xi’an, Shaanxi 710061 (China); Fei, Yao [College of Life Sciences, Northwest University, Xi’an, Shaanxi Province 710069 (China); Jiang, Congshan; Zhu, Wenhua; Han, Yan [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Xi’an Jiaotong University Health Science Center, Xi’an, Shaanxi 710061 (China); Lu, Shemin, E-mail: lushemin@xjtu.edu.cn [Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Xi’an Jiaotong University Health Science Center, Xi’an, Shaanxi 710061 (China); Key Laboratory of Environment and Genes Related to Diseases, Xi’an Jiaotong University, Ministry of Education of China (China)
2016-05-15
Thioredoxin reductase 2 (TrxR2) is a selenium (Se) containing protein. Se deficiency is associated with an endemic osteoarthropathy characterized by impaired cartilage formation. It is unclear whether TrxR2 have roles in cartilage function. We examined the effects of TrxR2 on chondrogenic ATDC5 cells through shRNA-mediated gene silencing of TrxR2. We demonstrated TrxR2 deficiencies could enhance chondrogenic differentiation and apoptosis of ATDC5 cells. TrxR2 deficiencies increased accumulation of cartilage glycosaminoglycans (GAGs) and mineralization. TrxR2 deficiencies also stimulated expression of extracellular (ECM) gene including Collagen II and Aggrecan. The enhanced chondrogenic properties were further confirmed by activation of Akt signaling which are required for chondrogenesis. In addition, TrxR2 deficiencies promoted chondrocyte proliferation through acceleration of cell cycle progression by increase in both S and G2/M phase cell distribution accompanied with induction of parathyroid hormone-related protein (PTHrP). Moreover, TrxR2 deficiencies induced chondrocyte death via apoptosis and increased cell sensitivity to exogenous oxidative stress. Furthermore, TrxR2 deficiencies induced emission of mitochondrial reactive oxygen species (ROS) without alteration of mitochondrial membrane potential and intracellular ATP content. Finally, treatment of TrxR2 deficiency cells with N-acetylcysteine (NAC) inhibited mitochondrial ROS production and chondrocyte apoptosis. NAC also prevented chondrogenic differentiation of TrxR2 deficiency cells by suppression of ECM gene expression, GAGs accumulation and mineralization, as well as attenuation of Akt signaling. Thus, TrxR2-mediated mitochondrial integrity is indispensable for chondrogenic differentiation of ATDC5 cells. TrxR2 deficiency-induced impaired proliferation and death of chondrocytes may be the pathological mechanism of the osteoarthropathy due to Se deficiency. Notably, this study also uncover the roles of
International Nuclear Information System (INIS)
Kim, Tae Rim; Lee, Hee Min; Lee, So Yong; Kim, Eun Jin; Kim, Kug Chan; Paik, Sang Gi; Cho, Eun Wie; Kim, In Gyu
2010-01-01
Research highlights: → SM22α overexpression in HepG2 cells leads cells to a growth arrest state, and the treatment of a subclinical dose of γ-radiation or doxorubicin promotes cellular senescence. → SM22α overexpression elevates p16 INK4a followed by pRB activation, but there are no effects on p53/p21 WAF1/Cip1 pathway. → SM22α-induced MT-1G activates p16 INK4a /pRB pathway, which promotes cellular senescence by damaging agents. -- Abstract: Smooth muscle protein 22-alpha (SM22α) is known as a transformation- and shape change-sensitive actin cross-linking protein found in smooth muscle tissue and fibroblasts; however, its functional role remains uncertain. We reported previously that SM22α overexpression confers resistance against anti-cancer drugs or radiation via induction of metallothionein (MT) isozymes in HepG2 cells. In this study, we demonstrate that SM22α overexpression leads cells to a growth arrest state and promotes cellular senescence caused by treatment with a subclinical dose of γ-radiation (0.05 and 0.1 Gy) or doxorubicin (0.01 and 0.05 μg/ml), compared to control cells. Senescence growth arrest is known to be controlled by p53 phosphorylation/p21 WAF1/Cip1 induction or p16 INK4a /retinoblastoma protein (pRB) activation. SM22α overexpression in HepG2 cells elevated p16 INK4a followed by pRB activation, but did not activate the p53/p21 WAF1/Cip1 pathway. Moreover, MT-1G, which is induced by SM22α overexpression, was involved in the activation of the p16 INK4a /pRB pathway, which led to a growth arrest state and promoted cellular senescence caused by damaging agents. Our findings provide the first demonstration that SM22α modulates cellular senescence caused by damaging agents via regulation of the p16 INK4a /pRB pathway in HepG2 cells and that these effects of SM22α are partially mediated by MT-1G.
Advertising and prescription drugs: promotion, education, and the public's health.
Avorn, Jerry
2003-01-01
The data presented by Joel Weissman and colleagues and by Robert Dubois do not justify the conclusions that the effects of pharmaceutical promotion are beneficial. Among consumers of direct-to-consumer advertising (Weissman and colleagues), those heavily influenced by such promotion were no more likely than others were to have new conditions diagnosed or confirmed and were much less likely to have laboratory studies ordered or lifestyle changes recommended. A second study (Dubois) arguing that drug advertising improves the appropriateness of prescribing relies on unconvincing ecological arguments. A greater presence of noncommercial, public health-oriented communication would make a more useful and cost-effective impact on the nation's health.
Wang, Yan; Cordewener, Jan H G; America, Antoine H P; Shan, Weixing; Bouwmeester, Klaas; Govers, Francine
2015-09-01
L-type lectin receptor kinases (LecRK) are potential immune receptors. Here, we characterized two closely-related Arabidopsis LecRK, LecRK-IX.1 and LecRK-IX.2, of which T-DNA insertion mutants showed compromised resistance to Phytophthora brassicae and Phytophthora capsici, with double mutants showing additive susceptibility. Overexpression of LecRK-IX.1 or LecRK-IX.2 in Arabidopsis and transient expression in Nicotiana benthamiana increased Phytophthora resistance but also induced cell death. Phytophthora resistance required both the lectin domain and kinase activity, but for cell death, the lectin domain was not needed. Silencing of the two closely related mitogen-activated protein kinase genes NbSIPK and NbNTF4 in N. benthamiana completely abolished LecRK-IX.1-induced cell death but not Phytophthora resistance. Liquid chromatography-mass spectrometry analysis of protein complexes coimmunoprecipitated in planta with LecRK-IX.1 or LecRK-IX.2 as bait, resulted in the identification of the N. benthamiana ABC transporter NbPDR1 as a potential interactor of both LecRK. The closest homolog of NbPDR1 in Arabidopsis is ABCG40, and coimmunoprecipitation experiments showed that ABCG40 associates with LecRK-IX.1 and LecRK-IX.2 in planta. Similar to the LecRK mutants, ABCG40 mutants showed compromised Phytophthora resistance. This study shows that LecRK-IX.1 and LecRK-IX.2 are Phytophthora resistance components that function independent of each other and independent of the cell-death phenotype. They both interact with the same ABC transporter, suggesting that they exploit similar signal transduction pathways.
Src Induces Podoplanin Expression to Promote Cell Migration*
Shen, Yongquan; Chen, Chen-Shan; Ichikawa, Hitoshi; Goldberg, Gary S.
2010-01-01
Nontransformed cells can force tumor cells to assume a normal morphology and phenotype by the process of contact normalization. Transformed cells must escape this process to become invasive and malignant. However, mechanisms underlying contact normalization have not been elucidated. Here, we have identified genes that are affected by contact normalization of Src-transformed cells. Tumor cells must migrate to become invasive and malignant. Src must phosphorylate the adaptor protein Cas (Crk-associated substrate) to promote tumor cell motility. We report here that Src utilizes Cas to induce podoplanin (Pdpn) expression to promote tumor cell migration. Pdpn is a membrane-bound extracellular glycoprotein that associates with endogenous ligands to promote tumor cell migration leading to cancer invasion and metastasis. In fact, Pdpn expression accounted for a major part of the increased migration seen in Src-transformed cells. Moreover, nontransformed cells suppressed Pdpn expression in adjacent Src-transformed cells. Of >39,000 genes, Pdpn was one of only 23 genes found to be induced by transforming Src activity and suppressed by contact normalization of Src-transformed cells. In addition, we found 16 genes suppressed by Src and induced by contact normalization. These genes encode growth factor receptors, adaptor proteins, and products that have not yet been annotated and may play important roles in tumor cell growth and migration. PMID:20123990
Directory of Open Access Journals (Sweden)
Natalia Brzozowska
2016-05-01
Full Text Available Cannabidiol (CBD is currently being investigated as a novel therapeutic for the treatment of CNS disorders like schizophrenia and epilepsy. ABC transporters such as P-glycoprotein (P-gp and breast cancer resistance protein (Bcrp mediate pharmacoresistance in these disorders. P-gp and Bcrp are expressed at the blood brain barrier (BBB and reduce the brain uptake of substrate drugs including various antipsychotics and anticonvulsants. It is therefore important to assess whether CBD is prone to treatment resistance mediated by P-gp and Bcrp. Moreover, it has become common practice in the drug development of CNS agents to screen against ABC transporters to help isolate lead compounds with optimal pharmacokinetic properties. The current study aimed to assess whether P-gp and Bcrp impacts the brain transport of CBD by comparing CBD tissue concentrations in wild-type (WT mice versus mice devoid of ABC transporter genes. P-gp knockout (Abcb1a/b−∕−, Bcrp knockout (Abcg2−∕−, combined P-gp/Bcrp knockout (Abcb1a/b−∕−Abcg2−∕− and WT mice were injected with CBD, before brain and plasma samples were collected at various time-points. CBD results were compared with the positive control risperidone and 9-hydroxy risperidone, antipsychotic drugs that are established ABC transporter substrates. Brain and plasma concentrations of CBD were not greater in P-gp, Bcrp or P-gp/Bcrp knockout mice than WT mice. In comparison, the brain/plasma concentration ratios of risperidone and 9-hydroxy risperidone were profoundly higher in P-gp knockout mice than WT mice. These results suggest that CBD is not a substrate of P-gp or Bcrp and may be free from the complication of reduced brain uptake by these transporters. Such findings provide favorable evidence for the therapeutic development of CBD in the treatment of various CNS disorders.
Drug-Induced Dental Caries: A Disproportionality Analysis Using Data from VigiBase.
de Campaigno, Emilie Patras; Kebir, Inès; Montastruc, Jean-Louis; Rueter, Manuela; Maret, Delphine; Lapeyre-Mestre, Maryse; Sallerin, Brigitte; Despas, Fabien
2017-12-01
Dental caries is defined as a pathological breakdown of the tooth. It is an infectious phenomenon involving a multifactorial aetiology. The impact of drugs on cariogenic risk has been poorly investigated. In this study, we identified drugs suspected to induce dental caries as adverse drug reactions (ADRs) and then studied a possible pathogenic mechanism for each drug that had a statistically significant disproportionality. We extracted individual case safety reports of dental caries associated with drugs from VigiBase ® (the World Health Organization global individual case safety report database). We calculated disproportionality for each drug with a reporting odds ratio (ROR) and 99% confidence interval. We analysed the pharmacodynamics of each drug that had a statistically significant disproportionality. In VigiBase ® , 5229 safety reports for dental caries concerning 733 drugs were identified. Among these drugs, 88 had a significant ROR, and for 65 of them (73.9%), no information about dental caries was found in the summaries of the product characteristics, the Micromedex ® DRUGDEX, or the Martindale databases. Regarding the pharmacological classes of drugs involved in dental caries, we identified bisphosphonates, atropinic drugs, antidepressants, corticoids, immunomodulating drugs, antipsychotics, antiepileptics, opioids and β 2 -adrenoreceptor agonist drugs. Regarding possible pathogenic mechanisms for these drugs, we identified changes in salivary flow/composition for 54 drugs (61.4%), bone metabolism changes for 31 drugs (35.2%), hyperglycaemia for 32 drugs (36.4%) and/or immunosuppression for 23 drugs (26.1%). For nine drugs (10.2%), the mechanism was unclear. We identified 88 drugs with a significant positive disproportionality for dental caries. Special attention has to be paid to bisphosphonates, atropinic drugs, immunosuppressants and drugs causing hyperglycaemia.
Rapakoulia, Trisevgeni
2017-08-09
Motivation: Drug combination therapy for treatment of cancers and other multifactorial diseases has the potential of increasing the therapeutic effect, while reducing the likelihood of drug resistance. In order to reduce time and cost spent in comprehensive screens, methods are needed which can model additive effects of possible drug combinations. Results: We here show that the transcriptional response to combinatorial drug treatment at promoters, as measured by single molecule CAGE technology, is accurately described by a linear combination of the responses of the individual drugs at a genome wide scale. We also find that the same linear relationship holds for transcription at enhancer elements. We conclude that the described approach is promising for eliciting the transcriptional response to multidrug treatment at promoters and enhancers in an unbiased genome wide way, which may minimize the need for exhaustive combinatorial screens.
El Kasmi, Karim C.; Anderson, Aimee L.; Devereaux, Michael W.; Vue, Padade M.; Zhang, Wujuan; Setchell, Kenneth D. R.; Karpen, Saul J.; Sokol, Ronald J.
2014-01-01
Parenteral nutrition–associated liver disease (PNALD) is a serious complication of PN in infants who do not tolerate enteral feedings, especially those with acquired or congenital intestinal diseases. Yet, the mechanisms underlying PNALD are poorly understood. It has been suggested that a component of soy oil (SO) lipid emulsions in PN solutions, such as plant sterols (phytosterols), may be responsible for PNALD, and that use of fish oil (FO)–based lipid emulsions may be protective. We used a mouse model of PNALD combining PN infusion with intestinal injury to demonstrate that SO-based PN solution causes liver damage and hepatic macrophage activation and that PN solutions that are FO-based or devoid of all lipids prevent these processes. We have furthermore demonstrated that a factor in the SO lipid emulsions, stigmasterol, promotes cholestasis, liver injury, and liver macrophage activation in this model and that this effect may be mediated through suppression of canalicular bile transporter expression (Abcb11/BSEP, Abcc2/MRP2) via antagonism of the nuclear receptors Fxr and Lxr, and failure of up-regulation of the hepatic sterol exporters (Abcg5/g8/ABCG5/8). This study provides experimental evidence that plant sterols in lipid emulsions are a major factor responsible for PNALD and that the absence or reduction of plant sterols is one of the mechanisms for hepatic protection in infants receiving FO-based PN or lipid minimization PN treatment. Modification of lipid constituents in PN solutions is thus a promising strategy to reduce incidence and severity of PNALD. PMID:24107776
Directory of Open Access Journals (Sweden)
Li Li
Full Text Available Aerial plant surfaces are covered by epicuticular waxes that among other purposes serve to control water loss. Maize glossy mutants originally identified by their "glossy" phenotypes exhibit alterations in the accumulation of epicuticular waxes. By combining data from a BSR-Seq experiment and the newly developed Seq-Walking technology, GRMZM2G118243 was identified as a strong candidate for being the glossy13 gene. The finding that multiple EMS-induced alleles contain premature stop codons in GRMZM2G118243, and the one knockout allele of gl13, validates the hypothesis that gene GRMZM2G118243 is gl13. Consistent with this, GRMZM2G118243 is an ortholog of AtABCG32 (Arabidopsis thaliana, HvABCG31 (barley and OsABCG31 (rice, which encode ABCG subfamily transporters involved in the trans-membrane transport of various secondary metabolites. We therefore hypothesize that gl13 is involved in the transport of epicuticular waxes onto the surfaces of seedling leaves.
Effect of goat milk on hepatotoxicity induced by antitubercular drugs in rats
Directory of Open Access Journals (Sweden)
Sonam Miglani
2016-10-01
Full Text Available Aim of the present study was to assess the hepatoprotective activity of goat milk on antitubercular drug-induced hepatotoxicity in rats. Hepatotoxicity was induced in rats using a combination of isoniazid, rifampicin, and pyrazinamide given orally as a suspension for 30 days. Treatment groups received goat milk along with antitubercular drugs. Liver damage was assessed using biochemical and histological parameters. Administration of goat milk (20 mL/kg along with antitubercular drugs (Group III reversed the levels of serum alanine aminotransferase (82 ± 25.1 vs. 128.8 ± 8.9 units/L and aspartate aminotransferase (174.7 ± 31.5 vs. 296.4 ± 56.4 units/L, p<0.01 compared with antitubercular drug treatment Group II. There was a significant decrease in serum alanine aminotransferase (41.8 ± 4.1 vs. 128.8 ± 8.9 units/L, p<0.01 and aspartate aminotransferase (128.8 ± 8.54 vs. 296.4 ± 56.4 units/L, p<0.001 levels in Group IV (goat milk 40 mL/kg compared with antitubercular drug treatment Group II. Goat milk (20 mL/kg and 40 mL/kg was effective in reversing the rise in malondialdehyde level compared with the antitubercular drug suspension groups (58.5 ± 2 vs. 89.88 ± 2.42 μmol/mL of tissue homogenate, p<0.001 and 69.7 ± 0.78 vs. 89.88 ± 2.42 μmol/mL of tissue homogenate, p<0.001, respectively. Similarly, both doses of milk significantly prevented a fall in superoxide dismutase level (6.23 ± 0.29 vs. 3.1 ± 0.288 units/mL, p<0.001 and 7.8 ± 0.392 vs. 3.1 ± 0.288 units/mL, p<0.001 compared with the group receiving antitubercular drugs alone. Histological examination indicated that goat milk reduced inflammation and necrotic changes in hepatocytes in the treatment groups. The results indicated that goat milk prevented the antitubercular drug-induced hepatotoxicity and is an effective hepatoprotective agent.
Choi, Sung E; Kwon, Sanghoon; Seok, Sunmi; Xiao, Zhen; Lee, Kwan-Woo; Kang, Yup; Li, Xiaoling; Shinoda, Kosaku; Kajimura, Shingo; Kemper, Byron; Kemper, Jongsook Kim
2017-08-01
Sirtuin1 (SIRT1) deacetylase delays and improves many obesity-related diseases, including nonalcoholic fatty liver disease (NAFLD) and diabetes, and has received great attention as a drug target. SIRT1 function is aberrantly low in obesity, so understanding the underlying mechanisms is important for drug development. Here, we show that obesity-linked phosphorylation of SIRT1 inhibits its function and promotes pathological symptoms of NAFLD. In proteomic analysis, Ser-164 was identified as a major serine phosphorylation site in SIRT1 in obese, but not lean, mice, and this phosphorylation was catalyzed by casein kinase 2 (CK2), the levels of which were dramatically elevated in obesity. Mechanistically, phosphorylation of SIRT1 at Ser-164 substantially inhibited its nuclear localization and modestly affected its deacetylase activity. Adenovirus-mediated liver-specific expression of SIRT1 or a phosphor-defective S164A-SIRT1 mutant promoted fatty acid oxidation and ameliorated liver steatosis and glucose intolerance in diet-induced obese mice, but these beneficial effects were not observed in mice expressing a phosphor-mimic S164D-SIRT1 mutant. Remarkably, phosphorylated S164-SIRT1 and CK2 levels were also highly elevated in liver samples of NAFLD patients and correlated with disease severity. Thus, inhibition of phosphorylation of SIRT1 by CK2 may serve as a new therapeutic approach for treatment of NAFLD and other obesity-related diseases. Copyright © 2017 American Society for Microbiology.
Drug induced xerostomia in elderly individuals: An institutional study
Directory of Open Access Journals (Sweden)
Shishir Ram Shetty
2012-01-01
Full Text Available Introduction : With better health care facilities and nutritional levels the average life expectancy of Indian population has been on the rise over the years. Most of the geriatric population is under long-term medication. Aim : The aim of this study was to evaluate the synergistic effect of multiple xerostomia drugs. Materials and Methods : Unstimulated saliva was measured in 60 geriatric patients, and xerostomia questionnaire and quality-of-life scale were also administered. Results : There was a very highly significant reduction in the salivary flow rates of patients under multiple xerostomia-inducing drugs. Conclusion : The synergistic effect of the xerostomia inducing medication could be the possible factor responsible for reduced salivary flow in elderly individuals using such drugs
Drug-induced peripheral neuropathy
DEFF Research Database (Denmark)
Vilholm, Ole Jakob; Christensen, Alex Alban; Zedan, Ahmed
2014-01-01
Peripheral neuropathy can be caused by medication, and various descriptions have been applied for this condition. In this MiniReview, the term 'drug-induced peripheral neuropathy' (DIPN) is used with the suggested definition: Damage to nerves of the peripheral nervous system caused by a chemical...... substance used in the treatment, cure, prevention or diagnosis of a disease. Optic neuropathy is included in this definition. A distinction between DIPN and other aetiologies of peripheral neuropathy is often quite difficult and thus, the aim of this MiniReview is to discuss the major agents associated...
Directory of Open Access Journals (Sweden)
Colleen Anne Dell
2012-01-01
Full Text Available The intentional misuse of psychotropic drugs is recognized as a significant public health concern in Canada, although there is a lack of empirical research detailing this. Even less research has been documented on the misuse of prescription drugs among First Nations in Canada. In the past, Western biomedical and individual-based approaches to researching Indigenous health have been applied, whereas First Nations’ understandings of health are founded on a holistic view of wellbeing. Recognition of this disjuncture, alongside the protective influence of First Nations traditional culture, is foundational to establishing an empirical understanding of and comprehensive response to prescription drug misuse. We propose health promotion as a framework from which to begin to explore this. Our work with a health promotion framework has conveyed its potential to support the consideration of Western and Indigenous worldviews together in an ‘ethical space’, with illustrations provided. Health promotion also allots for the consideration of Canada's colonial history of knowledge production in public health and supports First Nations’ self-determination. Based on this, we recommend three immediate ways in which a health promotion framework can advance research on prescription drug misuse among First Nations in Canada.
Jarzabek, Monika A; Proctor, William R; Vogt, Jennifer; Desai, Rupal; Dicker, Patrick; Cain, Gary; Raja, Rajiv; Brodbeck, Jens; Stevens, Dale; van der Stok, Eric P; Martens, John W M; Verhoef, Cornelis; Hegde, Priti S; Byrne, Annette T; Tarrant, Jacqueline M
2018-01-01
Drug-related sinusoidal dilatation (SD) is a common form of hepatotoxicity associated with oxaliplatin-based chemotherapy used prior to resection of colorectal liver metastases (CRLM). Recently, hepatic SD has also been associated with anti-delta like 4 (DLL4) cancer therapies targeting the NOTCH pathway. To investigate the hypothesis that NOTCH signaling plays an important role in drug-induced SD, gene expression changes were examined in livers from anti-DLL4 and oxaliplatin-induced SD in non-human primate (NHP) and patients, respectively. Putative mechanistic biomarkers of bevacizumab (bev)-mediated protection against oxaliplatin-induced SD were also investigated. RNA was extracted from whole liver sections or centrilobular regions by laser-capture microdissection (LCM) obtained from NHP administered anti-DLL4 fragment antigen-binding (F(ab')2 or patients with CRLM receiving oxaliplatin-based chemotherapy with or without bev. mRNA expression was quantified using high-throughput real-time quantitative PCR. Significance analysis was used to identify genes with differential expression patterns (false discovery rate (FDR) < 0.05). Eleven (CCL2, CCND1, EFNB2, ERG, ICAM1, IL16, LFNG, NOTCH1, NOTCH4, PRDX1, and TGFB1) and six (CDH5, EFNB2, HES1, IL16, MIK67, HES1 and VWF) candidate genes were differentially expressed in the liver of anti-DLL4- and oxaliplatin-induced SD, respectively. Addition of bev to oxaliplatin-based chemotherapy resulted in differential changes in hepatic CDH5, HEY1, IL16, JAG1, MMP9, NOTCH4 and TIMP1 expression. This work implicates NOTCH and IL16 pathways in the pathogenesis of drug-induced SD and further explains the hepato-protective effect of bev in oxaliplatin-induced SD observed in CRLM patients.
Multimode drug inducible CRISPR/Cas9 devices for transcriptional activation and genome editing
Lu, Jia; Zhao, Chen; Zhao, Yingze; Zhang, Jingfang; Zhang, Yue; Chen, Li; Han, Qiyuan; Ying, Yue; Peng, Shuai; Ai, Runna; Wang, Yu
2018-01-01
Abstract Precise investigation and manipulation of dynamic biological processes often requires molecular modulation in a controlled inducible manner. The clustered, regularly interspaced, short palindromic repeats (CRISPR)/CRISPR associated protein 9 (Cas9) has emerged as a versatile tool for targeted gene editing and transcriptional programming. Here, we designed and vigorously optimized a series of Hybrid drug Inducible CRISPR/Cas9 Technologies (HIT) for transcriptional activation by grafting a mutated human estrogen receptor (ERT2) to multiple CRISPR/Cas9 systems, which renders them 4-hydroxytamoxifen (4-OHT) inducible for the access of genome. Further, extra functionality of simultaneous genome editing was achieved with one device we named HIT2. Optimized terminal devices herein delivered advantageous performances in comparison with several existing designs. They exerted selective, titratable, rapid and reversible response to drug induction. In addition, these designs were successfully adapted to an orthogonal Cas9. HIT systems developed in this study can be applied for controlled modulation of potentially any genomic loci in multiple modes. PMID:29237052
Directory of Open Access Journals (Sweden)
Vik-Mo Audun O
2006-10-01
Full Text Available Abstract Background The etiology of schizophrenia is unknown, but neurodevelopmental disturbances, myelin- and oligodendrocyte abnormalities and synaptic dysfunction have been suggested as pathophysiological factors in this severe psychiatric disorder. Cholesterol is an essential component of myelin and has proved important for synapse formation. Recently, we demonstrated that the antipsychotic drugs clozapine and haloperidol stimulate lipogenic gene expression in cultured glioma cells through activation of the sterol regulatory element-binding protein (SREBP transcription factors. We here compare the action of chlorpromazine, haloperidol, clozapine, olanzapine, risperidone and ziprasidone on SREBP activation and SREBP-controlled gene expression (ACAT2, HMGCR, HMGCS1, FDPS, SC5DL, DHCR7, LDLR, FASN and SCD1 in four CNS-relevant human cell lines. Results There were marked differences in the ability of the antipsychotic drugs to activate the expression of SREBP target genes, with clozapine and chlorpromazine as the most potent stimulators in a context of therapeutically relevant concentrations. Glial-like cells (GaMg glioma and CCF-STTG1 astrocytoma cell lines displayed more pronounced drug-induced SREBP activation compared to the response in HCN2 human cortical neurons and SH-SY5Y neuroblastoma cells, indicating that antipsychotic-induced activation of lipogenesis is most prominent in glial cells. Conclusion Our present data show a marked variation in the ability of different antipsychotics to induce SREBP-controlled transcriptional activation of lipogenesis in cultured human CNS-relevant cells. We propose that this effect could be relevant for the therapeutic efficacy of some antipsychotic drugs.
Sorafenib-induced defective autophagy promotes cell death by necroptosis
Kharaziha, Pedram; Chioureas, Dimitris; Baltatzis, George; Fonseca, Pedro; Rodriguez, Patricia; Gogvadze, Vladimir; Lennartsson, Lena; Bj?rklund, Ann-Charlotte; Zhivotovsky, Boris; Grand?r, Dan; Egevad, Lars; Nilsson, Sten; Panaretakis, Theocharis
2015-01-01
Autophagy is one of the main cytoprotective mechanisms that cancer cells deploy to withstand the cytotoxic stress and survive the lethal damage induced by anti-cancer drugs. However, under specific conditions, autophagy may, directly or indirectly, induce cell death. In our study, treatment of the Atg5-deficient DU145 prostate cancer cells, with the multi-tyrosine kinase inhibitor, sorafenib, induces mitochondrial damage, autophagy and cell death. Molecular inhibition of autophagy by silencin...
The Necrosome Promotes Pancreas Oncogenesis via CXCL1 and Mincle Induced Immune Suppression
Seifert, Lena; Werba, Gregor; Tiwari, Shaun; Giao Ly, Nancy Ngoc; Alothman, Sara; Alqunaibit, Dalia; Avanzi, Antonina; Barilla, Rocky; Daley, Donnele; Greco, Stephanie H.; Torres-Hernandez, Alejandro; Pergamo, Matthew; Ochi, Atsuo; Zambirinis, Constantinos P.; Pansari, Mridul; Rendon, Mauricio; Tippens, Daniel; Hundeyin, Mautin; Mani, Vishnu R.; Hajdu, Cristina; Engle, Dannielle; Miller, George
2016-01-01
Neoplastic pancreatic epithelial cells are widely believed to die via Caspase 8-dependant apoptotic cell death and chemotherapy is thought to further promote tumor apoptosis1. Conversely, disruption of apoptosis is a basic modality cancer cells exploit for survival2,3. However, the role of necroptosis, or programmed necrosis, in pancreatic ductal adenocarcinoma (PDA) is uncertain. There are a multitude of potential inducers of necroptosis in PDA including ligation of TNFR1, CD95, TRAIL receptors, Toll-like receptors, ROS, and Chemotherapeutics4,5. Here we report that the principal components of the necrosome, RIP1 and RIP3, are highly expressed in PDA and are further upregulated by chemotherapy. Blockade of the necrosome in vitro promoted cancer cell proliferation and induced an aggressive oncogenic phenotype. By contrast, in vivo RIP3 deletion or RIP1 inhibition was protective against oncogenic progression and was associated with the development of a highly immunogenic myeloid and T cell infiltrate. The immune-suppressive tumor microenvironment (TME) associated with intact RIP1/RIP3 signaling was in-part contingent on necroptosis-induced CXCL1 expression whereas CXCL1 blockade was protective against PDA. Moreover, we found that cytoplasmic SAP130 was expressed in PDA in a RIP1/RIP3-dependent manner, and Mincle – its cognate receptor – was upregulated in tumor-infiltrating myeloid cells. Mincle ligation by SAP130 promoted oncogenesis whereas Mincle deletion was protective and phenocopied the immunogenic reprogramming of the TME characteristic of RIP3 deletion. Cellular depletion experiments suggested that whereas inhibitory macrophages promote tumorigenesis in PDA, they lose their immune-suppressive effects in the context of RIP3 or Mincle deletion. As such, T cells which are dispensable to PDA progression in hosts with intact RIP3 or Mincle signaling become reprogrammed into indispensable mediators of anti-tumor immunity in absence of RIP3 or Mincle. Our work
Energy Technology Data Exchange (ETDEWEB)
Kim, Tae Rim; Lee, Hee Min; Lee, So Yong; Kim, Eun Jin; Kim, Kug Chan [Department of Radiation Biology, Environmental Radiation Research Group, Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Paik, Sang Gi [Department of Biology, School of Biosciences and Biotechnology, Chungnam National University, Daejeon (Korea, Republic of); Cho, Eun Wie, E-mail: ewcho@kribb.re.kr [Daejeon-KRIBB-FHCRC Cooperation Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon (Korea, Republic of); Kim, In Gyu, E-mail: igkim@kaeri.re.kr [Department of Radiation Biology, Environmental Radiation Research Group, Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)
2010-09-10
Research highlights: {yields} SM22{alpha} overexpression in HepG2 cells leads cells to a growth arrest state, and the treatment of a subclinical dose of {gamma}-radiation or doxorubicin promotes cellular senescence. {yields} SM22{alpha} overexpression elevates p16{sup INK4a} followed by pRB activation, but there are no effects on p53/p21{sup WAF1/Cip1} pathway. {yields} SM22{alpha}-induced MT-1G activates p16{sup INK4a}/pRB pathway, which promotes cellular senescence by damaging agents. -- Abstract: Smooth muscle protein 22-alpha (SM22{alpha}) is known as a transformation- and shape change-sensitive actin cross-linking protein found in smooth muscle tissue and fibroblasts; however, its functional role remains uncertain. We reported previously that SM22{alpha} overexpression confers resistance against anti-cancer drugs or radiation via induction of metallothionein (MT) isozymes in HepG2 cells. In this study, we demonstrate that SM22{alpha} overexpression leads cells to a growth arrest state and promotes cellular senescence caused by treatment with a subclinical dose of {gamma}-radiation (0.05 and 0.1 Gy) or doxorubicin (0.01 and 0.05 {mu}g/ml), compared to control cells. Senescence growth arrest is known to be controlled by p53 phosphorylation/p21{sup WAF1/Cip1} induction or p16{sup INK4a}/retinoblastoma protein (pRB) activation. SM22{alpha} overexpression in HepG2 cells elevated p16{sup INK4a} followed by pRB activation, but did not activate the p53/p21{sup WAF1/Cip1} pathway. Moreover, MT-1G, which is induced by SM22{alpha} overexpression, was involved in the activation of the p16{sup INK4a}/pRB pathway, which led to a growth arrest state and promoted cellular senescence caused by damaging agents. Our findings provide the first demonstration that SM22{alpha} modulates cellular senescence caused by damaging agents via regulation of the p16{sup INK4a}/pRB pathway in HepG2 cells and that these effects of SM22{alpha} are partially mediated by MT-1G.
Tong, Mengsha; Zheng, Weicheng; Lu, Xingrong; Ao, Lu; Li, Xiangyu; Guan, Qingzhou; Cai, Hao; Li, Mengyao; Yan, Haidan; Guo, You; Chi, Pan; Guo, Zheng
2015-12-01
Until recently, few molecular signatures of drug resistance identified in drug-induced resistant cancer cell models can be translated into clinical practice. Here, we defined differentially expressed genes (DEGs) between pre-chemotherapy colorectal cancer (CRC) tissue samples of non-responders and responders for 5-fluorouracil and oxaliplatin-based therapy as clinically relevant drug resistance genes (CRG5-FU/L-OHP). Taking CRG5-FU/L-OHP as reference, we evaluated the clinical relevance of several types of genes derived from HCT116 CRC cells with resistance to 5-fluorouracil and oxaliplatin, respectively. The results revealed that DEGs between parental and resistant cells, when both were treated with the corresponding drug for a certain time, were significantly consistent with the CRG5-FU/L-OHP as well as the DEGs between the post-chemotherapy CRC specimens of responders and non-responders. This study suggests a novel strategy to extract clinically relevant drug resistance genes from both drug-induced resistant cell models and post-chemotherapy cancer tissue specimens.
Keller, Guillermo A; Alvarez, Paulino A; Ponte, Marcelo L; Belloso, Waldo H; Bagnes, Claudia; Sparanochia, Cecilia; Gonzalez, Claudio D; Villa Etchegoyen, M Cecilia; Diez, Roberto A; Di Girolamo, Guillermo
2016-01-01
The actual prevalence of drug induced QTc prolongation in clinical practice is unknown. Our objective was to determine the occurrence and characteristics of drug-induced QT prolongation in several common clinical practices. Additionally, a subgroup of patients treated with dextropropoxyphene of particular interest for the regulatory authority was analysed. Medical history and comorbidities predisposing to QT interval prolongation were registered for 1270 patient requiring medical assistance that involved drug administration. Three ionograms and ECGs were performed: baseline, intra- and after treatment; QT interval was corrected with Bazzet formula. Among patients, 9.9% presented QTc >450/470 ms, 3% QTc > 500 ms, 12.7% ΔQTc >30 ms and 5.2% ΔQTc >60 ms. QTc prolongation associated with congestive heart failure, ischemic cardiopathy, diabetes, renal failure, arrhythmias, hypothyroidism, and bradycardia. At univariate analysis, clarithromycin, haloperidol, tramadol, amiodarone, glyceryl trinitrate, amoxicillin + clavulanic acid, amoxicillin + sulbactam, ampicillin + sulbactam, fentanyl, piperacillin + tazobactam, and diazepam prolonged QTc. Prolongation remained significantly associated with furosemide, clarithromycin, glyceryl trinitrate and betalactamase inhibitors after multivariate analysis. QT interval prolongation in everyday practice is frequent, in association to clinical factors and drugs that can be easily identified for monitoring and prevention strategies.
Van Moerkercke, Alex; Galván-Ampudia, Carlos S; Verdonk, Julian C; Haring, Michel A; Schuurink, Robert C
2012-05-01
In which cells of the flower volatile biosynthesis takes place is unclear. In rose and snapdragon, some enzymes of the volatile phenylpropanoid/benzenoid pathway have been shown to be present in the epidermal cells of petals. It is therefore generally believed that the production of these compounds occurs in these cells. However, whether the entire pathway is active in these cells and whether it is exclusively active in these cells remains to be proven. Cell-specific transcription factors activating these genes will determine in which cells they are expressed. In petunia, the transcription factor EMISSION OF BENZENOIDS II (EOBII) activates the ODORANT1 (ODO1) promoter and the promoter of the biosynthetic gene isoeugenol synthase (IGS). The regulator ODO1 in turn activates the promoter of the shikimate gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Here the identification of a new target gene of ODO1, encoding an ABC transporter localized on the plasma membrane, PhABCG1, which is co-expressed with ODO1, is described. PhABCG1 expression is up-regulated in petals overexpressing ODO1 through activation of the PhABCG1 promoter. Interestingly, the ODO1, PhABCG1, and IGS promoters were active in petunia protoplasts originating from both epidermal and mesophyll cell layers of the petal, suggesting that the volatile phenylpropanoid/benzenoid pathway in petunia is active in these different cell types. Since volatile release occurs from epidermal cells, trafficking of (volatile) compounds between cell layers must be involved, but the exact function of PhABCG1 remains to be resolved.
Understanding promotion of photocatalytic activity of TiO2 by Au nanoparticles
Amrollahi Buky, Rezvaneh; Hamdy, Mohamed S.; Mul, Guido
2014-01-01
Au nanoparticles prepared by deposition–precipitation were evaluated in promoting photocatalytic activity of TiO2 (P25) in the oxidation of methylcyclohexane. At 375 nm and in particular at 425 nm, Au was found to significantly enhance the rate induced by P25. Illumination of Au-promoted P25 at 525
Drug-induced liver toxicity and prevention by herbal antioxidants: an overview
Directory of Open Access Journals (Sweden)
Divya eSingh
2016-01-01
Full Text Available The liver is the center for drug and xenobiotic metabolism, which is influenced most with medication/xenobiotic-mediated toxic activity. Drug-induced hepatotoxicity is common and its actual frequency is hard to determine due to underreporting, difficulties in detection or diagnosis, and incomplete observation of exposure. The death rate is high, up to about 10% for medication instigated liver danger. Endorsed medications (counting acetaminophen represented >50% of instances of intense liver failure in a study from the Acute Liver Failure Study Group (ALFSG of the patients admitted in 17 US healing facilities. Albeit different studies are accessible uncovering the mechanistic aspects of medication prompted hepatotoxicity, we are in the dilemma about the virtual story. The expanding prevalence and effectiveness of Ayurveda and herbal products in the treatment of various disorders led the investigators to look into their potential in countering drug-induced liver toxicity. Several plant products have been reported to date to mitigate the drug-induced toxicity. The dietary nature and less side reactions of the herbs provide them an extra edge over other candidates of supplementary medication. In this paper, we have discussed on the mechanism involved in drug-induced liver toxicity and the potential of herbal antioxidants as supplementary medication.
Gemfibrozil, a Lipid-lowering Drug, Induces Suppressor of Cytokine Signaling 3 in Glial Cells
Ghosh, Arunava; Pahan, Kalipada
2012-01-01
Glial inflammation is an important feature of several neurodegenerative disorders. Suppressor of cytokine signaling (SOCS) proteins play a crucial role in inhibiting cytokine signaling and inflammatory gene expression in various cell types, including glial cells. However, mechanisms by which SOCS genes could be up-regulated are poorly understood. This study underlines the importance of gemfibrozil, a Food and Drug Administration-approved lipid-lowering drug, in up-regulating the expression of SOCS3 in glial cells. Gemfibrozil increased the expression of Socs3 mRNA and protein in mouse astroglia and microglia in both a time- and dose-dependent manner. Interestingly, gemfibrozil induced the activation of type IA phosphatidylinositol (PI) 3-kinase and AKT. Accordingly, inhibition of PI 3-kinase and AKT by chemical inhibitors abrogated gemfibrozil-mediated up-regulation of SOCS3. Furthermore, we demonstrated that gemfibrozil induced the activation of Krüppel-like factor 4 (KLF4) via the PI 3-kinase-AKT pathway and that siRNA knockdown of KLF4 abrogated gemfibrozil-mediated up-regulation of SOCS3. Gemfibrozil also induced the recruitment of KLF4 to the distal, but not proximal, KLF4-binding site of the Socs3 promoter. This study delineates a novel property of gemfibrozil in up-regulating SOCS3 in glial cells via PI 3-kinase-AKT-mediated activation of KLF4 and suggests that gemfibrozil may find therapeutic application in neuroinflammatory and neurodegenerative disorders. PMID:22685291
Directory of Open Access Journals (Sweden)
Maria Adriana Rangel
2017-01-01
Full Text Available The authors present a case report of antituberculosis drug-induced liver injury that offered diagnostic challenges (namely, the possibility of drug-induced autoimmune hepatitis and treatment difficulties.
Heiss, Silvia; Hörmann, Angelika; Tauer, Christopher; Sonnleitner, Margot; Egger, Esther; Grabherr, Reingard; Heinl, Stefan
2016-03-10
Engineering lactic acid bacteria (LAB) is of growing importance for food and feed industry as well as for in vivo vaccination or the production of recombinant proteins in food grade organisms. Often, expression of a transgene is only desired at a certain time point or period, e.g. to minimize the metabolic burden for the host cell or to control the expression time span. For this purpose, inducible expression systems are preferred, though cost and availability of the inducing agent must be feasible. We selected the plasmid free strain Lactobacillus plantarum 3NSH for testing and characterization of novel inducible promoters/repressor systems. Their feasibility in recombinant protein production was evaluated. Expression of the reporter protein mCherry was monitored with the BioLector(®) micro-fermentation system. Reporter gene mCherry expression was compared under the control of different promoter/repressor systems: PlacA (an endogenous promoter/repressor system derived from L. plantarum 3NSH), PxylA (a promoter/repressor system derived from Bacillus megaterium DSMZ 319) and PlacSynth (synthetic promoter and codon-optimized repressor gene based on the Escherichia coli lac operon). We observed that PlacA was inducible solely by lactose, but not by non-metabolizable allolactose analoga. PxylA was inducible by xylose, yet showed basal expression under non-induced conditions. Growth on galactose (as compared to exponential growth phase on glucose) reduced basal mCherry expression at non-induced conditions. PlacSynth was inducible with TMG (methyl β-D-thiogalactopyranoside) and IPTG (isopropyl β-D-1-thiogalactopyranoside), but also showed basal expression without inducer. The promoter PlacSynth was used for establishment of a dual plasmid expression system, based on T7 RNA polymerase driven expression in L. plantarum. Comparative Western blot supported BioLector(®) micro-fermentation measurements. Conclusively, overall expression levels were moderate (compared to a
Antimalarial drug induced decrease in creatinine clearance
Landewé, R. B.; Vergouwen, M. S.; Goeei The, S. G.; van Rijthoven, A. W.; Breedveld, F. C.; Dijkmans, B. A.
1995-01-01
To confirm the antimalarial drug induced increase of creatinine to determine the factors contributing to this effect. Patients with rheumatoid arthritis (RA) (n = 118) who have used or still use antimalarials (chloroquine or hydroxychloroquine). Serum creatinines prior to antimalarials and serum
Vitamin D3: A Role in Dopamine Circuit Regulation, Diet-Induced Obesity, and Drug Consumption.
Trinko, Joseph R; Land, Benjamin B; Solecki, Wojciech B; Wickham, Robert J; Tellez, Luis A; Maldonado-Aviles, Jaime; de Araujo, Ivan E; Addy, Nii A; DiLeone, Ralph J
2016-01-01
The influence of micronutrients on dopamine systems is not well defined. Using mice, we show a potential role for reduced dietary vitamin D3 (cholecalciferol) in promoting diet-induced obesity (DIO), food intake, and drug consumption while on a high fat diet. To complement these deficiency studies, treatments with exogenous fully active vitamin D3 (calcitriol, 10 µg/kg, i.p.) were performed. Nondeficient mice that were made leptin resistant with a high fat diet displayed reduced food intake and body weight after an acute treatment with exogenous calcitriol. Dopamine neurons in the midbrain and their target neurons in the striatum were found to express vitamin D3 receptor protein. Acute calcitriol treatment led to transcriptional changes of dopamine-related genes in these regions in naive mice, enhanced amphetamine-induced dopamine release in both naive mice and rats, and increased locomotor activity after acute amphetamine treatment (2.5 mg/kg, i.p.). Alternatively, mice that were chronically fed either the reduced D3 high fat or chow diets displayed less activity after acute amphetamine treatment compared with their respective controls. Finally, high fat deficient mice that were trained to orally consume liquid amphetamine (90 mg/L) displayed increased consumption, while nondeficient mice treated with calcitriol showed reduced consumption. Our findings suggest that reduced dietary D3 may be a contributing environmental factor enhancing DIO as well as drug intake while eating a high fat diet. Moreover, these data demonstrate that dopamine circuits are modulated by D3 signaling, and may serve as direct or indirect targets for exogenous calcitriol.
Targeted deletion of Nrf2 reduces urethane-induced lung tumor development in mice.
Directory of Open Access Journals (Sweden)
Alison K Bauer
Full Text Available Nrf2 is a key transcription factor that regulates cellular redox and defense responses. However, permanent Nrf2 activation in human lung carcinomas promotes pulmonary malignancy and chemoresistance. We tested the hypothesis that Nrf2 has cell survival properties and lack of Nrf2 suppresses chemically-induced pulmonary neoplasia by treating Nrf2(+/+ and Nrf2(-/- mice with urethane. Airway inflammation and injury were assessed by bronchoalveolar lavage analyses and histopathology, and lung tumors were analyzed by gross and histologic analysis. We used transcriptomics to assess Nrf2-dependent changes in pulmonary gene transcripts at multiple stages of neoplasia. Lung hyperpermeability, cell death and apoptosis, and inflammatory cell infiltration were significantly higher in Nrf2(-/- mice compared to Nrf2(+/+ mice 9 and 11 wk after urethane. Significantly fewer lung adenomas were found in Nrf2(-/- mice than in Nrf2(+/+ mice at 12 and 22 wk. Nrf2 modulated expression of genes involved cell-cell signaling, glutathione metabolism and oxidative stress response, and immune responses during early stage neoplasia. In lung tumors, Nrf2-altered genes had roles in transcriptional regulation of cell cycle and proliferation, carcinogenesis, organismal injury and abnormalities, xenobiotic metabolism, and cell-cell signaling genes. Collectively, Nrf2 deficiency decreased susceptibility to urethane-induced lung tumorigenesis in mice. Cell survival properties of Nrf2 were supported, at least in part, by reduced early death of initiated cells and heightened advantage for tumor cell expansion in Nrf2(+/+ mice relative to Nrf2(-/- mice. Our results were consistent with the concept that Nrf2 over-activation is an adaptive response of cancer conferring resistance to anti-cancer drugs and promoting malignancy.
Nox2 in regulatory T cells promotes angiotensin II-induced cardiovascular remodeling.
Emmerson, Amber; Trevelin, Silvia Cellone; Mongue-Din, Heloise; Becker, Pablo D; Ortiz, Carla; Smyth, Lesley A; Peng, Qi; Elgueta, Raul; Sawyer, Greta; Ivetic, Aleksandar; Lechler, Robert I; Lombardi, Giovanna; Shah, Ajay M
2018-04-24
The superoxide-generating enzyme Nox2 contributes to hypertension and cardiovascular remodeling triggered by activation of the renin-angiotensin system. Multiple Nox2-expressing cells are implicated in angiotensin II (AngII)-induced pathophysiology, but the importance of Nox2 in leukocyte subsets is poorly understood. Here, we investigated the role of Nox2 in T cells, particularly Tregs. Mice globally deficient in Nox2 displayed increased numbers of Tregs in the heart at baseline whereas AngII-induced T-effector cell (Teffs) infiltration was inhibited. To investigate the role of Treg Nox2, we generated a mouse line with CD4-targeted Nox2 deficiency (Nox2fl/flCD4Cre+). These animals showed inhibition of AngII-induced hypertension and cardiac remodeling related to increased tissue-resident Tregs and reduction in infiltrating Teffs, including Th17 cells. The protection in Nox2fl/flCD4Cre+ mice was reversed by anti-CD25 Ab-depletion of Tregs. Mechanistically, Nox2-/y Tregs showed higher in vitro suppression of Teffs proliferation than WT Tregs, increased nuclear levels of FoxP3 and NF-κB, and enhanced transcription of CD25, CD39, and CD73. Adoptive transfer of Tregs confirmed that Nox2-deficient cells had greater inhibitory effects on AngII-induced heart remodeling than WT cells. These results identify a previously unrecognized role of Nox2 in modulating suppression of Tregs, which acts to enhance hypertension and cardiac remodeling.
THE ROLE OF PROMOTION ON MARKETING IN TURKISH DRUG INDUSTRY
Directory of Open Access Journals (Sweden)
Emrah Bilgener
2004-08-01
Full Text Available Abstract\tMarketing has an important role in modern life. Marketing provides economical and social bene-fits with correleating between producers and consumers.\tPromotional activities are necessary for better marketing strategies. Therefore, firms have to give more importance to promotional activities. Promotional activities are marketing instruments that an-nounced all the knowledges about the products and services to their consumers, for surviving and de-veloping the firms.\tNowadays drug producers are marketing their products all arround the world. But, drugs are not ordinary products, for this reason more importance must be given to drug marketing andpromotion.\tThe purpose of this study is to determine the role of promotion within the marketing in Turkish Drug Industry. The material of this study is an uniform questionnaire with 41 questions applied to about 190-200 medical representatives who work in Çorum, Yozgat, Amasya and Tokat cities for 37 firms which are the members of Federation of Employer’s Organization in Pharmaceutical Industry and 14 firms which are profited by the services of this federation.\tIn this study, SPSS program (ver7.5 has been used for evaluation of the data. According to the re-sults, medical represantatives think that the drug sales will increase and wait the data of IMS (Inform Medicines Statistics will rise about 60-80%. 90% of the medical represantatives believe that the pa-ramedical activities are effective and 73% of them carry out paramedical studies.\tÖzet\tPazarlama modern yasantida önemli bir role sahiptir. Pazarlama üreticiler ve tüketiciler arasinda bir iliski kurarak, ekonomik ve sosyal faydalar saglar. Tanitim faaliyetleri daha iyi bir pazarlama stratejisi için gereklidir. Bu nedenle sirketler daha iyi bir pazarlama stratejisi için tanitim faaliyetlerine önem vermelidir. Tanitim faaliyetleri, isletmenin ürettigi mal ve hizmetleri tüketicilere duyuran, isletmenin gelisimini ve yasamasini
Feng, Jie; Shi, Wanliang; Zhang, Shuo; Sullivan, David; Auwaerter, Paul G; Zhang, Ying
2016-01-01
Although currently recommended antibiotics for Lyme disease such as doxycycline or amoxicillin cure the majority of the patients, about 10-20% of patients treated for Lyme disease may experience lingering symptoms including fatigue, pain, or joint and muscle aches. Under experimental stress conditions such as starvation or antibiotic exposure, Borrelia burgdorferi can develop round body forms, which are a type of persister bacteria that appear resistant in vitro to customary first-line antibiotics for Lyme disease. To identify more effective drugs with activity against the round body form of B. burgdorferi, we established a round body persister model induced by exposure to amoxicillin (50 μg/ml) and then screened the Food and Drug Administration drug library consisting of 1581 drug compounds and also 22 drug combinations using the SYBR Green I/propidium iodide viability assay. We identified 23 drug candidates that have higher activity against the round bodies of B. burgdorferi than either amoxicillin or doxycycline. Eleven individual drugs scored better than metronidazole and tinidazole which have been previously described to be active against round bodies. In this amoxicillin-induced round body model, some drug candidates such as daptomycin and clofazimine also displayed enhanced activity which was similar to a previous screen against stationary phase B. burgdorferi persisters not exposure to amoxicillin. Additional candidate drugs active against round bodies identified include artemisinin, ciprofloxacin, nifuroxime, fosfomycin, chlortetracycline, sulfacetamide, sulfamethoxypyridazine and sulfathiozole. Two triple drug combinations had the highest activity against amoxicillin-induced round bodies and stationary phase B. burgdorferi persisters: artemisinin/cefoperazone/doxycycline and sulfachlorpyridazine/daptomycin/doxycycline. These findings confirm and extend previous findings that certain drug combinations have superior activity against B. burgdorferi
Shimizu, Takayuki; Mori, Takehiko; Karigane, Daiki; Kikuchi, Taku; Koda, Yuya; Toyama, Takaaki; Nakajima, Hideaki; Okamoto, Shinichiro
2014-01-01
A 62-year-old man with refractory leukemia transformed from myelodysplastic syndrome was placed on hydroxyurea (hydroxycarbamide) at a daily dose of 500 mg. Because of insufficient cytoreductive efficacy, the dose was increased to 1,500 mg five days later. Eight days after the initiation of hydroxyurea, the patient started complaining of chills, fever, and vomiting. Serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were markedly elevated to 5,098 and 3,880 IU/l from 44 and 59 IU/l in one day, respectively. Tests for hepatitis viruses were all negative. With the discontinuation of hydroxyurea, AST and ALT returned to their former levels within two weeks. A drug-induced lymphocyte stimulation test for hydroxyurea was positive with a stimulating index of 2.0. Hepatic dysfunction has been recognized as one of the side effects of hydroxyurea. However, there have been only a limited number of reports demonstrating drug allergy to have a role in hepatic dysfunction accompanied by fever and gastrointestinal symptoms. The findings of our case strongly suggest that all presentations could be explained by drug allergy. Physicians should be mindful of the potential for acute and severe hepatic dysfunction due to allergic reaction against hydroxyurea.
Potenza, Marc N; Hong, Kwang-ik Adam; Lacadie, Cheryl M; Fulbright, Robert K; Tuit, Keri L; Sinha, Rajita
2012-04-01
Although stress and drug cue exposure each increase drug craving and contribute to relapse in cocaine dependence, no previous research has directly examined the neural correlates of stress-induced and drug cue-induced craving in cocaine-dependent women and men relative to comparison subjects. Functional MRI was used to assess responses to individualized scripts for stress, drug/alcohol cue and neutral-relaxing-imagery conditions in 30 abstinent cocaine-dependent individuals (16 women, 14 men) and 36 healthy recreational-drinking comparison subjects (18 women, 18 men). Significant three-way interactions between diagnostic group, sex, and script condition were observed in multiple brain regions including the striatum, insula, and anterior and posterior cingulate. Within women, group-by-condition interactions were observed involving these regions and were attributable to relatively increased regional activations in cocaine-dependent women during the stress and, to a lesser extent, neutral-relaxing conditions. Within men, group main effects were observed involving these same regions, with cocaine-dependent men demonstrating relatively increased activation across conditions, with the main contributions from the drug and neutral-relaxing conditions. In men and women, subjective drug-induced craving measures correlated positively with corticostriatal-limbic activations. In cocaine dependence, corticostriatal-limbic hyperactivity appears to be linked to stress cues in women, drug cues in men, and neutral-relaxing conditions in both. These findings suggest that sex should be taken into account in the selection of therapies in the treatment of addiction, particularly those targeting stress reduction.
Cordes, Henrik; Thiel, Christoph; Baier, Vanessa; Blank, Lars M; Kuepfer, Lars
2018-01-01
Drug-induced perturbations of the endogenous metabolic network are a potential root cause of cellular toxicity. A mechanistic understanding of such unwanted side effects during drug therapy is therefore vital for patient safety. The comprehensive assessment of such drug-induced injuries requires the simultaneous consideration of both drug exposure at the whole-body and resulting biochemical responses at the cellular level. We here present a computational multi-scale workflow that combines whole-body physiologically based pharmacokinetic (PBPK) models and organ-specific genome-scale metabolic network (GSMN) models through shared reactions of the xenobiotic metabolism. The applicability of the proposed workflow is illustrated for isoniazid, a first-line antibacterial agent against Mycobacterium tuberculosis , which is known to cause idiosyncratic drug-induced liver injuries (DILI). We combined GSMN models of a human liver with N-acetyl transferase 2 (NAT2)-phenotype-specific PBPK models of isoniazid. The combined PBPK-GSMN models quantitatively describe isoniazid pharmacokinetics, as well as intracellular responses, and changes in the exometabolome in a human liver following isoniazid administration. Notably, intracellular and extracellular responses identified with the PBPK-GSMN models are in line with experimental and clinical findings. Moreover, the drug-induced metabolic perturbations are distributed and attenuated in the metabolic network in a phenotype-dependent manner. Our simulation results show that a simultaneous consideration of both drug pharmacokinetics at the whole-body and metabolism at the cellular level is mandatory to explain drug-induced injuries at the patient level. The proposed workflow extends our mechanistic understanding of the biochemistry underlying adverse events and may be used to prevent drug-induced injuries in the future.
Kuga, Kazuhiro; Yasuno, Hironobu; Sakai, Yumi; Harada, Yumiko; Shimizu, Fumi; Miyamoto, Yumiko; Takamatsu, Yuki; Miyamoto, Makoto; Sato, Keiichiro
2017-11-01
In vivo phototoxicity studies are important to predict drug-induced phototoxicity in humans; however, a standard methodology has not established. To determine differences in sensitivity to drug-induced phototoxicity among various skin sites, we evaluated phototoxic reactions in the back and abdominal skin of female Sprague-Dawley rats orally dosed with phototoxic drugs (pirfenidone, 8-methoxysoraren, doxycycline, and lomefloxacin) or a non-phototoxic drug (gatifloxacin) followed by solar-simulated light irradiation comprising 18J/cm 2 ultraviolet A. Tissue reactions were evaluated by macroscopic and microscopic examination and immunohistochemistry for γ-H2AX, and tissue concentrations of pirfenidone, doxycycline, and lomefloxacin were measured by tandem mass spectrometry. In addition, the thicknesses of the skin layers at both sites were measured in drug-naïve rats. The abdominal skin showed more severe reactions to all phototoxic drugs than the back skin, whereas the minimal erythema dose in drug-naïve rats and skin concentrations of each drug were comparable between the sites. Furthermore, histopathological lesions and γ-H2AX-positive cells in the abdominal skin were detected in deeper layers than in the back skin. The stratum corneum and dermis in the abdominal skin were significantly thinner than in the back skin, indicating a difference in the depth of light penetration and potentially contributing to the site differences observed in sensitivity to phototoxicity. Gatifloxacin did not induce any phototoxic reactions at either site. In conclusion, the abdominal skin is more sensitive to drug-induced phototoxicity than the back skin and may represent a preferable site for irradiation in this rat phototoxicity model. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
So Masaki
Full Text Available Transforming growth factor beta (TGF-β has critical roles in regulating cell growth, differentiation, apoptosis, invasion and epithelial-mesenchymal transition (EMT of various cancer cells. TGF-β-induced EMT is an important step during carcinoma progression to invasion state. Thioredoxin binding protein-2 (TBP-2, also called Txnip or VDUP1 is downregulated in various types of human cancer, and its deficiency results in the earlier onset of cancer. However, it remains unclear how TBP-2 suppresses the invasion and metastasis of cancer.In this study, we demonstrated that TBP-2 deficiency increases the transcriptional activity in response to TGF-β and also enhances TGF-β-induced Smad2 phosphorylation levels. Knockdown of TBP-2 augmented the TGF-β-responsive expression of Snail and Slug, transcriptional factors related to TGF-β-mediated induction of EMT, and promoted TGF-β-induced spindle-like morphology consistent with the depletion of E-Cadherin in A549 cells.Our results indicate that TBP-2 deficiency enhances TGF-β signaling and promotes TGF-β-induced EMT. The control of TGF-β-induced EMT is critical for the inhibition of the invasion and metastasis. Thus TBP-2, as a novel regulatory molecule of TGF-β signaling, is likely to be a prognostic indicator or a potential therapeutic target for preventing tumor progression.
DEFF Research Database (Denmark)
Kopp, Tine Iskov; Andersen, Vibeke; Tjonneland, Anne
2015-01-01
to assess whether polymorphisms in ABCB1, ABCC2 and ABCG2 were associated with risk of colorectal cancer (CRC) and to investigate gene-environment (dietary factors, smoking and use of non-steroidal anti-inflammatory drugs) and gene-gene interactions between previously studied polymorphisms in IL1B and IL10......The ATP-binding cassette (ABC) transporter family transports various molecules across the enterocytes in the gut protecting the intestine against potentially harmful substances. Moreover, ABC transporters are involved in mucosal immune defence through interaction with cytokines. The study aimed...... of the polymorphisms were associated with CRC, but ABCB1 and ABCG2 haplotypes were associated with risk of CRC. ABCB1/rs1045642 interacted with intake of cereals and fiber (p-Value for interaction (Pint) = 0.001 and 0.01, respectively). In a three-way analysis, both ABCB1/rs1045642 and ABCG2/rs2231137 in combination...
Acute fulminant drug induced necrotizing pancreatitis in a patient with ankylosing spondylitis
Directory of Open Access Journals (Sweden)
Pablo Miramontes
2015-03-01
Full Text Available Drug-induced acute necrotizing pancreatitis is a rare adverse event, although it has been reported in association with different drugs, including non-steroidal anti-inflammatory drugs, disease-modifying antirheumatic drugs, and analgesic agents commonly used in rheumatology. In different reviews of the pancreotoxicity of drugs, infliximab and etanercept are mentioned among all medications implicated in drug-induced pancreatitis, but clinical cases of acute pancreatitis complicating treatment with these anti-TNF-α agents have been exceptionally reported. We describe a patient with ankylosing spondylitis treated with etanercept, who developed an acute fulminant necrotizing pancreatitis that resulted in death. Doctors should pay close attention to patients taking biologic drugs in which a complaint of abdominal pain lasting for several days with no apparent cause may require a prompt referral for medical consultation.
Bell, R A; Kravitz, R L; Wilkes, M S
2000-04-01
We conducted a content analysis of consumer-targeted prescription drug advertisements to explore trends in prevalence, shifts in the medical conditions for which drugs are promoted, reliance on financial and nonmonetary inducements, and appeals used to attract public interest. We collected the drug advertisements appearing in 18 consumer magazines from 1989 through 1998. Two judges independently coded each advertisement and placed it in a category pertaining to the target audience, use of inducements, and product benefits (mean kappa=0.93). We employed descriptive statistics, cross-tabulations, and curve estimation procedures. A total of 320 distinct advertisements were identified, representing 101 brands and 14 medical conditions. New advertisement and brand introductions increased dramatically during this decade. Advertisements for drugs used for dermatologic, human immunodeficiency virus/acquired immune deficiency syndrome (HIV/AIDS), and obstetric/gynecologic conditions were most common. Almost all of the advertisements were aimed at the potential user of the drug, not third-party intermediaries such as parents and spouses. Although most advertisements were gender-neutral, women were more likely to be exclusively targeted. One eighth of the advertisements offered a monetary incentive (eg, a rebate or money-back guarantee), and one third made an offer of additional information in printed or audio/video form. The most common appeals used were effectiveness, symptom control, innovativeness, and convenience. Consumer-directed prescription drug advertising has increased dramatically during the past decade. The pharmaceutical industry is turning to this type of advertising to generate interest in its products. Our data may be useful to physicians who want to stay abreast of the treatments that are being directly marketed to their patients.
International Nuclear Information System (INIS)
Anjaria, K.B.; Shirsath, K.B.; Bhat, N.N.; Sreedevi, B.
2010-01-01
It has been reported that tumour-promoting agents potentiate a number of genetic events induced by initiating agents in vitro Iodoacetate (IA) is reported to be a tumour promoter of moderate potency and although to the best of our knowledge, tumour promoting ability of IA in animals has not been reported, a large number of studies have reported various types of effects of IA, which may result in tumour promotion. In this paper, the modifying effects of tumour promoter IA on radiation induced dicentrics in peripheral blood lymphocytes have been reported
Functionalized nanoparticles for AMF-induced gene and drug delivery
Biswas, Souvik
The properties and broad applications of nano-magnetic colloids have generated much interest in recent years. Specially, Fe3O4 nanoparticles have attracted a great deal of attention since their magnetic properties can be used for hyperthermia treatment or drug targeting. For example, enhanced levels of intracellular gene delivery can be achieved using Fe3O4 nano-vectors in the presence of an external magnetic field, a process known as 'magnetofection'. The low cytotoxicity, tunable particle size, ease of surface functionalization, and ability to generate thermal energy using an external alternating magnetic field (AMF) are properties have propelled Fe3O4 research to the forefront of nanoparticle research. The strategy of nanoparticle-mediated, AMF-induced heat generation has been used to effect intracellular hyperthermia. One application of this 'magnetic hyperthermia' is heat activated local delivery of a therapeutic effector (e.g.; drug or polynucleotide). This thesis describes the development of a magnetic nano-vector for AMF-induced, heat-activated pDNA and small molecule delivery. The use of heat-inducible vectors, such as heat shock protein ( hsp) genes, is a promising mode of gene therapy that would restrict gene expression to a local region by focusing a heat stimulus only at a target region. We thus aimed to design an Fe3O4 nanoparticle-mediated gene transfer vehicle for AMF-induced localized gene expression. We opted to use 'click' oximation techniques to assemble the magnetic gene transfer vector. Chapter 2 describes the synthesis, characterization, and transfection studies of the oxime ether lipid-based nano-magnetic vectors MLP and dMLP. The synthesis and characterization of a novel series of quaternary ammonium aminooxy reagents (2.1--2.4) is described. These cationic aminooxy compounds were loaded onto nanoparticles for ligation with carbonyl groups and also to impart a net positive charge on the nanoparticle surface. Our studies indicated that the
Comparison between two ovulation-inducing drugs in mares
Directory of Open Access Journals (Sweden)
Paula Cardoso de Almeida Silva
2016-11-01
Full Text Available ABSTRACT. Silva P.C.A., Oliveira J.P., Sá M.A.F., Paiva S.O., Caram D.F., Junqueira R.G.C. & Jacob J.C.F. [Comparison between two ovulation-inducing drugs in mares.] Comparação entre dois agentes indutores da ovulação em éguas. Revista Brasileira de Medicina Veterinária, 38(Supl.2:45-48, 2016. Departamento de Reprodução e Avaliação Animal, Instituto de Zootecnia, Universidade Federal Rural do Rio de Janeiro, BR-465, Km 7, Seropédica, RJ 23890-000, Brasil. E-mail: paulinha_calmeida@hotmail.com Hormonal control of the ovulation is an effective tool to improve reproductive performance and reduce costs in equine breeding programs. The aim of this study was to compare the efficiency of lower doses of hCG and Deslorelina than doses traditionally used, evaluating the follicular parameters and time between induction and ovulation. Induction of ovulation was performed according to the groups, 1000 IU of hCG (G1, 0.75mg of Deslorelin (G2, and 1.0ml of saline solution (G3. Twenty-four hours after administration, ovaries were evaluated by ultrasound every six hours until detection of ovulation. The percentage of ovulation within 36 hours was 34.4%, 13.3% and 8.7%, and up to 42 hours was 96.9%, 70% and 17.4% for G1, G2 and G3, respectively, showing a significant increase (p ˂ 0.0001 in G1 compared to other groups. In G2 there was a significant increase (p ˂ 0.0001 of ovulation after 42 hours from the induction, and G3 after 48 hours. Until 48 hours the percentage of induction of ovulation was 96.8% (31/32 90% (27/30 and 30.4% (7/23, respectively, for G1, G2 and G3. Thus, the lower doses of ovulation-inducing drugs were effective in inducing ovulation within 48 hours, however hCG was faster than deslorelin, which might reduce costs and help the reproduction management.
Devarbhavi, Harshad; Andrade, Raúl J
2014-05-01
Antimicrobial agents including antituberculosis (anti-TB) agents are the most common cause of idiosyncratic drug-induced liver injury (DILI) and drug-induced liver failure across the world. Better molecular and genetic biomarkers are acutely needed to help identify those at risk of liver injury particularly for those needing antituberculosis therapy. Some antibiotics such as amoxicillin-clavulanate and isoniazid consistently top the lists of agents in retrospective and prospective DILI databases. Central nervous system agents, particularly antiepileptics, account for the second most common class of agents implicated in DILI registries. Hepatotoxicity from older antiepileptics such as carbamazepine, phenytoin, and phenobarbital are often associated with hypersensitivity features, whereas newer antiepileptic drugs have a more favorable safety profile. Antidepressants and nonsteroidal anti-inflammatory drugs carry very low risk of significant liver injury, but their prolific use make them important causes of DILI. Early diagnosis and withdrawal of the offending agent remain the mainstays of minimizing hepatotoxicity. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.
Ishii, Misawa Niki; Yamamoto, Koji; Shoji, Masanobu; Asami, Asano; Kawamata, Yuji
2017-08-15
Accurate risk assessment for drug-induced seizure is expected to be performed before entering clinical studies because of its severity and fatal damage to drug development. Induced pluripotent stem cell (iPSC) technology has allowed the use of human neurons and glial cells in toxicology studies. Recently, several studies showed the advantage of co-culture system of human iPSC (hiPSC)-derived neurons with rodent/human primary astrocytes regarding neuronal functions. However, the application of hiPSC-derived neurons for seizure risk assessment has not yet been fully addressed, and not at all when co-cultured with hiPSC-derived astrocytes. Here, we characterized hiPSC-derived neurons co-cultured with hiPSC-derived astrocytes to discuss how hiPSC-derived neurons are useful to assess seizure risk of drugs. First, we detected the frequency of spikes and synchronized bursts hiPSC-derived neurons when co-cultured with hiPSC-derived astrocytes for 8 weeks. This synchronized burst was suppressed by the treatment with 6-cyano-7-nitroquinoxaline-2,3-dione, α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor antagonist, and D-(-)-2-amino-5-phosphonopentanoic acid, an N-Methyl-d-aspartate (NMDA) receptor antagonist. These data suggested that co-cultured hiPSC-derived neurons formed synaptic connections mediated by AMPA and NMDA receptors. We also demonstrated that co-cultured hiPSC-derived neurons showed epileptiform activity upon treatment with gabazine or kaliotoxin. Finally, we performed single-cell transcriptome analysis in hiPSC-derived neurons and found that hiPSC-derived astrocytes activated the pathways involved in the activities of AMPA and NMDA receptor functions, neuronal polarity, and axon guidance in hiPSC-derived neurons. These data suggested that hiPSC-derived astrocytes promoted the development of action potential, synaptic functions, and neuronal networks in hiPSC-derived neurons, and then these functional alterations result in the epileptiform
Directory of Open Access Journals (Sweden)
Tingling Joseph D
2005-09-01
Full Text Available Abstract Background The fetal cortical neuroepithelium is a mosaic of distinct progenitor populations that elaborate diverse cellular fates. Ethanol induces apoptosis and interferes with the survival of differentiating neurons. However, we know little about ethanol's effects on neuronal progenitors. We therefore exposed neurosphere cultures from fetal rat cerebral cortex, to varying ethanol concentrations, to examine the impact of ethanol on stem cell fate. Results Ethanol promoted cell cycle progression, increased neurosphere number and increased diversity in neurosphere size, without inducing apoptosis. Unlike controls, dissociated cortical progenitors exposed to ethanol exhibited morphological evidence for asymmetric cell division, and cells derived from ethanol pre-treated neurospheres exhibited decreased proliferation capacity. Ethanol significantly reduced the numbers of cells expressing the stem cell markers CD117, CD133, Sca-1 and ABCG2, without decreasing nestin expression. Furthermore, ethanol-induced neurosphere proliferation was not accompanied by a commensurate increase in telomerase activity. Finally, cells derived from ethanol-pretreated neurospheres exhibited decreased differentiation in response to retinoic acid. Conclusion The reduction in stem cell number along with a transient ethanol-driven increase in cell proliferation, suggests that ethanol promotes stem to blast cell maturation, ultimately depleting the reserve proliferation capacity of neuroepithelial cells. However, the lack of a concomitant change in telomerase activity suggests that neuroepithelial maturation is accompanied by an increased potential for genomic instability. Finally, the cellular phenotype that emerges from ethanol pre-treated, stem cell depleted neurospheres is refractory to additional differentiation stimuli, suggesting that ethanol exposure ablates or delays subsequent neuronal differentiation.
Tomasetti, M; Strafella, E; Staffolani, S; Santarelli, L; Neuzil, J; Guerrieri, R
2010-04-13
A strategy to reduce the secondary effects of anti-cancer agents is to potentiate the therapeutic effect by their combination. A combination of vitamin K3 (VK3) and ascorbic acid (AA) exhibited an anti-cancer synergistic effect, associated with extracellular production of H(2)O(2) that promoted cell death. The redox-silent vitamin E analogue alpha-tocopheryl succinate (alpha-TOS) was used in combination with VK3 and AA to evaluate their effect on prostate cancer cells. Prostate cancer cells were sensitive to alpha-TOS and VK3 treatment, but resistant to AA upto 3.2 mM. When combined, a synergistic effect was found for VK3-AA, whereas alpha-TOS-VK3 and alpha-TOS-AA combination showed an antagonist and additive effect, respectively. However, sub-lethal doses of AA-VK3 combination combined with a sub-toxic dose of alpha-TOS showed to induce efficient cell death that resembles autoschizis. Associated with this cell demise, lipid peroxidation, DNA damage, cytoskeleton alteration, lysosomal-mitochondrial perturbation, and release of cytochrome c without caspase activation were observed. Inhibition of lysosomal proteases did not attenuate cell death induced by the combined agents. Furthermore, cell deaths by apoptosis and autoschizis were detected. These finding support the emerging idea that synergistic combinations of some agents can overcome toxicity and other side-effects associated with high doses of single drugs creating the opportunity for therapeutically relevant selectivity.
2017-01-01
Non-steroidal anti-inflammatory drugs (NSAIDs) are a broad class of non glucocorticoid drugs which are extensively used in anti-inflammatory, analgesic, and antipyretic therapies. However, NSAIDs may cause many side effects, most commonly in gastrointestinal(GI) tract. Cardiovascular system, kidney, liver, central nervous system and hematopoietic system are also involved. NSAID-induced GI side effects not only endanger the patients' health, increase mortality, but also greatly increase the cost of medical care. Therefore, how to reduce GI side effects is of particular concern to clinicians. The Chinese Rheumatism Data Center(CRDC) and Chinese Systemic Lupus Erythematosus Treatment and Research Group(CSTAR) compose a "Recommendation for the prevention and treatment of non-steroidal anti-inflammatory drug-induced gastrointestinal ulcers and its complications" , as following: (1) GI lesions are the most common side effects of NSAIDs. (2) NSAID-induced GI side effects include gastritis, esophagitis, gastric and duodenal ulcers, bleeding, perforation and obstruction. (3) With the application of capsule endoscopy and small intestinal endoscopy, growing attention is being paid to the NASID-induced small intestine mucosa damage, which is mainly erosion and ulcer. (4) Risk factors related to NSAID-induced GI ulcers include: Helicobacter pylori (Hp) infection, age> 65 years, past history of GI ulcers, high doses of NSAIDs, multiple-drug combination therapy, and comorbidities, such as cardiovascular disease and nephropathy.(5) GI and cardiovascular function should be evaluated before using NSAIDs and gastric mucosal protective agents. (6) The risk of GI ulcers and complications caused by selective cyclooxygenase-2 (COX-2) inhibitors is less than that of non-selective COX-2 inhibitors. (7)Hp eradication therapy helps to cure GI ulcers and prevent recurrence when Hp infection is positive in NSAID-induced ulcers. (8) Proton pump inhibitor (PPI) is the first choice for the
Xu, Jiegou; Futakuchi, Mitsuru; Alexander, David B; Fukamachi, Katsumi; Numano, Takamasa; Suzui, Masumi; Shimizu, Hideo; Omori, Toyonori; Kanno, Jun; Hirose, Akihiko; Tsuda, Hiroyuki
2014-01-01
Zinc oxide (ZnO) is known to induce lung toxicity, including terminal bronchiolar epithelial hyperplasia, which gives rise to concerns that nanosized ZnO (nZnO) might lead to lung carcinogenesis. We studied the tumor promoting activity of nZnO by an initiation-promotion protocol using human c-Ha-ras proto-oncogene transgenic rats (Hras128 rats). The rats were given 0.2 % N-nitrosobis(2-hydroxypropyl)amine (DHPN) in the drinking water for 2 weeks and then treated with 0.5 ml of 250 or 500 μg/ml nZnO suspension by intra-pulmonary spraying once every 2 weeks for a total of 7 times. Treatment with nZnO particles did not promote DHPN-induced lung carcinogenesis. However, nZnO dose-dependently caused epithelial hyperplasia of terminal bronchioles (EHTB) and fibrosis-associated interstitial pneumonitis (FAIP) that were independent of DHPN treatment. Tracing the fate of EHTB lesions in wild-type rats indicated that the hyperplastic lesions almost completely disappeared within 12 weeks after the last nZnO treatment. Since nZnO particles were not found in the lung and ZnCl2 solution induced similar lung lesions and gene expression profiles, the observed lesions were most likely caused by dissolved Zn(2+). In summary, nZnO did not promote carcinogenesis in the lung and induced EHTB and FAIP lesions that regressed rapidly, probably due to clearance of surplus Zn(2+) from the lung.
Overcoming chemoresistance in pancreatic cancer cells: role of the bitter taste receptor T2R10.
Stern, Louisa; Giese, Nathalia; Hackert, Thilo; Strobel, Oliver; Schirmacher, Peter; Felix, Klaus; Gaida, Matthias M
2018-01-01
Bitter taste receptors (T2Rs) are G-protein coupled transmembrane proteins initially identified in the gustatory system as sensors for the taste of bitter. Recent evidence on expression of these receptors outside gustatory tissues suggested alternative functions, and there is growing interest of their potential role in cancer biology. In this study, we report for the first time, expression and functionality of the bitter receptor family member T2R10 in both human pancreatic ductal adenocarcinoma (PDAC) tissue and PDAC derived cell lines. Caffeine, a known ligand for T2R10, rendered the tumor cells more susceptible to two standard chemotherapeutics, Gemcitabine and 5-Fluoruracil. Knocking down T2R10 in the cell line BxPC-3 reduced the caffeine-induced effect. As possible underlying mechanism, we found that caffeine via triggering T2R10 inhibited Akt phosphorylation and subsequently downregulated expression of ABCG2, the so-called multi-drug resistance protein that participates in rendering cells resistant to a variety of chemotherapeutics. In conclusion, T2R10 is expressed in pancreatic cancer and it downmodulates the chemoresistance of the tumor cells.
Effect of nonsteroidal anti-inflammatory drugs on colorectal distension-induced visceral pain
Baskın, Veysel; Bilge, S. Sırrı; Bozkurt, Ayhan; Akyüz, Bahar; Ağrı, Arzu Erdal; Güzel, Hasan; İlkaya, Fatih
2016-01-01
Objectives: To investigate nonsteroidal anti-inflammatory drugs effectiveness in colorectal distension (CRD)-induced visceral pain model. Materials and Methods: Male Sprague–Dawley (250–300 g) rats were anesthetized with ketamine (50 mg/kg, intraperitoneally [i.p.]) and chlorpromazine (25 mg/kg, i.p.). Two bipolar Teflon-coated Ni/Cr wire electrodes (80-M diameter) were placed in the abdominal external oblique muscle for the recording of electromyography. Jugular vein catheter was placed for the administration of drugs. CRD method was applied to evaluate of visceral pain. All drugs (paracetamol, meloxicam, metamizole, and dexketoprofen) administered intravenously. Results: Paracetamol 200, 400, and 600 mg/kg did not change the visceromotor response (VMR) when compare with the control group. Meloxicam 2 and 4 mg/kg showed no effect but at doses of 6 mg/kg meloxicam significantly ([51.9 ± 6.4%] [P Dexketoprofen 2 and 4 mg/kg did not cause a change in VMR but 6 mg/kg dose significantly reduced response compared with the control group ([43.9 ± 3.9%, 36.8 ± 2.8%, 34.8 ± 2.5%, 42.1 ± 4.8%, 40.7 ± 3.5%, 36.4 ± 2.7%, and 26.1 ± 2.2%]; from 10 min to 70 min, respectively, [P dexketoprofen and meloxicam show antinociceptive effect with different duration of action on CRD-induced visceral pain model. This condition can be explained due to different chemical structures and different mechanisms which play a role in modulation of pain. PMID:27114637
Zhou, Shu; Li, Guo-Bo; Huang, Lu-Yi; Xie, Huan-Zhang; Zhao, Ying-Lan; Chen, Yu-Zong; Li, Lin-Li; Yang, Sheng-Yong
2014-08-01
Drug-induced ototoxicity, as a toxic side effect, is an important issue needed to be considered in drug discovery. Nevertheless, current experimental methods used to evaluate drug-induced ototoxicity are often time-consuming and expensive, indicating that they are not suitable for a large-scale evaluation of drug-induced ototoxicity in the early stage of drug discovery. We thus, in this investigation, established an effective computational prediction model of drug-induced ototoxicity using an optimal support vector machine (SVM) method, GA-CG-SVM. Three GA-CG-SVM models were developed based on three training sets containing agents bearing different risk levels of drug-induced ototoxicity. For comparison, models based on naïve Bayesian (NB) and recursive partitioning (RP) methods were also used on the same training sets. Among all the prediction models, the GA-CG-SVM model II showed the best performance, which offered prediction accuracies of 85.33% and 83.05% for two independent test sets, respectively. Overall, the good performance of the GA-CG-SVM model II indicates that it could be used for the prediction of drug-induced ototoxicity in the early stage of drug discovery. Copyright © 2014 Elsevier Ltd. All rights reserved.
Comparison of snoring sounds between natural and drug-induced sleep recorded using a smartphone.
Koo, Soo Kweon; Kwon, Soon Bok; Moon, Ji Seung; Lee, Sang Hoon; Lee, Ho Byung; Lee, Sang Jun
2018-08-01
Snoring is an important clinical feature of obstructive sleep apnea (OSA), and recent studies suggest that the acoustic quality of snoring sounds is markedly different in drug-induced sleep compared with natural sleep. However, considering differences in sound recording methods and analysis parameters, further studies are required. This study explored whether acoustic analysis of drug-induced sleep is useful as a screening test that reflects the characteristics of natural sleep in snoring patients. The snoring sounds of 30 male subjects (mean age=41.8years) were recorded using a smartphone during natural and induced sleep, with the site of vibration noted during drug-induced sleep endoscopy (DISE); then, we compared the sound intensity (dB), formant frequencies, and spectrograms of snoring sounds. Regarding the intensity of snoring sounds, there were minor differences within the retrolingual level obstruction group, but there was no significant difference between natural and induced sleep at either obstruction site. There was no significant difference in the F 1 and F 2 formant frequencies of snoring sounds between natural sleep and induced sleep at either obstruction site. Compared with natural sleep, induced sleep was slightly more irregular, with a stronger intensity on the spectrogram, but the spectrograms showed the same pattern at both obstruction sites. Although further studies are required, the spectrograms and formant frequencies of the snoring sounds of induced sleep did not differ significantly from those of natural sleep, and may be used as a screening test that reflects the characteristics of natural sleep according to the obstruction site. Copyright © 2017 Elsevier B.V. All rights reserved.
A high content screening assay to predict human drug-induced liver injury during drug discovery.
Persson, Mikael; Løye, Anni F; Mow, Tomas; Hornberg, Jorrit J
2013-01-01
Adverse drug reactions are a major cause for failures of drug development programs, drug withdrawals and use restrictions. Early hazard identification and diligent risk avoidance strategies are therefore essential. For drug-induced liver injury (DILI), this is difficult using conventional safety testing. To reduce the risk for DILI, drug candidates with a high risk need to be identified and deselected. And, to produce drug candidates without that risk associated, risk factors need to be assessed early during drug discovery, such that lead series can be optimized on safety parameters. This requires methods that allow for medium-to-high throughput compound profiling and that generate quantitative results suitable to establish structure-activity-relationships during lead optimization programs. We present the validation of such a method, a novel high content screening assay based on six parameters (nuclei counts, nuclear area, plasma membrane integrity, lysosomal activity, mitochondrial membrane potential (MMP), and mitochondrial area) using ~100 drugs of which the clinical hepatotoxicity profile is known. We find that a 100-fold TI between the lowest toxic concentration and the therapeutic Cmax is optimal to classify compounds as hepatotoxic or non-hepatotoxic, based on the individual parameters. Most parameters have ~50% sensitivity and ~90% specificity. Drugs hitting ≥2 parameters at a concentration below 100-fold their Cmax are typically hepatotoxic, whereas non-hepatotoxic drugs typically hit based on nuclei count, MMP and human Cmax, we identified an area without a single false positive, while maintaining 45% sensitivity. Hierarchical clustering using the multi-parametric dataset roughly separates toxic from non-toxic compounds. We employ the assay in discovery projects to prioritize novel compound series during hit-to-lead, to steer away from a DILI risk during lead optimization, for risk assessment towards candidate selection and to provide guidance of safe
International Nuclear Information System (INIS)
Sui Meihua; Zhang Hongfang; Di Xiaoyun; Chang Jinjia; Shen Youqing; Fan Weimin
2012-01-01
Background and purpose: We previously demonstrated that radiation may arrest tumor cells at G2 phase, which in turn prevents the cytotoxicity of antimicrotubule drugs and results in antagonistic interaction between these two modalities. Herein we tested whether G2 abrogators would attenuate the above antagonistic interaction and improve the therapeutic efficacy of combination therapy between radiation and antimicrotubule drugs. Materials and methods: Breast cancer BCap37 and epidermoid carcinoma KB cell lines were administered with radiation, UCN-01 (a model drug of G2 abrogator), paclitaxel or vincristine, alone or in combinations. The antitumor activities of single and combined treatments were analyzed by a series of cytotoxic, apoptotic, cell cycle, morphological and biochemical assays. Results: UCN-01 significantly enhanced the cytotoxicity of radiation, antimitotic drugs, and their combined treatments in vitro. Further investigations demonstrated that UCN-01 attenuated radiation-induced G2 arrest, and subsequently repressed the inhibitory effect of radiation on drug-induced mitotic arrest and apoptosis. Conclusions: This is the first report demonstrating that G2 checkpoint abrogation represses the inhibitory effect of radiation on antimicrotubule drugs, which may be implicated in cancer combination therapy. Considering that G2 abrogators are under extensive evaluation for cancer treatment, our findings provide valuable information for this class of promising compounds.
LENUS (Irish Health Repository)
McEneaney, Victoria
2010-01-01
Aldosterone elicits transcriptional responses in target tissues and also rapidly stimulates the activation of protein kinase signalling cascades independently of de novo protein synthesis. Here we investigated aldosterone-induced cell proliferation and extra-cellular regulated kinase 1 and 2 (ERK1\\/2) mitogen activated protein (MAP) kinase signalling in the M1 cortical collecting duct cell line (M1-CCD). Aldosterone promoted the proliferative growth of M1-CCD cells, an effect that was protein kinase D1 (PKD1), PKCdelta and ERK1\\/2-dependent. Aldosterone induced the rapid activation of ERK1\\/2 with peaks of activation at 2 and 10 to 30 min after hormone treatment followed by sustained activation lasting beyond 120 min. M1-CCD cells suppressed in PKD1 expression exhibited only the early, transient peaks in ERK1\\/2 activation without the sustained phase. Aldosterone stimulated the physical association of PKD1 with ERK1\\/2 within 2 min of treatment. The mineralocorticoid receptor (MR) antagonist RU28318 inhibited the early and late phases of aldosterone-induced ERK1\\/2 activation, and also aldosterone-induced proliferative cell growth. Aldosterone induced the sub-cellular redistribution of ERK1\\/2 to the nuclei at 2 min and to cytoplasmic sites, proximal to the nuclei after 30 min. This sub-cellular distribution of ERK1\\/2 was inhibited in cells suppressed in the expression of PKD1.
Whitefly and aphid inducible promoters from Arabidopsis thaliana L.
Indian Academy of Sciences (India)
Aphids, whitefly, inducible promoter, sap sucking insects, biotic stress. Whitefly and aphid ..... pathway related genes in cotton plants (Dubey et al. 2013). ... and coordination of work, data analysis and interpretation, and revised the article.
Directory of Open Access Journals (Sweden)
Tada T
2016-09-01
Full Text Available Tomoki Tada,1 Kensaku Aki,2 Wataru Oboshi,1,3 Kazuyoshi Kawazoe,4 Toshiyuki Yasui,5 Eiji Hosoi2 1Subdivision of Biomedical Laboratory Sciences, Graduate School of Health Sciences, Tokushima University, 2Department of Cells and Immunity Analytics, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, 3Department of Medical Technology, Kagawa Prefectural University of Health Sciences, Kagawa, 4Department of Clinical Pharmacy Practice Pedagogy, Institute of Biomedical Sciences, 5Department of Reproductive and Menopausal Medicine, Institute of Biomedical Sciences, Tokushima University Graduate School, Tokushima, Japan Background: The hyperfunction and activation of platelets have been strongly implicated in the development and recurrence of arterial occlusive disease, and various antiplatelet drugs are used to treat and prevent such diseases. New antiplatelet drugs and many other drugs have been developed, but some drugs may have adverse effects on platelet functions. Objective: The aim of this study was to establish an evaluation method for evaluating the effect and adverse effect of various drugs on platelet functions. Materials and methods: Human erythroid leukemia (HEL cells were used after megakaryocytic differentiation with phorbol 12-myristate 13-acetate as an alternative to platelets. Drugs were evaluated by changes in intracellular Ca2+ concentration ([Ca2+]i mobilization in Fura2-loaded phorbol 12-myristate 13-acetate-induced HEL cells. Aspirin and cilostazol were selected as antiplatelet drugs and ibuprofen and sodium valproate as other drugs. Results: There was a positive correlation between [Ca2+]i and platelet aggregation induced by thrombin. Aspirin (5.6–560 µM and cilostazol (5–10 µM significantly inhibited thrombin-induced increases in [Ca2+]i in a concentration-dependent manner. On the other hand, ibuprofen (8–200 µM and sodium valproate (50–1,000 µg/mL also significantly inhibited
Directory of Open Access Journals (Sweden)
Onat Kadioglu
2018-04-01
Full Text Available Drug resistance is one of the main reasons of chemotherapy failure. Therefore, overcoming drug resistance is an invaluable approach to identify novel anticancer drugs that have the potential to bypass or overcome resistance to established drugs and to substantially increase life span of cancer patients for effective chemotherapy. Oridonin is a cytotoxic diterpenoid isolated from Rabdosia rubescens with in vivo anticancer activity. In the present study, we evaluated the cytotoxicity of oridonin toward a panel of drug-resistant cancer cells overexpressing ABCB1, ABCG2, or ΔEGFR or with a knockout deletion of TP53. Interestingly, oridonin revealed lower degree of resistance than the control drug, doxorubicin. Molecular docking analyses pointed out that oridonin can interact with Akt/EGFR pathway proteins with comparable binding energies and similar docking poses as the known inhibitors. Molecular dynamics results validated the stable conformation of oridonin docking pose on Akt kinase domain. Western blot experiments clearly revealed dose-dependent downregulation of Akt and STAT3. Pharmacogenomics analyses pointed to a mRNA signature that predicted sensitivity and resistance to oridonin. In conclusion, oridonin bypasses major drug resistance mechanisms and targets Akt pathway and might be effective toward drug refractory tumors. The identification of oridonin-specific gene expressions may be useful for the development of personalized treatment approaches.
Machine learning-based prediction of adverse drug effects: An example of seizure-inducing compounds
Directory of Open Access Journals (Sweden)
Mengxuan Gao
2017-02-01
Full Text Available Various biological factors have been implicated in convulsive seizures, involving side effects of drugs. For the preclinical safety assessment of drug development, it is difficult to predict seizure-inducing side effects. Here, we introduced a machine learning-based in vitro system designed to detect seizure-inducing side effects. We recorded local field potentials from the CA1 alveus in acute mouse neocortico-hippocampal slices, while 14 drugs were bath-perfused at 5 different concentrations each. For each experimental condition, we collected seizure-like neuronal activity and merged their waveforms as one graphic image, which was further converted into a feature vector using Caffe, an open framework for deep learning. In the space of the first two principal components, the support vector machine completely separated the vectors (i.e., doses of individual drugs that induced seizure-like events and identified diphenhydramine, enoxacin, strychnine and theophylline as “seizure-inducing” drugs, which indeed were reported to induce seizures in clinical situations. Thus, this artificial intelligence-based classification may provide a new platform to detect the seizure-inducing side effects of preclinical drugs.
Directory of Open Access Journals (Sweden)
Hua Sun
2012-01-01
Full Text Available Bicyclol, an antihepatitis drug developed by Chinese scientists, has been shown to prevent the malignant transformation induced by 3-methylcholanthrene and 12-O-tetradecanoylphorbol-13-acetate in WB-F344 rat liver epithelial cells. This study provides further evidence on its role as a chemopreventive agent in experimental mice with diethylnitrosamine- (DEN- initiated and phenobarbital- (PB- promoted liver carcinoma. Liver tissue and serum were collected. In the two-stage model of hepatocarcinogenesis in mice, oral administration of bicyclol (100, 200 mg/kg before DEN injection showed significant reduction in the incidence of hepatocellular foci, nodules, or carcinoma. Histopathological examination revealed that there was no hepatocellular carcinoma (HCC and hepatoma formation in the mice pretreated with bicyclol (200 mg/kg at week 20, while the mice treated with DEN/PB developed 33.3% HCC and 55.6% hepatoma. Furthermore, the serum levels of alanine aminotransferase (ALT, alkaline phosphatase (ALP, and α-fetal protein (AFP in serum significantly increased in the DEN/PB model group in comparison with the control group. Pretreatment with bicyclol showed a marked reduction in the above condition. Bicyclol also decreased the expression of AFP and proliferating cell nuclear antigen level in the liver tissue and attenuated the decrease in body weight. In this study, we also found that 10 weeks after stopping the administration of PB and drugs, the control and bicyclol-treated (200 mg/kg animals showed no HCC and hepatoma formation at the time of termination whereas DEN/PB-induced mice developed 100% hepatoma and 50% HCC. These results further indicate that bicyclol has the chemopreventive potential for liver carcinogenesis induced by carcinogens.
Ishimaru, Naoto; Ohnishi, Hisashi; Nishiuma, Teruaki; Doukuni, Ryota; Umezawa, Kanoko; Oozone, Sachiko; Kuramoto, Emi; Yoshimura, Sho; Kinami, Saori
2013-01-01
Streptococcus pneumoniae is a rare pathogen of sepsis in patients with antithyroid drug-induced agranulocytosis. We herein describe a case of antithyroid drug-induced agranulocytosis complicated by pneumococcal sepsis and upper airway obstruction. A 27-year-old woman who was previously prescribed methimazole for nine months presented with a four-day history of a sore throat. She nearly choked and was diagnosed with febrile agranulocytosis. She was successfully treated with intubation, intravenous antibiotics and granulocyte colony-stimulating factor. Her blood cultures yielded S. pneumoniae. Emergency airway management, treatment of sepsis and the administration of granulocyte colony-stimulating factor can improve the clinical course of antithyroid drug-induced pneumococcal sepsis in patients with airway obstruction.
Pancreatic stellate cells enhance stem cell-like phenotypes in pancreatic cancer cells
International Nuclear Information System (INIS)
Hamada, Shin; Masamune, Atsushi; Takikawa, Tetsuya; Suzuki, Noriaki; Kikuta, Kazuhiro; Hirota, Morihisa; Hamada, Hirofumi; Kobune, Masayoshi; Satoh, Kennichi; Shimosegawa, Tooru
2012-01-01
Highlights: ► Pancreatic stellate cells (PSCs) promote the progression of pancreatic cancer. ► Pancreatic cancer cells co-cultured with PSCs showed enhanced spheroid formation. ► Expression of stem cell-related genes ABCG2, Nestin and LIN28 was increased. ► Co-injection of PSCs enhanced tumorigenicity of pancreatic cancer cells in vivo. ► This study suggested a novel role of PSCs as a part of the cancer stem cell niche. -- Abstract: The interaction between pancreatic cancer cells and pancreatic stellate cells (PSCs), a major profibrogenic cell type in the pancreas, is receiving increasing attention. There is accumulating evidence that PSCs promote the progression of pancreatic cancer by increasing cancer cell proliferation and invasion as well as by protecting them from radiation- and gemcitabine-induced apoptosis. Recent studies have identified that a portion of cancer cells, called “cancer stem cells”, within the entire cancer tissue harbor highly tumorigenic and chemo-resistant phenotypes, which lead to the recurrence after surgery or re-growth of the tumor. The mechanisms that maintain the “stemness” of these cells remain largely unknown. We hypothesized that PSCs might enhance the cancer stem cell-like phenotypes in pancreatic cancer cells. Indirect co-culture of pancreatic cancer cells with PSCs enhanced the spheroid-forming ability of cancer cells and induced the expression of cancer stem cell-related genes ABCG2, Nestin and LIN28. In addition, co-injection of PSCs enhanced tumorigenicity of pancreatic cancer cells in vivo. These results suggested a novel role of PSCs as a part of the cancer stem cell niche.
Drug-Induced Hypothermia as Beneficial Treatment before and after Cerebral Ischemia
DEFF Research Database (Denmark)
Johansen, Flemming F; Hasseldam, Henrik; Rasmussen, Rune Skovgaard
2014-01-01
Objectives: Hypothermia is still unproven as beneficial treatment in human stroke, although in animal models, conditioning the brain with hypothermia has induced tolerance to insults. Here, we delineate the feasibility of drug-induced mild hypothermia in reducing ischemic brain damage when...... conditioning before (preconditioning) and after (postconditioning) experimental stroke. Methods: Hypothermia was induced in rats with a bolus of 6 mg/kg talipexole followed by 20 h continuous talipexole infusion of 6 mg/kg in total. Controls received similar treatment with saline. The core body temperature...... was continuously monitored. In preconditioning, hypothermia was terminated before either reversible occlusion of the middle cerebral artery (MCAO) for 60 min or global ischemia for 10 min with 2-vessel occlusion and hypotension. In postconditioning, rats experienced 60 min of MCAO before hypothermia was induced...
Directory of Open Access Journals (Sweden)
Gabriel Uche Pascal Iloh
2017-01-01
Full Text Available Background: Pharmaceutical drug promotion is an important component of pharmaceutical care and is one of the factors that may lead to unethical drug prescriptions. As the impetus for rational drug use grows, emphasis should also be focused on prescribing behaviors of physicians, particularly in resource-poor settings. Aim: The study was aimed at describing the influence of drug promotion by pharmaceutical sales representatives (PSRs on the prescribing behaviors of medical practitioners in Abia State, Nigeria. Materials and Methods: A descriptive study was carried out on a cross-section of 185 medical practitioners in Abia State, Nigeria. Data collection was done using a pretested, self-administered questionnaire that elicits information on practice and attitude to drug promotion, types of incentives, frequency of visits, drug promotion methods and information, sources of drug information, and awareness of code of regulation on drug promotion. Results: The age of the participants ranged from 28 to 71 years. There were 166 males and 19 females. The prescribing practices of 47.6% of the medical practitioners were influenced by drug promotion and 66.5% of them had positive attitude to drug promotion. One hundred and sixty-four (88.6% were visited >12 times in the previous year. The most common incentive received was branded stationeries (100.0%; predominant drug promotional method and information were in-person clinic encounter (100.0% and brand names of the drugs (100.0%, respectively. The most common source of drug information was calling a colleague/pharmacist (93.5% while 84.9% of the respondents were aware of code of regulation on drug promotion. The prescribing practice (P = 0.041 and attitude (P = 0.032 to drug promotion were significantly associated with working in public hospitals. Conclusion: Drug promotion by PSRs influenced prescribing practices of medical practitioners with 66.5% of them having positive attitude to drug promotion. The
Promoter motifs required for c-mpl gene expression induced by thrombopoietin in CMK cells.
Sunohara, Masataka; Sato, Iwao; Morikawa, Shigeru
2017-11-30
Thrombopoietin (TPO) and its receptor, c-Mpl, are the central regulators of megakaryocyte development and platelet production and are also crucial to regulate megakaryocytopoiesis. TPO remarkably elevated c-mpl promoter activity, while the protein kinase C (PKC) inhibitors, GF109203, H7 and Calphostin C, clearly reduced the steady level of its promoter activity. In the present study, motifs crucial for c-mpl promoter activity induced by TPO treatment have been analyzed using a human megakaryoblastic cell line, CMK. Destruction of the -107Sp1 and the -57Sp1 sites in the c-mpl promoter enhancer region resulted in decrease of the promoter activity by 53.1% and 64.4%, respectively, and destruction of -69Ets and -28Ets elements dramatically decreased the promoter activity by 96.4% and 87.8%, respectively, while mutation of -77GATA moderately reduced the activity by 31.4%. The result was in agreement with our previous report that showed the crucial motifs in the c-mpl promoter for the promoter activity induced by PMA-treatment. This indicates that TPO-induced activation of the c-mpl promoter activity is fully modulated by transcription through a PKC-dependent pathway and the two Sp1 and two Ets motifs are crucial for the activation of the c-mpl promoter activity rather than a GATA motif in the c-mpl promoter of CMK cells.
Natural Rewards, Neuroplasticity, and Non-Drug Addictions
Olsen, Christopher M.
2011-01-01
There is a high degree of overlap between brain regions involved in processing natural rewards and drugs of abuse. “Non-drug” or “behavioral” addictions have become increasingly documented in the clinic, and pathologies include compulsive activities such as shopping, eating, exercising, sexual behavior, and gambling. Like drug addiction, non-drug addictions manifest in symptoms including craving, impaired control over the behavior, tolerance, withdrawal, and high rates of relapse. These alterations in behavior suggest that plasticity may be occurring in brain regions associated with drug addiction. In this review, I summarize data demonstrating that exposure to non-drug rewards can alter neural plasticity in regions of the brain that are affected by drugs of abuse. Research suggests that there are several similarities between neuroplasticity induced by natural and drug rewards and that, depending on the reward, repeated exposure to natural rewards might induce neuroplasticity that either promotes or counteracts addictive behavior. PMID:21459101
Directory of Open Access Journals (Sweden)
Min Li
2017-06-01
Full Text Available Human induced pluripotent stem cell (hiPSC-derived cardiomyocytes hold great potentials to predict pro-arrhythmic risks in preclinical cardiac safety screening, although the hiPSC cardiomyocytes exhibit rather immature functional and structural characteristics, including spontaneous activity. Our physiological characterization and mathematical simulation showed that low expression of the inward-rectifier potassium (IK1 channel is a determinant of spontaneous activity. To understand impact of the low IK1 expression on the pharmacological properties, we tested if transduction of hiPSC-derived cardiomyocytes with KCNJ2, which encodes the IK1 channel, alters pharmacological response to cardiac repolarization processes. The transduction of KCNJ2 resulted in quiescent hiPSC-derived cardiomyocytes, which need pacing to elicit action potentials. Significant prolongation of paced action potential duration in KCNJ2-transduced hiPSC-derived cardiomyocytes was stably measured at 0.1 μM E-4031, although the same concentration of E-4031 ablated firing of non-treated hiPSC-derived cardiomyocytes. These results in single cells were confirmed by mathematical simulations. Using the hiPSC-derived cardiac sheets with KCNJ2-transduction, we also investigated effects of a range of drugs on field potential duration recorded at 1 Hz. The KCNJ2 overexpression in hiPSC-derived cardiomyocytes may contribute to evaluate a part of QT-prolonging drugs at toxicological concentrations with high accuracy.
Induction of NFATc2 expression by interleukin 6 promotes T helper type 2 differentiation.
Diehl, Sean; Chow, Chi-Wing; Weiss, Linda; Palmetshofer, Alois; Twardzik, Thomas; Rounds, Laura; Serfling, Edgar; Davis, Roger J; Anguita, Juan; Rincón, Mercedes
2002-07-01
Interleukin (IL)-6 is produced by professional antigen-presenting cells (APCs) such as B cells, macrophages, and dendritic cells. It has been previously shown that APC-derived IL-6 promotes the differentiation of naive CD4+ T cells into effector T helper type 2 (Th2) cells. Here, we have studied the molecular mechanism for IL-6-mediated Th2 differentiation. During the activation of CD4+ T cells, IL-6 induces the production of IL-4, which promotes the differentiation of these cells into effector Th2 cells. Regulation of IL-4 gene expression by IL-6 is mediated by nuclear factor of activated T cells (NFAT), as inhibition of NFAT prevents IL-6-driven IL-4 production and Th2 differentiation. IL-6 upregulates NFAT transcriptional activity by increasing the levels of NFATc2. The ability of IL-6 to promote Th2 differentiation is impaired in CD4+ T cells that lack NFATc2, demonstrating that NFATc2 is required for regulation of IL-4 gene expression by IL-6. Regulation of NFATc2 expression and NFAT transcriptional activity represents a novel pathway by which IL-6 can modulate gene expression.
Khurana, Surender; Loving, Crystal L; Manischewitz, Jody; King, Lisa R; Gauger, Phillip C; Henningson, Jamie; Vincent, Amy L; Golding, Hana
2013-08-28
Vaccine-induced disease enhancement has been described in connection with several viral vaccines in animal models and in humans. We investigated a swine model to evaluate mismatched influenza vaccine-associated enhanced respiratory disease (VAERD) after pH1N1 infection. Vaccinating pigs with whole inactivated H1N2 (human-like) virus vaccine (WIV-H1N2) resulted in enhanced pneumonia and disease after pH1N1 infection. WIV-H1N2 immune sera contained high titers of cross-reactive anti-pH1N1 hemagglutinin (HA) antibodies that bound exclusively to the HA2 domain but not to the HA1 globular head. No hemagglutination inhibition titers against pH1N1 (challenge virus) were measured. Epitope mapping using phage display library identified the immunodominant epitope recognized by WIV-H1N2 immune sera as amino acids 32 to 77 of pH1N1-HA2 domain, close to the fusion peptide. These cross-reactive anti-HA2 antibodies enhanced pH1N1 infection of Madin-Darby canine kidney cells by promoting virus membrane fusion activity. The enhanced fusion activity correlated with lung pathology in pigs. This study suggests a role for fusion-enhancing anti-HA2 antibodies in VAERD, in the absence of receptor-blocking virus-neutralizing antibodies. These findings should be considered during the evaluation of universal influenza vaccines designed to elicit HA2 stem-targeting antibodies.
Maniwa, Yasuhisa; Kasukabe, Takashi; Kumakura, Shunichi
2015-08-01
Although all-trans retinoic acid (ATRA) is a standard and effective drug used for differentiation therapy in acute promyelocytic leukemia, ATRA-resistant leukemia cells ultimately emerge during this treatment. Therefore, the development of new drugs or effective combination therapy is urgently needed. We demonstrate that the combined treatment of vitamin K2 and cotylenin A synergistically induced monocytic differentiation in HL-60 cells. This combined treatment also synergistically induced NBT-reducing activity and non-specific esterase-positive cells as well as morphological changes to monocyte/macrophage-like cells. Vitamin K2 and cotylenin A cooperatively inhibited the proliferation of HL-60 cells in short-term and long-term cultures. This treatment also induced growth arrest at the G1 phase. Although 5 µg/ml cotylenin A or 5 µM vitamin K2 alone reduced c-MYC gene expression in HL-60 cells to approximately 45% or 80% that of control cells, respectively, the combined treatment almost completely suppressed c-MYC gene expression. We also demonstrated that the combined treatment of vitamin K2 and cotylenin A synergistically induced the expression of cyclin G2, which had a positive effect on the promotion and maintenance of cell cycle arrest. These results suggest that the combination of vitamin K2 and cotylenin A has therapeutic value in the treatment of acute myeloid leukemia.
Directory of Open Access Journals (Sweden)
Meng Yang
2017-11-01
Full Text Available Background/Aims: Vascular endothelial growth factor (VEGF has been demonstrated to play a pivotal role in the regulation of angiogenesis in ovarian follicular development, particularly during the preovulatory period. Although numerous studies have shown that interleukin-6 (IL-6 is one of the major inducing factors that regulate the expression of VEGF in non-ovarian cells, whether it involved in regulating the expression of VEGF in normal ovarian granulosa cells is still unknown. The aim of this study was to elucidate the mechanisms underlying the effect of IL-6 on FSH-induced VEGF expression in bovine granulosa cells derived from large follicles. Methods: VEGF mRNA expression in granulosa cells after IL-6 with/without inhibitors treatment was analyzed by RT-qPCR. Phosphorylation levels of ERK1/2 and STAT3 proteins induced by IL-6 were analyzed by western blotting. The protein levels produced by granulosa cells were detected by ELISA. Results: High concentration of IL-6 (10ng/ml can significantly up-regulate FSH-induced VEGF gene and protein expression levels in granulosa cells, and also promote the VEGF upstream regulators HIF-1α and COX2 mRNA expression. VEGF expression levels were significantly decreased after specifically blocking HIF-1α and COX2 by using inhibitors. The up-regulation effect of IL-6 on FSH-induced VEGF expression in granulosa cells mainly through activating the JAK/STAT3 signaling pathway, which can be impaired by JAK inhibitors. Conclusion: IL-6 can promote FSH-induced VEGF expression in granulosa cells, which is mainly achieved by increasing the expression of HIF-1α and COX2.This promoting effect is mediated by activating the JAK/STAT3 pathway. Moreover, there may be a synergistic relationship between FSH and IL-6 in the regulation of VEGF expression.
Drug–drug interaction of microdose and regular-dose omeprazole with a CYP2C19 inhibitor and inducer
Park, Gab-jin; Bae, Soo Hyeon; Park, Wan-Su; Han, Seunghoon; Park, Min-Ho; Shin, Seok-Ho; Shin, Young G; Yim, Dong-Seok
2017-01-01
Purpose A microdose drug–drug interaction (DDI) study may be a valuable tool for anticipating drug interaction at therapeutic doses. This study aimed to compare the magnitude of DDIs at microdoses and regular doses to explore the applicability of a microdose DDI study. Patients and methods Six healthy male volunteer subjects were enrolled into each DDI study of omeprazole (victim) and known perpetrators: fluconazole (inhibitor) and rifampin (inducer). For both studies, the microdose (100 μg, cold compound) and the regular dose (20 mg) of omeprazole were given at days 0 and 1, respectively. On days 2–9, the inhibitor or inducer was given daily, and the microdose and regular dose of omeprazole were repeated at days 8 and 9, respectively. Full omeprazole pharmacokinetic samplings were performed at days 0, 1, 8, and 9 of both studies for noncompartmental analysis. Results The magnitude of the DDI, the geometric mean ratios (with perpetrator/omeprazole only) of maximum concentration (Cmax) and area under the curve to the last measurement (AUCt) of the microdose and the regular dose were compared. The geometric mean ratios in the inhibition study were: 2.17 (micro) and 2.68 (regular) for Cmax, and 4.07 (micro), 4.33 (regular) for AUCt. For the induction study, they were 0.26 (micro) and 0.21 (regular) for Cmax, and 0.16 (micro) and 0.15 (regular) for AUCt. There were no significant statistical differences in the magnitudes of DDIs between microdose and regular-dose conditions, regardless of induction or inhibition. Conclusion Our results may be used as partial evidence that microdose DDI studies may replace regular-dose studies, or at least be used for DDI-screening purposes. PMID:28408803
Drug induced hypertension--An unappreciated cause of secondary hypertension.
Grossman, Alon; Messerli, Franz H; Grossman, Ehud
2015-09-15
Most patients with hypertension have essential hypertension or well-known forms of secondary hypertension, such as renal disease, renal artery stenosis, or common endocrine diseases (hyperaldosteronism or pheochromocytoma). Physicians are less aware of drug induced hypertension. A variety of therapeutic agents or chemical substances may increase blood pressure. When a patient with well controlled hypertension is presented with acute blood pressure elevation, use of drug or chemical substance which increases blood pressure should be suspected. Drug-induced blood pressure increases are usually minor and short-lived, although rare hypertensive emergencies associated with use of certain drugs have been reported. Careful evaluation of prescription and non-prescription medications is crucial in the evaluation of the hypertensive individual and may obviate the need for expensive and unnecessary evaluations. Discontinuation of the offending agent will usually achieve adequate blood pressure control. When use of a chemical agent which increases blood pressure is mandatory, anti-hypertensive therapy may facilitate continued use of this agent. We summarize the therapeutic agents or chemical substances that elevate blood pressure and their mechanisms of action. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
D’Urzo Nunzia
2013-02-01
Full Text Available Abstract Background In past years research has focused on the development of alternative Gram positive bacterial expression systems to produce industrially relevant proteins. Brevibacillus choshinensis is an easy to handle non-sporulating bacterium, lacking extracellular proteases, that has been already shown to provide a high level of recombinant protein expression. One major drawback, limiting the applicability of the Brevibacillus expression system, is the absence of expression vectors based on inducible promoters. Here we used the PxylA inducible promoter, commonly employed in other Bacillae expression systems, in Brevibacillus. Results Using GFP, α-amylase and TcdA-GT as model proteins, high level of intracellular protein expression (up to 250 mg/L for the GFP was achieved in Brevibacillus, using the pHis1522 vector carrying the B. megaterium xylose-inducible promoter (PxylA. The GFP expression yields were more than 25 fold higher than those reported for B. megaterium carrying the same vector. All the tested proteins show significant increment in their expression levels (2-10 folds than those obtained using the available plasmids based on the P2 constitutive promoter. Conclusion Combining the components of two different commercially available Gram positive expression systems, such as Brevibacillus (from Takara Bio and B. megaterium (from Mobitec, we demonstrate that vectors based on the B. megaterium PxylA xylose inducible promoter can be successfully used to induce high level of intracellular expression of heterologous proteins in Brevibacillus.
Bahar, Muh Akbar; Setiawan, Didik; Hak, Eelko; Wilffert, Bob
2017-05-01
Currently, most guidelines on drug-drug interaction (DDI) neither consider the potential effect of genetic polymorphism in the strength of the interaction nor do they account for the complex interaction caused by the combination of DDI and drug-gene interaction (DGI) where there are multiple biotransformation pathways, which is referred to as drug-drug-gene interaction (DDGI). In this systematic review, we report the impact of pharmacogenetics on DDI and DDGI in which three major drug-metabolizing enzymes - CYP2C9, CYP2C19 and CYP2D6 - are central. We observed that several DDI and DDGI are highly gene-dependent, leading to a different magnitude of interaction. Precision drug therapy should take pharmacogenetics into account when drug interactions in clinical practice are expected.
Drug-Induced Vasculitis: New Insights and a Changing Lineup of Suspects.
Grau, Rafael G
2015-12-01
An increasing number of therapeutic agents have been associated with a vasculitic syndrome. This usually involves small vessels, primarily capillaries, venules, and arterioles in leukocytoclastic vasculitis, small-vessel disease similar to an antineutrophil cytoplasmic antibody-related vasculitis, or mid-sized muscular arteries in a polyarteritis-like picture. Antineutrophil cytoplasmic antibodies are present in many cases of vasculitis regardless of the size of the vessel involved. Monoclonal antibodies used to treat many autoimmune disorders have become the most common agents associated with drug-induced vasculitis. Important advances in epigenetics, genetics, and neutrophil apoptosis are providing new insights into the pathogenesis of both drug-induced vasculitis and idiopathic vasculitis. Although management has not changed significantly in the past few years where withdrawal of the offending agent is the primary intervention, increasing awareness of drug-induced vasculitis can lead to earlier diagnosis and prevention of severe organ damage and fatalities.
Effectiveness of malic acid 1% in patients with xerostomia induced by antihypertensive drugs
Guardia, Javier; Aguilar-Salvatierra, Antonio; Cabrera-Ayala, Maribel; Maté-Sánchez de-Val, José E.; Calvo-Guirado, José L.
2013-01-01
Objectives: Assessing the clinical effectiveness of a topical sialogogue on spray (malic acid, 1%) in the treatment of xerostomia induced by antihypertensive drugs. Study Design: This research has been carried out through a randomized double-blind clinical trial. 45 patients suffering from hypertensive drugs-induced xerostomia were divided into 2 groups: the first group (25 patients) received a topical sialogogue on spray (malic acid, 1%) whereas the second group (20 patients) received a placebo. Both of them were administered on demand for 2 weeks. Dry Mouth Questionnaire (DMQ) was used in order to evaluate xerostomia levels before and after product/placebo application. Unstimulated and stimulated salivary flows rates, before and after application, were measured. All the statistical analyses were performed by using SPSS software v17.0. Different DMQ scores at the earliest and final stage of the trial were analysed by using Mann-Whitney U test, whereas Student’s T-test was used to analyse salivary flows. Critical p-value was established at p0.05) after placebo application. After two weeks of treatment with malic acid, unstimulated salivary flow increased from 0.17 to 0.242 mL/min whereas the stimulated one increased from 0.66 to 0.92 mL/min (p0.05). Conclusions: Malic acid 1% spray improved antihypertensive-induced xerostomia and stimulated the production of saliva. Key words:Xerostomia, hyposialia, malic acid, antihypertensive drugs. PMID:22926481
Drug induced exocytosis of glycogen in Pompe disease.
Turner, Christopher T; Fuller, Maria; Hopwood, John J; Meikle, Peter J; Brooks, Doug A
2016-10-28
Pompe disease is caused by a deficiency in the lysosomal enzyme α-glucosidase, and this leads to glycogen accumulation in the autolysosomes of patient cells. Glycogen storage material is exocytosed at a basal rate in cultured Pompe cells, with one study showing up to 80% is released under specific culture conditions. Critically, exocytosis induction may reduce glycogen storage in Pompe patients, providing the basis for a therapeutic strategy whereby stored glycogen is redirected to an extracellular location and subsequently degraded by circulating amylases. The focus of the current study was to identify compounds capable of inducing rapid glycogen exocytosis in cultured Pompe cells. Here, calcimycin, lysophosphatidylcholine and α-l-iduronidase each significantly increased glycogen exocytosis compared to vehicle-treated controls. The most effective compound, calcimycin, induced exocytosis through a Ca 2+ -dependent mechanism, although was unable to release a pool of vesicular glycogen larger than the calcimycin-induced exocytic pore. There was reduced glycogen release from Pompe compared to unaffected cells, primarily due to increased granule size in Pompe cells. Drug induced exocytosis therefore shows promise as a therapeutic approach for Pompe patients but strategies are required to enhance the release of large molecular weight glycogen granules. Copyright © 2016. Published by Elsevier Inc.
Drug-induced hypersensitivity syndrome with human herpesvirus-6 reactivation
Directory of Open Access Journals (Sweden)
Najeeba Riyaz
2012-01-01
Full Text Available A 45-year-old man, on carbamazepine for the past 3 months, was referred as a case of atypical measles. On examination, he had high-grade fever, generalized itchy rash, cough, vomiting and jaundice. A provisional diagnosis of drug hypersensitivity syndrome to carbamazepine was made with a differential diagnosis of viral exanthema with systemic complications. Laboratory investigations revealed leukocytosis with eosnophilia and elevated liver enzymes. Real-time multiplex polymerase chain reaction (PCR on throat swab and blood was suggestive of human herpesvirus-6 (HHV-6. Measles was ruled out by PCR and serology. The diagnosis of drug-induced hypersensitivity syndrome (DIHS was confirmed, which could explain all the features manifested by the patient. HHV-6 infects almost all humans by age 2 years. It infects and replicates in CD4 T lymphocytes and establishes latency in human peripheral blood monocytes or macrophages and early bone marrow progenitors. In DIHS, allergic reaction to the causative drug stimulates T cells, which leads to reactivation of the herpesvirus genome. DIHS is treated by withdrawal of the culprit drug and administration of systemic steroids. Our patient responded well to steroids and HHV-6 was negative on repeat real-time multiplex PCR at the end of treatment.
International Nuclear Information System (INIS)
Kunz, B.A.; Hannan, M.A.; Haynes, R.H.
1980-01-01
Recently, it has been suggested that mitotic recombination is involved in tumor promotion. On this basis, one might expect tumor promoters to be recombinagenic. D7 is a diploid strain of yeast in which both mutation and mitotic recombination can be measured. We have used this strain to assay the known tumor promoters, iodacetate, anthralin, and 12-0-tetradecanoylphorbol-13-acetate, and the cocarcinogen, catechol, for mutagenicity, recombinagenicity, and the ability to enhance ultraviolet light (UV)-induced genetic events. In the absence of preirradiation with UV, iodoacetate was found to be recombinagenic whereas catechol was mutagenic; however, in both cases, the effects were small. Iodoacetate, anthralin, and catechol potentiated UV-induced mitotic crossing-over, aberrant colony formation, and mutation, while catechol also increased UV-induced gene conversion. We were unable to detect any mutagenic or recombinagenic effect of 12-0-tetradecanoyl-phorbol-13-acetate in either whole cells or spheroplasts. Our results do not indicate any consistent correlation between tumor-promoting activity and the ability of an agent to induce mitotic recombination in yeast. However, the ability to potentiate UV-induced mutation and mitotic recombination may reflect the cocarcinogenic activity of certain promoters
Su, Yu-Wen; Chung, Rosa; Ruan, Chun-Sheng; Chim, Shek Man; Kuek, Vincent; Dwivedi, Prem P; Hassanshahi, Mohammadhossein; Chen, Ke-Ming; Xie, Yangli; Chen, Lin; Foster, Bruce K; Rosen, Vicki; Zhou, Xin-Fu; Xu, Jiake; Xian, Cory J
2016-06-01
Injured growth plate is often repaired by bony tissue causing bone growth defects, for which the mechanisms remain unclear. Because neurotrophins have been implicated in bone fracture repair, here we investigated their potential roles in growth plate bony repair in rats. After a drill-hole injury was made in the tibial growth plate and bone, increased injury site mRNA expression was observed for neurotrophins NGF, BDNF, NT-3, and NT-4 and their Trk receptors. NT-3 and its receptor TrkC showed the highest induction. NT-3 was localized to repairing cells, whereas TrkC was observed in stromal cells, osteoblasts, and blood vessel cells at the injury site. Moreover, systemic NT-3 immunoneutralization reduced bone volume at injury sites and also reduced vascularization at the injured growth plate, whereas recombinant NT-3 treatment promoted bony repair with elevated levels of mRNA for osteogenic markers and bone morphogenetic protein (BMP-2) and increased vascularization and mRNA for vascular endothelial growth factor (VEGF) and endothelial cell marker CD31 at the injured growth plate. When examined in vitro, NT-3 promoted osteogenesis in rat bone marrow stromal cells, induced Erk1/2 and Akt phosphorylation, and enhanced expression of BMPs (particularly BMP-2) and VEGF in the mineralizing cells. It also induced CD31 and VEGF mRNA in rat primary endothelial cell culture. BMP activity appears critical for NT-3 osteogenic effect in vitro because it can be almost completely abrogated by co-addition of the BMP inhibitor noggin. Consistent with its angiogenic effect in vivo, NT-3 promoted angiogenesis in metatarsal bone explants, an effect abolished by co-treatment with anti-VEGF. This study suggests that NT-3 may be an osteogenic and angiogenic factor upstream of BMP-2 and VEGF in bony repair, and further studies are required to investigate whether NT-3 may be a potential target for preventing growth plate faulty bony repair or for promoting bone fracture healing. © 2016
Patent Pooling for Promoting Access to Antiretroviral Drugs (ARVs) - A Strategic Option for India.
Satyanarayana, Kanikaram; Srivastava, Sadhana
2010-01-19
The current HIV/AIDS scenario in India is quite grim with an estimated 2.4 million people living with HIV/AIDS (PLHA) in 2008, just behind South Africa and Nigeria. The anti-retroviral drugs (ARVs) remain the main stay of global HIV/AIDS treatment. Over 30 ARVs (single and FDCs) available under six categories viz., NRTIs (nucleoside reverse transcriptase inhibitors), NNRTIs (non-nucleoside reverse transcriptase inhibitors), Protease inhibitors, the new Fusion inhibitors, Entry inhibitors-CCR5 co-receptor antagonists and HIV integrase strand transfer inhibitors. The major originator companies for these ARVs are: Abbott, Boehringer Ingelheim (BI), Bristol-Myers Squibb (BMS), Gilead, GlaxoSmithKline (GSK), Merck, Pfizer, Roche, and Tibotec. Beginning with zidovidine in 1987, all the drugs are available in the developed countries. In India, about 30 ARVs are available as generics manufactured by Aurobindo, Hyderabad, Andhra Pradesh; Cipla Limited, Goa; Emcure Pharmaceuticals, Pune, Maharashtra; Hetero Drugs, Hyderabad, Andhra Pradesh; Macleods Pharmaceuticals, Daman; Matrix Laboratories, Nashik, Maharashtra; Ranbaxy, Sirmour, Himachal Pradesh; and Strides Arcolab, Bangalore, Karnataka. The National AIDS Control Organization (NACO) set up in 1992 by the Govt. of India provides free ARVs to HIV positive patients in India since 2004. The drugs available in India include both single drugs and FDCs covering both first line and second line ARVs. Even while there are claims of stabilization of the disease load, there is still huge gap of those who require ARVs as only about 150,000 PLHA receive the ARVs from the Govt. and other sources. Access to ARVs therefore is still a cause of serious concern ever since India became fully Trade Related Aspects of Intellectual Property Rights (TRIPS)-complaint in 2005. Therefore, the Indian pharmaceutical companies cannot make generics for those for drugs introduced post-2005 due to product patent regime. Other concerns include heat stable
Kim, June-Sik; Mizoi, Junya; Yoshida, Takuya; Fujita, Yasunari; Nakajima, Jun; Ohori, Teppei; Todaka, Daisuke; Nakashima, Kazuo; Hirayama, Takashi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko
2011-12-01
In plants, osmotic stress-responsive transcriptional regulation depends mainly on two major classes of cis-acting elements found in the promoter regions of stress-inducible genes: ABA-responsive elements (ABREs) and dehydration-responsive elements (DREs). ABRE has been shown to perceive ABA-mediated osmotic stress signals, whereas DRE is known to be involved in an ABA-independent pathway. Previously, we reported that the transcription factor DRE-BINDING PROTEIN 2A (DREB2A) regulates DRE-mediated transcription of target genes under osmotic stress conditions in Arabidopsis (Arabidopsis thaliana). However, the transcriptional regulation of DREB2A itself remains largely uncharacterized. To elucidate the transcriptional mechanism associated with the DREB2A gene under osmotic stress conditions, we generated a series of truncated and base-substituted variants of the DREB2A promoter and evaluated their transcriptional activities individually. We found that both ABRE and coupling element 3 (CE3)-like sequences located approximately -100 bp from the transcriptional initiation site are necessary for the dehydration-responsive expression of DREB2A. Coupling our transient expression analyses with yeast one-hybrid and chromatin immunoprecipitation (ChIP) assays indicated that the ABRE-BINDING PROTEIN 1 (AREB1), AREB2 and ABRE-BINDING FACTOR 3 (ABF3) bZIP transcription factors can bind to and activate the DREB2A promoter in an ABRE-dependent manner. Exogenous ABA application induced only a modest accumulation of the DREB2A transcript when compared with the osmotic stress treatment. However, the osmotic stress-induced DREB2A expression was found to be markedly impaired in several ABA-deficient and ABA-insensitive mutants. These results suggest that in addition to an ABA-independent pathway, the ABA-dependent pathway plays a positive role in the osmotic stress-responsive expression of DREB2A.
Heidler, Juliana; Fysikopoulos, Athanasios; Wempe, Frank; Seimetz, Michael; Bangsow, Thorsten; Tomasovic, Ana; Veit, Florian; Scheibe, Susan; Pichl, Alexandra; Weisel, Friederike; Lloyd, K. C. Kent; Jaksch, Peter; Klepetko, Walter; Weissmann, Norbert; von Melchner, Harald
2013-01-01
SUMMARY Chronic obstructive pulmonary disease (COPD) is a leading cause of morbidity and mortality worldwide. COPD is caused by chronic exposure to cigarette smoke and/or other environmental pollutants that are believed to induce reactive oxygen species (ROS) that gradually disrupt signalling pathways responsible for maintaining lung integrity. Here we identify the antioxidant protein sestrin-2 (SESN2) as a repressor of PDGFRβ signalling, and PDGFRβ signalling as an upstream regulator of alveolar maintenance programmes. In mice, the mutational inactivation of Sesn2 prevents the development of cigarette-smoke-induced pulmonary emphysema by upregulating PDGFRβ expression via a selective accumulation of intracellular superoxide anions (O2−). We also show that SESN2 is overexpressed and PDGFRβ downregulated in the emphysematous lungs of individuals with COPD and to a lesser extent in human lungs of habitual smokers without COPD, implicating a negative SESN2-PDGFRβ interrelationship in the pathogenesis of COPD. Taken together, our results imply that SESN2 could serve as both a biomarker and as a drug target in the clinical management of COPD. PMID:24046361
Energy Technology Data Exchange (ETDEWEB)
Park, Jeong Ha; Lee, Myung Jun; Lee, Chang Joon [National Medical Center, Seoul (Korea, Republic of)
2001-10-01
To determine the usefulness of MR urography technique for the evaluation of urinary systems in patients with obstructed urinary tract and normal volunteers with non-obstructed urinary tract after intravenous normal saline and diuretic injection. Three normal volunteers and 12 patients with urinary tract obstruction [ureteral calculi (n=8), extraurinary mass (n=1), ureteral tumor invasion (n=3)] underwent MR urography using a 1.0T scanner and a 2D non-breath-hold heavily T2-weighted fast spin-cho sequence. These acquisition were post-processed with a maximum intensity projection (MIP) algorithm. Two acquisitions were performed, the first prior to saline solution infusion following standard MR urography procedures, and the second, within 2-3 minutes of the infusion of 250 ml saline solution followed by 20 mg of Lasix administered intravenously. For this latter, drug-induced MR urography procedures were followed. In healthy volunteer (n=3) and those experiencing partial obstruction (n=4) by a urinary stone, drug-induced MR urography provided better images of the urinary tract than did standard MR urography. In those in whom a urinary stone or tumor had caused complete obstruction (n=8), standard MR urography provided good images, as did drug-induced MR urography. In patients with a partially or non-obstructed urinary tract, drug-induced MR urography provided better anatomic and functional details of the kidney and urinary tract than did standard MR urography. In those experiencing complete obstruction of the urinary tract, however, standard or drug-induced MR urography permitted very adequate evaluation of the tract, and drug-induced MR urography was unnecessary.
DEFF Research Database (Denmark)
Graff, Claus; Andersen, Mads P; Xue, Joel Q
2009-01-01
BACKGROUND: The electrocardiographic QT interval is used to identify drugs with potential harmful effects on cardiac repolarization in drug trials, but the variability of the measurement can mask drug-induced ECG changes. The use of complementary electrocardiographic indices of abnormal repolariz......BACKGROUND: The electrocardiographic QT interval is used to identify drugs with potential harmful effects on cardiac repolarization in drug trials, but the variability of the measurement can mask drug-induced ECG changes. The use of complementary electrocardiographic indices of abnormal...... are typical ECG patterns in LQT2. Blinded to labels, the new morphology measures were tested in a third group of 39 healthy subjects receiving sotalol. Over 3 days the sotalol group received 0, 160 and 320 mg doses, respectively, and a 12-lead Holter ECG was recorded for 22.5 hours each day. Drug...... with QTcF, p ECG patterns in LQT2 carriers effectively quantified repolarization changes induced by sotalol. Further studies are needed to validate whether this measure has...
Cancer drug addiction is relayed by an ERK2-dependent phenotype switch.
Kong, Xiangjun; Kuilman, Thomas; Shahrabi, Aida; Boshuizen, Julia; Kemper, Kristel; Song, Ji-Ying; Niessen, Hans W M; Rozeman, Elisa A; Geukes Foppen, Marnix H; Blank, Christian U; Peeper, Daniel S
2017-10-12
Observations from cultured cells, animal models and patients raise the possibility that the dependency of tumours on the therapeutic drugs to which they have acquired resistance represents a vulnerability with potential applications in cancer treatment. However, for this drug addiction trait to become of clinical interest, we must first define the mechanism that underlies it. We performed an unbiased CRISPR-Cas9 knockout screen on melanoma cells that were both resistant and addicted to inhibition of the serine/threonine-protein kinase BRAF, in order to functionally mine their genome for 'addiction genes'. Here we describe a signalling pathway comprising ERK2 kinase and JUNB and FRA1 transcription factors, disruption of which allowed addicted tumour cells to survive on treatment discontinuation. This occurred in both cultured cells and mice and was irrespective of the acquired drug resistance mechanism. In melanoma and lung cancer cells, death induced by drug withdrawal was preceded by a specific ERK2-dependent phenotype switch, alongside transcriptional reprogramming reminiscent of the epithelial-mesenchymal transition. In melanoma cells, this reprogramming caused the shutdown of microphthalmia-associated transcription factor (MITF), a lineage survival oncoprotein; restoring this protein reversed phenotype switching and prevented the lethality associated with drug addiction. In patients with melanoma that had progressed during treatment with a BRAF inhibitor, treatment cessation was followed by increased expression of the receptor tyrosine kinase AXL, which is associated with the phenotype switch. Drug discontinuation synergized with the melanoma chemotherapeutic agent dacarbazine by further suppressing MITF and its prosurvival target, B-cell lymphoma 2 (BCL-2), and by inducing DNA damage in cancer cells. Our results uncover a pathway that underpins drug addiction in cancer cells, which may help to guide the use of alternating therapeutic strategies for enhanced
He, Jiangping; Zhang, Guangya; Pang, Qi; Yu, Cong; Xiong, Jie; Zhu, Jing; Chen, Fengling
2017-05-01
SIRT6 is a pivotal regulator of lipid metabolism. It is also closely connected to cardiovascular diseases, which are the main cause of death in diabetic patients. We observed a decrease in the expression of SIRT6 and key autophagy effectors (ATG5, LC3B, and LAMP1) in ox-LDL-induced foam cells, a special form of lipid-laden macrophages. In these cells, SIRT6 WT but not SIRT6 H133Y overexpression markedly reduced foam cell formation, as shown by Oil Red O staining, while inducing autophagy flux, as determined by both mRFP-GFP-LC3 labeling and transmission electron microscopy. Silencing the key autophagy initiation gene ATG5, reversed the autophagy-promoting effect of SIRT6 in ox-LDL-treated THP1 cells, as evidenced by an increase in foam cells. Cholesterol efflux assays indicated that SIRT6 overexpression in foam cells promoted cholesterol efflux, increased the levels of ABCA1 and ABCG1, and reduced miR-33 levels. By transfecting miR-33 into cells overexpressing SIRT6, we observed that reduced foam cell formation and autophagy flux induction were largely reversed. These data imply that SIRT6 plays an essential role in protecting against atherosclerosis by reducing foam cell formation through an autophagy-dependent pathway. © 2017 Federation of European Biochemical Societies.
Antithyroid drug-induced fetal goitrous hypothyroidism
DEFF Research Database (Denmark)
Bliddal, Sofie; Rasmussen, Ase Krogh; Sundberg, Karin
2011-01-01
Maternal overtreatment with antithyroid drugs can induce fetal goitrous hypothyroidism. This condition can have a critical effect on pregnancy outcome, as well as on fetal growth and neurological development. The purpose of this Review is to clarify if and how fetal goitrous hypothyroidism can...... be prevented, and how to react when prevention has failed. Understanding the importance of pregnancy-related changes in maternal thyroid status when treating a pregnant woman is crucial to preventing fetal goitrous hypothyroidism. Maternal levels of free T(4) are the most consistent indication of maternal...... and fetal thyroid status. In patients with fetal goitrous hypothyroidism, intra-amniotic levothyroxine injections improve fetal outcome. The best way to avoid maternal overtreatment with antithyroid drugs is to monitor closely the maternal thyroid status, especially estimates of free T(4) levels....
Directory of Open Access Journals (Sweden)
Linda Bosserman
Full Text Available A drug-induced apoptosis assay has been developed to determine which chemotherapy drugs or regimens can produce higher cell killing in vitro. This study was done to determine if this assay could be performed in patients with recurrent or metastatic breast cancer patients, to characterize the patterns of drug-induced apoptosis, and to evaluate the clinical utility of the assay. A secondary goal was to correlate assay use with clinical outcomes.In a prospective, non-blinded, multi institutional controlled trial, 30 evaluable patients with recurrent or metastatic breast cancer who were treated with chemotherapy had tumor samples submitted for the MiCK drug-induced apoptosis assay. After receiving results within 72 hours after biopsy, physicians could use the test to determine therapy (users, or elect to not use the test (non-users.The assay was able to characterize drug-induced apoptosis in tumor specimens from breast cancer patients and identified which drugs or combinations gave highest levels of apoptosis. Patterns of drug activity were also analyzed in triple negative breast cancer. Different drugs from a single class of agents often produced significantly different amounts of apoptosis. Physician frequently (73% used the assay to help select chemotherapy treatments in patients, Patients whose physicians were users had a higher response (CR+PR rate compared to non-users (38.1% vs 0%, p = 0.04 and a higher disease control (CR+PR+Stable rate (81% vs 25%, p<0.01. Time to relapse was longer in users 7.4 mo compared to non-users 2.2 mo (p<0.01.The MiCK assay can be performed in breast cancer specimens, and results are often used by physicians in breast cancer patients with recurrent or metastatic disease. These results from a good laboratory phase II study can be the basis for a future larger prospective multicenter study to more definitively establish the value of the assay.Clinicaltrials.gov NCT00901264.
Direct inhibition of TNF-α promoter activity by Fanconi anemia protein FANCD2.
Directory of Open Access Journals (Sweden)
Nobuko Matsushita
Full Text Available Fanconi anemia (FA, an inherited disease, is associated with progressive bone marrow failure, predisposition to cancer, and genomic instability. Genes corresponding to 15 identified FA complementation groups have been cloned, and each gene product functions in the response to DNA damage induced by cross-linking agents and/or in protection against genome instability. Interestingly, overproduction of inflammatory cytokines such as tumor necrosis factor alpha (TNF-α and aberrant activation of NF-κB-dependent transcriptional activity have been observed in FA cells. Here we demonstrated that FANCD2 protein inhibits NF-κB activity in its monoubiquitination-dependent manner. Furthermore, we detected a specific association between FANCD2 and an NF-κB consensus element in the TNF-α promoter by electrophoretic mobility shift assays (EMSA and chromatin immunoprecipitation (ChIP assay. Therefore, we propose FANCD2 deficiency promotes transcriptional activity of the TNF-α promoter and induces overproduction of TNF-which then sustains prolonged inflammatory responses. These results also suggest that artificial modulation of TNFα production could be a promising therapeutic approach to FA.
Drug-induced lung disease: High-resolution CT and histological findings
International Nuclear Information System (INIS)
Cleverley, Joanne R.; Screaton, Nicholas J.; Hiorns, Melanie P.; Flint, Julia D.A.; Mueller, Nestor L.
2002-01-01
AIM: To compare the parenchymal high-resolution computed tomography (HRCT) appearances with histological findings in patients with drug-induced lung disease and to determine the prognostic value of HRCT. MATERIALS AND METHODS: Drug history, HRCT features, histological findings and outcome at 3 months in 20 patients with drug induced-lung disease were reviewed retrospectively. The HRCT images were assessed for the pattern and distribution of abnormalities and classified as most suggestive of interstitial pneumonitis/fibrosis, diffuse alveolar damage (DAD), organizing pneumonia (OP) reaction, or a hypersensitivity reaction. RESULTS: On histopathological examination there were eight cases of interstitial pneumonitis/fibrosis, five of DAD, five of OP reactions, one of hypersensitivity reaction and one of pulmonary eosinophilia. The most common abnormalities on HRCT were ground-glass opacities (n = 17), consolidation (n = 14), interlobular septal thickening (n = 15) and centrilobular nodules (n 8). HRCT interpretation and histological diagnosis were concordant in only nine (45%) of 20 patients. The pattern, distribution, and extent of HRCT abnormalities were of limited prognostic value: all eight patients with histological findings of OP, hypersensitivity reaction, or eosinophilic infiltrate improved on follow-up compared to only five of 13 patients with interstitial pneumonitis/fibrosis or DAD. CONCLUSION: In many cases of drug-induced lung injury HRCT is of limited value in determining the histological pattern and prognosis. Cleverly, J.R. et al
Zanotto-Filho, Alfeu; Masamsetti, V Pragathi; Loranc, Eva; Tonapi, Sonal S; Gorthi, Aparna; Bernard, Xavier; Gonçalves, Rosângela Mayer; Moreira, José C F; Chen, Yidong; Bishop, Alexander J R
2016-12-01
Alkylating agents are a commonly used cytotoxic class of anticancer drugs. Understanding the mechanisms whereby cells respond to these drugs is key to identify means to improve therapy while reducing toxicity. By integrating genome-wide gene expression profiling, protein analysis, and functional cell validation, we herein demonstrated a direct relationship between NRF2 and Endoplasmic Reticulum (ER) stress pathways in response to alkylating agents, which is coordinated by the availability of glutathione (GSH) pools. GSH is essential for both drug detoxification and protein thiol homeostasis within the ER, thus inhibiting ER stress induction and promoting survival, an effect independent of its antioxidant role. NRF2 accumulation induced by alkylating agents resulted in increased GSH synthesis via GCLC/GCLM enzyme, and interfering with this NRF2 response by either NRF2 knockdown or GCLC/GCLM inhibition with buthionine sulfoximine caused accumulation of damaged proteins within the ER, leading to PERK-dependent apoptosis. Conversely, upregulation of NRF2, through KEAP1 depletion or NRF2-myc overexpression, or increasing GSH levels with N-acetylcysteine or glutathione-ethyl-ester, decreased ER stress and abrogated alkylating agents-induced cell death. Based on these results, we identified a subset of lung and head-and-neck carcinomas with mutations in either KEAP1 or NRF2/NFE2L2 genes that correlate with NRF2 target overexpression and poor survival. In KEAP1-mutant cancer cells, NRF2 knockdown and GSH depletion increased cell sensitivity via ER stress induction in a mechanism specific to alkylating drugs. Overall, we show that the NRF2-GSH influence on ER homeostasis implicates defects in NRF2-GSH or ER stress machineries as affecting alkylating therapy toxicity. Mol Cancer Ther; 15(12); 3000-14. ©2016 AACR. ©2016 American Association for Cancer Research.
Zanotto-Filho, Alfeu; Masamsetti, V. Pragathi; Loranc, Eva; Tonapi, Sonal S.; Gorthi, Aparna; Bernard, Xavier; Gonçalves, Rosângela Mayer; Moreira, José C. F.; Chen, Yidong; Bishop, Alexander J. R.
2016-01-01
Alkylating agents are a commonly used cytotoxic class of anticancer drugs. Understanding the mechanisms whereby cells respond to these drugs is key to identify means to improve therapy while reducing toxicity. By integrating genome-wide gene expression profiling, protein analysis and functional cell validation, we herein demonstrated a direct relationship between NRF2 and Endoplasmic Reticulum (ER) stress pathways in response to alkylating agents, which is coordinated by the availability of glutathione (GSH) pools. GSH is essential for both drug detoxification and protein thiol homeostasis within the ER, thus inhibiting ER stress induction and promoting survival; an effect independent of its antioxidant role. NRF2 accumulation induced by alkylating agents resulted in increased GSH synthesis via GCLC/GCLM enzyme, and interfering with this NRF2 response by either NRF2 knockdown or GCLC/GCLM inhibition with buthionine sulfoximine (BSO) caused accumulation of damaged proteins within the ER, leading to PERK-dependent apoptosis. Conversely, upregulation of NRF2, through KEAP1 depletion or NRF2-myc overexpression, or increasing GSH levels with N-acetylcysteine (NAC) or glutathione-ethyl-ester (GSH-E), decreased ER stress and abrogated alkylating agents-induced cell death. Based on these results, we identified a subset of lung and head-and-neck carcinomas with mutations in either KEAP1 or NRF2/NFE2L2 genes that correlate with NRF2 targets overexpression and poor survival. In KEAP1 mutant cancer cells, NRF2 knockdown and GSH depletion increased cell sensitivity via ER stress induction in a mechanism specific to alkylating drugs. Overall, we show that the NRF2-GSH influence on ER homeostasis implicates defects in NRF2-GSH or ER stress machineries as affecting alkylating therapy toxicity. PMID:27638861
Energy Technology Data Exchange (ETDEWEB)
Cho, Yun Kyung; Kim, Gunha; Park, Serah; Sim, Ju Hee; Won, You Jin [Department of Anatomy and Cell Biology, University of Ulsan College of Medicine, 388-1 Pungnap-dong, Songpa-gu, Seoul 138-736 (Korea, Republic of); Hwang, Chang Ho [Department of Physical Medicine and Rehabilitation, Ulsan University Hospital, University of Ulsan College of Medicine, 290-3 Jeonha-dong, Dong-gu, Ulsan 682-714 (Korea, Republic of); Yoo, Jong Yoon, E-mail: jyyoo@amc.seoul.kr [Department of Rehabilitation Medicine, University of Ulsan College of Medicine, 388-1 Pungnap-dong, Songpa-gu, Seoul 138-736 (Korea, Republic of); Hong, Hea Nam, E-mail: hnhong@amc.seoul.kr [Department of Anatomy and Cell Biology, University of Ulsan College of Medicine, 388-1 Pungnap-dong, Songpa-gu, Seoul 138-736 (Korea, Republic of)
2012-01-13
Highlights: Black-Right-Pointing-Pointer Lysolecithin-induced demyelination elevated EpoR expression in OPCs. Black-Right-Pointing-Pointer In association with elevated EpoR, EPO increased OPCs proliferation. Black-Right-Pointing-Pointer EPO enhanced the oligodendrogenesis via activation of JAK2 pathway. Black-Right-Pointing-Pointer EPO promoted myelin repair following lysolecithin-induced demyelination. -- Abstract: Here, we sought to delineate the effect of EPO on the remyelination processes using an in vitro model of demyelination. We report that lysolecithin-induced demyelination elevated EPO receptor (EpoR) expression in oligodendrocyte progenitor cells (OPCs), facilitating the beneficial effect of EPO on the formation of oligodendrocytes (oligodendrogenesis). In the absence of EPO, the resultant remyelination was insufficient, possibly due to a limiting number of oligodendrocytes rather than their progenitors, which proliferate in response to lysolecithin-induced injury. By EPO treatment, lysolecithin-induced proliferation of OPCs was accelerated and the number of myelinating oligodendrocytes and myelin recovery was increased. EPO also enhanced the differentiation of neural progenitor cells expressing EpoR at high level toward the oligodendrocyte-lineage cells through activation of cyclin E and Janus kinase 2 pathways. Induction of myelin-forming oligodendrocytes by high dose of EPO implies that EPO might be the key factor influencing the final differentiation of OPCs. Taken together, our data suggest that EPO treatment could be an effective way to enhance remyelination by promoting oligodendrogenesis in association with elevated EpoR expression in spinal cord slice culture after lysolecithin-induced demyelination.
Olmos, G; DeGregorio-Rocasolano, N; Paz Regalado, M; Gasull, T; Assumpció Boronat, M; Trullas, R; Villarroel, A; Lerma, J; García-Sevilla, J A
1999-07-01
This study was designed to assess the potential neuroprotective effect of several imidazol(ine) drugs and agmatine on glutamate-induced necrosis and on apoptosis induced by low extracellular K+ in cultured cerebellar granule cells. Exposure (30 min) of energy deprived cells to L-glutamate (1-100 microM) caused a concentration-dependent neurotoxicity, as determined 24 h later by a decrease in the ability of the cells to metabolize 3-(4,5-dimethythiazol-2-yl)-2,5-diphenyltetrazoliumbromide (MTT) into a reduced formazan product. L-glutamate-induced neurotoxicity (EC50=5 microM) was blocked by the specific NMDA receptor antagonist MK-801 (dizocilpine). Imidazol(ine) drugs and agmatine fully prevented neurotoxicity induced by 20 microM (EC100) L-glutamate with the rank order (EC50 in microM): antazoline (13)>cirazoline (44)>LSL 61122 [2-styryl-2-imidazoline] (54)>LSL 60101 [2-(2-benzofuranyl) imidazole] (75)>idazoxan (90)>LSL 60129 [2-(1,4-benzodioxan-6-yl)-4,5-dihydroimidazole](101)>RX82 1002 (2-methoxy idazoxan) (106)>agmatine (196). No neuroprotective effect of these drugs was observed in a model of apoptotic neuronal cell death (reduction of extracellular K+) which does not involve stimulation of NMDA receptors. Imidazol(ine) drugs and agmatine fully inhibited [3H]-(+)-MK-801 binding to the phencyclidine site of NMDA receptors in rat brain. The profile of drug potency protecting against L-glutamate neurotoxicity correlated well (r=0.90) with the potency of the same compounds competing against [3H]-(+)-MK-801 binding. In HEK-293 cells transfected to express the NR1-1a and NR2C subunits of the NMDA receptor, antazoline and agmatine produced a voltage- and concentration-dependent block of glutamate-induced currents. Analysis of the voltage dependence of the block was consistent with the presence of a binding site for antazoline located within the NMDA channel pore with an IC50 of 10-12 microM at 0 mV. It is concluded that imidazol(ine) drugs and agmatine are
Horiuchi-Yamamoto, Yuka; Gemma, Akihiko; Taniguchi, Hiroyuki; Inoue, Yoshikazu; Sakai, Fumikazu; Johkoh, Takeshi; Fujimoto, Kiminori; Kudoh, Shoji
2013-08-01
Sorafenib is a multi-kinase inhibitor currently approved in Japan for unresectable and/or metastatic renal cell carcinoma and unresectable hepatocellular carcinoma. Although drug-induced lung injury has recently been the focus of interest in Japanese patients treated with molecular targeting agents, the clinical features of patients receiving sorafenib remain to be completely investigated. All-patient post-marketing surveillance data was obtained within the frame of Special Drug Use Investigation; between April 2008 and March 2011, we summarized the clinical information of 62 cases with drug-induced lung injury among approximately 13,600 sorafenib-treated patients in Japan. In addition, we summarized the results of evaluation by a safety board of Japanese experts in 34 patients in whom pulmonary images were available. For the calculation of reporting frequency, interim results of Special Drug Use Investigation were used. In the sets of completed reports (2,407 in renal cell carcinoma and 647 in hepatocellular carcinoma), the reporting frequency was 0.33 % (8 patients; fatal, 4/8) and 0.62 % (4 patients; fatal, 2/4), respectively. Major clinical symptoms included dyspnea, cough, and fever. Evaluation of the images showed that 18 cases out of 34 patients had a pattern of diffuse alveolar damage. The patients with hepatocellular carcinoma showed a greater incidence and earlier onset of lung injury than those with renal cell carcinoma. Although the overall reporting frequency of sorafenib-induced lung injury is not considered high, the radiological diffuse alveolar damage pattern led to a fatal outcome. Therefore, early recognition of sorafenib-induced lung injury is crucial for physicians and patients.
Yuan, Xiao-Hua; Fan, Yang-Yang; Yang, Chun-Rong; Gao, Xiao-Rui; Zhang, Li-Li; Hu, Ying; Wang, Ya-Qin; Jun, Hu
2016-01-01
The role of progesterone on the cardiovascular system is controversial. Our present research is to specify the effect of progesterone on arterial endothelial cells in response to oxidative stress. Our result showed that H2O2 (150 μM and 300 μM) induced cellular antioxidant response. Glutathione (GSH) production and the activity of Glutathione peroxidase (GPx) were increased in H2O2-treated group. The expression of glutamate cysteine ligase catalytic subunit (GCLC) and modifier subunit (GCLM) was induced in response to H2O2. However, progesterone absolutely abolished the antioxidant response through increasing ROS level, inhibiting the activity of Glutathione peroxidase (GPx), decreasing GSH level and reducing expression of GClC and GCLM. In our study, H2O2 induced nitrogen monoxide (NO) production and endothelial nitric oxide synthase (eNOS) expression, and progesterone promoted H2O2-induced NO production. Progesterone increased H2O2-induced expression of hypoxia inducible factor-α (HIFα) which in turn regulated eNOS expression and NO synthesis. Further study demonstrated that progesterone increased H2O2 concentration of culture medium which may contribute to NO synthesis. Exogenous GSH decreased the content of H2O2 of culture medium pretreated by progesterone combined with H2O2 or progesterone alone. GSH also inhibited expression of HIFα and eNOS, and abolished NO synthesis. Collectively, our study demonstrated for the first time that progesterone inhibited cellular antioxidant effect and increased oxidative stress, promoted NO production of arterial endothelial cells, which may be due to the increasing H2O2 concentration and amplified oxidative stress signal. Copyright © 2015. Published by Elsevier Ltd.
Effect of vildagliptin and pravastatin combination on cholesterol efflux in adipocytes.
Mostafa, Ahmed M; Hamdy, Nadia M; Abdel-Rahman, Sherif Z; El-Mesallamy, Hala O
2016-07-01
Many reports suggested that some statins are almost ineffective in reducing triglycerides or enhancing HDL-C plasma levels, although statin treatment was still efficacious in reducing LDL-C. In diabetic dyslipidemic patients, it may therefore be necessary to use a combination therapy with other drugs to achieve either LDL-C- and triglyceride-lowering or HDL-C-enhancing goals. Such ineffectiveness of statins can be attributed to their effect on the liver X receptor (LXR) which regulates the expression of the ATP-binding cassette (ABC) transporters ABCA1 and ABCG1. A decrease in the expression of these transporters eventually leads to decreased cholesterol efflux from peripheral tissues leading to low levels of HDL-C. Although manipulating the LXR pathway may complement the effects of statins, LXR synthetic ligands as T091317 have shown significant hypertriglyceridemic action which limits their use. We recently found that the antidiabetic drug vildagliptin stimulates LXR expression leading to increased ABCB1/ABCG1 expression which improves cholesterol efflux from adipocytes. Therefore, a combination of vildagliptin and statin may provide a solution without the hypertriglyceridemic action observed with LXR agonist. We hypothesize that a combination of vildagliptin and pravastatin will improve cholesterol efflux in adipocytes. Statin-treated 3T3-L1 adipocytes were treated with vildagliptin, and the expression of LXR-ABCA1/ABCG1 cascade and the cholesterol efflux were then determined. Our data indicate that a combination of vildagliptin and pravastatin significantly induces the expression of LXR-ABCA1/ABCG1 cascade and improves cholesterol efflux (P > 0.05) in adipocytes. Our data may explain, at least in part, the improvement in HDL-C levels observed in patients receiving both medications. © 2016 IUBMB Life, 68(7):535-543, 2016. © 2016 International Union of Biochemistry and Molecular Biology.
Structural basis of drugs that increase cardiac inward rectifier Kir2.1 currents.
Gómez, Ricardo; Caballero, Ricardo; Barana, Adriana; Amorós, Irene; De Palm, Sue-Haida; Matamoros, Marcos; Núñez, Mercedes; Pérez-Hernández, Marta; Iriepa, Isabel; Tamargo, Juan; Delpón, Eva
2014-11-01
We hypothesize that some drugs, besides flecainide, increase the inward rectifier current (IK1) generated by Kir2.1 homotetramers (IKir2.1) and thus, exhibit pro- and/or antiarrhythmic effects particularly at the ventricular level. To test this hypothesis, we analysed the effects of propafenone, atenolol, dronedarone, and timolol on Kir2.x channels. Currents were recorded with the patch-clamp technique using whole-cell, inside-out, and cell-attached configurations. Propafenone (0.1 nM-1 µM) did not modify either IK1 recorded in human right atrial myocytes or the current generated by homo- or heterotetramers of Kir2.2 and 2.3 channels recorded in transiently transfected Chinese hamster ovary cells. On the other hand, propafenone increased IKir2.1 (EC50 = 12.0 ± 3.0 nM) as a consequence of its interaction with Cys311, an effect which decreased inward rectification of the current. Propafenone significantly increased mean open time and opening frequency at all the voltages tested, resulting in a significant increase of the mean open probability of the channel. Timolol, which interacted with Cys311, was also able to increase IKir2.1. On the contrary, neither atenolol nor dronedarone modified IKir2.1. Molecular modelling of the Kir2.1-drugs interaction allowed identification of the pharmacophore of drugs that increase IKir2.1. Kir2.1 channels exhibit a binding site determined by Cys311 that is responsible for drug-induced IKir2.1 increase. Drug binding decreases channel affinity for polyamines and current rectification, and can be a mechanism of drug-induced pro- and antiarrhythmic effects not considered until now. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2014. For permissions please email: journals.permissions@oup.com.
Energy Technology Data Exchange (ETDEWEB)
Guerrero M, M G
2004-07-01
The chlorophyllin (CHLN) it is a porphyrin of soluble nutritious grade in water, derived of the chlorophyll that includes in their structure a copper atom. It has been reported that this pigment can act as anti mutagen, reducing the damage to the DNA caused by physical or chemical agents of direct or indirect action. Their anti carcinogen action has also been studied during the initiation phase induced for carcinogen as the aflatoxins and heterocyclic amines. In contrast the reports have increased on a probable promoter activity of the CHLN on the induced genetic damage. This effect was seen for the first time before the damage induced by alkylating agents in Salmonella. Recently it has been observed with the damage induced by gamma radiation, ENU and CrO{sub 3} in somatic cells of the wing of Drosophila and in the induction of tumors for 1,2-dimethylhydrazine (DMH) in mice. Presently study is evaluated the protective effect or promoter of the CHLN before the genetic damage induced by 1,2-dimethylhydrazine, by means of the bioassay mutation and somatic recombination (SMART) in the wing of Drosophila melanogaster. Its were pretreated with CHLN or SAC to transheterocygotes larvas for two locus of the chromosome three mwh+/+flr{sup 3}; later on they are retarded the chronic treatment with DMH 0, 1, 2 and 3 days. It was measured the toxicity and the speed of development of the treated individuals. The wings of those adults that emerged were analyzed to register the number and the size of stains. The results indicated: differences in the viability of the individuals of the groups SAC + DMH vs CHLN + DMH only in the treated immediately after the pretreatment (DRT-0) that the CHLN doesn't modify the rate of the treated individuals development. The results of somatic mutation indicated that the CHLN has a protective effect only immediately after the pretreatment (DRT-0) however in DRT-1, 2 and 3 showed a promoter effect of genetic damage. (Author)
Energy Technology Data Exchange (ETDEWEB)
Guerrero M, M.G
2004-07-01
The chlorophyllin (CHLN) it is a porphyrin of soluble nutritious grade in water, derived of the chlorophyll that includes in their structure a copper atom. It has been reported that this pigment can act as anti mutagen, reducing the damage to the DNA caused by physical or chemical agents of direct or indirect action. Their anti carcinogen action has also been studied during the initiation phase induced for carcinogen as the aflatoxins and heterocyclic amines. In contrast the reports have increased on a probable promoter activity of the CHLN on the induced genetic damage. This effect was seen for the first time before the damage induced by alkylating agents in Salmonella. Recently it has been observed with the damage induced by gamma radiation, ENU and CrO{sub 3} in somatic cells of the wing of Drosophila and in the induction of tumors for 1,2-dimethylhydrazine (DMH) in mice. Presently study is evaluated the protective effect or promoter of the CHLN before the genetic damage induced by 1,2-dimethylhydrazine, by means of the bioassay mutation and somatic recombination (SMART) in the wing of Drosophila melanogaster. Its were pretreated with CHLN or SAC to transheterocygotes larvas for two locus of the chromosome three mwh+/+flr{sup 3}; later on they are retarded the chronic treatment with DMH 0, 1, 2 and 3 days. It was measured the toxicity and the speed of development of the treated individuals. The wings of those adults that emerged were analyzed to register the number and the size of stains. The results indicated: differences in the viability of the individuals of the groups SAC + DMH vs CHLN + DMH only in the treated immediately after the pretreatment (DRT-0) that the CHLN doesn't modify the rate of the treated individuals development. The results of somatic mutation indicated that the CHLN has a protective effect only immediately after the pretreatment (DRT-0) however in DRT-1, 2 and 3 showed a promoter effect of genetic damage. (Author)
Energy Technology Data Exchange (ETDEWEB)
Dong, Futao, E-mail: dongft@sina.com [College of Metallurgy and Energy, Hebei United University, Tangshan 063000 (China); Xue, Fei [College of Electrical Engineering, Hebei United University, Tangshan 063000 (China); Du, Linxiu; Liu, Xianghua [The State Key Laboratory of Rolling and Automation, Northeastern University, Shenyang 110819 (China)
2015-01-25
Highlights: • We study Ti{sub 4}C{sub 2}S{sub 2} strain induced precipitation in Ti stabilized IF steel. • The PTT diagram is obtained by plotting 1/A{sub r}–time curves. • Hot rolling at the nose of P{sub s} line effectively promotes Ti{sub 4}C{sub 2}S{sub 2} precipitation. • Annealed sheet with promoted Ti{sub 4}C{sub 2}S{sub 2} exhibits higher r value and stronger γ fiber texture. • Adverse impact of tiny TiC has been significantly mitigated. - Abstract: The kinetic of Ti{sub 4}C{sub 2}S{sub 2} strain induced precipitation in a Ti stabilized IF steel was investigated using two stage interrupted compression test with high true strain (0.5). The PTT (precipitation–time–temperature) diagram was obtained by plotting 1/A{sub r}–time curves. TEM (transmission electron microscopy) observation confirmed that the evolution of Ti{sub 4}C{sub 2}S{sub 2} precipitate in the quenched samples of thermal simulation is in good agreement with the PTT diagram. Hot strips were produced at three different rolling temperatures with high strain and slight shear deformation. It was found that hot rolling at the nose temperature of the P{sub s} line of the PTT diagram can effectively promote the precipitation of Ti{sub 4}C{sub 2}S{sub 2} and retard the precipitation of TiC. Cold rolled and annealed sheets from hot strip containing higher volume fraction of Ti{sub 4}C{sub 2}S{sub 2} exhibited higher r value and stronger γ fiber texture with equal {1 1 1}〈1 1 2〉 and {1 1 1}〈1 1 0〉 components. By contrast, cold rolled and annealed sheets from hot strips containing lower volume fraction of Ti{sub 4}C{sub 2}S{sub 2} represented lower r values and weaker γ fiber texture with significant drops from {1 1 1}〈1 1 2〉 to {1 1 1}〈1 1 0〉 component.
Lithium niobate bulk crystallization promoted by CO2 laser radiation
Ferreira, N. M.; Costa, F. M.; Nogueira, R. N.; Graça, M. P. F.
2012-09-01
The crystallization induced by laser radiation is a very promising technique to promote glass/ceramic transformation, being already used to produce crystalline patterns on glass surfaces. In this work, a SiO2-Li2O-Nb2O5 glass, prepared by the sol-gel route, was submitted to CO2 laser radiation and conventional heat-treatments in order to induce the LiNbO3 crystallization. The structure and morphology of the samples prepared by both routes was analyzed as a function of exposure time, radiation power and heat-treatment temperatures by XRD, Raman spectroscopy and SEM. The results reveal a correlation between the crystallization degree of LiNbO3 particles and glass matrix with the heat treatment type and experimental parameters. An heat-treatment at 650 °C/4 h was necessary to induce crystallization in heat treatments samples while 4 W/500 s was enough for laser radiation ones, corresponding a reduction time processing of ˜14 000 s.
Zhang, Fan; Throm, Stacy L.; Murley, Laura L.; Miller, Laura A.; Zatechka, D. Steven; Guy, R. Kiplin; Kennedy, Rachel; Stewart, Clinton F.
2011-01-01
Breast cancer resistance protein (BCRP; ABCG2), a clinical marker for identifying the side population (SP) cancer stem cell subgroup, affects intestinal absorption, brain penetration, hepatobiliary excretion, and multidrug resistance of many anti-cancer drugs. Nutlin-3a is currently under pre-clinical investigation in a variety of solid tumor and leukemia models as a p53 reactivation agent, and has been recently demonstrated to also have p53 independent actions in cancer cells. In the present study, we first report that nutlin-3a can inhibit the efflux function of BCRP. We observed that although the nutlin-3a IC50 did not differ between BCRP over-expressing and vector control cells, nutlin-3a treatment significantly potentiated the cells to treatment with the BCRP substrate mitoxantrone. Combination index calculations suggested synergism between nutlin-3a and mitoxantrone in cell lines over-expressing BCRP. Upon further investigation, it was confirmed that nutlin-3a increased the intracellular accumulation of BCRP substrates such as mitoxantrone and Hoechst 33342 in cells expressing functional BCRP without altering the expression level or localization of BCRP. Interestingly, nutlin-3b, considered virtually “inactive” in disrupting the MDM2/p53 interaction, reversed Hoechst 33342 efflux with the same potency as nutlin-3a. Intracellular accumulation and bi-directional transport studies using MDCKII cells suggested that nutlin-3a is not a substrate of BCRP. Additionally, an ATPase assay using Sf9 insect cell membranes over-expressing wild-type BCRP indicated that nutlin-3a inhibits BCRP ATPase activity in a dose-dependent fashion. In conclusion, our studies demonstrate that nutlin-3a inhibits BCRP efflux function, which consequently reverses BCRP-related drug resistance. PMID:21459080
Drug-Induced Anaphylaxis in Latin American Countries.
Jares, Edgardo José; Baena-Cagnani, Carlos E; Sánchez-Borges, Mario; Ensina, Luis Felipe C; Arias-Cruz, Alfredo; Gómez, Maximiliano; Cuello, Mabel Noemi; Morfin-Maciel, Blanca María; De Falco, Alicia; Barayazarra, Susana; Bernstein, Jonathan A; Serrano, Carlos; Monsell, Silvana; Schuhl, Juan; Cardona-Villa, Ricardo
2015-01-01
Information regarding the clinical features and management of drug-induced anaphylaxis (DIA) in Latin America is lacking. The objective of this study was to assess implicated medications, demographics, and treatments received for DIA in Latin American patients referred to national specialty centers for evaluation. A database previously used to compile information on drug-induced allergic reactions in 11 Latin American countries was used to identify and characterize patients presenting specifically with a clinical diagnosis of DIA. Information regarding clinical presentation, causative agent(s), diagnostic studies performed, treatment, and contributing factors associated with increased reaction severity was analyzed. There were 1005 patients evaluated for possible drug hypersensitivity reactions during the study interval, and 264 (26.3%) met criteria for DIA. DIA was more frequent in adults and in elderly females (N = 129 [76.6%] and N = 30 [75%], respectively) compared with children and/or adolescents (N = 21 [42.9%], P asthma (N = 22 vs 35 [38.6% vs 61.4%], P Latin American patients referred for evaluation of DIA, NSAIDs and antibiotics were implicated in approximately 80% of cases. Most of these reactions were treated in the emergency department. Epinephrine was administered in only 27.6% of all cases, although more frequently for anaphylactic shock. Dissemination of anaphylaxis guidelines among emergency department physicians should be encouraged to improve management of DIA. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.
Drug-induced liver injury due to antibiotics.
Björnsson, Einar S
Drug-induced liver injury (DILI) is an important differential diagnosis in patients with abnormal liver tests and normal hepatobiliary imaging. Of all known liver diseases, the diagnosis of DILI is probably one of the most difficult one to be established. In all major studies on DILI, antibiotics are the most common type of drugs that have been reported. The clinical phenotype of different types of antibiotics associated with liver injury is highly variable. Some widely used antibiotics such as amoxicillin-clavulanate have been shown to have a delayed onset on liver injury and recently cefazolin has been found to lead to liver injury 1-3 weeks after exposure of a single infusion. The other extreme is the nature of nitrofurantoin-induced liver injury, which can occur after a few years of treatment and lead to acute liver failure (ALF) or autoimmune-like reaction. Most patients with liver injury associated with use of antibiotics have a favorable prognosis. However, patients with jaundice have approximately 10% risk of death from liver failure and/or require liver transplantation. In rare instances, the hepatoxicity can lead to chronic injury and vanishing bile duct syndrome. Given, sometimes very severe consequences of the adverse liver reactions, it cannot be over emphasized that the indication for the different antibiotics should be evidence-based and symptoms and signs of liver injury from the drugs should lead to prompt cessation of therapy.
Jing, Jing; Teschke, Rolf
2018-03-28
Cases of suspected herb-induced liver injury (HILI) caused by herbal Traditional Chinese Medicines (TCMs) and of drug-induced liver injury (DILI) are commonly published in the scientific literature worldwide. As opposed to the multiplicity of botanical chemicals in herbal TCM products, which are often mixtures of several herbs, conventional Western drugs contain only a single synthetic chemical. It is therefore of interest to study how HILI by TCM and DILI compare with each other, and to what extent results from each liver injury type can be transferred to the other. China is among the few countries with a large population using synthetic Western drugs as well as herbal TCM. Therefore, China is well suited to studies of liver injury comparing drugs with TCM herbs. Despite some concordance, recent analyses of liver injury cases with verified causality, using the Roussel Uclaf Causality Assessment Method, revealed major differences in HILI caused by TCMs as compared to DILI with respect to the following features: HILI cases are less frequently observed as compared to DILI, have a smaller proportion of females and less unintentional rechallenge events, and present a higher rate of hepatocellular injury features. Since many results were obtained among Chinese residents who had access to and had used Western drugs and TCM herbs, such ethnic homogeneity supports the contention that the observed differences of HILI and DILI in the assessed population are well founded.
Zhuo, Yue; Wu, Jian-Lin; Yan, Xiaojing; Guo, Ming-Quan; Liu, Ning; Zhou, Hua; Liu, Liang; Li, Na
2017-12-19
Hepatotoxicity is a leading cause of drug withdrawal from the market; thus, the assessment of potential drug induced liver injury (DILI) in preclinical trials is necessary. More and more research has shown that the covalent modification of drug reactive metabolites (RMs) for cellular proteins is a possible reason for DILI. Unfortunately, so far no appropriate method can be employed to evaluate this kind of DILI due to the low abundance of RM-protein adducts in complex biological samples. In this study, we proposed a mechanism-based strategy to solve this problem using human liver microsomes (HLMs) and online 2D nano-LC-MS analysis. First, RM modification patterns and potential modified AA residues are determined using HLM and model amino acids (AAs) by UHPLC-Q-TOF-MS. Then, a new online 2D-nano-LC-Q-TOF-MS method is established and applied to separate the digested modified microsomal peptides from high abundance peptides followed by identification of RM-modified proteins using Mascot, in which RM modification patterns on specific AA residues are added. Finally, the functions and relationship with hepatotoxicity of the RM-modified proteins are investigated using ingenuity pathway analysis (IPA) to predict the possible DILI. Using this strategy, 21 proteins were found to be modified by RMs of toosendanin, a hepatotoxic drug with complex structure, and some of them have been reported to be associated with hepatotoxicity. This strategy emphasizes the identification of drug RM-modified proteins in complex biological samples, and no pretreatment is required for the drugs. Consequently, it may serve as a valuable method to predict potential DILI, especially for complex compounds.
21 CFR 201.2 - Drugs and devices; National Drug Code numbers.
2010-04-01
... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Drugs and devices; National Drug Code numbers. 201.2 Section 201.2 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS: GENERAL LABELING General Labeling Provisions § 201.2 Drugs and devices; National Drug Code...
Levofloxacin-Induced QTc Prolongation Depends on the Time of Drug Administration
Kervezee, L; Gotta, V; Stevens, J; Birkhoff, W; Kamerling, Imc; Danhof, M; Meijer, J H; Burggraaf, J
2016-01-01
Understanding the factors influencing a drug's potential to prolong the QTc interval on an electrocardiogram is essential for the correct evaluation of its safety profile. To explore the effect of dosing time on drug-induced QTc prolongation, a randomized, crossover, clinical trial was conducted in
Maruyama, Kyonoshin; Todaka, Daisuke; Mizoi, Junya; Yoshida, Takuya; Kidokoro, Satoshi; Matsukura, Satoko; Takasaki, Hironori; Sakurai, Tetsuya; Yamamoto, Yoshiharu Y.; Yoshiwara, Kyouko; Kojima, Mikiko; Sakakibara, Hitoshi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko
2012-01-01
The genomes of three plants, Arabidopsis (Arabidopsis thaliana), rice (Oryza sativa), and soybean (Glycine max), have been sequenced, and their many genes and promoters have been predicted. In Arabidopsis, cis-acting promoter elements involved in cold- and dehydration-responsive gene expression have been extensively analysed; however, the characteristics of such cis-acting promoter sequences in cold- and dehydration-inducible genes of rice and soybean remain to be clarified. In this study, we performed microarray analyses using the three species, and compared characteristics of identified cold- and dehydration-inducible genes. Transcription profiles of the cold- and dehydration-responsive genes were similar among these three species, showing representative upregulated (dehydrin/LEA) and downregulated (photosynthesis-related) genes. All (46 = 4096) hexamer sequences in the promoters of the three species were investigated, revealing the frequency of conserved sequences in cold- and dehydration-inducible promoters. A core sequence of the abscisic acid-responsive element (ABRE) was the most conserved in dehydration-inducible promoters of all three species, suggesting that transcriptional regulation for dehydration-inducible genes is similar among these three species, with the ABRE-dependent transcriptional pathway. In contrast, for cold-inducible promoters, the conserved hexamer sequences were diversified among these three species, suggesting the existence of diverse transcriptional regulatory pathways for cold-inducible genes among the species. PMID:22184637
Colloid electrochemistry of conducting polymer: towards potential-induced in-situ drug release
International Nuclear Information System (INIS)
Sankoh, Supannee; Vagin, Mikhail Yu.; Sekretaryova, Alina N.; Thavarungkul, Panote; Kanatharana, Proespichaya; Mak, Wing Cheung
2017-01-01
Highlights: • Pulsed electrode potential induced an in-situ drug release from dispersion of conducting polymer microcapsules. • Fast detection of the released drug within the colloid microenvironment. • Improved the efficiency of localized drug release at the electrode interface. - Abstract: Over the past decades, controlled drug delivery system remains as one of the most important area in medicine for various diseases. We have developed a new electrochemically controlled drug release system by combining colloid electrochemistry and electro-responsive microcapsules. The pulsed electrode potential modulation led to the appearance of two processes available for the time-resolved registration in colloid microenvironment: change of the electronic charge of microparticles (from 0.5 ms to 0.1 s) followed by the drug release associated with ionic equilibration (1–10 s). The dynamic electrochemical measurements allow the distinction of drug release associated with ionic relaxation and the change of electronic charge of conducting polymer colloid microparticles. The amount of released drug (methylene blue) could be controlled by modulating the applied potential. Our study demonstrated a surface-potential driven controlled drug release of dispersion of conducting polymer carrier at the electrode interfaces, while the bulk colloids dispersion away from the electrode remains as a reservoir to improve the efficiency of localized drug release. The developed new methodology creates a model platform for the investigations of surface potential-induced in-situ electrochemical drug release mechanism.
Directory of Open Access Journals (Sweden)
Chaohuan Luo
2016-11-01
Full Text Available Background/Aims: Hyperuricemia is part of the metabolic-syndrome cluster of abdominal obesity, impaired glucose tolerance, insulin resistance, dyslipidemia, and hypertension. Monocytes/macrophages are critical in the development of metabolic syndrome, including gout, obesity and atherosclerosis. However, how high uric acid (HUA exposure affects monocyte/macrophage function remains unclear. In this study, we investigated the molecular mechanism of HUA exposure in monocytes/macrophages and its impact on oxidized low-density lipoprotein (oxLDL-induced foam-cell formation in a human monocytic cell line, THP-1. Methods: We primed THP-1 cells with phorbol-12-myristate-13-acetate (PMA for differentiation, then exposed cells to HUA and detected the production of reactive oxygen species (ROS and analyzed the level of phospho-AMPKα. THP-1 cells were pre-incubated with Compound C, an AMPK inhibitor, or N-acetyl-L-cysteine (NAC, a ROS scavenger, or HUA before PMA, to assess CD68 expression and phospho-AMPKα level. PMA-primed THP-1 cells were pre-treated with oxLDL before Compound C and HUA treatment. Western blot analysis was used to examine the levels of phospho-AMPKα, CD68, ABCG1, ABCA1, cyclooxygenase-2 (COX-2 and NF-κB (p65. Flow cytometry was used to assess ROS production and CD68 expression in live cells. Oil-red O staining was used to observe oxLDL uptake in cells. Results: HUA treatment increased ROS production in PMA-primed THP-1 cells; NAC blocked HUA-induced oxidative stress. HUA treatment time-dependently increased phospho-AMPKα level in PMA-primed THP-1 cells. The HUA-induced oxidative stress increased phospho-AMPKα levels, which was blocked by NAC. HUA treatment impaired CD68 expression during cell differentiation by activating the AMPK pathway, which was reversed by Compound C treatment. Finally, HUA treatment inhibited oxLDL uptake in the formation of foam cells in THP-1 cells, which was blocked by Compound C treatment. HUA treatment
Lin, Hung-Chih; Su, Shih-Li; Lu, Chia-Yang; Lin, Ai-Hsuan; Lin, Wan-Chun; Liu, Chin-San; Yang, Ya-Chen; Wang, Hsiu-Miao; Lii, Chong-Kuei; Chen, Haw-Wen
2017-03-01
Andrographolide, the main bioactive component of the medicinal plant Andrographis paniculata, has been shown to possess potent anti-inflammatory activity. Endothelin 1 (ET-1), a potent vasoconstrictor peptide produced by vascular endothelial cells, displays proinflammatory property. Hypoxia-inducible factor 1α (HIF-1α), the regulatory member of the transcription factor heterodimer HIF-1α/β, is one of the most important molecules that responds to hypoxia. Changes in cellular HIF-1α protein level are the result of altered gene transcription and protein stability, with the latter being dependent on prolyl hydroxylases (PHDs). In this study, inhibition of pro-inflammatory ET-1 expression and changes of HIF-1α gene transcription and protein stability under hypoxia by andrographolide in EA.hy926 endothelial-like cells were investigated. Hypoxic conditions were created using the hypoxia-mimetic agent CoCl 2. We found that hypoxia stimulated the production of reactive oxygen species (ROS), the expression of HIF-1α mRNA and protein, and the expression and secretion of ET-1. These effects, however, were attenuated by co-exposure to andrographolide, bilirubin, and RuCO. Silencing Nrf2 and heme oxygenase 1 (HO-1) reversed the inhibitory effects of andrographolide on hypxoia-induced HIF-1α mRNA and protein expression. Moreover, andrographolide increased the expression of prolyl hydroxylases (PHD) 2/3, which hydroxylate HIF-1α and promotes HIF-1α proteasome degradation, with an increase in HIF-1α hydroxylation was noted under hypoxia. Inhibition of p38 MAPK abrogated the hypoxia-induced increases in HIF-1α mRNA and protein expression as well as ET-1 mRNA expression and secretion. Taken together, these results suggest that andrographolide suppresses hypoxia-induced pro-inflammatory ET-1 expression by activating Nrf2/HO-1, inhibiting p38 MAPK signaling, and promoting PHD2/3 expression. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 918-930, 2017. © 2016 Wiley
Huda, Kazi Md Kamrul; Banu, Mst Sufara Akhter; Pathi, Krishna Mohan; Tuteja, Narendra
2013-01-01
Plasma membrane Ca(2+)ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca(2+)) from the cell, hence regulating Ca(2+) level within cells. Though plant Ca(2+)ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied. The 1478 bp promoter sequence of rice plasma membrane Ca(2+)ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca(2+)ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The -1478 to -886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for -1210 and -886 bp flanking region. The -1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The -1210 and -886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the -886 bp and -519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs. The rice plasma membrane Ca(2+)ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible nature of this
Directory of Open Access Journals (Sweden)
Kazi Md Kamrul Huda
Full Text Available Plasma membrane Ca(2+ATPase is a transport protein in the plasma membrane of cells and helps in removal of calcium (Ca(2+ from the cell, hence regulating Ca(2+ level within cells. Though plant Ca(2+ATPases have been shown to be involved in plant stress responses but their promoter regions have not been well studied.The 1478 bp promoter sequence of rice plasma membrane Ca(2+ATPase contains cis-acting elements responsive to stresses and plant hormones. To identify the functional region, serial deletions of the promoter were fused with the GUS sequence and four constructs were obtained. These were differentially activated under NaCl, PEG cold, methyl viologen, abscisic acid and methyl jasmonate treatments. We demonstrated that the rice plasma membrane Ca(2+ATPase promoter is responsible for vascular-specific and multiple stress-inducible gene expression. Only full-length promoter showed specific GUS expression under stress conditions in floral parts. High GUS activity was observed in roots with all the promoter constructs. The -1478 to -886 bp flanking region responded well upon treatment with salt and drought. Only the full-length promoter presented cold-induced GUS expression in leaves, while in shoots slight expression was observed for -1210 and -886 bp flanking region. The -1210 bp deletion significantly responded to exogenous methyl viologen and abscisic acid induction. The -1210 and -886 bp flanking region resulted in increased GUS activity in leaves under methyl jasmonate treatments, whereas in shoots the -886 bp and -519 bp deletion gave higher expression. Salicylic acid failed to induce GUS activities in leaves for all the constructs.The rice plasma membrane Ca(2+ATPase promoter is a reproductive organ-specific as well as vascular-specific. This promoter contains drought, salt, cold, methyl viologen, abscisic acid and methyl jasmonate related cis-elements, which regulated gene expression. Overall, the tissue-specificity and inducible
Gómez-Herreros, Fernando; Zagnoli-Vieira, Guido; Ntai, Ioanna; Martínez-Macías, María Isabel; Anderson, Rhona M; Herrero-Ruíz, Andrés; Caldecott, Keith W
2017-08-10
DNA double-strand breaks (DSBs) induced by abortive topoisomerase II (TOP2) activity are a potential source of genome instability and chromosome translocation. TOP2-induced DNA double-strand breaks are rejoined in part by tyrosyl-DNA phosphodiesterase 2 (TDP2)-dependent non-homologous end-joining (NHEJ), but whether this process suppresses or promotes TOP2-induced translocations is unclear. Here, we show that TDP2 rejoins DSBs induced during transcription-dependent TOP2 activity in breast cancer cells and at the translocation 'hotspot', MLL. Moreover, we find that TDP2 suppresses chromosome rearrangements induced by TOP2 and reduces TOP2-induced chromosome translocations that arise during gene transcription. Interestingly, however, we implicate TDP2-dependent NHEJ in the formation of a rare subclass of translocations associated previously with therapy-related leukemia and characterized by junction sequences with 4-bp of perfect homology. Collectively, these data highlight the threat posed by TOP2-induced DSBs during transcription and demonstrate the importance of TDP2-dependent non-homologous end-joining in protecting both gene transcription and genome stability.DNA double-strand breaks (DSBs) induced by topoisomerase II (TOP2) are rejoined by TDP2-dependent non-homologous end-joining (NHEJ) but whether this promotes or suppresses translocations is not clear. Here the authors show that TDP2 suppresses chromosome translocations from DSBs introduced during gene transcription.
Drug-induced gingival enlargement: Series of cases
Directory of Open Access Journals (Sweden)
Isabella Manzur-Villalobos
2018-01-01
Full Text Available Introduction: Gingival enlargement (GA is a benign condition of the oral cavity that is characterized by the excessive growth of the gingiva in mass and volume. This lesion is not only caused by hereditary factors or poor oral hygiene, but also by the intake of medications, including antihypertensive, anticonvulsant and immunosuppressive drugs. Objective: To sensitize the prevention or early care in patients with pathologies that merit the use of antihypertensive and anticonvulsants in conjunction with the dentist, to treat or avoid the drug-induced gingival enlargement (DIGE. Materials and methods: A series of clinical cases of patients with gingival enlargement by various drugs are reported, including Phenytoin, Amlodipine and Nifedipine. Periodontal and gingivectomy hygienic phase measures were applied to obtain better effects. Results: Satisfactory results were obtained with a considerable decrease in DIGE. Conclusions: The integral management is important in conjunction with the treating physician to follow up the drug that can be generating gingival enlargement. It is necessary to employ an initial approach with strategies of periodontal hygiene, and in severe cases and, as last resort, the periodontal surgery with gingivectomy and gingivoplasty.
Genomic Influences on Hyperuricemia and Gout.
Merriman, Tony
2017-08-01
Genome-wide association studies (GWAS) have identified nearly 30 loci associated with urate concentrations that also influence the subsequent risk of gout. The ABCG2 Q141 K variant is highly likely to be causal and results in internalization of ABCG2, which can be rescued by drugs. Three other GWAS loci contain uric acid transporter genes, which are also highly likely to be causal. However identification of causal genes at other urate loci is challenging. Finally, relatively little is known about the genetic control of progression from hyperuricemia to gout. Only 4 small GWAS have been published for gout. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Arpiainen, Satu; Jaervenpaeae, Sanna-Mari; Manninen, Aki; Viitala, Pirkko; Lang, Matti A.; Pelkonen, Olavi; Hakkola, Jukka
2008-01-01
The nutritional state of organisms and energy balance related diseases such as diabetes regulate the metabolism of xenobiotics such as drugs, toxins and carcinogens. However, the mechanisms behind this regulation are mostly unknown. The xenobiotic-metabolizing cytochrome P450 (CYP) 2A5 enzyme has been shown to be induced by fasting and by glucagon and cyclic AMP (cAMP), which mediate numerous fasting responses. Peroxisome proliferator-activated receptor γ coactivator (PGC)-1α triggers many of the important hepatic fasting effects in response to elevated cAMP levels. In the present study, we were able to show that cAMP causes a coordinated induction of PGC-1α and CYP2A5 mRNAs in murine primary hepatocytes. Furthermore, the elevation of the PGC-1α expression level by adenovirus mediated gene transfer increased CYP2A5 transcription. Co-transfection of Cyp2a5 5' promoter constructs with the PGC-1α expression vector demonstrated that PGC-1α is able to activate Cyp2a5 transcription through the hepatocyte nuclear factor (HNF)-4α response element in the proximal promoter of the Cyp2a5 gene. Chromatin immunoprecipitation assays showed that PGC-1α binds, together with HNF-4α, to the same region at the Cyp2a5 proximal promoter. In conclusion, PGC-1α mediates the expression of CYP2A5 induced by cAMP in mouse hepatocytes through coactivation of transcription factor HNF-4α. This strongly suggests that PGC-1α is the major factor mediating the fasting response of CYP2A5
Directory of Open Access Journals (Sweden)
Ylva Haasum
Full Text Available Many drugs increase the risk of falls in old age. Although persons with Parkinson's disease (PD are at increased risk of experiencing falls and fractures, the use of fall-risk inducing drugs (FRIDs in this population has not previously been investigated. The objective of this study was to investigate the burden of use of FRIDs in older persons treated with anti-Parkinson drugs (APD; used as a proxy for PD, compared to persons without APD.We analyzed individual data on age, sex, type of housing and drug use in 1 346 709 persons aged ≥ 65 years in the Swedish Prescribed Drug Register on the date of 30 September 2008. Main outcome measure was the use of FRIDs.FRIDs were used by 79% of persons with APD and 75% of persons without APD. Persons with APD were more likely to use ≥ 1 FRIDs compared to persons without APD (adjusted OR: 1.09; 95% CI: 1.06-1-12. The association was stronger for concomitant use of ≥ 5 FRIDS (adjusted OR: 1.49; 95% CI: 1.44-1.55.The high use of FRIDs among persons with APD indicates that these patients may be at increased risk of drug-induced falls. Further studies are needed to investigate how these drugs affect the risk of falling in persons with PD.
Zhang, Yuelei; Yin, Junhui; Ding, Hao; Zhang, Changqing; Gao, You-Shui
2016-01-01
Glucocorticoid has been reported to decrease blood vessel number and harm the blood supply in the femoral head, which is recognized to be an important mechanism of glucocorticoid-induced osteonecrosis of the femoral head (ONFH). To prevent glucocorticoid-induced ONFH, medication that promotes both bone formation and angiogenesis would be ideal. Vitamin K2 has been revealed to play an important role in bone metabolism; however, few studies have focused on the effect of Vitamin K2 on new vascular formation. Thus, this study aimed to investigate whether Vitamin K2 promoted new blood vessel formation in the presence of glucocorticoids, both in vitro and in vivo. The effect of Vitamin K2 on viability, migration, in vitro tube formation, and VEGF, vWF, CD31, KDR, Flt and PDGFB in EAhy926 incubated with or without dexamethasone were elucidated. VEGF, TGF-β and BMP-2, angiogenesis-related proteins secreted by osteoblasts, were also detected in the osteoblast-like cell line of MG63. In addition, blood vessels of the femoral head in rats administered with or without methylprednisolone and Vitamin K2 were evaluated using angiography and CD31 staining. In vitro studies showed that Vitamin K2 significantly protected endothelial cells from dexamethasone-induced apoptosis, promoted endothelial cell migration and in vitro tube formation. Angiogenesis-related proteins both in EAhy926 and MG63 were also upregulated by Vitamin K2 when cotreated with dexamethasone. In vivo studies showed enhanced blood vessel volume and CD31-positive staining cells in rats cotreated with VK2 and methylprednisolone compared to rats treated with methylprednisolone only. Collectively, Vitamin K2 has the ability to promote angiogenesis in vitro and to ameliorate vessels of the femoral head in glucocorticoid-treated rats in vivo, indicating that Vitamin K2 is a promising drug that may be used to prevent steroid-induced ONFH.