WorldWideScience

Sample records for drug resistance mdr

  1. Significance of MDR1 and multiple drug resistance in refractory human epileptic brain

    Directory of Open Access Journals (Sweden)

    Dini Gabriele

    2004-10-01

    Full Text Available Abstract Background The multiple drug resistance protein (MDR1/P-glycoprotein is overexpressed in glia and blood-brain barrier (BBB endothelium in drug refractory human epileptic tissue. Since various antiepileptic drugs (AEDs can act as substrates for MDR1, the enhanced expression/function of this protein may increase their active extrusion from the brain, resulting in decreased responsiveness to AEDs. Methods Human drug resistant epileptic brain tissues were collected after surgical resection. Astrocyte cell cultures were established from these tissues, and commercially available normal human astrocytes were used as controls. Uptake of fluorescent doxorubicin and radioactive-labeled Phenytoin was measured in the two cell populations, and the effect of MDR1 blockers was evaluated. Frozen human epileptic brain tissue slices were double immunostained to locate MDR1 in neurons and glia. Other slices were exposed to toxic concentrations of Phenytoin to study cell viability in the presence or absence of a specific MDR1 blocker. Results MDR1 was overexpressed in blood vessels, astrocytes and neurons in human epileptic drug-resistant brain. In addition, MDR1-mediated cellular drug extrusion was increased in human 'epileptic' astrocytes compared to 'normal' ones. Concomitantly, cell viability in the presence of cytotoxic compounds was increased. Conclusions Overexpression of MDR1 in different cell types in drug-resistant epileptic human brain leads to functional alterations, not all of which are linked to drug pharmacokinetics. In particular, the modulation of glioneuronal MDR1 function in epileptic brain in the presence of toxic concentrations of xenobiotics may constitute a novel cytoprotective mechanism.

  2. Isolation, Characterization and Anti-Multiple Drug Resistant (MDR ...

    African Journals Online (AJOL)

    (MDR) Bacterial Activity of Endophytic Fungi Isolated from ... Institute of Protection & Development of Beibu Wan Ocean Resources, Qinzhou University, Qinzhou, Guangxi Province, ..... isolated from secondary metabolites of the mangrove.

  3. Molecular approaches for detection of the multi-drug resistant tuberculosis (MDR-TB in Bangladesh.

    Directory of Open Access Journals (Sweden)

    Tafsina Haque Aurin

    Full Text Available The principal obstacles in the treatment of tuberculosis (TB are delayed and inaccurate diagnosis which often leads to the onset of the drug resistant TB cases. To avail the appropriate treatment of the patients and to hinder the transmission of drug-resistant TB, accurate and rapid detection of resistant isolates is critical. Present study was designed to demonstrate the efficacy of molecular techniques inclusive of line probe assay (LPA and GeneXpert MTB/RIF methods for the detection of multi-drug resistant (MDR TB. Sputum samples from 300 different categories of treated and new TB cases were tested for the detection of possible mutation in the resistance specific genes (rpoB, inhA and katG through Genotype MTBDRplus assay or LPA and GeneXpert MTB/RIF tests. Culture based conventional drug susceptibility test (DST was also carried out to measure the efficacy of the molecular methods employed. Among 300 samples, 191 (63.7% and 193 (64.3% cases were found to be resistant against rifampicin in LPA and GeneXpert methods, respectively; while 189 (63% cases of rifampicin resistance were detected by conventional DST methods. On the other hand, 196 (65.3% and 191 (63.7% isolates showed isoniazid resistance as detected by LPA and conventional drug susceptibility test (DST, respectively. Among the drug resistant isolates (collectively 198 in LPA and 193 in conventional DST, 189 (95.6% and 187 (96.9% were considered to be MDR as examined by LPA and conventional DST, respectively. Category-II and -IV patients encountered higher frequency of drug resistance compared to those from category-I and new cases. Considering the higher sensitivity, specificity and accuracy along with the required time to results significantly shorter, our study supports the adoption of LPA and GeneXpert assay as efficient tools in detecting drug resistant TB in Bangladesh.

  4. Molecular detection of multi drug resistant tuberculosis (mdr-tb) in mdr-tb patients' attendant in north western pakistan

    International Nuclear Information System (INIS)

    Shah, T.; Hayat, A.; Shah, Z.; Hayat, A.; Khan, S.B.

    2017-01-01

    Objective: To determine the drugs susceptibility pattern of mycobacterium tuberculosis (M.TB) in multi-drug resistant tuberculosis (MDR-TB) patients' attendants in North Western, Pakistan. Study Design: Cross sectional study. Place and Duration of Study: This study was conducted at Peshawar Tuberculosis Research Laboratory (PTRL), Provincial TB Control Program Hayatabad Medical Complex Peshawar, (KP) from August 2013 to March 2014. Material and Methods: A cross sectional study in which four hundred and eighty sputum samples from MDR-TB patients' attendants were processed for the detection of M.TB through Ziehl-Neelsen staining, Lowenstein-Jensen, BACTEC MGIT-960 culture and line probe assay. Results: Out of 480 samples, 06 (2.1%) were found positive for M.TB through Ziehl-Neelsen staining while 10 (2.8%) were positive through LJ and BACTEC MGIT-960 culture. The 10 positive samples were further subjected to drugs susceptibility testing and line probes assay test to find out rifampicin, isoniazid, streptomycin and ethambutol resistant and it was found that 6 M.TB isolates were resistant while 4 were sensitive to rifampicin and isoniazid. Among the 6 resistant M.TB strains, 4 showed mutation in rpoB gene at 531, 516 and 526 codons. Conclusion: Majority of MDR-TB patients' attendants had drug-resistant tuberculosis and the rate of drug susceptible TB was low. (author)

  5. ANTIBACTERIAL ACTIVITY OF DRACONTOMELON DAO EXTRACTS ON METHICILLIN-RESISTANT S. AUREUS (MRSA) AND E. COLI MULTIPLE DRUG RESISTANCE (MDR).

    Science.gov (United States)

    Yuniati, Yuniati; Hasanah, Nurul; Ismail, Sjarif; Anitasari, Silvia; Paramita, Swandari

    2018-01-01

    Staphylococcus aureus , methicillin-resistant and Escherichia coli , multidrug-resistant included in the list of antibiotic-resistant priority pathogens from WHO. As multidrug-resistant bacteria problem is increasing, it is necessary to probe new sources for identifying antimicrobial compounds. Medicinal plants represent a rich source of antimicrobial agents. One of the potential plants for further examined as antibacterial is Dracontomelon dao (Blanco) Merr. & Rolfe. The present study designed to find the antibacterial activity of D. dao stem bark extracts on Methicillin-resistant S. aureus (MRSA) and E. coli Multiple Drug Resistance (MDR), followed by determined secondary metabolites with antibacterial activity and determined the value of MIC (minimum inhibitory concentration) and MBC (minimum bactericidal concentration). D. dao stem bark extracted using 60% ethanol. Disc diffusion test methods used to find the antibacterial activity, following by microdilution methods to find the value of MIC and MBC. Secondary metabolites with antibacterial activity determined by bioautography using TLC (thin layer chromatography) methods. D. dao stem bark extracts are sensitive to MSSA, MRSA and E.coli MDR bacteria. The inhibition zone is 16.0 mm in MSSA, 11.7 mm in MRSA and 10.7 mm in E. coli MDR. The entire MBC/MIC ratios for MSSA, MRSA and E.coli MDR is lower than 4. The ratio showed bactericidal effects of D. dao stem bark extracts. In TLC results, colorless bands found to be secondary metabolites with antibacterial activity. D. dao stem bark extracts are potential to develop as antibacterial agent especially against MRSA and E. coli MDR strain.

  6. Development of PET and SPECT radiopharmaceuticals to study multi-drug resistance (MDR)

    International Nuclear Information System (INIS)

    Katsififs, A.; Dikic, B.; Greguric, I.; Knott, R.; Mattner, F.

    2002-01-01

    Full text: Cellular resistance or Multidrug Resistance (MDR) to cytotoxic agents is the major cause of treatment failure in many human cancers. P-glycoprotein (Pgp), a Mr 17,0000 transmembrane protein and Multi Resistance Protein (MRP) are two proteins that are over expressed and confer resistance to a large number of chemotherapeutic agents by enhancing their extracellular transport. P-glycoprotein is expressed at a relative high level in treated and untreated human malignant tumours, including renal, colonic, adrenal, hepatocellular carcinoma and a considerable percentage of breast carcinomas. 99m Tc-Sestamibi, a lipophilic cationic complex is a transport substrate for Pgp. In clinical studies of human neoplasms it was found that tumour uptake and clearance of this tracer correlate with Pgp expression and may be used for the phenotypic assessment of MDR. However, new tracers with better substrate specificity for Pgp and other drug transporters would greatly assist in optimising chemotherapeutic treatment and improving patient management by predicting tumour response to therapy and to assist in the development of antagonists, which may reverse or halt MDR. The aim of this project is therefore to develop PET and SPECT radiopharmaceuticals with improved affinity and selectivity for Pgp and MRP for the clinical evaluation of MDR in cancer patients. To optimise cellular transport characteristics, a number of chemical families that have been found to be substrates of Pgp and other drug efflux pumps, will be investigated. In the first instance, a series of drugs based on the flavonol natural product, Quercetin will be developed, screened for MDR and radiolabelled with PET and SPECT isotopes. Quercetin and related flavonol derivatives have been selected for this project because of their moderate to good affinity for Pgp. With the assistance of molecular modeling and in vitro studies, structural modification will be undertaken to improve the specificity and affinity for

  7. Analysis of multi drug resistant tuberculosis (MDR-TB) financial protection policy: MDR-TB health insurance schemes, in Chhattisgarh state, India.

    Science.gov (United States)

    Kundu, Debashish; Sharma, Nandini; Chadha, Sarabjit; Laokri, Samia; Awungafac, George; Jiang, Lai; Asaria, Miqdad

    2018-01-27

    There are significant financial barriers to access treatment for multi drug resistant tuberculosis (MDR-TB) in India. To address these challenges, Chhattisgarh state in India has established a MDR-TB financial protection policy by creating MDR-TB benefit packages as part of the universal health insurance scheme that the state has rolled out in their effort towards attaining Universal Health Coverage for all its residents. In these schemes the state purchases health insurance against set packages of services from third party health insurance agencies on behalf of all its residents. Provider payment reform by strategic purchasing through output based payments (lump sum fee is reimbursed as per the MDR-TB benefit package rates) to the providers - both public and private health facilities empanelled under the insurance scheme was the key intervention. To understand the implementation gap between policy and practice of the benefit packages with respect to equity in utilization of package claims by the poor patients in public and private sector. Data from primary health insurance claims from January 2013 to December 2015, were analysed using an extension of 'Kingdon's multiple streams for policy implementation framework' to explain the implementation gap between policy and practice of the MDR-TB benefit packages. The total number of claims for MDR-TB benefit packages increased over the study period mainly from poor patients treated in public facilities, particularly for the pre-treatment evaluation and hospital stay packages. Variations and inequities in utilizing the packages were observed between poor and non-poor beneficiaries in public and private sector. Private providers participation in the new MDR-TB financial protection mechanism through the universal health insurance scheme was observed to be much lower than might be expected given their share of healthcare provision overall in India. Our findings suggest that there may be an implementation gap due to weak

  8. Pharmacological modification of multi-drug resistance (MDR) in vitro detected by a novel fluorometric microculture cytotoxicity assay. Reversal of resistance and selective cytotoxic actions of cyclosporin A and verapamil on MDR leukemia T-cells.

    Science.gov (United States)

    Larsson, R; Nygren, P

    1990-07-15

    A novel fluorometric microculture cytotoxicity assay (FMCA), based on measurements of fluorescein diacetate (FDA) hydrolysis and DNA staining by Hoechst 33342, was used for drug sensitivity testing and detection of resistance reversal in acute lymphoblastic leukemia (ALL) cell lines. The 72-hr assay was found to be sensitive, reproducible and linearly related to the number of viable cells within a broad range of cell concentrations. At clinically achievable drug concentrations, the calcium channel blocker Verapamil (ver) and the immunosuppressant Cyclosporin A (csA) were found to partly reverse acquired Vincristine (vcr) resistance in multi-drug resistant (MDR) T-ALL L100 cells with little or no effect on the drug-sensitive parental L0 cell line. By combining the fluorometric indices, we found that low concentrations of csA were growth-inhibitory, whereas higher concentrations (greater than 10 micrograms/ml) were progressively cytotoxic for drug-sensitive L0 cells. In MDR L100 cells, on the other hand, csA produced significant cell kill even at low drug concentrations. Ver had no effects on sensitive L0 cells but showed considerable cytotoxic action towards MDR L100 cells. There was no apparent relationship between drug reversal of vcr resistance and the cytotoxic actions of the drug per se since the calcium channel blocker diltiazem (dil) significantly potentiated the actions of vcr on MDR L100 cells without being more toxic to these cells (compared to vcr-sensitive L0 cells).

  9. Anaplasia and drug selection-independent overexpression of the multidrug resistance gene, MDR1, in Wilms' tumor.

    Science.gov (United States)

    Re, G G; Willingham, M C; el Bahtimi, R; Brownlee, N A; Hazen-Martin, D J; Garvin, A J

    1997-02-01

    One reason for the failure of chemotherapy is the overexpression of the multidrug resistance gene, MDR1. The product of this gene is the multidrug transporter P-glycoprotein, an ATP-dependent pump that extrudes drugs from the cytoplasm. Some tumors inherently express P-glycoprotein, whereas others acquire the ability to do so after exposure to certain chemotherapeutic agents, often by the mechanism of gene amplification. Classical Wilms' tumors (nephroblastoma) typically respond to therapy and have a good prognosis. On the contrary, anaplastic Wilms' tumors are generally refractory to chemotherapy. These anaplastic variants are rare (4.5% of all Wilms' tumors reported in the United States), aggressive, and often fatal forms of tumor, which are commonly thought to result from the progression of classical Wilms' tumors. To investigate the basis for this differential response to therapy, we examined a number of classical and anaplastic Wilms' tumors for the expression of the MDR1 gene by immunohistochemical and mRNA analysis. Classical Wilms' tumors consistently did not express P-glycoprotein except in areas of tubular differentiation, as in normal kidney. Similarly, two of three anaplastic tumors failed to show P-glycoprotein expression. In contrast, cultured cells derived from a third anaplastic tumor, W4, exhibited strong P-glycoprotein expression and were drug resistant in vitro. Southern analysis revealed that W4 cells contained a single copy of the MDR1 gene per haploid genome similar to normal cells, demonstrating that the overexpression of MDR1 was not caused by gene amplification. Transcriptional activation of the MDR1 gene would be in keeping with the concept that p53 might act as a transcriptional repressor of the MDR1 gene.

  10. Inhibition of ABCB1 (MDR1 expression by an siRNA nanoparticulate delivery system to overcome drug resistance in osteosarcoma.

    Directory of Open Access Journals (Sweden)

    Michiro Susa

    2010-05-01

    Full Text Available The use of neo-adjuvant chemotherapy in treating osteosarcoma has improved patients' average 5 year survival rate from 20% to 70% in the past 30 years. However, for patients who progress after chemotherapy, its effectiveness diminishes due to the emergence of multi-drug resistance (MDR after prolonged therapy.In order to overcome both the dose-limiting side effects of conventional chemotherapeutic agents and the therapeutic failure resulting from MDR, we designed and evaluated a novel drug delivery system for MDR1 siRNA delivery. Novel biocompatible, lipid-modified dextran-based polymeric nanoparticles were used as the platform for MDR1 siRNA delivery; and the efficacy of combination therapy with this system was evaluated. In this study, multi-drug resistant osteosarcoma cell lines (KHOS(R2 and U-2OS(R2 were treated with the MDR1 siRNA nanocarriers and MDR1 protein (P-gp expression, drug retention, and immunofluoresence were analyzed. Combination therapy of the MDR1 siRNA loaded nanocarriers with increasing concentrations of doxorubicin was also analyzed. We observed that MDR1 siRNA loaded dextran nanoparticles efficiently suppresses P-gp expression in the drug resistant osteosarcoma cell lines. The results also demonstrated that this approach may be capable of reversing drug resistance by increasing the amount of drug accumulation in MDR cell lines.Lipid-modified dextran-based polymeric nanoparticles are a promising platform for siRNA delivery. Nanocarriers loaded with MDR1 siRNA are a potential treatment strategy for reversing MDR in osteosarcoma.

  11. Multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP and lung resistance protein (LRP gene expression in childhood acute lymphoblastic leukemia

    Directory of Open Access Journals (Sweden)

    Elvis Terci Valera

    Full Text Available CONTEXT: Despite the advances in the cure rate for acute lymphoblastic leukemia, approximately 25% of affected children suffer relapses. Expression of genes for the multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP, and lung resistance protein (LRP may confer the phenotype of resistance to the treatment of neoplasias. OBJECTIVE: To analyze the expression of the MDR-1, MRP and LRP genes in children with a diagnosis of acute lymphoblastic leukemia via the semiquantitative reverse transcription polymerase chain reaction (RT-PCR, and to determine the correlation between expression and event-free survival and clinical and laboratory variables. DESIGN: A retrospective clinical study. SETTING: Laboratory of Pediatric Oncology, Department of Pediatrics, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Brazil. METHODS: Bone marrow aspirates from 30 children with a diagnosis of acute lymphoblastic leukemia were assessed for the expression of messenger RNA for the MDR-1, MRP and LRP genes by semi-quantitative RT-PCR. RESULTS: In the three groups studied, only the increased expression of LRP was related to worsened event-free survival (p = 0.005. The presence of the common acute lymphoblastic leukemia antigen (CALLA was correlated with increased LRP expression (p = 0.009 and increased risk of relapse or death (p = 0.05. The relative risk of relapse or death was six times higher among children with high LRP expression upon diagnosis (p = 0.05, as confirmed by multivariate analysis of the three genes studied (p = 0.035. DISCUSSION: Cell resistance to drugs is a determinant of the response to chemotherapy and its detection via RT-PCR may be of clinical importance. CONCLUSIONS: Evaluation of the expression of genes for resistance to antineoplastic drugs in childhood acute lymphoblastic leukemia upon diagnosis, and particularly the expression of the LRP gene, may be of clinical relevance, and should be the

  12. vPARP Adjusts MVP Expression in Drug-resistant Cell Lines in Conjunction with MDR Proteins.

    Science.gov (United States)

    Wojtowicz, Karolina; Januchowski, Radoslaw; Nowicki, Michal; Zabel, Maciej

    2017-06-01

    The definition of vault (ribonucleoprotein particles) function remains highly complex. Vaults may cooperate with multidrug resistance (MDR) proteins, supporting their role in drug resistance. This topic is the main theme of this publication. The cell viability was determined by an MTT assay. The protein expression was detected by western blot analysis. The proteins were knocked-down using siRNA. No major vault protein (MVP) in the LoVo/Dx and W1PR cell lines after tunicamycin treatment was shown. In W1PR cells with knocked-down MVP, a statistically significant decrease in cell viability was noted. In LoVo/Dx, W1TR and A2780TR cells were vault poly-ADP-ribose polymerase (vPARP) was knockdown, a decrease in cell viability was shown. Also, MVP silencing induced an increase in glycoprotein P (Pgp) expression in LoVo/Dx cells. MVP is important for the drug resistance of cancer cells, but it probably requires the presence of vPARP for full activation. Some correlations between MDR proteins and vaults exist. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  13. Multi-drug resistance (MDR1 gene and P-glycoprotein influence on pharmacokinetic and pharmacodymanic of therapeutic drugs

    Directory of Open Access Journals (Sweden)

    Linardi Renata Lehn

    2006-01-01

    Full Text Available (MDR1 gene expressed in tumor cells and also in several normal tissues, such as intestine, liver, kidney, blood-brain barrier, spinal cord, and placenta. P-gp has been identified in mice, rat, bovine, monkey, rodents, and human beings and has been receiving a particular clinical relevance because this protein expression limits brain access and intestinal absorption of many drugs. This protein plays a role as a protective barrier against a wide variety of substrates, avoiding drug entry into the central nervous system. P-glycoprotein also interferes with drug bioavailability and disposition, including absorption, distribution, metabolization, and excretion, influencing pharmacokinetic and pharmacodynamic of drugs. Modulation of P-gp may help the efficacy of treatment of several diseases and can explain some adverse central nervous system effects induced by drugs after intravenous administration and the poor response of oral administration in patients. Alteration in P-gp expression or function has been associated with several diseases susceptibility in humans and animals. Furthermore, additional studies relating MDR1 and P-gp expression has an important clinical implication also in terms of treatment efficacy.

  14. [Polymorphisms of the multiple drug resistance gene (MDR1) in Mapuche, Mestizo and Maori populations in Chile].

    Science.gov (United States)

    Wielandt, Ana María; Vollrath, Valeska; Chianale, José

    2004-09-01

    There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.

  15. Association between C3435T polymorphism of MDR1 gene and the incidence of drug-resistant epilepsy in the population of Polish children.

    Science.gov (United States)

    Stasiołek, Mariusz; Romanowicz, Hanna; Połatyńska, Katarzyna; Chamielec, Maciej; Skalski, Dominik; Makowska, Marianna; Smolarz, Beata

    2016-07-08

    Epilepsy is a disease of neurological character. Approximately one third of epileptic patients demonstrate a drug-resistant phenotype, which is associated with the development of drug-resistant epilepsy. The multidrug resistance protein 1 and glycoprotein P, encoded by MDR1, play a significant role in the transmembrane transport of anti-epileptic agents. Single nucleotide polymorphism C3435T (rs1045642) within MDR1 gene may be associated with an increased expression of P-gp which affects the levels of antiepileptic drugs in plasma. The presented studies analysed the association between C3435T polymorphism of MDR1 gene and the incidence of drug-resistant epilepsy in the population of Polish children. C3435T polymorphism of MDR1 gene was analysed by the high resolution melting technique in a group of patients with drug-resistant (n = 106) and drug-responsive epilepsy (n = 67), as well as in non-epileptic children (n = 98) hospitalised at the Department of Neurology, Polish Mother's Memorial Hospital in Lodz. Genotype and allele distributions were evaluated and their compatibility with the Hardy-Weinberg distribution was assessed by means of the χ(2) test. Genotype and allele evaluation, regarding their relationship with a given feature, was supported by an analysis of odds ratio and 95 % confidence interval, calculated according to the logistic regression model. An association was observed between the incidence rate of DRE and the presence of C allele in C3435T polymorphism of MDR1 gene, which may enhance the risk of the disease. The T allele may then play a protective role. No differences were found in the studied groups, regarding either genotype or allele distribution in reference to patient's gender or concomitant diseases. Following the obtained results, C3435T polymorphism of MDR1 gene may be connected with the incidence of drug-resistant epilepsy in the population of Polish children. ISRCTN ISRCTN73824458. Registered 28th September 2014.

  16. Efficacy and safety profile of linezolid in the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis: a systematic review and meta-analysis.

    Science.gov (United States)

    Agyeman, Akosua Adom; Ofori-Asenso, Richard

    2016-06-22

    Treatment options for drug-resistant tuberculosis are still limited. Linezolid has been recommended for treatment of patients with multidrug-resistant (MDR) or extensively-drug-resistant (XDR) tuberculosis, although uncertainties remain regarding its safety and tolerability in these circumstances. To systematically evaluate the existing evidence regarding the efficacy and tolerability of linezolid in the treatment of MDR or XDR tuberculosis. We conducted a systematic review and meta-analysis in accordance with the PRISMA guidelines. Searches were conducted in PubMed, Web of Science and EMBASE followed by direct search of abstracts in the International Journal of Tuberculosis and Lung Disease to retrieve primary studies published between January 2000 and January 2016 assessing linezolid efficacy and safety in the treatment of drug-resistant TB. We evaluated the occurrence of outcomes including culture conversion, treatment success and incidence of adverse events such as myelosuppression and neuropathy. Twenty-three (23) studies conducted in fourteen (14) countries and involving 507 patients were retrieved. Only 1 randomized controlled trial was identified and none of the identified studies involved participants from Africa. The pooled proportion for treatment success was 77.36 % (95 % CI = 71.38-82.83 %, I(2) = 37.6 %) with culture conversion rate determined as 88.45 % (95 % CI = 83.82-92.38 %, I(2) = 45.4 %). There was no strong evidence for both culture conversion (p = 0.0948) and treatment success (p = 0.0695) between linezolid daily doses ≤ 600 and > 600 mg. Only myelosuppression showed a strong statistical significance (p linezolid also showed no significance upon dose comparisons (p = 0.3213, p = 0.9050 respectively). Available evidence presents Linezolid as a viable option in the treatment of MDR/XDR TB although patients ought to be monitored closely for the incidence of major adverse events such as myelosuppression and

  17. Development of a Patient-Centred, Psychosocial Support Intervention for Multi-Drug-Resistant Tuberculosis (MDR-TB Care in Nepal.

    Directory of Open Access Journals (Sweden)

    Sudeepa Khanal

    Full Text Available Multi-drug-resistant tuberculosis (MDR-TB poses a major threat to public health worldwide, particularly in low-income countries. The current long (20 month and arduous treatment regime uses powerful drugs with side-effects that include mental ill-health. It has a high loss-to-follow-up (25% and higher case fatality and lower cure-rates than those with drug sensitive tuberculosis (TB. While some national TB programmes provide small financial allowances to patients, other aspects of psychosocial ill-health, including iatrogenic ones, are not routinely assessed or addressed. We aimed to develop an intervention to improve psycho-social well-being for MDR-TB patients in Nepal. To do this we conducted qualitative work with MDR-TB patients, health professionals and the National TB programme (NTP in Nepal. We conducted semi-structured interviews (SSIs with 15 patients (10 men and 5 women, aged 21 to 68, four family members and three frontline health workers. In addition, three focus groups were held with MDR-TB patients and three with their family members. We conducted a series of meetings and workshops with key stakeholders to design the intervention, working closely with the NTP to enable government ownership. Our findings highlight the negative impacts of MDR-TB treatment on mental health, with greater impacts felt among those with limited social and financial support, predominantly married women. Michie et al's (2011 framework for behaviour change proved helpful in identifying corresponding practice- and policy-level changes. The findings from this study emphasise the need for tailored psycho-social support. Recent work on simple psychological support packages for the general population can usefully be adapted for use with people with MDR-TB.

  18. Expression of multi-drug resistance-related genes MDR3 and MRP as prognostic factors in clinical liver cancer patients.

    Science.gov (United States)

    Yu, Zheng; Peng, Sun; Hong-Ming, Pan; Kai-Feng, Wang

    2012-01-01

    To investigate the expression of multi-drug resistance-related genes, MDR3 and MRP, in clinical specimens of primary liver cancer and their potential as prognostic factors in liver cancer patients. A total of 26 patients with primary liver cancer were enrolled. The expression of MDR3 and MRP genes was measured by real-time PCR and the association between gene expression and the prognosis of patients was analyzed by the Kaplan-Meier method and COX regression model. This study showed that increases in MDR3 gene expression were identified in cholangiocellular carcinoma, cirrhosis and HBsAg-positive patients, while MRP expression increased in hepatocellular carcinoma, non-cirrhosis and HBsAg-negative patients. Moreover, conjugated bilirubin and total bile acid in the serum were significantly reduced in patients with high MRP expression compared to patients with low expression. The overall survival tended to be longer in patients with high MDR3 and MRP expression compared to the control group. MRP might be an independent prognostic factor in patients with liver cancer by COX regression analysis. MDR3 and MRP may play important roles in liver cancer patients as prognostic factors and their underlying mechanisms in liver cancer are worthy of further investigation.

  19. Evaluating the Role of Multidrug Resistance Protein 3 (MDR3) Inhibition in Predicting Drug-Induced Liver Injury Using 125 Pharmaceuticals.

    Science.gov (United States)

    Aleo, Michael D; Shah, Falgun; He, Kan; Bonin, Paul D; Rodrigues, A David

    2017-05-15

    The role of bile salt export protein (BSEP) inhibition in drug-induced liver injury (DILI) has been investigated widely, while inhibition of the canalicular multidrug resistant protein 3 (MDR3) has received less attention. This transporter plays a pivotal role in secretion of phospholipids into bile and functions coordinately with BSEP to mediate the formation of bile acid-containing biliary micelles. Therefore, inhibition of MDR3 in human hepatocytes was examined across 125 drugs (70 of Most-DILI-concern and 55 of No-DILI-concern). Of these tested, 41% of Most-DILI-concern and 47% of No-DILI-concern drugs had MDR3 IC 50 values of <50 μM. A better distinction across DILI classifications occurred when systemic exposure was considered where safety margins of 50-fold had low sensitivity (0.29), but high specificity (0.96). Analysis of physical chemical property space showed that basic compounds were twice as likely to be MDR3 inhibitors as acids, neutrals, and zwitterions and that inhibitors were more likely to have polar surface area (PSA) values of <100 Å 2 and cPFLogD values between 1.5 and 5. These descriptors, with different cutoffs, also highlighted a group of compounds that shared dual potency as MDR3 and BSEP inhibitors. Nine drugs classified as Most-DILI-concern compounds (four withdrawn, four boxed warning, and one liver injury warning in their approved label) had intrinsic potency features of <20 μM in both assays, thereby reinforcing the notion that multiple inhibitory mechanisms governing bile formation (bile acid and phospholipid efflux) may confer additional risk factors that play into more severe forms of DILI as shown by others for BSEP inhibitors combined with multidrug resistance-associated protein (MRP2, MRP3, MRP4) inhibitory properties. Avoiding physical property descriptors that highlight dual BSEP and MDR3 inhibition or testing drug candidates for inhibition of multiple efflux transporters (e.g., BSEP, MDR3, and MRPs) may be an effective

  20. Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug-transporting) P-glycoproteins

    NARCIS (Netherlands)

    Schinkel, A. H.; Mayer, U.; Wagenaar, E.; Mol, C. A.; van Deemter, L.; Smit, J. J.; van der Valk, M. A.; Voordouw, A. C.; Spits, H.; van Tellingen, O.; Zijlmans, J. M.; Fibbe, W. E.; Borst, P.

    1997-01-01

    The mdr1-type P-glycoproteins (P-gps) confer multidrug resistance to cancer cells by active extrusion of a wide range of drugs from the cell. To study their physiological roles, we have generated mice genetically deficient in the mdr1b gene [mdr1b (-/-) mice] and in both the mdr1a and mdr1b genes

  1. Molecular identification of marine symbiont bacteria of gastropods from the waters of the Krakal coast Yogyakarta and its potential as a Multi-Drug Resistant (MDR) antibacterial agent

    Science.gov (United States)

    Bahry, Muhammad Syaifudien; Pringgenies, Delianis; Trianto, Agus

    2017-01-01

    The resistance of pathogenic bacteria may occur to many types of antibiotics, especially in cases of non-compliance use of antibiotics, which likely to allow the evolution of Multi-Drug Resistant (MDR) bacteria. Gastropods seas are marine invertebrates informed capable of production of secondary metabolites as antibacterial MDR. The purpose of the study was the isolation and identification of gastropod symbiont bacteria found in the waters of Krakal, Gunung Kidul, Yogyakarta, which has the ability to produce antibacterial compounds against MDR(Escherichia coli, Enterobacter cloacae, Klebsiella pneumoniae, MRSA (methicillin-Resistant Staphylococcus aureus), Staphylococcus aureus, and Staphylococcus homunis) molecular. Stages of this research began with the isolation of bacteria, bacteria screening for anti-MDR compound, mass culture, and extraction, antibacterial activity test, DNA extraction, amplification by PCR 16S rDNA and sequencing. The results of the study showed that 19 isolates of bacteria were isolated from three species of gastropods namely Littorina scabra, Cypraea moneta and Conus ebraeus. Among them, 4 isolates showed activity against MDR test bacteria (E. coli, E. cloacae, K. pneumoniae, S. aureus and S. homunis). The highest activity was displayed by code LS.G1.8 isolate with the largest inhibition zone 15.47±0.45mm on S. humonis at 250 µg/disk concentration. Isolate CM.G2.1 showed largest inhibition zone, with 21.5±0.07mm on MRSA at 1000 µg/disk concentration and isolate the largest inhibition zone CM.G2.5 14.37±0.81mm on MRSA 14.37±0.81mm at concentrations 1000 µg/disk. The molecular identification of isolates LS.G1.8 has 99% homology with Bacillus subtilis and isolates CM.G2.1 has 99% homology with Bacillus pumillus.

  2. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    International Nuclear Information System (INIS)

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.

    1990-01-01

    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy

  3. Active Sputum Monitoring Detects Substantial Rate of Multi-Drug Resistant Tuberculosis (MDR-TB) in an HIV-Infected Population in South Africa

    Science.gov (United States)

    Hassim, Shaheen; Shaw, Pamela A.; Sangweni, Phumelele; Malan, Lizette; Ntshani, Ella; Mathibedi, Monkwe Jethro; Stubbs, Nomso; Metcalf, Julia A; Eckes, Risa; Masur, Henry; Komati, Stephanus

    2010-01-01

    Background Tuberculosis (TB) co-infection with HIV is a substantial problem in South Africa. There has been a presumption that drug resistant strains of TB are common in South Africa, but few studies have documented this impression. Methods In Phidisa, a joint observational and randomized HIV treatment study for South African National Defence Force members and dependents, an initiative obtained microbiologic TB testing in subjects who appeared to be at high risk. We report results for HIV-infected subjects. Results TB was identified by culture in 116/584 (19.9%) of patients selected for sputum examination on the basis of suggestive symptoms. Smear was an insensitive technique for confirming the diagnosis: only 33% of culture-positive patients were identified by smear, with a 0.2% false positive rate. Of the 107 culture-positive individuals with susceptibility testing, 22 (20.6%) were identified to be MDR and 4 (3.7%) became extremely drug resistant tuberculosis (XDR) while under observation. Culture-positive cases with a history of TB treatment had more than twice the rate of MDR than those without, 27.1% vs. 11.9% (p=0.05). Conclusions TB is common in this cohort of HIV-infected patients. Smear was not a sensitive technique for identifying culture-positive cases in this health system. Drug susceptibility testing is essential to proper patient management because MDR was present in 20.6% of culture-positive patients. Better management strategies are needed to reduce the development of MDR-TB since so many such patients had received prior antituberculous therapy that was presumably not curative. PMID:20196651

  4. The roles of variants in human multidrug resistance (MDR1 gene and their haplotypes on antiepileptic drugs response: a meta-analysis of 57 studies.

    Directory of Open Access Journals (Sweden)

    Hui Li

    Full Text Available Previous studies reported the associations between the ATP-binding cassette sub-family B member 1 (ABCB1, also known as MDR1 polymorphisms and their haplotypes with risk of response to antiepileptic drugs in epilepsy, however, the results were inconclusive.The Pubmed, Embase, Web of Science, CNKI and Chinese Biomedicine databases were searched up to July 15, 2014. Pooled odds ratios (ORs and 95% confidence intervals (CIs were calculated using a fixed-effects or random-effects model based on heterogeneity tests. Meta-regression and Galbraith plot analysis were carried out to explore the possible heterogeneity.A total of 57 studies involving 12407 patients (6083 drug-resistant and 6324 drug-responsive patients with epilepsy were included in the pooled-analysis. For all three polymorphisms (C3435T, G2677T/A, and C1236T, we observed a wide spectrum of minor allele frequencies across different ethnicities. A significantly decreased risk of AEDs resistance was observed in Caucasian patients with T allele of C3435T variant, which was still significant after adjusted by multiple testing corrections (T vs C: OR=0.83, 95%CI=0.71-0.96, p=0.01. However, no significant association was observed between the other two variants and AEDs resistance. Of their haplotypes in ABCB1 gene (all studies were in Indians and Asians, no significant association was observed with AEDs resistance. Moreover, sensitivity and Cumulative analysis showed that the results of this meta-analysis were stable.In summary, this meta-analysis demonstrated that effect of C3435T variant on risk of AEDs resistance was ethnicity-dependent, which was significant in Caucasians. Additionally, further studies in different ethnic groups are warranted to clarify possible roles of haplotypes in ABCB1 gene in AEDs resistance, especially in Caucasians.

  5. IPEC-J2 MDR1, a Novel High-Resistance Cell Line with Functional Expression of Human P-glycoprotein (ABCB1) for Drug Screening Studies

    DEFF Research Database (Denmark)

    Saaby, Lasse; Helms, Hans Christian Cederberg; Brodin, Birger

    2016-01-01

    The P-glycoprotein (P-gp) efflux pump has been shown to affect drug distribution and absorption in various organs and to cause drug resistance in cancer therapy. The aim of this work was to develop a cell line to serve as a screening system for potential substrates of P-gp. This requires a cell...... line with high paracellular tightness, low expression of nonhuman ABC transporters, and high expression of functional human P-gp (ABCB1). The porcine intestinal epithelial cell line, IPEC-J2, was selected as a transfection host, due to its ability to form extremely high-resistance monolayers (>10,000 Ω......·cm(2)) and its low endogenous expression of ABC-type efflux transporters. The IPEC-J2 cells were transfected with a plasmid that contained the sequence of the human MDR1 gene, which encodes P-gp, followed by a selection of successfully transfected cells with geneticin and puromycin. The resulting cell...

  6. Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

    Directory of Open Access Journals (Sweden)

    Buddhasukh Duang

    2004-04-01

    Full Text Available Abstract Background Multidrug resistance (MDR is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170, thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. Methods In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn, were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Results Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. Conclusion These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents.

  7. Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

    International Nuclear Information System (INIS)

    Limtrakul, Pornngarm; Anuchapreeda, Songyot; Buddhasukh, Duang

    2004-01-01

    Multidrug resistance (MDR) is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170), thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn), were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin) decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents

  8. Reduced intracellular drug accumulation in drug-resistant leukemia cells is not solely due to MDR-mediated efflux but also to decreased uptake

    Directory of Open Access Journals (Sweden)

    Angela Oliveira Pisco

    2014-10-01

    Full Text Available Expression of ABC family transporter proteins that promote drug efflux from cancer cells is a widely observed mechanism of multi-drug resistance of cancer cells. Cell adaptation in long-term culture of HL60 leukemic cells in the presence of chemotherapy leads to induction and maintenance of the ABC transporters expression, preventing further accumulation of drugs. However, we found that decreased accumulation of drugs and fluorescent dyes was also contributed by a reduced uptake by the resistant cells. Confocal time-lapse microscopy and flow cytometry revealed that fluid-phase endocytosis was diminished in drug-resistant cells compared to drug-sensitive cells. Drug uptake was increased by insulin co-treatment when cells were grown in methylcellulose and monitored under the microscope, but not when cultured in suspension. We propose that multi-drug resistance is not solely achieved by enhanced efflux capacity but also by supressed intake of the drug offering an alternative target to overcome drug resistance or potentiate chemotherapy.

  9. Impact of BCRP/MXR, MRP1 and MDR1/P-Glycoprotein on thermoresistant variants of atypical and classical multidrug resistant cancer cells

    DEFF Research Database (Denmark)

    Stein, Ulrike; Lage, Hermann; Jordan, Andreas

    2002-01-01

    The impact of the ABC transporters breast cancer resistance protein/mitoxantrone resistance associated transporter (BCRP/MXR), multidrug resistance-associated protein 1 (MRP1) and multidrug resistance gene-1/P-glycoprotein (MDR1/PGP) on the multidrug resistance (MDR) phenotype in chemoresistance...... expression of BCRP/MXR and of MRP1 were clearly enhanced (vs. parental and classical MDR lines). MDR1/PGP expression was distinctly elevated in the classical MDR subline EPG85-257RDB (vs. parental and atypical MDR sublines). In all thermoresistant counterparts basal expression of BCRP/MXR, MRP1 and MDR1/PGP...... was increased relative to thermosensitive sublines. Although it could be shown that the overexpressed ABC transporters were functionally active, however, no decreased drug accumulations of doxorubicin, mitoxantrone and rhodamine 123 were observed. Thus, expression of BCRP/MXR, MRP1 and MDR1/PGP was found...

  10. Mortality among MDR-TB cases: comparison with drug-susceptible tuberculosis and associated factors.

    Directory of Open Access Journals (Sweden)

    Kocfa Chung-Delgado

    Full Text Available An increase in multidrug-resistant tuberculosis (MDR-TB cases is evident worldwide. Its management implies a complex treatment, high costs, more toxic anti-tuberculosis drug use, longer treatment time and increased treatment failure and mortality. The aims of this study were to compare mortality between MDR and drug-susceptible cases of tuberculosis, and to determine risk factors associated with mortality among MDR-TB cases.A retrospective cohort study was performed using data from clinical records of the National Strategy for Prevention and Control of Tuberculosis in Lima, Peru. In the first objective, MDR-TB, compared to drug-susceptible cases, was the main exposure variable and time to death, censored at 180 days, the outcome of interest. For the second objective, different variables obtained from clinical records were assessed as potential risk factors for death among MDR-TB cases. Cox regression analysis was used to determine hazard ratios (HR and 95% confidence intervals (95%CI. A total of 1,232 patients were analyzed: mean age 30.9 ±14.0 years, 60.0% were males. 61 patients (5.0% died during treatment, whereas the MDR-TB prevalence was 19.2%. MDR-TB increased the risk of death during treatment (HR = 7.5; IC95%: 4.1-13.4 when compared to presumed drug-susceptible cases after controlling for potential confounders. Education level (p = 0.01, previous TB episodes (p<0.001, diabetes history (p<0.001 and HIV infection (p = 0.04 were factors associated with mortality among MDR-TB cases.MDR-TB is associated with an increased risk of death during treatment. Lower education, greater number of previous TB episodes, diabetes history, and HIV infection were independently associated with mortality among MDR-TB cases. New strategies for appropriate MDR-TB detection and management should be implemented, including drug sensitivity tests, diabetes and HIV screening, as well as guarantee for a complete adherence to therapy.

  11. Detection of expression and modulation of multidrug-resistance (MDR) and establishment of a new bioassay

    International Nuclear Information System (INIS)

    Berger, W.

    1993-08-01

    The present thesis deals with the resistance of human malignant cells against cellular toxicity of anticancer drugs, a phenomenon representing one of the major obstacles to successful chemotherapy. One mechanism underlying a cross-resistance to different drugs called multidrug resistance (MDR) is characterized by the expression of an active transport protein (P-glycoprotein), causing decreased intracellular drug retention and cytotoxicity. The main subjects of the present work were to establish different detection methods for MDR and its modulation (by substances blocking activity of P-glycoprotein) including immunological methods (immunocytochemistry, radioimmunoassay), molecular biology (slot-blot analysis, in-situ hybridization) and functional assays (drug-accumulation analysis, drug-cytotoxicity analysis). The methods were evaluated and compared using human and mouse MDR control cell lines and human tumor cell lines established in our laboratory. In cell lines derived from human melanoma - a malignancy insensitive to chemotherapy - expression of P-glycoprotein of relatively low transporting activity was detected by different methods in 8 of 33 cases. Furthermore a new sensitive in vitro assay for the functional detection of MDR was established using the biological features of cytochalasins, a microfilament disrupting substance group. These compounds were shown to be substrates for the P-glycoprotein efflux pump and their effects on cell division (blockade of cytokinesis resulting in multinucleate cells) correlated with MDR-activity of the tested cells. With this new assay P-glycoprotein activity can be demonstrated and analysed over a wide range of resistance against different cytotoxic drugs. Therefore it may by a suitable tool for research and diagnosis in the field of drug resistance

  12. Carcinogen-induced mdr overexpression is associated with xenobiotic resistance in rat preneoplastic liver nodules and hepatocellular carcinomas.

    Science.gov (United States)

    Fairchild, C R; Ivy, S P; Rushmore, T; Lee, G; Koo, P; Goldsmith, M E; Myers, C E; Farber, E; Cowan, K H

    1987-11-01

    We have previously reported the isolation of a human breast cancer cell line resistant to doxorubicin (adriamycin; AdrR MCF-7 cells) that has also developed the phenotype of multidrug resistance (MDR). MDR in this cell line is associated with increased expression of mdr (P glycoprotein) gene sequences. The development of MDR in AdrR MCF-7 cells is also associated with changes in the expression of several phase I and phase II drug-detoxifying enzymes. These changes are remarkably similar to those associated with development of xenobiotic resistance in rat hyperplastic liver nodules, a well-studied model system of chemical carcinogenesis. Using an mdr-encoded cDNA sequence isolated from AdrR MCF-7 cells, we have examined the expression of mdr sequences in rat livers under a variety of experimental conditions. The expression of mdr increased 3-fold in regenerating liver. It was also elevated (3- to 12-fold) in several different samples of rat hyperplastic nodules and in four of five hepatomas that developed in this system. This suggests that overexpression of mdr, a gene previously associated with resistance to antineoplastic agents, may also be involved in the development of resistance to xenobiotics in rat hyperplastic nodules. In addition, although the acute administration of 2-acetylaminofluorene induced an 8-fold increase in hepatic mdr-encoded RNA, performance of a partial hepatectomy either before or after administration of 2-acetylaminofluorene resulted in a greater than 80-fold increase in mdr gene expression over that in normal untreated livers. This represents an important in vivo model system in which to study the acute regulation of this drug resistance gene.

  13. Initial drug resistance in India

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Initial drug resistance in India. There is gradual increase in primary MDR all over India : Pondi= Pondicherry 1985; Bangalore =1986; Jaipur = 1991; Jaipur =2000. Overall the MDR is less than 3% (TRC studies).

  14. Study of antagonistic effects of Lactobacillus strains as probiotics on multi drug resistant (MDR) bacteria isolated from urinary tract infections (UTIs).

    Science.gov (United States)

    Naderi, Atiyeh; Kasra-Kermanshahi, Roha; Gharavi, Sara; Imani Fooladi, Abbas Ali; Abdollahpour Alitappeh, Meghdad; Saffarian, Parvaneh

    2014-03-01

    Urinary tract infection (UTI) caused by bacteria is one of the most frequent infections in human population. Inappropriate use of antibiotics, often leads to appearance of drug resistance in bacteria. However, use of probiotic bacteria has been suggested as a partial replacement. This study was aimed to assess the antagonistic effects of Lactobacillus standard strains against bacteria isolated from UTI infections. Among 600 samples; those with ≥10,000 cfu/ml were selected as UTI positive samples. Enterococcus sp., Klebsiella pneumoniae, Enterobacter sp., and Escherichia coli were found the most prevalent UTI causative agents. All isolates were screened for multi drug resistance and subjected to the antimicrobial effects of three Lactobacillus strains by using microplate technique and the MICs amounts were determined. In order to verify the origin of antibiotic resistance of isolates, plasmid curing using ethidium bromide and acridine orange was carried out. No antagonistic activity in Lactobacilli suspension was detected against test on Enterococcus and Enterobacter strains and K. pneumoniae, which were resistant to most antibiotics. However, an inhibitory effect was observed for E. coli which were resistant to 8-9 antibiotics. In addition, L. casei was determined to be the most effective probiotic. RESULTS from replica plating suggested one of the plasmids could be related to the gene responsible for ampicillin resistance. Treatment of E. coli with probiotic suspension was not effective on inhibition of the plasmid carrying hypothetical ampicillin resistant gene. Moreover, the plasmid profiles obtained from probiotic-treated isolates were identical to untreated isolates.

  15. Efficacy of moxifloxacin & econazole against multidrug resistant (MDR Mycobacterium tuberculosis in murine model

    Directory of Open Access Journals (Sweden)

    U D Gupta

    2015-01-01

    Full Text Available Background & objectives: Studies have shown the bactericidal potential of econazole and clotrimazole against Mycobacterium tuberculosis under in vitro and ex vivo conditions along with their synergism with conventional antituberculosis drugs. These molecules were also found to be effective against different multidrug resistant (MDR M. tuberculosis isolates in vitro. Hence the present study was designed to evaluate the in vivo antimycobacterial potential of moxifloxacin and econazole alone and in combination against multidrug resistant tuberculosis (MDR-TB in a mice model. Methods: Mice were infected with 2.5×10 [7] bacilli of MDR strain of M. tuberculosis by aerosol route of infection. After four weeks of infection, chemotherapy was started orally by moxifloxacin 8.0 mg/kg body wt and econazole 3.3 mg/kg alone and in combination, as well as with four first line anti-tuberculosis drugs as a positive control. The animals were sacrificed and the lungs and spleen were excised under aspetic conditions. The tissues were homogenized with sterile normal saline, an aliquot of the homogenate was plated on Middlebrook 7H11 agar supplemented with oleate albumin dextrose catalase (OADC and incubated at 37°C for four weeks. The number of visible and individual colonies were counted. Results: The first line anti-tuberculosis drugs (RIF+INH+EMB+PZA after eight weeks of therapy had no impact as the bacillary load in lungs and spleens remained unchanged. However, econazole, moxifloxacin alone as well as in combination significantly reduced the bacillary load in lungs as well as in spleens of MDR-TB bacilli infected mice. Interpretation & conclusions: Co-administration of the two drugs (econazole and moxifloxacin to MDR-TB strain JAL-7782 infected mice exhibited additive effect, the efficacy of the drugs in combination being higher as compared with ECZ or MOX alone. These results were substantiated by histopathological studies. This study suggests the utility of

  16. Treatment Outcomes of Patients with Multidrug-Resistant Tuberculosis (MDR- TB) Compared with Non-MDR-TB Infections in Peninsular Malaysia.

    Science.gov (United States)

    Elmi, Omar Salad; Hasan, Habsah; Abdullah, Sarimah; Mat Jeab, Mat Zuki; Ba, Zilfalil; Naing, Nyi Nyi

    2016-07-01

    Treating patients with multidrug-resistant tuberculosis (MDR-TB) strains is more complicated, complex, toxic, expensive, than treating patients with susceptible TB strains. This study aims to compare the treatment outcomes and potential factors associated between patients with MDR-TB and non MDR TB infections in peninsular Malaysia. This study was a retrospective cohort study. Data were collected from the medical records of all registered MDR-TB patients and Non-MDR-TB patients at five TB hospitals in peninsular Malaysia from January 2010 to January 2014. A total of 314 subjects were studied, including 105 MDR-TB cases and 209 non-MDR-TB. After TB treatment, 24.8% of the MDR-TB patients and 17.7% of non MDR TB relapsed; 17.1% of the MDR-TB patients and 16.3% of non MDR TB defaulted from TB treatment. A significant difference seen in treatment success rate 17.1% for MDR-TB; 63.1% for non MDR TB (P history of TB treatment, and presence of HIV infection.

  17. Prognostic significance of multidrug-resistance protein (MDR-1 in renal clear cell carcinomas: A five year follow-up analysis

    Directory of Open Access Journals (Sweden)

    Strazzullo Viviana

    2006-12-01

    Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader

  18. HIF-1α inhibition reverses multidrug resistance in colon cancer cells via downregulation of MDR1/P-glycoprotein.

    Directory of Open Access Journals (Sweden)

    Jianfang Chen

    Full Text Available Multidrug resistance (MDR is one of the major reasons chemotherapy-based treatments fail. Hypoxia is generally associated with tumor chemoresistance. However, the correlation between the heterodimeric hypoxia-inducible factor-1 (HIF-1 and the multidrug resistance (MDR1 gene/transporter P-glycoprotein (P-gp remains unclear. This study aims to explore the molecular mechanisms of reversing colon cancer MDR by focusing on the target gene HIF-1α.A chemotherapeutic sensitivity assay was used to observe the efficiency of MDR reversal in LoVo multicellular spheroids (MCS. The apoptotic level induced by different drugs was examined by flow cytometry (FCM. Binding of HIF-1α to the MDR1 gene promoter was evaluated by Chromatin immunoprecipitation (ChIP. The relationship between HIF-1α/P-gp expression and sensitivity to chemotherapy was analyzed.The sensitivity of LoVo MCS to all four chemotherapy drugs was decreased to varying degrees under hypoxic conditions. After silencing the HIF-1α gene, the sensitivities of LoVo MCS to all four chemotherapy drugs were restored. The apoptotic levels that all the drugs induced were all decreased to various extents in the hypoxic group. After silencing HIF-1α, the apoptosis level induced by all four chemotherapy drugs increased. The expression of HIF-1α and P-gp was significantly enhanced in LoVo MCS after treatment with hypoxia. Inhibiting HIF-1α significantly decreased the expression of MDR1/P-gp mRNA or protein in both the LoVo monolayers and LoVo MCS. The ChIP assay showed that HIF-1α was bound to the MDR1 gene promoter. Advanced colon carcinoma patients with expression of both HIF-1α and P-gp were more resistant to chemotherapy than that with non expression.HIF-1α inhibition reverses multidrug resistance in colon cancer cells via downregulation of MDR1/P-gp. The expression of HIF-1α and MDR1/P-gp can be used as a predictive marker for chemotherapy resistance in colon cancer.

  19. Study of antagonistic effects of Lactobacillus strains as probiotics on multi drug resistant (MDR bacteria isolated from urinary tract infections (UTIs

    Directory of Open Access Journals (Sweden)

    Atiyeh Naderi

    2014-03-01

    Conclusion: Treatment of E. coli with probiotic suspension was not effective on inhibition of the plasmid carrying hypothetical ampicillin resistant gene. Moreover, the plasmid profiles obtained from probiotic-treated isolates were identical to untreated isolates.

  20. Splice form variant and amino acid changes in MDR49 confers DDT resistance in transgenic Drosophila.

    Science.gov (United States)

    Seong, Keon Mook; Sun, Weilin; Clark, John M; Pittendrigh, Barry R

    2016-03-22

    The ATP-binding cassette (ABC) transporters represent a superfamily of proteins that have important physiological roles in both prokaryotes and eukaryotes. In insects, ABC transporters have previously been implicated in insecticide resistance. The 91-R strain of Drosophila melanogaster has been intensely selected with DDT over six decades. A recent selective sweeps analysis of 91-R implicated the potential role of MDR49, an ABC transporter, in DDT resistance, however, to date the details of how MDR49 may play a role in resistance have not been elucidated. In this study, we investigated the impact of structural changes and an alternative splicing event in MDR49 on DDT-resistance in 91-R, as compared to the DDT susceptible strain 91-C. We observed three amino acid differences in MDR49 when 91-R was compared with 91-C, and only one isoform (MDR49B) was implicated in DDT resistance. A transgenic Drosophila strain containing the 91-R-MDR49B isoform had a significantly higher LD50 value as compared to the 91-C-MDR49B isoform at the early time points (6 h to 12 h) during DDT exposure. Our data support the hypothesis that the MDR49B isoform, with three amino acid mutations, plays a role in the early aspects of DDT resistance in 91-R.

  1. Heightened vulnerability to MDR-TB epidemics after controlling drug-susceptible TB.

    Directory of Open Access Journals (Sweden)

    Jason D Bishai

    2010-09-01

    Full Text Available Prior infection with one strain TB has been linked with diminished likelihood of re-infection by a new strain. This paper attempts to determine the role of declining prevalence of drug-susceptible TB in enabling future epidemics of MDR-TB.A computer simulation of MDR-TB epidemics was developed using an agent-based model platform programmed in NetLogo (See http://mdr.tbtools.org/. Eighty-one scenarios were created, varying levels of treatment quality, diagnostic accuracy, microbial fitness cost, and the degree of immunogenicity elicited by drug-susceptible TB. Outcome measures were the number of independent MDR-TB cases per trial and the proportion of trials resulting in MDR-TB epidemics for a 500 year period after drug therapy for TB is introduced.MDR-TB epidemics propagated more extensively after TB prevalence had fallen. At a case detection rate of 75%, improving therapeutic compliance from 50% to 75% can reduce the probability of an epidemic from 45% to 15%. Paradoxically, improving the case-detection rate from 50% to 75% when compliance with DOT is constant at 75% increases the probability of MDR-TB epidemics from 3% to 45%.The ability of MDR-TB to spread depends on the prevalence of drug-susceptible TB. Immunologic protection conferred by exposure to drug-susceptible TB can be a crucial factor that prevents MDR-TB epidemics when TB treatment is poor. Any single population that successfully reduces its burden of drug-susceptible TB will have reduced herd immunity to externally or internally introduced strains of MDR-TB and can experience heightened vulnerability to an epidemic. Since countries with good TB control may be more vulnerable, their self interest dictates greater promotion of case detection and DOTS implementation in countries with poor control to control their risk of MDR-TB.

  2. Candida albicans Swi/Snf and Mediator Complexes Differentially Regulate Mrr1-Induced MDR1 Expression and Fluconazole Resistance.

    Science.gov (United States)

    Liu, Zhongle; Myers, Lawrence C

    2017-11-01

    Long-term azole treatment of patients with chronic Candida albicans infections can lead to drug resistance. Gain-of-function (GOF) mutations in the transcription factor Mrr1 and the consequent transcriptional activation of MDR1 , a drug efflux coding gene, is a common pathway by which this human fungal pathogen acquires fluconazole resistance. This work elucidates the previously unknown downstream transcription mechanisms utilized by hyperactive Mrr1. We identified the Swi/Snf chromatin remodeling complex as a key coactivator for Mrr1, which is required to maintain basal and induced open chromatin, and Mrr1 occupancy, at the MDR1 promoter. Deletion of snf2 , the catalytic subunit of Swi/Snf, largely abrogates the increases in MDR1 expression and fluconazole MIC observed in MRR1 GOF mutant strains. Mediator positively and negatively regulates key Mrr1 target promoters. Deletion of the Mediator tail module med3 subunit reduces, but does not eliminate, the increased MDR1 expression and fluconazole MIC conferred by MRR1 GOF mutations. Eliminating the kinase activity of the Mediator Ssn3 subunit suppresses the decreased MDR1 expression and fluconazole MIC of the snf2 null mutation in MRR1 GOF strains. Ssn3 deletion also suppresses MDR1 promoter histone displacement defects in snf2 null mutants. The combination of this work with studies on other hyperactive zinc cluster transcription factors that confer azole resistance in fungal pathogens reveals a complex picture where the induction of drug efflux pump expression requires the coordination of multiple coactivators. The observed variations in transcription factor and target promoter dependence of this process may make the search for azole sensitivity-restoring small molecules more complicated. Copyright © 2017 American Society for Microbiology.

  3. Effect of pO2 on antitumor drug cytotoxicity on MDR and non-MDR variants selected from the LoVo metastatic colon carcinoma cell line.

    Science.gov (United States)

    Lelong-Rebel, Isabelle; Brisson, Christine; Fabre, Michel; Bergerat, Jean-Pierre; Rebel, Gérard

    2008-01-01

    Two chemosensitive cell lines, LoVo-fusoid (LoVo-f) and LoVo-small cells (LoVo-sc) were derived from the original LoVo cell line. These two variants and the multidrug-resistant (MDR) cell line LoVo-Dox were screened for various properties. In non-permeabilized cells, only LoVo-sc showed mucin-2 staining whereas labelling was positive in all permeabilized cell lines. As shown by electron microscopy screening and by relative resistance to trypsin detachment, only LoVo-sc cells showed strong mucus secretion. All three cell lines displayed strong staining for P-glycoprotein (P-gp), multidrug resistance-associated protein (MRP) and lung-resistance-related protein (LRP) in different locations according to the drug resistance state. The three cell lines showed intracellular labelling of LRP and MRP. The sensitive cells showed P-gp in a large perinuclear ring and in the cytoplasm, but little (LoVo-sc cells) or no staining (LoVo-f cells) was shown at the plasma membrane level. For the Lovo-Dox cells, P-gp was located in the plasma membrane, in cellular anchorages and in the cytoplasm as well. Cell resistance against antineoplastic agents often results from mobilization of various factors, the modulation of which is linked to the culture conditions. As most of the protocols utilize cells growing in (air + 5-10% CO2) atmosphere e.g. 20% O2, balance of the respective participants in the MDR multi-modal mechanism may not be representative of the in vivo situation and may lead to erratic pharmacological response. Indeed, cells within solid tumours were exposed to low pO2, most of them being under hypoxic condition (0.1-5% O2). In the absence of anticancer drugs, all LoVo cell lines grew notably faster at 20% O2 than at 5% O2. Moreover, respective sensitivities of both non-MDR variants to doxorubicin were altered according the pO2. Whatever the pO2 was, virtually none of the antioxidants tested affected the cytotoxic activity of doxorubicin for the three cell lines. By contrast

  4. Association of ACE and MDR1 Gene Polymorphisms with Steroid Resistance in Children with Idiopathic Nephrotic Syndrome.

    Science.gov (United States)

    Dhandapani, Mohanapriya Chinambedu; Venkatesan, Vettriselvi; Rengaswamy, Nammalwar Bollam; Gowrishankar, Kalpana; Nageswaran, Prahlad; Perumal, Venkatachalam

    2015-08-01

    The purpose of the study was to investigate the distribution of insertion/deletion (I/D) polymorphisms of the angiotensin-converting enzyme (ACE) gene and three exonic polymorphisms of the multidrug resistance 1 (MDR1) gene (C3435T, C1236T, and G2677T) in children diagnosed with idiopathic nephrotic syndrome (INS). The study group consisted of 100 healthy controls and 150 INS patients, of which 50 were steroid resistant. Genomic DNA from blood samples was isolated from both of these groups and genotyping of the ACE and MDR1 genes was performed by polymerase chain reaction (PCR) using specific primers. There was no significant difference observed in the genotypic distribution and D allele frequency of the ACE gene. The two single-nucleotide polymorphisms (SNPs), C1236T and C3435T, of the MDR1 gene showed no significance, whereas the SNP G2677T/A was significantly associated with the genotypes GT and GA of the MDR1 gene, indicating it may be a potential marker to detect drug resistance. Screening these polymorphisms will pave the way to better understand the molecular mechanisms of the disease, which may be useful in developing targeted therapies for INS patients.

  5. Procurement and Supply Management System for MDR-TB in Nigeria: Are the Early Warning Targets for Drug Stock Outs and Over Stock of Drugs Being Achieved?

    Science.gov (United States)

    Jatau, Bolajoko; Avong, Yohanna; Ogundahunsi, Olumide; Shah, Safieh; Tayler Smith, Katherine; Van den Bergh, Rafael; Zachariah, Rony; van Griensven, Johan; Ekong, Ernest; Dakum, Patrick

    2015-01-01

    The World Health Organisation (WHO) introduced the twelve early warning indicators for monitoring and evaluating drug Procurement and Supply management (PSM) systems, intended to prevent drug stock-outs and overstocking. Nigeria--one of the high Multi Drug Resistant Tuberculosis (MDR-TB) burden countries, scaled-up treatment in 2012 with the concurrent implementation of a PSM system. We evaluated how well this system functioned using the WHO indicators, including all seven MDR-TB treatment centres in the country that were functional throughout 2013. The quantity of MDR-TB drugs ordered for 2013 matched the annual forecast and all central orders placed during the year were delivered in full and on time. Drug consumption was 81%-106% of the quantity allocated for routine consumption. Timely submission of complete inventory reports ranged from 86-100%, late submissions being 5-15 days late. Forty to 71% of treatment centres placed a drug order when stock was below the minimum level of three months. The proportion of drug orders received at the treatment centres in full and on time ranged from 29-80%, late orders being 1-19 days late. The PSM was found to be performing well in terms of forecasting and procurement of MDR-TB drugs, but there were shortcomings in drug distribution, reporting at treatment centre level and in drug order placements. Despite these gaps, there were no stock outs. These findings indicate that where it matters most, namely ensuring that no drug stock outs affect patient management, the PSM system is effective. Addressing the observed shortcomings will help to strengthen the existing PSM system in anticipation of a growing MDR-TB case burden in the country.

  6. Genome sequencing and annotation of multidrug resistant Mycobacterium tuberculosis (MDR-TB PR10 strain

    Directory of Open Access Journals (Sweden)

    Mohd Zakihalani A. Halim

    2016-03-01

    Full Text Available Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10 isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. Keywords: Mycobacterium tuberculosis, Genome, MDR, Extrapulmonary

  7. Drug Resistance

    Science.gov (United States)

    ... Drug-resistance testing is also recommended for all pregnant women with HIV before starting HIV medicines and also in some pregnant women already taking HIV medicines. Pregnant women will work with their health ...

  8. From MDR to MXR

    DEFF Research Database (Denmark)

    Litman, Thomas; Druley, T E; Stein, W D

    2001-01-01

    The ATP binding cassette (ABC) superfamily of membrane transporters is one of the largest protein classes known, and counts numerous proteins involved in the trafficking of biological molecules across cell membranes. The first known human ABC transporter was P-glycoprotein (P-gp), which confers...... multidrug resistance (MDR) to anticancer drugs. In recent years, we have obtained an increased understanding of the mechanism of action of P-gp as its ATPase activity, substrate specificity and pharmacokinetic interactions have been investigated. This review focuses on the functional characterization of P...... for reversal of MDR in cancer and for drug delivery, are discussed....

  9. Genetic modification of haematopoietic cells for combined resistance to podophyllotoxins, other agents covered by MDR1-mediated efflux activity and nitrosoureas.

    Science.gov (United States)

    Baum, C; Peinert, S; Carpinteiro, A; Eckert, H G; Fairbairn, L J

    2000-05-01

    Genetic transfer and expression of drug-resistance functions into haematopoietic stem and progenitor cells is a promising means to overcome both the acute and longterm side-effects of cytotoxic drugs in bone marrow. Here, we describe a functional analysis of a retroviral vector that co-expresses human cDNAs for multidrug resistance 1/P-glycoprotein (MDR1) and a double mutant of O(6)-alkylguanine-alkyltransferase (hATPA/GA) to high levels. The hATPA/GA protein contains two amino acid substitutions that render it resistant to compounds such as O(6)-benzylguanine that inhibit the wild-type protein which is often overexpressed in resistant tumour cells. Evidence for simultaneous drug resistance of genetically modified primary murine progenitor cells to colchicine or the podophyllotoxin etoposide, both covered by MDR1-mediated efflux activity, and the nitrosourea BCNU, which is counteracted by hATPA/GA, is presented using in vitro colony assays.

  10. Drug resistance

    NARCIS (Netherlands)

    Gorter, J.A.; Potschka, H.; Noebels, J.L.; Avoli, M.; Rogawski, M.A.; Olsen, R.W.; Delgado-Escueta, A.V.

    2012-01-01

    Drug resistance remains to be one of the major challenges in epilepsy therapy. Identification of factors that contribute to therapeutic failure is crucial for future development of novel therapeutic strategies for difficult-to-treat epilepsies. Several clinical studies have shown that high seizure

  11. Ion channels and transporters in the development of drug resistance in cancer cells

    DEFF Research Database (Denmark)

    Hoffmann, Else Kay; Lambert, Ian Henry

    2014-01-01

    Multi-drug resistance (MDR) to chemotherapy is the major challenge in the treatment of cancer. MDR can develop by numerous mechanisms including decreased drug uptake, increased drug efflux and the failure to undergo drug-induced apoptosis. Evasion of drug-induced apoptosis through modulation of i...

  12. Expression of multidrug resistance genes MVP, MDR1, and MRP1 determined sequentially before, during, and after hyperthermic isolated limb perfusion of soft tissue sarcoma and melanoma patients.

    Science.gov (United States)

    Stein, Ulrike; Jürchott, Karsten; Schläfke, Matthias; Hohenberger, Peter

    2002-08-01

    Isolated, hyperthermic limb perfusion (ILP) with recombinant human tumor necrosis factor alpha and melphalan is a highly effective treatment for advanced soft tissue sarcoma (STS) and locoregional metastatic malignant melanoma. Multidrug resistance (MDR)-associated genes are known to be inducible by heat and drugs; expression levels of the major vault protein (MVP), MDR1, and MDR-associated protein 1 (MRP1) were determined sequentially before, during, and after ILP of patients. Twenty-one STS or malignant melanoma patients were treated by ILP. Tumor tissue temperatures were recorded continuously and ranged from 33.4 degrees C initially to peak values of 40.4 degrees C during ILP. Serial true-cut biopsy specimens from tumor tissues were routinely microdissected. Expression analyses for MDR genes were performed by real-time reverse transcriptase polymerase chain reaction and immunohistochemistry. In 83% of the patients, MVP expression was induced during hyperthermic ILP. MVP-mRNA inductions often paralleled the increase in temperature during ILP. Increased MVP protein expressions either were observed simultaneously with the MVP-mRNA induction or were delayed until after the induction at the transcriptional level. Inductions of MDR1 and MRP1 were observed in only 13% and 27% of the specimens analyzed. Temperatures and drugs applied preferentially led to an induction of MVP and were not sufficient to induce MDR1 and MRP1 in the majority of tumors. This study is the first to analyze the expression of MDR-associated genes sequentially during ILP of patients and demonstrates that treatment might lead to increased levels of MVP, whereas enhanced levels of MDR1 and MRP1 remain rare events.

  13. CHANGES IN THE PREVALENCE OF DRUG RESISTANT TUBERCULOSIS

    Directory of Open Access Journals (Sweden)

    V. B. Galkin

    2017-01-01

    Full Text Available The tendency of tuberculosis prevalence reduction observed in the Russian Federation is mostly related to the cases without multiple drug resistance (MDR. In general the number of MDR TB cases still tends to be increasing in the Russian Federation. Confident long-term reduction is registered only in the Central and North-Western Districts with relatively low level of MDR TB prevalence. From 2017 MDR TB patients are expected to prevail in the structure of the sputum positive cases which surely provides negative impact on the treatment efficiency and epidemic trends. The system of dispensary follow-up allows evaluating the annual number of MDT TB cases and following the ways of its increase and reduction. Taking MDR TB sources on and off the register is less intensive compared to the same flows of non-MDR infectious cases. The number of MDR TB sources is increasing mostly due new tuberculosis cases however acquired MDR TB makes significant contribution to the growth of MDR TB sources number. The increase in the ratio of respiratory MDR TB patients with sputum conversion to those died reflects the success in the improvement of the treatment strategy of MDR TB patients.

  14. Direct nitrate reductase assay versus microscopic observation drug susceptibility test for rapid detection of MDR-TB in Uganda.

    Directory of Open Access Journals (Sweden)

    Freddie Bwanga

    Full Text Available The most common method for detection of drug resistant (DR TB in resource-limited settings (RLSs is indirect susceptibility testing on Lowenstein-Jensen medium (LJ which is very time consuming with results available only after 2-3 months. Effective therapy of DR TB is therefore markedly delayed and patients can transmit resistant strains. Rapid and accurate tests suitable for RLSs in the diagnosis of DR TB are thus highly needed. In this study we compared two direct techniques--Nitrate Reductase Assay (NRA and Microscopic Observation Drug Susceptibility (MODS for rapid detection of MDR-TB in a high burden RLS. The sensitivity, specificity, and proportion of interpretable results were studied. Smear positive sputum was collected from 245 consecutive re-treatment TB patients attending a TB clinic in Kampala, Uganda. Samples were processed at the national reference laboratory and tested for susceptibility to rifampicin and isoniazid with direct NRA, direct MODS and the indirect LJ proportion method as reference. A total of 229 specimens were confirmed as M. tuberculosis, of these interpretable results were obtained in 217 (95% with either the NRA or MODS. Sensitivity, specificity and kappa agreement for MDR-TB diagnosis was 97%, 98% and 0.93 with the NRA; and 87%, 95% and 0.78 with the MODS, respectively. The median time to results was 10, 7 and 64 days with NRA, MODS and the reference technique, respectively. The cost of laboratory supplies per sample was low, around 5 USD, for the rapid tests. The direct NRA and MODS offered rapid detection of resistance almost eight weeks earlier than with the reference method. In the study settings, the direct NRA was highly sensitive and specific. We consider it to have a strong potential for timely detection of MDR-TB in RLS.

  15. Psychiatric disorders in patients with multidrug resistant tuberculosis (MDR-TB in Sardjito Hospital, Yogyakarta, Indonesia

    Directory of Open Access Journals (Sweden)

    Irwan Supriyanto

    2017-08-01

    Full Text Available Introduction: Tuberculosis has become a chronic debilitating disease in developing countries, particularly after the emergence of multidrug resistant tuberculosis (MDR-TB. Second line treatments for the disease which were subsequently developed were associated with psychiatric disorders among patients. Psychiatric disorder can either be induced by treatment regiments or psychosocial factors. Cycloserine administration is frequently reported to be associated with psychiatric disorders. In this study, we examined the prevalence and characteristics of psychiatric disorders among MDR-TB patients in Sardjito Hospital, Yogyakarta, Indonesia. Methods: In this descriptive study, we studied medical records of MDR-TB patients admitted for MDR-TB treatments to Sardjito Hospital from January 2014 to July 2016 and screened for psychiatric disorders. Results: We found that 32.8% of the patients had psychiatric disorders, some of which had multiple psychiatric diagnoses (14.1%. The diagnoses were medication induced delirium, substance/medication induced psychotic disorder, substance/medication use depressive disorder, depressive type schizoaffective disorder, bipolar I disorder current episode severe manic with psychotic features, mild depression, moderate depression, major depression without psychotic features, major depression with psychotic features, adjustment disorders with mixed anxiety and depressed mood, adjustment disorder with anxiety, acute stress disorder, and insomnia. Psychiatric disorders were significantly associated with cycloserine dose and sex. Psychotic symptoms were significantly associated with sex and level of education. Conclusion: The presence of psychiatric disorders might disturb MDR-TB treatment resulting in poor outcomes. Precaution and prompt managements are required for psychiatric disorders in patients receiving MDR-TB treatment regiments.

  16. Multi drug resistance to cancer chemotherapy: Genes involved and blockers

    International Nuclear Information System (INIS)

    Sayed-Ahmed, Mohamed M.

    2007-01-01

    During the last three decades, important and considerable research efforts had been performed to investigate the mechanism through which cancer cells overcome the cytotoxic effects of a variety of chemotherapeutic drugs. Most of the previously published work has been focused on the resistance of tumor cells to those anticancer drugs of natural source. Multidrug resistance (MDR) is a cellular cross-resistance to a broad spectrum of natural products used in cancer chemotherapy and is believed to be the major cause of the therapeutic failures of the drugs belonging to different naturally obtained or semisynthetic groups including vinca alkaloids, taxans, epipodophyllotoxins and certain antibiotics. This phenomenon results from overexpression of four MDR genes and their corresponding proteins that act as membrane-bound ATP consuming pumps. These proteins mediate the efflux of many structurally and functionally unrelated anticancer drugs of natural source. MDR may be intrinsic or acquired following exposure to chemotherapy. The existence of intrinsically resistant tumor cell clone before and following chemotherapeutic treatment has been associated with a worse final outcome because of increased incidence of distant metasis. In view of irreplaceability of natural product anticancer drugs as effective chemotherapeutic agents, and in view of MDR as a major obstacle to successful chemotherapy, this review is aimed to highlight the genes involved in MDR, classical MDR blockers and gene therapy approaches to overcome MDR. (author)

  17. Supermolecular drug challenge to overcome drug resistance in cancer cells.

    Science.gov (United States)

    Onishi, Yasuhiko; Eshita, Yuki; Ji, Rui-Cheng; Kobayashi, Takashi; Onishi, Masayasu; Mizuno, Masaaki; Yoshida, Jun; Kubota, Naoji

    2018-06-04

    Overcoming multidrug resistance (MDR) of cancer cells can be accomplished using drug delivery systems in large-molecular-weight ATP-binding cassette transporters before entry into phagolysosomes and by particle-cell-surface interactions. However, these hypotheses do not address the intratumoral heterogeneity in cancer. Anti-MDR must be related to alterations of drug targets, expression of detoxification, as well as altered proliferation. In this study, it is shown that the excellent efficacy and sustainability of anti-MDR is due to a stable ES complex because of the allosteric facilities of artificial enzymes when they are used as supramolecular complexes. The allosteric effect of supermolecular drugs can be explained by the induced-fit model and can provide stable feedback control systems through the loop transfer function of the Hill equation. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Asiatic Acid (AA) Sensitizes Multidrug-Resistant Human Lung Adenocarcinoma A549/DDP Cells to Cisplatin (DDP) via Downregulation of P-Glycoprotein (MDR1) and Its Targets.

    Science.gov (United States)

    Cheng, Qilai; Liao, Meixiang; Hu, Haibo; Li, Hongliang; Wu, Longhuo

    2018-01-01

    P-glycoprotein (P-gp, i.e., MDR1) is associated with the phenotype of multidrug resistance (MDR) and causes chemotherapy failure in the management of cancers. Searching for effective MDR modulators and combining them with anticancer drugs is a promising strategy against MDR. Asiatic acid (AA), a natural triterpene isolated from the plant Centella asiatica, may have an antitumor activity. The present study assessed the reversing effect of AA on MDR and possible molecular mechanisms of AA action in MDR1-overexpressing cisplatin (DDP)-resistant lung cancer cells, A549/DDP. Human lung adenocarcinoma A549/DDP cells were either exposed to different concentrations of AA or treated with DDP, and their viability was measured by the MTT assay. A Rhodamine 123 efflux assay, immunofluorescent staining, ATPase assay, reverse-transcription PCR (RT-PCR), and western blot analysis were conducted to elucidate the mechanisms of action of AA on MDR. Our results showed that AA significantly enhanced the cytotoxicity of DDP toward A549/DDP cells but not its parental A549 cells. Furthermore, AA strongly inhibited P-gp expression by blocking MDR1 gene transcription and increased the intracellular accumulation of the P-gp substrate Rhodamine 123 in A549/DDP cells. Nuclear factor (NF)-kB (p65) activity, IkB degradation, and NF-kB/p65 nuclear translocation were markedly inhibited by pretreatment with AA. Additionally, AA inhibited the MAPK-ERK pathway, as indicated by decreased phosphorylation of ERK1 and -2, AKT, p38, and JNK, thus resulting in reduced activity of the Y-box binding protein 1 (YB1) via blockage of its nuclear translocation. AA reversed P-gp-mediated MDR by inhibition of P-gp expression. This effect was likely related to downregulation of YB1, and this effect was mediated by the NF-kB and MAPK-ERK pathways. AA may be useful as an MDR reversal agent for combination therapy in clinical trials. © 2018 The Author(s). Published by S. Karger AG, Basel.

  19. Surveillance of extensively drug-resistant tuberculosis in Europe, 2003-2007.

    NARCIS (Netherlands)

    Devaux, I.; Manissero, D.; Fernandez de la Hoz, K.; Kremer, K.; Soolingen, D. van

    2010-01-01

    This paper describes the results of second-line drug (SLD) susceptibility tests among multidrug-resistant tuberculosis (MDR TB) cases reported in 20 European countries aiming to identify extensively drug-resistant tuberculosis (XDR TB) cases. A project on molecular surveillance of MDR TB cases was

  20. Simple strategy to assess linezolid exposure in patients with multi-drug-resistant and extensively-drug-resistant tuberculosis

    NARCIS (Netherlands)

    Kamp, Jasper; Bolhuis, Mathieu S.; Tiberi, Simon; Akkerman, Onno W.; Centis, Rosella; de lange, Wiel C.; Kosterink, Jos G.; van der Werf, Tjip S.; Migliori, Giovanni B.; Alffenaar, Jan-Willem C.

    Linezolid is used increasingly for the treatment of multi-drug-resistant (MDR) and extensively-drug-resistant (XDR) tuberculosis (TB). However, linezolid can cause severe adverse events, such as peripheral and optical neuropathy or thrombocytopenia related to higher drug exposure. This study aimed

  1. Overview of drug-resistant tuberculosis worldwide

    Directory of Open Access Journals (Sweden)

    Ali A Velayati

    2016-01-01

    Full Text Available Even in the 21st century, we are losing the battle against eradication of tuberculosis (TB. In 2015, 9.6 million people were estimated to have fallen ill with TB, of which 1.5 million people died. This is the real situation despite the well-structured treatment programs and availability of effective treatment options since the 1950s. The high mortality rate has been associated with other risk factors, such as the HIV epidemic, underlying diseases, and decline of socioeconomic standards. Furthermore, the problem of drug resistance that was recognized in the early days of the chemotherapeutic era raises serious concerns. Although resistance to a single agent is the most common type, resistance to multiple agents is less frequent but of greater concern. The World Health Organization estimated approximately 5% of all new TB cases involved multidrug-resistant (MDR-TB. The estimation for MDR-TB is 3.3% for new cases, and 20.5% for previously treated cases. Failure to identify and appropriately treat MDR-TB patients has led to more dangerous forms of resistant TB. Based on World Health Organization reports, 5% of global TB cases are now considered to be extensively drug resistant (XDR, defined as MDR with additional resistance to both fluoroquinolones and at least one second-line injectable drug. XDR-TB had been reported by 105 countries by 2015. An estimated 9.7% of people with MDR-TB have XDR-TB. More recently, another dangerous form of TB bacillus was identified, which was named totally drug resistant (TDR-TB or extremely drug resistant TB. These strains were resistant to all first- and second-line anti-TB drugs. Collectively, it is accepted that 2% of MDR-TB strains turn to be TDR-TB. This number, however, may not reflect the real situation, as many laboratories in endemic TB countries do not have proper facilities and updated protocols to detect the XDR or TDR-TB strains. Nevertheless, existing data emphasize the need for additional control

  2. Drug-resistant tuberculosis

    African Journals Online (AJOL)

    statistics show that almost half a million new ... testing for second-line drugs, no international consensus has been reached about .... Given the high background rates of TB and MDR-TB in several countries, regimens are often constructed ...

  3. Cholesterol-Containing Nuclease-Resistant siRNA Accumulates in Tumors in a Carrier-free Mode and Silences MDR1 Gene

    Directory of Open Access Journals (Sweden)

    Ivan V. Chernikov

    2017-03-01

    Full Text Available Chemical modifications are an effective way to improve the therapeutic properties of small interfering RNAs (siRNAs, making them more resistant to degradation in serum and ensuring their delivery to target cells and tissues. Here, we studied the carrier-free biodistribution and biological activity of a nuclease-resistant anti-MDR1 cholesterol-siRNA conjugate in healthy and tumor-bearing severe combined immune deficiency (SCID mice. The attachment of cholesterol to siRNA provided its efficient accumulation in the liver and in tumors, and reduced its retention in the kidneys after intravenous and intraperitoneal injection. The major part of cholesterol-siRNA after intramuscular and subcutaneous injections remained in the injection place. Confocal microscopy data demonstrated that cholesterol-siRNA spread deep in the tissue and was present in the cytoplasm of almost all the liver and tumor cells. The reduction of P-glycoprotein level in human KB-8-5 xenograft overexpressing the MDR1 gene by 60% was observed at days 5–6 after injection. Then, its initial level recovered by the eighth day. The data showed that, regardless of the mode of administration (intravenous, intraperitoneal, or peritumoral, cholesterol-siMDR efficiently reduced the P-glycoprotein level in tumors. The designed anti-MDR1 conjugate has potential as an adjuvant therapeutic for the reversal of multiple drug resistance of cancer cells.

  4. MDR1 siRNA loaded hyaluronic acid-based CD44 targeted nanoparticle systems circumvent paclitaxel resistance in ovarian cancer

    Science.gov (United States)

    Yang, Xiaoqian; Lyer, Arun K.; Singh, Amit; Choy, Edwin; Hornicek, Francis J.; Amiji, Mansoor M.; Duan, Zhenfeng

    2015-02-01

    Development of multidrug resistance (MDR) is an almost universal phenomenon in patients with ovarian cancer, and this severely limits the ultimate success of chemotherapy in the clinic. Overexpression of the MDR1 gene and corresponding P-glycoprotein (Pgp) is one of the best known MDR mechanisms. MDR1 siRNA based strategies were proposed to circumvent MDR, however, systemic, safe, and effective targeted delivery is still a major challenge. Cluster of differentiation 44 (CD44) targeted hyaluronic acid (HA) based nanoparticle has been shown to successfully deliver chemotherapy agents or siRNAs into tumor cells. The goal of this study is to evaluate the ability of HA-PEI/HA-PEG to deliver MDR1 siRNA and the efficacy of the combination of HA-PEI/HA-PEG/MDR1 siRNA with paclitaxel to suppress growth of ovarian cancer. We observed that HA-PEI/HA-PEG nanoparticles can efficiently deliver MDR1 siRNA into MDR ovarian cancer cells, resulting in down-regulation of MDR1 and Pgp expression. Administration of HA-PEI/HA-PEG/MDR1 siRNA nanoparticles followed by paclitaxel treatment induced a significant inhibitory effect on the tumor growth, decreased Pgp expression and increased apoptosis in MDR ovarian cancer mice model. Our findings suggest that CD44 targeted HA-PEI/HA-PEG/MDR1 siRNA nanoparticles can serve as a therapeutic tool with great potentials to circumvent MDR in ovarian cancer.

  5. Multi drug resistant tuberculosis: a challenge in the management of ...

    African Journals Online (AJOL)

    Multi drug resistant tuberculosis (MDR-TB) will not usually respond to short course chemotherapy. Unless the individual infected with this bug is treated appropriately, they can continue spreading resistant strains in the community and further fuel the tuberculosis epidemic. Diagnosis requires drug sensitivity testing and the ...

  6. Definition of drug resistance of Mycobacterium tuberculosis to antituberculosis drugs in patients with multidrugresistant tuberculosis and TB with extremely drug resistant depending on the case of the disease

    Directory of Open Access Journals (Sweden)

    Kryzhanovsky D.G.

    2014-11-01

    Full Text Available There was studied the profile of drug resistance to the main (I line and reserve (II line antituberculosis drugs in patients with MDR and XDR tuberculosis, depending of the case of the disease. According to the randomized retrospective research 200 patients with MDR and XDR tuberculosis, who received treatment in the clinic of hospital Municipal institution «Dnipropetrovsk rigional clinical association «Phthisiology» Dnipropetrovsk regional Council» during the period 2010 – 2012 were involved. Data about patients contained the data on a case of the disease and the results of the test of drug sensitivity to MBT. XDR – TB was revealed in 7.5% of patients with MDR tuberculosis. In patients with MDR tuberculosis as compared with patients with XDR tuberculosis «new cases» were diagnosed in 19.5% against 18.5% (p <0.05. In patients with MDR tuberculosis and with XDR tuberculosis resistance to the antituberculosis drug more commonly developed to S - 88.5%, E - 55% and Z - 24%. The presence of MDR-TB and XDR-TB prevails in patients, who underwent previous courses of treatment with anti-TB drugs in case history as compared with patients with «new cases» of treatment. The development of resistance to anti-TB drugs depends on the availability of these drugs in the previous treatment regimens.

  7. Specificity of drug transport mediated by CaMDR1: a major facilitator ...

    Indian Academy of Sciences (India)

    Unknown

    CaMDR1 encodes a major facilitator superfamily (MFS) protein in Candida albicans whose expression has been linked to .... by plaque assay and the integration of CaMDR1 at the ... with recombinant virus, vAcCaMDR1 and cells infected.

  8. Functional evidence of multidrug resistance transporters (MDR in rodent olfactory epithelium.

    Directory of Open Access Journals (Sweden)

    Adrien Molinas

    Full Text Available P-glycoprotein (Pgp and multidrug resistance-associated protein (MRP1 are membrane transporter proteins which function as efflux pumps at cell membranes and are considered to exert a protective function against the entry of xenobiotics. While evidence for Pgp and MRP transporter activity is reported for olfactory tissue, their possible interaction and participation in the olfactory response has not been investigated.Functional activity of putative MDR transporters was assessed by means of the fluorometric calcein acetoxymethyl ester (calcein-AM accumulation assay on acute rat and mouse olfactory tissue slices. Calcein-AM uptake was measured as fluorescence intensity changes in the presence of Pgp or MRP specific inhibitors. Epifluorescence microscopy measured time course analysis in the olfactory epithelium revealed significant inhibitor-dependent calcein uptake in the presence of each of the selected inhibitors. Furthermore, intracellular calcein accumulation in olfactory receptor neurons was also significantly increased in the presence of either one of the Pgp or MRP inhibitors. The presence of Pgp or MRP1 encoding genes in the olfactory mucosa of rat and mouse was confirmed by RT-PCR with appropriate pairs of species-specific primers. Both transporters were expressed in both newborn and adult olfactory mucosa of both species. To assess a possible involvement of MDR transporters in the olfactory response, we examined the electrophysiological response to odorants in the presence of the selected MDR inhibitors by recording electroolfactograms (EOG. In both animal species, MRPs inhibitors induced a marked reduction of the EOG magnitude, while Pgp inhibitors had only a minor or no measurable effect.The findings suggest that both Pgp and MRP transporters are functional in the olfactory mucosa and in olfactory receptor neurons. Pgp and MRPs may be cellular constituents of olfactory receptor neurons and represent potential mechanisms for modulation

  9. Risk factors associated with multidrug-resistant tuberculosis (MDR-TB) in a tertiary armed force referral and teaching hospital, Ethiopia.

    Science.gov (United States)

    Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke

    2018-05-31

    Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of

  10. Cancer multidrug resistance: mechanisms involved and strategies for circumvention using a drug delivery system.

    Science.gov (United States)

    Kibria, Golam; Hatakeyama, Hiroto; Harashima, Hideyoshi

    2014-01-01

    Multidrug resistance (MDR), the principal mechanism by which many cancers develop resistance to chemotherapy, is one of the major obstacles to the successful clinical treatment of various types of cancer. Several key regulators are responsible for mediating MDR, a process that renders chemotherapeutic drugs ineffective in the internal organelles of target cells. A nanoparticulate drug delivery system (DDS) is a potentially promising tool for circumventing such MDR, which can be achieved by targeting tumor cells themselves or tumor endothelial cells that support the survival of MDR cancer cells. The present article discusses key factors that are responsible for MDR in cancer cells, with a specific focus on the application of DDS to overcome MDR via the use of chemotherapy or macromolecules.

  11. Drug-resistant tuberculosis: time for visionary political leadership.

    Science.gov (United States)

    Abubakar, Ibrahim; Zignol, Matteo; Falzon, Dennis; Raviglione, Mario; Ditiu, Lucica; Masham, Susan; Adetifa, Ifedayo; Ford, Nathan; Cox, Helen; Lawn, Stephen D; Marais, Ben J; McHugh, Timothy D; Mwaba, Peter; Bates, Matthew; Lipman, Marc; Zijenah, Lynn; Logan, Simon; McNerney, Ruth; Zumla, Adam; Sarda, Krishna; Nahid, Payam; Hoelscher, Michael; Pletschette, Michel; Memish, Ziad A; Kim, Peter; Hafner, Richard; Cole, Stewart; Migliori, Giovanni Battista; Maeurer, Markus; Schito, Marco; Zumla, Alimuddin

    2013-06-01

    Two decades ago, WHO declared tuberculosis a global emergency, and invested in the highly cost-effective directly observed treatment short-course programme to control the epidemic. At that time, most strains of Mycobacterium tuberculosis were susceptible to first-line tuberculosis drugs, and drug resistance was not a major issue. However, in 2013, tuberculosis remains a major public health concern worldwide, with prevalence of multidrug-resistant (MDR) tuberculosis rising. WHO estimates roughly 630 000 cases of MDR tuberculosis worldwide, with great variation in the frequency of MDR tuberculosis between countries. In the past 8 years, extensively drug-resistant (XDR) tuberculosis has emerged, and has been reported in 84 countries, heralding the possibility of virtually untreatable tuberculosis. Increased population movement, the continuing HIV pandemic, and the rise in MDR tuberculosis pose formidable challenges to the global control of tuberculosis. We provide an overview of the global burden of drug-resistant disease; discuss the social, health service, management, and control issues that fuel and sustain the epidemic; and suggest specific recommendations for important next steps. Visionary political leadership is needed to curb the rise of MDR and XDR tuberculosis worldwide, through sustained funding and the implementation of global and regional action plans. Copyright © 2013 World Health Organization. Published by Elsevier Ltd/Inc/BV. All rights reserved. Published by Elsevier Ltd. All rights reserved.

  12. Repurposing and Revival of the Drugs: A New Approach to Combat the Drug Resistant Tuberculosis

    Directory of Open Access Journals (Sweden)

    Divakar Sharma

    2017-12-01

    Full Text Available Emergence of drug resistant tuberculosis like multi drug resistant tuberculosis (MDR-TB, extensively drug-resistant tuberculosis (XDR-TB and totally drug resistant tuberculosis (TDR-TB has created a new challenge to fight against these bad bugs of Mycobacterium tuberculosis. Repurposing and revival of the drugs are the new trends/options to combat these worsen situations of tuberculosis in the antibiotics resistance era or in the situation of global emergency. Bactericidal and synergistic effect of repurposed/revived drugs along with the latest drugs bedaquiline and delamanid used in the treatment of MDR-TB, XDR-TB, and TDR-TB might be the choice for future promising combinatorial chemotherapy against these bad bugs.

  13. Multi-drug-resistant tuberculosis in HIV positive patients in Eastern Europe

    DEFF Research Database (Denmark)

    Post, Frank A; Grint, Daniel; Efsen, Anne Marie Werlinrud

    2014-01-01

    Observational data from Eastern Europe on the management and outcome of multi-drug-resistant tuberculosis (MDR TB) in HIV positive populations remain sparse in the English-language literature.We compared clinical characteristics and outcomes of 55 patients who were diagnosed with HIV and MDR TB...... in Eastern Europe between 2004 and 2006 to 89 patients whose Mycobacterium tuberculosis isolates were susceptible to isoniazid and rifampicin.Patients with HIV and MDR TB were young and predominantly male with high rates of intravenous drug use, imprisonment and hepatitis C co-infection. Eighty-four per cent...... of patients with MDR TB had no history of previous TB drug exposure suggesting that the majority of MDR TB resulted from transmission of drug-resistant M. tuberculosis. The use of non-standardized tuberculosis treatment was common, and the use of antiretroviral therapy infrequent. Compared to those...

  14. JNK1/2 Activation by an Extract from the Roots of Morus alba L. Reduces the Viability of Multidrug-Resistant MCF-7/Dox Cells by Inhibiting YB-1-Dependent MDR1 Expression

    Directory of Open Access Journals (Sweden)

    Youn Kyung Choi

    2013-01-01

    Full Text Available Cancer cells acquire anticancer drug resistance during chemotherapy, which aggravates cancer disease. MDR1 encoded from multidrug resistance gene 1 mainly causes multidrug resistance phenotypes of different cancer cells. In this study, we demonstrate that JNK1/2 activation by an extract from the root of Morus alba L. (White mulberry reduces doxorubicin-resistant MCF-7/Dox cell viability by inhibiting YB-1 regulation of MDR1 gene expression. When MCF-7 or MCF-7/Dox cells, where MDR1 is highly expressed were treated with an extract from roots or leaves of Morus alba L., respectively, the root extract from the mulberry (REM but not the leaf extract (LEM reduced cell viabilities of both MCF-7 and MCF-7/Dox cells, which was enhanced by cotreatment with doxorubicin. REM but not LEM further inhibited YB-1 nuclear translocation and its regulation of MDR1 gene expression. Moreover, REM promoted phosphorylation of c-Jun NH2-terminal kinase 1/2 (JNK1/2 and JNK1/2 inhibitor, SP600125 and rescued REM inhibition of both MDR1 expression and viabilities in MCF-7/Dox cells. Consistently, overexpression of JNK1, c-Jun, or c-Fos inhibited YB-1-dependent MDR1 expression and reduced viabilities in MCF-7/Dox cells. In conclusion, our data indicate that REM-activated JNK-cJun/c-Fos pathway decreases the viability of MCF-7/Dox cells by inhibiting YB-1-dependent MDR1 gene expression. Thus, we suggest that REM may be useful for treating multidrug-resistant cancer cells.

  15. Drug resistance patterns in pulmonary tuberculosis

    International Nuclear Information System (INIS)

    Khoharo, H.K.; Shaikh, I.A.

    2011-01-01

    Objective: To determine the resistance patterns of mycobacterium tuberculosis (MTB) isolates among category I and II patients of pulmonary tuberculosis. Methods: This cross sectional study was conducted at the Department of Medicine, Liaquat University of Medical and Health Sciences Jamshoro, from November 2008 to September 2009. Patients were divided into category I and II. The sputa were collected, stained with Ziehl-Nielsen (Z-N) staining and ultimately inoculated on Lowenstein-Jensen (L-J) media for six weeks. Out of 890 pulmonary tuberculosis (PTB) patients, the growth was obtained in 285 cases. The Drug sensitivity testing (DST) for Isoniazid (INH), Rifampicin (RIF), Ethambutol (EMB) Pyrazinamide (PZA) and Streptomycin (SM) were performed. The data was analyzed on SPSS 10.0. A p-value of <0.05 was taken as significant. Result: Out of 285 cases, 176 (61.75%) were male and 109 (38.24%) female. The mean age was 37 +- 19.90 years. The DST showed drug sensitive and drug resistant isolates in 80 (28.05%) and 205 (71.92%) cases respectively (p=0.001). The drug resistant tuberculosis (DR-TB) rates for individual drugs; INH, RIF, EMB, PZA and SM were 51,22%, 15.4%, 13.33%, 9%12, and 3.85% respectively (p=0.03). The MDR-TB isolates were detected in 120 (42.10%) cases, including 5 (5.88%) in category I and 115 (57.50%) in category II patients (p=0.0001). Conclusion: Drug resistant and multidrug resistant tuberculosis was observed mainly in category II patients. However, primary MDR was also observed in category I patients and reflects dissemination of MDR cases within the community. (author)

  16. Identification of antibiotic resistance genes in the multidrug-resistant Acinetobacter baumannii strain, MDR-SHH02, using whole-genome sequencing.

    Science.gov (United States)

    Wang, Hualiang; Wang, Jinghua; Yu, Peijuan; Ge, Ping; Jiang, Yanqun; Xu, Rong; Chen, Rong; Liu, Xuejie

    2017-02-01

    This study aimed to investigate antibiotic resistance genes in the multidrug-resistant (MDR) Acinetobacter baumannii (A. baumanii) strain, MDR-SHH02, using whole‑genome sequencing (WGS). The antibiotic resistance of MDR-SHH02 isolated from a patient with breast cancer to 19 types of antibiotics was determined using the Kirby‑Bauer method. WGS of MDR-SHH02 was then performed. Following quality control and transcriptome assembly, functional annotation of genes was conducted, and the phylogenetic tree of MDR-SHH02, along with another 5 A. baumanii species and 2 Acinetobacter species, was constructed using PHYLIP 3.695 and FigTree v1.4.2. Furthermore, pathogenicity islands (PAIs) were predicted by the pathogenicity island database. Potential antibiotic resistance genes in MDR-SHH02 were predicted based on the information in the Antibiotic Resistance Genes Database (ARDB). MDR-SHH02 was found to be resistant to all of the tested antibiotics. The total draft genome length of MDR-SHH02 was 4,003,808 bp. There were 74.25% of coding sequences to be annotated into 21 of the Clusters of Orthologous Groups (COGs) of protein terms, such as 'transcription' and 'amino acid transport and metabolism'. Furthermore, there were 45 PAIs homologous to the sequence MDRSHH02000806. Additionally, a total of 12 gene sequences in MDR-SHH02 were highly similar to the sequences of antibiotic resistance genes in ARDB, including genes encoding aminoglycoside‑modifying enzymes [e.g., aac(3)-Ia, ant(2'')‑Ia, aph33ib and aph(3')-Ia], β-lactamase genes (bl2b_tem and bl2b_tem1), sulfonamide-resistant dihydropteroate synthase genes (sul1 and sul2), catb3 and tetb. These results suggest that numerous genes mediate resistance to various antibiotics in MDR-SHH02, and provide a clinical guidance for the personalized therapy of A. baumannii-infected patients.

  17. Drug Susceptibility of Mycobacterium tuberculosis Beijing Genotype and Association with MDR TB

    Science.gov (United States)

    ten Kate, Marian T.; de Knegt, Gerjo J.; Kremer, Kristin; Aarnoutse, Rob E.; Boeree, Martin J.; Verbrugh, Henri A.; van Soolingen, Dick; Bakker-Woudenberg, Irma A.J.M.

    2012-01-01

    To determine differences in the ability of Mycobacterium tuberculosis strains to withstand antituberculosis drug treatment, we compared the activity of antituberculosis drugs against susceptible Beijing and East-African/Indian genotype M. tuberculosis strains. Beijing genotype strains showed high rates of mutation within a wide range of drug concentrations, possibly explaining this genotype’s association with multidrug-resistant tuberculosis. PMID:22469099

  18. Circumvention of multi-drug resistance of cancer cells by Chinese herbal medicines

    Directory of Open Access Journals (Sweden)

    Lin Ge

    2010-07-01

    Full Text Available Abstract Multi-drug resistance (MDR of cancer cells severely limits therapeutic outcomes. A proposed mechanism for MDR involves the efflux of anti-cancer drugs from cancer cells, primarily mediated by ATP-binding cassette (ABC membrane transporters including P-glycoprotein. This article reviews the recent progress of using active ingredients, extracts and formulae from Chinese medicine (CM in circumventing ABC transporters-mediated MDR. Among the ABC transporters, Pgp is the most extensively studied for its role in MDR reversal effects. While other MDR reversal mechanisms remain unclear, Pgp inhibition is a criterion for further mechanistic study. More mechanistic studies are needed to fully establish the pharmacological effects of potential MDR reversing agents.

  19. Circumvention of multi-drug resistance of cancer cells by Chinese herbal medicines.

    Science.gov (United States)

    Chai, Stella; To, Kenneth Kw; Lin, Ge

    2010-07-25

    Multi-drug resistance (MDR) of cancer cells severely limits therapeutic outcomes. A proposed mechanism for MDR involves the efflux of anti-cancer drugs from cancer cells, primarily mediated by ATP-binding cassette (ABC) membrane transporters including P-glycoprotein. This article reviews the recent progress of using active ingredients, extracts and formulae from Chinese medicine (CM) in circumventing ABC transporters-mediated MDR. Among the ABC transporters, Pgp is the most extensively studied for its role in MDR reversal effects. While other MDR reversal mechanisms remain unclear, Pgp inhibition is a criterion for further mechanistic study. More mechanistic studies are needed to fully establish the pharmacological effects of potential MDR reversing agents.

  20. Drug resistance in Mexico: results from the National Survey on Drug-Resistant Tuberculosis.

    Science.gov (United States)

    Bojorquez-Chapela, I; Bäcker, C E; Orejel, I; López, A; Díaz-Quiñonez, A; Hernández-Serrato, M I; Balandrano, S; Romero, M; Téllez-Rojo Solís, M M; Castellanos, M; Alpuche, C; Hernández-Ávila, M; López-Gatell, H

    2013-04-01

    To present estimations obtained from a population-level survey conducted in Mexico of prevalence rates of mono-, poly- and multidrug-resistant strains among newly diagnosed cases of pulmonary tuberculosis (TB), as well as the main factors associated with multidrug resistance (combined resistance to isoniazid and rifampicin). Study data came from the National Survey on TB Drug Resistance (ENTB-2008), a nationally representative survey conducted during 2008-2009 in nine states with a stratified cluster sampling design. Samples were obtained for all newly diagnosed cases of pulmonary TB in selected sites. Drug susceptibility testing (DST) was performed for anti-tuberculosis drugs. DST results were obtained for 75% of the cases. Of these, 82.2% (95%CI 79.5-84.7) were susceptible to all drugs. The prevalence of multidrug-resistant TB (MDR-TB) was estimated at 2.8% (95%CI 1.9-4.0). MDR-TB was associated with previous treatment (OR 3.3, 95%CI 1.1-9.4). The prevalence of drug resistance is relatively low in Mexico. ENTB-2008 can be used as a baseline for future follow-up of drug resistance.

  1. Antimicrobial (Drug) Resistance

    Science.gov (United States)

    ... with facebook share with twitter share with linkedin Antimicrobial (Drug) Resistance Go to Information for Researchers ► Credit: ... and infectious diseases. Why Is the Study of Antimicrobial (Drug) Resistance a Priority for NIAID? Over time, ...

  2. Emergence of fluoroquinolone resistance among drug resistant tuberculosis patients at a tertiary care facility in Karachi, Pakistan.

    Science.gov (United States)

    Zaidi, Syed Mohammad Asad; Haseeb, Abdul; Habib, Shifa Salman; Malik, Amyn; Khowaja, Saira; SaifUllah, Nausheen; Rizvi, Nadeem

    2017-07-25

    Pakistan is classified as one of the high multi-drug resistant tuberculosis (MDR-TB) burden countries. A poorly regulated private sector, over-prescription of antibiotics and self-medication has led to augmented rates of drug-resistance in the country. Pakistan's first national anti-tuberculosis drug resistance survey identified high prevalence of fluoroquinolone resistance among MDR-TB patients. Further institutional evidence of fluoroquinolone drug-resistance can support re-evaluation of treatment regimens as well as invigorate efforts to control antibiotic resistance in the country. In this study, data for drug-susceptibility testing (DST) was retrospectively analyzed for a total of 133 patients receiving MDR-TB treatment at the Chest Department of Jinnah Postgraduate Medical Center, Karachi, Pakistan. Frequency analyses for resistance patterns was carried out and association of fluoroquinolone (ofloxacin) resistance with demographics and past TB treatment category were assessed. Within first-line drugs, resistance to isoniazid was detected in 97.7% of cases, followed by rifampicin (96.9%), pyrazinamide (86.4%), ethambutol (69.2%) and streptomycin (64.6%). Within second-line drugs, ofloxacin resistance was detected in 34.6% of cases. Resistance to ethionamide and amikacin was 2.3% and 1.6%, respectively. Combined resistance of oflaxacin and isoniazid was detected in 33.9% of cases. Age, gender and past TB treatment category were not significantly associated with resistance to ofloxacin. Fluoroquinolone resistance was observed in an alarmingly high proportion of MDR-TB cases. Our results suggest caution in their use for empirical management of MDR-TB cases and recommended treatment regimens for MDR-TB may require re-evaluation. Greater engagement of private providers and stringent pharmacy regulations are urgently required.

  3. Isolation, Identification And Screening Antibacterial Activity from Marine Sponge-Associated Fungi Against Multidrug-Resistant (MDR) Escherichia coli

    Science.gov (United States)

    Triandala Sibero, Mada; Sabdaningsih, Aninditia; Cristianawati, Olvi; Nuryadi, Handung; Karna Radjasa, Ocky; Sabdono, Agus; Trianto, Agus

    2017-02-01

    Irrational used of antibiotic in several decades ago causing resistant in bacteria and decreasing the cure rate of infectious diseases. Multidrug-resistant (MDR) Escherichia coli is known to cause various of infectious diseases such as urinary tract infection, nosocomial bloodstream infection, meningitis, bacteraemia, and gastrointestinal disease. Marine sponge-associated fungi have potential as source of new compound to combat MDR E. coli. The aims of this research were to isolate marine sponge-assosiated fungi, to screen potential fungi against MDR E. coli, to identify the potential fungi and its host sponge. There were 29 marine sponge-associated fungi successfully isolated from 9 sponges. Among 29 sponge-associated fungi screened, there were 7 isolates showed antibacterial activity against MDR E. coli. The best inhibition zone produced by MPS 14.1/MT 02 and MPS 14.3/MT 04 from sponge PP.SP.16.14. According to fungi identification result fungus MPS 14.1/MT 02 was identified as Trichoderma asperellum while MPS 14.3/MT 04 was identified as Trichoderma reesei. Sponge identification leaded the PP.SP.16.14 as Cinachyrella sp.

  4. Molecular Analysis of Multi-Drug Resistance (MDR) in ...

    African Journals Online (AJOL)

    This review therefore brings to light some of the processes involved in molecular typing of Mycobacterium tuberculosis strains like the use of restriction fragment length polymorphism (RFLP) and spoligotyping, which have become valuable tools in the epidemiology of tuberculosis, identification of genotypes and ...

  5. EDITORIAL Multi-drug-resistant tuberculosis (MDR-TB): Current ...

    African Journals Online (AJOL)

    A South African Health Systems Trust report indicated that despite a global ... less financial resources performed better. ... Healthcare providers need to be better trained at our various nursing colleges and medical schools on how to manage TB, with regular and intense follow-up in-service training sessions. In addition ...

  6. Drug resistance-related mutations in multidrug-resistant Mycobacterium tuberculosis isolates from diverse geographical regions

    Directory of Open Access Journals (Sweden)

    Senia Rosales-Klintz

    2012-01-01

    Conclusion: This study confirms that there are significant geographical differences in the distribution of resistance-related mutations and suggests that an increased understanding of such differences in the specific distribution of resistance conferring mutations is crucial for development of new, generally applicable, molecular tools for rapid diagnosis of drug-resistant TB. The fact that a narrower distribution of mutations in high MDR-TB prevalence settings was seen suggests that much of the problems in these settings can be a result of an ongoing transmission of certain MDR-TB strains.

  7. Transmission of MDR and XDR tuberculosis in Shanghai, China.

    Directory of Open Access Journals (Sweden)

    Ming Zhao

    Full Text Available Multidrug-resistant (MDR and extensively drug-resistant (XDR tuberculosis (TB are global health problems. We sought to determine the characteristics, prevalence, and relative frequency of transmission of MDR and XDR TB in Shanghai, one of the largest cities in Asia.TB is diagnosed in district TB hospitals in Shanghai, China. Drug susceptibility testing for first-line drugs was performed for all culture positive TB cases, and tests for second-line drugs were performed for MDR cases. VNTR-7 and VNTR-16 were used to genotype the strains, and prior treatment history and treatment outcomes were determined for each patient.There were 4,379 culture positive TB cases diagnosed with drug susceptibility test results available during March 2004 through November 2007. 247 (5.6% were infected with a MDR strain of M. tuberculosis and 11 (6.3% of the 175 MDR patients whose isolate was tested for susceptibility to second-line drugs, were XDR. More than half of the patients with MDR and XDR were newly diagnosed and had no prior history of TB treatment. Nearly 57% of the patients with MDR were successfully treated.Transmission of MDR and XDR strains is a serious problem in Shanghai. While a history of prior anti-TB treatment indicates which individuals may have acquired MDR or XDR TB, it does not accurately predict which TB patients have disease caused by transmission of MDR and XDR strains. Therefore, universal drug susceptibility testing is recommended for new and retreatment TB cases.

  8. The roles of CDR1, CDR2, and MDR1 in kaempferol-induced suppression with fluconazole-resistant Candida albicans.

    Science.gov (United States)

    Shao, Jing; Zhang, MengXiang; Wang, TianMing; Li, Yue; Wang, ChangZhong

    2016-01-01

    Fungal infections caused by fluconazole-resistant Candida albicans are an intractable clinical problem, calling for new efficient antifungal drugs. Kaempferol, an active flavonoid, has been considered a potential candidate against Candida species. This work investigates the resistance reversion of kaempferol in fluconazole-resistant C. albicans and the underlying mechanism. The antifungal activities of fluconazole and/or kaempferol were assessed by a series of standard procedures including broth microdilution method, checkerboard assay and time-kill (T-K) test in nine clinical strains as well as a standard reference isolate of C. albicans. Subsequently, the morphological changes, the efflux of rhodamine 6G, and the expressions of CDR 1, CDR 2, and MDR 1 were analysed by scanning electron microscope (SEM), inverted fluorescence microscope and quantitative reverse transcription polymerase chain reaction (qRT-PCR) in C. albicans z2003. For all the tested C. albicans strains, the minimum inhibitory concentrations (MICs) of fluconazole and kaempferol ranged 0.25-32 and 128-256 μg/mL with a range of fractional inhibitory concentration index of 0.257-0.531. In C. albicans z2003, the expression of both CDR 1 and CDR 2 were decreased after exposure to kaempferol alone with negligible rhodamine 6G accumulation, while the expression of CDR 1, CDR 2 and MDR 1 were all decreased when fluconazole and kaempferol were used concomitantly with notable fluorescence of rhodamine 6G observed. Kaempferol-induced reversion in fluconazole-resistant C. albicans might be likely due to the suppression of the expression of CDR1, CDR2 and MDR1.

  9. Self-assembled Multifunctional DNA Nanoflowers for the Circumvention of Multidrug Resistance in Targeted Anticancer Drug Delivery.

    Science.gov (United States)

    Mei, Lei; Zhu, Guizhi; Qiu, Liping; Wu, Cuichen; Chen, Huapei; Liang, Hao; Cansiz, Sena; Lv, Yifan; Zhang, Xiaobing; Tan, Weihong

    2015-11-01

    Cancer chemotherapy has been impeded by side effects and multidrug resistance (MDR) partially caused by drug efflux from cancer cells, which call for targeted drug delivery systems additionally able to circumvent MDR. Here we report multifunctional DNA nanoflowers (NFs) for targeted drug delivery to both chemosensitive and MDR cancer cells and circumvent MDR in both leukemia and breast cancer cell models. NFs are self-assembled via liquid crystallization of DNA generated by Rolling Circle Replication, during which NFs are incorporated with aptamers for specific cancer cell recognition, fluorophores for bioimaging, and Doxorubicin (Dox)-binding DNA for drug delivery. NF sizes are tunable (down to ~200 nm in diameter), and the densely packed drug-binding motifs and porous intrastructures endow NFs with high drug loading capacity (71.4%, wt/wt). The Dox-loaded NFs (NF-Dox) are stable at physiological pH, yet drug release is facilitated in acidic or basic conditions. NFs deliver Dox into target chemosensitive and MDR cancer cells, preventing drug efflux and enhancing drug retention in MDR cells. Consequently, NF-Dox induces potent cytotoxicity in both target chemosensitive cells and MDR cells, but not nontarget cells, thus concurrently circumventing MDR and reducing side effects. Overall, these NFs are promising to circumvent MDR in targeted cancer therapy.

  10. Accelerating resistance, inadequate antibacterial drug pipelines and international responses.

    Science.gov (United States)

    Theuretzbacher, Ursula

    2012-04-01

    The pandemic of multidrug-resistant (MDR) pathogens and their continuing spread is beyond dispute. In contrast to the past, today's antibacterial research and development (R&D) pipelines are nearly dry, failing to provide the flow of novel antibiotics required to match the clinical challenges of the multidrug resistance (MDR) crisis. Concerned over the rapidly worsening potential global healthcare crisis caused by MDR bacteria and the lack of robust drug pipelines, several multinational campaigns have issued policy recommendations and have initiated broad discussion with a goal of stimulating the development of novel antibacterial drugs and technologies. These activities have resulted in intensified co-operation between the USA and the EU. The recently announced extensive 'Action plan against the rising threats from antimicrobial resistance' substantially ramps up action within the EU. In recognising the potential crisis caused by MDR and the limited treatment options, the European Commission decided on an unprecedented approach to drive the search for novel antibiotics by integrating the pharmaceutical industry, the research capacities of universities and small companies supported by public funding along with pricing/reimbursement and regulatory bodies. The European Commission has shown leadership and put action plans in place. Only the future will tell whether these initiatives will help curb the impact of the MDR pandemic. Copyright © 2012 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  11. Impact of drug resistance on the tuberculosis treatment outcome

    Directory of Open Access Journals (Sweden)

    E. Lesnic

    2017-03-01

    Full Text Available Background. The standard treatment of a new case of multidrug-resistant tuberculosis (MDR-TB according to WHO recommendations in the Republic of Moldova is performed since 2005 showing a low treatment succes. Actually the treatment success rate increased due to excluding of MDR-TB patients from the general cohort. The major rate of patients with low outcome is represented by the failed and lost to follow-up cases. The purpose of the study was to assess the impact of multidrug-resiatnce and MDR-TB on the tuberculosis treatment outcome. Materials and methods. A retrospective selective, descriptive study targeting social, demographic, economic and epidemiological peculiarities, case-management, diagnostic radiological aspects and microbiological characteristics of 187 patients with pulmonary tuberculosis registered during 2013–2015 distributed in two groups: 1st group (61 patients with established multidrug-resistant strains using conventional cultural methods and the 2nd group (126 patients with MDR-TB. Results. Multidrug-resistance was established more frequently in new cases and MDR-TB in two thirds of retreated patients. No difference was identified in gender and age distribution, social, economical, educational characteristics; case-management assessment identified a similar proportion of patients revealed by general practitioners and specialists, with low rate of screened high risk groups. All patients from the multidrug-resistant group began the standard treatment for drug-responsiveness tuberculosis before drug susceptibility testing and one third of MDR-TB group was treated from the onset with the DOTS-Plus regimen. Highest success rate was identified in the new-case subgroups of both groups and higher rate of died patients was determined in the retreated subgroups. Such a low rate of patients aggrevates the resistance. Conclusions. Early diagnosis, drug responsiveness testing and raising awareness among about treatment compliance will

  12. Resistance patterns and trends of extensively drug-resistant tuberculosis: 5-year experience

    Directory of Open Access Journals (Sweden)

    Amresh Kumar Singh

    2013-12-01

    Full Text Available Objective:Extensively drug-resistant tuberculosis (XDR-TB strains were emerged when multidrug-resistant TB (MDR- TB was inadequately treated. Inadequate treatment of MDR-TB cases may result in additional resistance especially non-XDR-TB and then XDR-TB. The aim of this study was to know the prevalence, resistance patterns and trends of the XDR-TB strains among the MDR-TB at a tertiary care hospital in Lucknow, India Methods: A total of 430 Mycobacterium isolates were underwent NAP test and TB MPT64 Ag test for the identification of Mycobacterium tuberculosis complex (MTBC. Drug-susceptibility test (DST was performed over MTBC for the first line drugs by 1% proportion method (Bactec and for the second-line drugs by 1% proportion method (Lowenstein- Jensen media. The XDR-TB status was further confirmed by line probe assay (GenoType® MTBDRsl assay. Results: Among the 430 isolates of mycobacterium, 365 (84.9% were MTBC and 139 (38.1% were MDR-TB respectively. Further 97 MDR-TB from “highly suspected drug resistant-TB (DR-TB” cases among MDR-TB were tested with second line drugs in which 15 (15.5% XDR-TB and 82 (84.5% were non-XDR-TB. Regarding XDR-TB status, using the 1% proportion method a 100% agreement was seen with the GenoType® MTBDRsl assay. Resistance patterns of XDR-TB were as; 10/15 (66.7% as isoniazid + rifampicin + ciprofloxacin + amikacin resistance and 5/15 (33.3% as isoniazid + rifampicin + ciprofloxacin + amikacin + kanamycin resistance. Conclusion:The prevalence of XDR-TB was 15.5% among MDR-TB. Hence laboratory testing of “highly suspected drug resistant-TB” isolates should be done for both first and second line drugs simultaneously especially in developing countries.J Microbiol Infect Dis 2013;3(4: 169-175

  13. A population-based study of first and second-line drug-resistant tuberculosis in a high-burden area of the Mexico/United States border

    Directory of Open Access Journals (Sweden)

    Pola Becerril-Montes

    2013-04-01

    Full Text Available The resistance of 139 Mycobacterium tuberculosis (MTB isolates from the city of Monterrey, Northeast Mexico, to first and second-line anti-TB drugs was analysed. A total of 73 isolates were susceptible and 66 were resistant to anti-TB drugs. Monoresistance to streptomycin, isoniazid (INH and ethambutol was observed in 29 cases. Resistance to INH was found in 52 cases and in 29 cases INH resistance was combined with resistance to two or three drugs. A total of 24 isolates were multidrug-resistant (MDR resistant to at least INH and rifampicin and 11 MDR cases were resistant to five drugs. The proportion of MDR-TB among new TB cases in our target population was 0.72% (1/139 cases. The proportion of MDR-TB among previously treated cases was 25.18% (35/139 cases. The 13 polyresistant and 24 MDR isolates were assayed against the following seven second-line drugs: amikacin (AMK, kanamycin (KAN, capreomycin (CAP, clofazimine (CLF, ethionamide (ETH, ofloxacin (OFL and cycloserine (CLS. Resistance to CLF, OFL or CLS was not observed. Resistance was detected to ETH (10.80% and to AMK (2.70%, KAN (2.70% and CAP (2.70%. One isolate of MDR with primary resistance was also resistant to three second-line drugs. Monterrey has a high prevalence of MDR-TB among previously treated cases and extensively drug-resistant-MTB strains may soon appear.

  14. Comparative evaluation of GenoType MTBDRplus line probe assay with solid culture method in early diagnosis of multidrug resistant tuberculosis (MDR-TB at a tertiary care centre in India.

    Directory of Open Access Journals (Sweden)

    Raj N Yadav

    Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.

  15. High prevalence of drug-resistant tuberculosis, Republic of Lithuania, 2002

    DEFF Research Database (Denmark)

    Dewan, P; Sosnovskaja, A; Thomsen, V

    2005-01-01

    BACKGROUND: Nations of the former Soviet Union have the world's highest reported levels of resistance to anti-tuberculosis drugs. We conducted the first national survey of anti-tuberculosis drug resistance in the Republic of Lithuania. METHODS: We tested Mycobacterium tuberculosis isolates from all...... isolates, 475 (41%) were resistant to at least one first-line drug, and 263 (23%) were resistant to at least INH and RMP (MDR); this included 76/818 (9.3%) from new patients and 187/345 (54%) from previously treated patients. Of 52 MDR isolates randomly selected for extended testing at an international...

  16. Multi-drug-resistant tuberculosis in HIV positive patients in Eastern Europe.

    Science.gov (United States)

    Post, Frank A; Grint, Daniel; Werlinrud, Anne Marie; Panteleev, Alexander; Riekstina, Vieja; Malashenkov, Evgeniy A; Skrahina, Alena; Duiculescu, Dan; Podlekareva, Daria; Karpov, Igor; Bondarenko, Vasiliy; Chentsova, Nelly; Lundgren, Jens; Mocroft, Amanda; Kirk, Ole; Miro, Jose M

    2014-03-01

    Observational data from Eastern Europe on the management and outcome of multi-drug-resistant tuberculosis (MDR TB) in HIV positive populations remain sparse in the English-language literature. We compared clinical characteristics and outcomes of 55 patients who were diagnosed with HIV and MDR TB in Eastern Europe between 2004 and 2006 to 89 patients whose Mycobacterium tuberculosis isolates were susceptible to isoniazid and rifampicin. Patients with HIV and MDR TB were young and predominantly male with high rates of intravenous drug use, imprisonment and hepatitis C co-infection. Eighty-four per cent of patients with MDR TB had no history of previous TB drug exposure suggesting that the majority of MDR TB resulted from transmission of drug-resistant M. tuberculosis. The use of non-standardized tuberculosis treatment was common, and the use of antiretroviral therapy infrequent. Compared to those with susceptible tuberculosis, patients with MDR TB were less likely to achieve cure or complete tuberculosis treatment (21.8% vs. 62.9%, p < 0.0001), and they were more likely to die (65.5% vs. 27.0%, p < 0.0001). Our study documents suboptimal management and poor outcomes in HIV positive patients with MDR TB. Implementation of WHO guidelines, rapid TB diagnostics and TB drug susceptibility testing for all patients remain a priority in this region. Copyright © 2013 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  17. Adverse reactions among patients being treated for multi-drug resistant tuberculosis at Abbassia Chest Hospital

    Directory of Open Access Journals (Sweden)

    Mohammad A. Tag El Din

    2015-10-01

    Conclusions: There is a relation between both tobacco smoking and drug addiction, and MDR TB. The most common type of resistance is acquired resistance because of lack of adherence to treatment or inappropriate treatment. The most common co-morbidities associated with MDR TB are diabetes and chronic obstructive lung diseases. The most important predictors of patients’ outcome are sputum conversion, number of previous TB treatment and presence of co-morbidities.

  18. Personalized Medicine Digoxin Theraphy in Individuals with MDR Gene Polymorphism

    Directory of Open Access Journals (Sweden)

    Em Sutrisna

    2015-06-01

    Full Text Available Digoxin is one of digitalis drugs. Wider applicability to heart failure and arrhythmias (supraventricular requires fairly strict scrutiny because of its narrow therapeutic index. Digoxin is a substrate of P-glycoprotein (P-gp encoded by multi drugs resistance-1 (MDR1. MDR-1 gen located on chromosome 7q21.1. This gene contains 28 exons that encoded a protein of 1280 amino acids. This gene plays an important role in the absorption, distribution and elimination of many drugs. MDR1C3435T polymorphism occurs in exon 26. There are three types of MDR1C3435T gene namely MDR1C3435T CC, MDR1C3435T CT and MDR1C3435T TT. These polymorphisms will affect to the formation of P-gp and consequently to change the kinetic profile of digoxin. The change of kinetic profile causes changes in the digoxin blood levels. The method used in this review is data search based on pubmed, medline, and embase with keywords MDR and digoxin. There are several different studies of the influence of polymorphisms MDR1C3435T on blood digoxin levels. Increased levels of digoxin in the blood due to polymorphism of MDR1C3435T will be at risk of digitalis intoxication. Long-term digoxin treatment or large dose should consider the patient’s genetic profile. Distribution of polymorphism of MDR1C3435T in Javanese population is approximately TT (0,10, CT (0,52, and CC(0, 38.

  19. PfMDR2 and PfMDR5 are dispensable for Plasmodium falciparum asexual parasite multiplication but change in vitro susceptibility to anti-malarial drugs

    NARCIS (Netherlands)

    Velden, M. van der; Rijpma, S.R.; Russel, F.G.M.; Sauerwein, R.W.; Koenderink, J.B.

    2015-01-01

    BACKGROUND: Membrane-associated ATP binding cassette (ABC) transport proteins hydrolyze ATP in order to translocate a broad spectrum of substrates, from single ions to macromolecules across membranes. In humans, members from this transport family have been linked to drug resistance phenotypes, e.g.,

  20. Factors influencing [F-18]2-fluoro-2-deoxy-D-glucose (F-18 FDG) accumulation in melanoma cells. Is FDG a substrate of multidrug resistance (MDR)?

    International Nuclear Information System (INIS)

    Yamada, Kiyoshi; Brink, I.; Engelhardt, R.

    2005-01-01

    In order to specify the influence of multidrug-resistance (MDR) on the accumulation of the PET tracer, F-18 FDG ([Fluorine-18]2-fluoro-2-deoxy-D-glucose, in melanoma cells, both the MDR function and expression of two human melanoma cell lines SK-MEL 23 and 24, were evaluated. The effects of MDR modulators on FDG accumulation and efflux were also investigated. A functional analysis using representative MDR fluorescent substrates and inhibitors clarified the following characteristics: SK-MEL 23 possesses a highly active function of multidrug resistance-associated protein (MRP), but not P-gp. SK-MEL 24 possesses weak functions of both MRP and P-gp. Western blot analysis using monoclonal antibodies for MDR expression demonstrated an exceedingly high MRP expression of SK-MEL 23 and only slight P-gp and MRP expression of SK-MEL 24, corresponding to the functional data. The efflux inhibition assay using F-18 FDG revealed a considerable retention of FDG in SK-MEL 23 in the presence of the MRP inhibitor probenecid. It was also found that the P-gp inhibitor verapamil depressed the FDG efflux of SK-MEL 24. Our present in vitro study suggests that FDG may be a substrate of MDR in some melanoma cells and further MDR may be one of the important factors affecting FDG-PET melanoma imaging. (author)

  1. A study on demographic characteristics of drug resistant Mycobacterium tuberculosis isolates in Belarus

    Directory of Open Access Journals (Sweden)

    L Surkova

    2012-01-01

    Conclusion: As Belarus is a high-burden MDR-TB country and treatment of drug-resistant TB is long and complicated, the findings of this study provided useful information to deliver effective community-based disease control measures and a proposed plane for the effective management of drug-resistant TB at the national level.

  2. Estimating the future burden of multidrug-resistant and extensively drug-resistant tuberculosis in India, the Philippines, Russia, and South Africa: a mathematical modelling study.

    Science.gov (United States)

    Sharma, Aditya; Hill, Andrew; Kurbatova, Ekaterina; van der Walt, Martie; Kvasnovsky, Charlotte; Tupasi, Thelma E; Caoili, Janice C; Gler, Maria Tarcela; Volchenkov, Grigory V; Kazennyy, Boris Y; Demikhova, Olga V; Bayona, Jaime; Contreras, Carmen; Yagui, Martin; Leimane, Vaira; Cho, Sang Nae; Kim, Hee Jin; Kliiman, Kai; Akksilp, Somsak; Jou, Ruwen; Ershova, Julia; Dalton, Tracy; Cegielski, Peter

    2017-07-01

    Multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis are emerging worldwide. The Green Light Committee initiative supported programmatic management of drug-resistant tuberculosis in 90 countries. We used estimates from the Preserving Effective TB Treatment Study to predict MDR and XDR tuberculosis trends in four countries with a high burden of MDR tuberculosis: India, the Philippines, Russia, and South Africa. We calibrated a compartmental model to data from drug resistance surveys and WHO tuberculosis reports to forecast estimates of incident MDR and XDR tuberculosis and the percentage of incident MDR and XDR tuberculosis caused by acquired drug resistance, assuming no fitness cost of resistance from 2000 to 2040 in India, the Philippines, Russia, and South Africa. The model forecasted the percentage of MDR tuberculosis among incident cases of tuberculosis to increase, reaching 12·4% (95% prediction interval 9·4-16·2) in India, 8·9% (4·5-11·7) in the Philippines, 32·5% (27·0-35·8) in Russia, and 5·7% (3·0-7·6) in South Africa in 2040. It also predicted the percentage of XDR tuberculosis among incident MDR tuberculosis to increase, reaching 8·9% (95% prediction interval 5·1-12·9) in India, 9·0% (4·0-14·7) in the Philippines, 9·0% (4·8-14·2) in Russia, and 8·5% (2·5-14·7) in South Africa in 2040. Acquired drug resistance would cause less than 30% of incident MDR tuberculosis during 2000-40. Acquired drug resistance caused 80% of incident XDR tuberculosis in 2000, but this estimate would decrease to less than 50% by 2040. MDR and XDR tuberculosis were forecast to increase in all four countries despite improvements in acquired drug resistance shown by the Green Light Committee-supported programmatic management of drug-resistant tuberculosis. Additional control efforts beyond improving acquired drug resistance rates are needed to stop the spread of MDR and XDR tuberculosis in countries with a high burden of MDR

  3. Incidence of multidrug-resistant, extensively drug-resistant and pan-drug-resistant bacteria in children hospitalized at Dr. Hasan Sadikin general hospital Bandung Indonesia

    Science.gov (United States)

    Adrizain, R.; Suryaningrat, F.; Alam, A.; Setiabudi, D.

    2018-03-01

    Antibiotic resistance has become a global issue, with 700,000 deaths attributable to multidrug-resistance (MDR) occurring each year. Centers for Disease Control and Prevention (CDC) show rapidly increasing rates of infection due to antibiotic-resistant bacteria. The aim of the study isto describe the incidence of MDR, extensively drug-resistant (XDR) and pan drug-resistant (PDR) in Enterococcus spp., Staphylococcus aureus, K. pneumonia, Acinetobacter baumanii, P. aeruginosin, and Enterobacter spp. (ESKAPE) pathogens in children admitted to Dr. Hasan Sadikin Hospital. All pediatric patients having blood culture drawn from January 2015 to December 2016 were retrospectively studied. Data include the number of drawn blood culture, number of positive results, type of bacteria, sensitivity pattern. International standard definitions for acquired resistance by ECDC and CDC was used as definitions for MDR, XDR and PDR bacteria. From January 2015 to December 2016, 299 from 2.542 (11.7%) blood culture was positive, with Staphylococcus aureus, Enterococcus spp., Enterobacteriaceae, Pseudomonas aeruginosa, Acinetobacter spp., respectively 5, 6, 24, 5, 20 with total 60 (20%). The MDR and XDR pathogen found were 47 and 13 patients, respectively.

  4. Antimicrobial (Drug) Resistance Prevention

    Science.gov (United States)

    ... June 6, 2018 HIV Vaccine Elicits Antibodies in Animals that Neutralize Dozens of HIV Strains , June 4, 2018 ... Antimicrobial (Drug) Resistance > Understanding share with facebook share with twitter share ...

  5. Mechanisms of antibiotic resistance in Mycobacterium tuberculosis, validation of methods BACTECTM MGIT 960 and AnyplexM TII MTB / MDR / XDR Detection for detection of antibiotic resistance to first and second line in Mycobacterium tuberculosis strains

    International Nuclear Information System (INIS)

    Centeno Urena, Yadel

    2014-01-01

    A literature review is developed of drug-resistant TB in the world and in Costa Rica. The mechanisms of resistance to antibiotics are studied of the bacterium that causes tuberculosis; drug resistance to first-line and second-line, treatment regimen according to the World Health Organization and edge detection methods available in the market. The agreement between the results is studied by the phenotypic detection system of resistance of M. tuberculosis BACTEC MGIT960 and PCR, in real-time of commercial kit Anyplex II MTB/MDR/XDR, for genotypic identification of M. tuberculosis and related mutations to resistance with the referring results to thirty strains provided by the Pan American Health Organization, allowing a significant shortening in the time of obtaining reliable results. The results obtained have allowed to suggest a possible implementation at the Centro Nacional de Referencia en Micobacteriologia (CNRM), to perform antibiotic susceptibility testing and genotypic testing of multidrug cases respectively. The study results have allowed the implementation of the technology of genotypic detection of M. tuberculosis in the CNRM, obtaining for the first time in Costa Rica, information about genes of M. tuberculosis related to the generation of resistance to the major drugs of Primary treatment scheme as well as testing of resistance to second-line drug for resistant strains referred to the Centro Nacional de Referencia en Micobacteriologia in 2013. (author) [es

  6. Rapid diagnosis of multidrug resistance in cancer by electrochemical sensor based on carbon nanotubes-drug supramolecular nanocomposites.

    Science.gov (United States)

    Zhang, Haijun; Jiang, Hui; Sun, Feifei; Wang, Huangping; Zhao, Juan; Chen, Baoan; Wang, Xuemei

    2011-03-15

    The multidrug resistance (MDR) in cancer is a major chemotherapy obstacle, rendering many currently available chemotherapeutic drugs ineffective. The aim of this study was to explore the new strategy to early diagnose the MDR by electrochemical sensor based on carbon nanotubes-drug supramolecular interaction. The carbon nanotubes modified glassy carbon electrodes (CNTs/GCE) were directly immersed into the cells suspension of the sensitive leukemia cells K562 and/or its MDR cells K562/A02 to detect the response of the electrochemical probe of daunorubicin (DNR) residues after incubated with cells for 1h. The fresh evidence from the electrochemical studies based on CNTs/GCE demonstrated that the homogeneous, label-free strategy could directly measure the function of cell membrane transporters in MDR cancer cells, identify the cell phenotype (sensitive or MDR). When the different ratios of the sensitive leukemia cells K562 and its MDR ones K562/A02 were applied as a model of MDR levels to simulate the MDR occurrence in cancer, the cathodic peak current showed good linear response to the fraction of MDR with a correlation coefficient of 0.995. Therefore, the MDR fraction can be easily predicted based on the calibration curve of the cathodic peak current versus the fraction of MDR. These results indicated that the sensing strategy could provide a powerful tool for assessment of MDR in cancer. The new electrochemical sensor based on carbon nanotubes-drug supramolecular nanocomposites could represent promising approach in the rapid diagnosis of MDR in cancer. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Use of Lot Quality Assurance Sampling to Ascertain Levels of Drug Resistant Tuberculosis in Western Kenya.

    Directory of Open Access Journals (Sweden)

    Julia Jezmir

    Full Text Available To classify the prevalence of multi-drug resistant tuberculosis (MDR-TB in two different geographic settings in western Kenya using the Lot Quality Assurance Sampling (LQAS methodology.The prevalence of drug resistance was classified among treatment-naïve smear positive TB patients in two settings, one rural and one urban. These regions were classified as having high or low prevalence of MDR-TB according to a static, two-way LQAS sampling plan selected to classify high resistance regions at greater than 5% resistance and low resistance regions at less than 1% resistance.This study classified both the urban and rural settings as having low levels of TB drug resistance. Out of the 105 patients screened in each setting, two patients were diagnosed with MDR-TB in the urban setting and one patient was diagnosed with MDR-TB in the rural setting. An additional 27 patients were diagnosed with a variety of mono- and poly- resistant strains.Further drug resistance surveillance using LQAS may help identify the levels and geographical distribution of drug resistance in Kenya and may have applications in other countries in the African Region facing similar resource constraints.

  8. Use of Lot Quality Assurance Sampling to Ascertain Levels of Drug Resistant Tuberculosis in Western Kenya.

    Science.gov (United States)

    Jezmir, Julia; Cohen, Ted; Zignol, Matteo; Nyakan, Edwin; Hedt-Gauthier, Bethany L; Gardner, Adrian; Kamle, Lydia; Injera, Wilfred; Carter, E Jane

    2016-01-01

    To classify the prevalence of multi-drug resistant tuberculosis (MDR-TB) in two different geographic settings in western Kenya using the Lot Quality Assurance Sampling (LQAS) methodology. The prevalence of drug resistance was classified among treatment-naïve smear positive TB patients in two settings, one rural and one urban. These regions were classified as having high or low prevalence of MDR-TB according to a static, two-way LQAS sampling plan selected to classify high resistance regions at greater than 5% resistance and low resistance regions at less than 1% resistance. This study classified both the urban and rural settings as having low levels of TB drug resistance. Out of the 105 patients screened in each setting, two patients were diagnosed with MDR-TB in the urban setting and one patient was diagnosed with MDR-TB in the rural setting. An additional 27 patients were diagnosed with a variety of mono- and poly- resistant strains. Further drug resistance surveillance using LQAS may help identify the levels and geographical distribution of drug resistance in Kenya and may have applications in other countries in the African Region facing similar resource constraints.

  9. Laboratory-Based Surveillance of Extensively Drug-Resistant Tuberculosis in Eastern China.

    Science.gov (United States)

    Huang, Yu; Wu, Qingqing; Xu, Shuiyang; Zhong, Jieming; Chen, Songhua; Xu, Jinghang; Zhu, Liping; He, Haibo; Wang, Xiaomeng

    2017-03-01

    With 25% of the global burden, China has the highest incidence of drug-resistant tuberculosis (TB) in the world. However, surveillance data on extensively drug-resistant TB (XDR-TB) from China are scant. To estimate the prevalence of XDR-TB in Zhejiang, Eastern China, 30 of 90 TB treatment centers in Zhejiang were recruited. Patients with suspected TB who reported to the clinics for diagnosis were requested to undergo a smear sputum test. Positive sputum samples were tested for drug susceptibility. Data on anti-TB drug resistance from 1999 to 2008 were also collected to assess drug resistance trends. A total of 931 cases were recruited for drug susceptibility testing (DST). Among these, 23.6% (95% confidence interval [CI], 18.8-24.4) were resistant to any of the following drugs: isoniazid, rifampin, streptomycin, and ethambutol. Multidrug resistant (MDR) strains were identified in 5.1% of all cases (95% CI, 3.61-6.49). Among MDR-TB cases, 6.4% were XDR (95% CI, 1.7-18.6) and 8.9% (95% CI, 7.0-10.8) of all cases were resistant to either isoniazid or rifampin (but not both). Among MDR-TB cases, 23.4% (95% CI, 12.8-38.4) were resistant to either fluoroquinolones or a second-line anti-TB injectable drug, but not both. From 1999 to 2014, the percentage of MDR cases decreased significantly, from 8.6% to 5.1% (p = 0.00). The Global Fund to Fight TB program showed signs of success in Eastern China. However, drug-resistant TB, MDR-TB, and XDR-TB still pose a challenge for TB control in Eastern China. High-quality directly observed treatment, short-course, and universal DST for TB cases to determine appropriate treatment regimens are urgently needed to prevent acquired drug resistance.

  10. Comparison of the pharmacokinetics of two dosage regimens of linezolid in multidrug-resistant and extensively drug-resistant tuberculosis patients.

    NARCIS (Netherlands)

    Alffenaar, J.W.C.; Altena, R. van; Harmelink, I.M.; Filguera, P.; Molenaar, E.; Wessels, A.M.; Soolingen, D. van; Kosterink, J.G.W.; Uges, D.R.A.; Werf, T.S. van der

    2010-01-01

    BACKGROUND AND OBJECTIVES: For the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis (TB), potent new drugs are urgently needed. Linezolid is a promising drug, but its use is limited by adverse effects with prolonged administration of 600 mg twice daily. In

  11. Comparison of the Pharmacokinetics of Two Dosage Regimens of Linezolid in Multidrug-Resistant and Extensively Drug-Resistant Tuberculosis Patients

    NARCIS (Netherlands)

    Alffenaar, Jan-Willem C.; van Altena, Richard; Harmelink, Ilse M.; Filguera, Patricia; Molenaar, Esther; Wessels, A. Mireille A.; van Soolingen, Dick; Kosterink, Jos G. W.; Uges, Donald R. A.; van der Werf, Tjip S.

    2010-01-01

    Background and Objectives: For the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis (TB), potent new drugs are urgently needed. Linezolid is a promising drug, but its use is limited by adverse effects with prolonged administration of 600 mg twice daily. In

  12. Rapid molecular detection of rifampicin resistance facilitates early diagnosis and treatment of multi-drug resistant tuberculosis: case control study.

    Directory of Open Access Journals (Sweden)

    Philly O'Riordan

    2008-09-01

    Full Text Available Multi-drug resistant tuberculosis (MDR-TB is a major public health concern since diagnosis is often delayed, increasing the risk of spread to the community and health care workers. Treatment is prolonged, and the total cost of treating a single case is high. Diagnosis has traditionally relied upon clinical suspicion, based on risk factors and culture with sensitivity testing, a process that can take weeks or months. Rapid diagnostic molecular techniques have the potential to shorten the time to commencing appropriate therapy, but have not been put to the test under field conditions.This retrospective case-control study aimed to identify risk factors for MDR-TB, and analyse the impact of testing for rifampicin resistance using RNA polymerase B (rpoB mutations as a surrogate for MDR-TB. Forty two MDR-TB cases and 84 fully sensitive TB controls were matched by date of diagnosis; and factors including demographics, clinical presentation, microbiology findings, management and outcome were analysed using their medical records. Conventionally recognised risk factors for MDR-TB were absent in almost half (43% of the cases, and 15% of cases were asymptomatic. A significant number of MDR-TB cases were identified in new entrants to the country. Using rpoB mutation testing, the time to diagnosis of MDR-TB was dramatically shortened by a median of 6 weeks, allowing patients to be commenced on appropriate therapy a median of 51days earlier than those diagnosed by conventional culture and sensitivity testing.MDR-TB is frequently an unexpected finding, may be asymptomatic, and is particularly prevalent among TB infected new entrants to the country. Molecular resistance testing of all acid fast bacilli positive specimens has the potential to rapidly identify MDR-TB patients and commence them on appropriate therapy significantly earlier than by conventional methods.

  13. Multidrug-resistant and extensively drug-resistant tuberculosis: implications for the HIV epidemic and antiretroviral therapy rollout in South Africa.

    Science.gov (United States)

    Andrews, Jason R; Shah, N Sarita; Gandhi, Neel; Moll, Tony; Friedland, Gerald

    2007-12-01

    Drug-resistant tuberculosis (TB) is emerging as a major clinical and public health challenge in areas of sub-Saharan Africa where there is a high prevalence of human immunodeficiency virus (HIV) infection. TB drug-resistance surveillance in this region has been limited by laboratory capacity and the public health infrastructure; however, with the maturation of the HIV epidemic, the burden of drug-resistant TB is increasing rapidly. The recent discovery of large numbers of cases of multidrug-resistant (MDR) TB and extensively drug-resistant (XDR) TB in South Africa likely represents an unrecognized and evolving epidemic rather than sporadic, localized outbreaks. The combination of a large population of HIV-infected susceptible hosts with poor TB treatment success rates, a lack of airborne infection control, limited drug-resistance testing, and an overburdened MDR-TB treatment program provides ideal conditions for an MDR-TB and XDR-TB epidemic of unparalleled magnitude. In the present article, we review the history of drug-resistant TB in South Africa, describe its interaction with the HIV epidemic and the resultant consequences, and suggest measures necessary for controlling MDR-TB and XDR-TB in this context. A successful response to the emergence of MDR-TB and XDR-TB will necessitate increased resources for and collaboration between TB and HIV programs.

  14. Catalytic transitions in the human MDR1 P-glycoprotein drug binding sites.

    Science.gov (United States)

    Wise, John G

    2012-06-26

    Multidrug resistance proteins that belong to the ATP-binding cassette family like the human P-glycoprotein (ABCB1 or Pgp) are responsible for many failed cancer and antiviral chemotherapies because these membrane transporters remove the chemotherapeutics from the targeted cells. Understanding the details of the catalytic mechanism of Pgp is therefore critical to the development of inhibitors that might overcome these resistances. In this work, targeted molecular dynamics techniques were used to elucidate catalytically relevant structures of Pgp. Crystal structures of homologues in four different conformations were used as intermediate targets in the dynamics simulations. Transitions from conformations that were wide open to the cytoplasm to transition state conformations that were wide open to the extracellular space were studied. Twenty-six nonredundant transitional protein structures were identified from these targeted molecular dynamics simulations using evolutionary structure analyses. Coupled movement of nucleotide binding domains (NBDs) and transmembrane domains (TMDs) that form the drug binding cavities were observed. Pronounced twisting of the NBDs as they approached each other as well as the quantification of a dramatic opening of the TMDs to the extracellular space as the ATP hydrolysis transition state was reached were observed. Docking interactions of 21 known transport ligands or inhibitors were analyzed with each of the 26 transitional structures. Many of the docking results obtained here were validated by previously published biochemical determinations. As the ATP hydrolysis transition state was approached, drug docking in the extracellular half of the transmembrane domains seemed to be destabilized as transport ligand exit gates opened to the extracellular space.

  15. Kinetically Controlled Drug Resistance

    DEFF Research Database (Denmark)

    Sun, Xin E.; Hansen, Bjarne Gram; Hedstrom, Lizbeth

    2011-01-01

    The filamentous fungus Penicillium brevicompactum produces the immunosuppressive drug mycophenolic acid (MPA), which is a potent inhibitor of eukaryotic IMP dehydrogenases (IMPDHs). IMPDH catalyzes the conversion of IMP to XMP via a covalent enzyme intermediate, E-XMP*; MPA inhibits by trapping E...... of resistance is not apparent. Here, we show that, unlike MPA-sensitive IMPDHs, formation of E-XMP* is rate-limiting for both PbIMPDH-A and PbIMPDH-B. Therefore, MPA resistance derives from the failure to accumulate the drug-sensitive intermediate....

  16. Amplification of genome sections in mammalian somatic cells resistant to colchicine. VII. Localization of original and amplified copes of the mdr gene in the same segment of chromosome 4 of the Dzungarian hamster

    International Nuclear Information System (INIS)

    Sokova, O.I.; Siyanova, E.Yu.; Gudkov, A.V.; Kopnin, B.P.

    1988-01-01

    Using in situ hybridization, the mdr gene was mapped in chromosomes of Dzungarian hamster embryonic cells, amplification of which accompanies development of multidrug resistance (MDR). It was shown that the mdr gene is located in chromosome segment 4q15-21, in which, according to data obtained previously, amplified copes of open quotes MDR genes close quotes (mdr, et al.) are distributed, as a rule. Results obtained, as well as data of other investigators, attest to the fact that integration recombination of amplified copies of DNA occurs primarily at the site of disposition of homologous sequences

  17. Global transcriptional profiling of longitudinal clinical isolates of Mycobacterium tuberculosis exhibiting rapid accumulation of drug resistance.

    Directory of Open Access Journals (Sweden)

    Anirvan Chatterjee

    Full Text Available The identification of multidrug resistant (MDR, extensively and totally drug resistant Mycobacterium tuberculosis (Mtb, in vulnerable sites such as Mumbai, is a grave threat to the control of tuberculosis. The current study aimed at explaining the rapid expression of MDR in Directly Observed Treatment Short Course (DOTS compliant patients, represents the first study comparing global transcriptional profiles of 3 pairs of clinical Mtb isolates, collected longitudinally at initiation and completion of DOTS. While the isolates were drug susceptible (DS at onset and MDR at completion of DOTS, they exhibited identical DNA fingerprints at both points of collection. The whole genome transcriptional analysis was performed using total RNA from H37Rv and 3 locally predominant spoligotypes viz. MANU1, CAS and Beijing, hybridized on MTBv3 (BuG@S microarray, and yielded 36, 98 and 45 differentially expressed genes respectively. Genes encoding transcription factors (sig, rpoB, cell wall biosynthesis (emb genes, protein synthesis (rpl and additional central metabolic pathways (ppdK, pknH, pfkB were found to be down regulated in the MDR isolates as compared to the DS isolate of the same genotype. Up regulation of drug efflux pumps, ABC transporters, trans-membrane proteins and stress response transcriptional factors (whiB in the MDR isolates was observed. The data indicated that Mtb, without specific mutations in drug target genes may persist in the host due to additional mechanisms like drug efflux pumps and lowered rate of metabolism. Furthermore this population of Mtb, which also showed reduced DNA repair activity, would result in selection and stabilization of spontaneous mutations in drug target genes, causing selection of a MDR strain in the presence of drug pressures. Efflux pump such as drrA may play a significant role in increasing fitness of low level drug resistant cells and assist in survival of Mtb till acquisition of drug resistant mutations with

  18. Prevalence of resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients in Viet Nam, 2011.

    Science.gov (United States)

    Nguyen, Hoa Binh; Nguyen, Nhung Viet; Tran, Huong Thi Giang; Nguyen, Hai Viet; Bui, Quyen Thi Tu

    2016-01-01

    Extensively drug-resistant tuberculosis (XDR-TB) represents an emerging public health problem worldwide. According to the World Health Organization, an estimated 9.7% of multidrug-resistant TB (MDR-TB) cases are defined as XDR-TB globally. The objective of this study was to determine the prevalence of drug resistance to second-line TB drugs among MDR-TB cases detected in the Fourth National Anti-Tuberculosis Drug Resistance Survey in Viet Nam. Eighty clusters of TB cases were selected using a probability-proportion-to-size approach. To identify MDR-TB cases, drug susceptibility testing (DST) was performed for the four major first-line TB drugs. DST of second-line drugs (ofloxacin, amikacin, kanamycin, capreomycin) was performed on isolates from MDR-TB cases to identify pre-XDR and XDR cases. A total of 1629 smear-positive TB cases were eligible for culture and DST. Of those, DST results for first-line drugs were available for 1312 cases, and 91 (6.9%) had MDR-TB. Second-line DST results were available for 84 of these cases. Of those, 15 cases (17.9%) had ofloxacin resistance and 6.0% were resistant to kanamycin and capreomycin. Five MDR-TB cases (6.0%) met the criteria of XDR-TB. This survey provides the first estimates of the proportion of XDR-TB among MDR-TB cases in Viet Nam and provides important information for local policies regarding second-line DST. Local policies and programmes that are geared towards TB prevention, early diagnosis and treatment with effective regimens are of high importance.

  19. Diabetes and Other Risk Factors for Multi-drug Resistant Tuberculosis in a Mexican Population with Pulmonary Tuberculosis: Case Control Study.

    Science.gov (United States)

    Gómez-Gómez, Alejandro; Magaña-Aquino, Martin; López-Meza, Salvador; Aranda-Álvarez, Marcelo; Díaz-Ornelas, Dora E; Hernández-Segura, María Guadalupe; Salazar-Lezama, Miguel Ángel; Castellanos-Joya, Martín; Noyola, Daniel E

    2015-02-01

    Multidrug resistant tuberculosis (MDR-TB) poses problems in treatment, costs and treatment outcomes. It is not known if classically described risk factors for MDR-TB in other countries are the same in Mexico and the frequency of the association between diabetes mellitus (DM) and MDR-TB in our country is not clear. We undertook this study to analyze risk factors associated with the development of MDR-TB, with emphasis on DM. A case-control study in the state of San Luis Potosi (SLP), Mexico was carried out. All pulmonary MDR-TB patients diagnosed in the state of SLP between 1998 and 2013 (36 cases) evaluated at a state pharmacoresistant tuberculosis (TB) clinic and committee; 139 controls were randomly selected from all pulmonary non-multidrug-resistant tuberculosis (non-MDR-TB) cases identified between 2003 and 2008. Cases and controls were diagnosed and treated under programmatic conditions. Age, gender, malnutrition, being a health-care worker, HIV/AIDS status, and drug abuse were not significantly different between MDR-TB and non-MDR-TB patients. Significant differences between MDR-TB and non-MDR-TB patients were DM (47.2 vs. 28.1%; p = 0.028); previous anti-TB treatments (3 vs. 0, respectively; p <0.001), and duration of first anti-TB treatment (8 vs. 6 months, respectively; p <0.001). MDR-TB and DM are associated in 47.2% of MDR TB cases (17/36) in this study. Other recognized factors were not found to be significantly different in MDR-TB compared to non-MDR-TB in this study. Cost-feasible strategies must be implemented in the treatment of DM-TB in order to prevent the selection of MDR-TB. Copyright © 2015 IMSS. Published by Elsevier Inc. All rights reserved.

  20. Drug-resistance patterns of Mycobacterium tuberculosis strains and associated risk factors among multi drug-resistant tuberculosis suspected patients from Ethiopia.

    Science.gov (United States)

    Mesfin, Eyob Abera; Beyene, Dereje; Tesfaye, Abreham; Admasu, Addisu; Addise, Desalegn; Amare, Miskir; Dagne, Biniyam; Yaregal, Zelalem; Tesfaye, Ephrem; Tessema, Belay

    2018-01-01

    Multidrug drug-resistant tuberculosis (MDR-TB) is a major health problem and seriously threatens TB control and prevention efforts globally. Ethiopia is among the 30th highest TB burden countries for MDR-TB with 14% prevalence among previously treated cases. The focus of this study was on determining drug resistance patterns of Mycobacterium tuberculosis among MDR-TB suspected cases and associated risk factors. A cross-sectional study was conducted in Addis Ababa from June 2015 to December 2016. Sputum samples and socio-demographic data were collected from 358 MDR-TB suspected cases. Samples were analyzed using Ziehl-Neelsen technique, GeneXpert MTB/RIF assay, and culture using Lowenstein-Jensen and Mycobacterial growth indicator tube. Data were analyzed using SPSS version 23. A total of 226 the study participants were culture positive for Mycobacterium tuberculosis, among them, 133 (58.8%) participants were males. Moreover, 162 (71.7%) had been previously treated for tuberculosis, while 128 (56.6%) were TB/HIV co-infected. A majority [122 (54%)] of the isolates were resistant to any first-line anti-TB drugs. Among the resistant isolates, 110 (48.7%) were determined to be resistant to isoniazid, 94 (41.6%) to streptomycin, 89 (39.4%) to rifampicin, 72 (31.9%) to ethambutol, and 70 (30.9%) to pyrazinamide. The prevalence of MDR-TB was 89 (39.4%), of which 52/89 (58.4%) isolates were resistance to all five first-line drugs. Risk factors such as TB/HIV co-infection (AOR = 5.59, p = 0.00), cigarette smoking (AOR = 3.52, p = 0.045), alcohol drinking (AOR = 5.14, p = 0.001) hospital admission (AOR = 3.49, p = 0.005) and visiting (AOR = 3.34, p = 0.044) were significantly associated with MDR-TB. The prevalence of MDR-TB in the study population was of a significantly high level among previously treated patients and age group of 25-34. TB/HIV coinfection, smoking of cigarette, alcohol drinking, hospital admission and health facility visiting were identified as risk factors

  1. Reversing multidrug resistance in Caco-2 by silencing MDR1, MRP1, MRP2, and BCL-2/BCL-xL using liposomal antisense oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Yu-Li Lo

    Full Text Available Multidrug resistance (MDR is a major impediment to chemotherapy. In the present study, we designed antisense oligonucleotides (ASOs against MDR1, MDR-associated protein (MRP1, MRP2, and/or BCL-2/BCL-xL to reverse MDR transporters and induce apoptosis, respectively. The cationic liposomes (100 nm composed of N-[1-(2,3-dioleyloxypropyl]-n,n,n-trimethylammonium chloride and dioleoyl phosphotidylethanolamine core surrounded by a polyethylene glycol (PEG shell were prepared to carry ASOs and/or epirubicin, an antineoplastic agent. We aimed to simultaneously suppress efflux pumps, provoke apoptosis, and enhance the chemosensitivity of human colon adenocarcinoma Caco-2 cells to epirubicin. We evaluated encapsulation efficiency, particle size, cytotoxicity, intracellular accumulation, mRNA levels, cell cycle distribution, and caspase activity of these formulations. We found that PEGylated liposomal ASOs significantly reduced Caco-2 cell viability and thus intensified epirubicin-mediated apoptosis. These formulations also decreased the MDR1 promoter activity levels and enhanced the intracellular retention of epirubicin in Caco-2 cells. Epirubicin and ASOs in PEGylated liposomes remarkably decreased mRNA expression levels of human MDR1, MRP1, MRP2, and BCL-2. The combined treatments all significantly increased the mRNA expressions of p53 and BAX, and activity levels of caspase-3, -8, and -9. The formulation of epirubicin and ASOs targeting both pump resistance of MDR1, MRP1, and MRP2 and nonpump resistance of BCL-2/BCL-xL demonstrated more superior effect to all the other formulations used in this study. Our results provide a novel insight into the mechanisms by which PEGylated liposomal ASOs against both resistance types act as activators to epirubicin-induced apoptosis through suppressing MDR1, MRP1, and MRP2, as well as triggering intrinsic mitochondrial and extrinsic death receptor pathways. The complicated regulation of MDR highlights the necessity

  2. Extensively and Pre-Extensively Drug Resistant Tuberculosis in Clinical Isolates of Multi-Drug Resistant Tuberculosis Using Classical Second Line Drugs (Levofloxacin and Amikacin)

    International Nuclear Information System (INIS)

    Mirza, I. A.; Khan, F. A.; Khan, K. A.; Satti, L.; Ghafoor, T.; Fayyaz, M.

    2015-01-01

    Objective:To find out the frequency of Extensively Drug Resistant (XDR) and pre-XDR tuberculosis in clinical isolates of Multi-Drug Resistant (MDR) Tuberculosis (TB) by determining the susceptibilities against Levofloxacin and Amikacin (classical second line antituberculosis drugs). Study Design: A descriptive cross-sectional study. Place and Duration of Study: Microbiology Department, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from September 2011 to August 2013. Methodology: Amikacin (AK) and Levofloxacin (LEVO) were obtained in chemically pure form from Sigma (Taufkirchen, Germany). The breakpoint concentration used for AK was 1.0 micro g/ml and for LEVO 2.0 micro g/ml. Mycobacterial Growth Indicator Tube (MGIT) 960 system was used to carry out drug susceptibility testing as per recommended protocol. Results: A total of 3 MDR-TB isolates (3 percentage) turned out to be XDR-TB based upon simultaneous resistance to injectable second line antituberculosis drug AK and one of the fluoro-quinolones (LEVO). A total of 24 MDR-TB isolates (24 percentage) were found to be pre-XDR based upon resistance to LEVO alone. Treatment status record of patients with XDR and pre-XDRTB isolates revealed that majority of patients had received fluoroquinolones (FQs) during the course of treatment. Conclusion: XDR-TB has started to emerge in MDR-TB isolates in our set up. The worrying sign is the high frequency of pre-XDR tuberculosis. Urgent steps need to be taken to stem the tide of pre-XDR-TB in our population. It is thus recommended to develop facilities to carry out drug susceptibility testing to monitor the status of pre-XDR and XDR-TB in our population. (author)

  3. The fourth national anti-tuberculosis drug resistance survey in Viet Nam.

    Science.gov (United States)

    Nhung, N V; Hoa, N B; Sy, D N; Hennig, C M; Dean, A S

    2015-06-01

    Viet Nam's Fourth National Anti-Tuberculosis Drug Resistance Survey was conducted in 2011. To determine the prevalence of resistance to the four main first-line anti-tuberculosis drugs in Viet Nam. Eighty clusters were selected using a probability proportion to size approach. Drug susceptibility testing (DST) against the four main first-line anti-tuberculosis drugs was performed. A total of 1629 smear-positive tuberculosis (TB) patients were eligible for culture. Of these, DST results were available for 1312 patients, including 1105 new TB cases, 195 previously treated TB cases and 12 cases with an unknown treatment history. The proportion of cases with resistance to any drug was 32.7% (95%CI 29.1-36.5) among new cases and 54.2% (95%CI 44.3-63.7) among previously treated cases. The proportion of multidrug-resistant TB (MDR-TB) cases was 4.0% (95%CI 2.5-5.4) in new cases and 23.3 (95%CI 16.7-29.9) in previously treated cases. The fourth drug resistance survey in Viet Nam found that the proportion of MDR-TB among new and previously treated cases was not significantly different from that in the 2005 survey. The National TB Programme should prioritise the detection and treatment of MDR-TB to reduce transmission of MDR-TB in the community.

  4. Investigational drugs for the treatment of infections caused by multidrug-resistant Gram-negative bacteria.

    Science.gov (United States)

    Avery, Lindsay M; Nicolau, David P

    2018-04-01

    Infections caused by multidrug-resistant Gram-negative bacteria (MDR-GNB) are associated with significant mortality and costs. New drugs in development to combat these difficult-to-treat infections primarily target carbapenem-resistant Enterobacteriaceae, MDR Pseudomonas aeruginosa, and MDR Acinetobacter baumannii. Areas covered: The authors summarize in vitro and in vivo efficacy studies, as well as available clinical trial findings, for new agents in development for treatment of infection caused by MDR-GNB. Information regarding dosage regimens utilized in clinical trials and key pharmacokinetic and pharmacodynamic considerations are provided if available. A summary of recently approved agents, delafloxacin and meropenem/vaborbactam, is also included. Expert opinion: The development of multiple novel agents to fight MDR-GNB is promising to help save the lives of patients who acquire infection, and judicious use of these agents is imperative once they come to market to prevent the development of resistance. The other component paramount to this field of research is implementation of effective infection control policies and carbapenem-resistant Enterobacteriaceae (CRE) carrier screening protocols to mitigate the worldwide spread of MDR-GNB. Further investigation of anti-infective synergistic combinations will also be important, as well as support for economic research to reveal the true cost-benefit of utilization of the new agents discussed herein.

  5. Estimating Fitness by Competition Assays between Drug Susceptible and Resistant Mycobacterium tuberculosis of Predominant Lineages in Mumbai, India

    Science.gov (United States)

    Bhatter, Purva; Chatterjee, Anirvan; D'souza, Desiree; Tolani, Monica; Mistry, Nerges

    2012-01-01

    Background Multi Drug Resistant Tuberculosis (MDR TB) is a threat to global tuberculosis control. A significant fitness cost has been associated with DR strains from specific lineages. Evaluation of the influence of the competing drug susceptible strains on fitness of drug resistant strains may have an important bearing on understanding the spread of MDR TB. The aim of this study was to evaluate the fitness of MDR TB strains, from a TB endemic region of western India: Mumbai, belonging to 3 predominant lineages namely CAS, Beijing and MANU in the presence of drug susceptible strains from the same lineages. Methodology Drug susceptible strains from a single lineage were mixed with drug resistant strain, bearing particular non synonymous mutation (rpoB D516V; inhA, A16G; katG, S315T1/T2) from the same or different lineages. Fitness of M.tuberculosis (M.tb) strains was evaluated using the difference in growth rates obtained by using the CFU assay system. Conclusion/Significance While MANU were most fit amongst the drug susceptible strains of the 3 lineages, only Beijing MDR strains were found to grow in the presence of any of the competing drug susceptible strains. A disproportionate increase in Beijing MDR could be an alarm for an impending epidemic in this locale. In addition to particular non synonymous substitutions, the competing strains in an environment may impact the fitness of circulating drug resistant strains. PMID:22479407

  6. The making of a public health problem: multi-drug resistant tuberculosis in India.

    Science.gov (United States)

    Engel, Nora C

    2013-07-01

    This paper examines how actors construct the public problem of multi-drug resistant tuberculosis (MDR-TB) in India. MDR-TB has been framed by the World Health Organization as a pressing, global public health problem. The responses to MDR-TB are complicated as treatment takes longer and is more expensive than routine TB treatment. This is particularly problematic in countries, such as India, with high patient loads, a large and unregulated private sector, weak health systems and potentially high numbers of MDR-TB cases. This paper analyses how actors struggle for control over ownership, causal theories and political responsibility of the public problem of MDR-TB in India. It combines Gusfield's theory on the construction of public problems with insights from literature on the social construction of diseases and on medical social control. It highlights that there are flexible definitions of public problems, which are negotiated among actor groups and which shift over time. The Indian government has shifted its policy in recent years and acknowledged that MDR-TB needs to be dealt with within the TB programme. The study results reveal how the policy shift happened, why debates on the construction of MDR-TB as a public problem in India continue, and why actors with alternative theories than the government do not succeed in their lobbying efforts. Two main arguments are put forward. First, the construction of the public problem of MDR-TB in India is a social and political process. The need for representative data, international influence and politics define what is controllable. Second, the government seems to be anxious to control the definition of India's MDR-TB problem. This impedes an open, critical and transparent discussion on the definition of the public problem of MDR-TB, which is important in responding flexibly to emerging public health challenges.

  7. Mechanisms of first-line antimicrobial resistance in multi-drug and extensively drug resistant strains of Mycobacterium tuberculosis in KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Navisha Dookie

    2016-10-01

    Full Text Available Abstract Background In South Africa, drug resistant tuberculosis is a major public health crisis in the face of the colossal HIV pandemic. Methods In an attempt to understand the distribution of drug resistance in our setting, we analysed the rpoB, katG, inhA, pncA and embB genes associated with resistance to key drugs used in the treatment of tuberculosis in clinical isolates of Mycobacterium tuberculosis in the KwaZulu-Natal province. Results Classical mutations were detected in the katG, inhA and embB genes associated with resistance to isoniazid and ethambutol. Diverse mutations were recorded in the multidrug resistant (MDR and extensively drug resistant (XDR isolates for the rpoB and pncA gene associated with resistance to rifampicin and pyrazinamide. Conclusions M.tuberculosis strains circulating in our setting display a combination of previously observed mutations, each mediating resistance to a different drug. The MDR and XDR TB isolates analysed in this study displayed classical mutations linked to INH and EMB resistance, whilst diverse mutations were linked to RIF and PZA resistance. The similarity of the XDR strains confirms reports of the clonality of the XDR epidemic. The successful dissemination of the drug resistant strains in the province underscores the need for rapid diagnostics to effectively diagnose drug resistance and guide treatment.

  8. Primary and secondary anti-tuberculosis drug resistance in Hitossa District of Arsi Zone, Oromia Regional State, Central Ethiopia

    Directory of Open Access Journals (Sweden)

    Shallo Daba Hamusse

    2016-07-01

    Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDR-TB drugs which is resistant to the major first-line anti-TB drugs, Isoniazid and Rifampicin, has become a major global challenge in tuberculosis (TB control programme. However, its burden at community level is not well known. Thus, the aim of study was to assess the prevalence of primary and secondary resistance to any first line anti-TB drugs and MDR TB in Hitossa District of Oromia Regional State, Central Ethiopia. Methods Population based cross- sectional study was conducted on individuals aged ≥15 years. Those with symptoms suggestive of TB were interviewed and two sputum specimens were collected from each and examined using Lowenstein-Jensen (LJ culture medium. Further, the isolates were confirmed by the Ziehl-Neelsen microscopic examination method. Drug susceptibility test (DST was also conducted on LJ medium using a simplified indirect proportion method. The resistance strains were then determined by percentage of colonies that grew on the critical concentration of Isoniazid, Streptomycin, Rifampicin and Ethambutol. Results The overall resistance of all forms of TB to any first-line anti-TB drug was 21.7 %. Of the total new and previously treated culture positive TB cases, 15.3 and 48.8 % respectively were found to be a resistant to any of the first-line anti-TB drugs. Further, of all forms of TB, the overall resistance of MDR-TB was 4.7 %. However, of the total new TB cases, 2.4 % had primary while 14.3 % had secondary MDR-TB. Resistance to any of the first-line anti-TB drugs (adjusted odd ratio (AOR, 8.1; 95 % CI: 2.26–29.30 and MDR-TB (AOR, 7.1; 95 % CI: 2.6–43.8 was found to be linked with previous history of anti-TB treatment. Conclusions The study has identified a high rate of primary and secondary resistance to any of the first-line anti-TB drugs and MDR-TB in the study area. The resistance may have resulted from sub-optimal performance of directly observed

  9. Immunohistochemical Estimates of Angiogenesis, Proliferative Activity, p53 Expression, and Multiple Drug Resistance Have No Prognostic Impact in Osteosarcoma: A Comparative Clinicopathological Investigation

    DEFF Research Database (Denmark)

    Sørensen, Flemming Brandt; Jensen, Kenneth; Vaeth, Michael

    2008-01-01

    Purpose. To investigate angiogenesis, multiple drug resistance (MDR) and proliferative activity as prognostic variables in patients suffering from osteosarcoma. Methods. Histologic biopsies from 117 patients treated in the period from 1972 through 1999 were immunohistologically investigated...

  10. Culture and Next-generation sequencing-based drug susceptibility testing unveil high levels of drug-resistant-TB in Djibouti: results from the first national survey.

    Science.gov (United States)

    Tagliani, Elisa; Hassan, Mohamed Osman; Waberi, Yacine; De Filippo, Maria Rosaria; Falzon, Dennis; Dean, Anna; Zignol, Matteo; Supply, Philip; Abdoulkader, Mohamed Ali; Hassangue, Hawa; Cirillo, Daniela Maria

    2017-12-15

    Djibouti is a small country in the Horn of Africa with a high TB incidence (378/100,000 in 2015). Multidrug-resistant TB (MDR-TB) and resistance to second-line agents have been previously identified in the country but the extent of the problem has yet to be quantified. A national survey was conducted to estimate the proportion of MDR-TB among a representative sample of TB patients. Sputum was tested using XpertMTB/RIF and samples positive for MTB and resistant to rifampicin underwent first line phenotypic susceptibility testing. The TB supranational reference laboratory in Milan, Italy, undertook external quality assurance, genotypic testing based on whole genome and targeted-deep sequencing and phylogenetic studies. 301 new and 66 previously treated TB cases were enrolled. MDR-TB was detected in 34 patients: 4.7% of new and 31% of previously treated cases. Resistance to pyrazinamide, aminoglycosides and capreomycin was detected in 68%, 18% and 29% of MDR-TB strains respectively, while resistance to fluoroquinolones was not detected. Cluster analysis identified transmission of MDR-TB as a critical factor fostering drug resistance in the country. Levels of MDR-TB in Djibouti are among the highest on the African continent. High prevalence of resistance to pyrazinamide and second-line injectable agents have important implications for treatment regimens.

  11. Expression of multidrug resistance markers ABCB1 (MDR-1/P-gp) and ABCC1 (MRP-1) in renal cell carcinoma.

    LENUS (Irish Health Repository)

    Walsh, Naomi

    2009-01-01

    BACKGROUND: Renal cell carcinoma patients respond poorly to conventional chemotherapy, this unresponsiveness may be attributable to multidrug resistance (MDR). The mechanisms of MDR in renal cancer are not fully understood and the specific contribution of ABC transporter proteins which have been implicated in the chemoresistance of various cancers has not been fully defined in this disease. METHODS: In this retrospective study the expression of two of these transporter efflux pumps, namely MDR-1 P-gp (ABCB1) and MRP-1 (ABCC1) were studied by immunohistochemistry in archival material from 95 renal cell carcinoma patients. RESULTS: In the first study investigating MDR-1 P-gp and MRP-1 protein expression patterns in renal cell carcinoma patients, high levels of expression of both efflux pumps are observed with 100% of tumours studied showing MDR-1 P-gp and MRP-1 positivity. CONCLUSION: Although these findings do not prove a causal role, the high frequency of tumours expressing these efflux pumps suggests that they may be important contributors to the chemoresistance of this tumour type.

  12. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  13. Multidrug-resistant tuberculosis in Europe, 2010-2011

    DEFF Research Database (Denmark)

    Günther, Gunar; van Leth, Frank; Alexandru, Sofia

    2015-01-01

    Drug-resistant Mycobacterium tuberculosis is challenging elimination of tuberculosis (TB). We evaluated risk factors for TB and levels of second-line drug resistance in M. tuberculosis in patients in Europe with multidrug-resistant (MDR) TB. A total of 380 patients with MDR TB and 376 patients...... with non-MDR TB were enrolled at 23 centers in 16 countries in Europe during 2010-2011. A total of 52.4% of MDR TB patients had never been treated for TB, which suggests primary transmission of MDR M. tuberculosis. At initiation of treatment for MDR TB, 59.7% of M. tuberculosis strains tested were...

  14. Variation and risk factors of drug resistant tuberculosis in sub-Saharan Africa: a systematic review and meta-analysis

    NARCIS (Netherlands)

    Lukoye, Deus; Ssengooba, Willy; Musisi, Kenneth; Kasule, George W.; Cobelens, Frank G. J.; Joloba, Moses; Gomez, Gabriela B.

    2015-01-01

    Prevalence of multidrug resistant tuberculosis (MDR-TB), defined as in vitro resistance to both rifampicin and isoniazid with or without resistance to other TB drugs, in sub-Saharan Africa (SSA) is reportedly low compared to other regions. These estimates are based on data reported to the World

  15. [Reflection on Medical Treatment of Multi-drug Resistance Tuberculosis: The Necessity of Chinese Medicine Holistic View].

    Science.gov (United States)

    Zhang, Lei-lei; Jin, Hua

    2015-12-01

    Causative factors of multi-drug resistance tuberculosis (MDR-TB) were analyzed from iatrogenic angles, patients themselves, and society. Reviewed was the development of treatment strategies for MDR-TB from directly observed treatment short-course (DOTS) to DOTS-Plus. The history of Chinese medicine (CM) fighting TB and characteristics at the present stage were also analyzed. Authors pointed out that CM pays attention not only to killing pathogens and confirms the necessity of getting rid of pathogens, but also to cascade response caused by pathogens. It also regards the occurrence and development of MDR-TB as a whole by combining patients' conditions, climatic, geographic, psychological, and social factors. Authors believed that therapeutic principles under guidance of CM holistic view are of positive significance and inspiration in treating MDR-TB, and emphasized holistic view as basic strategies for treating MDR-TB, but not a single countermeasure.

  16. Risk Factors for Acquisition of Drug Resistance during Multidrug-Resistant Tuberculosis Treatment, Arkhangelsk Oblast, Russia, 2005–2010

    Science.gov (United States)

    Ershova, Julia; Vlasova, Natalia; Nikishova, Elena; Tarasova, Irina; Eliseev, Platon; Maryandyshev, Andrey O.; Shemyakin, Igor G.; Kurbatova, Ekaterina; Cegielski, J. Peter

    2015-01-01

    Acquired resistance to antituberculosis drugs decreases effective treatment options and the likelihood of treatment success. We identified risk factors for acquisition of drug resistance during treatment for multidrug-resistant tuberculosis (MDR TB) and evaluated the effect on treatment outcomes. Data were collected prospectively from adults from Arkhangelsk Oblast, Russia, who had pulmonary MDR TB during 2005–2008. Acquisition of resistance to capreomycin and of extensively drug-resistant TB were more likely among patients who received 3 effective drugs (9.4% vs. 0% and 8.6% vs. 0.8%, respectively). Poor outcomes were more likely among patients with acquired capreomycin resistance (100% vs. 25.9%), acquired ofloxacin resistance (83.6% vs. 22.7%), or acquired extensive drug resistance (100% vs. 24.4%). To prevent acquired drug resistance and poor outcomes, baseline susceptibility to first- and second-line drugs should be determined quickly, and treatment should be adjusted to contain >3 effective drugs. PMID:25988954

  17. Decreasing prevalence of multi-drugs resistant Mycobacterium tuberculosis in Nashik City, India

    Directory of Open Access Journals (Sweden)

    Arun P. More

    2013-03-01

    Full Text Available Objective: In India, increasing prevalence of multi-drug resistant tuberculosis (MDR has aggravated the control oftuberculosis problem. In many urban and semi-urban regions of India, no surveillance data of multidrug resistance inMycobacterium tuberculosisis available.Methods: A surveillance study on multidrug resistance was carried out in semi-urban and rural regions in and aroundNashik City of Maharashtra, India. The surveillance study was conducted in this region found that the prevalence ofcombined resistance to first and second-line anti-tuberculosis drugs is remarkably high. The isolates of M. tuberculosiswas identified and subjected to drug susceptibility testing. The patterns of drug susceptibility of isolates of M. tuberculosisduring the periods 2000 and 2004 were compared with drug susceptibility patterns of the organisms during theperiod 2008 to 2011.Results: The 260 isolates identified as M. tuberculosis show mean drug resistance prevalence of 45.6% for more than anytwo drugs and the MDR rate as 37% in the years 2000 to 2004 whereas 305 isolates of the organism show mean drugresistance prevalence of 30.2% and the MDR rate as 25% in the years 2008 to 2011.Conclusion: The researcher found that, though the prevalence of multidrug resistance to the drugs tested is remarkablyhigh, it has come down noticeably during the past seven years due to efforts of State Government and strict implementationof treatment guidelines of WHO by the physicians. J Microbiol Infect Dis 2013; 3(1: 12-17Key words: MDR-TB, XDR-TB, DOTS, drug-resistance prevalence rate.

  18. Decreasing prevalence of multi-drugs resistant Mycobacterium tuberculosis in Nashik City, India

    OpenAIRE

    More, Arun Punaji; Nagdawane, Ramkrishna Panchamrao; Gangurde, Aniket K

    2013-01-01

    Objective: In India, increasing prevalence of multi-drug resistant tuberculosis (MDR) has aggravated the control oftuberculosis problem. In many urban and semi-urban regions of India, no surveillance data of multidrug resistance inMycobacterium tuberculosisis available.Methods: A surveillance study on multidrug resistance was carried out in semi-urban and rural regions in and aroundNashik City of Maharashtra, India. The surveillance study was conducted in this region found that the prevalence...

  19. Metallo- β-lactamases among Multidrug Resistant (MDR Gram Negative Bacteria Isolated from Clinical Specimens during 2009 in Sanandaj, Kurdistan Province

    Directory of Open Access Journals (Sweden)

    Himen Salimizand

    2012-08-01

    Full Text Available Background: Today, there are numerous reports about emerging multi drug resistant gram negative bacteria all around the world, especially in ICUs. Rarely, Metallo-β-lactamase (MBL enzymes are responsible for these cases. Study of MBLs for diagnosing and preventing distribution of the origin of infection are critical issues. In addition, we would like to compare the efficacy of Iranian and foreign- made antibiotic disks. Materials and Methods: During 2009 all entered clinical specimens to the laboratory tested for detecting gram negative bacteria. Isolated bacteria were tested by Kirby-Bauer method to antibiotic susceptibility test by Iranian and foreign (MAST disks. For gram negative carbapenem resistant isolates, PCR technique used to detect VIM, GIM, and SIM variants of MBLs.Results: During one year, 17890 clinical specimens referred Besat laboratory. The most specimen was Urine (8172 followed by blood culture (5190 that in which 1110 gram negative and positives isolated. Out of which, 778 (70% of isolates were gram negatives. MDR gram negatives were 157 (20.2%. Imipenem and meropenem were the most efficient antibiotics (all susceptible and ceftriaxone was the least (19 % susceptible. E. coli was the most prevalent isolate. 79 Gram negative isolates (10.1% were resistant to Iranian-made discs but all susceptible for foreign ones. All 79 isolates were tested by PCR for MBL genes, that, all were negative. Besides, Iranian imipenem and cefepime disks have had distinguishable difference in susceptibility of isolates.Conclusion: Fortunately, none of gram negative isolates were MBL producer, which revealed no colonization of MBL producing bacteria. Iranian-made disks appear efficient except for imipenem and cefepime.

  20. Provider perspectives on drug-resistant tuberculosis and human immunodeficiency virus care in South Africa: a qualitative case study.

    Science.gov (United States)

    Daftary, A; Padayatchi, N

    2016-11-01

    To examine influences on health care workers' (HCWs') capacity to deliver health care for multi- and/or extensively drug-resistant tuberculosis (MDR/XDR-TB) and human immunodeficiency virus (HIV) infection in South Africa. Qualitative data were collected via group and individual interviews with a purposive sample of 17 HCWs at a centralised, tertiary TB facility and analysed using grounded theory. Four themes were identified: 1) personal infection control practices among HCWs may be weakened by a workplace culture comprising low motivation, disparate risk perceptions and practices across workforce hierarchies, physical discomfort, and problems managing patients with treatment-induced hearing loss. 2) Patient-provider interactions are likely stronger among nurses, and in HIV vs. MDR/XDR-TB service delivery, due to greater attention to patient empowerment and support. Stigma associated with MDR/XDR-TB, considered worse than HIV, may be perpetuated within non-specialised facilities less familiar with MDR/XDR-TB. 3) HCWs who struggle with the daily tedium of MDR/XDR-TB treatment supervision are becoming increasingly supportive of treatment literacy and self-administration. 4) Effective integration of HIV and MDR/XDR-TB services may be impeded by administrative restrictions, workplace norms and provider mindsets. Comprehensive, decentralised management of MDR/XDR-TB and HIV coinfection requires the creation of patient-provider trust and treatment literacy in MDR/XDR-TB programmes, and defying workplace norms that could provoke nosocomial TB exposure and fragmented service provision.

  1. Direct detection of Mycobacterium tuberculosis and drug resistance in respiratory specimen using Abbott Realtime MTB detection and RIF/INH resistance assay.

    Science.gov (United States)

    Tam, Kingsley King-Gee; Leung, Kenneth Siu-Sing; To, Sabrina Wai-Chi; Siu, Gilman Kit-Hang; Lau, Terrence Chi-Kong; Shek, Victor Chi-Man; Tse, Cindy Wing-Sze; Wong, Samson Sai-Yin; Ho, Pak-Leung; Yam, Wing-Cheong

    2017-10-01

    Abbott RealTime MTB (Abbott-RT) in conjunction with Abbott RealTime MTB RIF/INH Resistance (Abbott-RIF/INH) is a new, high-throughput automated nucleic acid amplification platform (Abbott-MDR) for detection of Mycobacterium tuberculosis complex (MTBC) and the genotypic markers for rifampicin (RIF) and isoniazid (INH) resistance directly from respiratory specimens. This prospective study evaluated the diagnostic performance of this new platform for MTBC and multidrug-resistant tuberculosis (MDR-TB) using 610 sputum specimens in a tuberculosis high-burden setting. Using conventional culture results and clinical background as reference standards, Abbott-RT exhibited an overall sensitivity and specificity of 95.2% and 99.8%, respectively. Genotypic RIF/INH resistance of 178 "MTB detected" specimens was subsequently analyzed by Abbott-RIF/INH. Compared to phenotypic drug susceptibility test results, Abbott-RIF/INH detected resistance genotypic markers in 84.6% MDR-TB, 80% mono-RIF-resistant and 66.7% mono-INH-resistant specimens. Two of the RIF-resistant specimens carried a novel single, nonsense mutation at rpoB Q513 and in silico simulation demonstrated that the truncated RpoB protein failed to bind with other subunits for transcription. Overall, Abbott-MDR platform provided high throughput and reliable diagnosis of MDR-TB within a TB high-burden region. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Drug Resistance and Population Structure of Mycobacterium tuberculosis Beijing Strains Isolated in Poland.

    Science.gov (United States)

    Kozińska, Monika; Augustynowicz-Kopeć, Ewa

    2015-01-01

    In total, 1095 Mycobacterium tuberculosis clinical isolates from 282 patients with drug-resistant and 813 with drug-sensitive tuberculosis (TB) in Poland during 2007-2011 were analysed. Seventy-one (6.5%) patients were found to have strains of Beijing genotype as defined by spoligotyping. The majority of patients were Polish-born; among foreign-born a large proportion came from Chechnya and Vietnam. Analysis showed strong associations between Beijing genotype infection and MDR, pre-XDR and XDR resistance, with a considerable relative risk among new patients, suggesting that this is due to increased spread of drug-resistant strains rather than acquisition of resistance during treatment.

  3. A study on Prevalence of Drug Resistance in Drug Default ...

    African Journals Online (AJOL)

    ), and particularly multidrug-resistant TB (MDR-TB), has become a significant public health problem in a number of countries and an obstacle to effective global TB control. Method: This is a prospective randomized cross sectional study to ...

  4. Antibacterial Activity Test of Nudibranches Polka - Dot (Jorunna funebris (Gastropods : Molusc Extract Against Multi(Aktivitas Antibakteri Ekstrak Nudibranch Polka-Dot (Jorunna funebris (Gastropoda : Moluska Terhadap Bakteri Multidrug Resistant (MDR

    Directory of Open Access Journals (Sweden)

    Delianis Pringgenies

    2015-12-01

    Full Text Available Terjadinya resistensi antibiotik menjadi permasalahan dalam dunia kesehatan. Peningkatan kemampuan patogen dalam menahan efek obat menyebabkan timbulnya resistensi. Beberapa bakteri patogen pada manusia dilaporkan telah mengalami resistensi terhadap lebih dari satu kelas antibiotik. Untuk mengatasi permasalahan tersebut, maka perlu dilakukan pencarian senyawa antibiotik baru yang lebih efektif dalam mengatasi permasalahan bakteri Multi-drug Resistant (MDR. Metabolit sekunder yang diproduksi oleh invertebrata laut  mempunyai prospek sebagai bahan obat dari laut. Nudibranch diduga mampu menghasilkan metabolit sekunder sebagai mekanisme pertahanan diri. Tujuan dari penelitian ini adalah untuk mengetahui fraksi dari ekstrak nudibranch Jorunna funebris yang menunjukkan bioaktivitas terhadap bakteri Multi-drug Resistant (MDR. Proses ekstraksi dilakukan dengan metode maserasi. Fraksinasi dengan Kromatografi Kolom Terbuka (KKT. Uji aktivitas antibakteri menggunakan metode difusi agar. Analisis komponen senyawa dengan GC-MS. Hasil penelitian menunjukkan bahwa 8 fraksi ekstrak nudibranch J. funebris menunjukkan aktivitas antibakteri. Hasil uji aktivitas menunjukkan fraksi I paling aktif terhadap 5 bakteri uji yaitu Klebsiella, Pseudomonas, Escherichia coli, Enterobacter 5 dan Enterobacter 10 dengan rata-rata zona hambatan secara berurutan sebesar 12,78 mm; 12,51 mm; 15,47 mm; 14,09 mm dan 12,46 mm. Fraksi II paling aktif terhadap bakteri Coagulase Negative Staphylococcus dengan rata-rata zona hambatan sebesar 12,70 mm. Analisis GC-MS menunjukkan bahwa dalam fraksi II terdapat senyawa 1-oktadekanol yang berpotensi sebagai antibakteri. Kata kunci : nudibranch, Jorunna funebris, antibakteri, multi-drug resistant, 1-oktadekanol Emergence of antibiotic resistance become a problems on medical world. Increasing pathogen ability to hold the antibiotic effect caused resistance. Several human-patogen bacteria were resistance to one or more classes of antibiotics

  5. Silencage du gene MDR1 et resensibilisation des cellules MCF-7 MDR a la doxorubicine en utilisant les nanoparticules chitosane/MDR1-siARN

    Science.gov (United States)

    El-Ariss, Mohamad

    Cancer is the leading cause of death in Canada and is responsible for about 30% of all deaths in the country.[1] It is estimated that by 2015, one in four Canadians (24% women and 29% men) will die from cancer. In the world and only for 2012, 14 million new cancer cases and 8.2 million deaths from the disease were reported.[2] The worst is yet to come because, according to World Health Organization, the number of new cases is expected to increase by about 70% over the next two decades. The high mortality associated with cancer is partly explained by the acquisition of drug resistance that make patients refractory to chemotherapy. In fact, cancer cells exposed to a cytotoxic agent during chemotherapy, may develop a resistance to this agent as well as various agents sharing structural or functional similarities. These cancer cells are known for multidrug resistance ("Multiple Drug resistant cells"). The development of resistance to chimiodrogues is a major public health problem that presents an obstacle for the development of new cancer treatments. MCF-7 MDR are established cell lines of human breast cancer that have developed resistance to chimiodrogues such as doxorubicin. MCF-7 MDR have the particularity to over-express P-gp protein that is responsible for the detoxification of cells by reflux of chimiodrogues. The purpose of this study was therefore to reduce the expression of P-gp, encoded by the MDR1 gene (also called gene ABCB1) in cancer cells MCF-7, and re-sensitize MCF-7 MDR cells to anti-cancer treatments. In order to modify MDR1 gene expression, we used small RNAi called siRNA that are specific to the MDR1 gene. In total, 4 duplexes of siRNA have been used: siRNA_1, siRNA_1M, siRNA_2 and siRNA_2M. Each of the duplexes strands is consists of 21 nucleic acids and has two protruding nucleic acids (overhangs) at the 3' end. siRNA_1 and siRNA_1M are complementary to the nucleic acid sequence (577-595 nucleic acids ) of the MDR1 gene, whereas siARN_2 and si

  6. Regional Lymphotropic Therapy in Combination with Low Level Laser Therapy for Treating Multi-Drug-Resistant Tuberculosis

    Directory of Open Access Journals (Sweden)

    Oksana Dogorova

    2016-03-01

    Full Text Available With the growing incidence of Multi-Drug-Resistant Tuberculosis (MDR-TB in newly identified patients, novel multimodality treatment methods are needed, aimed at reducing the time to sputum conversion and cavity healing, which would be applicable in MDR cases. Our experimental treatment consisted of the following: 1 chemotherapy based on the drug sensitivity profile, 2 local laser irradiation therapy for 25 days, and lymphotropic administration of isoniazid (to subcutaneous tissue in alternating locations: underarm area; fifth intercostal space along the sterna border; subclavian area where the first rib meets the sternum in a daily dose of 10mg/kg 5 times a week. This treatment was significantly more effective in newly detected destructive MDR-TB versus the standard Category IV regimen for MDR-TB in terms of reduced time for sputum culture conversion and cavity healing, estimated to be 6 months after initiation of treatment.

  7. Risk factors associated with multidrug resistant tuberculosis among ...

    African Journals Online (AJOL)

    Background: Multidrug resistant tuberculosis (MDR-TB) remains is an important public health problem in developing world. We conducted this study to determine risk factors associated with MDR-TB and drug susceptibility pattern to second line drug among MDR TB patients in Tanzania. Methods: Unmatched case control ...

  8. Dried blood spot analysis for therapeutic drug monitoring of linezolid in patients with multidrug-resistant tuberculosis

    NARCIS (Netherlands)

    Vu, D H; Bolhuis, M S; Koster, R A; Greijdanus, B; de Lange, W C M; van Altena, R; Brouwers, J R B J; Uges, D R A; Alffenaar, J W C

    2012-01-01

    Linezolid is a promising antimicrobial agent for the treatment of multidrug-resistant tuberculosis (MDR-TB), but its use is limited by toxicity. Therapeutic drug monitoring (TDM) may help to minimize toxicity while adequate drug exposure is maintained. Conventional plasma sampling and monitoring

  9. 20(S)-Protopanaxadiol (PPD) analogues chemosensitize multidrug-resistant cancer cells to clinical anticancer drugs.

    Science.gov (United States)

    Liu, Junhua; Wang, Xu; Liu, Peng; Deng, Rongxin; Lei, Min; Chen, Wantao; Hu, Lihong

    2013-07-15

    Novel 20(S)-protopanoxadiol (PPD) analogues were designed, synthesized, and evaluated for the chemosensitizing activity against a multidrug resistant (MDR) cell line (KBvcr) overexpressing P-glycoprotein (P-gp). Structure-activity relationship analysis showed that aromatic substituted aliphatic amine at the 24-positions (groups V) effectively and significantly sensitized P-gp overexpressing multidrug resistant (MDR) cells to anticancer drugs, such as docetaxel (DOC), vincristine (VCR), and adriamycin (ADM). PPD derivatives 12 and 18 showed 1.3-2.6 times more effective reversal ability than verapamil (VER) for DOC and VCR. Importantly, no cytotoxicity was observed by the active PPD analogues (5μM) against both non-MDR and MDR cells, suggesting that PPD analogues serve as novel lead compounds toward a potent and safe resistance modulator. Moreover, a preliminary mechanism study demonstrated that the chemosensitizing activity of PPD analogues results from inhibition of P-glycoprotein (P-gp) overexpressed in MDR cancer cells. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. Role of wild birds as carriers of multi-drug resistant Escherichia coli and Escherichia vulneris

    Directory of Open Access Journals (Sweden)

    Mohammed Y. Shobrak

    2014-12-01

    Full Text Available Emergence and distribution of multi-drug resistant (MDR bacteria in environments pose a risk to human and animal health. A total of 82 isolates of Escherichia spp. were recovered from cloacal swabs of migrating and non-migrating wild birds. All bacterial isolates were identified and characterized morphologically and biochemically. 72% and 50% of isolates recovered from non-migrating and migrating birds, respectively, showed positive congo red dye binding (a virulence factor. Also, hemolysin production (a virulence factor was showed in 8% of isolates recovered from non-migrating birds and 75% of isolates recovered from migrating birds. All isolates recovered from non-migrating birds were found resistant to Oxacillin while all isolates recovered from migrating birds demonstrated resistance to Oxacillin, Chloramphenicol, Oxytetracycline and Lincomycin. Some bacterial isolates recovered from non-migrating birds and migrating birds exhibited MDR phenotype. The MDR isolates were further characterized by API 20E and 16S rRNA as E. coli and E. vulneris. MDR Escherichia isolates contain ~1-5 plasmids of high-molecular weights. Accordingly, wild birds could create a potential threat to human and animal health by transmitting MDR bacteria to water streams and other environmental sources through their faecal residues, and to remote regions by migration.

  11. Role of wild birds as carriers of multi-drug resistant Escherichia coli and Escherichia vulneris

    Science.gov (United States)

    Shobrak, Mohammed Y.; Abo-Amer, Aly E.

    2014-01-01

    Emergence and distribution of multi-drug resistant (MDR) bacteria in environments pose a risk to human and animal health. A total of 82 isolates of Escherichia spp. were recovered from cloacal swabs of migrating and non-migrating wild birds. All bacterial isolates were identified and characterized morphologically and biochemically. 72% and 50% of isolates recovered from non-migrating and migrating birds, respectively, showed positive congo red dye binding (a virulence factor). Also, hemolysin production (a virulence factor) was showed in 8% of isolates recovered from non-migrating birds and 75% of isolates recovered from migrating birds. All isolates recovered from non-migrating birds were found resistant to Oxacillin while all isolates recovered from migrating birds demonstrated resistance to Oxacillin, Chloramphenicol, Oxytetracycline and Lincomycin. Some bacterial isolates recovered from non-migrating birds and migrating birds exhibited MDR phenotype. The MDR isolates were further characterized by API 20E and 16S rRNA as E. coli and E. vulneris. MDR Escherichia isolates contain ~1–5 plasmids of high-molecular weights. Accordingly, wild birds could create a potential threat to human and animal health by transmitting MDR bacteria to water streams and other environmental sources through their faecal residues, and to remote regions by migration. PMID:25763023

  12. Drug ratio-dependent antagonism: a new category of multidrug resistance and strategies for its circumvention.

    Science.gov (United States)

    Harasym, Troy O; Liboiron, Barry D; Mayer, Lawrence D

    2010-01-01

    A newly identified form of multidrug resistance (MDR) in tumor cells is presented, pertaining to the commonly encountered resistance of cancer cells to anticancer drug combinations at discrete drug:drug ratios. In vitro studies have revealed that whether anticancer drug combinations interact synergistically or antagonistically can depend on the ratio of the combined agents. Failure to control drug ratios in vivo due to uncoordinated pharmacokinetics could therefore lead to drug resistance if tumor cells are exposed to antagonistic drug ratios. Consequently, the most efficacious drug combination may not occur at the typically employed maximum tolerated doses of the combined drugs if this leads to antagonistic ratios in vivo after administration and resistance to therapeutic effects of the drug combination. Our approach to systematically screen a wide range of drug ratios and concentrations and encapsulate the drug combination in a liposomal delivery vehicle at identified synergistic ratios represents a means to mitigate this drug ratio-dependent MDR mechanism. The in vivo efficacy of the improved agents (CombiPlex formulations) is demonstrated and contrasted with the decreased efficacy when drug combinations are exposed to tumor cells in vivo at antagonistic ratios.

  13. The process behind the expression of mdr-1/P-gp and mrp/MRP in human leukemia/lymphoma.

    Science.gov (United States)

    Hirose, Masao

    2009-04-01

    There is a controversy over the link between phenotypes of multidrug resistance (MDR) and clinical outcome in leukemia/lymphoma patients. This may be because the process behind the induction and loss of expression of genotypes and phenotypes by which MDR develops and the role of MDR in fresh cells of human leukemia/lymphoma are not clearly defined. P-glycoprotein (P-gp) increased and decreased along with mdr-1 expression in three cell lines out of five vincristine (VCR)-resistant cell lines. MRP appeared with increased mrp expression in the other two cell lines. After the drug was removed from the culture system, mdr-1/P-gp changed in parallel with the level of VCR resistance, although mrp and MRP did not. It was concluded that P-gp is directly derived from mdr-1 and that mdr-1/P-gp supports the VCR-resistance but mrp/MRP is not directly linked to the VCR-resistance. These results should contribute to a better understanding of MDR phenomenon in cancer.

  14. Detekce polymorfismu v genu MDR1 u ovčáckých a honáckých psů

    OpenAIRE

    Staroveská, Marieta

    2016-01-01

    This thesis is focused on polymorphism of MDR1 gene and related drug resistance. Resistance is caused by deletion of four nucleotids, that resulting in a frame shift and synthesis of nonfunctional transport of P-glycoprotein. The text describes a polymorphism of MDR1 (ABCB1) gene, which results in reduced resistance to drugs belonging to the group of macrocyclic lactones. It also describes inheritance of this phenomenon and it deals with the detection of mutation using PCR (polymerase chain r...

  15. Evaluation of GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing of multi-drug resistance tuberculosis in Northern India

    Directory of Open Access Journals (Sweden)

    Anand Kumar Maurya

    2013-01-01

    Full Text Available Background: The problem of multi-drug resistance tuberculosis (MDR-TB is growing in several hotspots throughout the world. Rapid and accurate diagnosis of MDR-TB is crucial to facilitate early treatment and to reduce its spread in the community. The aim of the present study was to evaluate the new, novel GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing (DST of MDR-TB cases in Northern India. Materials and Methods: A total of 550 specimens were collected from highly suspected drug resistant from pulmonary and extra-pulmonary TB cases. All the specimens were processed by Ziehl- Neelsen staining, culture, differentiation by the GenoType® CM assay, first line DST using BacT/ALERT 3D system and GenoType® MTBDRplus assay. The concordance of the GenoType® MTBDRplus assay was calculated in comparison with conventional DST results. Results: Overall the sensitivity for detection of rifampicin, isoniazid and MDR-TB resistance by GenoType® MTBDRplus assay was 98.0%, 98.4% and 98.2% respectively. Out of 55 MDR-TB strains, 45 (81.8%, 52 (94.5% and 17 (30.9% strains showed mutation in rpoB, katG and inhA genes respectively (P < 0.05. The most prominent mutations in rpoB, katG and inhA genes were; 37 (67.3% in S531L, 52 (94.5% in S315T1 and 11 (20% in C15T regions respectively (P < 0.05. Conclusions: Our study demonstrated a high concordance between the GenoType® MTBDRplus assay resistance patterns and those were observed by conventional DST with good sensitivity, specificity with short turnaround times and to control new cases of MDR-TB in countries with a high prevalence of MDR-TB.

  16. Simple strategy to assess linezolid exposure in patients with multi-drug-resistant and extensively-drug-resistant tuberculosis.

    Science.gov (United States)

    Kamp, Jasper; Bolhuis, Mathieu S; Tiberi, Simon; Akkerman, Onno W; Centis, Rosella; de Lange, Wiel C; Kosterink, Jos G; van der Werf, Tjip S; Migliori, Giovanni B; Alffenaar, Jan-Willem C

    2017-06-01

    Linezolid is used increasingly for the treatment of multi-drug-resistant (MDR) and extensively-drug-resistant (XDR) tuberculosis (TB). However, linezolid can cause severe adverse events, such as peripheral and optical neuropathy or thrombocytopenia related to higher drug exposure. This study aimed to develop a population pharmacokinetic model to predict the area under the concentration curve (AUC) for linezolid using a limited number of blood samples. Data from patients with MDR-/XDR-TB who received linezolid and therapeutic drug monitoring as part of their TB treatment were used. Mw\\Pharm 3.82 (Mediware, Zuidhorn, The Netherlands) was used to develop a population pharmacokinetic model and limited sampling strategy (LSS) for linezolid. LSS was evaluated over a time span of 6 h. Blood sampling directly before linezolid administration and 2 h after linezolid administration were considered to be the most clinically relevant sampling points. The model and LSS were evaluated by analysing the correlation between AUC 12h,observed and AUC 12h,estimated . In addition, LSS was validated with an external group of patients with MDR-/XDR-TB from Sondalo, Italy. Fifty-two pharmacokinetic profiles were used to develop the model. Thirty-three profiles with a 300 mg dosing regimen and 19 profiles with a 600 mg dosing regimen were obtained. Model validation showed prediction bias of 0.1% and r 2 of 0.99. Evaluation of the most clinically relevant LSS showed prediction bias of 4.8% and r 2 of 0.97. The root mean square error corresponding to the most relevant LSS was 6.07%. The developed LSS could be used to enable concentration-guided dosing of linezolid. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

  17. Drug resistant tuberculosis in Saudi Arabia: an analysis of surveillance data 2014-2015.

    Science.gov (United States)

    Al Ammari, Maha; Al Turaiki, Abdulrahman; Al Essa, Mohammed; Kashkary, Abdulhameed M; Eltigani, Sara A; Ahmed, Anwar E

    2018-01-01

    There is limited data that investigates the national rates of drug-resistant tuberculosis (TB) in Saudi Arabia.This study aimed to estimate the rates of multi-drug-resistant tuberculosis (MDR-TB), rifampicin-resistant tuberculosis (RR-TB), and monoresistance (MR) in Saudi Arabia. A retrospective cohort study was conducted on all TB cases reported to the National TB Control and Prevention Program (NTCPP) registry at the Saudi Ministry of Health between January 1, 2014 and December 31, 2015. A total of 2098 TB patients with positive TB cultures were included in the study. Subgroup analyses and multivariate binary logistic regression models were performed with IBM SPSS 23.0. Of the total TB cases, 4.4% (95% CI: 3.59%-5.40%) were found to have MDR-TB. The rates of MR were 3.8% (95% CI: 2.99%-4.67%) for ethambutol, 5.4% (95% CI: 4.50%-6.49%) for pyrazinamide, 10.2% (95% CI: 5.89%-11.52%) for isoniazid, 11% (95% CI: 9.70%-12.43%) for streptomycin, and 5.9% (95% CI: 4.90%-6.96%) for rifampicin. The high rates of MDR and RR-TB were found among the younger age group, female gender, and those who had a previous history of TB. We also discovered that renal failure tends to increase the risk of rifampicin resistance. National TB data in Saudi Arabia shows that the rate of MDR-TB was similar to the global rate reported by the World Health Organization (WHO). It is a relatively high rate as compared to Western countries. The proportion of MDR/RR-TB patients tends to be higher in the younger age group, female gender, and in patients with a previous history of TB treatment. Effective strategies for prevention of all multi-drug-resistant TB cases are warranted.

  18. Proteomic analysis of drug-resistant Mycobacterium tuberculosis by one-dimensional gel electrophoresis and charge chromatography.

    Science.gov (United States)

    Yari, Shamsi; Hadizadeh Tasbiti, Alireza; Ghanei, Mostafa; Shokrgozar, Mohammad Ali; Fateh, Abolfazl; Mahdian, Reza; Yari, Fatemeh; Bahrmand, Ahmadreza

    2017-01-01

    Multidrug-resistant tuberculosis (MDR-TB) is a form of TB caused by Mycobacterium tuberculosis (M. tuberculosis) that do not respond to, at least, isoniazid and rifampicin, the two most powerful, first-line (or standard) anti-TB drugs. Novel intervention strategies for eliminating this disease were based on finding proteins that can be used for designing new drugs or new and reliable kits for diagnosis. The aim of this study was to compare the protein profiles of MDR-TB with sensitive isolates. Proteomic analysis of M. tuberculosis MDR-TB and sensitive isolates was obtained with ion exchange chromatography coupled with MALDI-TOF-TOF (matrix-assisted laser desorption/ionization) in order to identify individual proteins that have different expression in MDR-TB to be used as a drug target or diagnostic marker for designing valuable TB vaccines or TB rapid tests. We identified eight proteins in MDR-TB isolates, and analyses showed that these proteins are absent in M. tuberculosis-sensitive isolates: (Rv2140c, Rv0009, Rv1932, Rv0251c, Rv2558, Rv1284, Rv3699 and MMP major membrane proteins). These data will provide valuable clues in further investigation for suitable TB rapid tests or drug targets against drug-resistant and sensitive M. tuberculosis isolates.

  19. Increased multi-drug resistant Escherichia coli from hospitals in ...

    African Journals Online (AJOL)

    Background: Multidrug-resistant Escherichia coli (MDR E. coli) has become a major public health concern in Sudan and many countries, causing failure in treatment with consequent huge health burden. Objectives: To determine the prevalence and susceptibility of MDR E. coli isolated from patients in hospitals at Khartoum ...

  20. Antibacterial activity of herbal extracts against multi-drug resistant Escherichia coli recovered from retail chicken meat.

    Science.gov (United States)

    Shaheen, Arfat Yousaf; Sheikh, Ali Ahmad; Rabbani, Masood; Aslam, Asim; Bibi, Tasra; Liaqat, Fakhra; Muhammad, Javed; Rehmani, Shafqat Fatima

    2015-07-01

    Increasing incidence rate of multiple drug resistance in Escherichia coli (E. coli) due to extensive uses of antibiotics is a serious challenge to disease treatment. Contaminated retail chicken meat is one of the major sources of spread of multi drug resistant (MDR) E. coli. Current study has been conducted to study the prevalence of MDR E. coli in retail chicken meat samples from Lahore city of Pakistan and it was found that 73.86% of E. coli isolates have MDR pattern. In vitro evaluation of antibacterial activity of crude ethanolic extracts of six herbs against MDR E. coli phenotypes has revealed that clove and cinnamon have maximum zones of inhibition as compared to other herbal extracts. Mint and coriander gave the intermediate results while garlic and kalonji showed the least antibacterial activity against the MDR E. coli phenotypes using the agar well diffusion technique. Average Minimum Inhibitory Concentrations (MICs) for clove, mint, cinnamon, coriander, kalonji and garlic extracts were 1.15, 1.38, 0.5, 1.99, 2.41, 8.60 mg/mL respectively using the broth micro dilution method. The results obtained in present study were revealed that crude ethanol extracts of selected herbs have had significant antibacterial activity. Hence they can be used as promising alternatives of antimicrobials against MDR E. coli species and can be used for cooked food preservation.

  1. Use of GenoType® MTBDRplus assay to assess drug resistance and mutation patterns of multidrug-resistant tuberculosis isolates in northern India

    Directory of Open Access Journals (Sweden)

    A K Maurya

    2013-01-01

    Full Text Available Purpose: The emergence and spread of multidrug-resistant tuberculosis (MDR-TB is a major public health problem. The diagnosis of MDR-TB is of paramount importance in establishing appropriate clinical management and infection control measures. The aim of this study was to evaluate drug resistance and mutational patterns in clinical isolates MDR-TB by GenoType® MTBDRplus assay. Material and Methods: A total of 350 non-repeated sputum specimens were collected from highly suspected drug-resistant pulmonary tuberculosis (PTB cases; which were processed by microscopy, culture, differentiation and first line drug susceptibility testing (DST using BacT/ALERT 3D system. Results: Among a total of 125 mycobacterium tuberculosis complex (MTBC strains, readable results were obtained from 120 (96% strains by GenoType® MTBDRplus assay. Only 45 MDR-TB isolates were analysed for the performance, frequency and mutational patterns by GenoType® MTBDRplus assay. The sensitivity of the GenoType® MDRTBplus assay for detecting individual resistance to rifampicin (RIF, isoniazid (INH and multidrug resistance was found to be 95.8%, 96.3% and 97.7%, respectively. Mutation in codon S531L of the rpoB gene and codon S315T1 of katG genes were dominated in MDR-TB strains, respectively (P < 0.05. Conclusions: The GenoType® MTBDRplus assay is highly sensitive with short turnaround times and a rapid test for the detection of the most common mutations conferring resistance in MDR-TB strains that can readily be included in a routine laboratory workflow.

  2. Direct costs of managing adverse drug reactions during rifampicin-resistant tuberculosis treatment in South Africa.

    Science.gov (United States)

    Schnippel, K; Firnhaber, C; Berhanu, R; Page-Shipp, L; Sinanovic, E

    2018-04-01

    To estimate the provider costs of managing adverse drug reactions (ADRs) to standard long-course treatment for multidrug- and rifampicin-resistant tuberculosis (MDR/RR-TB) according to South African guidelines. We parameterised a published Markov health state model for MDR/RR-TB with guidelines-based, bottom-up public-sector provider costing of ADR management. Frequency of ADR occurrence was extracted from the literature. Costs were estimated over 10 years, discounted 3% annually and tested using probabilistic sensitivity analysis. On average, guidelines-based costing of moderate ADRs weighted by the frequency of occurrence was US$135.76 (standard deviation [SD] US$17.18) and the cost of serious ADRs was US$521.29 (SD US$55.99). We estimated that the incremental costs of ADR management were US$380.17 annually per patient initiating MDR/RR-TB treatment. The incremental costs of ADR management for the public health sector in South Africa was US$4.76 million, 8.3% of the estimated cohort costs of MDR/RR-TB treatment ($57.55 million) for the 2015 cohort of 12 527 patients. Management of multiple ADRs and serious ADRs, which are common during the first 6 months of standard, long-course MDR/RR-TB treatment, substantially increases provider treatment costs. These results need to be taken into account when comparing regimen costs, and highlight the urgent need to identify drug regimens with improved safety profiles.

  3. Genotypes of Mycobacterium tuberculosis in patients at risk of drug resistance in Bolivia.

    Science.gov (United States)

    Monteserin, Johana; Camacho, Mirtha; Barrera, Lucía; Palomino, Juan Carlos; Ritacco, Viviana; Martin, Anandi

    2013-07-01

    Bolivia ranks among the 10 Latin American countries with the highest rates of tuberculosis (TB) and multidrug resistant (MDR) TB. In view of this, and of the lacking information on the population structure of Mycobacterium tuberculosis in the country, we explored genotype associations with drug resistance and clustering by analyzing isolates collected in 2010 from 100 consecutive TB patients at risk of drug resistance in seven of the nine departments in which Bolivia is divided. Fourteen isolates were MDR, 29 had other drug resistance profiles, and 57 were pansusceptible. Spoligotype family distribution was: Haarlem 39.4%, LAM 26.3%, T 22.2%, S 2.0%, X 1.0%, orphan 9.1%, with very low intra-family diversity and absence of Beijing genotypes. We found 66 different MIRU-VNTR patterns; the most frequent corresponded to Multiple Locus Variable Analysis (MLVA) MtbC15 patterns 860, 372 and 873. Twelve clusters, each with identical MIRU-VNTR and spoligotypes, gathered 35 patients. We found no association of genotype with drug resistant or MDR-TB. Clustering associated with SIT 50 and the H3 subfamily to which it belongs (pBolivia. However, results should be taken cautiously because the sample is small and includes a particular subset of M. tuberculosis population. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Molecular Genetic Analysis of Multi-drug Resistance in Indian Isolates of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Noman Siddiqi

    1998-09-01

    Full Text Available A total of 116 isolates from patients attending the out-patient department at the All India Institute of Medical Sciences, New Delhi and the New Delhi Tuberculosis Centre, New Delhi, India were collected. They were analyzed for resistance to drugs prescribed in the treatment for tuberculosis. The drug resistance was initially determined by microbiological techniques. The Bactec 460TB system was employed to determine the type and level of resistance in each isolate. The isolates were further characterized at molecular level. The multi-drug loci corresponding to rpo b, gyr A, kat G were studied for mutation(s by the polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP technique. The SSCP positive samples were sequenced to characterize the mutations in rpo b, and gyr A loci. While previously reported mutations in the gyr A and rpo b loci were found to be present, several novel mutations were also scored in the rpo b locus. Interestingly, analysis of the gyr A locus showed the presence of point mutation(s that could not be detected by PCR-SSCP. Furthermore, rifampicin resistance was found to be an important marker for checking multi-drug resistance (MDR in clinical isolates of Mycobacterium tuberculosis. This is the first report on molecular genetic analysis of MDR tuberculosis one from India, highlights the increasing incidence of MDR in the Indian isolates of M. tuberculosis.

  5. The Potential Impact of Up-Front Drug Sensitivity Testing on India's Epidemic of Multi-Drug Resistant Tuberculosis.

    Directory of Open Access Journals (Sweden)

    Kuldeep Singh Sachdeva

    Full Text Available In India as elsewhere, multi-drug resistance (MDR poses a serious challenge in the control of tuberculosis (TB. The End TB strategy, recently approved by the world health assembly, aims to reduce TB deaths by 95% and new cases by 90% between 2015 and 2035. A key pillar of this approach is early diagnosis of tuberculosis, including use of higher-sensitivity diagnostic testing and universal rapid drug susceptibility testing (DST. Despite limitations of current laboratory assays, universal access to rapid DST could become more feasible with the advent of new and emerging technologies. Here we use a mathematical model of TB transmission, calibrated to the TB epidemic in India, to explore the potential impact of a major national scale-up of rapid DST. To inform key parameters in a clinical setting, we take GeneXpert as an example of a technology that could enable such scale-up. We draw from a recent multi-centric demonstration study conducted in India that involved upfront Xpert MTB/RIF testing of all TB suspects.We find that widespread, public-sector deployment of high-sensitivity diagnostic testing and universal DST appropriately linked with treatment could substantially impact MDR-TB in India. Achieving 75% access over 3 years amongst all cases being diagnosed for TB in the public sector alone could avert over 180,000 cases of MDR-TB (95% CI 44187 - 317077 cases between 2015 and 2025. Sufficiently wide deployment of Xpert could, moreover, turn an increasing MDR epidemic into a diminishing one. Synergistic effects were observed with assumptions of simultaneously improving MDR-TB treatment outcomes. Our results illustrate the potential impact of new and emerging technologies that enable widespread, timely DST, and the important effect that universal rapid DST in the public sector can have on the MDR-TB epidemic in India.

  6. Expression of the MDR1 gene and P-glycoprotein in canine mast cell tumor cell lines

    OpenAIRE

    NAKAICHI, Munekazu; TAKESHITA, Yoko; OKUDA, Masaru; NAKAMOTO, Yuya; ITAMOTO, Kazuhito; UNE, Satoshi; SASAKI, Nobuo; KADOSAWA, Tsuyoshi; TAKAHASHI, Tomoko; TAURA, Yasuho

    2007-01-01

    Cellular drug resistance to antineoplastic drugs is often due to the presence of a drug efflux pump that reduces intracellular drug accumulation and chemosensitivity. P-glycoprotein (P-gp), which is encoded by the MDR1 gene, is considered to function as an ATP-driven membrane drug efflux pump and appears to play an important role in tumor cell resistance. In the present report, we assessed the expression of MDR1 by RT-PCR in three canine mast cell tumor cell lines, TiMC, CoMS and LuMC, origin...

  7. Drug-resistant spinal tuberculosis

    Directory of Open Access Journals (Sweden)

    Anil K Jain

    2018-01-01

    Full Text Available Drug-resistant spinal tuberculosis (TB is an emerging health problem in both developing and developed countries. In this review article, we aim to define management protocols for suspicion, diagnosis, and treatment of such patients. Spinal TB is a deep-seated paucibacillary lesion, and the demonstration of acid-fast bacilli on Ziehl-Neelsen staining is possible only in 10%–30% of cases. Drug resistance is suspected in patients showing the failure of clinicoradiological improvement or appearance of a fresh lesion of osteoarticular TB while on anti tubercular therapy (ATT for a minimum period of 5 months. The conventional culture of Mycobacterium tuberculosis remains the gold standard for both bacteriological diagnosis and drug sensitivity testing (DST; however, the high turn around time of 2–6 weeks for detection with added 3 weeks for DST is a major limitation. To overcome this problem, rapid culture methods and molecular methods have been introduced. From a public health perspective, reducing the period between diagnosis and treatment initiation has direct benefits for both the patient and the community. For all patients of drug-resistant spinal TB, a complete Drug-O-Gram should be prepared which includes details of all drugs, their doses, and duration. Patients with confirmed multidrug-resistant TB strains should receive a regimen with at least five effective drugs, including pyrazinamide and one injectable. Patients with resistance to additional antitubercular drugs should receive individualized ATT as per their DST results.

  8. Molecular biological studies on the human radioresistance and drug resistance

    International Nuclear Information System (INIS)

    Kim, Chang Min; Hong, Weon Seon

    1992-04-01

    We irradiated the MKN45 and PC14 cell lines with 500 rads and also established the adriamycin-resistant and cis-platinum resistant cell line. The genomic DNA and total RNA were extracted and subjected to the Southern and Northern analysis using various probes including heat shock protein 70, MDR1, fos, TGFb etc. The mRNA transcript was increased 1 hour after the irradiation and sustained during the 48 hours and returned to the level of pre-irradiation. No significant change was observed with the drug resistant cell lines at the level of gene dosage. We suggest that the marked increase of the hsp70 transcript is very important finding and is believed to be a good candidate for the modulation of the cellular response to irradiation and the radioresistance. (Author)

  9. Unique behavioral characteristics and microRNA signatures in a drug resistant epilepsy model.

    Directory of Open Access Journals (Sweden)

    Jangsup Moon

    Full Text Available BACKGROUND: Pharmacoresistance is a major issue in the treatment of epilepsy. However, the mechanism underlying pharmacoresistance to antiepileptic drugs (AEDs is still unclear, and few animal models have been established for studying drug resistant epilepsy (DRE. In our study, spontaneous recurrent seizures (SRSs were investigated by video-EEG monitoring during the entire procedure. METHODS/PRINCIPAL FINDINGS: In the mouse pilocarpine-induced epilepsy model, we administered levetiracetam (LEV and valproate (VPA in sequence. AED-responsive and AED-resistant mice were naturally selected after 7-day treatment of LEV and VPA. Behavioral tests (open field, object exploration, elevated plus maze, and light-dark transition test and a microRNA microarray test were performed. Among the 37 epileptic mice with SRS, 23 showed significantly fewer SRSs during administration of LEV (n = 16, LEV sensitive (LS group or VPA (n = 7, LEV resistant/VPA sensitive (LRVS group, while 7 epileptic mice did not show any amelioration with either of the AEDs (n = 7, multidrug resistant (MDR group. On the behavioral assessment, MDR mice displayed distinctive behaviors in the object exploration and elevated plus maze tests, which were not observed in the LS group. Expression of miRNA was altered in LS and MDR groups, and we identified 4 miRNAs (miR-206, miR-374, miR-468, and miR-142-5p, which were differently modulated in the MDR group versus both control and LS groups. CONCLUSION: This is the first study to identify a pharmacoresistant subgroup, resistant to 2 AEDs, in the pilocarpine-induced epilepsy model. We hypothesize that modulation of the identified miRNAs may play a key role in developing pharmacoresistance and behavioral alterations in the MDR group.

  10. The culturable soil antibiotic resistome: a community of multi-drug resistant bacteria.

    Science.gov (United States)

    Walsh, Fiona; Duffy, Brion

    2013-01-01

    Understanding the soil bacterial resistome is essential to understanding the evolution and development of antibiotic resistance, and its spread between species and biomes. We have identified and characterized multi-drug resistance (MDR) mechanisms in the culturable soil antibiotic resistome and linked the resistance profiles to bacterial species. We isolated 412 antibiotic resistant bacteria from agricultural, urban and pristine soils. All isolates were multi-drug resistant, of which greater than 80% were resistant to 16-23 antibiotics, comprising almost all classes of antibiotic. The mobile resistance genes investigated, (ESBL, bla NDM-1, and plasmid mediated quinolone resistance (PMQR) resistance genes) were not responsible for the respective resistance phenotypes nor were they present in the extracted soil DNA. Efflux was demonstrated to play an important role in MDR and many resistance phenotypes. Clinically relevant Burkholderia species are intrinsically resistant to ciprofloxacin but the soil Burkholderia species were not intrinsically resistant to ciprofloxacin. Using a phenotypic enzyme assay we identified the antibiotic specific inactivation of trimethoprim in 21 bacteria from different soils. The results of this study identified the importance of the efflux mechanism in the soil resistome and variations between the intrinsic resistance profiles of clinical and soil bacteria of the same family.

  11. The culturable soil antibiotic resistome: a community of multi-drug resistant bacteria.

    Directory of Open Access Journals (Sweden)

    Fiona Walsh

    Full Text Available Understanding the soil bacterial resistome is essential to understanding the evolution and development of antibiotic resistance, and its spread between species and biomes. We have identified and characterized multi-drug resistance (MDR mechanisms in the culturable soil antibiotic resistome and linked the resistance profiles to bacterial species. We isolated 412 antibiotic resistant bacteria from agricultural, urban and pristine soils. All isolates were multi-drug resistant, of which greater than 80% were resistant to 16-23 antibiotics, comprising almost all classes of antibiotic. The mobile resistance genes investigated, (ESBL, bla NDM-1, and plasmid mediated quinolone resistance (PMQR resistance genes were not responsible for the respective resistance phenotypes nor were they present in the extracted soil DNA. Efflux was demonstrated to play an important role in MDR and many resistance phenotypes. Clinically relevant Burkholderia species are intrinsically resistant to ciprofloxacin but the soil Burkholderia species were not intrinsically resistant to ciprofloxacin. Using a phenotypic enzyme assay we identified the antibiotic specific inactivation of trimethoprim in 21 bacteria from different soils. The results of this study identified the importance of the efflux mechanism in the soil resistome and variations between the intrinsic resistance profiles of clinical and soil bacteria of the same family.

  12. GENETIC DIVERSITY OF DRUG RESISTANT STRAINS OF MYCOBACTERIUM TUBERCULOSIS IN OMSK REGION

    Directory of Open Access Journals (Sweden)

    O. A. Pаsechnik

    2017-01-01

    Full Text Available The article presents the investigation results of the specific epidemic situation on tuberculous infection in Omsk Region in 2006-2015 and molecular genetic features of M. tuberculosis strains with multiple drug resistance circulating in this region. Bacteriological, molecular genetic methods, VNTR-typing were used as well as descriptive techniques of the epidemiological process. Tuberculosis prevalence made 269.2 per 100,000 population. There is an increase in those with bacillary excretion among new cases of respiratory tuberculosis from 39.8% to 53.4%. Drug resistance was detected in 48.0% of new cases. Among drug resistance patterns, MDR made 57%, and extensive drug resistance (XDR increased from 2.5 to 7.0%. In 2015 prevalence of XDR tuberculosis made 8.9 per 100,000 population in Omsk Region. When performing VNTR-typing of 77 samples of M. tuberculosis DNA with MDR, 27 genetic types were identified. The population of MDR strain of M. tuberculosis is heterogeneous and presented by strains of various genetic families -Beijing, LAM, S,Haarlem,Uganda. The investigation showed that isolates ofBeijing family prevailed (76.6%.

  13. The Burden of Drug-Resistant Tuberculosis in Papua New Guinea: Results of a Large Population-Based Survey.

    Directory of Open Access Journals (Sweden)

    Paul Aia

    Full Text Available Reliable estimates of the burden of multidrug-resistant tuberculosis (MDR-TB are crucial for effective control and prevention of tuberculosis (TB. Papua New Guinea (PNG is a high TB burden country with limited information on the magnitude of the MDR-TB problem.A cross-sectional study was conducted in four PNG provinces: Madang, Morobe, National Capital District and Western Province. Patient sputum samples were tested for rifampicin resistance by the Xpert MTB/RIF assay and those showing the presence of resistance underwent phenotypic susceptibility testing to first- and second-line anti-TB drugs including streptomycin, isoniazid, rifampicin, ethambutol, pyrazinamide, ofloxacin, amikacin, kanamycin and capreomycin.Among 1,182 TB patients enrolled in the study, MDR-TB was detected in 20 new (2.7%; 95% confidence intervals [CI] 1.1-4.3% and 24 previously treated (19.1%; 95%CI: 8.5-29.8% TB cases. No case of extensively drug-resistant TB (XDR-TB was detected. Thirty percent (6/20 of new and 33.3% (8/24 of previously treated cases with MDR-TB were detected in a single cluster in Western Province.In PNG the proportion of MDR-TB in new cases is slightly lower than the regional average of 4.4% (95%CI: 2.6-6.3%. A large proportion of MDR-TB cases were identified from a single hospital in Western Province, suggesting that the prevalence of MDR-TB across the country is heterogeneous. Future surveys should further explore this finding. The survey also helped strengthening the use of smear microscopy and Xpert MTB/RIF testing as diagnostic tools for TB in the country.

  14. Challenges of using new and repurposed drugs for the treatment of multidrug-resistant tuberculosis in children.

    Science.gov (United States)

    Schaaf, H Simon; Garcia-Prats, Anthony J; McKenna, Lindsay; Seddon, James A

    2018-03-01

    New and repurposed antituberculosis drugs are urgently needed to more safely and effectively treat multidrug-resistant (MDR) tuberculosis (TB) in children. Multiple challenges limit timely access to new MDR-TB treatments in children. Areas covered: Diagnosis of MDR-TB in children remains a barrier, with few children with MDR-TB diagnosed and treated. Other barriers to timely access to new and repurposed drugs are discussed, and include delayed initiation of paediatric trials, limited funding for paediatric drug development, fragmented regulatory systems and operational challenges. The status of access to current repurposed and novel drugs is presented. Expert commentary: More timely initiation of paediatric trials is needed and paediatric work should happen and be funded in parallel with each phase of adult trials. Better quality data, increased regulator resources and expertise, harmonization of regulatory requirements across borders/organisations and registration fee waivers would improve registration timelines. Improved diagnosis, recording and reporting will establish better demand. Improved systems for procurement and supply chain management would reduce in-country operational barriers to getting medications to children. The challenges must be addressed to ensure timely and equitable access to new drugs and regimens that are urgently needed for effective, safe and shorter treatment of children with MDR-TB.

  15. A PROSPECTIVE, OBSERVATIONAL STUDY OF ADVERSE REACTIONS TO DRUG REGIME FOR MULTI-DRUG RESISTANT PULMONARY TUBERCULOSIS IN CENTRAL INDIA.

    Directory of Open Access Journals (Sweden)

    Dr. Rohan C. Hire

    2014-09-01

    Full Text Available Abstract Objective: 1 To assess the adverse drug reactions of second line anti-tubercular drugs used to treat Multi-drug resistant Tuberculosis (MDR TB in central India on the basis of causality, severity and avoidability scales. 2 To study the relationship of type of MDR TB (primary or secondary and presence of diabetes mellitus (DM with mean smear conversion time. Material and Methods: A prospective, observational study was carried out on diagnosed multidrug resistant tuberculosis patients enrolled for DOTS‑Plus regimen at TB and Chest Disease Department from January to December 2012. They were followed for 9 months thereafter and encountered adverse drug reactions (ADRs were noted along with the time of sputum conversion. The data were analysed by Chi-square or Fisher’s exact test and unpaired student’s‘t’ test. Results: Total 64 ADRs were reported in 55 patients out of total 110 patients (n = 110. As per the Naranjo causality assessment of ADRs, 7 patients had “definite” causal relation, 45 had “probable” causal relation and 3 had “possible” causal relation with drugs of DOTS Plus regime. As per the Hartwig’s severity assessment scale, there were total 7 ADRs in Level 1, 6 in Level 2, 33 in Level 3 and 9 in Level 4. Hallas avoidability assessment scale divided the ADRs as 3 being “Definitely avoidable”, 26 “Possibly avoidable”, 23 “Not avoidable” and 3 “unevaluable”. . Mean sputum smear conversion time is significantly higher in patients with secondary type than that of primary type of MDR TB (p = 0.0001 and in patients with DM than those without DM (p <0.0001. Conclusion: ADRs were common in patients of MDR TB on DOTs-Plus drug regime. It was due to lack of availability of safer and equally potent drugs in DOTs-Plus drug regime compared to DOTS regime in non-resistant TB. The frequency and severity of ADRs can be reduced by strict vigilance about known and unknown ADRs, monitoring their laboratory and

  16. Primary drug-resistant tuberculosis in Hanoi, Viet Nam: present status and risk factors.

    Directory of Open Access Journals (Sweden)

    Nguyen Thi Le Hang

    Full Text Available INTRODUCTION: Resistance of Mycobacterium tuberculosis (MTB to anti-tuberculosis (TB drugs presents a serious challenge to TB control worldwide. We investigated the status of drug resistance, including multidrug-resistant (MDR TB, and possible risk factors among newly diagnosed TB patients in Hanoi, the capital of Viet Nam. METHODS: Clinical and epidemiological information was collected from 506 newly diagnosed patients with sputum smear- and culture-positive TB, and 489 (96.6% MTB isolates were subjected to conventional drug susceptibility testing, spoligotyping, and 15-locus variable numbers of tandem repeats typing. Adjusted odds ratios (aORs were calculated to analyze the risk factors for primary drug resistance. RESULTS: Of 489 isolates, 298 (60.9% were sensitive to all drugs tested. Resistance to isoniazid, rifampicin, streptomycin, ethambutol, and MDR accounted for 28.2%, 4.9%, 28.2%, 2.9%, and 4.5%, respectively. Of 24 isolates with rifampicin resistance, 22 (91.7% were MDR and also resistant to streptomycin, except one case. Factors associated with isoniazid resistance included living in old urban areas, presence of the Beijing genotype, and clustered strains [aOR = 2.23, 95% confidence interval (CI 1.15-4.35; 1.91, 1.18-3.10; and 1.69, 1.06-2.69, respectively. The Beijing genotype was also associated with streptomycin resistance (aOR = 2.10, 95% CI 1.29-3.40. Human immunodeficiency virus (HIV coinfection was associated with rifampicin resistance and MDR (aOR = 5.42, 95% CI 2.07-14.14; 6.23, 2.34-16.58, respectively. CONCLUSION: Isoniazid and streptomycin resistance was observed in more than a quarter of TB patients without treatment history in Hanoi. Transmission of isoniazid-resistant TB among younger people should be carefully monitored in urban areas, where Beijing strains and HIV coinfection are prevalent. Choosing an optimal treatment regimen on the basis of the results of drug susceptibility tests and monitoring of treatment

  17. Drug-resistant tuberculosis--current dilemmas, unanswered questions, challenges, and priority needs.

    Science.gov (United States)

    Zumla, Alimuddin; Abubakar, Ibrahim; Raviglione, Mario; Hoelscher, Michael; Ditiu, Lucica; McHugh, Timothy D; Squire, S Bertel; Cox, Helen; Ford, Nathan; McNerney, Ruth; Marais, Ben; Grobusch, Martin; Lawn, Stephen D; Migliori, Giovanni-Battista; Mwaba, Peter; O'Grady, Justin; Pletschette, Michel; Ramsay, Andrew; Chakaya, Jeremiah; Schito, Marco; Swaminathan, Soumya; Memish, Ziad; Maeurer, Markus; Atun, Rifat

    2012-05-15

    Tuberculosis was declared a global emergency by the World Health Organization (WHO) in 1993. Following the declaration and the promotion in 1995 of directly observed treatment short course (DOTS), a cost-effective strategy to contain the tuberculosis epidemic, nearly 7 million lives have been saved compared with the pre-DOTS era, high cure rates have been achieved in most countries worldwide, and the global incidence of tuberculosis has been in a slow decline since the early 2000s. However, the emergence and spread of multidrug-resistant (MDR) tuberculosis, extensively drug-resistant (XDR) tuberculosis, and more recently, totally drug-resistant tuberculosis pose a threat to global tuberculosis control. Multidrug-resistant tuberculosis is a man-made problem. Laboratory facilities for drug susceptibility testing are inadequate in most tuberculosis-endemic countries, especially in Africa; thus diagnosis is missed, routine surveillance is not implemented, and the actual numbers of global drug-resistant tuberculosis cases have yet to be estimated. This exposes an ominous situation and reveals an urgent need for commitment by national programs to health system improvement because the response to MDR tuberculosis requires strong health services in general. Multidrug-resistant tuberculosis and XDR tuberculosis greatly complicate patient management within resource-poor national tuberculosis programs, reducing treatment efficacy and increasing the cost of treatment to the extent that it could bankrupt healthcare financing in tuberculosis-endemic areas. Why, despite nearly 20 years of WHO-promoted activity and >12 years of MDR tuberculosis-specific activity, has the country response to the drug-resistant tuberculosis epidemic been so ineffectual? The current dilemmas, unanswered questions, operational issues, challenges, and priority needs for global drug resistance screening and surveillance, improved treatment regimens, and management of outcomes and prevention of DR

  18. Genotypic characterization of multi-drug-resistant Mycobacterium tuberculosis isolates in Myanmar.

    Science.gov (United States)

    Aye, Khin Saw; Nakajima, Chie; Yamaguchi, Tomoyuki; Win, Min Min; Shwe, Mu Mu; Win, Aye Aye; Lwin, Thandar; Nyunt, Wint Wint; Ti, Ti; Suzuki, Yasuhiko

    2016-03-01

    The number of multi-drug-resistant tuberculosis (MDR-TB) cases is rising worldwide. As a countermeasure against this situation, the implementation of rapid molecular tests to identify MDR-TB would be effective. To develop such tests, information on the frequency and distribution of mutations associating with phenotypic drug resistance in Mycobacterium tuberculosis is required in each country. During 2010, the common mutations in the rpoB, katG and inhA of 178 phenotypically MDR M. tuberculosis isolates collected by the National Tuberculosis Control Program (NTP) in Myanmar were investigated by DNA sequencing. Mutations affecting the 81-bp rifampicin (RIF) resistance-determining region (RRDR) of the rpoB were identified in 127 of 178 isolates (71.3%). Two of the most frequently affected codons were 531 and 526, with percentages of 48.3% and 14.0% respectively. For isoniazid (INH) resistance, 114 of 178 MDR-TB isolates (64.0%) had mutations in the katG in which a mutation-conferring amino acid substitution at codon 315 from Ser to Thr was the most common. Mutations in the inhA regulatory region were also detected in 20 (11.2%) isolates, with the majority at position -15. Distinct mutation rate and pattern from surrounding countries might suggest that MDR-TB has developed and spread domestically in Myanmar. Copyright © 2015 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  19. Low-level quinolone-resistance in multi-drug resistant typhoid

    Energy Technology Data Exchange (ETDEWEB)

    Mirza, S H; Khan, M A [Armed Forces Inst. of Pathology, Rawalpindi (Pakistan). Dept. of Microbiolgy

    2008-01-15

    To find out the frequency of low-level quinolone-resistance in Multi-Drug Resistant (MDR) typhoid using nalidixic acid screening disc. Blood was obtained from suspected cases of typhoid fever and cultured in to BacT/ALERT. The positive blood cultures bottles were subcultured. The isolates were identified by colony morphology and biochemical tests using API-20E galleries. Susceptibility testing of isolates was done by modified Kirby-Bauer disc diffusion method on Muellar Hinton Agar. For the isolates, which were resistant to nalidixic acid by disc diffusion method, Minimal Inhibitory Concentrations (MICs) of ciprofloxacin and nalidixic acid were determined by using the E-test strips. Disc diffusion susceptibility tests and MICs were interpreted according to the guidelines provided by National Committee for Control Laboratory Standard (NCCLS). A total of 21(65.5%) out of 32 isolates of Salmonellae were nalidixic acid-resistant by disk diffusion method. All the nalidixic acid-resistant isolates by disc diffusion method were confirmed by MICs for both ciprofloxacin and nalidixic acid. All the nalidixic acid-resistant isolates had a ciprofloxacin MIC of 0.25-1 microg/ml (reduced susceptibility) and nalidixic acid MICs > 32 microg (resistant). Out of all Salmonella isolates, 24 (75%) were found to be MDR, and all were S. typbi. Low-level quinolone-resistance in typhoid was high in this small series. Screening for nalidixic acid resistance with a 30 microg nalidixic acid disk is a reliable and cost-effective method to detect low-level fluoroquinolone resistance, especially in the developing countries. (author)

  20. Low-level quinolone-resistance in multi-drug resistant typhoid

    International Nuclear Information System (INIS)

    Mirza, S.H.; Khan, M.A.

    2008-01-01

    To find out the frequency of low-level quinolone-resistance in Multi-Drug Resistant (MDR) typhoid using nalidixic acid screening disc. Blood was obtained from suspected cases of typhoid fever and cultured in to BacT/ALERT. The positive blood cultures bottles were subcultured. The isolates were identified by colony morphology and biochemical tests using API-20E galleries. Susceptibility testing of isolates was done by modified Kirby-Bauer disc diffusion method on Muellar Hinton Agar. For the isolates, which were resistant to nalidixic acid by disc diffusion method, Minimal Inhibitory Concentrations (MICs) of ciprofloxacin and nalidixic acid were determined by using the E-test strips. Disc diffusion susceptibility tests and MICs were interpreted according to the guidelines provided by National Committee for Control Laboratory Standard (NCCLS). A total of 21(65.5%) out of 32 isolates of Salmonellae were nalidixic acid-resistant by disk diffusion method. All the nalidixic acid-resistant isolates by disc diffusion method were confirmed by MICs for both ciprofloxacin and nalidixic acid. All the nalidixic acid-resistant isolates had a ciprofloxacin MIC of 0.25-1 microg/ml (reduced susceptibility) and nalidixic acid MICs > 32 microg (resistant). Out of all Salmonella isolates, 24 (75%) were found to be MDR, and all were S. typbi. Low-level quinolone-resistance in typhoid was high in this small series. Screening for nalidixic acid resistance with a 30 microg nalidixic acid disk is a reliable and cost-effective method to detect low-level fluoroquinolone resistance, especially in the developing countries. (author)

  1. Association between diabetes mellitus and multi-drug-resistant tuberculosis : a protocol for a systematic review and meta-analysis

    NARCIS (Netherlands)

    Tegegne, Balewgizie Sileshi; Habtewold, Tesfa Dejenie; Mengesha, Melkamu Merid; Burgerhof, Johannes G M

    2017-01-01

    INTRODUCTION: Multi-drug-resistant tuberculosis (MDR-TB) has emerged as a challenge to global tuberculosis (TB) control and remains a major public health concern in many countries. Diabetes mellitus (DM) is an increasingly recognized comorbidity that can both accelerate TB disease and complicate its

  2. Computational Studies of Drug Resistance

    DEFF Research Database (Denmark)

    da Silva Martins, João Miguel

    Drug resistance has been an increasing problem in patient treatment and drug development. Starting in the last century and becoming a major worry in the medical and scienti c communities in the early part of the current millennium, major research must be performed to address the issues of viral...... is of the utmost importance in developing better and less resistance-inducing drugs. A drug's in uence can be characterized in many diff erent ways, however, and the approaches I take in this work re ect those same different in uences. This is what I try to achieve in this work, through seemingly unrelated...... approaches that come together in the study of drug's and their in uence on proteins and vice-versa. In part I, I aim to understand through combined theoretical ensemble analysis and free energy calculations the e ects mutations have over the binding anity and function of the M2 proton channel. This research...

  3. MIRU-VNTR typing of drug-resistant tuberculosis isolates in Greece.

    Science.gov (United States)

    Rovina, Nikoletta; Karabela, Simona; Constantoulakis, Pantelis; Michou, Vassiliki; Konstantinou, Konstantinos; Sgountzos, Vassileios; Roussos, Charis; Poulakis, Nikolaos

    2011-08-01

    The increasing immigration rate in Greece from countries with a high prevalence of Mycobacterium tuberculosis (MTB) and multidrug-resistant tuberculosis (MDR-TB) may have an impact οn the number of MDR-TB cases in Greece. The aim of this study was to genotypically characterize the MTB isolates from patients with pulmonary drug-resistant tuberculosis (DR-TB) in Greece, and to determine whether there is any association between the prevalent genotypes and drug resistance. Fifty-three drug-resistant MTB strains isolated from culture specimens of clinical material from native Greeks and immigrant patients with pulmonary tuberculosis were genotyped using the mycobacterial interspersed repetitive units-variable number of tandem repeats (MIRU-VNTR) method. The phylogenetically distinct groups of isolates identified were: the Beijing (34%), the LAM (11%), the Haarlem (24.5%), the Uganda I (9.4%), the Ural (3.8%), the Delhi/CAS (9.4%) and the Cameroon (3.8%) families. Greek patients were more likely to have monoresistant and polyresistant TB with the most prevalent isolates belonging to the Haarlem family. Among foreign-born patients with MDR-TB, the most prevalent genotypes belonged to the Beijing family. MIRU-VNTR rapidly obtained clinically useful genotyping data, by characterizing clonal MTB heterogeneity in the isolated strains. Our results underline the need for more effective antituberculosis control programs in order to control the expansion of DR-TB in Greece.

  4. Bakteri Simbion Gastropoda Pleuroploca trapesium Dari Perairan Ternate, Sebagai Alternatif Antibakteri MDR (Bacterial Symbiont Gastropoda Pleuroploca trapezium from Ternate, as Alternative Antibacterial MDR

    Directory of Open Access Journals (Sweden)

    Delianis Pringgenies

    2014-03-01

    The bacteria resistant to some antibiotics are known as multi drug resistant (MDR. To overcome the problem, it is needed to search for a new antibiotic compounds more effectively and efficiently. This study aims to identify potential from symbionts of Pleuroploca trapezium as a source of antibacteria MDR and identifying the bacteria that were active against the MDR. Samples were collected from Ternate, Maluku. Isolation of symbiotic bacteria, screening for bacteria which producing secondary metabolites as anti-MDR bacteria, antibacterial test, isolation of clinical pathogenic bacteria of MDR. Conducting anti-bacterial sensitivity test,  sensitivity test for antibacterial,  DNA exctraction, DNA amplification based on PCR method, DNA sequencing.  Result of 16S r-DNA sequence was then analyzed and edited using GENETYX program and followed by 16S rDNA sequence analysis. Screening of bacteria associated with P. trapezium resulted in 19 isolates with 5 active bacteria. Based on the size of the zone forming and the consistency of zone, so the best isolate is TPT 4.7. The identification shows that TPT 4.7 has a close relationship with the Paracoccus sp. MBIC4019 with homologi of 95%, which shows the relationship at the genus level. Its suggest that these results are very promising as a new antibacterial material. Keywords: antibacterial, symbiotic bacteria, Pleuroploca trapezium, multi drugs resistant

  5. Changing prevalence and resistance patterns in children with drug-resistant tuberculosis in Mumbai.

    Science.gov (United States)

    Shah, Ira; Shah, Forum

    2017-05-01

    The prevalence of drug-resistant (DR) tuberculosis (TB) in children is increasing. Although, in India, multi-drug-resistant (MDR) TB rates have been relatively stable, the number of children with pre-extensively drug-resistant and extensively drug-resistant (XDR) TB is increasing. To determine whether the prevalence of DR TB in children in Mumbai is changing and to study the evolving patterns of resistance. A retrospective study was undertaken in 1311 paediatric patients referred between April 2007 and March 2013 to the Paediatric TB clinic at B. J. Wadia Hospital for Children, Mumbai. Children were defined as having DR TB on the basis of drug susceptibility testing (DST) of Mycobacterium tuberculosis grown on culture of body fluids (in the case of extra pulmonary TB) or from gastric lavage/bronchi-alveolar lavage/sputum in patients with pulmonary TB or from DST of the contacts. The prevalence of DR TB was calculated and the type of DR was evaluated yearly and in the pre-2010 and post-2010 eras. The overall prevalence of DR TB was 86 (6.6%) with an increase from 23 (5.6%) patients pre-2010 to 63 (7%) post-2010 (P = 0.40). Nine (10.4%) patients were diagnosed on the basis of contact with a parent with DR TB. Overall fluoroquinolone resistance increased from 9 (39.1%) pre-2010 to 59 (93.7%) post-2010 (P = 0.0001): moxifloxacin resistance increased from 2 (8.7%) to 29 (46%) (P = 0.0018) and ofloxacin resistance increased from 7 (30.4%) to 30 (47.6%) (P = 0.14). Ethionamide resistance also increased from 6 (26.1%) to 31 (49.2%) (P = 0.04), aminoglycoside resistance was one (4.3%) pre-2010 and 12 (19%) post-2010 (P = 0.17) and resistance remained virtually the same for both amikacin [0 pre-2010 and 6 (9.5%) after 2010] and kanamycin [one (4.3%) pre- and 6 (9.5%) post-2010]. Of the first-line drugs, resistance remained the same for isoniazid [23 (100%) to 61 (96.8%)], rifampicin [22 (95.7%) to 51 (80.9%),P = 0.17], pyrazinamide [15 (65.2%) to

  6. Small-molecule synthetic compound norcantharidin reverses multi-drug resistance by regulating Sonic hedgehog signaling in human breast cancer cells.

    Directory of Open Access Journals (Sweden)

    Yu-Jen Chen

    Full Text Available Multi-drug resistance (MDR, an unfavorable factor compromising treatment efficacy of anticancer drugs, involves upregulated ATP binding cassette (ABC transporters and activated Sonic hedgehog (Shh signaling. By preparing human breast cancer MCF-7 cells resistant to doxorubicin (DOX, we examined the effect and mechanism of norcantharidin (NCTD, a small-molecule synthetic compound, on reversing multidrug resistance. The DOX-prepared MCF-7R cells also possessed resistance to vinorelbine, characteristic of MDR. At suboptimal concentration, NCTD significantly inhibited the viability of DOX-sensitive (MCF-7S and DOX-resistant (MCF-7R cells and reversed the resistance to DOX and vinorelbine. NCTD increased the intracellular accumulation of DOX in MCF-7R cells and suppressed the upregulated the mdr-1 mRNA, P-gp and BCRP protein expression, but not the MRP-1. The role of P-gp was strengthened by partial reversal of the DOX and vinorelbine resistance by cyclosporine A. NCTD treatment suppressed the upregulation of Shh expression and nuclear translocation of Gli-1, a hallmark of Shh signaling activation in the resistant clone. Furthermore, the Shh ligand upregulated the expression of P-gp and attenuated the growth inhibitory effect of NCTD. The knockdown of mdr-1 mRNA had not altered the expression of Shh and Smoothened in both MCF-7S and MCF-7R cells. This indicates that the role of Shh signaling in MDR might be upstream to mdr-1/P-gp, and similar effect was shown in breast cancer MDA-MB-231 and BT-474 cells. This study demonstrated that NCTD may overcome multidrug resistance through inhibiting Shh signaling and expression of its downstream mdr-1/P-gp expression in human breast cancer cells.

  7. Structural Biology Meets Drug Resistance: An Overview on Multidrug Resistance Transporters

    DEFF Research Database (Denmark)

    Shaheen, Aqsa; Iqbal, Mazhar; Mirza, Osman

    2017-01-01

    . Research on the underlying causes of multidrug resistance in cancerous cells and later on in infectious bacteria revealed the involvement of integral membrane transporters, capable of recognizing a broad range of structurally different molecules as substrates and exporting them from the cell using cellular...... superfamilies, viz., ATP-binding cassette superfamily, major facilitator superfamily and resistance nodulation division superfamily are presented. Further, the future role of structural biology in improving our understanding of drug-transporter interactions and in designing novel inhibitors against MDR pump...... century, mankind has become aware and confronted with the emergence of antibiotic-resistant pathogens. In parallel to the failure of antibiotic therapy against infectious pathogens, there had been continuous reports of cancerous cells not responding to chemotherapy with increase in the duration of therapy...

  8. Study of tea polyphenol as a reversal agent for carcinoma cell lines' multidrug resistance (study of TP as a MDR reversal agent)

    International Nuclear Information System (INIS)

    Zhu Aizhi; Wang Xiangyun; Guo Zhenquan

    2001-01-01

    The aim of this study was to examine MDR1 expression product P-glycoprotein (Pgp) and study the effect and mechanism of tea polyphenol (TP) in reversion of multidrug resistance (MDR) in carcinoma cell lines. Immunocytochemical method was used for qualitative detection of Pgp. A comparative study of cytotoxicity and multidrug resistance reversion effect was made by MTT assay for tea polyphenol and quinidine in MCF-7 and MCF-7/Adr cell lines. The multidrug resistance reversion effect and mechanism were studied by measuring the uptake of 99m Tc-tetrofosmin in the carcinoma cell lines. (1) The Pgp overexpression in MCF-7/Adr cells was found to be strong positive, while the Pgp expression of MCF-7 was negative. (2) Although both tea polyphenol and quinidine could not remarkably change the toxicity of adriamycin to MCF-7, they could improve the sensitivity of MCF-7/Adr to adriamycin. The reversion index of tea polyphenol and quinidine was 3 and 10 respectively. (3) The cellular uptake of 99m Tc-tetrofosmin was remarkably lower in MCF-7/Adr than in MCF-7. The uptake of 99m Tc-tetrofosmin in MCF-7/Adr exhibited a 4, 13, 16 fold increase in the presence of 200, 400 and 500 μg/ml of tea polyphenol respectively. The uptake of 99m Tc-tetrofosmin in MCF-7/Adr exhibited only a 4-fold increase in the presence of 200 μM of quinidine. Immunocytochemistry can detect P-glycoprotein expression level qualitatively. Tea polyphenol is not only an anti-tumor agent, but also a multidrug resistant modulator similar to quinidine. The multidrug resistance reversion mechanism of tea polyphenol seems to be its inhibition of the activity of P-glycoprotein. Tea polyphenol has the advantage of very low toxicity in tumor treatment

  9. Inhibitory effect of the reversal agents V-104, GF120918 and Pluronic L61 on MDR1 Pgp-, MRP1- and MRP2-mediated transport

    NARCIS (Netherlands)

    Evers, R.; Kool, M.; Smith, A. J.; van Deemter, L.; de Haas, M.; Borst, P.

    2000-01-01

    The human multidrug transporter MDR1 P-glycoprotein and the multidrug resistance proteins MRP1 and MRP2 transport a range of cytotoxic drugs, resulting in multidrug resistance in tumour cells. To overcome this form of drug resistance in patients, several inhibitors (reversal agents) of these

  10. A cross-sectional study of tuberculosis drug resistance among previously treated patients in a tertiary hospital in Accra, Ghana: public health implications of standardized regimens.

    Science.gov (United States)

    Forson, Audrey; Kwara, Awewura; Kudzawu, Samuel; Omari, Michael; Otu, Jacob; Gehre, Florian; de Jong, Bouke; Antonio, Martin

    2018-04-02

    Mycobacterium tuberculosis drug resistance is a major challenge to the use of standardized regimens for tuberculosis (TB) therapy, especially among previously treated patients. We aimed to investigate the frequency and pattern of drug resistance among previously treated patients with smear-positive pulmonary tuberculosis at the Korle-Bu Teaching Hospital Chest Clinic, Accra. This was a cross-sectional survey of mycobacterial isolates from previously treated patients referred to the Chest Clinic Laboratory between October 2010 and October 2013. The Bactec MGIT 960 system for mycobactrerial culture and drug sensitivity testing (DST) was used for sputum culture of AFB smear-positive patients with relapse, treatment failure, failure of smear conversion, or default. Descriptive statistics were used to summarize patient characteristics, and frequency and patterns of drug resistance. A total of 112 isolates were studied out of 155 from previously treated patients. Twenty contaminated (12.9%) and 23 non-viable isolates (14.8%) were excluded. Of the 112 studied isolates, 53 (47.3%) were pan-sensitive to all first-line drugs tested Any resistance (mono and poly resistance) to isoniazid was found in 44 isolates (39.3%) and any resistance to streptomycin in 43 (38.4%). Thirty-one (27.7%) were MDR-TB. Eleven (35.5%) out of 31 MDR-TB isolates were pre-XDR. MDR-TB isolates were more likely than non-MDR isolates to have streptomycin and ethambutol resistance. The main findings of this study were the high prevalence of MDR-TB and streptomycin resistance among previously treated TB patients, as well as a high prevalence of pre-XDR-TB among the MDR-TB patients, which suggest that first-line and second-line DST is essential to aid the design of effective regimens for these groups of patients in Ghana.

  11. Diagnostic and therapeutic progress of multi-drug resistance with anti-HBV nucleos(t)ide analogues

    Institute of Scientific and Technical Information of China (English)

    Zhuo-Lun Song; Yu-Jun Cui; Wei-Ping Zheng; Da-Hong Teng; Hong Zheng

    2012-01-01

    Nucleos(t)ide analogues (NA) are a breakthrough in the treatment and management of chronic hepatitis B.NA could suppress the replication of hepatitis B virus (HBV) and control the progression of the disease.However,drug resistance caused by their long-term use becomes a practical problem,which influences the long-term outcomes in patients.Liver transplantation is the only choice for patients with HBV-related end-stage liver disease.But,the recurrence of HBV after transplantation often caused by the development of drug resistance leads to unfavorable outcomes for the recipients.Recentiy,the multi-drug resistance (MDR) has become a common issue raised due to the development and clinical application of a variety of NA.This may complicate the antiviral therapy and bring poorly prognostic outcomes.Although clinical evidence has suggested that combination therapy with different NA could effectively reduce the viral load in patients with MDR,the advent of new antiviral agents with high potency and high genetic barrier to resistance brings hope to antiviral therapy.The future of HBV researches relies on how to prevent the MDR occurrence and develop reasonable and effective treatment strategies.This review focuses on the diagnostic and therapeutic progress in MDR caused by the anti-HBV NA and describes some new research progress in this field.

  12. Multidrug resistance in Lactococcus lactis

    NARCIS (Netherlands)

    Bolhuis, Hendrik

    1996-01-01

    Multidrug resistance (MDR) was initially recongnized as the major cause of the failure of the drug-based treatment of human cancers. It has become increasingly clear that MDR occurs in mammalian cells but also in lower eukaryotes and bacteria. The appearance of multiple antibiotic resistant

  13. Drug resistance pattern of mycobacterial isolates in HIV and non-HIV population in South India

    Directory of Open Access Journals (Sweden)

    Umamaheshwari Shivaswamy

    2016-01-01

    Full Text Available Background: Emergence of drug resistance has complicated the treatment of tuberculosis (TB. WHO reports India to be one among 27 “high burden” multidrug-resistant (MDR TB countries. Objective: To diagnose TB and detect drug resistance of mycobacterial isolates in acid-fast bacilli (AFB smear negative HIV reactive patients (Group A and compare them with HIV seropositive AFB smear positive (Group B and HIV-seronegative AFB positive cases (Group C. Materials and Methods: Clinical specimens collected in all groups were processed as per the standard protocol except blood, which was processed by lysis centrifugation technique. They were then inoculated with Lowenstein-Jensen media and the isolates obtained were subjected to drug susceptibility test (DST by proportion method and genotype MTBDR plus assay. Results: In Group A, 162 patients were included. Of the 443 clinical samples collected, 76 mycobacterial strains were obtained from 67 (41% patients. Of these, 50 (65.8% were sensitive to all drugs and 26 (34.2% resistant to one or more anti-tubercular drugs. Antibiogram of Group A when compared with Group B and C showed that the MDR rate 6.6%, 6.7% and 8% respectively did not differ much; but resistance to at least single drug was (26 [34.2%], 3 [10%], and 8 [16%], respectively. Conclusion: Our study suggests that HIV has no influence on the anti-tubercular resistance pattern, but increased MDR rate along with HIV in high TB burden setting stresses the need for early diagnosis and DST in providing proper regimens and improve prognosis.

  14. Sensitivity Pattern of Second Line Anti-Tuberculosis Drugs against Clinical Isolates of Multidrug Resistant Mycobacterium Tuberculosis

    International Nuclear Information System (INIS)

    Ghafoor, T.; Ikram, A.; Abbasi, S. A.; Zaman, G.; Ayyub, M.; Palomino, J. C.; Vandamme, P.; Martin, A.

    2015-01-01

    Objective:To determine the current sensitivity pattern of second line anti-tuberculosis drugs against clinical isolates of Multidrug Resistant Mycobacterium tuberculosis (MDR-TB). Study Design: A cross-sectional study. Place and Duration of Study: Department of Microbiology, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from November 2011 to April 2013. Methodology: Samples received during the study period were processed on BACTEC MGIT 960 system for Mycobacterium tuberculosis (MTB) culture followed by first line drugs susceptibility testing of culture proven MTB isolates. On the basis of resistance to rifampicin and isoniazid, 100 clinical isolates of MDR-TB were further subjected to susceptibility testing against amikacin (AMK), capreomycin (CAP), ofloxacin (OFL) and ethionamide (ETH) as per standard BACTEC MGIT 960 instructions. Results: Out of 100 MDR-TB isolates, 62% were from male patients and 38% from female patients. 97% were sensitive to AMK, 53% to OFL, 87% to CAP; and 87% were sensitive to ETH. Conclusion: The majority of the MDR-TB isolates showed excellent sensitivity against AMK, CAP and ETH. However, sensitivity of MDR-TB isolates against fluoroquinolones like OFL was not encouraging. (author)

  15. Extensively Drug-Resistant TB

    Centers for Disease Control (CDC) Podcasts

    2016-12-16

    Dr. Charlotte Kvasnovsky, a surgery resident and Ph.D. candidate in biostatistics, discusses various types of drug resistance in TB patients in South Africa.  Created: 12/16/2016 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 12/16/2016.

  16. Multimodal transfer of MDR by exosomes in human osteosarcoma.

    Science.gov (United States)

    Torreggiani, Elena; Roncuzzi, Laura; Perut, Francesca; Zini, Nicoletta; Baldini, Nicola

    2016-07-01

    Exosomes are extracellular vesicles released by both normal and tumour cells which are involved in a new intercellular communication pathway by delivering cargo (e.g., proteins, microRNAs, mRNAs) to recipient cells. Tumour-derived exosomes have been shown to play critical roles in different stages of tumour growth and progression. In this study, we investigated the potential role of exosomes to transfer the multidrug resistance (MDR) phenotype in human osteosarcoma cells. Exosomes were isolated by differential centrifugation of culture media from multidrug resistant human osteosarcoma MG-63DXR30 (Exo/DXR) and MG-63 parental cells (Exo/S). Exosome purity was examined by transmission electron microscopy and confirmed by immunoblot analysis for the expression of specific exosomal markers. Our data showed that exosomes derived from doxorubicin-resistant osteosarcoma cells could be taken up into secondary cells and induce a doxorubicin-resistant phenotype. The incubation of osteosarcoma cells with Exo/DXR decreased the sensitivity of parental cells to doxorubicin, while exposure with Exo/S was ineffective. In addition, we demonstrated that Exo/DXR expressed higher levels of MDR-1 mRNA and P-glycoprotein compared to Exo/S (p=0.03). Interestingly, both MDR-1 mRNA and P-gp increased in MG-63 cells after incubation with Exo/DXR, suggesting this as the main mechanism of exosome-mediated transfer of drug resistance. Our findings suggest that multidrug resistant osteosarcoma cells are able to spread their ability to resist the effects of doxorubicin treatment on sensitive cells by transferring exosomes carrying MDR-1 mRNA and its product P-glycoprotein.

  17. Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

    International Nuclear Information System (INIS)

    Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

    2008-01-01

    Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression

  18. Evaluation of the microscopic observational drug susceptibility assay for rapid and efficient diagnosis of multi-drug resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    R P Lazarus

    2012-01-01

    Full Text Available Purpose: Tuberculosis (TB is endemic in India and the burden of multi-drug-resistant tuberculosis (MDR-TB is high. Early detection of MDR-TB is of primary importance in controlling the spread of TB. The microscopic observational drug susceptibility (MODS assay has been described as a cost-effective and rapid method by which mycobacterial culture and the drug susceptibility test (DST can be done at the same time. Materials and Methods: A total of 302 consecutive sputum samples that were received in an accredited mycobacteriology laboratory for conventional culture and DST were evaluated by the MODS assay. Results: In comparison with conventional culture on Lowenstein Jensen (LJ media, the MODS assay showed a sensitivity of 94.12% and a specificity of 89.39% and its concordance with the DST by the proportion method on LJ media to isoniazid and rifampicin was 90.8% and 91.5%, respectively. The turnaround time for results by MODS was 9 days compared to 21 days by culture on LJ media and an additional 42 days for DST by the 1% proportion method. The cost of performing a single MODS assay was Rs. 250/-, compared to Rs. 950/- for culture and 1st line DST on LJ. Conclusion: MODS was found to be a sensitive and rapid alternative method for performing culture and DST to identify MDR-TB in resource poor settings.

  19. Multiple Origins of Mutations in the mdr1 Gene--A Putative Marker of Chloroquine Resistance in P. vivax.

    Directory of Open Access Journals (Sweden)

    Mette L Schousboe

    2015-11-01

    Full Text Available Chloroquine combined with primaquine has been the recommended antimalarial treatment of Plasmodium vivax malaria infections for six decades but the efficacy of this treatment regimen is threatened by chloroquine resistance (CQR. Single nucleotide polymorphisms (SNPs in the multidrug resistance gene, Pvmdr1 are putative determinants of CQR but the extent of their emergence at population level remains to be explored.In this study we describe the prevalence of SNPs in the Pvmdr1 among samples collected in seven P. vivax endemic countries and we looked for molecular evidence of drug selection by characterising polymorphism at microsatellite (MS loci flanking the Pvmdr1 gene.We examined the prevalence of SNPs in the Pvmdr1 gene among 267 samples collected from Pakistan, Afghanistan, Sri Lanka, Nepal, Sudan, São Tomé and Ecuador. We measured and diversity in four microsatellite (MS markers flanking the Pvmdr1 gene to look evidence of selection on mutant alleles.SNP polymorphism in the Pvmdr1 gene was largely confined to codons T958M, Y976F and F1076L. Only 2.4% of samples were wildtype at all three codons (TYF, n = 5, 13.3% (n = 28 of the samples were single mutant MYF, 63.0% of samples (n = 133 were double mutant MYL, and 21.3% (n = 45 were triple mutant MFL. Clear geographic differences in the prevalence of these Pvmdr mutation combinations were observed. Significant linkage disequilibrium (LD between Pvmdr1 and MS alleles was found in populations sampled in Ecuador, Nepal and Sri Lanka, while significant LD between Pvmdr1 and the combined 4 MS locus haplotype was only seen in Ecuador and Sri Lanka. When combining the 5 loci, high level diversity, measured as expected heterozygosity (He, was seen in the complete sample set (He = 0.99, while He estimates for individual loci ranged from 0.00-0.93. Although Pvmdr1 haplotypes were not consistently associated with specific flanking MS alleles, there was significant differentiation between geographic

  20. Higher Desolvation Energy Reduces Molecular Recognition in Multi-Drug Resistant HIV-1 Protease

    Directory of Open Access Journals (Sweden)

    Ladislau C. Kovari

    2012-05-01

    Full Text Available Designing HIV-1 protease inhibitors that overcome drug-resistance is still a challenging task. In this study, four clinical isolates of multi-drug resistant HIV-1 proteases that exhibit resistance to all the US FDA-approved HIV-1 protease inhibitors and also reduce the substrate recognition ability were examined. A multi-drug resistant HIV-1 protease isolate, MDR 769, was co-crystallized with the p2/NC substrate and the mutated CA/p2 substrate, CA/p2 P1’F. Both substrates display different levels of molecular recognition by the wild-type and multi-drug resistant HIV-1 protease. From the crystal structures, only limited differences can be identified between the wild-type and multi-drug resistant protease. Therefore, a wild-type HIV-1 protease and four multi-drug resistant HIV-1 proteases in complex with the two peptides were modeled based on the crystal structures and examined during a 10 ns-molecular dynamics simulation. The simulation results reveal that the multi-drug resistant HIV-1 proteases require higher desolvation energy to form complexes with the peptides. This result suggests that the desolvation of the HIV-1 protease active site is an important step of protease-ligand complex formation as well as drug resistance. Therefore, desolvation energy could be considered as a parameter in the evaluation of future HIV-1 protease inhibitor candidates.

  1. World Health Organization treatment guidelines for drug-resistant tuberculosis, 2016 update.

    Science.gov (United States)

    Falzon, Dennis; Schünemann, Holger J; Harausz, Elizabeth; González-Angulo, Licé; Lienhardt, Christian; Jaramillo, Ernesto; Weyer, Karin

    2017-03-01

    Antimicrobial resistance is a major global concern. Tuberculosis (TB) strains resistant to rifampicin and other TB medicines challenge patient survival and public health. The World Health Organization (WHO) has published treatment guidelines for drug-resistant TB since 1997 and last updated them in 2016 based on reviews of aggregated and individual patient data from published and unpublished studies. An international expert panel formulated recommendations following the GRADE approach. The new WHO guidelines recommend a standardised 9-12 months shorter treatment regimen as first choice in patients with multidrug- or rifampicin-resistant TB (MDR/RR-TB) strains not resistant to fluoroquinolones or second-line injectable agents; resistance to these two classes of core second-line medicines is rapidly detectable with molecular diagnostics also approved by WHO in 2016. The composition of longer regimens for patients ineligible for the shorter regimen was modified. A first-ever meta-analysis of individual paediatric patient data allowed treatment recommendations for childhood MDR/RR-TB to be made. Delamanid is now also recommended in patients aged 6-17 years. Partial lung resection is a recommended option in MDR/RR-TB care. The 2016 revision highlighted the continued shortage of high-quality evidence and implementation research, and reiterated the need for clinical trials and best-practice studies to improve MDR/RR-TB patient treatment outcomes and strengthen policy. The content of this work is copyright of the authors or their employers. Design and branding are copyright ©ERS 2017.

  2. Specific Clinical Profile and Risk Factors for Mortality in General Surgery Patients with Infections by Multi-Drug-Resistant Gram-Negative Bacteria.

    Science.gov (United States)

    Rubio-Perez, Ines; Martin-Perez, Elena; Domingo-García, Diego; Garcia-Olmo, Damian

    2017-07-01

    The incidence of gram-negative multi-drug-resistant (MDR) infections is increasing worldwide. This study sought to determine the incidence, clinical profiles, risk factors, and mortality of these infections in general surgery patients. All general surgery patients with a clinical infection by gram-negative MDR bacteria were studied prospectively for a period of five years (2007-2011). Clinical, surgical, and microbiologic parameters were recorded, with a focus on the identification of risk factors for MDR infection and mortality. Incidence of MDR infections increased (5.6% to 15.2%) during the study period; 106 patients were included, 69.8% presented nosocomial infections. Mean age was 65 ± 15 years, 61% male. Extended-spectrum β-lactamases (ESBL) Escherichia coli was the most frequent MDR bacteria. Surgical site infections and abscesses were the most common culture locations. The patients presented multiple pre-admission risk factors and invasive measures during hospitalization. Mortality was 15%, and related to older age (odds ratio [OR] 1.07), malnutrition (OR 13.5), chronic digestive conditions (OR 4.7), chronic obstructive pulmonary disease (OR 3.9), and surgical re-intervention (OR 9.2). Multi-drug resistant infections in the surgical population are increasing. The most common clinical profile is a 65-year-old male, with previous comorbidities, who has undergone a surgical intervention, intensive care unit (ICU) admission, and invasive procedures and who has acquired the MDR infection in the nosocomial setting.

  3. Yield of facility-based verbal screening amongst household contacts of patients with multi-drug resistant tuberculosis in Pakistan

    Directory of Open Access Journals (Sweden)

    Ejaz Qadeer

    2017-05-01

    Full Text Available Background: Household contacts of multidrug-resistant tuberculosis (MDR-TB patients are at a high risk of getting infected with TB/MDR-TB, therefore symptomatic or vulnerable individuals should be screened and treated early. Methods: A cross-sectional study was conducted among household contacts of MDR-TB patients in three high-burden TB sites in Pakistan from July 2013 to June 2014. MDR-TB index patients were asked to provide a list of all members of their household and were asked whether any of them had TB symptoms such as productive cough, fever, weight loss and night sweat (“facility-based verbal screening”. Symptomatic contacts were defined as presumptive TB cases and were invited for investigations at the facility. Those who did not come were paid a home-visit. Confirmed TB/MDR-TB patients were registered in the nearest treatment facility. Results: Of 209 MDR-TB index patients, 1467 household contacts were identified and screened, 95 of them children < 5 years. Of these 172 (12% were symptomatic. Most common symptoms were cough 157 (91% and fever 107 (62%. 58 (34% presumptive TB contacts were not investigated. Of total contacts, 56 (3.8% were diagnosed with TB, among them 54(96% with MDR-TB and 2(4% with drug-susceptible-TB. The number needed to screen (NNS to identify a new MDR-TB case among adult household contacts was 27 and among presumptive adult and pediatric TB contacts was three. All 56 confirmed patients were registered for treatment. Conclusion: Screening household contacts of MDR-TB index cases may be considered a feasible and high yield option, in high-burden, low-resource settings within Pakistan. The number of presumptive TB contacts required to screen to identify a new MDR-TB case was unusually low, indicating an effective strategy that could easily be scaled-up. The screening and management of vulnerable adults and children living with patients having TB of any form is a major priority in the combined efforts

  4. Isolation and in vitro evaluation of bacteriophages against MDR-bacterial isolates from septic wound infections.

    Directory of Open Access Journals (Sweden)

    Roja Rani Pallavali

    Full Text Available Multi-drug resistance has become a major problem for the treatment of pathogenic bacterial infections. The use of bacteriophages is an attractive approach to overcome the problem of drug resistance in several pathogens that cause fatal diseases. Our study aimed to isolate multi drug resistant bacteria from patients with septic wounds and then isolate and apply bacteriophages in vitro as alternative therapeutic agents. Pus samples were aseptically collected from Rajiv Gandhi Institute of Medical Science (RIMS, Kadapa, A.P., and samples were analyzed by gram staining, evaluating morphological characteristics, and biochemical methods. MDR-bacterial strains were collected using the Kirby-Bauer disk diffusion method against a variety of antibiotics. Bacteriophages were collected and tested in vitro for lytic activity against MDR-bacterial isolates. Analysis of the pus swab samples revealed that the most of the isolates detected had Pseudomonas aeruginosa as the predominant bacterium, followed by Staphylococcus aureus, Klebsiella pneumoniae and Escherichia coli. Our results suggested that gram-negative bacteria were more predominant than gram-positive bacteria in septic wounds; most of these isolates were resistant to ampicillin, amoxicillin, penicillin, vancomycin and tetracycline. All the gram-positive isolates (100% were multi-drug resistant, whereas 86% of the gram-negative isolates had a drug resistant nature. Further bacteriophages isolated from sewage demonstrated perfect lytic activity against the multi-drug resistant bacteria causing septic wounds. In vitro analysis of the isolated bacteriophages demonstrated perfect lysis against the corresponding MDR-bacteria, and these isolated phages may be promising as a first choice for prophylaxis against wound sepsis, Moreover, phage therapy does not enhance multi-drug resistance in bacteria and could work simultaneously on a wide variety of MDR-bacteria when used in a bacteriophage cocktail. Hence

  5. DRUG RESISTANCE IN HELICOBACTER PYLORI

    Directory of Open Access Journals (Sweden)

    Júlia Silveira VIANNA

    Full Text Available ABSTRACT Background Helicobacter pylori has a worldwide distribution and is associated with the pathogenesis of various diseases of the digestive system. Treatment to eradicate this microorganism involves the use of a combination of antimicrobials, such as amoxicillin, metronidazole, clarithromycin, and levofloxacin, combined with proton pump inhibitors. Although the current therapy is effective, a high rate of treatment failure has been observed, mainly because of the acquisition of point mutations, one of the major resistance mechanisms developed by H. pylori. This phenomenon is related to frequent and/or inappropriate use of antibiotics. Conclusion This review reported an overview of the resistance to the main drugs used in the treatment of H. pylori, confirming the hypothesis that antibacterial resistance is a highly local phenomenon and genetic characteristics of a given population can influence which therapy is the most appropriate.

  6. Potentiating antibiotics in drug-resistant clinical isolates via stimuli-activated superoxide generation.

    Science.gov (United States)

    Courtney, Colleen M; Goodman, Samuel M; Nagy, Toni A; Levy, Max; Bhusal, Pallavi; Madinger, Nancy E; Detweiler, Corrella S; Nagpal, Prashant; Chatterjee, Anushree

    2017-10-01

    The rise of multidrug-resistant (MDR) bacteria is a growing concern to global health and is exacerbated by the lack of new antibiotics. To treat already pervasive MDR infections, new classes of antibiotics or antibiotic adjuvants are needed. Reactive oxygen species (ROS) have been shown to play a role during antibacterial action; however, it is not yet understood whether ROS contribute directly to or are an outcome of bacterial lethality caused by antibiotics. We show that a light-activated nanoparticle, designed to produce tunable flux of specific ROS, superoxide, potentiates the activity of antibiotics in clinical MDR isolates of Escherichia coli , Salmonella enterica , and Klebsiella pneumoniae . Despite the high degree of antibiotic resistance in these isolates, we observed a synergistic interaction between both bactericidal and bacteriostatic antibiotics with varied mechanisms of action and our superoxide-producing nanoparticles in more than 75% of combinations. As a result of this potentiation, the effective antibiotic concentration of the clinical isolates was reduced up to 1000-fold below their respective sensitive/resistant breakpoint. Further, superoxide-generating nanoparticles in combination with ciprofloxacin reduced bacterial load in epithelial cells infected with S. enterica serovar Typhimurium and increased Caenorhabditis elegans survival upon infection with S. enterica serovar Enteriditis, compared to antibiotic alone. This demonstration highlights the ability to engineer superoxide generation to potentiate antibiotic activity and combat highly drug-resistant bacterial pathogens.

  7. Comparative In Vitro Efficacy of Doripenem and Imipenem Against Multi-Drug Resistant Pseudomonas aeruginosa.

    Science.gov (United States)

    Wali, Nadia; Mirza, Irfan Ali

    2016-04-01

    To compare the in vitro efficacy of doripenem and imipenem against multi-drug resistant (MDR) Pseudomonas aeruginosa from various clinical specimens. Descriptive cross-sectional study. Department of Microbiology, Armed Forces Institute of Pathology, Rawalpindi, from November 2012 to November 2013. MDR Pseudomonas aeruginosa isolates from various clinical samples were included in the study. Susceptibility of Pseudomonas aeruginosa against doripenem and imipenem was performed by E-test strip and agar dilution methods. The results were interpreted as recommended by Clinical Laboratory Standard Institute (CLSI) guidelines. The maximum number of Pseudomonas aeruginosa were isolated from pure pus and pus swabs. In vitro efficacy of doripenem was found to be more effective as compared to imipenem against MDR Pseudomonas aeruginosa with both E-test strip and agar dilution methods. Overall, p-values of 0.014 and 0.037 were observed when susceptibility patterns of doripenem and imipenem were evaluated with E-test strip and agar dilution methods. In vitro efficacy of doripenem was found to be better against MDR Pseudomonas aeruginosaas compared to imipenem when tested by both E-test and agar dilution methods.

  8. Comparative In Vitro Efficacy of Doripenem and Imipenem Against Multi-Drug Resistant Pseudomonas aeruginosa

    International Nuclear Information System (INIS)

    Wali, N.; Mirza, I. A.

    2016-01-01

    Objective: To compare the in vitro efficacy of doripenem and imipenem against multi-drug resistant (MDR) Pseudomonas aeruginosa from various clinical specimens. Study Design: Descriptive cross-sectional study. Place and Duration of Study: Department of Microbiology, Armed Forces Institute of Pathology, Rawalpindi, from November 2012 to November 2013. Methodology: MDR Pseudomonas aeruginosa isolates from various clinical samples were included in the study. Susceptibility of Pseudomonas aeruginosa against doripenem and imipenem was performed by E-test strip and agar dilution methods. The results were interpreted as recommended by Clinical Laboratory Standard Institute (CLSI) guidelines. Results: The maximum number of Pseudomonas aeruginosa were isolated from pure pus and pus swabs. In vitro efficacy of doripenem was found to be more effective as compared to imipenem against MDR Pseudomonas aeruginosa with both E-test strip and agar dilution methods. Overall, p-values of 0.014 and 0.037 were observed when susceptibility patterns of doripenem and imipenem were evaluated with E-test strip and agar dilution methods. Conclusion: In vitro efficacy of doripenem was found to be better against MDR Pseudomonas aeruginosa as compared to imipenem when tested by both E-test and agar dilution methods. (author)

  9. Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1 and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

    Directory of Open Access Journals (Sweden)

    Overvad Kim

    2009-11-01

    Full Text Available Abstract Background The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1 and Breast Cancer Resistance Protein (BCRP/ABCG2 may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA and polycyclic aromatic hydrocarbons (PAH. Cyclooxygenase-2 (COX-2 derived prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC, and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. Methods The following polymorphisms were analyzed; a synonymous MDR1 C3435T (rs1045642 in exon26, G-rs3789243-A in intron3, the functional BCRP C421A (rs2231142, the two COX-2 A-1195G (rs689466 and G-765C (rs20417 in the promoter region, and the COX-2 T8473C (rs5275 polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Results Carriers of the variant allele of MDR1 intron 3 polymorphism were at 1.52-fold higher risk of CRC than homozygous wild type allele carriers (Incidence rate ratio (IRR = 1.52, 95% Confidence Interval (CI: 1.12-2.06. Carriers of the variant allele of MDR1 C3435T exon 26 had a lower risk of CRC than homozygous C-allele carriers (IRR = 0.71 (CI:0.50-1.00. There was interaction between these MDR1 polymorphisms and intake of red and processed meat in relation to CRC risk. Homozygous MDR1 C3435T C-allele carriers were at 8% increased risk pr 25 gram meat per day (CI: 1.00-1.16 whereas variant allele carriers were not at increased risk (p for interaction = 0.02. COX-2 and BCRP polymorphisms were not associated with CRC risk. There was interaction between NSAID use and MDR1 C3435T and COX-2 T

  10. Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1) and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

    International Nuclear Information System (INIS)

    Andersen, Vibeke; Østergaard, Mette; Christensen, Jane; Overvad, Kim; Tjønneland, Anne; Vogel, Ulla

    2009-01-01

    The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1) and Breast Cancer Resistance Protein (BCRP/ABCG2) may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH). Cyclooxygenase-2 (COX-2) derived prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC), and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. The following polymorphisms were analyzed; a synonymous MDR1 C3435T (rs1045642) in exon26, G-rs3789243-A in intron3, the functional BCRP C421A (rs2231142), the two COX-2 A-1195G (rs689466) and G-765C (rs20417) in the promoter region, and the COX-2 T8473C (rs5275) polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Carriers of the variant allele of MDR1 intron 3 polymorphism were at 1.52-fold higher risk of CRC than homozygous wild type allele carriers (Incidence rate ratio (IRR) = 1.52, 95% Confidence Interval (CI): 1.12-2.06). Carriers of the variant allele of MDR1 C3435T exon 26 had a lower risk of CRC than homozygous C-allele carriers (IRR = 0.71 (CI:0.50-1.00)). There was interaction between these MDR1 polymorphisms and intake of red and processed meat in relation to CRC risk. Homozygous MDR1 C3435T C-allele carriers were at 8% increased risk pr 25 gram meat per day (CI: 1.00-1.16) whereas variant allele carriers were not at increased risk (p for interaction = 0.02). COX-2 and BCRP polymorphisms were not associated with CRC risk. There was interaction between NSAID use and MDR1 C3435T and COX-2 T8473C (p-values for interaction 0

  11. Dominant incidence of multidrug and extensively drug-resistant specific Mycobacterium tuberculosis clones in Osaka Prefecture, Japan.

    Directory of Open Access Journals (Sweden)

    Aki Tamaru

    Full Text Available Infection and transmission of multidrug-resistant Mycobacterium tuberculosis (MDR-Mtb and extensively drug-resistant M. tuberculosis (XDR-Mtb is a serious health problem. We analyzed a total of 1,110 Mtb isolates in Osaka Prefecture and neighboring areas from April 2000 to March 2009. A total of 89 MDR-Mtb were identified, 36 (48.5% of which were determined to be XDR-Mtb. Among the 89 MDR-Mtb isolates, 24 (27.0% phylogenetically distributed into six clusters based on mycobacterial interspersed repetitive units-various number of tandem repeats (MIRU-VNTR typing. Among these six clusters, the MIRU-VNTR patterns of four (OM-V02, OM-V03, OM-V04, and OM-V06 were only found for MDR-Mtb. Further analysis revealed that all isolates belonging to OM-V02 and OM-V03, and two isolates from OM-V04 were clonal. Importantly such genotypes were not observed for drug-sensitive isolates. These suggest that few but transmissible clones can transmit after acquiring multidrug resistance and colonize even in a country with a developed, well-organized healthcare system.

  12. Genomic analysis of globally diverse Mycobacterium tuberculosis strains provides insights into emergence and spread of multidrug resistance

    Science.gov (United States)

    Manson, Abigail L.; Cohen, Keira A.; Abeel, Thomas; Desjardins, Christopher A.; Armstrong, Derek T.; Barry, Clifton E.; Brand, Jeannette; Chapman, Sinéad B.; Cho, Sang-Nae; Gabrielian, Andrei; Gomez, James; Jodals, Andreea M.; Joloba, Moses; Jureen, Pontus; Lee, Jong Seok; Malinga, Lesibana; Maiga, Mamoudou; Nordenberg, Dale; Noroc, Ecaterina; Romancenco, Elena; Salazar, Alex; Ssengooba, Willy; Velayati, A. A.; Winglee, Kathryn; Zalutskaya, Aksana; Via, Laura E.; Cassell, Gail H.; Dorman, Susan E.; Ellner, Jerrold; Farnia, Parissa; Galagan, James E.; Rosenthal, Alex; Crudu, Valeriu; Homorodean, Daniela; Hsueh, Po-Ren; Narayanan, Sujatha; Pym, Alexander S.; Skrahina, Alena; Swaminathan, Soumya; Van der Walt, Martie; Alland, David; Bishai, William R.; Cohen, Ted; Hoffner, Sven; Birren, Bruce W.; Earl, Ashlee M.

    2017-01-01

    Multidrug-resistant tuberculosis (MDR-TB), caused by drug resistant strains of Mycobacterium tuberculosis, is an increasingly serious problem worldwide. In this study, we examined a dataset of 5,310 M. tuberculosis whole genome sequences from five continents. Despite great diversity with respect to geographic point of isolation, genetic background and drug resistance, patterns of drug resistance emergence were conserved globally. We have identified harbinger mutations that often precede MDR. In particular, the katG S315T mutation, conferring resistance to isoniazid, overwhelmingly arose before rifampicin resistance across all lineages, geographic regions, and time periods. Molecular diagnostics that include markers for rifampicin resistance alone will be insufficient to identify pre-MDR strains. Incorporating knowledge of pre-MDR polymorphisms, particularly katG S315, into molecular diagnostics will enable targeted treatment of patients with pre-MDR-TB to prevent further development of MDR-TB. PMID:28092681

  13. Cochleo-vestibular clinical findings among drug resistant Tuberculosis Patients on therapy-a pilot study

    Directory of Open Access Journals (Sweden)

    Ramma Lebogang

    2012-01-01

    Full Text Available Abstracts Background To investigate the Cochleo-vestibular clinical and audiometric findings in Multi and Extreme Drug Resistance(MDR and XDR tuberculosis(TB patients on treatment and make recommendations. Methods A cross-sectional study of adult MDR and XDR-TB patients was conducted in a general hospital in Cape-Town-South-Africa. Ethical approval was secured and all consenting patients administered with pretested and validated questionnaire under the guidance of International Classification of Functioning, Disability and Health(ICF Checklist-version-2.1a. Audiometric evaluation included: Otoscopy, Diagnostic Audiometry and Tympanometry. The data analyses were done with SPSS version 16, Chi-square and StatCalc-7. Results Fifty-three adults, ages 18-60 (mean-33 years comprising 26 males and 27 females participated in the study. Hospital stay duration varied from 1-18 months (mean-6 months and all were on anti-Koch's second line drugs (regimen 2. MDR TB group were 45(85% and XDR 8(15%. Vertigo was the most common vestibular symptoms, 24(45% whereas, tinnitus 23(42% and hearing loss 13(25% were most frequent auditory complaints. Bilateral sensorineural hearing losses of varying degrees were confirmed in 23(47%. There was no association between gender and age with hearing loss [χ2 (P = 0.16, ά = 0.05 and (p = 0.13, ά = 0.05]. Furthermore, MDR and XTR TB groups [20/42 Vs 3/8; Z = 0.46 and P = 0.64], showed no difference in pattern of the hearing losses. Conclusions A multi-disciplinary close surveillance of MDR and XDR TB patients on therapy is imperative. Finally, researches into therapeutic trials on antidotes and potent safer substitutes for aminoglycosides in the management are recommended.

  14. Non-p-glycoprotein-mediated multidrug resistance in detransformed rat cells selected for resistance to methylglyoxal bis(guanylhydrazone).

    Science.gov (United States)

    Weber, J M; Sircar, S; Horvath, J; Dion, P

    1989-11-01

    Three independent variants (G2, G4, G5), resistant to methylglyoxal bis(guanylhydrazone), an anticancer drug, have been isolated by single step selection from an adenovirus-transformed rat brain cell line (1). These variants display selective cross-resistance to several natural product drugs of dissimilar structure and action. Multidrug resistance has recently been shown to be caused by overexpression of the membrane-associated p-glycoprotein, most often caused by amplification of the mdr gene. Several types of experiments were conducted to determine whether the observed drug resistance in our cell lines could be due to changes at the mdr locus. The following results were obtained: (a) the mdr locus was not amplified; (b) transcription of the mdr gene and p-glycoprotein synthesis were not increased; (c) multidrug resistance cell lines, which carry an amplified mdr locus, were not cross-resistant to methylglyoxal bis(guanylhydrazone); (d) verapamil did not reverse the resistance of G cells or mdr cells to methylglyoxal bis(guanylhydrazone), nor that of G cells to vincristine; and (e) methylglyoxal bis(guanylhydrazone) resistance was recessive and depended on a block to drug uptake, as opposed to mdr cells which are dominant and express increased drug efflux. The results obtained suggest that the drug resistance in the G2, G4, and G5 cells was atypical and may be due to a mechanism distinct from that mediated by the mdr locus.

  15. Characteristics of plasmids in multi-drug-resistant Enterobacteriaceae isolated during prospective surveillance of a newly opened hospital in Iraq.

    Directory of Open Access Journals (Sweden)

    Xiao-Zhe Huang

    Full Text Available BACKGROUND: Gram-negative multidrug-resistant (MDR bacteria are major causes of nosocomial infections, and antibiotic resistance in these organisms is often plasmid mediated. Data are scarce pertaining to molecular mechanisms of antibiotic resistance in resource constrained areas such as Iraq. METHODOLOGY/PRINCIPAL FINDINGS: In this study, all MDR Enterobacteriaceae (n = 38 and randomly selected non-MDR counterparts (n = 41 isolated from patients, healthcare workers and environmental surfaces in a newly opened hospital in Iraq were investigated to characterize plasmids found in these isolates and determine their contribution to antibiotic resistance. Our results demonstrated that MDR E. coli and K. pneumoniae isolates harbored significantly more (≥ 3 plasmids compared to their non-MDR counterparts, which carried ≤ 2 plasmids (p<0.01. Various large plasmids (~52 to 100 kb from representative isolates were confirmed to contain multiple resistance genes by DNA microarray analysis. Aminoglycoside (acc, aadA, aph, strA/B, and ksgA, β-lactam (bla(TEM1, bla(AMPC, bla(CTX-M-15, bla(OXA-1, bla(VIM-2 and bla(SHV, sulfamethoxazole/trimethoprim (sul/dfr, tetracycline (tet and chloramphenicol (cat resistance genes were detected on these plasmids. Additionally, multiple plasmids carrying multiple antibiotic resistance genes were found in the same host strain. Genetic transfer-associated genes were identified on the plasmids from both MDR and non-MDR isolates. Seven plasmid replicon types (FII, FIA, FIB, B/O, K, I1 and N were detected in the isolates, while globally disseminated IncA/C and IncHI1 plasmids were not detected in these isolates. CONCLUSIONS/SIGNIFICANCE: This is the first report of the characteristics of the plasmids found in Enterobacteriaceae isolated following the opening of a new hospital in Iraq. The information provided here furthers our understanding of the mechanisms of drug resistance in this specific region and their evolutionary

  16. Transmissible Plasmids and Integrons Shift Escherichia coli Population Toward Larger Multiple Drug Resistance Numbers.

    Science.gov (United States)

    Suhartono, Suhartono; Savin, Mary C; Gbur, Edward E

    2018-04-01

    Transmissible plasmids and integrons may play important roles in the persistence and spread of antibiotic-resistant bacteria throughout aquatic environment by accumulating antibiotic resistance genes (ARG). Class 1 and class 2 integron (intI), mobilization (mob), sulfamethoxazole resistance (sul), and trimethoprim resistance (dfr) genes were PCR-amplified and confirmed through DNA sequencing following plasmid extraction from 139 antibiotic-resistant Escherichia coli. E. coli had previously been recovered from wastewater treatment plant effluent and receiving stream water in Northwest Arkansas and isolates had expressed resistance to one to six antibiotics. Almost half of the total isolates (47%) carried putatively transmissible plasmids with mob F12 gene as the most frequently detected mobilization gene. When two or three mob genes were detected per isolate, there was a significant shift in the population toward larger multiple drug resistance (MDR) number. Class 1 and/or 2 integrons were prevalent (46%), and the presence of integron significantly shifted the isolate population toward larger MDR number. More isolates carried single or coexistence of two or three sul genes (99.3%), and single or a combination up to five dfr genes (89.3%) than had exhibited in vitro resistance to the respective antibiotics. These findings indicate not only the role of the wastewater treatment effluent and the stream environment in coaccumulation of ARG with transmissible plasmids and integrons in multiple antibiotic-resistant E. coli populations but also suggest that density of sul and dfr resistance genes within an isolate may serve as a biomarker for mobile MDR in general.

  17. Association between HIV/AIDS and multi-drug resistance tuberculosis: a systematic review and meta-analysis.

    Directory of Open Access Journals (Sweden)

    Yonatan Moges Mesfin

    Full Text Available BACKGROUND: Human immunodeficiency virus (HIV, multi-drug resistant tuberculosis (MDR is emerging as major challenge facing tuberculosis control programs worldwide particularly in Asia and Africa. Findings from different studies on associations of HIV co-infection and drug resistance among patients with TB have been contradictory (discordant. Some institution based studies found strongly increased risks for multi-drug resistant TB (MDR TB among patients co-infected with TB and HIV, whereas other studies found no increased risk (it remains less clear in community based studies. The aim was to conduct a systematic review and meta-analysis of the association between multi-drug resistant tuberculosis and HIV infection. METHODS AND FINDINGS: Systematic review of the published literature of observational studies was conducted. Original studies were identified using databases of Medline/Pubmed, Google Scholar and HINARI. The descriptions of original studies were made using frequency and forest plot. Publication bias was assessed using Funnel plot graphically and Egger weighted and Begg rank regression tests statistically. Heterogeneity across studies was checked using Cochrane Q test statistic and I(2. Pool risk estimates of MDR-TB and sub-grouping analysis were computed to analyze associations with HIV. Random effects of the meta-analysis of all 24 observational studies showed that HIV is associated with a marginal increased risk of multi-drug resistant tuberculosis (estimated Pooled OR 1.24; 95%, 1.04-1.43. Subgroup analyses showed that effect estimates were higher (Pooled OR 2.28; 95%, 1.52-3.04 for primary multi-drug resistance tuberculosis and moderate association between HIV/AIDS and MDR-TB among population based studies and no significant association in institution settings. CONCLUSIONS: This study demonstrated that there is association between MDR-TB and HIV. Capacity for diagnosis of MDR-TB and initiating and scale up of antiretroviral

  18. Ambulatory Multi-Drug Resistant Tuberculosis Treatment Outcomes in a Cohort of HIV-Infected Patients in a Slum Setting in Mumbai, India

    Science.gov (United States)

    Isaakidis, Petros; Cox, Helen S.; Varghese, Bhanumati; Montaldo, Chiara; Da Silva, Esdras; Mansoor, Homa; Ladomirska, Joanna; Sotgiu, Giovanni; Migliori, Giovanni B.; Pontali, Emanuele; Saranchuk, Peter; Rodrigues, Camilla; Reid, Tony

    2011-01-01

    Background India carries one quarter of the global burden of multi-drug resistant TB (MDR-TB) and has an estimated 2.5 million people living with HIV. Despite this reality, provision of treatment for MDR-TB is extremely limited, particularly for HIV-infected individuals. Médecins Sans Frontières (MSF) has been treating HIV-infected MDR-TB patients in Mumbai since May 2007. This is the first report of treatment outcomes among HIV-infected MDR-TB patients in India. Methods HIV-infected patients with suspected MDR-TB were referred to the MSF-clinic by public Antiretroviral Therapy (ART) Centers or by a network of community non-governmental organizations. Patients were initiated on either empiric or individualized second-line TB-treatment as per WHO recommendations. MDR-TB treatment was given on an ambulatory basis and under directly observed therapy using a decentralized network of providers. Patients not already receiving ART were started on treatment within two months of initiating MDR-TB treatment. Results Between May 2007 and May 2011, 71 HIV-infected patients were suspected to have MDR-TB, and 58 were initiated on treatment. MDR-TB was confirmed in 45 (78%), of which 18 (40%) were resistant to ofloxacin. Final treatment outcomes were available for 23 patients; 11 (48%) were successfully treated, 4 (17%) died, 6 (26%) defaulted, and 2 (9%) failed treatment. Overall, among 58 patients on treatment, 13 (22%) were successfully treated, 13 (22%) died, 7 (12%) defaulted, two (3%) failed treatment, and 23 (40%) were alive and still on treatment at the end of the observation period. Twenty-six patients (45%) experienced moderate to severe adverse events, requiring modification of the regimen in 12 (20%). Overall, 20 (28%) of the 71 patients with MDR-TB died, including 7 not initiated on treatment. Conclusions Despite high fluoroquinolone resistance and extensive prior second-line treatment, encouraging results are being achieved in an ambulatory MDR-T- program in a

  19. Resistance to fluoroquinolones and second-line injectable drugs: impact on multidrug-resistant TB outcomes

    NARCIS (Netherlands)

    Falzon, Dennis; Gandhi, Neel; Migliori, Giovanni B.; Sotgiu, Giovanni; Cox, Helen S.; Holtz, Timothy H.; Hollm-Delgado, Maria-Graciela; Keshavjee, Salmaan; Deriemer, Kathryn; Centis, Rosella; D'Ambrosio, Lia; Lange, Christoph G.; Bauer, Melissa; Menzies, Dick; Ahuja, S. D.; Ashkin, D.; Avendaño, M.; Banerjee, R.; Bauer, M.; Becerra, M. C.; Benedetti, A.; Burgos, M.; Centis, R.; Chan, E. D.; Chiang, C. Y.; Cobelens, F.; Cox, H.; D'Ambrosio, L.; de Lange, W. C. M.; DeRiemer, K.; Enarson, D.; Falzon, D.; Flanagan, K. L.; Flood, J.; Gandhi, N.; Garcia-Garcia, M. L.; Granich, R. M.; Hollm-Delgado, M. G.; Holtz, T. H.; Hopewell, P.; Iseman, M. D.; Jarlsberg, L. G.; Keshavjee, S.; Kim, H. R.; Koh, W. J.; Lancaster, J. L.; Lange, C.; Leimane, V.; Leung, C. C.; Li, J.

    2013-01-01

    A meta-analysis for response to treatment was undertaken using individual data of multidrug-resistant tuberculosis (MDR-TB) (resistance to isoniazid and rifampicin) patients from 26 centres. The analysis assessed the impact of additional resistance to fluoroquinolones and/or second-line injectable

  20. Genotypic diversity of multidrug-, quinolone- and extensively drug-resistant Mycobacterium tuberculosis isolates in Thailand.

    Science.gov (United States)

    Disratthakit, Areeya; Meada, Shinji; Prammananan, Therdsak; Thaipisuttikul, Iyarit; Doi, Norio; Chaiprasert, Angkana

    2015-06-01

    Drug-resistant tuberculosis (TB), which includes multidrug-resistant (MDR-TB), quinolone-resistant (QR-TB) and extensively drug-resistant tuberculosis (XDR-TB), is a serious threat to TB control. We aimed to characterize the genotypic diversity of drug-resistant TB clinical isolates collected in Thailand to establish whether the emergence of drug-resistant TB is attributable to transmitted resistance or acquired resistance. We constructed the first molecular phylogeny of MDR-TB (n=95), QR-TB (n=69) and XDR-TB (n=28) in Thailand based on spoligotyping and proposed 24-locus multilocus variable-number of tandem repeat analysis (MLVA). Clustering analysis was performed using the unweighted pair group method with arithmetic mean. Spoligotyping identified the Beijing strain (SIT1) as the most predominant genotype (n=139; 72.4%). The discriminatory power of 0.9235 Hunter-Gaston Discriminatory Index (HGDI) with the 15-locus variable-number tandem repeats of mycobacterial interspersed repetitive units typing was improved to a 0.9574 HGDI with proposed 24-locus MLVA, thereby resulting in the subdivision of a large cluster of Beijing strains (SIT1) into 17 subclusters. We identified the spread of drug-resistant TB clones caused by three different MLVA types in the Beijing strain (SIT1) and a specific clone of XDR-TB caused by a rare genotype, the Manu-ancestor strain (SIT523). Overall, 49.5% of all isolates were clustered. These findings suggest that a remarkable transmission of drug-resistant TB occurred in Thailand. The remaining 50% of drug-resistant TB isolates were unique genotypes, which may have arisen from the individual acquisition of drug resistance. Our results suggest that transmitted and acquired resistance have played an equal role in the emergence of drug-resistant TB. Further characterization of whole genome sequences of clonal strains could help to elucidate the mycobacterial genetic factors relevant for drug resistance, transmissibility and virulence

  1. Phenotypic and genotypic analysis of anti-tuberculosis drug resistance in Mycobacterium tuberculosis isolates in Myanmar.

    Science.gov (United States)

    Aung, Wah Wah; Ei, Phyu Win; Nyunt, Wint Wint; Swe, Thyn Lei; Lwin, Thandar; Htwe, Mi Mi; Kim, Kyung Jun; Lee, Jong Seok; Kim, Chang Ki; Cho, Sang Nae; Song, Sun Dae; Chang, Chulhun L

    2015-09-01

    Tuberculosis (TB) is one of the most serious health problems in Myanmar. Because TB drug resistance is associated with genetic mutation(s) relevant to responses to each drug, genotypic methods for detecting these mutations have been proposed to overcome the limitations of classic phenotypic drug susceptibility testing (DST). We explored the current estimates of drug-resistant TB and evaluated the usefulness of genotypic DST in Myanmar. We determined the drug susceptibility of Mycobacterium tuberculosis isolated from sputum smear-positive patients with newly diagnosed pulmonary TB at two main TB centers in Myanmar during 2013 by using conventional phenotypic DST and the GenoType MTBDRplus assay (Hain Lifescience, Germany). Discrepant results were confirmed by sequencing the genes relevant to each type of resistance (rpoB for rifampicin; katG and inhA for isoniazid). Of 191 isolates, phenotypic DST showed that 27.7% (n=53) were resistant to at least one first-line drug and 20.9% (n=40) were resistant to two or more, including 18.3% (n=35) multidrug-resistant TB (MDR-TB) strains. Monoresistant strains accounted for 6.8% (n=13) of the samples. Genotypic assay of 189 isolates showed 17.5% (n=33) MDR-TB and 5.3% (n=10) isoniazid-monoresistant strains. Genotypic susceptibility results were 99.5% (n=188) concordant and agreed almost perfectly with phenotypic DST (kappa=0.99; 95% confidence interval 0.96-1.01). The results highlight the burden of TB drug resistance and prove the usefulness of the genotypic DST in Myanmar.

  2. Drug-resistant tuberculosis in HIV-infected patients in a national referral hospital, Phnom Penh, Cambodia

    Directory of Open Access Journals (Sweden)

    Genevieve Walls

    2015-01-01

    Full Text Available Background and objective: There are no recent data on the prevalence of drug-resistant tuberculosis (DR TB in Cambodia. We aim to describe TB drug resistance amongst adults with pulmonary and extra-pulmonary TB and human immunodeficiency virus (HIV co-infection in a national referral hospital in Phnom Penh, Cambodia. Design: Between 22 November 2007 and 30 November 2009, clinical specimens from HIV-infected patients suspected of having TB underwent routine microscopy, Mycobacterium tuberculosis culture, and drug susceptibility testing. Laboratory and clinical data were collected for patients with positive M. tuberculosis cultures. Results: M. tuberculosis was cultured from 236 HIV-infected patients. Resistance to any first-line TB drug occurred in 34.7% of patients; 8.1% had multidrug resistant tuberculosis (MDR TB. The proportion of MDR TB amongst new patients and previously treated patients was 3.7 and 28.9%, respectively (p<0.001. The diagnosis of MDR TB was made after death in 15.8% of patients; in total 26.3% of patients with MDR TB died. The diagnosis of TB was established by culture of extra-pulmonary specimens in 23.6% of cases. Conclusions: There is significant resistance to first-line TB drugs amongst new and previously treated TB–HIV co-infected patients in Phnom Penh. These data suggest that the prevalence of DR TB in Cambodia may be higher than previously recognised, particularly amongst HIV-infected patients. Additional prevalence studies are needed. This study also illustrates the feasibility and utility of analysis of non-respiratory specimens in the diagnosis of TB, even in low-resource settings, and suggests that extra-pulmonary specimens should be included in TB diagnostic algorithms.

  3. Clinical and Drug Resistance Characteristics of New Pediatric Tuberculosis Cases in Northern China.

    Science.gov (United States)

    Wang, Ting; Dong, Fang; Li, Qin-Jing; Yin, Qing-Qin; Song, Wen-Qi; Mokrousov, Igor; Jiao, Wei-Wei; Shen, A-Dong

    2018-05-09

    The aim of this study was to evaluate the clinical features and characteristics of drug resistance in newly diagnosed pediatric tuberculosis (TB) patients in northern China. Mycobacterium tuberculosis isolates were collected from September 2010 to October 2016 at the Beijing Children's Hospital. Patients were divided into two groups (resistant to at least one drug and pan-susceptible) according to drug susceptibility testing (DST) results. A total of 132 new cases, mainly from northern China (87.9%), were included in the study. The median age was 1.9 years (1 month-15 years). Resistance to at least one drug was detected in Mycobacterium tuberculosis isolates from 33 (25%) cases. Eight cases of multidrug-resistant TB (MDR-TB) (6.1%) were detected. The two groups did not differ in clinical presentations (disease site, fever >2 weeks, and cough >2 weeks) or in chest imaging (lesion location, lymphadenitis [mediastinal], and pleural effusion). The rate of Mycobacterium tuberculosis drug resistance in new pediatric TB cases was as high as in the new adult patients surveyed in the national drug resistance survey conducted in 2007. No significant difference was observed in clinical features between patients infected with drug-resistant and drug-susceptible strains. Routine DST is important for prescribing effective antituberculosis treatment regimens.

  4. Molecular characterization of mutations associated with resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients from high prevalence tuberculosis city in Morocco.

    Science.gov (United States)

    Oudghiri, Amal; Karimi, Hind; Chetioui, Fouad; Zakham, Fathiah; Bourkadi, Jamal Eddine; Elmessaoudi, My Driss; Laglaoui, Amin; Chaoui, Imane; El Mzibri, Mohammed

    2018-02-27

    The emergence of extensively drug-resistant tuberculosis (XDR-TB) has raised public health concern for global TB control. Although multi drug-resistant tuberculosis (MDR- TB) prevalence and associated genetic mutations in Morocco are well documented, scarce information on XDR TB is available. Hence, the evaluation of pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drugs, is of great value for better management of M/XDR TB in Morocco. To evaluate pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drug resistance, in 703 clinical isolates from TB patients recruited in Casablanca, and to assess the usefulness of molecular tools in clinical laboratories for better management of M/XDR TB in Morocco. Drug susceptibility testing (DST) was performed by the proportional method for first line drugs, and then the selected MDR isolates were tested for second line drugs (Ofloxacin, Kanamycin, Amikacin and Capreomycin). Along with DST, all samples were subjected to rpoB, katG and p-inhA mutation analysis by PCR and DNA sequencing. MDR isolates as well as 30 pan-susceptible strains were subjected to PCR and DNA sequencing of gyrA, gyrB, rrs, tlyA genes and eis promoter, associated with resistance to fluoroquinolones and injectable drugs. Among the 703 analysed strains, 12.8% were MDR; Ser531Leu and Ser315Thr being the most common recorded mutations within rpoB and katG genes associated with RIF and INH resistance respectively. Drug susceptibility testing for second line drugs showed that among the 90 MDR strains, 22.2% (20/90) were resistant to OFX, 2.22% (2/90) to KAN, 3.33% (3/90) to AMK and 1.11% (1/90) to CAP. Genotypic analysis revealed that 19 MDR strains harbored mutations in the gyrA gene; the most recorded mutation being Asp91Ala accounting for 47.6% (10

  5. Esters of the Marine-Derived Triterpene Sipholenol A Reverse P-GP-Mediated Drug Resistance

    Directory of Open Access Journals (Sweden)

    Yongchao Zhang

    2015-04-01

    Full Text Available Our previous studies showed that several sipholane triterpenes, sipholenol A, sipholenone E, sipholenol L and siphonellinol D, have potent reversal effect for multidrug resistance (MDR in cancer cells that overexpressed P-glycoprotein (P-gp/ABCB1. Through comparison of cytotoxicity towards sensitive and multi-drug resistant cell lines, we identified that the semisynthetic esters sipholenol A-4-O-acetate and sipholenol A-4-O-isonicotinate potently reversed P-gp-mediated MDR but had no effect on MRP1/ABCC1 and BCRP/ABCG2-mediated MDR. The results from [3H]-paclitaxel accumulation and efflux studies suggested that these two triterpenoids were able to increase the intracellular accumulation of paclitaxel by inhibiting its active efflux. In addition, western blot analysis revealed that these two compounds did not alter the expression levels of P-gp when treated up to 72 h. These sipholenol derivatives also stimulated the ATPase activity of P-gp membranes, which suggested that they might be substrates of P-gp. Moreover, in silico molecular docking studies revealed the virtual binding modes of these two compounds into human homology model of P-gp. In conclusion, sipholenol A-4-O-acetate and sipholenol A-4-O-isonicotinate efficiently inhibit the P-gp and may represent potential reversal agents for the treatment of multidrug resistant cancers.

  6. Parallel screening of wild-type and drug-resistant targets for anti-resistance neuraminidase inhibitors.

    Directory of Open Access Journals (Sweden)

    Kai-Cheng Hsu

    Full Text Available Infection with influenza virus is a major public health problem, causing serious illness and death each year. Emergence of drug-resistant influenza virus strains limits the effectiveness of drug treatment. Importantly, a dual H275Y/I223R mutation detected in the pandemic influenza A 2009 virus strain results in multidrug resistance to current neuraminidase (NA drugs. Therefore, discovery of new agents for treating multiple drug-resistant (MDR influenza virus infections is important. Here, we propose a parallel screening strategy that simultaneously screens wild-type (WT and MDR NAs, and identifies inhibitors matching the subsite characteristics of both NA-binding sites. These may maintain their potency when drug-resistant mutations arise. Initially, we analyzed the subsite of the dual H275Y/I223R NA mutant. Analysis of the site-moiety maps of NA protein structures show that the mutant subsite has a relatively small volume and is highly polar compared with the WT subsite. Moreover, the mutant subsite has a high preference for forming hydrogen-bonding interactions with polar moieties. These changes may drive multidrug resistance. Using this strategy, we identified a new inhibitor, Remazol Brilliant Blue R (RB19, an anthraquinone dye, which inhibited WT NA and MDR NA with IC(50 values of 3.4 and 4.5 µM, respectively. RB19 comprises a rigid core scaffold and a flexible chain with a large polar moiety. The former interacts with highly conserved residues, decreasing the probability of resistance. The latter forms van der Waals contacts with the WT subsite and yields hydrogen bonds with the mutant subsite by switching the orientation of its flexible side chain. Both scaffolds of RB19 are good starting points for lead optimization. The results reveal a parallel screening strategy for identifying resistance mechanisms and discovering anti-resistance neuraminidase inhibitors. We believe that this strategy may be applied to other diseases with high

  7. Multiple drug resistance patterns in various phylogenetic groups of uropathogenic E.coli isolated from Faisalabad region of Pakistan

    Directory of Open Access Journals (Sweden)

    Saira Bashir

    2011-12-01

    Full Text Available The objective of this work was the phylogenetic characterization of local clinical isolates of uropathogenic E. coli with respect to drug resistance. A total of 59 uropathogenic E. coli responsible for community acquired urinary tract infections were included in this study. A triplex PCR was employed to segregate each isolate into four different phylogenetic groups (A, B1, B2 and D. Drug resistance was evaluated by disc diffusion method. The drugs used were ampicillin, aztreonam, cefixime, cefoperazone, ceftriaxone, cephradine among β-lactam group; amikacin, gentamicin, and streptomycin among aminoglycosides; nalidixic acid and ciprofloxacin from quinolones; trimethoprim-sulfomethoxazole, and tetracycline. Among 59 uropathogenic E. coli isolates majority belonged to phylogenetic group B2 (50% where as 19% each belonged to groups A and B1, and 12% to group D. All the isolates were multiple drug resistant (MDR. Most effective drugs against Group A, B1, and B2 were gentamicin, amikacin and cefixime; ceftriaxone and quinolones; and ceftriaxone and amikacin, respectively. Group D isolates were found to be highly resistant to all drugs. Our results have shown emergence of MDR isolates among uropathogenic E. coli with dominance of phylogenetic group B2. However, it was found that group D isolates were though less frequent, more drug resistant as compared with group B2. Groups A and B1 were relatively uncommon. Amikacin, ceftriaxone and gentamicin were the most effective drugs in general.

  8. Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zhigang [Wayne State Univ., Detroit, MI (United States); Case Western Reserve Univ., Cleveland, OH (United States); Harbor Hospital Baltimore, MD (United States); Wang, Yong [Wayne State Univ., Detroit, MI (United States); Yedidi, Ravikiran S. [Wayne State Univ., Detroit, MI (United States); National Institutes of Health, Bethesda, MD (United States); Dewdney, Tamaria G. [Wayne State Univ., Detroit, MI (United States); Reiter, Samuel J. [Wayne State Univ., Detroit, MI (United States); Brunzelle, Joseph S. [Northwestern Univ. Feinberg School of Medicine, Chicago, IL (United States); Kovari, Iulia A. [Wayne State Univ., Detroit, MI (United States); Kovari, Ladislau C. [Wayne State Univ., Detroit, MI (United States)

    2012-12-19

    Success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. Additionally, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.

  9. drug resistant strains of Salmonella enterica

    African Journals Online (AJOL)

    Conclusions: The aqueous extract of Thonningia sanguinea can provide an alternative therapy for the treatment of salmonellosis, mainly for typhoid fever caused by MDR strains of S. Typhi.The extract also inhibits S.Hadar a MDR emerging strain in Ivory Coast. Keywords: Thonningia sanguinea; Salmonella, MDR strains, ...

  10. Multiple Origins of Mutations in the mdr1 Gene—A Putative Marker of Chloroquine Resistance in P. vivax

    DEFF Research Database (Denmark)

    Schousboe, Mette L; Ranjitkar, Samir; Rajakaruna, Rupika S

    2015-01-01

    BACKGROUND: Chloroquine combined with primaquine has been the recommended antimalarial treatment of Plasmodium vivax malaria infections for six decades but the efficacy of this treatment regimen is threatened by chloroquine resistance (CQR). Single nucleotide polymorphisms (SNPs) in the multidrug...

  11. Inhibition of bacterial multidrug resistance by celecoxib, a cyclooxygenase-2 inhibitor.

    Science.gov (United States)

    Kalle, Arunasree M; Rizvi, Arshad

    2011-01-01

    Multidrug resistance (MDR) is a major problem in the treatment of infectious diseases and cancer. Accumulating evidence suggests that the cyclooxygenase-2 (COX-2)-specific inhibitor celecoxib would not only inhibit COX-2 but also help in the reversal of drug resistance in cancers by inhibiting the MDR1 efflux pump. Here, we demonstrate that celecoxib increases the sensitivity of bacteria to the antibiotics ampicillin, kanamycin, chloramphenicol, and ciprofloxacin by accumulating the drugs inside the cell, thus reversing MDR in bacteria.

  12. Doxorubicin loaded Polymeric Nanoparticulate Delivery System to overcome drug resistance in osteosarcoma

    International Nuclear Information System (INIS)

    Susa, Michiro; Iyer, Arun K; Ryu, Keinosuke; Hornicek, Francis J; Mankin, Henry; Amiji, Mansoor M; Duan, Zhenfeng

    2009-01-01

    Drug resistance is a primary hindrance for the efficiency of chemotherapy against osteosarcoma. Although chemotherapy has improved the prognosis of osteosarcoma patients dramatically after introduction of neo-adjuvant therapy in the early 1980's, the outcome has since reached plateau at approximately 70% for 5 year survival. The remaining 30% of the patients eventually develop resistance to multiple types of chemotherapy. In order to overcome both the dose-limiting side effects of conventional chemotherapeutic agents and the therapeutic failure incurred from multidrug resistant (MDR) tumor cells, we explored the possibility of loading doxorubicin onto biocompatible, lipid-modified dextran-based polymeric nanoparticles and evaluated the efficacy. Doxorubicin was loaded onto a lipid-modified dextran based polymeric nano-system. The effect of various concentrations of doxorubicin alone or nanoparticle loaded doxorubicin on KHOS, KHOS R2 , U-2OS, and U-2OS R2 cells was analyzed. Effects on drug retention, immunofluorescence, Pgp expression, and induction of apoptosis were also analyzed. Dextran nanoparticles loaded with doxorubicin had a curative effect on multidrug resistant osteosarcoma cell lines by increasing the amount of drug accumulation in the nucleus via Pgp independent pathway. Nanoparticles loaded with doxorubicin also showed increased apoptosis in osteosarcoma cells as compared with doxorubicin alone. Lipid-modified dextran nanoparticles loaded with doxorubicin showed pronounced anti-proliferative effects against osteosarcoma cell lines. These findings may lead to new treatment options for MDR osteosarcoma

  13. P-glycoprotein inhibition of drug resistant cell lines by nanoparticles.

    Science.gov (United States)

    Singh, Manu Smriti; Lamprecht, Alf

    2016-01-01

    Several pharmaceutical excipients are known for their ability to interact with cell membrane lipids and reverse the phenomenon of multidrug resistance (MDR) in cancer. Interestingly, many excipients act as stabilizers and are key ingredients in a variety of nano-formulations. In this study, representatives of ionic and non-ionic excipients were used as surface active agents in nanoparticle (NP) formulations to utilize their MDR reversing potential. In-vitro assays were performed to elucidate particle-cell interaction and accumulation of P-glycoprotein (P-gp) substrates-rhodamine-123 and calcein AM, in highly drug resistant glioma cell lines. Chemosensitization achieved using NPs and their equivalent dose of free excipients was assessed with the co-administered anti-cancer drug doxorubicin. Among the excipients used, non-ionic surfactant, Cremophor® EL, and cationic surfactant, cetyltrimethylammonuium bromide (CTAB), demonstrated highest P-gp modulatory activity in both free solution form (up to 7-fold lower IC50) and as a formulation (up to 4.7-fold lower IC50) as compared to doxorubicin treatment alone. Solutol® HS15 and Tween® 80 exhibited considerable chemosensitization as free solution but not when incorporated into a formulation. Sodium dodecyl sulphate (SDS)-based nanocarriers resulted in slightly improved cytotoxicity. Overall, the results highlight and envisage the usage of excipient in nano-formulations in a bid to improve chemosensitization of drug resistant cancer cells towards anti-cancer drugs.

  14. Alarming levels of drug-resistant tuberculosis in HIV-infected patients in metropolitan Mumbai, India.

    Science.gov (United States)

    Isaakidis, Petros; Das, Mrinalini; Kumar, Ajay M V; Peskett, Christopher; Khetarpal, Minni; Bamne, Arun; Adsul, Balkrishna; Manglani, Mamta; Sachdeva, Kuldeep Singh; Parmar, Malik; Kanchar, Avinash; Rewari, B B; Deshpande, Alaka; Rodrigues, Camilla; Shetty, Anjali; Rebello, Lorraine; Saranchuk, Peter

    2014-01-01

    Drug-resistant tuberculosis (DR-TB) is a looming threat to tuberculosis control in India. However, no countrywide prevalence data are available. The burden of DR-TB in HIV-co-infected patients is likewise unknown. Undiagnosed and untreated DR-TB among HIV-infected patients is a major cause of mortality and morbidity. We aimed to assess the prevalence of DR-TB (defined as resistance to any anti-TB drug) in patients attending public antiretroviral treatment (ART) centers in greater metropolitan Mumbai, India. A cross-sectional survey was conducted among adults and children ART-center attendees. Smear microscopy, culture and drug-susceptibility-testing (DST) against all first and second-line TB-drugs using phenotypic liquid culture (MGIT) were conducted on all presumptive tuberculosis patients. Analyses were performed to determine DR-TB prevalence and resistance patterns separately for new and previously treated, culture-positive TB-cases. Between March 2013 and January 2014, ART-center attendees were screened during 14135 visits, of whom 1724 had presumptive TB. Of 1724 attendees, 72 (4%) were smear-positive and 202 (12%) had a positive culture for Mycobacterium tuberculosis. Overall DR-TB was diagnosed in 68 (34%, 95% CI: 27%-40%) TB-patients. The proportions of DR-TB were 25% (29/114) and 44% (39/88) among new and previously treated cases respectively. The patterns of DR-TB were: 21% mono-resistant, 12% poly-resistant, 38% multidrug-resistant (MDR-TB), 21% pre-extensively-drug-resistant (MDR-TB plus resistance to either a fluoroquinolone or second-line injectable), 6% extensively drug-resistant (XDR-TB) and 2% extremely drug-resistant TB (XDR-TB plus resistance to any group-IV/V drug). Only previous history of TB was significantly associated with the diagnosis of DR-TB in multivariate models. The burden of DR-TB among HIV-infected patients attending public ART-centers in Mumbai was alarmingly high, likely representing ongoing transmission in the community and

  15. Alarming levels of drug-resistant tuberculosis in HIV-infected patients in metropolitan Mumbai, India.

    Directory of Open Access Journals (Sweden)

    Petros Isaakidis

    Full Text Available BACKGROUND: Drug-resistant tuberculosis (DR-TB is a looming threat to tuberculosis control in India. However, no countrywide prevalence data are available. The burden of DR-TB in HIV-co-infected patients is likewise unknown. Undiagnosed and untreated DR-TB among HIV-infected patients is a major cause of mortality and morbidity. We aimed to assess the prevalence of DR-TB (defined as resistance to any anti-TB drug in patients attending public antiretroviral treatment (ART centers in greater metropolitan Mumbai, India. METHODS: A cross-sectional survey was conducted among adults and children ART-center attendees. Smear microscopy, culture and drug-susceptibility-testing (DST against all first and second-line TB-drugs using phenotypic liquid culture (MGIT were conducted on all presumptive tuberculosis patients. Analyses were performed to determine DR-TB prevalence and resistance patterns separately for new and previously treated, culture-positive TB-cases. RESULTS: Between March 2013 and January 2014, ART-center attendees were screened during 14135 visits, of whom 1724 had presumptive TB. Of 1724 attendees, 72 (4% were smear-positive and 202 (12% had a positive culture for Mycobacterium tuberculosis. Overall DR-TB was diagnosed in 68 (34%, 95% CI: 27%-40% TB-patients. The proportions of DR-TB were 25% (29/114 and 44% (39/88 among new and previously treated cases respectively. The patterns of DR-TB were: 21% mono-resistant, 12% poly-resistant, 38% multidrug-resistant (MDR-TB, 21% pre-extensively-drug-resistant (MDR-TB plus resistance to either a fluoroquinolone or second-line injectable, 6% extensively drug-resistant (XDR-TB and 2% extremely drug-resistant TB (XDR-TB plus resistance to any group-IV/V drug. Only previous history of TB was significantly associated with the diagnosis of DR-TB in multivariate models. CONCLUSION: The burden of DR-TB among HIV-infected patients attending public ART-centers in Mumbai was alarmingly high, likely representing

  16. Multidrug resistant to extensively drug resistant tuberculosis: What is ...

    Indian Academy of Sciences (India)

    Prakash

    The modern, ... World Health Organization is based on a four-drug regimen ... Better management and control of tuberculosis specially drug resistant TB by experienced and qualified .... a comprehensive approach including the major DOTS.

  17. How many sputum culture results do we need to monitor multidrug-resistant-tuberculosis (MDR-TB) patients during treatment?

    NARCIS (Netherlands)

    Janssen, Saskia; Padanilam, Xavier; Louw, Rianna; Mahanyele, Russel; Coetzee, Gerrit; Hänscheid, Thomas; Leenstra, Tjalling; Grobusch, Martin P.

    2013-01-01

    Discharge of a hospital patient after a single negative sputum culture may save money when treating multidrug-resistant tuberculosis. However, after initial sputum conversion in 336 South Africans, 11.6% and 5.4% reconverted after 1 and 2 months, respectively. These findings endorse the WHO

  18. Tumor Heterogeneity and Drug Resistance

    International Nuclear Information System (INIS)

    Kucerova, L.; Skolekova, S.; Kozovska, Z.

    2015-01-01

    New generation of sequencing methodologies revealed unexpected complexity and genomic alterations linked with the tumor subtypes. This diversity exists across the tumor types, histologic tumor subtypes and subsets of the tumor cells within the same tumor. This phenomenon is termed tumor heterogeneity. Regardless of its origin and mechanisms of development it has a major impact in the clinical setting. Genetic, phenotypic and expression pattern diversity of tumors plays critical role in the selection of suitable treatment and also in the prognosis prediction. Intratumoral heterogeneity plays a key role in the intrinsic and acquired chemoresistance to cytotoxic and targeted therapies. In this review we focus on the mechanisms of intratumoral and inter tumoral heterogeneity and their relationship to the drug resistance. Understanding of the mechanisms and spatiotemporal dynamics of tumor heterogeneity development before and during the therapy is important for the ability to design individual treatment protocols suitable in the given molecular context. (author)

  19. Drug-resistant tuberculosis in Sindh

    International Nuclear Information System (INIS)

    Almani, S.A.; Memon, N.M.; Qureshi, A.F.

    2002-01-01

    Objective: To assess the prevalence of primary and secondary drug resistance amongst the clinical isolates of M.tuberculosis, to identify risk factors and how to overcome this problem. Design: A case series of 50 indoor patients with sputum smear-positive pulmonary tuberculosis. Place and duration of Study: Department of Medicine, Liaquat University of Medical and Health Sciences Jamshoro, Sindh, (Pakistan) from January 1999 to December 2000. Patients and methods: Four first line anti-tuberculous drugs rifampicine, ethambutol and streptomycin were tested for sensitivity pattern. Results: Twelve (26.66%) were sensitive to all four drugs, 12(26.66%) were resistant to one drug, 14 (31.11%) were resistant to two drugs, 2 (4.44%) were resistant to three drugs, and 5(11.11%) were resistant to all four drugs. Resistance to isoniazid was the most common in 27 cases (60%) with primary resistance in 6(13.33%) and secondary resistance in 21(46.66%), followed by resistance to streptomycin in 17 cases (37.77%) with primary resistance in 5(11.11%) and secondary resistance in 12 (26.66%). Resistance to ethambutol in 10 cases (22.22%) and rifampicine in 11 (24.44%) and all cases were secondary. Similarly multi-drugs resistance (MRD) TB was found in 11(24.44%) isolates. Conclusion: This study showed high prevalence of drug resistance among clinical isolates of M. tuberculosis. Their is a need to establish centers at number of places with adequate facilities for susceptibility testing so that the resistant pattern could be ascertained and treatment regimens tailored accordingly. (author)

  20. Drug resistance pattern of M. tuberculosis in category II treatment failure pulmonary tuberculosis patients

    Directory of Open Access Journals (Sweden)

    Fahmida Rahman

    2013-01-01

    Full Text Available This study was designed to determine the extent of drug resistance of M. tuberculosis (MTB isolated from category II treatment failure pulmonary tuberculosis (PTB patients. A total of 100 Ziehl-Neelsen (Z-N smear positive category II failure PTB patients were included in this study. Sputum culture was done in Lowenstein-Jensen (L-J media. Conventional proportion method on Lowenstein-Jensen (L-J media was used to determine the drug susceptibility of M. tuberculosis to isoniazid (INH, rifampicin (RMP, ofloxacin (OFX and kanamycin (KA. Out of 100 sputum samples, a total of 87 samples were positive by culture. Drug susceptibility test (DST revealed that 82 (94.25% isolates were resistant to one or more anti -TB drugs. Resistance to isoniazide (INH, rifampicin (RMP, ofloxacin (OFX and kanamycin (KA was 94.25%, 82.75%, 29.90% and 3.45% respectively. Among these isolates, 79.31% and 3.45% isolates were multi-drug resistant (MDR and extended drug resistant (XDR M. tuberculosis respectively. High rate of anti-tubercular drug resistance was observed among the category II treatment failure TB patients. Ibrahim Med. Coll. J. 2013; 7(1: 9-11

  1. Mechanisms of drug resistance in cancer cells

    International Nuclear Information System (INIS)

    Iqbal, M.P.

    2003-01-01

    Development of drug resist chemotherapy. For the past several years, investigators have been striving hard to unravel mechanisms of drug resistance in cancer cells. Using different experimental models of cancer, some of the major mechanisms of drug resistance identified in mammalian cells include: (a) Altered transport of the drug (decreased influx of the drug; increased efflux of the drug (role of P-glycoprotein; role of polyglutamation; role of multiple drug resistance associated protein)), (b) Increase in total amount of target enzyme/protein (gene amplification), (c) alteration in the target enzyme/protein (low affinity enzyme), (d) Elevation of cellular glutathione, (e) Inhibition of drug-induced apoptosis (mutation in p53 tumor suppressor gene; increased expression of bcl-xl gene). (author)

  2. Genomic diversity of drug-resistant Mycobacterium tuberculosis isolates in Lisbon Portugal: Towards tuberculosis genomic epidemiology

    Directory of Open Access Journals (Sweden)

    João Perdigão

    2015-01-01

    Full Text Available Multidrug- (MDR and extensively drug-resistant (XDR tuberculosis (TB present a challenge to disease control and elimination goals. Lisbon, Portugal, has a high TB incidencerate and unusual and successful XDR-TB strains that have been found in circulation foralmost two decades. For the last 20 years, a continued circulation of two phylogenetic clades, Lisboa3 and Q1, which are highly associated with MDR and XDR, have been observed. In recent years, these strains have been well characterized regarding the molecular basis of drug resistance and have been inclusively subjected to whole genome sequencing (WGS. Researchers have been studying the genomic diversity of strains circulating in Lisbon and its genomic determinants through cutting-edge next generation sequencing. An enormous amount of whole genome sequence data are now available for the most prevalent and clinically relevant strains circulating in Lisbon. It is the persistence, prevalence and rapid evolution towards drug resistance that has prompted researchers to investigate the properties of these strains at the genomic level and in the future at a global transcriptomic level. Seventy Mycobacterium tuberculosis (MTB isolates, mostly recovered in Lisbon, were genotyped by 24-loci Mycobacterial Interspersed Repetitive Unit – Variable Number of Tandem Repeats (MIRU-VNTR and the genomes sequenced using a next generation sequencing platform – Illumina HiSeq 2000. The genotyping data revealed three major clusters associated with MDR-TB (Lisboa3-A, Lisboa3-B and Q1, two of which are associated with XDR-TB (Lisboa3-B and Q1, whilst the genomic data contributed to elucidating the phylogenetic positioning of circulating MDR-TB strains, showing a high predominance of a single SNP cluster group 5. Furthermore, a genome-wide phylogeny analysis from these strains, together with 19 publicly available genomes of MTB clinical isolates, revealed two major clades responsible for MDR/XDR-TB in the region

  3. Genomic diversity of drug-resistant Mycobacterium tuberculosis isolates in Lisbon Portugal: Towards tuberculosis genomic epidemiology

    KAUST Repository

    Perdigã o, Joã o; Silva, Hugo; Machado, Diana; Macedo, Rita; Maltez, Fernando; Silva, Carla; Jordao, Luisa; Couto, Isabel; Mallard, Kim; Coll, Francesc; Hill-Cawthorne, Grant A.; McNerney, Ruth; Pain, Arnab; Clark, Taane G.; Viveiros, Miguel; Portugal, Isabel

    2015-01-01

    Multidrug- (MDR) and extensively drug-resistant (XDR) tuberculosis (TB) present a challenge to disease control and elimination goals. Lisbon, Portugal, has a high TB incidence rate and unusual and successful XDR-TB strains that have been found in circulation for almost two decades. For the last 20. years, a continued circulation of two phylogenetic clades, Lisboa3 and Q1, which are highly associated with MDR and XDR, have been observed. In recent years, these strains have been well characterized regarding the molecular basis of drug resistance and have been inclusively subjected to whole genome sequencing (WGS). Researchers have been studying the genomic diversity of strains circulating in Lisbon and its genomic determinants through cutting-edge next generation sequencing. An enormous amount of whole genome sequence data are now available for the most prevalent and clinically relevant strains circulating in Lisbon.It is the persistence, prevalence and rapid evolution towards drug resistance that has prompted researchers to investigate the properties of these strains at the genomic level and in the future at a global transcriptomic level. Seventy Mycobacterium tuberculosis (MTB) isolates, mostly recovered in Lisbon, were genotyped by 24-. loci Mycobacterial Interspersed Repetitive Unit - Variable Number of Tandem Repeats (MIRU-VNTR) and the genomes sequenced using a next generation sequencing platform - Illumina HiSeq 2000.The genotyping data revealed three major clusters associated with MDR-TB (Lisboa3-A, Lisboa3-B and Q1), two of which are associated with XDR-TB (Lisboa3-B and Q1), whilst the genomic data contributed to elucidating the phylogenetic positioning of circulating MDR-TB strains, showing a high predominance of a single SNP cluster group 5. Furthermore, a genome-wide phylogeny analysis from these strains, together with 19 publicly available genomes of MTB clinical isolates, revealed two major clades responsible for MDR/XDR-TB in the region: Lisboa3 and Q

  4. Genomic diversity of drug-resistant Mycobacterium tuberculosis isolates in Lisbon Portugal: Towards tuberculosis genomic epidemiology

    KAUST Repository

    Perdigão, João

    2015-03-01

    Multidrug- (MDR) and extensively drug-resistant (XDR) tuberculosis (TB) present a challenge to disease control and elimination goals. Lisbon, Portugal, has a high TB incidence rate and unusual and successful XDR-TB strains that have been found in circulation for almost two decades. For the last 20. years, a continued circulation of two phylogenetic clades, Lisboa3 and Q1, which are highly associated with MDR and XDR, have been observed. In recent years, these strains have been well characterized regarding the molecular basis of drug resistance and have been inclusively subjected to whole genome sequencing (WGS). Researchers have been studying the genomic diversity of strains circulating in Lisbon and its genomic determinants through cutting-edge next generation sequencing. An enormous amount of whole genome sequence data are now available for the most prevalent and clinically relevant strains circulating in Lisbon.It is the persistence, prevalence and rapid evolution towards drug resistance that has prompted researchers to investigate the properties of these strains at the genomic level and in the future at a global transcriptomic level. Seventy Mycobacterium tuberculosis (MTB) isolates, mostly recovered in Lisbon, were genotyped by 24-. loci Mycobacterial Interspersed Repetitive Unit - Variable Number of Tandem Repeats (MIRU-VNTR) and the genomes sequenced using a next generation sequencing platform - Illumina HiSeq 2000.The genotyping data revealed three major clusters associated with MDR-TB (Lisboa3-A, Lisboa3-B and Q1), two of which are associated with XDR-TB (Lisboa3-B and Q1), whilst the genomic data contributed to elucidating the phylogenetic positioning of circulating MDR-TB strains, showing a high predominance of a single SNP cluster group 5. Furthermore, a genome-wide phylogeny analysis from these strains, together with 19 publicly available genomes of MTB clinical isolates, revealed two major clades responsible for MDR/XDR-TB in the region: Lisboa3 and Q

  5. Clinical Management of HIV Drug Resistance

    Science.gov (United States)

    Cortez, Karoll J.; Maldarelli, Frank

    2011-01-01

    Combination antiretroviral therapy for HIV-1 infection has resulted in profound reductions in viremia and is associated with marked improvements in morbidity and mortality. Therapy is not curative, however, and prolonged therapy is complicated by drug toxicity and the emergence of drug resistance. Management of clinical drug resistance requires in depth evaluation, and includes extensive history, physical examination and laboratory studies. Appropriate use of resistance testing provides valuable information useful in constructing regimens for treatment-experienced individuals with viremia during therapy. This review outlines the emergence of drug resistance in vivo, and describes clinical evaluation and therapeutic options of the individual with rebound viremia during therapy. PMID:21994737

  6. Multi-clonal evolution of multi-drug-resistant/extensively drug-resistant Mycobacterium tuberculosis in a high-prevalence setting of Papua New Guinea for over three decades

    Science.gov (United States)

    Bainomugisa, Arnold; Lavu, Evelyn; Hiashiri, Stenard; Majumdar, Suman; Honjepari, Alice; Moke, Rendi; Dakulala, Paison; Hill-Cawthorne, Grant A.; Pandey, Sushil; Marais, Ben J.; Coulter, Chris; Coin, Lachlan

    2018-01-01

    An outbreak of multi-drug resistant (MDR) tuberculosis (TB) has been reported on Daru Island, Papua New Guinea. Mycobacterium tuberculosis strains driving this outbreak and the temporal accrual of drug resistance mutations have not been described. Whole genome sequencing of 100 of 165 clinical isolates referred from Daru General Hospital to the Supranational reference laboratory, Brisbane, during 2012–2015 revealed that 95 belonged to a single modern Beijing sub-lineage strain. Molecular dating suggested acquisition of streptomycin and isoniazid resistance in the 1960s, with potentially enhanced virulence mediated by an mycP1 mutation. The Beijing sub-lineage strain demonstrated a high degree of co-resistance between isoniazid and ethionamide (80/95; 84.2 %) attributed to an inhA promoter mutation combined with inhA and ndh coding mutations. Multi-drug resistance, observed in 78/95 samples, emerged with the acquisition of a typical rpoB mutation together with a compensatory rpoC mutation in the 1980s. There was independent acquisition of fluoroquinolone and aminoglycoside resistance, and evidence of local transmission of extensively drug resistant (XDR) strains from 2009. These findings underline the importance of whole genome sequencing in informing an effective public health response to MDR/XDR TB. PMID:29310751

  7. Management and treatment outcomes of patients enrolled in MDR-TB treatment in Viet Nam.

    Science.gov (United States)

    Phuong, N T M; Nhung, N V; Hoa, N B; Thuy, H T; Takarinda, K C; Tayler-Smith, K; Harries, A D

    2016-03-21

    The programmatic management of drug-resistant tuberculosis (TB) in Viet Nam has been rapidly scaled up since 2009. To document the annual numbers of patients enrolled for multidrug-resistant tuberculosis (MDR-TB) treatment during 2010-2014 and to determine characteristics and treatment outcomes of patients initiating treatment during 2010-2012. A retrospective cohort study using national reports and data from the national electronic data system for drug-resistant TB. The number of patients enrolled annually for MDR-TB treatment increased from 97 in 2010 to 1522 in 2014. The majority of patients were middle-aged men who had pulmonary disease and had failed a retreatment regimen; 77% had received ⩾2 courses of TB treatment. Favourable outcomes (cured and treatment completed) were attained in 73% of patients. Unfavourable outcomes included loss to follow-up (12.5%), death (8%) and failure (6.3%). Having had ⩾2 previous treatment courses and being human immunodeficiency virus-positive were associated with unfavourable outcomes. Increasing numbers of patients are being treated for MDR-TB each year with good treatment outcomes under national programme management in Viet Nam. However, there is a need to increase case detection-currently at 30% of the estimated 5100 MDR-TB cases per year, reduce adverse outcomes and improve monitoring and evaluation.

  8. Bloodstream infections caused by multi-drug resistant Proteus mirabilis: Epidemiology, risk factors and impact of multi-drug resistance.

    Science.gov (United States)

    Korytny, Alexander; Riesenberg, Klaris; Saidel-Odes, Lisa; Schlaeffer, Fransisc; Borer, Abraham

    2016-01-01

    The prevalence of antimicrobial co-resistance among ESBL-producing Enterobactereaceae is extremely high in Israel. Multidrug-resistant Proteus mirabilis strains (MDR-PM), resistant to almost all antibiotic classes have been described. The aim was to determine the risk factors for bloodstream infections caused by MDR-PM and clinical outcomes. A retrospective case-control study. Adult patients with PM bacteremia during 7 years were identified retrospectively and their files reviewed for demographics, underlying diseases, Charlson Comorbidity Index, treatment and outcome. One hundred and eighty patients with PM-bloodstream infection (BSI) were included; 90 cases with MDR-PM and 90 controls with sensitive PM (S-PM). Compared to controls, cases more frequently were from nursing homes, had recurrent hospital admissions in the past year and received antibiotic therapy in the previous 3 months, were bedridden and suffered from peripheral vascular disease and peptic ulcer disease (p < 0.001). Two-thirds of the MDR-PM isolates were ESBL-producers vs 4.4% of S-PM isolates (p < 0.001, OR = 47.6, 95% CI = 15.9-142.6). In-hospital crude mortality rate of patients with MDR-PM BSI was 37.7% vs 23.3% in those with S-PM BSI (p = 0.0359, OR = 2, 95% CI = 1.4-3.81). PM bacteremia in elderly and functionally-dependent patients is likely to be caused by nearly pan-resistant PM strains in the institution; 51.8% of the patients received inappropriate empiric antibiotic treatment. The crude mortality rate of patients with MDR-PM BSI was significantly higher than that of patients with S-PM BSI.

  9. Antimicrobial activity of PVP from an Antarctic bacterium, Janthinobacterium sp. Ant5-2, on multi-drug and methicillin resistant Staphylococcus aureus

    KAUST Repository

    Huang, Jonathan P.

    2012-04-11

    Multiple drug resistant (MDR) and methicillin-resistant Staphylococcus aureus (MRSA) have become increasingly prevalent as a community acquired infection. As a result limited treatment options are available with conventional synthetic antibiotics. Bioprospecting natural products with potent antimicrobial activity show promise for developing new drugs against this pathogen. In this study, we have investigated the antimicrobial activity of a purple violet pigment (PVP) from an Antarctic bacterium, Janthinobacterium sp. Ant5-2 on 15 clinical MDR and MRSA strains. The colorimetric resazurin assay was employed to determine the minimum inhibitory concentration (MIC90) of PVP against MDR and MRSA. The MIC90 ranged between 1.57 µg/mL and 3.13 µg/mL, which are significantly lower than many antimicrobials tested from natural sources against this pathogen. The spectrophotometrically determined growth analysis and total microscopic counts using Live/dead® BacLight™ fluorescent stain exhibited a steady decrease in viability of both MDR and MRSA cultures following treatment with PVP at the MIC levels. In silico predictive molecular docking study revealed that PVP could be a DNA-targeting minor groove binding antimicrobial compound. The continued development of novel antimicrobials derived from natural sources with the combination of a suite of conventional antibiotics could stem the rising pandemic of MDR and MRSA along with other deadly microbial pathogens.

  10. Antimicrobial activity of PVP from an Antarctic bacterium, Janthinobacterium sp. Ant5-2, on multi-drug and methicillin resistant Staphylococcus aureus

    KAUST Repository

    Huang, Jonathan P.; Mojib, Nazia; Goli, Rakesh R.; Watkins, Samantha; Waites, Ken B.; Ravindra, Rasik; Andersen, Dale T.; Bej, Asim K.

    2012-01-01

    Multiple drug resistant (MDR) and methicillin-resistant Staphylococcus aureus (MRSA) have become increasingly prevalent as a community acquired infection. As a result limited treatment options are available with conventional synthetic antibiotics. Bioprospecting natural products with potent antimicrobial activity show promise for developing new drugs against this pathogen. In this study, we have investigated the antimicrobial activity of a purple violet pigment (PVP) from an Antarctic bacterium, Janthinobacterium sp. Ant5-2 on 15 clinical MDR and MRSA strains. The colorimetric resazurin assay was employed to determine the minimum inhibitory concentration (MIC90) of PVP against MDR and MRSA. The MIC90 ranged between 1.57 µg/mL and 3.13 µg/mL, which are significantly lower than many antimicrobials tested from natural sources against this pathogen. The spectrophotometrically determined growth analysis and total microscopic counts using Live/dead® BacLight™ fluorescent stain exhibited a steady decrease in viability of both MDR and MRSA cultures following treatment with PVP at the MIC levels. In silico predictive molecular docking study revealed that PVP could be a DNA-targeting minor groove binding antimicrobial compound. The continued development of novel antimicrobials derived from natural sources with the combination of a suite of conventional antibiotics could stem the rising pandemic of MDR and MRSA along with other deadly microbial pathogens.

  11. Preventing drug resistance in severe influenza

    Science.gov (United States)

    Dobrovolny, Hana; Deecke, Lucas

    2015-03-01

    Severe, long-lasting influenza infections are often caused by new strains of influenza. The long duration of these infections leads to an increased opportunity for the emergence of drug resistant mutants. This is particularly problematic for new strains of influenza since there is often no vaccine, so drug treatment is the first line of defense. One strategy for trying to minimize drug resistance is to apply periodic treatment. During treatment the wild-type virus decreases, but resistant virus might increase; when there is no treatment, wild-type virus will hopefully out-compete the resistant virus, driving down the number of resistant virus. We combine a mathematical model of severe influenza with a model of drug resistance to study emergence of drug resistance during a long-lasting infection. We apply periodic treatment with two types of antivirals: neuraminidase inhibitors, which block release of virions; and adamantanes, which block replication of virions. We compare the efficacy of the two drugs in reducing emergence of drug resistant mutants and examine the effect of treatment frequency on the emergence of drug resistant mutants.

  12. Drug-sensitive tuberculosis, multidrug-resistant tuberculosis, and nontuberculous mycobacterial pulmonary disease in nonAIDS adults: comparisons of thin-section CT findings

    International Nuclear Information System (INIS)

    Chung, Myung Jin; Lee, Kyung Soo; Kim, Tae Sung; Kim, Sung Mok; Koh, Won-Jung; Kwon, O Jung; Kang, Eun Young; Kim, Seonwoo

    2006-01-01

    The aim of this work was to compare thin-section CT (TSCT) findings of drug-sensitive (DS) tuberculosis (TB), multidrug-resistant (MDR) TB, and nontuberculous mycobacterial (NTM) pulmonary disease in nonAIDS adults. During 2003, 216 (113 DS TB, 35 MDR TB, and 68 NTM) patients with smear-positive sputum for acid-fast bacilli (AFB), and who were subsequently confirmed to have mycobacterial pulmonary disease, underwent thoracic TSCT. The frequency of lung lesion patterns on TSCT and patients' demographic data were compared. The commonest TSCT findings were tree-in-bud opacities and nodules. On a per-person basis, significant differences were found in the frequency of multiple cavities and bronchiectasis (P<0.001, chi-square test and multiple logistic regression analysis). Multiple cavities were more frequent in MDR TB than in the other two groups and extensive bronchiectasis in NTM disease (multiple logistic regression analysis). Patients with MDR TB were younger than those with DS TB or NTM disease (P<0.001, multiple logistic regression analysis). Previous tuberculosis treatment history was significantly more frequent in patients with MDR TB or NTM disease (P<0.001, chi-square test and multiple logistic regression analysis). In patients with positive sputum AFB, multiple cavities, young age, and previous tuberculosis treatment history imply MDR TB, whereas extensive bronchiectasis, old age, and previous tuberculosis treatment history NTM disease. (orig.)

  13. Drug-sensitive tuberculosis, multidrug-resistant tuberculosis, and nontuberculous mycobacterial pulmonary disease in nonAIDS adults: comparisons of thin-section CT findings

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Myung Jin; Lee, Kyung Soo; Kim, Tae Sung; Kim, Sung Mok [Sungkyunkwan University School of Medicine, Department of Radiology and Center for Imaging Science, Samsung Medical Center, Seoul (Korea); Koh, Won-Jung; Kwon, O Jung [Sungkyunkwan University School of Medicine, Division of Pulmonary and Critical Care Medicine, Department of Medicine, Samsung Medical Center, Seoul (Korea); Kang, Eun Young [Korea University Guro Hospital, Department of Diagnostic Radiology, Korea University College of Medicine, Seoul (Korea); Kim, Seonwoo [Sungkyunkwan University School of Medicine, Biostatistics Unit of the Samsung Biomedical Research Institute, Samsung Medical Center, Seoul (Korea)

    2006-09-15

    The aim of this work was to compare thin-section CT (TSCT) findings of drug-sensitive (DS) tuberculosis (TB), multidrug-resistant (MDR) TB, and nontuberculous mycobacterial (NTM) pulmonary disease in nonAIDS adults. During 2003, 216 (113 DS TB, 35 MDR TB, and 68 NTM) patients with smear-positive sputum for acid-fast bacilli (AFB), and who were subsequently confirmed to have mycobacterial pulmonary disease, underwent thoracic TSCT. The frequency of lung lesion patterns on TSCT and patients' demographic data were compared. The commonest TSCT findings were tree-in-bud opacities and nodules. On a per-person basis, significant differences were found in the frequency of multiple cavities and bronchiectasis (P<0.001, chi-square test and multiple logistic regression analysis). Multiple cavities were more frequent in MDR TB than in the other two groups and extensive bronchiectasis in NTM disease (multiple logistic regression analysis). Patients with MDR TB were younger than those with DS TB or NTM disease (P<0.001, multiple logistic regression analysis). Previous tuberculosis treatment history was significantly more frequent in patients with MDR TB or NTM disease (P<0.001, chi-square test and multiple logistic regression analysis). In patients with positive sputum AFB, multiple cavities, young age, and previous tuberculosis treatment history imply MDR TB, whereas extensive bronchiectasis, old age, and previous tuberculosis treatment history NTM disease. (orig.)

  14. In vivo detection of multidrug-resistant (MDR1) phenotype by technetium-99m sestamibi scan in untreated breast cancer patients

    International Nuclear Information System (INIS)

    Del Vecchio, S.; Ciarmiello, A.; Potena, M.I.; Carriero, M.V.; Mainolfi, C.; Botti, G.; Thomas, R.; Cerra, M.; D'Aiuto, G.; Tsuruo, T.; Salvatore, M.

    1997-01-01

    Technetium-99m sestamibi is a transport substrate recognised by the multidrug-resistant P-glycoprotein (Pgp). To test whether 99m Tc-sestamibi efflux is enhanced in breast carcinomas overexpressing Pgp, we determined the efflux rates of 99m Tc-sestamibi and Pgp levels in tumours from 30 patients with untreated breast carcinoma. Patients were intravenously injected with 740 MBq of 99m Tc-sestamibi and underwent a 15-min dynamic study followed by the acquisition of static planar images at 0.5, 1, 2 and 4 h. Tumour specimens were obtained from each patient 24 h after 99m Tc-sestamibi scan and Pgp levels were determined using 125 I-MRK16 monoclonal antibody and in vitro quantitative autoradiography. All breast carcinomas showed high uptake of 99m Tc-sestamibi and data from region of interest analysis on sequential images were fitted with a monoexponential function. The efflux rates of 99m Tc-sestamibi, calculated from decay-corrected time-activity curves, ranged between 0.00121 and 0.01690 min -1 and were directly correlated with Pgp levels measured in the same tumours (r=0.62; P 99m Tc-sestamibi efflux from tumours of group A was 2.7 times higher than that observed in tumours of group B (0.00686 ±0.00390 min -1 vs 0.00250 ±0.00090 min -1 , P 99m Tc-sestamibi showed a sensitivity and a specificity of 80% and 95%, respectively. In conclusion, the efflux rate of 99m Tc-sestamibi may be used for the in vivo identification of the multidrug resistant (MDR1) phenotype in untreated breast cancer patients. (orig.). With 7 figs., 3 tabs

  15. Multiplex TaqMan® detection of pathogenic and multi-drug resistant Salmonella.

    Science.gov (United States)

    Singh, Prashant; Mustapha, Azlin

    2013-09-02

    Overuse of antibiotics in the medical and animal industries is one of the major causes for the development of multi-drug-resistant (MDR) food pathogens that are often difficult to treat. In the past few years, higher incidences of outbreaks caused by MDR Salmonella have been increasingly documented. The objective of this study was to develop a rapid multiplex real-time polymerase chain reaction (PCR) assay for simultaneous detection of pathogenic and MDR Salmonella spp. A multiplex TaqMan®real-time PCR was designed by targeting the invasin virulence gene (invA), and four commonly found antibiotic resistance genes, viz. ampicillin, chloramphenicol, streptomycin and tetracycline. To avoid false negative results and to increase the reliability of the assay, an internal amplification control (IAC) was added which was detected using a locked nucleic acid (LNA) probe. In serially diluted (5 ng-50 fg) DNA samples, the assay was able to detect 100 genomic equivalents of Salmonella, while in a multiplex format, the sensitivity was 1000 genomic equivalents. The assay performed equally well on artificially contaminated samples of beef trim, ground beef of different fat contents (73:27, 80:20, 85:15 and 93:7), chicken rinse, ground chicken, ground turkey, egg, spinach and tomato. While the detection limit for un-enriched inoculated food samples was 10(4) CFU/g, this was improved to 10 CFU/g after a 12-h enrichment in buffered peptone water, with 100% reproducibility. The multiplex real-time assay developed in this study can be used as a valuable tool to detect MDR virulent Salmonella, thus enhancing the safety of food. © 2013.

  16. Combined antiretroviral and anti- tuberculosis drug resistance ...

    African Journals Online (AJOL)

    these epidemics, many challenges remain.[3] Antiretroviral and anti-TB drug resistance pose considerable threats to the control of these epidemics.[4,5]. The breakdown in HIV/TB control within prisons is another emerging threat.[6,7] We describe one of the first reports of combined antiretroviral and anti-TB drug resistance ...

  17. Drug Resistance of Mycobacterium tuberculosis Complex among ...

    African Journals Online (AJOL)

    BACKGROUND: In Burkina Faso, there is no recent data about the level of drug resistance in Mycobacterium tuberculosis strains among newly diagnosed tuberculosis cases. OBJECTIVE: To provide an update of the primary drug resistance of mycobacterium tuberculosis among patients in Burkina faso. METHODS: ...

  18. Emergence of Extensively Drug Resistant Tuberculosis

    Centers for Disease Control (CDC) Podcasts

    Extensively drug-resistant tuberculosis (XDR TB) outbreaks have been reported in South Africa, and strains have been identified on 6 continents. Dr. Peter Cegielski, team leader for drug-resistant TB with the Division of Tuberculosis Elimination at CDC, comments on a multinational team's report on this emerging global public health threat.

  19. [Change in drug resistance of Staphylococcus aureus].

    Science.gov (United States)

    Lin, Yan; Liu, Yan; Luo, Yan-Ping; Liu, Chang-Ting

    2013-11-01

    To analyze the change in drug resistance of Staphylococcus aureus (SAU) in the PLA general hospital from January 2008 to December 2012, and to provide solid evidence to support the rational use of antibiotics for clinical applications. The SAU strains isolated from clinical samples in the hospital were collected and subjected to the Kirby-Bauer disk diffusion test. The results were assessed based on the 2002 American National Committee for Clinical Laboratory Standards (NCCLS) guidelines. SAU strains were mainly isolated from sputum, urine, blood and wound excreta and distributed in penology, neurology wards, orthopedics and surgery ICU wards. Except for glycopeptide drugs, methicillin-resistant Staphylococcus aureus (MRSA) had a higher drug resistance rate than those of the other drugs and had significantly more resistance than methicillin-sensitive Staphylococcus aureus (MSSA) (P resistance, we discovered a gradual increase in drug resistance to fourteen test drugs during the last five years. Drug resistance rate of SAU stayed at a higher level over the last five years; moreover, the detection ratio of MRSA keeps rising year by year. It is crucial for physicians to use antibiotics rationally and monitor the change in drug resistance in a dynamic way.

  20. Survival of civilian and prisoner drug-sensitive, multi- and extensive drug- resistant tuberculosis cohorts prospectively followed in Russia.

    Directory of Open Access Journals (Sweden)

    Yanina Balabanova

    Full Text Available OBJECTIVE AND METHODS: A long-term observational study was conducted in Samara, Russia to assess the survival and risk factors for death of a cohort of non-multidrug resistant tuberculosis (non-MDRTB and multidrug resistant tuberculosis (MDRTB civilian and prison patients and a civilian extensive drug-resistant tuberculosis (XDRTB cohort. RESULTS: MDRTB and XDRTB rates of 54.8% and 11.1% were identified in the region. Half (50% of MDRTB patients and the majority of non-MDRTB patients (71% were still alive at 5 years. Over half (58% of the patients died within two years of establishing a diagnosis of XDRTB. In the multivariate analysis, retreatment (HR = 1.61, 95%CI 1.04, 2.49 and MDRTB (HR = 1.67, 95%CI 1.17, 2.39 were significantly associated with death within the non-MDR/MDRTB cohort. The effect of age on survival was relatively small (HR = 1.01, 95%CI 1.00, 1.02. No specific factor affected survival of XDRTB patients although median survival time for HIV-infected versus HIV-negative patients from this group was shorter (185 versus 496 days. The majority of MDRTB and XDRTB strains (84% and 92% respectively strains belonged to the Beijing family. Mutations in the rpoB (codon 531 in 81/92; 88.8%, katG (mutation S315T in 91/92, 98.9% and inhA genes accounted for most rifampin and isoniazid resistance respectively, mutations in the QRDR region of gyrA for most fluroquinolone resistance (68/92; 73.5%. CONCLUSIONS: Alarmingly high rates of XDRTB exist. Previous TB treatment cycles and MDR were significant risk factors for mortality. XDRTB patients' survival is short especially for HIV-infected patients. Beijing family strains comprise the majority of drug-resistant strains.

  1. Rapid Screening of MDR-TB in Cases of Extra Pulmonary Tuberculosis Using Geno Type MTBDRplus.

    Directory of Open Access Journals (Sweden)

    Richa Kumari

    Full Text Available Drug resistance in tuberculosis is a major public health challenge in developing countries. The limited data available on drug resistance in extra pulmonary tuberculosis stimulated us to design our study on anti-tuberculosis drug resistance pattern in cases of extra pulmonary tuberculosis in a tertiary referral hospital of North India. We performed Geno Type MTBDRplus assay in comparison with conventional drug susceptibility testing by proportion method to study the mutation patterns in rpoB, katG and inhA genes.A total of 510 extra pulmonary samples were included in this study. After the smear microscopy, all the specimens were subjected for culture on Lowenstein Jensen (LJ media. Phenotypic drug susceptibility testing (DST was performed on LJ media for all the MTB isolates and compared with the results of Geno Type MTBDRplus assay which was performed with the DNA isolated from the culture by conventional method.Of 510 specimens cultured, the total culture positivity obtained was 11.8% (60 encompassing 54 (10.6% Mycobacterium tuberculosis and 6 (1.2% non-tubercular mycobacteria (NTM. DST results by Geno Type MTBDRplus assay and solid culture methods were compared in 51 MTB isolates excluding the two Rif indeterminate and one invalid test. Geno Type MTBDRplus accurately identified 13 of 14 rifampicin-resistant strains, 14 of 15 isoniazid-resistant strains and 13 of 14 as multi drug resistant tuberculosis (MDR-TB in comparison with conventional method. Sensitivity and specificity were 92.86% and 97.30% respectively for detection of RIF resistance, 93.33% and 94.44% respectively for detection of INH resistance, 92.86% and 97.30% respectively for detection of MDR-TB, while the overall concordance of Geno Type MTBDRplus assay with conventional DST was 94.11%. The turn-around time for performing Geno Type MTBDRplus assay test was 48 hours.The problem of MDR in extra pulmonary tuberculosis (EPTB cannot be overlooked and due attention on patients

  2. The impact of drug resistance on the risk of tuberculosis infection and disease in child household contacts: a cross sectional study.

    Science.gov (United States)

    Golla, Vera; Snow, Kathryn; Mandalakas, Anna M; Schaaf, H Simon; Du Preez, Karen; Hesseling, Anneke C; Seddon, James A

    2017-08-29

    The relative fitness of organisms causing drug-susceptible (DS) and multidrug-resistant (MDR) tuberculosis (TB) is unclear. We compared the risk of TB infection and TB disease in young child household contacts of adults with confirmed DS-TB and MDR-TB. In this cross-sectional analysis we included data from two community-based contact cohort investigation studies conducted in parallel in Cape Town, South Africa. Children <5 years of age with household exposure to an infectious TB case were included between August 2008 to June 2011. Children completed investigation for TB infection (tuberculin skin test) and TB disease (symptom evaluation, chest radiograph, bacteriology) in both studies using standard approaches. The impact of MDR-TB exposure on each covariate of TB infection and TB disease was assessed using univariable and multivariable logistic regression. Of 538 children included, 312 had DS-TB and 226 had MDR-TB exposure. 107 children with DS-TB exposure had TB infection (34.3%) vs. 101 (44.7%) of children with MDR-TB exposure (adjusted Odds Ratio [aOR]: 2.05; 95% confidence interval [CI]: 1.34-3.12). A total of 15 (6.6%) MDR-TB vs. 27 (8.7%) DS-TB child contacts had TB disease at enrolment (aOR: 0.43; 95% CI: 0.19-0.97). Our results suggest a higher risk of TB infection in child contacts with household MDR-TB vs. DS-TB exposure, but a lower risk of TB disease. Although potentially affected by residual confounding or selection bias, our results are consistent with the hypothesis of impaired virulence in MDR-TB strains in this setting.

  3. Is one sputum specimen as good as two during follow-up cultures for monitoring multi drug resistant tuberculosis patients in India?

    Directory of Open Access Journals (Sweden)

    Sharath Burugina Nagaraja

    Full Text Available BACKGROUND: In India, the Revised National Tuberculosis Control Programme (RNTCP has adopted the strategy of examining two specimens during follow-up culture examinations to monitor the treatment response of multi-drug resistant tuberculosis (MDR-TB patients. OBJECTIVES: To determine the incremental yield of the second sputum specimen during follow-up culture examinations among patients with MDR-TB and the effect on case management on changing from two to one specimen follow-up strategy. METHODS: A cross sectional record review of MDR-TB patients registered during 2008-09 under RNTCP was undertaken in three MDR-TB treatment sites of India. RESULTS: Of 1721 pairs of follow-up sputum culture examinations done among 220 MDR-TB patients, 451(26% were positive with either of the two specimens; 29(1.7% were culture positive only on the second specimen indicating the incremental yield. To detect one additional culture positive result on the second specimen, 59 specimens needed to be processed. If we had examined only one specimen, we would have missed 29 culture-positive results. By current RNTCP guidelines, however, a single specimen policy would have altered case management in only 3(0.2% instances, where patients would have missed a one month extension of the intensive phase of MDR-TB treatment. There is no meaningful advantage in using two specimens for the monitoring of MDR-TB patients. A single specimen policy could be safely implemented with negligible clinical effect on MDR-TB patients and favourable resource implications for RNTCP.

  4. Quercetin and doxorubicin co-encapsulated biotin receptor-targeting nanoparticles for minimizing drug resistance in breast cancer.

    Science.gov (United States)

    Lv, Li; Liu, Chunxia; Chen, Chuxiong; Yu, Xiaoxia; Chen, Guanghui; Shi, Yonghui; Qin, Fengchao; Ou, Jiebin; Qiu, Kaifeng; Li, Guocheng

    2016-05-31

    The combination of a chemotherapeutic drug with a chemosensitizer has emerged as a promising strategy for cancers showing multidrug resistance (MDR). Herein we describe the simultaneous targeted delivery of two drugs to tumor cells by using biotin-decorated poly(ethylene glycol)-b-poly(ε-caprolactone) nanoparticles encapsulating the chemotherapeutic drug doxorubicin and the chemosensitizer quercetin (BNDQ). Next, the potential ability of BNDQ to reverse MDR in vitro and in vivo was investigated. Studies demonstrated that BNDQ was more effectively taken up with less efflux by doxorubicin-resistant MCF-7 breast cancer cells (MCF-7/ADR cells) than by the cells treated with the free drugs, single-drug-loaded nanoparticles, or non-biotin-decorated nanoparticles. BNDQ exhibited clear inhibition of both the activity and expression of P-glycoprotein in MCF-7/ADR cells. More importantly, it caused a significant reduction in doxorubicin resistance in MCF-7/ADR breast cancer cells both in vitro and in vivo, among all the groups. Overall, this study suggests that BNDQ has a potential role in the treatment of drug-resistant breast cancer.

  5. Antimicrobial Drugs in Fighting against Antimicrobial Resistance

    OpenAIRE

    Cheng, Guyue; Dai, Menghong; Ahmed, Saeed; Hao, Haihong; Wang, Xu; Yuan, Zonghui

    2016-01-01

    The outbreak of antimicrobial resistance, together with the lack of newly developed antimicrobial drugs, represents an alarming signal for both human and animal healthcare worldwide. Selection of rational dosage regimens for traditional antimicrobial drugs based on pharmacokinetic/pharmacodynamic principles as well as development of novel antimicrobials targeting new bacterial targets or resistance mechanisms are key approaches in tackling AMR. In addition to the cellular level resistance (i....

  6. Polyether ionophores: broad-spectrum and promising biologically active molecules for the control of drug-resistant bacteria and parasites.

    Science.gov (United States)

    Kevin Ii, Dion A; Meujo, Damaris Af; Hamann, Mark T

    2009-02-01

    As multidrug-resistant (MDR) pathogens continue to emerge, there is a substantial amount of pressure to identify new drug candidates. Carboxyl polyethers, also referred to as polyether antibiotics, are a unique class of compounds with outstanding potency against a variety of critical infectious disease targets including protozoa, bacteria and viruses. The characteristics of these molecules that are of key interest are their selectivity and high potency against several MDR etiological agents. Although many studies have been published about carboxyl polyether antibiotics, there are no recent reviews of this class of drugs. The purpose of this review is to provide the reader with an overview of the spectrum of activity of polyether antibiotics, their mechanism of action, toxicity and potential as drug candidates to combat drug-resistant infectious diseases. Polyether ionophores show a high degree of promise for the potential control of drug-resistant bacterial and parasitic infections. Despite the long history of use of this class of drugs, very limited medicinal chemistry and drug optimization studies have been reported, thus leaving the door open to these opportunities in the future. Scifinder and PubMed were the main search engines used to locate articles relevant to the topic presented in the present review. Keywords used in our search were specific names of each of the 88 compounds presented in the review as well as more general terms such as polyethers, ionophores, carboxylic polyethers and polyether antibiotics.

  7. Rapid molecular diagnostics for multi-drug resistant tuberculosis in India.

    Science.gov (United States)

    Ramachandran, Rajeswari; Muniyandi, M

    2018-03-01

    Rapid molecular diagnostic methods help in the detection of TB and Rifampicin resistance. These methods detect TB early, are accurate and play a crucial role in reducing the burden of drug resistant tuberculosis. Areas covered: This review analyses rapid molecular diagnostic tools used in the diagnosis of MDR-TB in India, such as the Line Probe Assay and GeneXpert. We have discussed the burden of MDR-TB and the impact of recent diagnostic tools on case detection and treatment outcomes. This review also discusses the costs involved in establishing these new techniques in India. Expert commentary: Molecular methods have considerable advantages for the programmatic management of drug resistant TB. These include speed, standardization of testing, potentially high throughput and reduced laboratory biosafety requirements. There is a desperate need for India to adopt modern, rapid, molecular tools with point-of-care tests being currently evaluated. New molecular diagnostic tests appear to be cost effective and also help in detecting missing cases. There is enough evidence to support the scaling up of these new tools in India.

  8. Trends of anti-tuberculosis drug resistance pattern in new cases and previously treated cases of extrapulmonary tuberculosis cases in referral hospitals in northern India

    Directory of Open Access Journals (Sweden)

    A K Maurya

    2012-01-01

    Full Text Available Background: Drug-resistant tuberculosis is one of major current challenges to global public health. The transmission of resistant strains is increasing as a burden of multidrug-resistant tuberculosis (MDR-TB patients in extra pulmonary tuberculosis (EPTB cases in India. Aim and Objectives: The aim was to study trends of anti-tuberculosis drug resistance pattern in new cases and previously treated cases of EPTB in referral hospitals in northern India. Study Design and Setting: A prospectively observational study and referral medical institutions in northern India. Materials and Methods: All EPTB specimens were processed for Ziehl Neelsen staining, BACTEC culture and BACTEC NAP test for Mycobacterium tuberculosis complex. All M. tuberculosis complex isolates were performed for radiometric-based drug susceptibility pattern against streptomycin, isoniazid, rifampicin and ethambutol using the 1% proportion method. Results: We found that 165/756 (20.5% isolates were identified as M. tuberculosis complex by the NAP test. We observed that 39.9% were resistant to first-line antitubercular drugs. The resistance rate was higher in previously treated patients: H (30.3%, R (16.3%, E (15.7% and S (16.3%. MDR-TB was observed in 13.4%, but, in new cases, this was 11.4% and 19.1% of the previously treated patients (P<0.05. Conclusion: MDR-TB is gradually increased in EPTB cases and predominant resistance to previous treated cases of EPTB. The molecular drug sensitivity test (DST method can be an early decision for chemotherapy in MDR-TB patients. The International Standards of TB Care need to be used by the RNTCP and professional medical associations as a tool to improve TB care in the country.

  9. Prevalence and occurrence rate of Mycobacterium tuberculosis Haarlem family multi-drug resistant in the worldwide population: A systematic review and meta-analysis

    Science.gov (United States)

    Ramazanzadeh, Rashid; Roshani, Daem; Shakib, Pegah; Rouhi, Samaneh

    2015-01-01

    Background: Transmission of Mycobacterium tuberculosis (M. tuberculosis) can occur in different ways. Furthermore, drug resistant in M. tuberculosis family is a major problem that creates obstacles in treatment and control of tuberculosis (TB) in the world. One of the most prevalent families of M. tuberculosis is Haarlem, and it is associated with drug resistant. Our objectives of this study were to determine the prevalence and occurrence rate of M. tuberculosis Haarlem family multi-drug resistant (MDR) in the worldwide using meta-analysis based on a systematic review that performed on published articles. Materials and Methods: Data sources of this study were 78 original articles (2002-2012) that were published in the literatures in several databases including PubMed, Science Direct, Google Scholar, Biological abstracts, ISI web of knowledge and IranMedex. The articles were systematically reviewed for prevalence and rate of MDR. Data were analyzed using meta-analysis and random effects models with the software package Meta R, Version 2.13 (P < 0.10). Results: Final analysis included 28601 persons in 78 articles. The highest and lowest occurrence rate of Haarlem family in M. tuberculosis was in Hungary in 2006 (66.20%) with negative MDR-TB and in China in 2010 (0.8%), respectively. From 2002 to 2012, the lowest rate of prevalence was in 2010, and the highest prevalence rate was in 2012. Also 1.076% were positive for MDR and 9.22% were negative (confidence interval: 95%).0020. Conclusion: Many articles and studies are performed in this field globally, and we only chose some of them. Further studies are needed to be done in this field. Our study showed that M. tuberculosis Haarlem family is prevalent in European countries. According to the presence of MDR that was seen in our results, effective control programs are needed to control the spread of drug-resistant strains, especially Haarlem family. PMID:25767526

  10. Prevalence and occurrence rate of Mycobacterium tuberculosis Haarlem family multi-drug resistant in the worldwide population: A systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Rashid Ramazanzadeh

    2015-01-01

    Full Text Available Background: Transmission of Mycobacterium tuberculosis (M. tuberculosis can occur in different ways. Furthermore, drug resistant in M. tuberculosis family is a major problem that creates obstacles in treatment and control of tuberculosis (TB in the world. One of the most prevalent families of M. tuberculosis is Haarlem, and it is associated with drug resistant. Our objectives of this study were to determine the prevalence and occurrence rate of M. tuberculosis Haarlem family multi-drug resistant (MDR in the worldwide using meta-analysis based on a systematic review that performed on published articles. Materials and Methods: Data sources of this study were 78 original articles (2002-2012 that were published in the literatures in several databases including PubMed, Science Direct, Google Scholar, Biological abstracts, ISI web of knowledge and IranMedex. The articles were systematically reviewed for prevalence and rate of MDR. Data were analyzed using meta-analysis and random effects models with the software package Meta R, Version 2.13 (P < 0.10. Results: Final analysis included 28601 persons in 78 articles. The highest and lowest occurrence rate of Haarlem family in M. tuberculosis was in Hungary in 2006 (66.20% with negative MDR-TB and in China in 2010 (0.8%, respectively. From 2002 to 2012, the lowest rate of prevalence was in 2010, and the highest prevalence rate was in 2012. Also 1.076% were positive for MDR and 9.22% were negative (confidence interval: 95%.0020. Conclusion: Many articles and studies are performed in this field globally, and we only chose some of them. Further studies are needed to be done in this field. Our study showed that M. tuberculosis Haarlem family is prevalent in European countries. According to the presence of MDR that was seen in our results, effective control programs are needed to control the spread of drug-resistant strains, especially Haarlem family.

  11. Quadruple-first line drug resistance in Mycobacterium tuberculosis in Vietnam: What can we learn from genes?

    Science.gov (United States)

    Nguyen, Huy Quang; Nguyen, Nhung Viet; Contamin, Lucie; Tran, Thanh Hoa Thi; Vu, Thuong Thi; Nguyen, Hung Van; Nguyen, Ngoc Lan Thi; Nguyen, Son Thai; Dang, Anh Duc; Bañuls, Anne-Laure; Nguyen, Van Anh Thi

    2017-06-01

    In Vietnam, a country with high tuberculosis (137/100.000 population) and multidrug-resistant (MDR)-TB burdens (7.8/100.000 population), little is known about the molecular signatures of drug resistance in general and more particularly of second line drug (SLD) resistance. This study is specifically focused on Mycobacterium tuberculosis isolates resistant to four first-line drugs (FLDs) that make TB much more difficult to treat. The aim is to determine the proportion of SLD resistance in these quadruple drug resistant isolates and the genetic determinants linked to drug resistance to better understand the genetic processes leading to quadruple and extremely drug resistance (XDR). 91 quadruple (rifampicin, isoniazid, ethambutol and streptomycin) FLD resistant and 55 susceptible isolates were included. Spoligotyping and 24-locus MIRU-VNTR techniques were performed and 9 genes and promoters linked to FLD and SLD resistance were sequenced. SLD susceptibility testing was carried out on a subsample of isolates. High proportion of quadruple-FLD resistant isolates was resistant to fluoroquinolones (27%) and second-line injectable drugs (30.2%) by drug susceptibility testing. The sequencing revealed high mutation diversity with prevailing mutations at positions katG315, inhA-15, rpoB531, embB306, rrs1401, rpsL43 and gyrA94. The sensitivity and specificity were high for most drug resistances (>86%), but the sensitivity was lower for injectable drug resistances (resistance. Nevertheless, particular mutation patterns linked to high-level resistance and low fitness costs seem to be favored. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Plasmodium falciparum drug resistance in Angola.

    Science.gov (United States)

    Fançony, Cláudia; Brito, Miguel; Gil, Jose Pedro

    2016-02-09

    Facing chloroquine drug resistance, Angola promptly adopted artemisinin-based combination therapy as the first-line to treat malaria. Currently, the country aims to consolidate malaria control, while preparing for the elimination of the disease, along with others African countries in the region. However, the remarkable capacity of Plasmodium to develop drug resistance represents an alarming threat for those achievements. Herein, the available, but relatively scarce and dispersed, information on malaria drug resistance in Angola, is reviewed and discussed. The review aims to inform but also to encourage future research studies that monitor and update the information on anti-malarial drug efficacy and prevalence of molecular markers of drug resistance, key fields in the context and objectives of elimination.

  13. Involvement of CUL4A in Regulation of Multidrug Resistance to P-gp Substrate Drugs in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Yunshan Wang

    2013-12-01

    Full Text Available CUL4A encodes a core component of a cullin-based E3 ubiquitin ligase complex that regulates many critical processes such as cell cycle progression, DNA replication, DNA repair and chromatin remodeling by targeting a variety of proteins for ubiquitination and degradation. In the research described in this report we aimed to clarify whether CUL4A participates in multiple drug resistance (MDR in breast cancer cells. We first transfected vectors carrying CUL4A and specific shCUL4A into breast cancer cells and corresponding Adr cells respectively. Using reverse transcription polymerase chain reactions and western blots, we found that overexpression of CUL4A in MCF7 and MDA-MB-468 cells up-regulated MDR1/P-gp expression on both the transcription and protein levels, which conferred multidrug resistance to P-gp substrate drugs, as determined by 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assays. On the other hand, silencing CUL4A in MCF7/Adr and MDA-MB-468/Adr cells led to the opposite effect. Moreover, ERK1/2 in CUL4A-overexpressing cells was highly activated and after treatment with PD98059, an ERK1/2-specific inhibitor, CUL4A-induced expression of MDR1/P-gp was decreased significantly. Lastly, immunohistochemistry in breast cancer tissues showed that P-gp expression had a positive correlation with the expression of CUL4A and ERK1/2. Thus, these results implied that CUL4A and ERK1/2 participated in multi-drug resistance in breast cancer through regulation of MDR1/P-gp expression.

  14. A meta-analysis of drug resistant tuberculosis in Sub-Saharan Africa: how strongly associated with previous treatment and HIV co-infection?

    Science.gov (United States)

    Berhan, Asres; Berhan, Yifru; Yizengaw, Desalegn

    2013-11-01

    In Sub-Saharan Africa, the fight against tuberculosis (TB) has encountered a great challenge because of the emergence of drug resistant TB strains and the high prevalence of HIV infection. The aim of this meta-analysis was to determine the association of drug-resistant TB with anti-TB drug treatment history and HIV co-infection. After electronic based literature search in the databases of Medline, HINARI, EMBASE and the Cochrane library, article selection and data extraction were carried out. HIV co-infection and previous history of TB treatment were used as predictors for the occurrence of any anti-TB drug resistant or multiple drug resistant TB (MDR-TB). The risk ratios for each included study and for the pooled sample were computed using the random-effects model. Heterogeneity test, sensitivity analyses and funnel plots were also done. The pooled analysis showed that the risk of developing drug-resistant TB to at least one anti-TB drug was about 3 times higher in individuals who had a previous history of anti-TB treatment than new TB cases. The risk of having MDR-TB in previously anti-TB treated TB cases was more than 5-fold higher than that of new TB cases. Resistance to Ethambutol and Rifampicin was more than fivefold higher among the previously treated with anti-TB drugs. However, HIV infection was not associated with drug-resistant TB. There was a strong association of previous anti-TB treatment with MDR-TB. Primary treatment warrants special emphasis, and screening for anti-TB drugs sensitivity has to be strengthened.

  15. The multidrug resistance 1 (MDR1) gene polymorphism G-rs3789243-A is not associated with disease susceptibility in Norwegian patients with colorectal adenoma and colorectal cancer; a case control study

    DEFF Research Database (Denmark)

    Andersen, V.; Agerstjerne, L.; Jensen, D.

    2009-01-01

    Background: Smoking, dietary factors, and alcohol consumption are known life style factors contributing to gastrointestinal carcinogenesis. Genetic variations in carcinogen handling may affect cancer risk. The multidrug resistance 1(MDR1/ABCB1) gene encodes the transport protein P-glycoprotein (a...... in inflammation, and may thereby affect the risk of malignity. Hence, genetic variations that modify the function of P-glycoprotein may be associated with the risk of colorectal cancer (CRC). We have previously found an association between the MDR1 intron 3 G-rs3789243-A polymorphism and the risk of CRC...... of colorectal carcinomas and adenomas in the Norwegian population was assessed in 167 carcinomas, 990 adenomas, and 400 controls. Genotypes were determined by allelic discrimination. Odds ratio (OR) and 95 confidence interval (95% CI) were estimated by binary logistic regression. Results: No association...

  16. Association between MDR1 gene polymorphisms and the risk of Crohn's disease in a cohort of Algerian pediatric patients.

    Science.gov (United States)

    Bouzidi, Amira; Mesbah-Amroun, Hamida; Boukercha, Aziza; Benhassine, Fadila; Belboueb, Réda; Berkouk, Karima; Messadi, Wassila; Touil-Boukoffa, Chafia

    2016-12-01

    The multi-drug resistance gene (MDR1) has raised increasing interest as a susceptibility gene for Crohn's disease (CD). The role of MDR1 single-nucleotide polymorphisms (SNPs) in the predisposition and behavior of CD in the pediatric population is still elusive. Here, we investigated whether SNPs in MDR1 are associated with CD in Algerian pediatric patients. A case-control study was conducted enrolling 47 pediatric CD patients and 100 controls. All subjects were genotyped for the most common MDR1 SNPs (C3434T, C1236T, and G2677A/T) using PCR-RFLP method. We also explored the association between polymorphisms and clinical sub-phenotypes. We have detected no significant association of C3435T SNP and pediatric CD. However, we observed a significantly higher frequency of the risk alleles, 1236T and 2677T/A among the CD patients compared to controls. Moreover, the risk allele 1236T was associated to a higher risk for resective surgery. Our data suggest that the C1236T and G2677A/T SNPs in the MDR1 gene are associated with CD and the C1236T risk allele with a more severe course of disease in Algerian pediatric patients. Further analysis using larger patients group and functional studies would be interesting to elucidate the role of MDR1 gene in pediatric CD.Pediatric Research (2016); doi:10.1038/pr.2016.163.

  17. Community-based management versus traditional hospitalization in treatment of drug-resistant tuberculosis: a systematic review and meta-analysis.

    Science.gov (United States)

    Williams, Abimbola Onigbanjo; Makinde, Olusesan Ayodeji; Ojo, Mojisola

    2016-01-01

    Multidrug drug resistant Tuberculosis (MDR-TB) and extensively drug resistant Tuberculosis (XDR-TB) have emerged as significant public health threats worldwide. This systematic review and meta-analysis aimed to investigate the effects of community-based treatment to traditional hospitalization in improving treatment success rates among MDR-TB and XDR-TB patients in the 27 MDR-TB High burden countries (HBC). We searched PubMed, Cochrane, Lancet, Web of Science, International Journal of Tuberculosis and Lung Disease, and Centre for Reviews and Dissemination (CRD) for studies on community-based treatment and traditional hospitalization and MDR-TB and XDR-TB from the 27 MDR-TB HBC. Data on treatment success and failure rates were extracted from retrospective and prospective cohort studies, and a case control study. Sensitivity analysis, subgroup analyses, and meta-regression analysis were used to explore bias and potential sources of heterogeneity. The final sample included 16 studies involving 3344 patients from nine countries; Bangladesh, China, Ethiopia, Kenya, India, South Africa, Philippines, Russia, and Uzbekistan. Based on a random-effects model, we observed a higher treatment success rate in community-based treatment (Point estimate = 0.68, 95 % CI: 0.59 to 0.76, p   18 months, and regimen with drugs >5 reported higher treatment success rate. In the meta-regression model, age of patients, adverse events, treatment duration, and lost to follow up explains some of the heterogeneity of treatment effects between studies. Community-based management improved treatment outcomes. A mix of interventions with DOTS-Plus throughout therapy and treatment duration > 18 months as well as strategies in place for lost to follow up and adverse events should be considered in MDR-TB and XDR-TB interventions, as they influenced positively, treatment success.

  18. In Vitro Evaluation of Linezolid and Meropenem Against Clinical Isolates of Multi Drug Resistant Tuberculosis By Mycobacterial Growth Indicator Tube (MGIT) 960

    International Nuclear Information System (INIS)

    Mirza, I. A.; Satti, L.; Khan, F. A.; Khan, K. A.

    2015-01-01

    Objective: To evaluate the in vitro effectiveness of multiple breakpoint concentrations of newer antituberculosis agents (Linezolid and Meropenem) against Multi Drug-Resistant Tuberculosis (MDR-TB) isolates. Study Design: Adescriptive cross-sectional study. Place and Duration of Study: Microbiology Department, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from September 2011 to August 2013. Methodology: Atotal of 100 MDR-TB isolates recovered during the study period were subjected to susceptibility testing against multiple breakpoint concentrations of Linezolid (LZD) and Meropenem (MER). The breakpoint concentration used for LZD were 0.5, 1.0 and 2.0 micro g/ml, while for MER were 4.0, 8.0 and 16 micro g/ml. Mycobacterial Growth Indicator Tube (MGIT) 960 system was used to carry out drug susceptibility testing as per recommended protocol. Results: At break point concentration of 0.5 micro g/ml, 80 out of 100 (80%) MDR-TB isolates were susceptible to LZD while at breakpoint concentration of 1.0 micro g/ml and 2.0 micro g/ml, 96/100, (96%) of MDR-TB isolates were susceptible. For MER, at breakpoint concentrations of 4.0 micro g/ml no MDR-TB isolate was susceptible, while at 8.0 micro g/ml 3/100, (3%) and at 16.0 micro g/ml 11/100, (11%) of MDR-TB isolates were susceptible. Conclusion: LZD was found to have excellent in vitroefficacy as 96% of MDR-TB isolates were susceptible at breakpoint concentration of 1.0 micro g/ml or more. In case of MER it was found that in vitrosusceptibility improved as the break point concentrations were increased. (author)

  19. Antibacterial and antibiotic resistance modifying activity of the extracts from Allanblackia gabonensis, Combretum molle and Gladiolus quartinianus against Gram-negative bacteria including multi-drug resistant phenotypes.

    Science.gov (United States)

    Fankam, Aimé G; Kuiate, Jules R; Kuete, Victor

    2015-06-30

    Bacterial resistance to antibiotics is becoming a serious problem worldwide. The discovery of new and effective antimicrobials and/or resistance modulators is necessary to tackle the spread of resistance or to reverse the multi-drug resistance. We investigated the antibacterial and antibiotic-resistance modifying activities of the methanol extracts from Allanblackia gabonensis, Gladiolus quartinianus and Combretum molle against 29 Gram-negative bacteria including multi-drug resistant (MDR) phenotypes. The broth microdilution method was used to determine the minimal inhibitory concentrations (MIC) and minimal bactericidal concentrations (MBC) of the samples meanwhile the standard phytochemical methods were used for the preliminary phytochemical screening of the plant extracts. Phytochemical analysis showed the presence of alkaloids, flavonoids, phenols and tannins in all studied extracts. Other chemical classes of secondary metabolites were selectively presents. Extracts from A. gabonensis and C. molle displayed a broad spectrum of activity with MICs varying from 16 to 1024 μg/mL against about 72.41% of the tested bacteria. The extract from the fruits of A. gabonensis had the best activity, with MIC values below 100 μg/mL on 37.9% of tested bacteria. Percentages of antibiotic-modulating effects ranging from 67 to 100% were observed against tested MDR bacteria when combining the leaves extract from C. molle (at MIC/2 and MIC/4) with chloramphenicol, kanamycin, streptomycin and tetracycline. The overall results of the present study provide information for the possible use of the studied plant, especially Allanblackia gabonensis and Combretum molle in the control of Gram-negative bacterial infections including MDR species as antibacterials as well as resistance modulators.

  20. Changing patterns of drug-resistant Shigella isolates in egypt.

    Science.gov (United States)

    Abd-Elmeged, Ghada M; Khairy, Rasha M; Abo-Eloyoon, Sahar M; Abdelwahab, Sayed F

    2015-06-01

    The emergence of multidrug resistance (MDR) is a serious problem in treating shigellosis. There are limited existing data examining the change in the antimicrobial resistance profile of Shigella in Egypt. We previously reported that 58% of the Shigella isolates in Egypt were resistant to at least one member of the three different antimicrobial groups. This study was performed to determine the antimicrobial resistance profile of Shigella, determine their possible mechanisms of resistance, and compare their resistance profile to those reported 20 years ago. Stool samples were collected from 500 subjects and processed for the isolation and identification of Shigella. The susceptibility of the isolates to 11 different antimicrobials was determined using the disc diffusion method. Of 500 stool cultures, 24 (4.8%) samples were positive for Shigella. There was a high percentage of resistance to ampicillin (88%), tetracycline (83%), and sulfamethoxazole-trimethoprim (75%). Also, there was a moderate percentage of resistance to chloramphenicol (46%), streptomycin (42%), ceftazidime (33%), and cefotaxime (25%). A lower percentage of resistance was recorded for amikacin, nalidixic acid (17% each), and ofloxacin (7%), while no resistance was found to ciprofloxacin (0%). Twenty-one of the isolates (88%) were resistant to at least three different antimicrobial groups (indicating MDR). The average number of antimicrobial agents to which the Shigella isolates were resistant was 4.3±1.4, while it was 3.4±1.5 in the same locality in 1994. These data demonstrate that there is a marked increase in MDR and change in the resistance patterns of Shigella over the past 20 years.

  1. Role of hypoxia-inducible factor-α in hepatitis-B-virus X protein-mediated MDR1 activation

    International Nuclear Information System (INIS)

    Han, Hyo-Kyung; Han, Chang Yeob; Cheon, Eun-Pa; Lee, Jaewon; Kang, Keon Wook

    2007-01-01

    The transition from chemotherapy-responsive cancer cells to chemotherapy-resistant cancer cells is mainly accompanied by the increased expression of multi-drug resistance 1 (MDR1). We found that hepatitis-B-virus X protein (HBx) increases the transcriptional activity and protein level of MDR1 in a hepatoma cell line, H4IIE. In addition, HBx overexpression made H4IIE cells more resistant to verapamil-uptake. HBx stabilized hypoxia-inducible factor-1α (HIF-1α) and induced the nuclear translocation of C/EBPβ. Reporter gene analyses showed that HBx increased the reporter activity in the cells transfected with the reporter containing MDR1 gene promoter. Moreover, the luciferase reporter gene activity was significantly inhibited by HIF-1α siRNA but not by overexpression of C/EBP dominant negative mutant. These results imply that HBx increases the MDR1 transporter activity through the transcriptional activation of the MDR1 gene with HIF-1α activation, and suggest HIF-1α for the therapeutic target of HBV-mediated chemoresistance

  2. Breed distribution of the nt230(del4) MDR1 mutation in dogs.

    Science.gov (United States)

    Gramer, Irina; Leidolf, Regina; Döring, Barbara; Klintzsch, Stefanie; Krämer, Eva-Maria; Yalcin, Ebru; Petzinger, Ernst; Geyer, Joachim

    2011-07-01

    A 4-bp deletion mutation associated with multiple drug sensitivity exists in the canine multidrug resistance (MDR1) gene. This mutation has been detected in more than 10 purebred dog breeds as well as in mixed breed dogs. To evaluate the breed distribution of this mutation in Germany, 7378 dogs were screened, including 6999 purebred and 379 mixed breed dogs. The study included dog breeds that show close genetic relationship or share breeding history with one of the predisposed breeds but in which the occurrence of the MDR1 mutation has not been reported. The breeds comprised Bearded Collies, Anatolian Shepherd Dog, Greyhound, Belgian Tervuren, Kelpie, Borzoi, Australian Cattle Dog and the Irish Wolfhound. The MDR1 mutation was not detected is any of these breeds, although it was found as expected in the Collie, Longhaired Whippet, Shetland Sheepdog, Miniature Australian Shepherd, Australian Shepherd, Wäller, White Swiss Shepherd, Old English Sheepdog and Border Collie with varying allelic frequencies for the mutant MDR1 allele of 59%, 45%, 30%, 24%, 22%, 17%, 14%, 4% and 1%, respectively. Allelic frequencies of 8% and 2% were determined in herding breed mixes and unclassified mixed breeds, respectively. Because of its widespread breed distribution and occurrence in many mixed breed dogs, it is difficult for veterinarians and dog owners to recognise whether MDR1-related drug sensitivity is relevant for an individual animal. This study provides a comprehensive overview of all affected dog breeds and many dog breeds that are probably unaffected on the basis of ∼15,000 worldwide MDR1 genotyping data. Copyright © 2010 Elsevier Ltd. All rights reserved.

  3. TTFields alone and in combination with chemotherapeutic agents effectively reduce the viability of MDR cell sub-lines that over-express ABC transporters

    International Nuclear Information System (INIS)

    Schneiderman, Rosa S; Shmueli, Esther; Kirson, Eilon D; Palti, Yoram

    2010-01-01

    Exposure of cancer cells to chemotherapeutic agents may result in reduced sensitivity to structurally unrelated agents, a phenomenon known as multidrug resistance, MDR. The purpose of this study is to investigate cell growth inhibition of wild type and the corresponding MDR cells by Tumor Treating Fields - TTFields, a new cancer treatment modality that is free of systemic toxicity. The TTFields were applied alone and in combination with paclitaxel and doxorubicin. Three pairs of wild type/MDR cell lines, having resistivity resulting from over-expression of ABC transporters, were studied: a clonal derivative (C11) of parental Chinese hamster ovary AA8 cells and their emetine-resistant sub-line Emt R1 ; human breast cancer cells MCF-7 and their mitoxantrone-resistant sub lines MCF-7/Mx and human breast cancer cells MDA-MB-231 and their doxorubicin resistant MDA-MB-231/Dox cells. TTFields were applied for 72 hours with and without the chemotherapeutic agents. The numbers of viable cells in the treated cultures and the untreated control groups were determined using the XTT assay. Student t-test was applied to asses the significance of the differences between results obtained for each of the three cell pairs. TTFields caused a similar reduction in the number of viable cells of wild type and MDR cells. Treatments by TTFields/drug combinations resulted in a similar increased reduction in cell survival of wild type and MDR cells. TTFields had no effect on intracellular doxorubicin accumulation in both wild type and MDR cells. The results indicate that TTFields alone and in combination with paclitaxel and doxorubicin effectively reduce the viability of both wild type and MDR cell sub-lines and thus can potentially be used as an effective treatment of drug resistant tumors

  4. Comparative study of isolates from community-acquired and catheter-associated urinary tract infections with reference to biofilm-producing property, antibiotic sensitivity and multi-drug resistance.

    Science.gov (United States)

    Bardoloi, Vishwajeet; Yogeesha Babu, K V

    2017-07-01

    Urinary tract infection (UTI) can be community-acquired (Com-UTI) or catheter-associated (CAUTI) and may be associated with biofilm-producing organisms. A comparative analysis of biofilm-producing property (BPP), antibiotic-sensitivity and multi-drug resistance (MDR) and their relation with the BPP of isolates from Com-UTI and CAUTI has not yet been performed and necessitated this study. (1) isolation of bacteria from CAUTI and Com-UTI and identification of their BPP, antibiotic-sensitivity and MDR status; (2) comparison of the isolates from CAUTI and Com-UTI as regards BPP, MDR status and their relation with BPP. isolates from 100 cases each of Com-UTI and CAUTI were subjected to Congo redagar (CRA) and Safranin tube tests. Antibiotic susceptibility was investigated using the disc diffusion method. Both groups were compared regarding BPP, drug sensitivity and MDR status. Statistical analyses were performed using χ2 and Fisher's exact tests. 76.19 % of isolates from Com-UTI and 60.72 % from CAUTI had BPP (P=0.0252; significant). The Safranin tube test detected more isolates with BPP than the CRA test. MDR is greater in CAUTI than Com-UTI (83.33 % versus 64.76 %; P=0.0039; significant). MDR is greater in isolates with BPP in both Com-UTI and CAUTI (76.47 and 62.35 %; non-significant). BPP was found in both Com-UTI and CAUTI. When used together, the Safranin tube test and the CRA test increased the sensitivity of detecting BPP. MDR was higher in CAUTI than Com-UTI. MDR and BPP are not interrelated or associated, especially in settings where it is not certain that isolates were obtained from a well-formed biofilm. However, this does not rule out a higher incidence or prevalence of MDR in isolates with BPP taken directly from the biofilms.

  5. MRJP1-containing glycoproteins isolated from honey, a novel antibacterial drug candidate with broad spectrum activity against multi-drug resistant clinical isolates

    Directory of Open Access Journals (Sweden)

    Katrina eBrudzynski

    2015-07-01

    Full Text Available The emergence of extended- spectrum β-lactamase (ESBL is the underlying cause of growing antibiotic resistance among Gram-negative bacteria to β-lactam antibiotics. We recently reported the discovery of honey glycoproteins (glps that exhibited a rapid, concentration-dependent antibacterial activity against both Gram-positive Bacillus subtilis and Gram-negative Escherichia coli that resembled action of cell wall-active β-lactam drugs. Glps showed sequence identity with the Major Royal Jelly Protein 1 (MRJP1 precursor that harbors three antimicrobial peptides: Jelleins 1, 2 and 4. Here, we used semi-quantitative radial diffusion assay and broth microdilution assay to evaluate susceptibility of a number of multi-drug resistant (MDR clinical isolates to the MRJP1-contaning honey glycoproteins. The MDR bacterial strains comprised 3 MRSA, 4 Pseudomonas aeruginosa, 2 Klebsiella pneumoniae, 2 VRE and 5 Extended-spectrum beta-lactamase (ESBL identified as 1 Proteus mirabilis, 3 Escherichia coli and 1 Escherichia coli NDM. Their resistance to different classes of antibiotics was confirmed using automated system Vitek 2. MDR isolates differred in their susceptibility to glps with MIC90 values ranging from 4.8μg/ml against B. subtilis to 14.4μg/ml against ESBL K. pneumoniae, Klebsiella spp ESBL and E. coli and up to 33μg/ml against highly resistant strains of P. aeruginosa. Glps isolated from different honeys showed a similar ability to overcome bacterial resistance to β-lactams suggesting that (a their mode of action is distinct from other classes of β-lactams and that (b the common glps structure was the lead structure responsible for the activity. The results of the current study together with our previous evidence of a rapid bactericidal activity of glps demonstrate that glps possess suitable characteristics to be considered a novel antibacterial drug candidate.

  6. Antibacterial effect of mango (Mangifera indica Linn.) leaf extract against antibiotic sensitive and multi-drug resistant Salmonella typhi.

    Science.gov (United States)

    Hannan, Abdul; Asghar, Samra; Naeem, Tahir; Ikram Ullah, Muhammad; Ahmed, Ijaz; Aneela, Syeda; Hussain, Shabbir

    2013-07-01

    Alternative herbal medicine has been used to treat various infections from centuries. Natural plants contain phytoconstituents having similar chemical properties as of synthetic antibiotics. Typhoid fever is a serious infection and failure of its treatment emerged multi-drug resistant (MDR) bugs of Salmonella typhi. Due to multiple and repeated issues with antibiotics efficacy, it became essential to evaluate biological properties of plants from different geographical origins. Mango leaves have been Reported for various medicinal effects like antioxidant, antimicrobial, antihelminthic, antidiabetic and antiallergic etc. Objective of present study was to investigate anti-typhoid properties of acetone mango leaf extract (AMLE) against antibiotic sensitive and MDR S. typhi isolates. A total of 50 isolates of S. typhi including MDR (n=30) and antibiotic sensitive (n=20) were investigated. Staphylococcus aureus (ATCC 25923) and Salmonella typhimurium (ATCC14028) were used as quality control strains. AMLE was prepared and its antibacterial activity was evaluated by agar well diffusion screening method and minimum inhibitory concentration (MIC), by agar dilution technique. Zone of inhibition (mm) of AMLE against MDR and antibiotic sensitive isolates was 18±1.5mm (Mean±S.D). Zone of S. aureus (ATCC 25923) and S. typhimurium (ATCC14028) was 20±1.5mm (Mean±S.D). MIC of AMLE was Reported in range from 10-50 mg/ml. The present study described the inhibitory effects of mango leaves against S. typhi.

  7. Promising therapy of XDR-TB/MDR-TB with thioridazine an inhibitor of bacterial efflux pumps

    DEFF Research Database (Denmark)

    Amaral, L; Martins, M; Viveiros, M

    2008-01-01

    -TB) - a M. tuberculosis organism that is resistant to the most effective second line drugs available for the treatment of TB. This review provides detailed, significant evidence that supports the use of an old neuroleptic compound, thioridazine (TZ), for the management of MDR-TB and XDR-TB infections...... therapy predictably ineffective and death is inevitable, compassionate therapy with TZ should be contemplated. The risks are small and the rewards great....

  8. Treatment outcomes of MDR-tuberculosis patients in Brazil: a retrospective cohort analysis

    Directory of Open Access Journals (Sweden)

    Mayara Lisboa Bastos

    2017-11-01

    Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDR-TB is a threat for the global TB epidemic control. Despite existing evidence that individualized treatment of MDR-TB is superior to standardized regimens, the latter are recommended in Brazil, mainly because drug-susceptibility tests (DST are often restricted to first-line drugs in public laboratories. We compared treatment outcomes of MDR-TB patients using standardized versus individualized regimens in Brazil, a high TB-burden, low resistance setting. Methods The 2007–2013 cohort of the national electronic database (SITE-TB, which records all special treatments including drug-resistance, was analysed. Patients classified as MDR-TB in SITE-TB were eligible. Treatment outcomes were classified as successful (cure/treatment completed or unsuccessful (failure/relapse/death/loss to follow-up. The odds for successful treatment according to type of regimen were controlled for demographic and clinical variables. Results Out of 4029 registered patients, we included 1972 recorded from 2010 to 2012, who had more complete outcome data. The overall success proportion was 60%. Success was more likely in non-HIV patients, sputum-negative at baseline, with unilateral disease and without prior DR-TB. Adjusted for these variables, those receiving standardized regimens had 2.7-fold odds of success compared to those receiving individualized treatments when failure/relapse were considered, and 1.4-fold odds of success when death was included as an unsuccessful outcome. When loss to follow-up was added, no difference between types of treatment was observed. Patients who used levofloxacin instead of ofloxacin had 1.5-fold odds of success. Conclusion In this large cohort of MDR-TB patients with a low proportion of successful outcomes, standardized regimens had superior efficacy than individualized regimens, when adjusted for relevant variables. In addition to the limitations of any retrospective observational

  9. Vital and dispensable roles of Plasmodium multidrug resistance transporters during blood- and mosquito-stage development.

    Science.gov (United States)

    Rijpma, Sanna R; van der Velden, Maarten; Annoura, Takeshi; Matz, Joachim M; Kenthirapalan, Sanketha; Kooij, Taco W A; Matuschewski, Kai; van Gemert, Geert-Jan; van de Vegte-Bolmer, Marga; Siebelink-Stoter, Rianne; Graumans, Wouter; Ramesar, Jai; Klop, Onny; Russel, Frans G M; Sauerwein, Robert W; Janse, Chris J; Franke-Fayard, Blandine M; Koenderink, Jan B

    2016-07-01

    Multidrug resistance (MDR) proteins belong to the B subfamily of the ATP Binding Cassette (ABC) transporters, which export a wide range of compounds including pharmaceuticals. In this study, we used reverse genetics to study the role of all seven Plasmodium MDR proteins during the life cycle of malaria parasites. Four P. berghei genes (encoding MDR1, 4, 6 and 7) were refractory to deletion, indicating a vital role during blood stage multiplication and validating them as potential targets for antimalarial drugs. Mutants lacking expression of MDR2, MDR3 and MDR5 were generated in both P. berghei and P. falciparum, indicating a dispensable role for blood stage development. Whereas P. berghei mutants lacking MDR3 and MDR5 had a reduced blood stage multiplication in vivo, blood stage growth of P. falciparum mutants in vitro was not significantly different. Oocyst maturation and sporozoite formation in Plasmodium mutants lacking MDR2 or MDR5 was reduced. Sporozoites of these P. berghei mutants were capable of infecting mice and life cycle completion, indicating the absence of vital roles during liver stage development. Our results demonstrate vital and dispensable roles of MDR proteins during blood stages and an important function in sporogony for MDR2 and MDR5 in both Plasmodium species. © 2016 John Wiley & Sons Ltd.

  10. A Prospective Study of Tuberculosis Drug Susceptibility in Sabah, Malaysia, and an Algorithm for Management of Isoniazid Resistance

    Science.gov (United States)

    Rashid Ali, Muhammad Redzwan S.; Parameswaran, Uma; William, Timothy; Bird, Elspeth; Wilkes, Christopher S.; Lee, Wai Khew; Yeo, Tsin Wen; Anstey, Nicholas M.; Ralph, Anna P.

    2015-01-01

    Introduction. The burden of tuberculosis is high in eastern Malaysia, and rates of Mycobacterium tuberculosis drug resistance are poorly defined. Our objectives were to determine M. tuberculosis susceptibility and document management after receipt of susceptibility results. Methods. Prospective study of adult outpatients with smear-positive pulmonary tuberculosis (PTB) in Sabah, Malaysia. Additionally, hospital clinicians accessed the reference laboratory for clinical purposes during the study. Results. 176 outpatients were enrolled; 173 provided sputum samples. Mycobacterial culture yielded M. tuberculosis in 159 (91.9%) and nontuberculous Mycobacterium (NTM) in three (1.7%). Among outpatients there were no instances of multidrug resistant M. tuberculosis (MDR-TB). Seven people (4.5%) had isoniazid resistance (INH-R); all were switched to an appropriate second-line regimen for varying durations (4.5–9 months). Median delay to commencement of the second-line regimen was 13 weeks. Among 15 inpatients with suspected TB, 2 had multidrug resistant TB (one extensively drug resistant), 2 had INH-R, and 4 had NTM. Conclusions. Current community rates of MDR-TB in Sabah are low. However, INH-resistance poses challenges, and NTM is an important differential diagnosis in this setting, where smear microscopy is the usual diagnostic modality. To address INH-R management issues in our setting, we propose an algorithm for the treatment of isoniazid-resistant PTB. PMID:25838829

  11. Potential antimicrobial agents for the treatment of multidrug-resistant tuberculosis

    NARCIS (Netherlands)

    Alsaad, Noor; Wilffert, Bob; van Altena, Richard; de Lange, Wiel C. M.; van der Werf, Tjip S.; Kosterink, Jos G. W.; Alffenaar, Jan-Willem C.

    2014-01-01

    Treatment of multidrug-resistant (MDR) tuberculosis (TB) is challenging because of the high toxicity of second-line drugs and the longer treatment duration than for drug-susceptible TB patients. In order to speed up novel treatment for MDR-TB, we suggest considering expanding the indications of

  12. Emergence of Extensively Drug Resistant Tuberculosis

    Centers for Disease Control (CDC) Podcasts

    2007-03-01

    Extensively drug-resistant tuberculosis (XDR TB) outbreaks have been reported in South Africa, and strains have been identified on 6 continents. Dr. Peter Cegielski, team leader for drug-resistant TB with the Division of Tuberculosis Elimination at CDC, comments on a multinational team's report on this emerging global public health threat.  Created: 3/1/2007 by Emerging Infectious Diseases.   Date Released: 3/26/2007.

  13. HIV resistance testing and detected drug resistance in Europe

    DEFF Research Database (Denmark)

    Schultze, Anna; Phillips, Andrew N; Paredes, Roger

    2015-01-01

    to Southern Europe. CONCLUSIONS: Despite a concurrent decline in virological failure and testing, drug resistance was commonly detected. This suggests a selective approach to resistance testing. The regional differences identified indicate that policy aiming to minimize the emergence of resistance......OBJECTIVES: To describe regional differences and trends in resistance testing among individuals experiencing virological failure and the prevalence of detected resistance among those individuals who had a genotypic resistance test done following virological failure. DESIGN: Multinational cohort...... study. METHODS: Individuals in EuroSIDA with virological failure (>1 RNA measurement >500 on ART after >6 months on ART) after 1997 were included. Adjusted odds ratios (aORs) for resistance testing following virological failure and aORs for the detection of resistance among those who had a test were...

  14. Drug-resistant tuberculosis in HIV-infected patients in a national referral hospital, Phnom Penh, Cambodia.

    Science.gov (United States)

    Walls, Genevieve; Bulifon, Sophie; Breysse, Serge; Daneth, Thol; Bonnet, Maryline; Hurtado, Northan; Molfino, Lucas

    2015-01-01

    There are no recent data on the prevalence of drug-resistant tuberculosis (DR TB) in Cambodia. We aim to describe TB drug resistance amongst adults with pulmonary and extra-pulmonary TB and human immunodeficiency virus (HIV) co-infection in a national referral hospital in Phnom Penh, Cambodia. Between 22 November 2007 and 30 November 2009, clinical specimens from HIV-infected patients suspected of having TB underwent routine microscopy, Mycobacterium tuberculosis culture, and drug susceptibility testing. Laboratory and clinical data were collected for patients with positive M. tuberculosis cultures. M. tuberculosis was cultured from 236 HIV-infected patients. Resistance to any first-line TB drug occurred in 34.7% of patients; 8.1% had multidrug resistant tuberculosis (MDR TB). The proportion of MDR TB amongst new patients and previously treated patients was 3.7 and 28.9%, respectively (pCambodia may be higher than previously recognised, particularly amongst HIV-infected patients. Additional prevalence studies are needed. This study also illustrates the feasibility and utility of analysis of non-respiratory specimens in the diagnosis of TB, even in low-resource settings, and suggests that extra-pulmonary specimens should be included in TB diagnostic algorithms.

  15. Beyond cellular detoxification: a plethora of physiological roles for MDR transporter homologs in plants

    Science.gov (United States)

    Remy, Estelle; Duque, Paula

    2014-01-01

    Higher plants possess a multitude of Multiple Drug Resistance (MDR) transporter homologs that group into three distinct and ubiquitous families—the ATP-Binding Cassette (ABC) superfamily, the Major Facilitator Superfamily (MFS), and the Multidrug And Toxic compound Extrusion (MATE) family. As in other organisms, such as fungi, mammals, and bacteria, MDR transporters make a primary contribution to cellular detoxification processes in plants, mainly through the extrusion of toxic compounds from the cell or their sequestration in the central vacuole. This review aims at summarizing the currently available information on the in vivo roles of MDR transporters in plant systems. Taken together, these data clearly indicate that the biological functions of ABC, MFS, and MATE carriers are not restricted to xenobiotic and metal detoxification. Importantly, the activity of plant MDR transporters also mediates biotic stress resistance and is instrumental in numerous physiological processes essential for optimal plant growth and development, including the regulation of ion homeostasis and polar transport of the phytohormone auxin. PMID:24910617

  16. Multidrug-resistant pathogens in the food supply.

    Science.gov (United States)

    Doyle, Marjorie E

    2015-04-01

    Antimicrobial resistance, including multidrug resistance (MDR), is an increasing problem globally. MDR bacteria are frequently detected in humans and animals from both more- and less-developed countries and pose a serious concern for human health. Infections caused by MDR microbes may increase morbidity and mortality and require use of expensive drugs and prolonged hospitalization. Humans may be exposed to MDR pathogens through exposure to environments at health-care facilities and farms, livestock and companion animals, human food, and exposure to other individuals carrying MDR microbes. The Centers for Disease Control and Prevention classifies drug-resistant foodborne bacteria, including Campylobacter, Salmonella Typhi, nontyphoidal salmonellae, and Shigella, as serious threats. MDR bacteria have been detected in both meat and fresh produce. Salmonellae carrying genes coding for resistance to multiple antibiotics have caused numerous foodborne MDR outbreaks. While there is some level of resistance to antimicrobials in environmental bacteria, the widespread use of antibiotics in medicine and agriculture has driven the selection of a great variety of microbes with resistance to multiple antimicrobials. MDR bacteria on meat may have originated in veterinary health-care settings or on farms where animals are given antibiotics in feed or to treat infections. Fresh produce may be contaminated by irrigation or wash water containing MDR bacteria. Livestock, fruits, and vegetables may also be contaminated by food handlers, farmers, and animal caretakers who carry MDR bacteria. All potential sources of MDR bacteria should be considered and strategies devised to reduce their presence in foods. Surveillance studies have documented increasing trends in MDR in many pathogens, although there are a few reports of the decline of certain multidrug pathogens. Better coordination of surveillance programs and strategies for controlling use of antimicrobials need to be implemented in

  17. Drug resistance in the mouse cancer clinic

    NARCIS (Netherlands)

    Rottenberg, Sven; Borst, Piet

    2012-01-01

    Drug resistance is one of the most pressing problems in treating cancer patients today. Local and regional disease can usually be adequately treated, but patients eventually die from distant metastases that have become resistant to all available chemotherapy. Although work on cultured tumor cell

  18. Malaria epidemic and drug resistance, Djibouti.

    Science.gov (United States)

    Rogier, Christophe; Pradines, Bruno; Bogreau, H; Koeck, Jean-Louis; Kamil, Mohamed-Ali; Mercereau-Puijalon, Odile

    2005-02-01

    Analysis of Plasmodium falciparum isolates collected before, during, and after a 1999 malaria epidemic in Djibouti shows that, despite a high prevalence of resistance to chloroquine, the epidemic cannot be attributed to a sudden increase in drug resistance of local parasite populations.

  19. Incorporating social justice and stigma in cost-effectiveness analysis: drug-resistant tuberculosis treatment.

    Science.gov (United States)

    Zwerling, A; Dowdy, D; von Delft, A; Taylor, H; Merritt, M W

    2017-11-01

    Novel therapies for multidrug-resistant tuberculosis (MDR-TB) are likely to be expensive. The cost of novel drugs (e.g., bedaquiline, delamanid) may be so prohibitively high that a traditional cost-effectiveness analysis (CEA) would rate regimens containing these drugs as not cost-effective. Traditional CEA may not appropriately account for considerations of social justice, and may put the most disadvantaged populations at greater risk. Using the example of novel drug regimens for MDR-TB, we propose a novel methodology, 'justice-enhanced CEA', and demonstrate how such an approach can simultaneously assess social justice impacts alongside traditional cost-effectiveness ratios. Justice-enhanced CEA, as we envision it, is performed in three steps: 1) systematic data collection about patients' lived experiences, 2) use of empirical findings to inform social justice assessments, and 3) incorporation of data-informed social justice assessments into a decision analytic framework that includes traditional CEA. These components are organized around a core framework of social justice developed by Bailey et al. to compare impacts on disadvantage not otherwise captured by CEA. Formal social justice assessments can produce three composite levels: 'expected not to worsen…', 'may worsen…', and 'expected to worsen clustering of disadvantage'. Levels of social justice impact would be assessed for each major type of outcome under each policy scenario compared. Social justice assessments are then overlaid side-by-side with cost-effectiveness assessments corresponding to each branch pathway on the decision tree. In conclusion, we present a 'justice-enhanced' framework that enables the incorporation of social justice concerns into traditional CEA for the evaluation of new regimens for MDR-TB.

  20. A co-delivery nanosystem of chemotherapeutics and DNAzyme overcomes cancer drug resistance and metastasis

    Science.gov (United States)

    Sun, Shu-Pin; Liu, Ching-Ping; Huang, I.-Ping; Chu, Chia-Hui; Chung, Ming-Fang; Cheng, Shih-Hsun; Lin, Shu-Yi; Lo, Leu-Wei

    2017-12-01

    Multidrug resistance (MDR) constitutes a major problem in the management of cancer and cancer metastasized from primary-source tumor causes cancer-related deaths. Our new approach is the co-delivery of chemotherapy drugs with a transcription-factor-targeting genetic agent to simultaneously inhibit the growth and metastasis of cancer cells. C-Jun is a transcription factor that regulates multidrug resistance-associated protein 1 (MRP1) pump efflux transcription and tumor metastasis. In this work, we reported that mesoporous silica nanoparticles (MSNs) can be functionalized to co-deliver doxorubicin (Dox) and DNAzyme (Dz) to increase cancer cell killing in an additive fashion. The MSNs were sequentially conjugated with Dox into the MSNs’ nanochannels and Dz onto the MSNs’ outermost surface to target c-Jun as the Dox@MSN-Dz co-delivery system. The Dox-resistant PC-3 cells treated with Dox@MSN-Dz efficiently enhanced the intracellular Dox concentration due to the abrogation of Dox-induced MRP1 expression through the downregulation of c-Jun expression by Dz. Additionally, significant reductions in invasion and migration related to metastasis were also observed in cells treated with Dox@MSN-Dz. Therefore, our results contribute new insight to the treatment of MDR combined metastatic cancer cells, worthwhile for studying its potential for development in clinical translation.

  1. First and second line drug resistance among treatment naïve pulmonary tuberculosis patients in a district under Revised National Tuberculosis Control Programme (RNTCP in New Delhi

    Directory of Open Access Journals (Sweden)

    Vithal Prasad Myneedu

    2015-12-01

    Full Text Available There is limited information of level of drug resistance to first-line and second line anti-tuberculosis agents in treatment naïve pulmonary tuberculosis (PTB patients from the Indian region. Therefore, the present prospective study was conducted to determine the antimicrobial susceptibility to first-line and second line anti-TB drug resistance in such patients. Sputum samples from consecutive treatment naïve PTB cases registered in Lala Ram Sarup (LRS district, under RNTCP containing 12 Directly Observed Treatment Centre’s (DOTS, were enrolled using cluster sampling technology. A total of 453 samples were received from July 2011 to June 2012. All samples were cultured on solid medium followed by drug susceptibility to first and second line anti-tubercular drugs as per RNTCP guidelines. Primary multi-drug resistance (MDR was found to be 18/453; (4.0%. Extensively drug resistance (XDR was found in one strain (0.2%, which was found to be resistant to other antibiotics. Data of drug resistant tuberculosis among treatment naïve TB patients are lacking in India. The presence of XDR-TB and high MDR-TB in small population studied, calls for conducting systematic multi-centric surveillance across the country.

  2. Pharmacokinetics of Pyrazinamide and Optimal Dosing Regimens for Drug-Sensitive and -Resistant Tuberculosis.

    Science.gov (United States)

    Chirehwa, Maxwell T; McIlleron, Helen; Rustomjee, Roxana; Mthiyane, Thuli; Onyebujoh, Philip; Smith, Peter; Denti, Paolo

    2017-08-01

    Pyrazinamide is used in the treatment of tuberculosis (TB) because its sterilizing effect against tubercle bacilli allows the shortening of treatment. It is part of standard treatment for drug-susceptible and drug-resistant TB, and it is being considered as a companion drug in novel regimens. The aim of this analysis was to characterize factors contributing to the variability in exposure and to evaluate drug exposures using alternative doses, thus providing evidence to support revised dosing recommendations for drug-susceptible and multidrug-resistant tuberculosis (MDR-TB). Pyrazinamide pharmacokinetic (PK) data from 61 HIV/TB-coinfected patients in South Africa were used in the analysis. The patients were administered weight-adjusted doses of pyrazinamide, rifampin, isoniazid, and ethambutol in fixed-dose combination tablets according to WHO guidelines and underwent intensive PK sampling on days 1, 8, 15, and 29. The data were interpreted using nonlinear mixed-effects modeling. PK profiles were best described using a one-compartment model with first-order elimination. Allometric scaling was applied to disposition parameters using fat-free mass. Clearance increased by 14% from the 1st day to the 29th day of treatment. More than 50% of patients with weight less than 55 kg achieved lower pyrazinamide exposures at steady state than the targeted area under the concentration-time curve from 0 to 24 h of 363 mg · h/liter. Among patients with drug-susceptible TB, adding 400 mg to the dose for those weighing 30 to 54 kg improved exposure. Average pyrazinamide exposure in different weight bands among patients with MDR-TB could be matched by administering 1,500 mg, 1,750 mg, and 2,000 mg to patients in the 33- to 50-kg, 51- to 70-kg, and greater than 70-kg weight bands, respectively. Copyright © 2017 American Society for Microbiology.

  3. The Prevalence of Drug-Resistant Tuberculosis in Mainland China: An Updated Systematic Review and Meta-Analysis.

    Science.gov (United States)

    Duan, Qionghong; Chen, Zi; Chen, Cong; Zhang, Zhengbin; Lu, Zhouqin; Yang, Yalong; Zhang, Lin

    2016-01-01

    In recent years, drug resistant tuberculosis (DR-TB) particularly the emergence of multi-drug-resistant tuberculosis (MDR-TB) has become a major public health issue. The most recent study regarding the prevalence of drug-resistant tuberculosis in mainland China was a meta-analysis published in 2011, and the subjects from the included studies were mostly enrolled before 2008, thus making it now obsolete. Current data on the national prevalence of DR-TB is needed. This review aims to provide a comprehensive and up-to-date assessment of the status of DR-TB epidemic in mainland China. A systematic review and meta-analysis of studies regarding the prevalence of drug-resistant tuberculosis in mainland China was performed. Pubmed/MEDLINE, EMBASE, the Cochrane central database, the Chinese Biomedical Literature Database and the China National Knowledge Infrastructure Database were searched for studies relevant to drug-resistant tuberculosis that were published between January 1, 2012 and May 18, 2015. Comprehensive Meta-Analysis (V2.2, Biostat) software was used to analyse the data. A total of fifty-nine articles, published from 2012 to 2015, were included in our review. The result of this meta-analysis demonstrated that among new cases, the rate of resistance to any drug was 20.1% (18.0%-22.3%; n/N = 7203/34314) and among retreatment cases, the rate was 49.8% (46.0%-53.6%; n/N = 4155/8291). Multi-drug resistance among new and retreatment cases was 4.8% (4.0%-5.7%; n/N = 2300/42946) and 26.3% (23.1%-29.7%; n/N = 3125/11589) respectively. The results were significantly heterogeneous (pdrug resistance patterns were found by subgroup analysis according to geographic areas, subject enrolment time, and methods of drug susceptibility test (DST). The prevalence of resistance to any drug evidently dropped for both new and retreatment cases, and multi-drug resistance declined among new cases but became more prevalent among retreatment cases compared to the data before 2008

  4. Antimicrobial and Herbal Drug Resistance in Enteric Bacteria Isolated from Faecal Droppings of Common House Lizard/Gecko (Hemidactylus frenatus

    Directory of Open Access Journals (Sweden)

    Bhoj R. Singh

    2013-01-01

    Full Text Available From 194 faecal dropping samples of common house geckos collected from offices (60, houses (88, integrated farm units (IFS,18 and hostels, guest houses, and dining rooms of different canteen/mess (HGM, 28, 326 bacterial isolates of enteric bacteria belonging to 17 genera and 34 species were detected. Escherichia coli were the most frequently (39 isolated followed by Citrobacter freundii (33, Klebsiella pneumonia (27, Salmonella indica (12, Enterobacter gergoviae (12, and Ent. agglomerans (11. Other important bacteria isolated from gecko droppings were Listonella damsela (2, Raoultella terrigena (3, S. salamae (2, S. houtenae (3, Edwardsiella tarda (4, Edwardsiella hoshinae (1, and Klebsiella oxytoca (2. Of the 223 isolates tested for antimicrobial drug sensitivity, 27 (12.1% had multiple drug resistance (MDR. None of the salmonellae or edwardsiellae had MDR however, MDR strains were significantly more common among Escherichia spp. (P=1.9×10-5 and isolates from IFS units (P=3.58×10-23. The most effective herbal drug, Ageratum conyzoides extract, inhibited growth of only 27.8% of strains tested followed by ethanolic extract of Zanthoxylum rhetsa (13.9%, eucalyptus oil (5.4%, patchouli oil (5.4%, lemongrass oil (3.6%, and sandalwood oil (3.1%, and Artemisia vulgaris essential oil (3.1%.

  5. Prevalence of drug-resistant tuberculosis and imputed burden in South Africa: a national and sub-national cross-sectional survey.

    Science.gov (United States)

    Ismail, Nazir Ahmed; Mvusi, Lindiwe; Nanoo, Ananta; Dreyer, Andries; Omar, Shaheed V; Babatunde, Sanni; Molebatsi, Thabo; van der Walt, Martie; Adelekan, Adeboye; Deyde, Varough; Ihekweazu, Chikwe; Madhi, Shabir A

    2018-04-20

    Globally, per-capita, South Africa reports a disproportionately high number of cases of multidrug-resistant (MDR) tuberculosis and extensively drug-resistant (XDR) tuberculosis. We sought to estimate the prevalence of resistance to tuberculosis drugs in newly diagnosed and retreated patients with tuberculosis provincially and nationally, and compared these with the 2001-02 estimates. A cross-sectional survey was done between June 15, 2012-June 14, 2014, using population proportionate randomised cluster sampling in the nine provinces in South Africa. 343 clusters were included, ranging between 31 and 48 per province. A patient was eligible for inclusion in the survey if he or she presented as a presumptive case during the intake period at a drug resistance survey enrolling facility. Consenting participants (≥18 years old) completed a questionnaire and had a sputum sample tested for resistance to first-line and second-line drugs. Analysis was by logistic regression with robust SEs, inverse probability weighted against routine data, and estimates were derived using a random effects model. 101 422 participants were tested in 2012-14. Nationally, the prevalence of MDR tuberculosis was 2·1% (95% CI 1·5-2·7) among new tuberculosis cases and 4·6% (3·2-6·0) among retreatment cases. The provincial point prevalence of MDR tuberculosis ranged between 1·6% (95% CI 0·9-2·9) and 5·1% (3·7-7·0). Overall, the prevalence of rifampicin-resistant tuberculosis (4·6%, 95% CI 3·5-5·7) was higher than the prevalence of MDR tuberculosis (2·8%, 2·0-3·6; p=0·01). Comparing the current survey with the previous (2001-02) survey, the overall MDR tuberculosis prevalence was 2·8% versus 2·9% and prevalance of rifampicin-resistant tuberculosis was 3·4% versus 1·8%, respectively. The prevalence of isoniazid mono-resistant tuberculosis was above 5% in all provinces. The prevalence of ethionamide and pyrazinamide resistance among MDR tuberculosis cases was 44·7% (95% CI 25

  6. Streptococcus pneumoniae Drugs Resistance in Acute Rhinosinusitis

    Directory of Open Access Journals (Sweden)

    Chong Jie Hao

    2016-03-01

    Full Text Available Background: Acute rhinosinusitis that usually caused by Streptococcus pneumoniae becomes the reason why patients seek for medical care. Drugs resistance in Streptococcus pneumoniae is increasing worldwide. This study was conducted to determine drugs resistance of Streptococcus pneumonia from acute rhinosinusitis in Dr. Hasan Sadikin General Hospital. Methods: A descriptive laboratory study was conducted in June–October 2014 at the Laboratory of Microbiology Faculty of Medicine Universitas Padjadjaran. The sample was taken using nasopharyngeal swabbing from 100 acute rhinosinusitis patients in Dr. Hasan Sadikin General Hospital and planted on tryptic soy agar containing 5% sheep blood and 5 μg/ml of gentamicin sulphate and then incubated in 5% CO2 incubator at 37°C for 24 hours. The identification of Streptococcus pneumonia was performed by optochin test. The susceptibility test against Streptococcus pneumoniae was done using disk diffusion method.The antibiotic disks were trimethoprim-sulfamethoxazole, oxacillin, levofloxacin, azithromycin, and doxycycline. Results: Out of 100 samples, 8 of them were tested positive for Streptococcus pneumoniae. Three of Streptococcus pneumoniae isolates died with unknown reason after it were stored at -80 .The drugs resistance test showed the resistance of Streptococcus pneumonia to oxacillin, azithromycin and trimethoprim were 6, whereas levofloxacin and doxycycline are 4. Conclusions: Streptococcus pneumonia drugs resistance in acute rhinosinusitis shows the resistance of Streptococcus pneumoniae to oxacillin, azithromycin and trimethoprim are 6, whereas the resistance to levofloxacin and doxycycline are 4.

  7. Cost-Effectiveness of a Model Infection Control Program for Preventing Multi-Drug-Resistant Organism Infections in Critically Ill Surgical Patients.

    Science.gov (United States)

    Jayaraman, Sudha P; Jiang, Yushan; Resch, Stephen; Askari, Reza; Klompas, Michael

    2016-10-01

    Interventions to contain two multi-drug-resistant Acinetobacter (MDRA) outbreaks reduced the incidence of multi-drug-resistant (MDR) organisms, specifically methicillin-resistant Staphylococcus aureus, vancomycin-resistant Enterococcus, and Clostridium difficile in the general surgery intensive care unit (ICU) of our hospital. We therefore conducted a cost-effective analysis of a proactive model infection-control program to reduce transmission of MDR organisms based on the practices used to control the MDRA outbreak. We created a model of a proactive infection control program based on the 2011 MDRA outbreak response. We built a decision analysis model and performed univariable and probabilistic sensitivity analyses to evaluate the cost-effectiveness of the proposed program compared with standard infection control practices to reduce transmission of these MDR organisms. The cost of a proactive infection control program would be $68,509 per year. The incremental cost-effectiveness ratio (ICER) was calculated to be $3,804 per aversion of transmission of MDR organisms in a one-year period compared with standard infection control. On the basis of probabilistic sensitivity analysis, a willingness-to-pay (WTP) threshold of $14,000 per transmission averted would have a 42% probability of being cost-effective, rising to 100% at $22,000 per transmission averted. This analysis gives an estimated ICER for implementing a proactive program to prevent transmission of MDR organisms in the general surgery ICU. To better understand the causal relations between the critical steps in the program and the rate reductions, a randomized study of a package of interventions to prevent healthcare-associated infections should be considered.

  8. Effectiveness and safety of imipenem/clavulanate and linezolid to treat multidrug and extensively drug-resistant tuberculosis at a referral hospital in Brazil

    Directory of Open Access Journals (Sweden)

    M.A. Arbex

    2016-11-01

    Full Text Available Evidence on effectiveness, safety, and tolerability of imipenem/clavulanate (IC and linezolid containing regimens to treat multidrug-resistant (MDR- and extensively drug-resistant tuberculosis (XDR-TB is scarce. The aim of this observational study is to evaluate the therapeutic contribution of IC and linezolid to manage MDR/XDR-TB cases at the reference centre of São Paulo state, Brazil. Twelve patients (9 males, 1 HIV positive in antiretroviral treatment, 4 MDR, 8 XDR were treated with IC, 11 of them within linezolid-containing regimens. They all were previously treated with treatment failure, for a median (IQR, interquartile range of 4.5 (2–6.5 times, having a severe resistance pattern (median number of resistances: 7 (5–8 and being sputum smear and culture positive. IC and linezolid were prescribed at the dose of 1000 mg/day and 600 mg/day, respectively. The overall exposure was (median (IQR 419 (375.5–658 days for IC and 678 (392–720 days for linezolid. All of them converted their sputum (time to sputum conversion; 60 (37.5–90 days and culture (75 (60–135 days, and 7 were cured while 5 are still on treatment with a gradually improving clinical picture.While no adverse events were reported for IC, 2 minor side effects, only, were attributed to linezolid (17%; in both cases the drug was re-started without further problems. Our study suggests that IC and linezolid-containing regimens can be used safely and with satisfactory outcomes in reference centres to treat MDR/XDR-TB patients. Keywords: MDR-TB, XDR-TB, Imipenem, Linezolid, Effectiveness, Safety, Tolerability

  9. Antimicrobial Drug Resistance and Gonorrhea

    Centers for Disease Control (CDC) Podcasts

    2017-12-26

    Dr. Robert Kirkcaldy, a medical officer at CDC, discusses his article on antimicrobial resistance and gonorrhea.  Created: 12/26/2017 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 12/26/2017.

  10. The risk of global epidemic replacement with drug-resistant Mycobacterium tuberculosis strains

    Directory of Open Access Journals (Sweden)

    Emma S. McBryde

    2017-03-01

    Results and conclusions: The ability of MDR-TB to dominate DS-TB was highly sensitive to the relative transmissibility of the resistant strain; however, MDR-TB could dominate even when its transmissibility was modestly reduced (to between 50% and 100% as transmissible as the DS-TB strain. This model suggests that it may take decades or more for strain replacement to occur. It was also found that while the amplification of resistance is the early cause of MDR-TB, this will rapidly give way to person-to-person transmission.

  11. HIV-1 integrase inhibitors are substrates for the multidrug transporter MDR1-P-glycoprotein

    Directory of Open Access Journals (Sweden)

    Cara Andrea

    2007-03-01

    Full Text Available Abstract Background The discovery of diketoacid-containing derivatives as inhibitors of HIV-1 Integrase (IN (IN inhibitors, IINs has played a major role in validating this enzyme as an important target for antiretroviral therapy. Since the in vivo efficacy depends on access of these drugs to intracellular sites where HIV-1 replicates, we determined whether the IINs are recognized by the multidrug transporter MDR1-P-glycoprotein (P-gp thereby reducing their intracellular accumulation. To address the effect of IINs on drug transport, nine quinolonyl diketo acid (DKA derivatives active on the HIV-1 IN strand transfer (ST step and with EC50 ranging from 1.83 to >50 μm in cell-based assays were tested for their in vitro interaction with P-gp in the CEM-MDR cell system. IINs were investigated for the inhibition and induction of the P-gp function and expression as well as for multidrug resistance (MDR reversing ability. Results The HIV-1 IINs act as genuine P-gp substrates by inhibiting doxorubicin efflux and inducing P-gp functional conformation changes as evaluated by the modulation of UIC2 mAb epitope. Further, IINs chemosensitize MDR cells to vinblastine and induce P-gp expression in drug sensitive revertants of CEM-MDR cells. Conclusion To our knowledge, this is the first demonstration that HIV-1 IINs are P-gp substrates. This biological property may influence the absorption, distribution and elimination of these novels anti HIV-1 compounds.

  12. Emergence of rifampicin, tigecycline, and colistin-resistant Acinetobacter baumannii in Iran; spreading of MDR strains of novel International Clone variants.

    Science.gov (United States)

    Bahador, Abbas; Taheri, Mohammad; Pourakbari, Babak; Hashemizadeh, Zahra; Rostami, Hossein; Mansoori, Noormohamad; Raoofian, Reza

    2013-10-01

    Multidrug-resistant Acinetobacter baumannii infections are serious challenges for clinicians because of A. baumannii propensity to acquire resistance to a wide spectrum of antimicrobial agents. In this study, 91 A. baumannii isolates from patients in tertiary intensive care units of three university hospitals in the north, central, and south of Iran were selected and tested for susceptibility to 22 antimicrobials; amplified restriction fragment polymorphism and multiplex polymerase chain reaction methods were used to determine genetic relationships and International Clone (IC) of A. baumannii isolates, respectively. Twenty-four genotypes were identified in A. baumannii isolates. About 91.2% of isolates categorized into 4 distinct clusters; one was more heterogeneous and observed across the three locations. A considerable number of the isolates (27.5%) belonged to the novel IC variant, sequence group 7 (SG7), which was geographically widespread in three locations. The drug resistance pattern showed that 14.2%, 20%, and 77% of the A. baumannii isolates were resistant to colistin, tigecycline, and rifampicin, respectively. Nine percent of isolates (8) showed simultaneous resistance to colistin, rifampicin, and tigecycline. Interestingly, all of them were susceptible to ampicillin-sulbactam and/or tobramycin. According to our results, SG7 could be considered as a pan-Iranian clone.

  13. High Frequency of a Single Nucleotide Substitution (c.-6-180T>G) of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

    OpenAIRE

    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

    2013-01-01

    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type...

  14. Characterization of a Novel 99mTc-Carbonyl Complex as a Functional Probe of MDR1 P-Glycoprotein Transport Activity

    Directory of Open Access Journals (Sweden)

    Mary Dyszlewski

    2002-01-01

    Full Text Available Multidrug resistance (MDR mediated by overexpression of MDR1 P-glycoprotein (Pgp is one of the best characterized barriers to chemotherapy in cancer patients. Furthermore, the protective function of Pgp-mediated efflux of xenobiotics in various organs has a profound effect on the bioavailability of drugs in general. Thus, there is an expanding requirement to noninvasively interrogate Pgp transport activity in vivo. We herein report the Pgp recognition properties of a novel 99mTc(I-tricarbonyl complex, [99mTc(CO3(MIBI3] + (Tc-CO-MIBI. Tc-CO-MIBI showed 60-fold higher accumulation in drug-sensitive KB 3–1 cells compared to colchicine-selected drug-resistant KB 8-5 cells. In KB 8-5 cells, tracer enhancement was observed with the potent MDR modulator LY335979 (EC50 = 62 nM. Similar behavior was observed using drug-sensitive MCF-7 breast adenocarcinoma cells and MCF-7/MDR1 stable transfectants, confirming that Tc-CO-MIBI is specifically excluded by overexpression of MDR1 Pgp. By comparison, net accumulation in control H69 lung tumor cells was 9-fold higher than in MDR-associated protein (MRP1-expressing H69AR cells, indicating only modest transport by MRP1. Biodistribution analysis following tail vein injection of Tc-CO-MIBI showed delayed liver clearance as well as enhanced brain uptake and retention in mdr1a/1b(−/− gene deleted mice versus wild-type mice, directly demonstrating that Tc-CO-MIBI is a functional probe of Pgp transport activity in vivo.

  15. Role of drug transporters and drug accumulation in the temporal acquisition of drug resistance

    International Nuclear Information System (INIS)

    Hembruff, Stacey L; Laberge, Monique L; Villeneuve, David J; Guo, Baoqing; Veitch, Zachary; Cecchetto, Melanie; Parissenti, Amadeo M

    2008-01-01

    Anthracyclines and taxanes are commonly used in the treatment of breast cancer. However, tumor resistance to these drugs often develops, possibly due to overexpression of drug transporters. It remains unclear whether drug resistance in vitro occurs at clinically relevant doses of chemotherapy drugs and whether both the onset and magnitude of drug resistance can be temporally and causally correlated with the enhanced expression and activity of specific drug transporters. To address these issues, MCF-7 cells were selected for survival in increasing concentrations of doxorubicin (MCF-7 DOX-2 ), epirubicin (MCF-7 EPI ), paclitaxel (MCF-7 TAX-2 ), or docetaxel (MCF-7 TXT ). During selection cells were assessed for drug sensitivity, drug uptake, and the expression of various drug transporters. In all cases, resistance was only achieved when selection reached a specific threshold dose, which was well within the clinical range. A reduction in drug uptake was temporally correlated with the acquisition of drug resistance for all cell lines, but further increases in drug resistance at doses above threshold were unrelated to changes in cellular drug uptake. Elevated expression of one or more drug transporters was seen at or above the threshold dose, but the identity, number, and temporal pattern of drug transporter induction varied with the drug used as selection agent. The pan drug transporter inhibitor cyclosporin A was able to partially or completely restore drug accumulation in the drug-resistant cell lines, but had only partial to no effect on drug sensitivity. The inability of cyclosporin A to restore drug sensitivity suggests the presence of additional mechanisms of drug resistance. This study indicates that drug resistance is achieved in breast tumour cells only upon exposure to concentrations of drug at or above a specific selection dose. While changes in drug accumulation and the expression of drug transporters does occur at the threshold dose, the magnitude of

  16. Mdr65 decreases toxicity of multiple insecticides in Drosophila melanogaster.

    Science.gov (United States)

    Sun, Haina; Buchon, Nicolas; Scott, Jeffrey G

    2017-10-01

    ABC transporters are ubiquitous membrane-bound proteins, present in both prokaryotes and eukaryotes. The major function of eukaryotic ABC transporters is to mediate the efflux of a variety of substrates (including xenobiotics) out of cells. ABC transporters have been widely investigated in humans, particularly for their involvement in multidrug resistance (MDR). Considerably less is known about their roles in transport and/or excretion in insects. ABC transporters are only known to function as exporters in insects. Drosophila melanogaster has 56 ABC transporter genes, including eight which are phylogenetically most similar to the human Mdr genes (ABCB1 clade). We investigated the role of ABC transporters in the ABCB1 clade in modulating the susceptibility to insecticides. We took advantage of the GAL4/UAS system in D. melanogaster to knockdown the expression levels of Mdr65, Mdr50, Mdr49 and ABCB6 using transgenic UAS-RNAi lines and conditional driver lines. The most notable effects were increased sensitivities to nine different insecticides by silencing of Mdr65. Furthermore, a null mutation of Mdr65 decreased the malathion, malaoxon and fipronil LC 50 values by a factor of 1.9, 2.1 and 3.9, respectively. Altogether, this data demonstrates the critical role of ABC transporters, particularly Mdr65, in altering the toxicity of specific, structurally diverse, insecticides in D. melanogaster. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. La resistencia a múltiples fármacos: una amenaza para el control de la tuberculosis Multiple drug resistance: a threat for tuberculosis control

    Directory of Open Access Journals (Sweden)

    Ernesto Montoro Cardoso

    2004-07-01

    Full Text Available Drug-resistant tuberculosis (TB was reported soon after the introduction of streptomycin, although it did not receive major attention until recently. It was not considered a major issue in the industrialized world until outbreaks of multidrug-resistant TB (MDR-TB were reported among HIV infected people. Administration of standard short-course chemotherapy (SSCC with first-line drugs under directly observed therapy (DOT is the cornerstone of modern TB control. Unfortunately, data available on the treatment outcome of MDR-TB cases under routine programmatic conditions suggest that patients with MDR-TB respond poorly to SSCC with first-line drugs. Since 1994, the World Health Organization and the International Union Against Tuberculosis and Lung Disease (IUATLD have conducted anti-TB drug resistance surveys through a network of subregional laboratories and researchers. Drug resistance was present in almost all settings surveyed, and prevalence varied widely across regions. High prevalence of MDR-TB is widespread in the Russian Federation and areas of the former Soviet Union (Estonia, Kazakhstan, Latvia, and Lithuania as well as Israel, Liaoning and Henan Provinces in China, and Ecuador. The Global Project has surveyed areas representing over one third of notified TB cases. However, enormous gaps still exist in the most crucial areas. The most effective strategy to prevent the emergence of drug resistance is through implementation of the directly observed treatment short (DOTS strategy. Effective implementation of the DOTS strategy saves lives through decreased TB transmission, decreased risk of emergence of drug- resistance, and decreased risk for individual TB patients of treatment failure, TB relapse, and death. The World Bank recognizes the DOTS strategy as one of the most cost-effective health interventions, and recommends that effective TB treatment be a part of the essential clinical services package available in primary health care settings

  18. Management of MDR-TB in HIV co-infected patients in Eastern Europe

    DEFF Research Database (Denmark)

    Efsen, A M W; Schultze, A; Miller, R F

    2018-01-01

    below the target of 90%, reflecting the challenging patient population and the environment in which health care is provided. Urgent improvement of management of patients with TB/HIV in EE, in particular for those with MDR-TB, is needed and includes widespread access to rapid TB diagnostics, better......OBJECTIVES: Mortality among HIV patients with tuberculosis (TB) remains high in Eastern Europe (EE), but details of TB and HIV management remain scarce. METHODS: In this prospective study, we describe the TB treatment regimens of patients with multi-drug resistant (MDR) TB and use of antiretroviral...... access to and use of second-line TB drugs, timely ART initiation with viral load monitoring, and integration of TB/HIV care....

  19. Single photon emission computed tomography imaging using 99Tcm-methoxyisobutylisonitrile predict the multi-drug resistance and chemotherapy efficacy of lung cancer

    International Nuclear Information System (INIS)

    Zhang Yiqiu; Shi Hongcheng

    2008-01-01

    Chemotherapy is one of the main comprehensive treatments for lung cancer, especially for non-small cell lung cancer (NSCIC) Multi-drug resistance of lung cancer plays an important role in the failure of chemotherapy. Early detection of multi-drug resistance (MDR) is essential for choosing a suitable chemotherapy regimen for the patients of lung cancer. In recent years lots of literature reports that MDR of lung cancer is related to many kinds of multi-drug resistance protein (MRP) expression in lung cancer. Some lipophilic chemotherapy drugs and 99 Tc m -methoxyisobutylisonitrile( 99 Tc m -MIBI)may be the same substrate for some MRP. These MRP can transport them out of the tumor cells, then the chemotherapy is invalid or non-radioactive concentration. The retention of 99 Tc m -MIBI in tumor cells is correlated with the expression of MRP, thus the prediction of the MRP expression before chemotherapy or monitoring MRP expression changes in the process of chemotherapy by using the noninvasive 99 Tc m -MIBI single photon emission computed tomography imaging is helpful to predict the MDR and chemotherapy efficacy of lung cancer. (authors)

  20. Thermoresponsive Supramolecular Chemotherapy by "V"-Shaped Armed β-Cyclodextrin Star Polymer to Overcome Drug Resistance.

    Science.gov (United States)

    Fan, Xiaoshan; Cheng, Hongwei; Wang, Xiaoyuan; Ye, Enyi; Loh, Xian Jun; Wu, Yun-Long; Li, Zibiao

    2018-04-01

    Pump mediated drug efflux is the key reason to result in the failure of chemotherapy. Herein, a novel star polymer β-CD-v-(PEG-β-PNIPAAm) 7 consisting of a β-CD core, grafted with thermo-responsive poly(N-isopropylacrylamide) (PNIPAAm) and biocompatible poly(ethylene glycol) (PEG) in the multiple "V"-shaped arms is designed and further fabricated into supramolecular nanocarriers for drug resistant cancer therapy. The star polymer could encapsulate chemotherapeutics between β-cyclodextrin and anti-cancer drug via inclusion complex (IC). Furthermore, the temperature induced chain association of PNIPAAm segments facilitated the IC to form supramolecular nanoparticles at 37 °C, whereas the presence of PEG impart great stability to the self-assemblies. When incubated with MDR-1 membrane pump regulated drug resistant tumor cells, much higher and faster cellular uptake of the supramolecular nanoparticles were detected, and the enhanced intracellular retention of drugs could lead to significant inhibition of cell growth. Further in vivo evaluation showed high therapeutic efficacy in suppressing drug resistant tumor growth without a significant impact on the normal functions of main organs. This work signifies thermo-responsive supramolecular chemotherapy is promising in combating pump mediated drug resistance in both in vitro and in vivo models, which may be encouraging for the advanced drug delivery platform design to overcome drug resistant cancer. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Radiosensitivity of drug-resistant human tumour xenografts

    International Nuclear Information System (INIS)

    Mattern, J.; Bak, M. Jr.; Volm, M.; Hoever, K.H.

    1989-01-01

    The radiosensitivity of three drug-resistant sublines of a human epidermoid lung carcinoma growing as xenografts in nude mice was investigated. Drug resistance to vincristine, actinomycin D and cisplatin was developed in vivo by repeated drug treatment. It was found that all three drug-resistant tumour lines were not cross-resistant to irradiation. (orig.) [de

  2. Unraveling Mycobacterium tuberculosis genomic diversity and evolution in Lisbon, Portugal, a highly drug resistant setting

    KAUST Repository

    Perdigão, João

    2014-11-18

    Background Multidrug- (MDR) and extensively drug resistant (XDR) tuberculosis (TB) presents a challenge to disease control and elimination goals. In Lisbon, Portugal, specific and successful XDR-TB strains have been found in circulation for almost two decades. Results In the present study we have genotyped and sequenced the genomes of 56 Mycobacterium tuberculosis isolates recovered mostly from Lisbon. The genotyping data revealed three major clusters associated with MDR-TB, two of which are associated with XDR-TB. Whilst the genomic data contributed to elucidate the phylogenetic positioning of circulating MDR-TB strains, showing a high predominance of a single SNP cluster group 5. Furthermore, a genome-wide phylogeny analysis from these strains, together with 19 publicly available genomes of Mycobacterium tuberculosis clinical isolates, revealed two major clades responsible for M/XDR-TB in the region: Lisboa3 and Q1 (LAM). The data presented by this study yielded insights on microevolution and identification of novel compensatory mutations associated with rifampicin resistance in rpoB and rpoC. The screening for other structural variations revealed putative clade-defining variants. One deletion in PPE41, found among Lisboa3 isolates, is proposed to contribute to immune evasion and as a selective advantage. Insertion sequence (IS) mapping has also demonstrated the role of IS6110 as a major driver in mycobacterial evolution by affecting gene integrity and regulation. Conclusions Globally, this study contributes with novel genome-wide phylogenetic data and has led to the identification of new genomic variants that support the notion of a growing genomic diversity facing both setting and host adaptation.

  3. Exosomes derived from human mesenchymal stem cells confer drug resistance in gastric cancer.

    Science.gov (United States)

    Ji, Runbi; Zhang, Bin; Zhang, Xu; Xue, Jianguo; Yuan, Xiao; Yan, Yongmin; Wang, Mei; Zhu, Wei; Qian, Hui; Xu, Wenrong

    2015-08-03

    Mesenchymal stem cells (MSCs) play an important role in chemoresistance. Exosomes have been reported to modify cellular phenotype and function by mediating cell-cell communication. In this study, we aimed to investigate whether exosomes derived from MSCs (MSC-exosomes) are involved in mediating the resistance to chemotherapy in gastric cancer and to explore the underlying molecular mechanism. We found that MSC-exosomes significantly induced the resistance of gastric cancer cells to 5-fluorouracil both in vivo and ex vivo. MSC-exosomes antagonized 5-fluorouracil-induced apoptosis and enhanced the expression of multi-drug resistance associated proteins, including MDR, MRP and LRP. Mechanistically, MSC-exosomes triggered the activation of calcium/calmodulin-dependent protein kinases (CaM-Ks) and Raf/MEK/ERK kinase cascade in gastric cancer cells. Blocking the CaM-Ks/Raf/MEK/ERK pathway inhibited the promoting role of MSC-exosomes in chemoresistance. Collectively, MSC-exosomes could induce drug resistance in gastric cancer cells by activating CaM-Ks/Raf/MEK/ERK pathway. Our findings suggest that MSC-exosomes have profound effects on modifying gastric cancer cells in the development of drug resistance. Targeting the interaction between MSC-exosomes and cancer cells may help improve the efficacy of chemotherapy in gastric cancer.

  4. HIV Genetic Diversity and Drug Resistance

    Science.gov (United States)

    Santos, André F.; Soares, Marcelo A.

    2010-01-01

    Most of the current knowledge on antiretroviral (ARV) drug development and resistance is based on the study of subtype B of HIV-1, which only accounts for 10% of the worldwide HIV infections. Cumulative evidence has emerged that different HIV types, groups and subtypes harbor distinct biological properties, including the response and susceptibility to ARV. Recent laboratory and clinical data highlighting such disparities are summarized in this review. Variations in drug susceptibility, in the emergence and selection of specific drug resistance mutations, in viral replicative capacity and in the dynamics of resistance acquisition under ARV selective pressure are discussed. Clinical responses to ARV therapy and associated confounding factors are also analyzed in the context of infections by distinct HIV genetic variants. PMID:21994646

  5. Comparison of effectiveness and safety of imipenem/clavulanate- versus meropenem/clavulanate-containing regimens in the treatment of MDR- and XDR-TB

    NARCIS (Netherlands)

    Tiberi, Simon; Sotgiu, Giovanni; D'Ambrosio, Lia; Centis, Rosella; Arbex, Marcos Abdo; Arrascue, Edith Alarcon; Alffenaar, Jan Willem; Caminero, Jose A.; Gaga, Mina; Gualano, Gina; Skrahina, Alena; Solovic, Ivan; Sulis, Giorgia; Tadolini, Marina; Alarcon Guizado, Valentina; De Lorenzo, Saverio; Roby Arias, Aurora Jazmin; Scardigli, Anna; Akkerman, Onno W.; Aleksa, Alena; Artsukevich, Janina; Auchynka, Vera; Bonini, Eduardo Henrique; Chong Marin, Felix Antonio; Collahuazo Lopez, Lorena; de Vries, Gerard; Dore, Simone; Kunst, Heinke; Matteelli, Alberto; Moschos, Charalampos; Palmieri, Fabrizio; Papavasileiou, Apostolos; Payen, Marie-Christine; Piana, Andrea; Spanevello, Antonio; Vargas Vasquez, Dante; Viggiani, Pietro; White, Veronica; Zumla, Alimuddin; Migliori, Giovanni Battista

    No large study to date has ever evaluated the effectiveness, safety and tolerability of imipenem/clavulanate versus meropenem/clavulanate to treat multidrug-and extensively drug-resistant tuberculosis (MDR- and XDR-TB). The aim of this observational study was to compare the therapeutic contribution

  6. Mouse ATP-Binding Cassette (ABC) Transporters Conferring Multi-Drug Resistance

    Science.gov (United States)

    Shuaizhang, L I; Zhang, Wen; Yin, Xuejiao; Xing, Shilai; Xie, Qunhui; Cao, Zhengyu; Zhao, Bin

    2015-04-28

    The ABC (ATP-binding cassette) transporter is one of the largest and most ancient protein families with members functioning from protozoa to human. The resistance of cancer and tumor cells to anticancer drugs is due to the over-expression of some ABC transporters, which may finally lead to chemotherapy failure. The mouse ABC transporters are classified into seven subfamilies by phylogenetic analysis. The mouse ABC transporter gene, alias, chromosomal location and function have been determined. Within the ABC super-family, the MDR transporters (Abcb1, Abcc1, Abcg2) in mouse models have been proved to be valuable to investigate the biochemistry and physiological functions. This review concentrates on the multidrug resistance of mouse ABC transporters in cancer and tumor cells.

  7. Mesenchymal change and drug resistance in neuroblastoma.

    Science.gov (United States)

    Naiditch, Jessica A; Jie, Chunfa; Lautz, Timothy B; Yu, Songtao; Clark, Sandra; Voronov, Dimitry; Chu, Fei; Madonna, Mary Beth

    2015-01-01

    Metastatic initiation has many phenotypic similarities to epithelial-to-mesenchymal transition, including loss of cell-cell adhesion, increased invasiveness, and increased cell mobility. We have previously demonstrated that drug resistance is associated with a metastatic phenotype in neuroblastoma (NB). The purpose of this project was to determine if the development of doxorubicin resistance is associated with characteristics of mesenchymal change in human NB cells. Total RNA was isolated from wild type (WT) and doxorubicin-resistant (DoxR) human NB cell lines (SK-N-SH and SK-N-BE(2)C) and analyzed using the Illumina Human HT-12 version 4 Expression BeadChip. Differentially expressed genes (DEGs) were identified. Volcano plots and heat maps were generated. Genes of interest with a fold change in expression >1.5 and an adjusted P change via multiple pathways in the transition to a drug-resistant state. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Time to initiation of multidrug-resistant tuberculosis treatment and its relation with outcome in a high incidence district in Lima, Peru.

    Science.gov (United States)

    Otero, L; De Orbegoso, A; Navarro, A F; Ríos, J; Párraga, T; Gotuzzo, E; Seas, C; Van der Stuyft, P

    2015-03-01

    To determine the time from diagnosis to start of multidrug resistant tuberculosis (MDR TB) treatment in Lima, Peru. We studied new smear-positive TB adults that were started on MDR TB treatment or that were switched to it between June 2008 and December 2011. Time from the first positive smear to MDR-TB treatment was >30 days in 35% (13/37) of patients. Among the 27% (24/88) of patients that switched to MDR-TB treatment, time from the last dose of a drug-susceptible regimen was >30 days. Start of and switching to MDR TB treatment is still delayed. © 2014 John Wiley & Sons Ltd.

  9. Drug-resistant tuberculosis: emerging treatment options

    Directory of Open Access Journals (Sweden)

    Adhvaryu MR

    2011-12-01

    Full Text Available Meghna Adhvaryu1, Bhasker Vakharia21Department of Biotechnology, SRK Institute of Computer Education and Applied Sciences, 2R&D, Bhuma Research in Ayurvedic and Herbal Medicine, Surat, Gujarat, IndiaAbstract: Multidrug-resistant tuberculosis has emerged worldwide, with an increasing incidence due to failure of implementation of apparently effective first-line antituberculous therapy as well as primary infection with drug-resistant strains. Failure of current therapy is attributed to a long duration of treatment leading to nonadherence and irregular therapy, lack of patient education about the disease, poverty, irregular supply by care providers, drug–drug interactions in patients coinfected with human immunodeficiency virus (HIV, inadequate regulations causing market overlap and irresponsible drug usage in the private sector, and lack of research, with no addition of new drugs in the last four decades. Present standards of care for the treatment of drug-susceptible tuberculosis, multidrug-resistant tuberculosis, tuberculosis-HIV coinfection, and latent tuberculosis infection are all unsatisfactory. Since 2000, the World Health Organization (WHO has focused on drug development for tuberculosis, as well as research in all relevant aspects to discover new regimens by 2015 and to eliminate tuberculosis as a public health concern by 2050. As a result, some 20 promising compounds from 14 groups of drugs have been discovered. Twelve candidates from eight classes are currently being evaluated in clinical trials. Ongoing research should prioritize identification of novel targets and newer application of existing drugs, discovery of multitargeted drugs from natural compounds, strengthening host factors by immunopotentiation with herbal immunomodulators, as well as protective vaccines before and after exposure, consideration of surgical measures when indicated, development of tools for rapid diagnosis, early identification of resistant strains, and

  10. Economic implications of resistance to antimalarial drugs.

    Science.gov (United States)

    Phillips, M; Phillips-Howard, P A

    1996-09-01

    The widespread evolution of drug resistance in malarial parasites has seriously hampered efforts to control this debilitating disease. Chloroquine, the mainstay of malaria treatment for many decades, is now proving largely ineffective in many parts of the world, particularly against the most severe form of malaria--falciparum. Alternative drugs have been developed, but they are frequently less safe and are all between 50 and 700% more expensive than chloroquine. Choice of drug clearly has important budgetary implications and national malaria control programmes need to weigh up the costs and benefits in deciding whether to change to more effective but more expensive drugs. The growth in drug resistance also has implications for the choice of diagnostic tool. Clinical diagnosis of malaria is relatively cheap, but less specific than some technological approaches. As more expensive drugs are employed, the cost of wasted treatment on suspected cases who do not in fact have malaria rises and the more worthwhile it becomes to invest in more specific diagnostic techniques. This paper presents an economic framework for analysing the various malaria drug and diagnostic tool options available. It discusses the nature of the key factors that need to be considered when making choices of malaria treatment (including treatment costs, drug resistance, the costs of treatment failure and compliance) and diagnosis (including diagnosis cost and accuracy, and the often overlooked costs associated with delayed treatment), and uses some simple equations to illustrate the impact of these on the relative cost effectiveness of the alternatives being considered. On the basis of some simplifying assumptions and illustrative calculations, it appears that in many countries more effective drugs and more specific and rapid diagnostic approaches will be worth adopting even although they imply additional expense.

  11. Mechanisms of Candida biofilm drug resistance

    Science.gov (United States)

    Taff, Heather T; Mitchell, Kaitlin F; Edward, Jessica A; Andes, David R

    2013-01-01

    Candida commonly adheres to implanted medical devices, growing as a resilient biofilm capable of withstanding extraordinarily high antifungal concentrations. As currently available antifungals have minimal activity against biofilms, new drugs to treat these recalcitrant infections are urgently needed. Recent investigations have begun to shed light on the mechanisms behind the profound resistance associated with the biofilm mode of growth. This resistance appears to be multifactorial, involving both mechanisms similar to conventional, planktonic antifungal resistance, such as increased efflux pump activity, as well as mechanisms specific to the biofilm lifestyle. A unique biofilm property is the production of an extracellular matrix. Two components of this material, β-glucan and extracellular DNA, promote biofilm resistance to multiple antifungals. Biofilm formation also engages several stress response pathways that impair the activity of azole drugs. Resistance within a biofilm is often heterogeneous, with the development of a subpopulation of resistant persister cells. In this article we review the molecular mechanisms underlying Candida biofilm antifungal resistance and their relative contributions during various growth phases. PMID:24059922

  12. Ecdysteroids Sensitize MDR and Non-MDR Cancer Cell Lines to Doxorubicin, Paclitaxel, and Vincristine but Tend to Protect Them from Cisplatin

    Directory of Open Access Journals (Sweden)

    Ana Martins

    2015-01-01

    Full Text Available Ecdysteroids, analogs of the insect molting hormone, are known for their various mild, nonhormonal bioactivities in mammals. Previously, we reported that less-polar ecdysteroids can modulate the doxorubicin resistance of a multidrug resistant (MDR mouse lymphoma cell line expressing the human ABCB1 transporter. Here, we describe the ability of 20-hydroxyecdysone (1 and its mono- (2 and diacetonide (3 derivatives to sensitize various MDR and non-MDR cancer cell lines towards doxorubicin, paclitaxel, vincristine, or cisplatin. Drug IC50 values with or without ecdysteroid were determined by MTT assay. Compound 3 significantly sensitized all cell lines to each chemotherapeutic except for cisplatin, whose activity was decreased. In order to overcome solubility and stability issues for the future in vivo administration of compound 3, liposomal formulations were developed. By means of their combination index values obtained via checkerboard microplate method, a formulation showed superior activity to that of compound 3 alone. Because ecdysteroids act also on non-ABCB1 expressing (sensitive cell lines, our results demonstrate that they do not or not exclusively exert their adjuvant anticancer activity as ABCB1 inhibitors, but other mechanisms must be involved, and they opened the way towards their in vivo bioactivity testing against various cancer xenografts.

  13. High proportion of modern genotypes of M. tuberculosis and their affinity with drug resistance in northern region of India.

    Science.gov (United States)

    Dhatwalia, Sunil Kumar; Yadav, Rakesh; Behera, Digambar; Kaur, Harsimran; Kumar, Manoj; Sethi, Sunil

    2017-09-01

    Comparative genomics on the basis of TbD1 deletion has differentiated the members of Mycobacterium tuberculosis complex (MTC) in two major genogroups. They exhibit differential distribution and virulence potential. The present study was carried out to see the proportion of these genogroups and their association with drug resistance. The drug resistance pattern of 205 culture positive cases of M. tuberculosis and their relation with TbD1 deletion was analysed from the tertiary care centre. Overall proportion of genotypes (TbD1- and Tbd1+) and their association with drug resistance was also observed from the various studies from India. Our study reports that 85.4% of the isolates of M. tuberculosis were modern genotypes (TbD1-) and rest of 14.6% were ancient genotypes (TbD1+). 37 cases were of multiple drug resistant-TB (MDR-TB), 35 of them belongs to modern genogrop and rest of (2) were in ancient genogroup (p=0.12). Overall pooled estimate of proportion of modern genotype is 75.5% (CI 95%, 73.03-77.87) and 24.55% (CI 95%, 22.13-26.97) for ancient genotypes from the studies carried out in India. Modern genotypes were more rarely drug sensitive phenotypes with a relative risk (RR) of 0.89 (CI 95%, 0.74-1.07) while MDR cases were more in this group with an odds ratio (OR) of 2.27 (CI 95%, 0-1.07). This study demonstrates a higher proportion of modern genotypes in our region/India; which are more likely to be associated with drug resistance. Future, epidemiological/in vitro studies are required to ascertain the relationship between genotypes and their virulence potential. Copyright © 2017 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

  14. Platelet-camouflaged nanococktail: Simultaneous inhibition of drug-resistant tumor growth and metastasis via a cancer cells and tumor vasculature dual-targeting strategy.

    Science.gov (United States)

    Jing, Lijia; Qu, Haijing; Wu, Dongqi; Zhu, Chaojian; Yang, Yongbo; Jin, Xing; Zheng, Jian; Shi, Xiangsheng; Yan, Xiufeng; Wang, Yang

    2018-01-01

    Multidrug resistance (MDR) poses a great challenge to cancer therapy. It is difficult to inhibit the growth of MDR cancer due to its chemoresistance. Furthermore, MDR cancers are more likely to metastasize, causing a high mortality among cancer patients. In this study, a nanomedicine RGD-NPVs@MNPs/DOX was developed by encapsulating melanin nanoparticles (MNPs) and doxorubicin (DOX) inside RGD peptide (c(RGDyC))-modified nanoscale platelet vesicles (RGD-NPVs) to efficiently inhibit the growth and metastasis of drug-resistant tumors via a cancer cells and tumor vasculature dual-targeting strategy. Methods: The in vitro immune evasion potential and the targeting performance of RGD-NPVs@MNPs/DOX were examined using RAW264.7, HUVECs, MDA-MB-231 and MDA-MB-231/ADR cells lines. We also evaluated the pharmacokinetic behavior and the in vivo therapeutic performance of RGD-NPVs@MNPs/DOX using a MDA-MB-231/ADR tumor-bearing nude mouse model. Results: By taking advantage of the self-recognizing property of the platelet membrane and the conjugated RGD peptides, RGD-NPVs@MNPs/DOX was found to evade immune clearance and target the αvβ3 integrin on tumor vasculature and resistant breast tumor cells. Under irradiation with a NIR laser, RGD-NPVs@MNPs/DOX produced a multipronged effect, including reversal of cancer MDR, efficient killing of resistant cells by chemo-photothermal therapy, elimination of tumor vasculature for blocking metastasis, and long-lasting inhibition of the expressions of VEGF, MMP2 and MMP9 within the tumor. Conclusion: This versatile nanomedicine of RGD-NPVs@MNPs/DOX integrating unique biomimetic properties, excellent targeting performance, and comprehensive therapeutic strategies in one formulation might bring opportunities to MDR cancer therapy.

  15. Development of novel strategies to combat multidrug resistance mediated by efflux transporters and intracellular bacteria

    OpenAIRE

    Kuriakose, Jerrin

    2014-01-01

    Multidrug resistance (MDR) is the condition where cancer cells or microorganisms cease to respond to multiple drugs. MDR conferred by efflux transporters, that deprive the bioavailability of drugs at their site of action, are a threat to cancer and malarial chemotherapy. Specifically, the mammalian ABC transporter Pglycoprotein (P-gp) has undermined many drugs in treatment of cancer and other disease states. Mutations in the parasitic transporter Plasmodium falciparum chloroquine resistance t...

  16. characterization of drug resistant pseudomonas aeruginosa and ...

    African Journals Online (AJOL)

    Abstract: Lizards as well as some other reptiles have been known to carry pathogenic bacteria organisms as well as drug resistant pathogens. Despite the fact that they remain asymptomatic in many cases, they nevertheless play significant roles in the epidemiology of these pathogens through their dissemination to the ...

  17. Repurposing salicylanilide anthelmintic drugs to combat drug resistant Staphylococcus aureus.

    Science.gov (United States)

    Rajamuthiah, Rajmohan; Fuchs, Beth Burgwyn; Conery, Annie L; Kim, Wooseong; Jayamani, Elamparithi; Kwon, Bumsup; Ausubel, Frederick M; Mylonakis, Eleftherios

    2015-01-01

    Staphylococcus aureus is a Gram-positive bacterium that has become the leading cause of hospital acquired infections in the US. Repurposing Food and Drug Administration (FDA) approved drugs for antimicrobial therapy involves lower risks and costs compared to de novo development of novel antimicrobial agents. In this study, we examined the antimicrobial properties of two commercially available anthelmintic drugs. The FDA approved drug niclosamide and the veterinary drug oxyclozanide displayed strong in vivo and in vitro activity against methicillin resistant S. aureus (minimum inhibitory concentration (MIC): 0.125 and 0.5 μg/ml respectively; minimum effective concentration: ≤ 0.78 μg/ml for both drugs). The two drugs were also effective against another Gram-positive bacteria Enterococcus faecium (MIC 0.25 and 2 μg/ml respectively), but not against the Gram-negative species Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa and Enterobacter aerogenes. The in vitro antimicrobial activity of niclosamide and oxyclozanide were determined against methicillin, vancomycin, linezolid or daptomycin resistant S. aureus clinical isolates, with MICs at 0.0625-0.5 and 0.125-2 μg/ml for niclosamide and oxyclozanide respectively. A time-kill study demonstrated that niclosamide is bacteriostatic, whereas oxyclozanide is bactericidal. Interestingly, oxyclozanide permeabilized the bacterial membrane but neither of the anthelmintic drugs exhibited demonstrable toxicity to sheep erythrocytes. Oxyclozanide was non-toxic to HepG2 human liver carcinoma cells within the range of its in vitro MICs but niclosamide displayed toxicity even at low concentrations. These data show that the salicylanilide anthelmintic drugs niclosamide and oxyclozanide are suitable candidates for mechanism of action studies and further clinical evaluation for treatment of staphylococcal infections.

  18. Towards understanding the drivers of policy change: a case study of infection control policies for multi-drug resistant tuberculosis in South Africa.

    Science.gov (United States)

    Saidi, Trust; Salie, Faatiema; Douglas, Tania S

    2017-05-30

    Explaining policy change is one of the central tasks of contemporary policy analysis. In this article, we examine the changes in infection control policies for multi-drug resistant tuberculosis (MDR-TB) in South Africa from the time the country made the transition to democracy in 1994, until 2015. We focus on MDR-TB infection control and refer to decentralised management as a form of infection control. Using Kingdon's theoretical framework of policy streams, we explore the temporal ordering of policy framework changes. We also consider the role of research in motivating policy changes. Policy documents addressing MDR-TB in South Africa over the period 1994 to 2014 were extracted. Literature on MDR-TB infection control in South Africa was extracted from PubMed using key search terms. The documents were analysed to identify the changes that occurred and the factors driving them. During the period under study, five different policy frameworks were implemented. The policies were meant to address the overwhelming challenge of MDR-TB in South Africa, contextualised by high prevalence of HIV infection, that threatened to undermine public health programmes and the success of antiretroviral therapy rollouts. Policy changes in MDR-TB infection control were supported by research evidence and driven by the high incidence and complexity of the disease, increasing levels of dissatisfaction among patients, challenges of physical, human and financial resources in public hospitals, and the ideologies of the political leadership. Activists and people living with HIV played an important role in highlighting the importance of MDR-TB as well as exerting pressure on policymakers, while the mass media drew public attention to infection control as both a cause of and a solution to MDR-TB. The critical factors for policy change for infection control of MDR-TB in South Africa were rooted in the socioeconomic and political environment, were supported by extensive research, and can be framed

  19. Predictors of death among drug-resistant tuberculosis patients in Kuala Lumpur, Malaysia: A retrospective cohort study from 2009 to 2013.

    Science.gov (United States)

    Mohd Shariff, Noorsuzana; Shah, Shamsul Azhar; Kamaludin, Fadzilah

    2016-09-01

    The emergence of drug-resistant tuberculosis (TB) is a major public health threat. However, little is known about the predictors of death in drug-resistant TB in Malaysia. This study aimed to determine the predictors of death in drug-resistant TB patients, including multidrug-resistant TB (MDR-TB), in Kuala Lumpur, Malaysia. This study adopted a retrospective cohort study design and involved laboratory-confirmed drug-resistant TB patients (n=426) from January 2009 to June 2013. A Cox regression model and Kaplan-Meier curves were used to model the outcome measure. Data were analysed by using SPSS v.20.0 for Windows. In this study, 15.3% (n=65) of the patients died. Among the study patients, 70.9% were monoresistant TB cases, 9.4% were poly-resistant TB and 19.7% were MDR-TB. MDR-TB [adjusted hazard ratio (aHR)=2.23, 95% confidence interval (CI) 1.26-3.95], ethnicity [Malay (aHR=5.95, 95% CI 2.30-15.41), Chinese (aHR=4.01, 95% CI 1.38-11.66) and Indian (aHR=3.76, 95% CI 1.19-11.85)], coronary heart disease (aHR=6.82, 95% CI 2.16-21.50), drug abuse (aHR=3.79, 95% CI 2.07-6.93) and treatment non-compliance (aHR=1.81, 95% CI 1.01-3.27) were independent predictors of poorer survival in the multivariate Cox regression analysis. This study suggests that MDR-TB, local ethnicity, coronary heart disease, history of drug abuse and treatment non-compliance are factors predicting poor survival in drug-resistant TB patients. More emphasis should be given to the management of drug-resistant TB patients with these characteristics to achieve better treatment outcomes. Copyright © 2016 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

  20. Population mobility, globalization, and antimicrobial drug resistance.

    Science.gov (United States)

    MacPherson, Douglas W; Gushulak, Brian D; Baine, William B; Bala, Shukal; Gubbins, Paul O; Holtom, Paul; Segarra-Newnham, Marisel

    2009-11-01

    Population mobility is a main factor in globalization of public health threats and risks, specifically distribution of antimicrobial drug-resistant organisms. Drug resistance is a major risk in healthcare settings and is emerging as a problem in community-acquired infections. Traditional health policy approaches have focused on diseases of global public health significance such as tuberculosis, yellow fever, and cholera; however, new diseases and resistant organisms challenge existing approaches. Clinical implications and health policy challenges associated with movement of persons across barriers permeable to products, pathogens, and toxins (e.g., geopolitical borders, patient care environments) are complex. Outcomes are complicated by high numbers of persons who move across disparate and diverse settings of disease threat and risk. Existing policies and processes lack design and capacity to prevent or mitigate adverse health outcomes. We propose an approach to global public health risk management that integrates population factors with effective and timely application of policies and processes.

  1. Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1) and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Østergaard, Mette; Christensen, Jane

    2009-01-01

    (rs5275) polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Results Carriers of the variant......Background The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1) and Breast Cancer Resistance Protein (BCRP/ABCG2) may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH). Cyclooxygenase-2 (COX-2) derived...... prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC), and to investigate possible interactions with lifestyle factors...

  2. High frequency of a single nucleotide substitution (c.-6-180T>G) of the canine MDR1/ABCB1 gene associated with phenobarbital-resistant idiopathic epilepsy in Border Collie dogs.

    Science.gov (United States)

    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

    2013-01-01

    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  3. High Frequency of a Single Nucleotide Substitution (c.-6-180T>G of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

    Directory of Open Access Journals (Sweden)

    Keijiro Mizukami

    2013-01-01

    Full Text Available A single nucleotide substitution (c.-6-180T>G associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9% in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  4. Localization and activity of multidrug resistance protein 1 in the secretory pathway of Leishmania parasites.

    Science.gov (United States)

    Dodge, Matthew A; Waller, Ross F; Chow, Larry M C; Zaman, Muhammad M; Cotton, Leanne M; McConville, Malcolm J; Wirth, Dyann F

    2004-03-01

    Upregulation of the multidrug resistance protein 1 (LeMDR1) in the protozoan parasite, Leishmania enriettii, confers resistance to hydrophobic drugs such as vinblastine, but increases the sensitivity of these parasites to the mitochondrial drug, rhodamine 123. In order to investigate the mechanism of action of LeMDR1, the subcellular localization of green fluorescent protein (GFP)-tagged versions of LeMDR1 and the fate of the traceable-fluorescent LeMDR1 substrate calcein AM were examined in both Leishmania mexicana and L. enriettii LeMDR1 -/- and overexpressing cell lines. The LeMDR1-GFP chimera was localized by fluorescence microscopy to a number of secretory and endocytic compartments, including the Golgi apparatus, endoplasmic reticulum (ER) and a multivesicular tubule (MVT)-lysosome. Pulse-chase labelling experiments with calcein AM suggested that the Golgi and ER pools, but not the MVT-lysosome pool, of LeMDR1 were active in pumping calcein AM out of the cell. Cells labelled with calcein AM under conditions that slow vesicular transport (low temperature and stationary growth) inhibited export and resulted in the accumulation of fluorescent calcein in both the Golgi and the mitochondria. We propose that LeMDR1 substrates are pumped into secretory compartments and exported from the parasite by exocytosis. Accumulation of MDR substrates in the ER can result in alternative transport to the mitochondrion, explaining the reciprocal sensitivity of drug-resistant Leishmania to vinblastine and rhodamine 123.

  5. The Second Zambian National Tuberculosis Drug Resistance survey - a comparison of conventional and molecular methods.

    Science.gov (United States)

    Kapata, Nathan; Mbulo, Grace; Cobelens, Frank; de Haas, Petra; Schaap, Ab; Mwamba, Pike; Mwanza, Winnie; Muvwimi, Mweemba; Muyoyeta, Monde; Moyo, Maureen; Mulenga, Lutinala; Grobusch, Martin P; Godfrey-Faussett, Peter; Ayles, Helen

    2015-11-01

    The prevalence of MDR-TB in Zambia was estimated to be 1.8% in 2001. A second drug resistance survey was conducted in 2008 to determine trends; the use of the Genotype MTBDRplus assay was applied to compare results to the gold standard. A two-stage cluster sampling, with health facilities as primary sampling units. Processed sputum specimens were inoculated on solid media for culture; heat-inactivated bacterial suspensions from sputum samples were tested on a commercial line probe assay for the identification of rifampicin and isoniazid resistance. A total of 917 patients with TB were enrolled and 883 (96.3%) analysed. A total of 574 (65%) had LJ results and 824 (93.3%) had results from MTBDRplus assay. The median age was 32, and 63.3% were males. MDR-TB according to LJ-based DST was 1.1% (CI 0.1-2.4) whereas according to MDTBDRplus assay was 1.6% (CI 0.6-2.6). Isoniazid monoresistance in new cases was 2.4% (CI 0.613-4.26) based on LJ results and 5.0% (CI 3.2-6.7) based on the MTBDRplus; in retreatment cases, it was 4.4% (CI 0.3-8.6) and 2.40% (CI <0.1-5.1) on LJ and MTBDRplus, respectively. Rifampicin monoresistance in new cases was 0.1% (CI <0.1-0.4) based on LJ and 0.6% (CI 0.01-1.1) based on the MTBDRplus; in retreatment cases, it was 0% (CI 0-3.8) and 1.8% (CI <0.1-4.0) on LJ and MTBDRplus, respectively. There were no XDR-TB cases found and no association between MDR-TB and HIV. There was no increase in MDR-TB prevalence in Zambia from 2001 to 2008; results from the two methods were similar. Molecular methods were quicker and simpler to use. © 2015 John Wiley & Sons Ltd.

  6. 14-3-3ε boosts bleomycin-induced DNA damage response by inhibiting the drug-resistant activity of MVP.

    Science.gov (United States)

    Tang, Siwei; Bai, Chen; Yang, Pengyuan; Chen, Xian

    2013-06-07

    Major vault protein (MVP) is the predominant constituent of the vault particle, the largest known ribonuclear protein complex. Although emerging evidence have been establishing the links between MVP (vault) and multidrug resistance (MDR), little is known regarding exactly how the MDR activity of MVP is modulated during cellular response to drug-induced DNA damage (DDR). Bleomycin (BLM), an anticancer drug, induces DNA double-stranded breaks (DSBs) and consequently triggers the cellular DDR. Due to its physiological implications in hepatocellular carcinoma (HCC) and cell fate decision, 14-3-3ε was chosen as the pathway-specific bait protein to identify the critical target(s) responsible for HCC MDR. By using an LC-MS/MS-based proteomic approach, MVP was first identified in the BLM-induced 14-3-3ε interactome formed in HCC cells. Biological characterization revealed that MVP possesses specific activity to promote the resistance to the BLM-induced DDR. On the other hand, 14-3-3ε enhances BLM-induced DDR by interacting with MVP. Mechanistic investigation further revealed that 14-3-3ε, in a phosphorylation-dependent manner, binds to the phosphorylated sites at both Thr52 and Ser864 of the monomer of MVP. Consequently, the phosphorylation-dependent binding between 14-3-3ε and MVP inhibits the drug-resistant activity of MVP for an enhanced DDR to BLM treatment. Our findings provide an insight into the mechanism underlying how the BLM-induced interaction between 14-3-3ε and MVP modulates MDR, implicating novel strategy to overcome the chemotherapeutic resistance through interfering specific protein-protein interactions.

  7. Molecular markers of anti-malarial drug resistance in Central, West and East African children with severe malaria

    OpenAIRE

    Nguetse, Christian N.; Adegnika, Ayola Akim; Agbenyega, Tsiri; Ogutu, Bernhards R.; Krishna, Sanjeev; Kremsner, Peter G.; Velavan, Thirumalaisamy P.

    2017-01-01

    BACKGROUND: The Plasmodium falciparum multidrug resistance 1 (PfMDR1), P. falciparum Ca(2+)-ATPase (PfATP6) and Kelch-13 propeller domain (PfK13) loci are molecular markers of parasite susceptibility to anti-malarial drugs. Their frequency distributions were determined in the isolates collected from children with severe malaria originating from three African countries. METHODS: Samples from 287 children with severe malaria [(Gabon: n = 114); (Ghana: n = 89); (Kenya: n = 84)] were genotyped fo...

  8. Rapid detection of drug resistance and mutational patterns of extensively drug-resistant strains by a novel GenoType® MTBDRsl assay

    Directory of Open Access Journals (Sweden)

    A K Singh

    2013-01-01

    Full Text Available Background: The emergence of extensively drug-resistant tuberculosis (XDR-TB is a major concern in the India. The burden of XDR-TB is increasing due to inadequate monitoring, lack of proper diagnosis, and treatment. The GenoType ® Mycobacterium tuberculosis drug resistance second line (MTBDRsl assay is a novel line probe assay used for the rapid detection of mutational patterns conferring resistance to XDR-TB. Aim: The aim of this study was to study the rapid detection of drug resistance and mutational patterns of the XDR-TB by a novel GenoType ® MTBDRsl assay. Materials and Methods: We evaluated 98 multidrug-resistant (MDR M. tuberculosis isolates for second line drugs susceptibility testing by 1% proportion method (BacT/ALERT 3D system and GenoType ® MTBDRsl assay for rapid detection of conferring drug resistance to XDR-TB. Results: A total of seven (17.4% were identified as XDR-TB by using standard phenotypic method. The concordance between phenotypic and GenoType ® MTBDRsl assay was 91.7-100% for different antibiotics. The sensitivity and specificity of the MTBDRsl assay were 100% and 100% for aminoglycosides; 100% and 100% for fluoroquinolones; 91.7% and 100% for ethambutol. The most frequent mutations and patterns were gyrA MUT1 (A90V in seven (41.2% and gyrA + WT1-3 + MUT1 in four (23.5%; rrs MUT1 (A1401G in 11 (64.7%, and rrs WT1-2 + MUT1 in eight (47.1%; and embB MUT1B (M306V in 11 (64.7% strains. Conclusions: These data suggest that the GenoType ® MTBDRsl assay is rapid, novel test for detection of resistance to second line anti-tubercular drugs. This assay provides additional information about the frequency and mutational patterns responsible for XDR-TB resistance.

  9. Emerging epidemic of drug resistant tuberculosis in vulnerable ...

    African Journals Online (AJOL)

    the incidence of TB/MDR-TB in domestic interactions of MDR-TB patients1. Domestic contacts of MDR-TB suggest more recurrent threat of developing active TB and MDR-TB but such studies are rare19. Homelessness is a miserable condition, incorporating several liabilities that strikingly intensify the risk of being diseased, ...

  10. Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

    Directory of Open Access Journals (Sweden)

    Chen Tingfu

    2010-07-01

    Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

  11. Hepatocyte SLAMF3 reduced specifically the multidrugs resistance protein MRP-1 and increases HCC cells sensitization to anti-cancer drugs.

    Science.gov (United States)

    Fouquet, Grégory; Debuysscher, Véronique; Ouled-Haddou, Hakim; Eugenio, Mélanie Simoes; Demey, Baptiste; Singh, Amrathlal Rabbind; Ossart, Christèle; Al Bagami, Mohammed; Regimbeau, Jean-Marc; Nguyen-Khac, Eric; Naassila, Mickael; Marcq, Ingrid; Bouhlal, Hicham

    2016-05-31

    Multidrug resistance MDR proteins (MRPs) are members of the C family of a group of proteins named ATP binding cassette (ABC) transporters. MRPs can transport drugs including anticancer drugs, nucleoside analogs, antimetabolites and tyrosine kinase inhibitors. Drugs used in HCC therapy, such as tyrosine kinase inhibitor sorafenib, are substrates of uptake and/or efflux transporters. Variable expression of MRPs at the plasma membrane of tumor cells may contribute to drug resistance and subsequent clinical response. Recently, we reported that the hepatocyte SLAMF3 expression (Signaling Lymphocytic Activation Molecule Family member 3) was reduced in tumor cells from hepatocellular carcinoma (HCC) compared to its high expression in adjacent tissues. In the present study, we make a strong correlation between induced SLAMF3 overexpression and the specific loss of MRP-1 expression and its functionalities as a drugs resistance transporter. No changes were observed on expression of ABCG2 and MDR. More importantly, we highlight a strong inverse correlation between MRP-1 and SLAMF3 expression in patients with HCC. We propose that the SLAMF3 overexpression in cancerous cells could represent a potential therapeutic strategy to improve the drugs sensibility of resistant cells and thus control the therapeutic failure in HCC patients.

  12. Resident cats in small animal veterinary hospitals carry multi-drug resistant enterococci and are likely involved in cross-contamination of the hospital environment

    Directory of Open Access Journals (Sweden)

    Anuradha eGhosh

    2012-02-01

    Full Text Available In the U.S., small animal veterinary hospitals (SAVHs commonly keep resident cats living permanently as pets within their facilities. Previously, multi-drug resistant (MDR enterococci were found as a contaminant of multiple surfaces within such veterinary hospitals, and nosocomial infections are a concern. The objectives of this study were to determine whether resident cats carry MDR enterococci and if they potentially play a role in the contamination of the hospital environment. Enterococcal strains (n=180 were isolated from the feces of six healthy resident cats from different SAVHs. The concentration of enterococci ranged from 1.1 x 105 to 6.0 x 108 CFU g-1 of feces, and the population comprised E. hirae (38.3±18.6%, E. faecium (35.0±14.3%, E. faecalis (23.9±11.0%, and E. avium (2.8±2.2%. Testing of phenotypic resistance to 14 antimicrobial agents revealed multi-drug resistance (≥3 antimicrobials in 48.9% of all enterococcal isolates with most frequent resistance to tetracycline (72.8%, erythromycin (47.8%, and rifampicin (35.6%. Vancomycin resistant E. faecalis (3.9% with vanB not horizontally transferable in in vitro conjugation assays were detected from one cat. Genotyping (pulsed-field gel electrophoresis demonstrated a host-specific clonal population of MDR E. faecalis and E. faecium. Importantly, several feline isolates were genotypically identical or closely related to isolates from surfaces of cage door, thermometer, and stethoscope of the corresponding SAVHs. These data demonstrate that healthy resident cats at SAVHs carry MDR enterococci and likely contribute to contamination of the SAVH environment. Proper disposal and handling of fecal material and restricted movement of resident cats within the ward is recommended.

  13. Optimizing the Safety of Multidrug-resistant Tuberculosis Therapy in Namibia

    NARCIS (Netherlands)

    Sagwa, Evans

    2017-01-01

    Introduction: Multidrug-resistant tuberculosis (MDR-TB), a growing global menace, is seriously undermining the previous successes made in the elimination of TB. MDR-TB treatment takes a long time, is complex, and is frequently associated with the occurrence of adverse drug reactions, some of which

  14. PknB remains an essential and a conserved target for drug development in susceptible and MDR strains of M. Tuberculosis.

    Science.gov (United States)

    Gupta, Anamika; Pal, Sudhir K; Pandey, Divya; Fakir, Najneen A; Rathod, Sunita; Sinha, Dhiraj; SivaKumar, S; Sinha, Pallavi; Periera, Mycal; Balgam, Shilpa; Sekar, Gomathi; UmaDevi, K R; Anupurba, Shampa; Nema, Vijay

    2017-08-18

    The Mycobacterium tuberculosis (M.tb) protein kinase B (PknB) which is now proved to be essential for the growth and survival of M.tb, is a transmembrane protein with a potential to be a good drug target. However it is not known if this target remains conserved in otherwise resistant isolates from clinical origin. The present study describes the conservation analysis of sequences covering the inhibitor binding domain of PknB to assess if it remains conserved in susceptible and resistant clinical strains of mycobacteria picked from three different geographical areas of India. A total of 116 isolates from North, South and West India were used in the study with a variable profile of their susceptibilities towards streptomycin, isoniazid, rifampicin, ethambutol and ofloxacin. Isolates were also spoligotyped in order to find if the conservation pattern of pknB gene remain consistent or differ with different spoligotypes. The impact of variation as found in the study was analyzed using Molecular dynamics simulations. The sequencing results with 115/116 isolates revealed the conserved nature of pknB sequences irrespective of their susceptibility status and spoligotypes. The only variation found was in one strains wherein pnkB sequence had G to A mutation at 664 position translating into a change of amino acid, Valine to Isoleucine. After analyzing the impact of this sequence variation using Molecular dynamics simulations, it was observed that the variation is causing no significant change in protein structure or the inhibitor binding. Hence, the study endorses that PknB is an ideal target for drug development and there is no pre-existing or induced resistance with respect to the sequences involved in inhibitor binding. Also if the mutation that we are reporting for the first time is found again in subsequent work, it should be checked with phenotypic profile before drawing the conclusion that it would affect the activity in any way. Bioinformatics analysis in our study

  15. Mycobacterium tuberculosis Complex Genotype Diversity and Drug Resistance Profiles in a Pediatric Population in Mexico

    Directory of Open Access Journals (Sweden)

    Mercedes Macías Parra

    2011-01-01

    Full Text Available The aim of this study was to determine the frequency of drug resistance and the clonality of genotype patterns in M. tuberculosis clinical isolates from pediatric patients in Mexico (n=90 patients from 19 states; time period—January 2002 to December 2003. Pulmonary disease was the most frequent clinical manifestation (71%. Children with systemic tuberculosis (TB were significantly younger compared to patients with localized TB infections (mean 7.7±6.2 years versus 15±3.4 years P=0.001. Resistance to any anti-TB drug was detected in 24/90 (26.7% of the isolates; 21/90 (23.3% and 10/90 (11.1% were resistant to Isoniazid and Rifampicin, respectively, and 10/90 (11.1% strains were multidrug-resistant (MDR. Spoligotyping produced a total of 55 different patterns; 12/55 corresponded to clustered isolates (n=47, clustering rate of 52.2%, and 43/55 to unclustered isolates (19 patterns were designated as orphan by the SITVIT2 database. Database comparison led to designation of 36 shared types (SITs; 32 SITs (n=65 isolates matched a preexisting shared type in SITVIT2, whereas 4 SITs (n=6 isolates were newly created. Lineage classification based on principal genetic groups (PGG revealed that 10% of the strains belonged to PGG1 (Bovis and Manu lineages. Among PGG2/3 group, the most predominant clade was the Latin-American and Mediterranean (LAM in 27.8% of isolates, followed by Haarlem and T lineages. The number of single drug-resistant (DR and multidrug-resistant (MDR-TB isolates in this study was similar to previously reported in studies from adult population with risk factors. No association between the spoligotype, age, region, or resistance pattern was observed. However, contrary to a study on M. tuberculosis spoligotyping in Acapulco city that characterized a single cluster of SIT19 corresponding to the EAI2-Manila lineage in 70 (26% of patients, not a single SIT19 isolate was found in our pediatric patient population. Neither did we find any

  16. Comparison of bacteriological conversion and treatment outcomes among MDR-TB patients with and without diabetes in Mexico: Preliminary data

    Directory of Open Access Journals (Sweden)

    M. Muñoz-Torrico

    2017-01-01

    Full Text Available Diabetes mellitus (DM is a well-known risk factor for tuberculosis (TB. However, it is not known to what extent DM affects the outcome in patients with multidrug-resistant (MDR-TB and extensively drug-resistant TB (XDR-TB treated with second-line anti-TB drugs.The objective of this study was to compare the microbiological evolution (sputum smear and culture conversion and final outcomes of MDR/XDR-TB patients with and without DM, managed at the national TB reference centre in Mexico City. Results: Ninety patients were enrolled between 2010 and 2015: 73 with MDR-TB (81.1%, 11 with pre-XDR-TB (e.g. MDR-TB with additional resistance to one injectable drug or a fluoroquinolone, 12.2% and 6 (6.7% with XDR-TB. Out of these, 49 (54.4% had DM and 42 (86% were undergoing insulin treatment.No statistically significant differences were found in treatment outcomes comparing DM vs. non-DM MDR-TB cases: 18/32 (56.3% of DM cases and 19/24 (79.2% non DM patients achieved treatment success (p = 0.07. The time to sputum smear and culture conversion was longer (although not statistically in patients without DM, as follows: the mean (±SD time to sputum smear conversion was 53.9 (±31.4 days in DM patients and 65.2 (±34.8 days in non-DM ones (p = 0.15, while the time to culture conversion was 66.2 (±27.6 days for DM and 81.4 (±37.7 days for non-DM MDR-TB cases (p = 0.06. Conclusions: The study results support the Mexican National TB programme to strengthen its collaboration with the DM programme, as an entry point for TB (and latent TB infection screening and management. Keywords: Diabetes mellitus, Delay, Sputum and culture conversion, MDR-TB, High treatment adherence

  17. ASSESSMENT OF EFFECT OF MDR - TB/TB ON SOCIAL, FUNCTIONAL AND ECONOMIC WELL BEING OF PATIENTS – A CROSS SECTIONAL STUDY

    Directory of Open Access Journals (Sweden)

    Shiv Kumar

    2015-06-01

    Full Text Available CONTEXT : Tuberculosis is a contagious disease with social stigma attached to it. Various problems which are social and economic in nature are faced by TB patient. Therefore , it is essential to explore the overall effect of MDR - TB/TB on health and patients perception of Well - being. AIMS : To Document the effect of MDR - TB/TB on social , functional and economic well - being of patients. SETTINGS AND DESIGN : A Cross - sectional study , Conveniently Recruited 68 MDR - TB Patients and 136 non - MDR - TB Patients (from Rural as well as urban Area of Surat District diagnosed by CBNAAT were interviewed for investigating the effect of Tuberculosis. METHODS AND MATERIAL : A pre - tested standardized semi - structured questionnaire was used. Data was collected about socio - demographic profile of patients and interpreted in table. Data about effect of MDR - TB/TB was collected on Likert Scale and Frequency was calculated and Data wa s plotted on multiple bar charts. RESULTS : As compared to healthy status in the past , 93% MDR - TB and 82% TB patients have decreased ability to do work , about half of MDR - TB Patients and TB Patients have detiorated relations with family members , 67% of stud y participants have developed disharmonious relations with neighbor’s , 55% of Study participants have decreased income , 88% of study participants have decreased performance in day to day activities and 78% of study participants have faced discordial and di srespectful behavior from co - workers. CONCLUSION : Working ability more detiorated in MDR - TB patients while rest of the effect on social , functional and economic well - being is same in both TB and Multi Drug Resistant TB patients. This study emphasizes very clearly that social stigma still persist in community about Tuberculosis which needs to be eliminated in community by behavior change communication by health workers at all levels of health care.

  18. Folate decorated dual drug loaded nanoparticle: role of curcumin in enhancing therapeutic potential of nutlin-3a by reversing multidrug resistance.

    Directory of Open Access Journals (Sweden)

    Manasi Das

    Full Text Available Retinoblastoma is the most common intraocular tumor in children. Malfunctioning of many signaling pathways regulating cell survival or apoptosis, make the disease more vulnerable. Notably, resistance to chemotherapy mediated by MRP-1, lung-resistance protein (LRP is the most challenging aspect to treat this disease. Presently, much attention has been given to the recently developed anticancer drug nutlin-3a because of its non-genotoxic nature and potency to activate tumor suppressor protein p53. However, being a substrate of multidrug resistance protein MRP1 and Pgp its application has become limited. Currently, research has step towards reversing Multi drug resistance (MDR by using curcumin, however its clinical relevance is restricted by plasma instability and poor bioavailability. In the present investigation we tried to encapsulate nutlin-3a and curcumin in PLGA nanoparticle (NPs surface functionalized with folate to enhance therapeutic potential of nutlin-3a by modulating MDR. We document that curcumin can inhibit the expression of MRP-1 and LRP gene/protein in a concentration dependent manner in Y79 cells. In vitro cellular cytotoxicity, cell cycle analysis and apoptosis studies were done to compare the effectiveness of native drugs (single or combined and single or dual drug loaded nanoparticles (unconjugated/folate conjugated. The result demonstrated an augmented therapeutic efficacy of targeted dual drug loaded NPs (Fol-Nut-Cur-NPs over other formulation. Enhanced expression or down regulation of proapoptotic/antiapoptotic proteins respectively and down-regulation of bcl2 and NFκB gene/protein by Fol-Nut-Cur-NPs substantiate the above findings. This is the first investigation exploring the role of curcumin as MDR modulator to enhance the therapeutic potentiality of nutlin-3a, which may opens new direction for targeting cancer with multidrug resistance phenotype.

  19. P-glycoprotein targeted nanoscale drug carriers

    KAUST Repository

    Li, Wengang; Abu Samra, Dina Bashir Kamil; Merzaban, Jasmeen; Khashab, Niveen M.

    2013-01-01

    Multi-drug resistance (MDR) is a trend whereby tumor cells exposed to one cytotoxic agent develop cross-resistance to a range of structurally and functionally unrelated compounds. P -glycoprotein (P -gp) efflux pump is one of the mostly studied drug

  20. Antituberculosis drug resistance patterns in adults with tuberculous meningitis

    DEFF Research Database (Denmark)

    Senbayrak, Seniha; Ozkutuk, Nuri; Erdem, Hakan

    2015-01-01

    BACKGROUND: Tuberculous meningitis (TBM) caused by Mycobacterium tuberculosis resistant to antituberculosis drugs is an increasingly common clinical problem. This study aimed to evaluate drug resistance profiles of TBM isolates in adult patients in nine European countries involving 32 centers...

  1. Telomerase and drug resistance in cancer

    OpenAIRE

    Lipinska, Natalia; Romaniuk, Aleksandra; Paszel-Jaworska, Anna; Toton, Ewa; Kopczynski, Przemyslaw; Rubis, Blazej

    2017-01-01

    It is well known that a decreased expression or inhibited activity of telomerase in cancer cells is accompanied by an increased sensitivity to some drugs (e.g., doxorubicin, cisplatin, or 5-fluorouracil). However, the mechanism of the resistance resulting from telomerase alteration remains elusive. There are theories claiming that it might be associated with telomere shortening, genome instability, hTERT translocation, mitochondria functioning modulation, or even alterations in ABC family gen...

  2. Multi-drug resistant Ewingella Americana

    International Nuclear Information System (INIS)

    Bukhari, Syed Z.; Ashshi, Ahmad M.; Hussain, Waleed M.; Fatani, Mohammad I.

    2008-01-01

    We report a case of pneumonia due to multi-drug resistant Ewingella Americana in a young patient admitted in the Intensive Care Unit of Hera General Hospital, Makkah, Saudi Arabia with severe head injury in a road traffic accident. He was an Indonesian pilgrim who had traveled to the Kingdom of Saudi Arabia to perform Hajj in December 2007. Ewingella Americana was identified to be the pathogen of pneumonia with clinical signs and symptoms along with positive radiological findings. (author)

  3. Effectiveness and safety of imipenem/clavulanate and linezolid to treat multidrug and extensively drug-resistant tuberculosis at a referral hospital in Brazil.

    Science.gov (United States)

    Arbex, M A; Bonini, E H; Kawakame Pirolla, G; D'Ambrosio, L; Centis, R; Migliori, G B

    Evidence on effectiveness, safety, and tolerability of imipenem/clavulanate (IC) and linezolid containing regimens to treat multidrug-resistant (MDR-) and extensively drug-resistant tuberculosis (XDR-TB) is scarce. The aim of this observational study is to evaluate the therapeutic contribution of IC and linezolid to manage MDR/XDR-TB cases at the reference centre of São Paulo state, Brazil. Twelve patients (9 males, 1 HIV positive in antiretroviral treatment, 4 MDR, 8 XDR) were treated with IC, 11 of them within linezolid-containing regimens. They all were previously treated with treatment failure, for a median (IQR, interquartile range) of 4.5 (2-6.5) times, having a severe resistance pattern (median number of resistances: 7 (5-8)) and being sputum smear and culture positive. IC and linezolid were prescribed at the dose of 1000mg/day and 600mg/day, respectively. The overall exposure was (median (IQR)) 419 (375.5-658) days for IC and 678 (392-720) days for linezolid. All of them converted their sputum (time to sputum conversion; 60 (37.5-90) days) and culture (75 (60-135) days), and 7 were cured while 5 are still on treatment with a gradually improving clinical picture. While no adverse events were reported for IC, 2 minor side effects, only, were attributed to linezolid (17%); in both cases the drug was re-started without further problems. Our study suggests that IC and linezolid-containing regimens can be used safely and with satisfactory outcomes in reference centres to treat MDR/XDR-TB patients. Copyright © 2016 Sociedade Portuguesa de Pneumologia. Published by Elsevier España, S.L.U. All rights reserved.

  4. A study of multidrug-resistant tuberculosis in risk groups in the city of Santos, São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Andréa Gobetti Vieira Coelho

    2012-09-01

    Full Text Available Monitoring the extent of and trends in multidrug-resistant tuberculosis (MDR-TB is a priority of the Brazilian National Tuberculosis Control Programme. The current study aimed to estimate the incidence of MDR-TB, describe the profile of TB drug resistance in risk groups and examine whether screening for MDR-TB adhered to the recommended guidelines. A descriptive study that examined diagnosed cases of pulmonary TB was conducted in the city of Santos, Brazil, between 2000-2004. Of the 2,176 pulmonary TB cases studied, 671 (30.8% met the criteria for drug sensitivity testing and, of these cases, 31.7% (213/671 were tested. Among the tested cases, 9.4% were resistant to one anti-TB drug and 15% were MDR. MDR was observed in 11.6% of 86 new TB cases and 17.3% of 127 previously treated cases. The average annual incidence of MDR-TB was 1.9 per 100,000 inhabitants-years. The extent of known MDR-TB in the city of Santos is high, though likely to be underestimated. Our study therefore indicates an inadequate adherence to the guidelines for MDR-TB screening and suggests the necessity of alternative strategies of MDR-TB surveillance.

  5. Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

    Directory of Open Access Journals (Sweden)

    Stefan Niemann

    2009-10-01

    Full Text Available Mycobacterium tuberculosis complex (MTBC, the causative agent of tuberculosis (TB, is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients.Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1 and one multidrug resistant (MDR isolate (K-2 of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan. Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1 and 33.0 million (K-2 paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations.Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using

  6. Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

    Science.gov (United States)

    Niemann, Stefan; Köser, Claudio U; Gagneux, Sebastien; Plinke, Claudia; Homolka, Susanne; Bignell, Helen; Carter, Richard J; Cheetham, R Keira; Cox, Anthony; Gormley, Niall A; Kokko-Gonzales, Paula; Murray, Lisa J; Rigatti, Roberto; Smith, Vincent P; Arends, Felix P M; Cox, Helen S; Smith, Geoff; Archer, John A C

    2009-10-12

    Mycobacterium tuberculosis complex (MTBC), the causative agent of tuberculosis (TB), is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients. Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1) and one multidrug resistant (MDR) isolate (K-2) of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan). Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1) and 33.0 million (K-2) paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations. Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using standard

  7. Diversity of multi-drug resistant Acinetobacter baumannii population in a major hospital in Kuwait

    Directory of Open Access Journals (Sweden)

    Leila eVali

    2015-07-01

    Full Text Available Acinetobacter baumannii is one of the most important opportunistic pathogens that causes serious health care associated complications in critically ill patients. In the current study we report on the diversity of the clinical multi-drug resistant A. baumannii in Kuwait by molecular characterization. One hundred A. baumannii were isolated from one of the largest governmental hospitals in Kuwait. Following the identification of the isolates by molecular methods, the amplified blaOXA-51-like gene product of one isolate (KO-12 recovered from blood showed the insertion of the ISAba19 at position 379 in blaOXA-78. Of the 33 multi-drug resistant isolates, 28 (85% contained blaOXA-23, 2 (6% blaOXA-24 and 6 (18% blaPER-1 gene. We did not detect blaOXA-58, blaVIM, blaIMP, blaGES, blaVEB and blaNDM genes in any of the tested isolates. In 3 blaPER-1 positive isolates the genetic environment of blaPER-1 consisted of two copies of ISPa12 (tnpiA1 surrounding the blaPER-1 gene on a highly stable plasmid of ca. 140-kb. MLST analysis of the 33 A. baumannii isolates identified 20 different STs, of which 6 (ST-607, ST-608, ST-609, ST-610, ST-611 and ST-612 were novel. Emerging STs such as ST15 (identified for the first time in the Middle East, ST78 and ST25 were also detected. The predominant clonal complex was CC2. PFGE and MLST defined the MDR isolates as multi-clonal with diverse lineages. Our results lead us to believe that A. baumannii is diverse in clonal origins and / or is undergoing clonal expansion continuously while multiple lineages of MDR A. baumannii circulate in hospital wards simultaneously.

  8. Prevalence of drug-resistant pulmonary tuberculosis in India: systematic review and meta-analysis.

    Science.gov (United States)

    Goyal, Vishal; Kadam, Vijay; Narang, Prashant; Singh, Vikram

    2017-10-17

    Drug-resistant pulmonary tuberculosis (DR-TB) is a significant public health issue that considerably deters the ongoing TB control efforts in India. The purpose of this review was to investigate the prevalence of DR-TB and understand the regional variation in resistance pattern across India from 1995 to 2015, based on a large body of published epidemiological studies. A systematic review of published studies reporting prevalence of DR-TB from biomedical databases (PubMed and IndMed) was conducted. Meta-analysis was performed using random effects model and the pooled prevalence estimate (95% confidence interval [CI]) of DR-TB, multidrug resistant (MDR-) TB, pre-extensively drug-resistant (pre-XDR) TB and XDR-TB were calculated across two study periods (decade 1: 1995 to 2005; decade 2: 2006 to 2015), countrywide and in different regions. Heterogeneity in this meta-analysis was assessed using I 2 statistic. A total of 75 of 635 screened studies that fulfilled the inclusion criteria were selected. Over 40% of 45,076 isolates suspected for resistance to any first-line anti-TB drugs tested positive. Comparative analysis revealed a worsening trend in DR-TB between the two study decades (decade 1: 37.7% [95% CI = 29.0; 46.4], n = 25 vs decade 2: 46.1% [95% CI = 39.0; 53.2], n = 36). The pooled estimate of MDR-TB resistance was higher in previously treated patients (decade 1: 29.8% [95% CI = 20.7; 39.0], n = 13; decade 2: 35.8% [95% CI = 29.2; 42.4], n = 24) as compared with the newly diagnosed cases (decade 1: 4.1% [95% CI = 2.7; 5.6], n = 13; decade 2: 5.6% [95% CI = 3.8; 7.4], n = 17). Overall, studies from Western states of India reported highest prevalence of DR-TB (57.8% [95% CI = 37.4; 78.2], n = 6) and MDR-TB (39.9% [95% CI = 21.7; 58.0], n = 6) during decade 2. Prevalence of pre-XDR TB was 7.9% (95% CI = 4.4; 11.4, n = 5) with resistance to fluoroquinolone (66.3% [95% CI = 58.2; 74.4], n = 5) being the highest. The

  9. Copper bis(diphosphine) complexes: radiopharmaceuticals for the detection of multi-drug resistance in tumours by PET

    International Nuclear Information System (INIS)

    Lewis, J.S.; Dearling, J.L.S.; Blower, P.J.; Sosabowski, J.K.; Zweit, J.; Carnochan, P.; Kelland, L.R.; Coley, H.M.

    2000-01-01

    Experience with imaging of the multi-drug resistance (MDR) phenotype in tumours using technetium-99m sestamibi, a substrate of the P-glycoprotein (Pgp) transporter, suggests that better quantification of images and separation of MDR from other variables affecting tracer uptake in tumours are required. One approach to these problems is the development of short half-life positron-emitting tracers which are substrates of Pgp. Several lipophilic cationic copper(I) bis(diphosphine) complexes labelled with copper-64 have been synthesised and evaluated in vitro as substrates for Pgp. The synthesis is rapid and efficient with no need for purification steps. The chemistry is suitable for use with very short half-life radionuclides such as copper-62 (9.7 min) and copper-60 (23.7 min). Incubation of the complexes with human serum in vitro showed that they are sufficiently stable in serum to support clinical imaging, and the more lipophilic members of the series are taken up rapidly by cells (Chinese hamster ovary and human ovarian carcinoma) in vitro with great avidity. Uptake in human ovarian carcinoma cells is significantly reduced after several months of conditioning in the presence of doxorubicin, which induces increased Pgp expression. Uptake in hooded rat sarcoma (HSN) cells, which express Pgp, is significantly increased in the presence of the MDR modulator cyclosporin A. Biodistribution studies in hooded rats show rapid blood clearance, excretion through both kidneys and liver, and low uptake in other tissues. The one complex investigated in HSN tumour-bearing rats showed uptake in tumour increasing up to 30 min p.i. while it was decreasing in other tissues. We conclude that diphosphine ligands offer a good basis for development of radiopharmaceuticals containing copper radionuclides, and that this series of complexes should undergo further evaluation in vivo as positron emission tomography imaging agents for MDR. (orig.)

  10. Reversal of the multidrug resistance by drug combination using multifunctional liposomes

    Science.gov (United States)

    Patel, Niravkumar R.

    One of the major obstacles to the success of cancer chemotherapy is the multi-drug resistance (MDR) that results due mainly to the over-expression of drug efflux transporter pumps such as P-glycoprotein (P-gp). Highly efficacious third generation P-gp inhibitors, like tariquidar, have shown promising results against MDR. However, P-gp is also expressed in normal tissues like the blood-brain barrier, gastrointestinal tract, liver and kidney. It is therefore important to limit the exposure of P-gp inhibitors to normal tissues and increase their co-localization with anticancer agents in tumor tissues to maximize the efficacy of a P-gp inhibitor. To minimize non-specific binding and increase its delivery to tumor tissues, liposomes, self-assembling phospholipid vesicles, were chosen as a drug delivery vehicle. The liposome has been identified as a system capable of carrying molecules with diverse physicochemical properties. It can also alter the pharmacokinetic profile of loaded molecules which is a concern with both tariquidar and paclitaxel. Liposomes can easily be surface-modified rendering them cell-specific as well as organelle-specific. The main objective of present study was to develop an efficient liposomal delivery system which would deliver therapeutic molecules of interest to tumor tissues and avoid interaction with normal tissues. In this study, the co-delivery of tariquidar and paclitaxel into tumor cells to reverse the MDR using long-circulating cationic liposomes was investigated. SKOV-3TR, the resistant variant of SKOV-3 and MCF-7/ADR, the resistant variant of MCF-7 were used as model cell lines. Uniform liposomal formulations were generated with high incorporation efficiency and no apparent decrease in tariquidar potency towards P-gp. Tariquidar- and paclitaxel- co-loaded long-circulating liposomes showed significant re-sensitization of SKOV-3TR and MCF-7/ADR for paclitaxel in vitro. Further modification of these liposomes with antitumor 2C5 resulted

  11. The expression and significance of multi-drug resistance genes in breast cancer stem cells%乳腺癌干细胞多药耐药基因的表达及意义

    Institute of Scientific and Technical Information of China (English)

    Zhi Li; Chunping Liu; Yanli He; Jinghui Zhang; Tao Huang

    2008-01-01

    Objective:To approach the expressions of MDR1 and BCRP in breast cancer stem cells and differentiated cells.Methods:The breast cancer stem calls were separated from human breast cancer primary tissues and MCF-7 by flow cytometry.Then we measured the expressions of MDR1 and BCRP with different subset cells by Realtime-PCR.Results:Contrasted with breast cancer differentiated cells,the expressions of MDR1 and BCRP in breast cancer stem calls were higher (P<0.01),and the proportion of stem cells rose after chemotherapy (P<0.01).Conclusion:Contrasted with breast cancer differentiated cells,breast cancer stem cells have stronger ability of clrug-resistanca with higher level of multi-drug resistance genes,and it is one of key points for chemotherapy failure of breast cancer.

  12. Thermodynamic secrets of multidrug resistance: A new take on transport mechanisms of secondary active antiporters.

    Science.gov (United States)

    Zhang, Xuejun C; Liu, Min; Lu, Guangyuan; Heng, Jie

    2018-03-01

    Multidrug resistance (MDR) presents a growing challenge to global public health. Drug extrusion transporters play a critical part in MDR; thus, their mechanisms of substrate recognition are being studied in great detail. In this work, we review common structural features of key transporters involved in MDR. Based on our membrane potential-driving hypothesis, we propose a general energy-coupling mechanism for secondary-active antiporters. This putative mechanism provides a common framework for understanding poly-specificity of most-if not all-MDR transporters. © 2017 The Protein Society.

  13. In vitro activity of potential old and new drugs against multidrug-resistant gram-negatives.

    Science.gov (United States)

    Rizek, Camila; Ferraz, Juliana Rosa; van der Heijden, Inneke Marie; Giudice, Mauro; Mostachio, Anna Karina; Paez, Jorge; Carrilho, Claudia; Levin, Anna Sara; Costa, Silvia F

    2015-02-01

    The aim of this study was to evaluate the in vitro susceptibility of MDR gram-negatives bacteria to old drugs such as polymyxin B, minocycline and fosfomycin and new drugs such as tigecycline. One hundred and fifty-three isolates from 4 Brazilian hospitals were evaluated. Forty-seven Acinetobacter baumannii resistant to carbapenens harboring adeB, blaOxA23, blaOxA51, blaOxA143 and blaIMP genes, 48 Stenotrophomonas maltophilia including isolates resistant to levofloxacin and/or trimethoprim-sulfamethoxazole harboring sul-1, sul-2 and qnrMR and 8 Serratia marcescens and 50 Klebsiella pneumoniae resistant to carbapenens harboring blaKPC-2 were tested to determine their minimum inhibitory concentrations (MICs) by microdilution to the following drugs: minocycline, ampicillin-sulbactam, tigecycline, and polymyxin B and by agar dilution to fosfomycin according with breakpoint criteria of CLSI and EUCAST (fosfomycin). In addition, EUCAST fosfomycin breakpoint for Pseudomonas spp. was applied for Acinetobacter spp and S. maltophilia, the FDA criteria for tigecycline was used for Acinetobacter spp and S. maltophilia and the Pseudomonas spp polymyxin B CLSI criterion was used for S. maltophilia. Tigecycline showed the best in vitro activity against the MDR gram-negative evaluated, followed by polymyxin B and fosfomycin. Polymyxin B resistance among K. pneumoniae was detected in 6 isolates, using the breakpoint of MIC > 8 ug/mL. Two of these isolates were resistant to tigecycline. Minocycline was tested only against S. maltophilia and A. baumannii and showed excellent activity against both. Fosfomycin seems to not be an option to treat infections due to the A. baumannii and S. maltophilia isolates according with EUCAST breakpoint, on the other hand, showed excellent activity against S. marcescens and K. pneumoniae. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  14. Targeting glucosylceramide synthase induction of cell surface globotriaosylceramide (Gb3) in acquired cisplatin-resistance of lung cancer and malignant pleural mesothelioma cells

    Energy Technology Data Exchange (ETDEWEB)

    Tyler, Andreas, E-mail: andreas.tyler@medbio.umu.se [Department of Medical Biosciences, Umeå University, S-901 85 Umea (Sweden); Johansson, Anders [Department of Odontology, Umeå University, S-901 85 Umea (Sweden); Karlsson, Terese [Department of Radiation Sciences, Oncology, S-901 85 Umea (Sweden); Gudey, Shyam Kumar; Brännström, Thomas; Grankvist, Kjell; Behnam-Motlagh, Parviz [Department of Medical Biosciences, Umeå University, S-901 85 Umea (Sweden)

    2015-08-01

    Background: Acquired resistance to cisplatin treatment is a caveat when treating patients with non-small cell lung cancer (NSCLC) and malignant pleural mesothelioma (MPM). Ceramide increases in response to chemotherapy, leading to proliferation arrest and apoptosis. However, a tumour stress activation of glucosylceramide synthase (GCS) follows to eliminate ceramide by formation of glycosphingolipids (GSLs) such as globotriaosylceramide (Gb3), the functional receptor of verotoxin-1. Ceramide elimination enhances cell proliferation and apoptosis blockade, thus stimulating tumor progression. GSLs transactivate multidrug resistance 1/P-glycoprotein (MDR1) and multidrug resistance-associated protein 1 (MRP1) expression which further prevents ceramide accumulation and stimulates drug efflux. We investigated the expression of Gb3, MDR1 and MRP1 in NSCLC and MPM cells with acquired cisplatin resistance, and if GCS activity or MDR1 pump inhibitors would reduce their expression and reverse cisplatin-resistance. Methods: Cell surface expression of Gb3, MDR1 and MRP1 and intracellular expression of MDR1 and MRP1 was analyzed by flow cytometry and confocal microscopy on P31 MPM and H1299 NSCLC cells and subline cells with acquired cisplatin resistance. The effect of GCS inhibitor PPMP and MDR1 pump inhibitor cyclosporin A for 72 h on expression and cisplatin cytotoxicity was tested. Results: The cisplatin-resistant cells expressed increased cell surface Gb3. Cell surface Gb3 expression of resistant cells was annihilated by PPMP whereas cyclosporin A decreased Gb3 and MDR1 expression in H1299 cells. No decrease of MDR1 by PPMP was noted in using flow cytometry, whereas a decrease of MDR1 in H1299 and H1299res was indicated with confocal microscopy. No certain co-localization of Gb3 and MDR1 was noted. PPMP, but not cyclosporin A, potentiated cisplatin cytotoxicity in all cells. Conclusions: Cell surface Gb3 expression is a likely tumour biomarker for acquired cisplatin

  15. JNK signaling maintains the mesenchymal properties of multi-drug resistant human epidermoid carcinoma KB cells through snail and twist1

    International Nuclear Information System (INIS)

    Zhan, Xia; Feng, Xiaobing; Kong, Ying; Chen, Yi; Tan, Wenfu

    2013-01-01

    In addition to possess cross drug resistance characteristic, emerging evidences have shown that multiple-drug resistance (MDR) cancer cells exhibit aberrant metastatic capacity when compared to parental cells. In this study, we explored the contribution of c-Jun N-terminal kinases (JNK) signaling to the mesenchymal phenotypes and the aberrant motile capacity of MDR cells utilizing a well characterized MDR cell line KB/VCR, which is established from KB human epidermoid carcinoma cells by vincristine (VCR), and its parental cell line KB. Taking advantage of experimental strategies including pharmacological tool and gene knockdown, we showed here that interference with JNK signaling pathway by targeting JNK1/2 or c-Jun reversed the mesenchymal properties of KB/VCR cells to epithelial phenotypes and suppressed the motile capacity of KB/VCR cells, such as migration and invasion. These observations support a critical role of JNK signaling in maintaining the mesenchymal properties of KB/VCR cells. Furthermore, we observed that JNK signaling may control the expression of both snail and twist1 in KB/VCR cells, indicating that both snail and twist1 are involved in controlling the mesenchymal characteristics of KB/VCR cells by JNK signaling. JNK signaling is required for maintaining the mesenchymal phenotype of KB/VCR cells; and JNK signaling may maintain the mesenchymal characteristics of KB/VCR cells potentially through snail and twist1

  16. JNK signaling maintains the mesenchymal properties of multi-drug resistant human epidermoid carcinoma KB cells through snail and twist1.

    Science.gov (United States)

    Zhan, Xia; Feng, Xiaobing; Kong, Ying; Chen, Yi; Tan, Wenfu

    2013-04-04

    In addition to possess cross drug resistance characteristic, emerging evidences have shown that multiple-drug resistance (MDR) cancer cells exhibit aberrant metastatic capacity when compared to parental cells. In this study, we explored the contribution of c-Jun N-terminal kinases (JNK) signaling to the mesenchymal phenotypes and the aberrant motile capacity of MDR cells utilizing a well characterized MDR cell line KB/VCR, which is established from KB human epidermoid carcinoma cells by vincristine (VCR), and its parental cell line KB. Taking advantage of experimental strategies including pharmacological tool and gene knockdown, we showed here that interference with JNK signaling pathway by targeting JNK1/2 or c-Jun reversed the mesenchymal properties of KB/VCR cells to epithelial phenotypes and suppressed the motile capacity of KB/VCR cells, such as migration and invasion. These observations support a critical role of JNK signaling in maintaining the mesenchymal properties of KB/VCR cells. Furthermore, we observed that JNK signaling may control the expression of both snail and twist1 in KB/VCR cells, indicating that both snail and twist1 are involved in controlling the mesenchymal characteristics of KB/VCR cells by JNK signaling. JNK signaling is required for maintaining the mesenchymal phenotype of KB/VCR cells; and JNK signaling may maintain the mesenchymal characteristics of KB/VCR cells potentially through snail and twist1.

  17. MicroRNA Expression Profiles Associated with Development of Drug Resistance in Ehrlich Ascites Tumor Cells

    DEFF Research Database (Denmark)

    Husted, Susanne; Søkilde, Rolf; Rask, Lene

    2011-01-01

    Multidrug resistance (MDR) poses a major obstacle to successful chemotherapeutic treatment of cancer, and often involves multiple genes, which may be regulated post-transcriptionally by microRNAs (miRNAs). The purpose of the present study was therefore to identify any resistance-associated change...

  18. Quercetin suppresses drug-resistant spheres via the p38 MAPK-Hsp27 apoptotic pathway in oral cancer cells.

    Directory of Open Access Journals (Sweden)

    Su-Feng Chen

    Full Text Available BACKGROUND: Treatment failure in oral squamous cell carcinoma (OSCC leading to local recurrence(s and metastases is mainly due to drug resistance. Cancer stem cells (CSCs are thought be responsible for the development of drug resistance. However, the correlations between CSCs, drug resistance, and new strategy against drug resistance in OSCC remain elusive. METHODS: A drug-resistant sphere (DRSP model was generated by using a nonadhesive culture system to induce drug-resistant cells from SCC25 oral cancer cells. A comparative analysis was performed between the parent control cells and DRSPs with a related treatment strategy focusing on the expression of epithelial-mesenchymal transition (EMT-associated markers, drug-resistance-related genes, and CSC properties in vitro, as well as tumorigenicity and the regimen for tumor regression in vivo. RESULTS: Our data show the presence of a phenomenon of EMT with gradual cellular transition from an epithelioid to mesenchymal-like spheroid morphology during induction of drug resistance. The characterization of DRSPs revealed the upregulation of the drug-resistance-related genes ABCG2 and MDR-1 and of CSC-representative markers, suggesting that DRSPs have greater resistance to cisplatin (Cis and stronger CSC properties compared with the control. Moreover, overexpression of phosphorylated heat-shock protein 27 (p-Hsp27 via the activation of p38 MAPK signaling was observed in DRSPs. Knockdown of Hsp27 decreased Cis resistance and induced apoptosis in DRSPs. Furthermore, an inhibitor of Hsp27, quercetin (Qu, suppressed p-Hsp27 expression, with alterations of the EMT signature, leading to the promotion of apoptosis in DRSPs. A xenographic study also confirmed the increase of tumorigenicity in DRSPs. The combination of Qu and Cis can reduce tumor growth and decrease drug resistance in OSCC. CONCLUSIONS: The p38 MAPK-Hsp27 axis plays an important role in CSCs-mediated drug resistance in OSCC. Targeting this axis

  19. Advances in nanotechnology-based carrier systems for targeted delivery of bioactive drug molecules with special emphasis on immunotherapy in drug resistant tuberculosis - a critical review.

    Science.gov (United States)

    Singh, Jagdeep; Garg, Tarun; Rath, Goutam; Goyal, Amit K

    2016-06-01

    From the early sixteenth and seventeenth centuries to the present day of life, tuberculosis (TB) still is a global health threat with some new emergence of resistance. This type of emergence poses a vital challenge to control TB cases across the world. Mortality and morbidity rates are high due to this new face of TB. The newer nanotechnology-based drug-delivery approaches involving micro-metric and nano-metric carriers are much needed at this stage. These delivery systems would provide more advantages over conventional systems of treatment by producing enhanced therapeutic efficacy, uniform distribution of drug molecule to the target site, sustained and controlled release of drug molecules and lesser side effects. The main aim to develop these novel drug-delivery systems is to improve the patient compliance and reduce therapy time. This article reviews and elaborates the new concepts and drug-delivery approaches for the treatment of TB involving solid-lipid particulate drug-delivery systems (solid-lipid micro- and nanoparticles, nanostructured lipid carriers), vesicular drug-delivery systems (liposomes, niosomes and liposphere), emulsion-based drug-delivery systems (micro and nanoemulsion) and some other novel drug-delivery systems for the effective treatment of tuberculosis and role of immunomodulators as an adjuvant therapy for management of MDR-TB and XDR-TB.

  20. Prediction of resistance development against drug combinations by collateral responses to component drugs

    DEFF Research Database (Denmark)

    Munck, Christian; Gumpert, Heidi; Nilsson Wallin, Annika

    2014-01-01

    the genomes of all evolved E. coli lineages, we identified the mutational events that drive the differences in drug resistance levels and found that the degree of resistance development against drug combinations can be understood in terms of collateral sensitivity and resistance that occurred during...... adaptation to the component drugs. Then, using engineered E. coli strains, we confirmed that drug resistance mutations that imposed collateral sensitivity were suppressed in a drug pair growth environment. These results provide a framework for rationally selecting drug combinations that limit resistance......Resistance arises quickly during chemotherapeutic selection and is particularly problematic during long-term treatment regimens such as those for tuberculosis, HIV infections, or cancer. Although drug combination therapy reduces the evolution of drug resistance, drug pairs vary in their ability...

  1. E-health systems for management of MDR-TB in resource-poor environments: a decade of experience and recommendations for future work.

    Science.gov (United States)

    Fraser, Hamish S F; Habib, Ali; Goodrich, Mark; Thomas, David; Blaya, Joaquin A; Fils-Aime, Joseph Reginald; Jazayeri, Darius; Seaton, Michael; Khan, Aamir J; Choi, Sharon S; Kerrison, Foster; Falzon, Dennis; Becerra, Mercedes C

    2013-01-01

    Multi-drug resistant TB (MDR-TB) is a complex infectious disease that is a growing threat to global health. It requires lengthy treatment with multiple drugs and specialized laboratory testing. To effectively scale up treatment to thousands of patients requires good information systems to support clinical care, reporting, drug forecasting, supply chain management and monitoring. Over the last decade we have developed the PIH-EMR electronic medical record system, and subsequently OpenMRS-TB, to support the treatment of MDR-TB in Peru, Haiti, Pakistan, and other resource-poor environments. We describe here the experience with implementing these systems and evaluating many aspects of their performance, and review other systems for MDR-TB management. We recommend a new approach to information systems to address the barriers to scale up MDR-TB treatment, particularly access to the appropriate drugs and lab data. We propose moving away from fragmented, vertical systems to focus on common platforms, addressing all stages of TB care, support for open data standards and interoperability, care for a wide range of diseases including HIV, integration with mHealth applications, and ability to function in resource-poor environments.

  2. Lysosomes as mediators of drug resistance in cancer.

    Science.gov (United States)

    Zhitomirsky, Benny; Assaraf, Yehuda G

    2016-01-01

    Drug resistance remains a leading cause of chemotherapeutic treatment failure and cancer-related mortality. While some mechanisms of anticancer drug resistance have been well characterized, multiple mechanisms remain elusive. In this respect, passive ion trapping-based lysosomal sequestration of multiple hydrophobic weak-base chemotherapeutic agents was found to reduce the accessibility of these drugs to their target sites, resulting in a markedly reduced cytotoxic effect and drug resistance. Recently we have demonstrated that lysosomal sequestration of hydrophobic weak base drugs triggers TFEB-mediated lysosomal biogenesis resulting in an enlarged lysosomal compartment, capable of enhanced drug sequestration. This study further showed that cancer cells with an increased number of drug-accumulating lysosomes are more resistant to lysosome-sequestered drugs, suggesting a model of drug-induced lysosome-mediated chemoresistance. In addition to passive drug sequestration of hydrophobic weak base chemotherapeutics, other mechanisms of lysosome-mediated drug resistance have also been reported; these include active lysosomal drug sequestration mediated by ATP-driven transporters from the ABC superfamily, and a role for lysosomal copper transporters in cancer resistance to platinum-based chemotherapeutics. Furthermore, lysosomal exocytosis was suggested as a mechanism to facilitate the clearance of chemotherapeutics which highly accumulated in lysosomes, thus providing an additional line of resistance, supplementing the organelle entrapment of chemotherapeutics away from their target sites. Along with these mechanisms of lysosome-mediated drug resistance, several approaches were recently developed for the overcoming of drug resistance or exploiting lysosomal drug sequestration, including lysosomal photodestruction and drug-induced lysosomal membrane permeabilization. In this review we explore the current literature addressing the role of lysosomes in mediating cancer drug

  3. Predicted levels of HIV drug resistance

    DEFF Research Database (Denmark)

    Cambiano, Valentina; Bertagnolio, Silvia; Jordan, Michael R

    2014-01-01

    -term effects. METHODS: The previously validated HIV Synthesis model was calibrated to South Africa. Resistance was modeled at the level of single mutations, transmission potential, persistence, and effect on drug activity. RESULTS: We estimate 652 000 people (90% uncertainty range: 543 000-744 000) are living...... are maintained, in 20 years' time HIV incidence is projected to have declined by 22% (95% confidence interval, CI -23 to -21%), and the number of people carrying NNRTI resistance to be 2.9-fold higher. If enhancements in diagnosis and retention in care occur, and ART is initiated at CD4 cell count less than 500......  cells/μl, HIV incidence is projected to decline by 36% (95% CI: -37 to -36%) and the number of people with NNRTI resistance to be 4.1-fold higher than currently. Prevalence of people with viral load more than 500  copies/ml carrying NRMV is not projected to differ markedly according to future ART...

  4. Molecular epidemiology and drug resistant mechanism in carbapenem-resistant Klebsiella pneumoniae isolated from pediatric patients in Shanghai, China.

    Science.gov (United States)

    Zhang, Xingyu; Chen, Di; Xu, Guifeng; Huang, Weichun; Wang, Xing

    2018-01-01

    Infection by carbapenem-resistant Klebsiella pneumoniae (CR-KP) is a public health challenge worldwide, in particular among children, which was associated with high morbidity and mortality rates. There was limited data in pediatric populations, thus this study aimed to investigate molecular epidemiology and drug resistant mechanism of CR-KP strains from pediatric patients in Shanghai, China. A total of 41 clinical CR-KP isolates from sputum, urine, blood or drainage fluid were collected between July 2014 and May 2015 in Shanghai Children's Medical Center. Multilocus sequence typing (MLST), antibiotic susceptibility testing, PCR amplification and sequencing of the drug resistance associated genes were applied to all these isolates. MLST analysis revealed 16 distinct STs identified within the 41 isolates, among which the most frequently represented were ST11(19.5%),ST25(14.6%),ST76(14.6%),ST37(9.8%).One new ST was first identified. All CR-KP isolates showed MDR phenotypes and were resistance to ceftazidime, imipenem, piperacillin / tazobactam, ceftriaxone, ampicillin /sulbactam, aztreonam. They were confirmed as carbapenemase producer, NDM-1 (56.1%, 23/41), IMP (26.8%, 11/41), KPC-2 (22.0%, 9/41) were detected. Of note, two isolates carried simultaneously both NDM-1 and IMP-4. All CR-KP strains contained at least one of extended spectrum β-lactamase genes tested(TEM, SHV, OXA-1, CTX-M group) and six isolates carried both ESBL and AmpC genes(DHA-1). Among the penicllinase and β-lactamase genes, the most frequently one is SHV(92.7%,38/41), followed by TEM-1(68.3%,28/41), CTX-M-14(43.9%,18/41), CTX-M-15(43.9%,14/41), OXA-1(14.6%,6/41). In the present study, NDM-1-producing isolates was the predominant CR-KP strains in children, follow by IMP and KPC-producing strains. NDM-1and IMP-4 were more frequent than KPC-2 and showed a multiclonal background. Those suggested carbapenem-resistant in children is diverse, and certain resistance mechanisms differ from prevalent

  5. Studies of the impact of occupational exposure of pharmaceutical workers on the development of antimicrobial drug resistance.

    Science.gov (United States)

    Sarker, Md Moklesur Rahman; Islam, Kamrun Nahar; Huri, Hasniza Zaman; Rahman, Monzur; Imam, Hasan; Hosen, Md Biplob; Mohammad, Nur; Sarker, Md Zaidul Islam

    2014-01-01

    Pharmaceutical workers involved with the production of antimicrobial drugs are exposed to various antimicrobial chemicals in different steps of manufacturing such as grinding, sieving, compression, granulation, mixing and filling. These exposures may lead to the development of multidrug resistance (MDR) in bacteria. Scientific reports on the occupational health hazard of pharmaceutical workers involved in manufacturing antibiotics are scarce. The present study aimed to compare the degree of bacterial resistance in pharmaceutical workers in Bangladesh to that of individuals not involved in the pharmaceutical field. Twenty male workers from five local pharmaceutical companies and twenty male subjects not involved in the pharmaceutical field (non-pharmaceutical subjects) were randomly selected. Nasal fluid, mucus/cough and stool specimens were collected from each subject and were cultured separately at 37°C for 24 hours to obtain bacterial growth. The cultured species were then identified, isolated and subjected to microbial sensitivity testing against 18 different antibiotics from eight different groups by the disk diffusion method. Staphylococcus spp., Pseudomonas spp. and Escherichia coli were identified and isolated from the culture of nasal fluids, mucuses and stools, respectively. All the isolated species of bacteria exhibited significant enhancement of the degree of MDR in pharmaceutical workers compared with non-pharmaceutical subjects. Workers with a longer working history had greater degree of antibiotic resistance and vice versa. It can be certainly considered that the exposure of pharmaceutical workers to antibiotic agents resulted in a high incidence of multidrug resistance. Effective steps should be taken to minimize inherent exposure of pharmaceutical workers to antibiotics during work to prevent antimicrobial drug resistance.

  6. Young Women's Experiences of Resisting Invitations to Use Illicit Drugs

    Science.gov (United States)

    Koehn, Corinne V.; O'Neill, Linda K.

    2011-01-01

    Ten young women were interviewed regarding their experiences of resisting invitations to use illicit drugs. Hermeneutic phenomenology was used to gather and analyze information. One key theme was the motivations that inspired women to refuse drug offers. Young women resisted drug invitations because of their desires to be authentic, protect their…

  7. Prevalence of drug resistant tuberculosis in Arsi Zone, Ethiopia ...

    African Journals Online (AJOL)

    Background: Wide spread of occurrence of multi-drug resistance tuberculosis is becoming a major challenge to effective tuberculosis control. Thus, it is imperative to monitor the sensitivity of anti-TB drugs regularly. Objective: To determine the prevalence resistance to anti-TB drugs in a well established control program area ...

  8. Artemether resistance in vitro is linked to mutations in PfATP6 that also interact with mutations in PfMDR1 in travellers returning with Plasmodium falciparum infections.

    KAUST Repository

    Pillai, Dylan R; Lau, Rachel; Khairnar, Krishna; Lepore, Rosalba; Via, Allegra; Staines, Henry M; Krishna, Sanjeev

    2012-01-01

    BACKGROUND: Monitoring resistance phenotypes for Plasmodium falciparum, using in vitro growth assays, and relating findings to parasite genotype has proved particularly challenging for the study of resistance to artemisinins. METHODS: Plasmodium falciparum isolates cultured from 28 returning travellers diagnosed with malaria were assessed for sensitivity to artemisinin, artemether, dihydroartemisinin and artesunate and findings related to mutations in pfatp6 and pfmdr1. RESULTS: Resistance to artemether in vitro was significantly associated with a pfatp6 haplotype encoding two amino acid substitutions (pfatp6 A623E and S769N; (mean IC50 (95% CI) values of 8.2 (5.7 - 10.7) for A623/S769 versus 623E/769 N 13.5 (9.8 - 17.3) nM with a mean increase of 65%; p = 0.012). Increased copy number of pfmdr1 was not itself associated with increased IC50 values for artemether, but when interactions between the pfatp6 haplotype and increased copy number of pfmdr1 were examined together, a highly significant association was noted with IC50 values for artemether (mean IC50 (95% CI) values of 8.7 (5.9 - 11.6) versus 16.3 (10.7 - 21.8) nM with a mean increase of 87%; p = 0.0068). Previously described SNPs in pfmdr1 are also associated with differences in sensitivity to some artemisinins. CONCLUSIONS: These findings were further explored in molecular modelling experiments that suggest mutations in pfatp6 are unlikely to affect differential binding of artemisinins at their proposed site, whereas there may be differences in such binding associated with mutations in pfmdr1. Implications for a hypothesis that artemisinin resistance may be exacerbated by interactions between PfATP6 and PfMDR1 and for epidemiological studies to monitor emerging resistance are discussed.

  9. Artemether resistance in vitro is linked to mutations in PfATP6 that also interact with mutations in PfMDR1 in travellers returning with Plasmodium falciparum infections.

    KAUST Repository

    Pillai, Dylan R

    2012-04-27

    BACKGROUND: Monitoring resistance phenotypes for Plasmodium falciparum, using in vitro growth assays, and relating findings to parasite genotype has proved particularly challenging for the study of resistance to artemisinins. METHODS: Plasmodium falciparum isolates cultured from 28 returning travellers diagnosed with malaria were assessed for sensitivity to artemisinin, artemether, dihydroartemisinin and artesunate and findings related to mutations in pfatp6 and pfmdr1. RESULTS: Resistance to artemether in vitro was significantly associated with a pfatp6 haplotype encoding two amino acid substitutions (pfatp6 A623E and S769N; (mean IC50 (95% CI) values of 8.2 (5.7 - 10.7) for A623/S769 versus 623E/769 N 13.5 (9.8 - 17.3) nM with a mean increase of 65%; p = 0.012). Increased copy number of pfmdr1 was not itself associated with increased IC50 values for artemether, but when interactions between the pfatp6 haplotype and increased copy number of pfmdr1 were examined together, a highly significant association was noted with IC50 values for artemether (mean IC50 (95% CI) values of 8.7 (5.9 - 11.6) versus 16.3 (10.7 - 21.8) nM with a mean increase of 87%; p = 0.0068). Previously described SNPs in pfmdr1 are also associated with differences in sensitivity to some artemisinins. CONCLUSIONS: These findings were further explored in molecular modelling experiments that suggest mutations in pfatp6 are unlikely to affect differential binding of artemisinins at their proposed site, whereas there may be differences in such binding associated with mutations in pfmdr1. Implications for a hypothesis that artemisinin resistance may be exacerbated by interactions between PfATP6 and PfMDR1 and for epidemiological studies to monitor emerging resistance are discussed.

  10. GEAR: A database of Genomic Elements Associated with drug Resistance

    Science.gov (United States)

    Wang, Yin-Ying; Chen, Wei-Hua; Xiao, Pei-Pei; Xie, Wen-Bin; Luo, Qibin; Bork, Peer; Zhao, Xing-Ming

    2017-01-01

    Drug resistance is becoming a serious problem that leads to the failure of standard treatments, which is generally developed because of genetic mutations of certain molecules. Here, we present GEAR (A database of Genomic Elements Associated with drug Resistance) that aims to provide comprehensive information about genomic elements (including genes, single-nucleotide polymorphisms and microRNAs) that are responsible for drug resistance. Right now, GEAR contains 1631 associations between 201 human drugs and 758 genes, 106 associations between 29 human drugs and 66 miRNAs, and 44 associations between 17 human drugs and 22 SNPs. These relationships are firstly extracted from primary literature with text mining and then manually curated. The drug resistome deposited in GEAR provides insights into the genetic factors underlying drug resistance. In addition, new indications and potential drug combinations can be identified based on the resistome. The GEAR database can be freely accessed through http://gear.comp-sysbio.org. PMID:28294141

  11. Carbapenems to Treat Multidrug and Extensively Drug-Resistant Tuberculosis: A Systematic Review.

    Science.gov (United States)

    Sotgiu, Giovanni; D'Ambrosio, Lia; Centis, Rosella; Tiberi, Simon; Esposito, Susanna; Dore, Simone; Spanevello, Antonio; Migliori, Giovanni Battista

    2016-03-12

    Carbapenems (ertapenem, imipenem, meropenem) are used to treat multidrug-resistant (MDR-) and extensively drug-resistant tuberculosis (XDR-TB), even if the published evidence is limited, particularly when it is otherwise difficult to identify the recommended four active drugs to be included in the regimen. No systematic review to date has ever evaluated the efficacy, safety, and tolerability of carbapenems. A search of peer-reviewed, scientific evidence was carried out, aimed at evaluating the efficacy/effectiveness, safety, and tolerability of carbapenem-containing regimens in individuals with pulmonary/extra-pulmonary disease which was bacteriologically confirmed as M/XDR-TB. We used PubMed to identify relevant full-text, English manuscripts up to the 20 December 2015, excluding editorials and reviews. Seven out of 160 studies satisfied the inclusion criteria: two on ertapenem, one on imipenem, and four on meropenem, all published between 2005 and 2016. Of seven studies, six were retrospective, four were performed in a single center, two enrolled children, two had a control group, and six reported a proportion of XDR-TB cases higher than 20%. Treatment success was higher than 57% in five studies with culture conversion rates between 60% and 94.8%. The safety and tolerability is very good, with the proportion of adverse events attributable to carbapenems below 15%.

  12. Clinical and programmatic considerations in the treatment of MDR-TB in children: a series of 16 patients from Lima, Peru.

    Science.gov (United States)

    Mukherjee, J S; Joseph, J K; Rich, M L; Shin, S S; Furin, J J; Seung, K J; Sloutsky, A; Socci, A R; Vanderwarker, C; Vasquez, L; Palacios, E; Guerra, D; Viru, F A; Farmer, P; Del Castillo, H E

    2003-07-01

    Since 2000, the directly observed treatment, short-course (DOTS) strategy has been expanded in several countries to include treatment of multidrug-resistant tuberculosis (MDR-TB). This strategy is known as DOTS-Plus. Tuberculosis is a common cause of morbidity and mortality for children throughout the developing world. Children may also be infected with MDR-TB, yet most developing countries do not specifically address pediatric MDR-TB. To present the intermediate outcomes of the first 16 children enrolled in the Peruvian DOTS-Plus program and to demonstrate the tolerability of second-line anti-tuberculosis drugs. Three children completed therapy and are cured, one child had bacteriologic and clinical failure after 12 months of therapy and died of respiratory insufficiency, and 12 have intermediate outcomes demonstrating favorable clinical, bacteriologic, and radiographic evidence of improvement after 9-19 months of therapy. Of the 16 pediatric DOTS-Plus patients, 15 have tolerated therapy well and have had favorable clinical evolution. However, the diagnosis of pediatric MDR-TB is often extremely delayed due to reliance on the adult case definition and should be changed to prevent progressive, chronic illness in such children. Programmatic changes could facilitate earlier diagnosis and treatment of pediatric MDR-TB in Peru and in other DOTS-Plus programs.

  13. MDR-TB Outbreak among HIV-Negative Tunisian Patients followed during 11 Years.

    Directory of Open Access Journals (Sweden)

    Naira Dekhil

    Full Text Available Multidrug-resistant tuberculosis (MDR-TB outbreaks that evolve, from the outset, in a context strictly negative for HIV infection deserve special consideration since they reflect the true intrinsic epidemic potential of the causative strain. To our knowledge, the long-term evolution of such exceptional outbreaks and the treatment outcomes for the involved patients has never been reported hitherto. Here we provide a thorough description, over an 11-year period, of an MDR-TB outbreak that emerged and expanded in an HIV-negative context, Northern Tunisia.From October 2001 to June 2011, the MDR-TB outbreak involved 48 HIV-negative individuals that are mainly young (mean age 31.09 yrs; 89.6% male and noninstitutionalized. Drug susceptibility testing coupled to mutational analysis revealed that initial transmission involved an isolate that was simultaneously resistant to isoniazid, rifampicin, ethambutol, and streptomycin. The causative Haarlem3-ST50 outbreak strain expanded mainly as an 11-banded IS6110 RFLP profile (77.1%, from which a 12-banded subclone evolved. After undergoing a 2-year treatment with second-line drugs, 22 (45.8% patients were cured and 3 (6.2% completed treatment, thus yielding an overall treatment success rate of 52.1%. Among the patients that experienced unfavorable treatment outcomes, 10 (20.8% failed treatment, 3 (6.2% were lost to follow-up, 5 (10.4% died, and 5 (10.4% could not be evaluated. Poor adherence to treatment was found to be the main independent predictor of unfavorable outcomes (HR: 9.15; 95% CI 1.72-48.73; P = 0.014. Intriguingly, the evolved 12-banded subclone proved significantly associated with unfavorable outcomes (HR: 4.90; 95% CI 1.04-23.04, P = 0.044. High rate of fatality and relapse was further demonstrated at the long-term, since 70% of those whose treatment failed have died, and 24% among those deemed successfully treated have relapsed.Taken together, the data obtained in this study indicate that MDR

  14. Risk factors for MDR and XDR-TB in a tertiary referral hospital in India.

    Directory of Open Access Journals (Sweden)

    V Balaji

    Full Text Available BACKGROUND: India has a high burden of drug resistant TB, although there are few data on XDR-TB. Although XDR-TB has existed previously in India, the definition has not been widely applied, and surveillance using second line drug susceptibility testing has not been performed. Our objective was to analyze clinical and demographic risk factors associated with isolation of MDR and XDR TB as compared to susceptible controls, at a tertiary center. METHODOLOGY/FINDINGS: Retrospective chart review based on positive cultures isolated in a high volume mycobacteriology laboratory between 2002 and 2007. 47 XDR, 30 MDR and 117 susceptible controls were examined. Drug resistant cases were less likely to be extrapulmonary, and had received more previous treatment regimens. Significant risk factors for XDR-TB included residence outside the local state (OR 7.43, 3.07-18.0 and care costs subsidized (OR 0.23, 0.097-0.54 in bivariate analysis and previous use of a fluoroquinolone and injectable agent (other than streptomycin (OR 7.00, 95% C.I. 1.14-43.03 and an initial treatment regimen which did not follow national guidelines (OR 5.68, 1.24-25.96 in multivariate analysis. Cavitation and HIV did not influence drug resistance. CONCLUSIONS/SIGNIFICANCE: There is significant selection bias in the sample available. Selection pressure from previous treatment and an inadequate initial regimen increases risk of drug resistance. Local patients and those requiring financial subsidies may be at lower risk of XDR-TB.

  15. Study on drug resistance of mycobacterium tuberculosis in patients with pulmonary tuberculosis by drug resistance gene detecting

    International Nuclear Information System (INIS)

    Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing

    2004-01-01

    To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)

  16. A Structural View on Medicinal Chemistry Strategies against Drug Resistance.

    Science.gov (United States)

    Agnello, Stefano; Brand, Michael; Chellat, Mathieu F; Gazzola, Silvia; Riedl, Rainer

    2018-05-30

    The natural phenomenon of drug resistance represents a generic impairment that hampers the benefits of drugs in all major clinical indications. Antibacterials and antifungals are affected as well as compounds for the treatment of cancer, viral infections or parasitic diseases. Despite the very diverse set of biological targets and organisms involved in the development of drug resistance, underlying molecular processes have been identified to understand the emergence of resistance and to overcome this detrimental mechanism. Detailed structural information of the root causes for drug resistance is nowadays frequently available to design next generation drugs anticipated to suffer less from resistance. This knowledge-based approach is a prerequisite in the fight against the inevitable occurrence of drug resistance to secure the achievements of medicinal chemistry in the future. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. THE EFFECT OF DIFFERENT TB DRUGS AND ANTIMICROBIAL AGENTS ON THE EFFICIENCY OF TREATMENT OF TUBERCULOSIS PATIENTS WITH MULTIPLE DRUG RESISTANCE

    Directory of Open Access Journals (Sweden)

    I. A. Vasilyeva

    2017-01-01

    Full Text Available Objective of the study: to study the effect of specific TB drugs and antimicrobial agents constituting chemotherapy regimens on the efficiency of treatment of tuberculosis patients with various patterns of multiple drug resistance.Subjects and Methods. 412 pulmonary tuberculosis patients with bacillary excretion and various patterns of multiple drug resistance were enrolled into the study (117 patients with MDR TB (non pre-XDR and non-XDR; 120 patients with pre-XDR TB and 175 with XDR TB. Patients in the subgroups were compatible regarding sex and age. The patients were prescribed regimens including 5-6 drugs in accordance with their drug resistance pattern. The time of sputum conversion (by culture versus the year of treatment was selected as a surrogate endpoint. The effect of specific TB drugs and antimicrobial agents on treatment efficiency was assessed through calculation of odds ratio (OR of achieving a surrogate endpoint in the patients receiving and not receiving a certain drug.Results. In the subgroup of pre-XDR TB, the following drugs demonstrated the valid increase of odds of sputum conversion: ethambutol (OR 11.8, pyrazinamide (OR 10.2, moxifloxacin (OR 7.8, capreomicin (OR 4.41. Sputum conversion was achieved in all 11 patients treated with bedaquiline.In the subgroup of XDR TB, the following drugs provided a positive effect on the achievement of sputum conversion: bedaquiline (OR 9.62, linezolid (OR 8.15, cycloserine (OR 7.88, pyrazinamide (OR 7.29, moxifloxacin (OR 7.08, and ethambutol (OR 6.69. Ofloxacin demonstrated a confident negative effect on achieving sputum conversion (95% CI 0.06-0.32. 

  18. Multi-drug resistance and molecular pattern of erythromycin and ...

    African Journals Online (AJOL)

    The appearance and dissemination of penicillin resistant and macrolide resistant Streptococcus pneumoniae strains has caused increasing concern worldwide. The aim of this study was to survey drug resistance and genetic characteristics of macrolide and penicillin resistance in S. pneumoniae. This is a cross-sectional ...

  19. 8__Aisha_Detection ofMDR-TB

    African Journals Online (AJOL)

    User

    Among the MDR-TB cases rifampicin resistance was associated with rpoB WT gene and rpoB MUT gene in 100% and 62% of the ... diagnosis of TB patients, and proper treatment and management of the infected cases to minimize the spread and ..... in an amino acid change and concluded that this is one of the reasons ...

  20. Cytotoxicity of the indole alkaloid reserpine from Rauwolfia serpentina against drug-resistant tumor cells.

    Science.gov (United States)

    Abdelfatah, Sara A A; Efferth, Thomas

    2015-02-15

    The antihypertensive reserpine is an indole alkaloid from Rauwolfia serpentina and exerts also profound activity against cancer cells in vitro and in vivo. The present investigation was undertaken to investigate possible modes of action to explain its activity toward drug-resistant tumor cells. Sensitive and drug-resistant tumor cell lines overexpressing P-glycoprotein (ABCB1/MDR1), breast cancer resistance protein (ABCG2/BCRP), mutation-activated epidermal growth factor receptor (EGFR), wild-type and p53-knockout cells as well as the NCI panel of cell lines from different tumor origin were analyzed. Reserpine's cytotoxicity was investigated by resazurin and sulforhodamine assays, flow cytometry, and COMPARE and hierarchical cluster analyses of transcriptome-wide microarray-based RNA expressions. P-glycoprotein- or BCRP overexpressing tumor cells did not reveal cross-resistance to reserpine. EGFR-overexpressing cells were collateral sensitive and p53- Knockout cells cross-resistant to this drug compared to their wild-type parental cell lines. Reserpine increased the uptake of doxorubicin in P-glycoprotein-overexpressing cells, indicating that reserpine inhibited the efflux function of P-glycoprotein. Using molecular docking, we found that reserpine bound with even higher binding energy to P-glycoprotein and EGFR than the control drugs verapamil (P-glycoprotein inhibitor) and erlotinib (EGFR inhibitor). COMPARE and cluster analyses of microarray data showed that the mRNA expression of a panel of genes predicted the sensitivity or resistance of the NCI tumor cell line panel with statistical significance. The genes belonged to diverse pathways and biological functions, e.g. cell survival and apoptosis, EGFR activation, regulation of angiogenesis, cell mobility, cell adhesion, immunological functions, mTOR signaling, and Wnt signaling. The lack of cross-resistance to most resistance mechanisms and the collateral sensitivity in EGFR-transfectants compared to wild

  1. MicroRNA signatures from multidrug-resistant Mycobacterium tuberculosis

    Science.gov (United States)

    REN, NA; GAO, GUIJU; SUN, YUE; ZHANG, LING; WANG, HUIZHU; HUA, WENHAO; WAN, KANGLIN; LI, XINGWANG

    2015-01-01

    Tuberculosis (TB) infections, caused by multi-drug-resistant Mycobacterium tuberculosis (MDR MTB), remain a significant public health concern worldwide. The regulatory mechanisms underlying the emergence of MDR MTB strains remain to be fully elucidated, and further investigation is required in order to develop better strategies for TB control. The present study investigated the expression profile of microRNA (miRNA) in MTB strains, and examined the differences between sensitive MTB and MDR MTB using next generation sequencing (NGS) with Illumina Deep Sequencing technology to better understand the mechanisms of resistance in MDR MTB, A total of 5, 785 and 195, and 6, 290 and 595 qualified Illumina reads were obtained from two MDR MTB strains, and 6, 673 and 665, and 7, 210 and 217 qualified Illumina reads were obtained from two sensitive MTB strains. The overall de novo assembly of miRNA sequence data generated 62 and 62, and 95 and 112 miRNAs between the 18 and 30 bp long from sensitive MTB strains and MDR MTB strains, respectively. Comparative miRNA analysis revealed that 142 miRNAs were differentially expressed in the MDR MTB strain, compared with the sensitive MTB strain, of which 48 were upregulated and 94 were downregulated. There were six similarly expressed miRNAs between the MDR and sensitive MTB strains, and 108 miRNAs were expressed only in the MDR MTB strain. The present study acquired miRNA data from sensitive MTB and MDR MTB strains using NGS techniques, and this identification miRNAs may serve as an invaluable resource for revealing the molecular basis of the regulation of expression associated with the mechanism of drug-resistance in MTB. PMID:26324150

  2. Evolution of extensively drug-resistant tuberculosis over four decades revealed by whole genome sequencing of Mycobacterium tuberculosis from KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Keira A Cohen

    2015-01-01

    Full Text Available The largest global outbreak of extensively drug-resistant (XDR tuberculosis (TB was identified in Tugela Ferry, KwaZulu-Natal (KZN, South Africa in 2005. The antecedents and timing of the emergence of drug resistance in this fatal epidemic XDR outbreak are unknown, and it is unclear whether drug resistance in this region continues to be driven by clonal spread or by the development of de novo resistance. A whole genome sequencing and drug susceptibility testing (DST was performed on 337 clinical isolates of Mycobacterium tuberculosis (M.tb collected in KZN from 2008 to 2013, in addition to three historical isolates, one of which was isolated during the Tugela Ferry outbreak. Using a variety of whole genome comparative approaches, 11 drug-resistant clones of M.tb circulating from 2008 to 2013 were identified, including a 50-member clone of XDR M.tb that was highly related to the Tugela Ferry XDR outbreak strain. It was calculated that the evolutionary trajectory from first-line drug resistance to XDR in this clone spanned more than four decades and began at the start of the antibiotic era. It was also observed that frequent de novo evolution of MDR and XDR was present, with 56 and 9 independent evolutions, respectively. Thus, ongoing amplification of drug-resistance in KwaZulu-Natal is driven by both clonal spread and de novo acquisition of resistance. In drug-resistant TB, isoniazid resistance was overwhelmingly the initial resistance mutation to be acquired, which would not be detected by current rapid molecular diagnostics that assess only rifampicin resistance.

  3. Integration of HIV testing in tuberculosis drug resistance surveillance in Kazakhstan and Kenya

    NARCIS (Netherlands)

    Klinkenberg, E.; van den Hof, S.; Tursynbayeva, A.; Kipruto, H.; Wahogo, J.; Pak, S.; Kutwa, A.; L'Herminez, R.

    2012-01-01

    In Kenya and Kazakhstan, integration of human immunodeficiency virus (HIV) testing results into the routine surveillance of multidrug-resistant tuberculosis (MDR-TB) proved feasible and useful. The integration process improved overall data quality and data validation capacity, and integrated data

  4. Effect of radiation decontamination on drug-resistant bacteria

    International Nuclear Information System (INIS)

    Ito, Hitoshi

    2006-01-01

    More than 80% of food poisoning bacteria such as Salmonella are reported as antibiotic-resistant to at least one type antibiotic, and more than 50% as resistant to two or more. For the decontamination of food poisoning bacteria in foods, radiation resistibility on drug-resistant bacteria were investigated compared with drug-sensitive bacteria. Possibility on induction of drug-resistant mutation by radiation treatment was also investigated. For these studies, type strains of Escherichia coli S2, Salmonella enteritidis YK-2 and Staphylococcus aureus H12 were used to induce drug-resistant strains with penicillin G. From the study of radiation sensitivity on the drug-resistant strain induced from E. coli S2, D 10 value was obtained to be 0.20 kGy compared with 0.25 kGy at parent strain. On S. enteritidis YK-2, D 10 value was obtained to be 0.14 kGy at drug-resistant strain compared with 0.16 kGy at parent strain. D 10 value was also obtained to be 0.15 kGy at drug-resistant strain compared with 0.21 kGy at parent strain of St. aureus H12. Many isolates of E. coli 157:H7 or other type of E. coli from meats such as beef were resistant to penicillin G, and looked to be no relationship on radiation resistivities between drug-resistant strains and sensitive strains. On the study of radiation sensitivity on E. coli S2 at plate agars containing antibiotics, higher survival fractions were obtained at higher doses compared with normal plate agar. The reason of higher survival fractions at higher doses on plate agar containing antibiotics should be recovery of high rate of injured cells by the relay of cell division, and drug-resistant strains by mutation are hardly induced by irradiation. (author)

  5. Increased p38-MAPK is responsible for chemotherapy resistance in human gastric cancer cells

    International Nuclear Information System (INIS)

    Guo, Xianling; Zhang, Baihe; Wu, Mengchao; Wei, Lixin; Ma, Nannan; Wang, Jin; Song, Jianrui; Bu, Xinxin; Cheng, Yue; Sun, Kai; Xiong, Haiyan; Jiang, Guocheng

    2008-01-01

    Chemoresistance is one of the main obstacles to successful cancer therapy and is frequently associated with Multidrug resistance (MDR). Many different mechanisms have been suggested to explain the development of an MDR phenotype in cancer cells. One of the most studied mechanisms is the overexpression of P-glycoprotein (P-gp), which is a product of the MDR1 gene. Tumor cells often acquire the drug-resistance phenotype due to upregulation of the MDR1 gene. Overexpression of MDR1 gene has often been reported in primary gastric adenocarcinoma. This study investigated the role of p38-MAPK signal pathway in vincristine-resistant SGC7901/VCR cells. P-gp and MDR1 RNA were detected by Western blot analysis and RT-PCR amplification. Mitgen-activated protein kinases and function of P-gp were demonstrated by Western blot and FACS Aria cytometer analysis. Ap-1 activity and cell apoptosis were detected by Dual-Luciferase Reporter Assay and annexin V-PI dual staining. The vincristine-resistant SGC7901/VCR cells with increased expression of the multidrug-resistance 1 (MDR1) gene were resistant to P-gp-related drug and P-gp-unrelated drugs. Constitutive increases of phosphorylated p38-MAPK and AP-1 activities were also found in the drug-resistant cells. Inhibition of p38-MAPK by SB202190 reduced activator protein-1 (AP-1) activity and MDR1 expression levels and increased the sensitivity of SGC7901/VCR cells to chemotherapy. Activation of the p38-MAPK pathway might be responsible for the modulation of P-glycoprotein-mediated and P-glycoprotein-unmediated multidrug resistance in the SGC7901/VCR cell line

  6. SNP genetic polymorphisms of MDR-1, CYP1A2 and CYPB11 genes in four canine breeds upon toxicological evaluation.

    Science.gov (United States)

    Gagliardi, Rosa; Llambí, Silvia; Arruga, M Victoria

    2015-01-01

    The fields of pharmacogenetics and pharmacogenomics have become increasingly promising regarding the clinical application of genetic data to aid in prevention of adverse reactions. Specific screening tests can predict which animals express modified proteins or genetic sequences responsible for adverse effects associated with a drug. Among the genetic variations that have been investigated in dogs, the multidrug resistance gene (MDR) is the best studied. However, other genes such as CYP1A2 and CYP2B11 control the protein syntheses involved in the metabolism of many drugs. In the present study, the MDR-1, CYP1A2 and CYP2B11 genes were examined to identify SNP polymorphisms associated with these genes in the following four canine breeds: Uruguayan Cimarron, Border Collie, Labrador Retriever and German Shepherd. The results revealed that several SNPs of the CYP1A2 and CYP2B11 genes are potential targets for drug sensitivity investigations.

  7. Distribution of red blood cell antigens in drug-resistant and drug ...

    African Journals Online (AJOL)

    sofo

    Frequency distribution of ABO, Rh-Hr, MN, Kell blood group system antigens were studied in 277 TB patients (151-drug-sensitive and 126 drug-resistant) of pulmonary tuberculosis to know whether there was any association between them, and also between drug resistance and sensitiveness. They were compared with 485 ...

  8. Photochemical internalisation of chemotherapy potentiates killing of multidrug-resistant breast and bladder cancer cells

    OpenAIRE

    Adigbli, D. K.; Wilson, D. G. G.; Farooqui, N.; Sousi, E.; Risley, P.; Taylor, I.; MacRobert, A. J.; Loizidou, M.

    2007-01-01

    Multidrug resistance (MDR) is the major confounding factor in adjuvant solid tumour chemotherapy. Increasing intracellular amounts of chemotherapeutics to circumvent MDR may be achieved by a novel delivery method, photochemical internalisation (PCI). PCI consists of the co-administration of drug and photosensitiser; upon light activation the latter induces intracellular release of organelle-bound drug. We investigated whether co-administration of hypericin ( photosensitiser) with mitoxantrone...

  9. Photochemical internalisation of chemotherapy potentiates killing of multidrug-resistant breast and bladder cancer cells

    OpenAIRE

    Adigbli, D K; Wilson, D G G; Farooqui, N; Sousi, E; Risley, P; Taylor, I; MacRobert, A J; Loizidou, M

    2007-01-01

    Multidrug resistance (MDR) is the major confounding factor in adjuvant solid tumour chemotherapy. Increasing intracellular amounts of chemotherapeutics to circumvent MDR may be achieved by a novel delivery method, photochemical internalisation (PCI). PCI consists of the co-administration of drug and photosensitiser; upon light activation the latter induces intracellular release of organelle-bound drug. We investigated whether co-administration of hypericin (photosensitiser) with mitoxantrone ...

  10. Transferrin receptor-targeted pH-sensitive micellar system for diminution of drug resistance and targetable delivery in multidrug-resistant breast cancer

    Directory of Open Access Journals (Sweden)

    Gao W

    2017-02-01

    Full Text Available Wei Gao,1 Guihua Ye,1 Xiaochuan Duan,1 Xiaoying Yang,1 Victor C Yang1,2 1Tianjin Key Laboratory on Technologies Enabling Development of Clinical Therapeutics and Diagnostics (Theranostics, School of Pharmacy, Tianjin Medical University, Tianjin, People’s Republic of China; 2Department of Pharmaceutical Sciences, College of Pharmacy, University of Michigan, Ann Arbor, MI, USA Abstract: The emergence of drug resistance is partially associated with overproduction of transferrin receptor (TfR. To overcome multidrug resistance (MDR and achieve tumor target delivery, we designed a novel biodegradable pH-sensitive micellar system modified with HAIYPRH, a TfR ligand (7pep. First, the polymers poly(l-histidine-coupled polyethylene glycol-2000 (PHIS-PEG2000 and 7pep-modified 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol-2000 (7pep-DSPE-PEG2000 were synthesized, and the mixed micelles were prepared by blending of PHIS-PEG2000 and 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol-2000 (DSPE-PEG2000 or 7pep-DSPE-PEG2000 (7-pep HD micelles. The micelles exhibited good size uniformity, high encapsulation efficiency, and a low critical micelle concentration. By changing the polymer ratio in the micellar formulation, the pH response range was specially tailored to pH ~6.0. When loaded with antitumor drug doxorubicin (DOX, the micelle showed an acid pH-triggering drug release profile. The cellular uptake and cytotoxicity study demonstrated that 7-pep HD micelles could significantly enhance the intracellular level and antitumor efficacy of DOX in multidrug-resistant cells (MCF-7/Adr, which attributed to the synergistic effect of poly(l-histidine-triggered endolysosom escape and TfR-mediated endocytosis. Most importantly, the in vivo imaging study confirmed the targetability of 7-pep HD micelles to MDR tumor. These findings indicated that 7-pep HD micelles would be a promising drug delivery system in the treatment of drug-resistant

  11. Adenovirus vector infection of non-small-cell lung cancer cells is a trigger for multi-drug resistance mediated by P-glycoprotein

    International Nuclear Information System (INIS)

    Tomono, Takumi; Kajita, Masahiro; Yano, Kentaro; Ogihara, Takuo

    2016-01-01

    P-glycoprotein (P-gp) is an ATP-binding cassette protein involved in cancer multi-drug resistance (MDR). It has been reported that infection with some bacteria and viruses induces changes in the activities of various drug-metabolizing enzymes and transporters, including P-gp. Although human adenoviruses (Ad) cause the common cold, the effect of Ad infection on MDR in cancer has not been established. In this study, we investigated whether Ad infection is a cause of MDR in A549, H441 and HCC827 non-small-cell lung cancer (NSCLC) cell lines, using an Ad vector system. We found that Ad vector infection of NSCLC cell lines induced P-gp mRNA expression, and the extent of induction was dependent on the number of Ad vector virus particles and the infection time. Heat-treated Ad vector, which is not infectious, did not alter P-gp mRNA expression. Uptake experiments with doxorubicin (DOX), a P-gp substrate, revealed that DOX accumulation was significantly decreased in Ad vector-infected A549 cells. The decrease of DOX uptake was blocked by verapamil, a P-gp inhibitor. Our results indicated that Ad vector infection of NSCLC cells caused MDR mediated by P-gp overexpression. The Ad vector genome sequence is similar to that of human Ad, and therefore human Ad infection of lung cancer patients may lead to chemoresistance in the clinical environment. -- Highlights: •Adenovirus vector infection induced P-gp mRNA expression in three NSCLC cell lines. •Adenovirus vector infection enhanced P-gp-mediated doxorubicin efflux from the cells. •The increase of P-gp was not mediated by nuclear receptors (PXR, CAR) or COX-2.

  12. Adenovirus vector infection of non-small-cell lung cancer cells is a trigger for multi-drug resistance mediated by P-glycoprotein

    Energy Technology Data Exchange (ETDEWEB)

    Tomono, Takumi [Laboratory of Clinical Pharmacokinetics, Graduate School of Pharmaceutical Sciences, Takasaki University of Health and Welfare, 60 Nakaorui-machi, Takasaki-shi, Gunma 370-0033 (Japan); Kajita, Masahiro [Laboratory of Molecular Pharmaceutics and Technology, Faculty of Pharmacy, Takasaki University of Health and Welfare, 60 Nakaorui-machi, Takasaki-shi, Gunma 370-0033 (Japan); Yano, Kentaro [Laboratory of Biopharmaceutics, Faculty of Pharmacy, Takasaki University of Health and Welfare, 60 Nakaorui-machi, Takasaki-shi, Gunma 370-0033 (Japan); Ogihara, Takuo, E-mail: togihara@takasaki-u.ac.jp [Laboratory of Clinical Pharmacokinetics, Graduate School of Pharmaceutical Sciences, Takasaki University of Health and Welfare, 60 Nakaorui-machi, Takasaki-shi, Gunma 370-0033 (Japan)

    2016-08-05

    P-glycoprotein (P-gp) is an ATP-binding cassette protein involved in cancer multi-drug resistance (MDR). It has been reported that infection with some bacteria and viruses induces changes in the activities of various drug-metabolizing enzymes and transporters, including P-gp. Although human adenoviruses (Ad) cause the common cold, the effect of Ad infection on MDR in cancer has not been established. In this study, we investigated whether Ad infection is a cause of MDR in A549, H441 and HCC827 non-small-cell lung cancer (NSCLC) cell lines, using an Ad vector system. We found that Ad vector infection of NSCLC cell lines induced P-gp mRNA expression, and the extent of induction was dependent on the number of Ad vector virus particles and the infection time. Heat-treated Ad vector, which is not infectious, did not alter P-gp mRNA expression. Uptake experiments with doxorubicin (DOX), a P-gp substrate, revealed that DOX accumulation was significantly decreased in Ad vector-infected A549 cells. The decrease of DOX uptake was blocked by verapamil, a P-gp inhibitor. Our results indicated that Ad vector infection of NSCLC cells caused MDR mediated by P-gp overexpression. The Ad vector genome sequence is similar to that of human Ad, and therefore human Ad infection of lung cancer patients may lead to chemoresistance in the clinical environment. -- Highlights: •Adenovirus vector infection induced P-gp mRNA expression in three NSCLC cell lines. •Adenovirus vector infection enhanced P-gp-mediated doxorubicin efflux from the cells. •The increase of P-gp was not mediated by nuclear receptors (PXR, CAR) or COX-2.

  13. PD173074, a selective FGFR inhibitor, reverses MRP7 (ABCC10-mediated MDR

    Directory of Open Access Journals (Sweden)

    Nagaraju Anreddy

    2014-06-01

    Full Text Available Multidrug resistance protein 7 (MRP7, ABCC10 is a recently identified member of the ATP-binding cassette (ABC transporter family, which adequately confers resistance to a diverse group of antineoplastic agents, including taxanes, vinca alkaloids and nucleoside analogs among others. Clinical studies indicate an increased MRP7 expression in non-small cell lung carcinomas (NSCLC compared to a normal healthy lung tissue. Recent studies revealed increased paclitaxel sensitivity in the Mrp7−/− mouse model compared to their wild-type counterparts. This demonstrates that MRP7 is a key contributor in developing drug resistance. Recently our group reported that PD173074, a specific fibroblast growth factor receptor (FGFR inhibitor, could significantly reverse P-glycoprotein-mediated MDR. However, whether PD173074 can interact with and inhibit other MRP members is unknown. In the present study, we investigated the ability of PD173074 to reverse MRP7-mediated MDR. We found that PD173074, at non-toxic concentration, could significantly increase the cellular sensitivity to MRP7 substrates. Mechanistic studies indicated that PD173074 (1 μmol/L significantly increased the intracellular accumulation and in-turn decreased the efflux of paclitaxel by inhibiting the transport activity without altering expression levels of the MRP7 protein, thereby representing a promising therapeutic agent in the clinical treatment of chemoresistant cancer patients.

  14. Strategies to overcome or circumvent P-glycoprotein mediated multidrug resistance.

    Science.gov (United States)

    Yuan, Hongyu; Li, Xun; Wu, Jifeng; Li, Jinpei; Qu, Xianjun; Xu, Wenfang; Tang, Wei

    2008-01-01

    Cancer patients who receive chemotherapy often experience intrinsic or acquired resistance to a broad spectrum of chemotherapeutic agents. The phenomenon, termed multidrug resistance (MDR), is often associated with the over-expression of P-glycoprotein, a transmembrane protein pump, which can enhance efflux of a various chemicals structurally unrelated at the expense of ATP depletion, resulting in decrease of the intracellular cytotoxic drug accumulation. The MDR has been a big threaten to the human health and the war fight for it continues. Although several other mechanisms for MDR are elucidated in recent years, considerable efforts attempting to inverse MDR are involved in exploring P-glycoprotein modulators and suppressing P-glycoprotein expression. In this review, we will report on the recent advances in various strategies for overcoming or circumventing MDR mediated by P-glycoprotein.

  15. Is Chemoprophylaxis for Child Contacts of Drug-Resistant TB Patients Beneficial? A Systematic Review

    Directory of Open Access Journals (Sweden)

    C. Padmapriyadarsini

    2018-01-01

    Full Text Available Background. Preventive therapy for child contacts of multidrug-resistant tuberculosis (MDR-TB patients is poorly studied, and no consensus about the role and the rationale of chemoprophylaxis has been reached. Objective. To conduct systematic review with an aim to determine the effectiveness of TB preventive therapy in reducing the incidence of TB disease in pediatric contacts of MDR-TB patients. Methods. We conducted a literature search for randomized control trials, cohort studies, and case reports of chemoprophylaxis for pediatric contacts of MDR-TB patients in PubMed, EMBASE, Cochrane Databases of Systematic Reviews, metaRegister of Controlled Trials, and other clinical registries through March 2017, using appropriate search strategy. In addition we searched abstracts from international conferences and references of published articles and reviews. Results. Of the 153 references assessed from various databases, seven studies were identified as relevant after adaption of eligibility criteria and assessed for systematic review. Of these, only two studies contributed data for the pooled meta-analysis. Conclusions. Though the available evidences suggest that the chemoprophylaxis for child contacts of MDR-TB patients is beneficial, data to support or reject preventive therapy is very limited. Further clinical research, in Tb endemic settings like India, needs to be performed to prove the beneficial effect of chemoprophylaxis for pediatric contacts of MDR-TB.

  16. Multi-drug resistant tuberculosis in Tanzania: Initial description of ...

    African Journals Online (AJOL)

    Background: Drug resistant Tuberculosis is well documented worldwide and is associated with increasing morbidity and mortality complicating Tuberculosis control with increasing costs of managing the disease. Broad. Objective: To describe clinical and laboratory characteristics of multi-drug resistant Tuberculosis ...

  17. Drug-resistance in chronic tuberculosis cases in Southern Nigeria ...

    African Journals Online (AJOL)

    Nigeria has a high burden of tuberculosis but the drug resistant situationwas previously unknown. This report evaluates the firstline drug resistance and associated factors among chronic tuberculosis cases from the tuberculosis control programme in South south and South east zones ofNigeria. Descriptive study of chronic ...

  18. Tuberculosis drug resistance in the Western Cape | Weyer | South ...

    African Journals Online (AJOL)

    Objectives: Drug resistance is a serious problem in the treatment of tuberculosis and a threat to successful tuberculosis control programmes. Local health workers have expressed concern that the increasing tuberculosis epidemic in the Western Cape is partly attributable to drug resistance. The aim of this study was to ...

  19. Adaptation and evolution of drug-resistant Mycobacterium tuberculosis

    NARCIS (Netherlands)

    Bergval, I.L.

    2013-01-01

    Many studies have been conducted on drug resistance and the evolution of Mycobacterium tuberculosis. Notwithstanding, many molecular mechanisms facilitating the emergence, adaptation and spread of drug-resistant tuberculosis have yet to be discovered. This thesis reports studies of the adaptive

  20. Drug resistance in leishmaniasis: current drug-delivery systems and future perspectives.

    Science.gov (United States)

    Yasinzai, Masoom; Khan, Momin; Nadhman, Akhtar; Shahnaz, Gul

    2013-10-01

    Leishmaniasis is a complex of diseases with numerous clinical manifestations for instance harshness from skin lesions to severe disfigurement and chronic systemic infection in the liver and spleen. So far, the most classical leishmaniasis therapy, despite its documented toxicities, remains pentavalent antimonial compounds. The arvailable therapeutic modalities for leishmaniasis are overwhelmed with resistance to leishmaniasis therapy. Mechanisms of classical drug resistance are often related with the lower drug uptake, increased efflux, the faster drug metabolism, drug target modifications and over-expression of drug transporters. The high prevalence of leishmaniasis and the appearance of resistance to classical drugs reveal the demand to develop and explore novel, less toxic, low cost and more promising therapeutic modalities. The review describes the mechanisms of classical drug resistance and potential drug targets in Leishmania infection. Moreover, current drug-delivery systems and future perspectives towards Leishmaniasis treatment are also covered.

  1. Multidrug Resistance in Breast Cancer: From In Vitro Models to Clinical Studies

    International Nuclear Information System (INIS)

    Wind, N.S.; Holen, I.

    2011-01-01

    The development of multidrug resistance (MDR) and subsequent relapse on therapy is a widespread problem in breast cancer, but our understanding of the underlying molecular mechanisms is incomplete. Numerous studies have aimed to establish the role of drug transporter pumps in MDR and to link their expression to response to chemotherapy. The ATP-binding cassette (ABC) transporters are central to breast cancer MDR, and increases in ABC expression levels have been shown to correlate with decreases in response to various chemotherapy drugs and a reduction in overall survival. But as there is a large degree of redundancy between different ABC transporters, this correlation has not been seen in all studies. This paper provides an introduction to the key molecules associated with breast cancer MDR and summarises evidence of their potential roles reported from model systems and clinical studies. We provide possible explanations for why despite several decades of research, the precise role of ABC transporters in breast cancer MDR remains elusive

  2. Fungicide-driven evolution and molecular basis of multidrug resistance in field populations of the grey mould fungus Botrytis cinerea.

    Directory of Open Access Journals (Sweden)

    Matthias Kretschmer

    2009-12-01

    Full Text Available The grey mould fungus Botrytis cinerea causes losses of commercially important fruits, vegetables and ornamentals worldwide. Fungicide treatments are effective for disease control, but bear the risk of resistance development. The major resistance mechanism in fungi is target protein modification resulting in reduced drug binding. Multiple drug resistance (MDR caused by increased efflux activity is common in human pathogenic microbes, but rarely described for plant pathogens. Annual monitoring for fungicide resistance in field isolates from fungicide-treated vineyards in France and Germany revealed a rapidly increasing appearance of B. cinerea field populations with three distinct MDR phenotypes. All MDR strains showed increased fungicide efflux activity and overexpression of efflux transporter genes. Similar to clinical MDR isolates of Candida yeasts that are due to transcription factor mutations, all MDR1 strains were shown to harbor activating mutations in a transcription factor (Mrr1 that controls the gene encoding ABC transporter AtrB. MDR2 strains had undergone a unique rearrangement in the promoter region of the major facilitator superfamily transporter gene mfsM2, induced by insertion of a retrotransposon-derived sequence. MDR2 strains carrying the same rearranged mfsM2 allele have probably migrated from French to German wine-growing regions. The roles of atrB, mrr1 and mfsM2 were proven by the phenotypes of knock-out and overexpression mutants. As confirmed by sexual crosses, combinations of mrr1 and mfsM2 mutations lead to MDR3 strains with higher broad-spectrum resistance. An MDR3 strain was shown in field experiments to be selected against sensitive strains by fungicide treatments. Our data document for the first time the rising prevalence, spread and molecular basis of MDR populations in a major plant pathogen in agricultural environments. These populations will increase the risk of grey mould rot and hamper the effectiveness of

  3. Expression of Drug-Resistant Factor Genes in Hepatocellular Carcinoma Patients Undergoing Chemotherapy with Platinum Complex by Arterial Infusion

    Directory of Open Access Journals (Sweden)

    Shiro Ueda

    2010-09-01

    Full Text Available This study investigated gene expression of drug resistance factors in biopsy tissue samples from hepatocellular carcinoma (HCC patients undergoing chemotherapy by platinum complex. Liver biopsy was performed to collect tissue from the tumor site (T and the non-tumor site (NT prior to the start of treatment. For drug-resistant factors, drug excretion transporters cMOAT and MDR-1, intracellular metal binding protein MT2, DNA repair enzyme ERCC-l and inter-nucleic cell transport protein MVP, were investigated. The comparison of the expression between T and NT indicated a significant decrease of MT2 and MDR-1 in T while a significant increase in ERCC-1 was noted in T. Further, expression was compared between the response cases and non-response cases using the ratios of expression in T to those in NT. The response rate was significantly low in the high expression group when the cutoff value of cMOAT and MT2 was set at 1.5 and 1.0, respectively. Furthermore, when the patients were classified into A group (cMOAT ≧ 1.5 or MT2 ≧ 1.0 and B group (cMOAT < 1.5 and MT2 < 1.0, the response rate of A group was significantly lower than B group when we combined the cutoff values of cMOAT and MT2. It is considered possible to estimate the therapeutic effect of platinum complex at a high probability by combining the expression condition of these two genes.

  4. Early antiretroviral therapy and potent second-line drugs could decrease HIV incidence of drug resistance.

    Science.gov (United States)

    Shen, Mingwang; Xiao, Yanni; Rong, Libin; Meyers, Lauren Ancel; Bellan, Steven E

    2017-06-28

    Early initiation of antiretroviral therapy (ART) reduces the risk of drug-sensitive HIV transmission but may increase the transmission of drug-resistant HIV. We used a mathematical model to estimate the long-term population-level benefits of ART and determine the scenarios under which earlier ART (treatment at 1 year post-infection, on average) could decrease simultaneously both total and drug-resistant HIV incidence (new infections). We constructed an infection-age-structured mathematical model that tracked the transmission rates over the course of infection and modelled the patients' life expectancy as a function of ART initiation timing. We fitted this model to the annual AIDS incidence and death data directly, and to resistance data and demographic data indirectly among men who have sex with men (MSM) in San Francisco. Using counterfactual scenarios, we assessed the impact on total and drug-resistant HIV incidence of ART initiation timing, frequency of acquired drug resistance, and second-line drug effectiveness (defined as the combination of resistance monitoring, biomedical drug efficacy and adherence). Earlier ART initiation could decrease the number of both total and drug-resistant HIV incidence when second-line drug effectiveness is sufficiently high (greater than 80%), but increase the proportion of new infections that are drug resistant. Thus, resistance may paradoxically appear to be increasing while actually decreasing. © 2017 The Author(s).

  5. Evaluation of the BACTEC MGIT 960 SL DST Kit and the GenoType MTBDRsl Test for Detecting Extensively Drug-resistant Tuberculosis Cases.

    Science.gov (United States)

    Tekin, Kemal; Albay, Ali; Simsek, Hulya; Sig, Ali Korhan; Guney, Mustafa

    2017-10-01

    The present study aimed to evaluate the performances of the BACTEC MGIT 960 SL DST kit and the GenoType MTBDRsl test for detecting second-line antituberculosis drug resistance in Multidrug-resistant TB (MDR-TB) cases. Forty-six MDR-TB strains were studied. Second-line antituberculosis drug resistances were detected using the BACTEC MGIT 960 SL DST kit and the GenoType MTBDRsl test. The Middlebrook 7H10 agar proportion method was used as the reference test. The sensitivity and specificity values for the BACTEC MGIT 960 SL DST kit were both 100% for amikacin, kanamycin, capreomycin (4 µg/mL), and ofloxacin; 100% and 95.3%, respectively, for capreomycin (10 µg/mL); and 85.7% and 100%, respectively, for moxifloxacin (0.5 µg/mL). The sensitivity and specificity values for the GenoType MTBDRsl test to detect fluoroquinolone and aminoglycoside/cyclic peptide resistance were 88.9% and 100%, respectively, for ofloxacin and 85.7% and 94.9%, respectively, for moxifloxacin (0.5 µg/mL). The accuracy of the GenoType MTBDRsl assay for kanamycin, capreomycin, ofloxacin, and moxifloxacin was lower than that of the BACTEC MGIT 960 SL DST. The BACTEC MGIT 960 SL DST kit and the GenoType MTBDRsl were successful in detecting second-line antituberculosis drug resistance. Preliminary results of the GenoType MTBDRsl are very valuable for early treatment decisions, but we still recommend additional BACTEC MGIT 960 SL DST kit usage in the routine evaluation of drug-resistant tuberculosis.

  6. Evaluation of the BACTEC MGIT 960 SL DST Kit and the GenoType MTBDRsl Test for Detecting Extensively Drug-resistant Tuberculosis Cases

    Science.gov (United States)

    Tekin, Kemal; Albay, Ali; Simsek, Hulya; Sig, Ali Korhan; Guney, Mustafa

    2017-01-01

    Objective: The present study aimed to evaluate the performances of the BACTEC MGIT 960 SL DST kit and the GenoType MTBDRsl test for detecting second-line antituberculosis drug resistance in Multidrug-resistant TB (MDR-TB) cases. Materials and Methods: Forty-six MDR-TB strains were studied. Second-line antituberculosis drug resistances were detected using the BACTEC MGIT 960 SL DST kit and the GenoType MTBDRsl test. The Middlebrook 7H10 agar proportion method was used as the reference test. Results: The sensitivity and specificity values for the BACTEC MGIT 960 SL DST kit were both 100% for amikacin, kanamycin, capreomycin (4 µg/mL), and ofloxacin; 100% and 95.3%, respectively, for capreomycin (10 µg/mL); and 85.7% and 100%, respectively, for moxifloxacin (0.5 µg/mL). The sensitivity and specificity values for the GenoType MTBDRsl test to detect fluoroquinolone and aminoglycoside/cyclic peptide resistance were 88.9% and 100%, respectively, for ofloxacin and 85.7% and 94.9%, respectively, for moxifloxacin (0.5 µg/mL). The accuracy of the GenoType MTBDRsl assay for kanamycin, capreomycin, ofloxacin, and moxifloxacin was lower than that of the BACTEC MGIT 960 SL DST. Conclusion: The BACTEC MGIT 960 SL DST kit and the GenoType MTBDRsl were successful in detecting second-line antituberculosis drug resistance. Preliminary results of the GenoType MTBDRsl are very valuable for early treatment decisions, but we still recommend additional BACTEC MGIT 960 SL DST kit usage in the routine evaluation of drug-resistant tuberculosis. PMID:29123441

  7. Multi drug resistance tuberculosis: pattern seen in last 13 years

    International Nuclear Information System (INIS)

    Iqbal, R.; Shabbir, I.; Munir, K.; Tabassum, M.N.; Khan, S.U.; Khan, M.Z.U.

    2011-01-01

    Background: Drug resistance in tuberculosis is a serious problem throughout the world especially, after the emergence of multi drug resistant TB strains. Objectives: To estimate drug resistance in TB patients and compare it with previous studies to see the changing trends. Materials and Methods: The PMRC Research Centre receives sputum samples from all the leading hospitals of Lahore. This retrospective analysis was done from 1996 to 2008 on the multi drug resistant TB strains that were seen during these years. Five first lines anti tuberculosis drugs were tested on Lowenstein Jensen medium using standard proportion method. Results: A total of 2661 confirmed isolates of Mycobacterium tuberculosis were seen over the past 13 years. Of the total, 2182 were pulmonary and 479 were extra pulmonary specimens. The patients comprised of those with and without history of previous treatment. These specimens were subjected to drug susceptibility testing. Almost half of the patient had some resistance; multiple drug resistance was seen in 12.3% and 23.0% cases without and with history of previous treatment respectively. Overall resistance to rifampicin was 26.4%, isoniazid 24.1% streptomycin 21.6% ethambutol 13.4% and pyrazinamide 28.4% respectively. Statistically significant difference was seen between primary and acquired resistance. When compared with the reports from previous studies from the same area, there was a trend of gradual increase of drug resistance. Conclusions Resistance to anti tuberculosis drugs is high. Policy message. TB Control Program should start 'DOTS Plus' schemes for which drug susceptibility testing facilities should be available for correctly managing the patients. (author)

  8. Multi drug resistance tuberculosis: pattern seen in last 13 years

    Energy Technology Data Exchange (ETDEWEB)

    Iqbal, R; Shabbir, I; Munir, K [King Edward Medical University Hospital, Lahore (Pakistan). Dept. of Research Centre; Tabassum, M N; Khan, S U; Khan, M Z.U. [King Edward Medical University Hospital, Lahore (Pakistan). Dept. of Chest Medicine

    2011-01-15

    Background: Drug resistance in tuberculosis is a serious problem throughout the world especially, after the emergence of multi drug resistant TB strains. Objectives: To estimate drug resistance in TB patients and compare it with previous studies to see the changing trends. Materials and Methods: The PMRC Research Centre receives sputum samples from all the leading hospitals of Lahore. This retrospective analysis was done from 1996 to 2008 on the multi drug resistant TB strains that were seen during these years. Five first lines anti tuberculosis drugs were tested on Lowenstein Jensen medium using standard proportion method. Results: A total of 2661 confirmed isolates of Mycobacterium tuberculosis were seen over the past 13 years. Of the total, 2182 were pulmonary and 479 were extra pulmonary specimens. The patients comprised of those with and without history of previous treatment. These specimens were subjected to drug susceptibility testing. Almost half of the patient had some resistance; multiple drug resistance was seen in 12.3% and 23.0% cases without and with history of previous treatment respectively. Overall resistance to rifampicin was 26.4%, isoniazid 24.1% streptomycin 21.6% ethambutol 13.4% and pyrazinamide 28.4% respectively. Statistically significant difference was seen between primary and acquired resistance. When compared with the reports from previous studies from the same area, there was a trend of gradual increase of drug resistance. Conclusions Resistance to anti tuberculosis drugs is high. Policy message. TB Control Program should start 'DOTS Plus' schemes for which drug susceptibility testing facilities should be available for correctly managing the patients. (author)

  9. In vitro detection of mdr1 mRNA in murine leukemia cells with 111In-labeled oligonucleotide

    International Nuclear Information System (INIS)

    Bai Jingming; Yokoyama, Kunihiko; Kinuya, Seigo; Michigishi, Takatoshi; Tonami, Norihisa; Shiba, Kazuhiro; Matsushita, Ryo; Nomura, Masaaki

    2004-01-01

    radioactivity and specific uptake of antisense 111 In-ODN in drug-resistant cells may facilitate future gene imaging of mdr1 mRNA. (orig.)

  10. Quantifying the Determinants of Evolutionary Dynamics Leading to Drug Resistance.

    Directory of Open Access Journals (Sweden)

    Guillaume Chevereau

    Full Text Available The emergence of drug resistant pathogens is a serious public health problem. It is a long-standing goal to predict rates of resistance evolution and design optimal treatment strategies accordingly. To this end, it is crucial to reveal the underlying causes of drug-specific differences in the evolutionary dynamics leading to resistance. However, it remains largely unknown why the rates of resistance evolution via spontaneous mutations and the diversity of mutational paths vary substantially between drugs. Here we comprehensively quantify the distribution of fitness effects (DFE of mutations, a key determinant of evolutionary dynamics, in the presence of eight antibiotics representing the main modes of action. Using precise high-throughput fitness measurements for genome-wide Escherichia coli gene deletion strains, we find that the width of the DFE varies dramatically between antibiotics and, contrary to conventional wisdom, for some drugs the DFE width is lower than in the absence of stress. We show that this previously underappreciated divergence in DFE width among antibiotics is largely caused by their distinct drug-specific dose-response characteristics. Unlike the DFE, the magnitude of the changes in tolerated drug concentration resulting from genome-wide mutations is similar for most drugs but exceptionally small for the antibiotic nitrofurantoin, i.e., mutations generally have considerably smaller resistance effects for nitrofurantoin than for other drugs. A population genetics model predicts that resistance evolution for drugs with this property is severely limited and confined to reproducible mutational paths. We tested this prediction in laboratory evolution experiments using the "morbidostat", a device for evolving bacteria in well-controlled drug environments. Nitrofurantoin resistance indeed evolved extremely slowly via reproducible mutations-an almost paradoxical behavior since this drug causes DNA damage and increases the mutation

  11. Shigella Antimicrobial Drug Resistance Mechanisms, 2004-2014.

    Science.gov (United States)

    Nüesch-Inderbinen, Magdalena; Heini, Nicole; Zurfluh, Katrin; Althaus, Denise; Hächler, Herbert; Stephan, Roger

    2016-06-01

    To determine antimicrobial drug resistance mechanisms of Shigella spp., we analyzed 344 isolates collected in Switzerland during 2004-2014. Overall, 78.5% of isolates were multidrug resistant; 10.5% were ciprofloxacin resistant; and 2% harbored mph(A), a plasmid-mediated gene that confers reduced susceptibility to azithromycin, a last-resort antimicrobial agent for shigellosis.

  12. Cancer stem cells and drug resistance: the potential of nanomedicine

    Science.gov (United States)

    Vinogradov, Serguei; Wei, Xin

    2012-01-01

    Properties of the small group of cancer cells called tumor-initiating or cancer stem cells (CSCs) involved in drug resistance, metastasis and relapse of cancers can significantly affect tumor therapy. Importantly, tumor drug resistance seems to be closely related to many intrinsic or acquired properties of CSCs, such as quiescence, specific morphology, DNA repair ability and overexpression of antiapoptotic proteins, drug efflux transporters and detoxifying enzymes. The specific microenvironment (niche) and hypoxic stability provide additional protection against anticancer therapy for CSCs. Thus, CSC-focused therapy is destined to form the core of any effective anticancer strategy. Nanomedicine has great potential in the development of CSC-targeting drugs, controlled drug delivery and release, and the design of novel gene-specific drugs and diagnostic modalities. This review is focused on tumor drug resistance-related properties of CSCs and describes current nanomedicine approaches, which could form the basis of novel combination therapies for eliminating metastatic and CSCs. PMID:22471722

  13. Resistance patterns among multidrug-resistant tuberculosis patients in greater metropolitan Mumbai: trends over time.

    Science.gov (United States)

    Dalal, Alpa; Pawaskar, Akshay; Das, Mrinalini; Desai, Ranjan; Prabhudesai, Pralhad; Chhajed, Prashant; Rajan, Sujeet; Reddy, Deepesh; Babu, Sajit; Jayalakshmi, T K; Saranchuk, Peter; Rodrigues, Camilla; Isaakidis, Petros

    2015-01-01

    While the high burden of multidrug-resistant tuberculosis (MDR-TB) itself is a matter of great concern, the emergence and rise of advanced forms of drug-resistance such as extensively drug-resistant TB (XDR-TB) and extremely drug-resistant TB (XXDR-TB) is more troubling. The aim of this study was to investigate the trends over time of patterns of drug resistance in a sample of MDR-TB patients in greater metropolitan Mumbai, India. This was a retrospective, observational study of drug susceptibility testing (DST) results among MDR-TB patients from eight health care facilities in greater Mumbai between 2005 and 2013. We classified resistance patterns into four categories: MDR-TB, pre-XDR-TB, XDR-TB and XXDR-TB. A total of 340 MDR-TB patients were included in the study. Pre-XDR-TB was the most common form of drug-resistant TB observed overall in this Mumbai population at 56.8% compared to 29.4% for MDR-TB. The proportion of patients with MDR-TB was 39.4% in the period 2005-2007